KIF4A Promotes the Development of Bladder Cancer by Transcriptionally Activating the Expression of CDCA3

INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021

KIF4A promotes the development of bladder cancer by transcriptionally activating the expression of CDCA3

PENGYI ZHENG1,2, KAIJIE WU1, ZHONGWEI GAO2, HUIBING LI2, WENSHENG LI2, XIAOHUI WANG2, ZHENGUO SHI2, FEI XIAO2, KAIXUAN WANG2, ZHIJUN LI2 and QINGJIANG HAN2

1Department of Urology, The First Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061; 2Department of Urology, The First Affiliated Hospital, and College of Clinical Medicine of Henan University of Science and Technology, Luoyang, Henan 471003, P.R. China

Received January 23, 2021; Accepted March 22, 2021

DOI: 10.3892/ijmm.2021.4932

Abstract. Bladder cancer (BC) is among the most common Introduction urinary system tumors with a high morbidity and mortality worldwide. Despite advancements being made in the diagnosis Bladder cancer (BC) is one of the most common type of and treatment of bladder cancer, targeted therapy remains the urinary system tumors with a high morbidity and mortality most promising treatment, and novel therapeutic targets are worldwide (1‑3). In 2017, approximately 80,000 new cases urgently required in to improve the outcomes of patients with of BC were diagnosed in the USA, leading to almost BC. Kinesin family member 4A (KIF4A) is a plus‑end directed 15,000 deaths (4,5). The traditional treatment methods for BC, motor protein involved in the regulation of multiple cellular such as surgical treatment, radiotherapy and chemotherapy, processes, such as mitosis and axon growth. Notably, KIF4A are largely dependent on the stage and grade of BC (6,7). The plays important roles in tumor growth and progression, and its 5‑year total survival rates for advanced BC remain <20% (8). expression is associated with the prognosis of several types of Despite advancements being made in the diagnosis and treat‑ cancer. However, the potential role and molecular mechanisms ment for BC, the survival rates of patients remained unaltered of KIF4A in bladder cancer development remain unclear. The until the emergence of targeted therapy (9). The BC molecular present study demonstrated that KIF4A was highly expressed targets, such as phosphatidylinositol‑4,5‑bisphosphate 3‑kinase in human BC tissues, and its expression was associated with catalytic subunit alpha (PIK3CA), epidermal growth factor patient clinicopathological characteristics, such as tumor stage receptor (EGFR) and neuroblastoma RAS viral oncogene (P=0.012) and with the prognosis of patients with BC. It was homolog (NRAS), have already been studied, and therapeutic further found that KIF4A promoted the cell proliferation of drugs targeting these proteins have been preliminarily devel‑ bladder cancer both in vitro and in vivo. On the whole, the oped (10). However, in order to improve the survival rates of data presented herein provide evidence that KIF4A promotes patients with BC, novel and promising therapeutic targets are the development of BC through the transcriptional activation urgently required. of the expression of CDCA3. The present study indicates the Kinesin family proteins are a class of microtubule‑depen‑ involvement of KIF4A in the progression of BC and suggests dent motor proteins that travel along microtubule tracks and that KIF4A may be a promising therapeutic target for the treat‑ mediate multiple cellular processes, such as mitosis and vesi‑ ment of BC. cles transport (11‑13). Kinesin family member 4A (KIF4A), a member of the kinesin family, is a plus end directed motor protein (14). Previous studies have indicated that KIF4A is dominantly localized in the nucleus and affects multiple cellular processes (15,16). KIF4A regulates mitosis through Correspondence to: Dr Kaijie Wu, Department of Urology, The various mechanisms, including the regulation of spindle First Hospital of Xi'an Jiaotong University, 277 Yanta West Road, assembly, chromosome regulation and segregation (17,18). Xi'an, Shaanxi 710061, P.R. China Additionally, KIF4A participates in the process of DNA repair E‑mail: [email protected] and replication, and further maintains genetic stability (19). KIF4A also promotes axon growth in neuronal cells (14). Dr Zhijun Li, Department of Urology, The First Affiliated Hospital, and College of Clinical Medicine of Henan University of Science and Importantly, KIF4A is highly expressed in multiple human Technology, 24 Jinghua Road, Luoyang, Henan 471003, P.R. China tissues and is overexpressed in several types of tumors, such as E‑mail: [email protected] colorectal cancer (20). Researchers have revealed the involve‑ ment of KIF4A in the growth and progression of multiple types Key words: bladder cancer, kinesin family member 4A, cell division of cancer (20‑22). KIF4A could serve as a potential contributor cycle‑associated protein 3, tumor stage, prognosis of several types of cancer, including lung cancer, colorectal cancer, and hepatocellular carcinoma (HCC), and its expres‑ sion has been shown to be associated with the prognosis of 2 ZHENG et al: KIF4A COOPERATES WITH CDCA3 TO PROMOTE BLADDER CANCER PROGRESSION these types of cancer (20‑22). Although the function of KIF4A The shRNA sequences which specifically targeted KIF4A in tumor development have gained increasing attention, the were as follows: 5'‑AACAGGAAGAAGTCTTCAATACA‑3'. possible role and mechanisms of KIF4A in the progression of In addition, the shRNA targeted sequences which specifically BC remain unclear. targeted CDCA3 were as follows: 5'‑AACTGGAGGGTCTTA Cell division cycle‑associated protein 3 (CDCA3) is a cell AACATGCC‑3'. cycle regulator involved in the progression of multiple types of cancer, such as breast cancer and gastric cancer (23,24). Human tissue samples. A total of 159 human BC tissues and CDCA3 has been shown to affect the proliferation, migration corresponding normal tissues were obtained from the First and apoptosis of cancer cells, and could therefore serve as a Affiliated Hospital and College of Clinical Medicine of Henan promising therapeutic target for tumors (25). Several proteins University of Science and Technology from March, 2020 to promote the progression of cancers via CDCA3 (26). October, 2020. The relevant experiments were in line with The present study demonstrated that KIF4A was highly the requirements of the Declaration of Helsinki and had been expressed in human BC tissues. The data further confirmed approved by the hospital. All patients were treated with surgery that KIF4A expression was associated with tumor stage and only, and no chemoradiotherapy was used. All patients were the prognosis of patients with BC. KIF4A promoted BC cell enrolled with informed consent. All studies were approved by proliferation in vivo and in vitro. Importantly, it was confirmed the IACC of the First Hospital of Xi'an Jiaotong University that KIF4A promoted BC progression via transactivating the (approval no. 2020‑03‑B003). expression of CDCA3. Collectively, the findings of the present Through IHC staining, it was found that KIF4A was located study indicate the involvement of KIF4A in the progression in the nucleus of BC tissues. The intensity of staining was scored of BC and demonstrate that KIF4A may serve as a promising for 4 grades as follows: 0, negative staining; 1, low staining therapeutic target for the treatment of BC. intensity; 2, medium staining intensity; 3, high staining inten‑ sity. The product (combination of proportion scores of positively Materials and methods stained cells and respective intensity scores) was used as the final staining score (a minimum value of 0 and a maximum Biological analysis. Biological analysis was conducted to value of 300). Scores of 0‑100 were considered as low expres‑ investigate the mRNA levels of KIF4A in tumor and normal sion, and scores of 101‑300 was considered as high expression. tissues and explore the link between KIF4A and the prognosis CDCA3 was found to be expressed in the cytoplasm of of patients with BC. Gene Expression Profiling Interactive BC samples. The expression level of CDCA3 was manually Analysis (GEPIA; http://gepia.cancer‑pku.cn/detail. divided into 4 groups based on the staining intensity (0, nega‑ php?gene=KIF4A/) was used to collate and analyze The tive staining; 1, low staining intensity; 2, medium staining Cancer Genome Atlas (TCGA) data with a threshold of P<0.05 intensity; 3, high staining intensity). Moreover, the proportion and LogFC >1 or <‑1 for differential genes, and the median of stained cells was shown as follows (0, 0% stained cells; 1, was used as the basis for dividing the patients into two groups 1‑30% stained cells; 2, 31‑60% stained cells; and 3, 61‑100% for Kaplan‑Meier survival analysis; the log rank test was used stained cells) The score of staining intensity x the score of to assess significant differences. The 95% confidence interval stained cells percentage <1 or =1 was considered as negative is marked with a dotted line in the cell survival plots. All the staining, a score of 2‑4 was considered as low staining and a data on the survival rates were obtained from TCGA. score >4 was considered as CDCA3 high staining. The sections from each patient were observed within a total Antibodies, primers and plasmids. Anti‑KIF4A antibody of 5 visual fields, and 2 experienced pathologists examined the [1:400 dilution for immunohistochemistry (IHC), 1:2,000 dilu‑ sections. tion for western blot analysis and 1:50 dilution for ChIP assay, ab122227; Abcam], anti‑CDCA3 antibody (1:100 dilution, Cells, cell culture and transfection. The T24 (SCSP‑536) AB_2719030; Thermo Fisher Scientific, Inc.), anti‑β‑actin and 5637 (TCHu 1) human BC cells were purchased from antibody (1:1,000 dilution, ab8226; Abcam), anti‑Ki67 anti‑ the The Cell Bank of Type Culture Collection of the Chinese body (1:1,000 dilution, ab16667; Abcam), anti‑proliferating Academy of Sciences and maintained in McCoy's 5a medium cell nuclear antigen (PCNA) antibody (1:500 dilution, ab29; and RPMI‑1640 culture medium (Gibco; Thermo Fisher Abcam), anti‑cyclin D1 antibody (1:500 dilution, ab16663; Scientific, Inc.), respectively, supplemented with 10% of fetal Abcam), anti‑cyclin A antibody (1:500 dilution, ab185619; bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and

Abcam). incubated at 37˚C in a 5% CO2 incubator. The sequences of primers used for reverse transcrip‑ The indicated plasmids in the present study were trans‑ tion‑quantitative PCR (RT‑qPCR) were as follows: KIF4A fected into BC cells using Lipofectamine® 3000 (L3000015; forward, 5'‑TCTGTTTCAGGCTGCTTTCA‑3' and reverse, Invitrogen; Thermo Fisher Scientific, Inc.). To perform trans‑ 5'‑GCCCTGAAATATTTGATTGGAG‑3'; CDCA3 forward, fection in 6‑well plates, 1 µg plasmids and 5 µl Lipofectamine® 5'‑TGGTATTGCACGGACACCTA‑3' and reverse, 5'‑TGT were respectively added into 500 µl Opti‑MEM (Gibco; TTCACCAGTGGGCTTG‑3'; and GAPDH forward, 5'‑TGA Thermo Fisher Scientific, Inc.) for 5 min, subsequently mixed CTTCAACAGCGACACCCA‑3' and reverse, 5'‑CACCCT for 20 min and added to the cells without serum, after 4 h, GTTGCTGTAGCCAAA‑3'. the medium was refreshed with complete medium. The subse‑ The shRNA plasmids of KIF4A and CDCA3, as well as quent in vitro assays were performed after 24 h. The stable other plasmids, including pEnter‑KIF4A, pEnter‑CDCA3, and knockdown of KIF4A in the cell lines was achieved by the use pGL‑CDCA3 plasmids were constructed by the authors. of KIF4A depletion or control and used for the animal assays. INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021 3

RT‑qPCR. Total RNA was extracted from the T24 and 5637 for 3 h and the absorbance value was measured at a wavelength cells using TRIzol® reagent (15596‑018; Invitrogen; Thermo of 490 nm by a multifunctional enzyme label instrument Fisher Scientific, Inc.). Total RNA was then reverse transcribed (SpectraMax i3x; Molecular Devices). using the M‑MLV reverse transcriptase kit (M1701; Promega Corporation). The primer sequences have been described Cell cycle assay. Following transfection for 24 h, the cells above. qPCR was performed through the use of SYBR‑Green were fixed using 70% ethyl alcohol for 24 h at ‑20˚C and incu‑ mixture (RR420A; Takara Bio, Inc.), and the expression levels bated with a concentration of 50 µg/ml propidium iodide (PI) of KIF4A and CDCA3 were normalized to those of GAPDH. at 37˚C for 30 min, subsequently the samples were analyzed The thermocycling conditions were used for qPCR were as by the use of a FACSCalibur flow cytometer (FACSAria III; follows: Initial denaturation at 95˚C for 3 min; followed by BD Biosciences). The percentage of cells in different phases, 30 cycles of denaturation at 95˚C for 30 sec, annealing at 58˚C including the G1, S and G2/M phases was compared between for 30 sec and extension a 72˚C for 30 sec. The 2‑ΔΔCq method the control‑transfected and KIF4A‑depleted cells. was used to quantify the results (27). Tumor growth in vivo assay. Animal maintenance and oper‑ Western blot analysis. All the cell and tissue samples were ation in the present study were approved by the Institutional lysed with RIPA buffer (R0278; Sigma‑Aldrich; Merck Animal Care Committee (IACC) of the First Hospital KGaA) to isolate total proteins and the proteins were sepa‑ of Xi'an Jiaotong University. Female BALB/c nude mice rated by SDS‑PAGE. The tge BCA method was used for (8 weeks old; weithing ~20 g) were supplied by Beijing Vital protein determination. SDS‑PAGE was performed, and 10% River Experimental Animal Technology Co., Ltd. Mice were gel was used for the SDS‑PAGE assay. A total of 20 µg fed with food and water ad libitum and were fed at specific protein was loaded per lane. The proteins were sequentially pathogen‑free conditions at 20˚C, 60% humidity and alter‑ transferred onto nitrocellulose (NC) membranes, followed nating 12‑h light/dark cycles. A total of 12 athymic nude by blocking with 5% fat‑free milk in TBST buffer at room mice were included in the control (n=6) and shRNA (n=6) temperature for 2 h. The NC membranes were then incubated groups. The mice were sacrificed by excessive anesthesia with primary antibodies to KIF4A, CDCA3, Ki67, PCNA, via intraperitoneal injection with pentobarbital sodium at a cyclin D1, cyclin A and β‑actin at room temperature for 1.5 h. concentration of 120 mg/kg. The hearts of the mice were Subsequently the membranes were incubated with rabbit or then monitored and their deaths were confirmed by cardiac mouse HRP‑conjugated secondary antibodies (1:5,000 dilu‑ arrest. To measure tumor growth capacity in vivo, ~1x106 tion, ab6721 for rabbit, and ab6728 for mouse; Abcam) at T24 cells were stably transfected with KIF4A‑targeted room temperature for 1 h. Signals were then visualized using shRNA plasmids to stably deplete the expression of KIF4A an ECL kit (ab65623; Abcam). Signal intensity was measured and injected subcutaneously into the right flanks of female using ImageJ (version 1.8.0; National Institutes of Health). nude mice (6 for each group). After 2 weeks, tumors began to form, and the volume was measured up to 7 weeks. The Colony formation assay. The BC cells, T24 and 5637, were tumor volume was calculated as follows: Length x (width2)/2. transfected with the shRNA plasmids or overexpression plas‑ The tumor growth curves were calculated and compared mids for 48 h and then re‑seeded into 6‑well plates at a density between the two groups. of almost 500 cells each well and maintained for almost 2 weeks, when the colonies were formed. The colonies were ChIP and luciferase assays. ChIP assays were performed then fixed with methanol at ‑20˚C for 10 min and stained with using a commercial kit, the ChIP assay kit (ab500; Abcam). A 0.1% crystal violet (332488; Sigma‑Aldrich; Merck KGaA) at total number of 108 T24 cells were crosslinked, resuspended room temperature for 20 min. After washing with PBS, the and lysed with RIPA buffer (R0278; Sigma‑Aldrich; Merck stained colonies were then photographed and the differences KGaA), then sonicated so as to shear the DNA into a range of in colony numbers between the control‑ and KIF4A shRNA 500‑1,000 bp. Chromatin fraction was then immunoprecipi‑ plasmid‑transfected BC cells were calculated. tated by the use of KIF4A or IgG (ab172730; Abcam, 1:200 dilution) antibodies at 4˚C for 6 h, respectively, and the mix MTT assay. Both the T24 and 5637 cells were transfected with was enriched by the use of protein A Agarose (5015979001; the shRNA plasmids or overexpression plasmids for 48 h and Roche Diagnostics). Beads were isolated and washed with PBS then seeded into the 96‑well plates at a density of 1,000 cells 5 times. DNA was finally purified and RT‑qPCR assays were each well and maintained for ~48 h. Cells were then treated performed as described above. with MTT (5 mg/ml, M2128; Sigma‑Aldrich; Merck KGaA) For luciferase assays, T24 cells were maintained for 4 h and washed with PBS 3 times. Cells were then stained and transfected with 1 µg pGL‑CDCA3, pGL‑CDCA1, by the use of 150 µl DMSO and the optical density (OD) value pGL‑CDCA8, pGL‑Basic pEnter‑KIF4A overexpression at a wavelength of 570 nm was measured and analyzed by a plasmids overnight by 5 µl Lipofectamine®. The luciferase multifunctional enzyme label instrument (SpectraMax i3x; reporter plasmid was bought from Merck (SRE0045). Molecular Devices). At 1 day following transfection, the cells were washed with PBS twice and lysed with RIPA (R0278; Sigma‑Aldrich; CCK‑8 assay. BC cells were plated into 96‑well plates at a Merck KGaA), and the luciferase activities were detected density of ~1,000 cells per well and subsequently transfected by the use of a luciferase assay kit (ab253393; Abcam). The with the shRNA plasmids or overexpression plasmids for 48 h. normalization was performed by comparison with Renilla The cells were then treated with CCK‑8 (ab228554; Abcam) luciferase activity. 4 ZHENG et al: KIF4A COOPERATES WITH CDCA3 TO PROMOTE BLADDER CANCER PROGRESSION

Table I. Association of KIF4A and clinicopathological characteristics of 159 patients with BC.

KIF4A expression ------Feature All n=159 Low (n=58) High (n=101) χ2 P‑value

Age (years) 0.836 0.360 <65 119 41 78 ≥65 40 17 23 Sex 0.330 0.566 Male 87 30 57 Female 72 28 44 Tumor stage 6.362 0.012a T1‑T2 67 32 35 T3/T4 92 26 66 Tumor grade 1.407 0.236 Low 59 25 34 High 100 33 67 Lymph node metastasis 0.020 0.889 Yes 51 19 32 No 108 39 69 aStatistically significant (P<0.05). KIF4A, kinesin family member 4A; BC, bladder cancer.

Statistical analysis. GraphPad 6.0 software was used for all to the adjacent normal tissues (Fig. 1A). In addition, the statistical analyses in the present study. Data are represented mRNA levels of KIF4A were detected in 30 tumor tissues and as the mean ± SEM. Paired t‑tests was used to compare the corresponding normal tissues from patients with BC. Through expression of KIF4A in tumor tissues and normal tissues. RT‑qPCR assays, it was found that the mRNA levels of KIF4A One‑way ANOVA with Tukey's post hoc test were used to make were markedly upregulated in the tumor tissues, consistent comparisons among multiple groups. Moreover, the analysis with data presented in Fig. 1A (Fig. 1B). Similarly, western of the association between the clinicopathological features of blot analysis revealed the high expression of KIF4A in tumor patients with BC and KIF4A expression was performed using tissues compared with normal tissues (Fig. 1C). the χ2 test. Kaplan‑Meier survival analysis was performed The mRNA levels of KIF4A was also significantly high in to evaluate the prognosis of patients and the log rank test a total of 404 tumor tissues, compared with that in 28 normal was used to determine statistically significant differences. tissues, which was analyzed using TCGA data (Fig. 1D). To Pearson's correlation analysis was also performed to deter‑ further explore the effects of KIF4A on the progression of BC, mine the correlation between KIF4A and CDCA3 expression. the effects of KIF4A on the prognosis of BC were evaluated. The unpaired t‑test was used for statistical comparisons, and Through Kaplan‑Meier survival analysis using TCGA data, P<0.05 was considered to indicate a statistically significant it was found that the mRNA level of KIF4A was evidently difference. associated with the disease‑free survival rate of two sets of patients with BC (Fig. 1E). However, no association was Results found between KIH4A and the overall survival of patients (data not shown). Collectively, these data demonstrated that KIF4A is highly expressed in human BC tissues and is KIF4A expression was associated with the prognosis of associated with the prognosis of patients with BC. As a patients with BC. member of kinesin proteins, KIF4A can mediate the process of mitosis and tumorigenesis (16). The possible role of KIF4A Link between KIF4A expression and the clinicopathological on the progression of BC remains unclear. Therefore, KIF4A characteristics of patients with BC. The potential link between expression in BC tissues obtained from surgery and the the clinicopathological features of the 159 patients with BC corresponding normal tissues isolated from 159 patients was and KIF4A expression was further assessed. Patient age, sex, measured by IHC. tumor stage, grade and lymph node metastasis were analyzed, It was noted that KIF4A was mainly expressed in the respectively. Of note, it was found that KIF4A expression was nucleus and exhibited a brown‑yellow granular appearance. The positively associated with tumor stage (P=0.012, Table I), expression level of KIF4A was graded according to the staining whereas no significant associations were found between the intensity and the staining area. According to the staining expression of KIF4A and other clinicopathological features, results, it was found that KIF4A was located in the nucleus including patient age (P=0.360), sex (P=0.566), tumor grade of cancer cells, and highly expressed in BC tissues, compared (P=0.236) and lymph node metastasis (P=0.889) (Table I). INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021 5

Figure 1. KIF4A is highly expressed in human BC tissues and is associated with a poor prognosis of patients with BC. (A) Representative images of the KIF4A expression level detected by immunohistochemical staining of BC tissues and normal tissues (x100 and x200 magnification, respectively). Scale bar, 5 mm. (B) RT‑qPCR assays showing the mRNA levels of KIF4A in 30 tumor tissues and the corresponding normal tissues from patients with BC. (C) Western blot analysis showing the expression levels of KIF4A in tumor tissues and corresponding normal tissues from patients with BC. (D) mRNA levels of KIF4A in 404 BC tissues and 28 normal tissues were compared according to TCGA data. (E) Kaplan‑Meier plot analysis of two sets of data for the disease‑free survival rate between high and low KIF4A expression groups according to TCGA data. KIF4A, kinesin family member 4A; BC, bladder cancer.

Knockdown of KIF4A in BC cells leads to an impaired suppression of cell proliferation induced by the knockdown capacity of proliferation in vitro. The present study then of KIF4A (Fig. 2C). explored whether KIF4A affects the proliferation of BC To confirm the findings presented in Fig. 2A‑C, the expres‑ cells in vitro. To explore the role of KIF4A in cell prolifera‑ sion levels of 2 proliferative cell markers, PCNA and Ki67, were tion, KIF4A shRNA plasmids were first used to knock down detected, respectively. A significant decrease in the PCNA and the expression of KIF4A in BC cells, and its effects on cell Ki67 expression levels was observed in the KIF4A‑depleted proliferation were then detected. In total, two types of BC BC cells, consistent with the decline in the cell proliferative cells were used in these assays, the T24 and 5637 cells. The capacity (Fig. 2D and E). Therefore, these data confirmed the decreased expression of KIF4A following shRNA transfection promoting effects of KIF4A on BC cell proliferation. was examined by RT‑qPCR and western blot analysis. As was expected, the results indicated that the KIF4A expression level KIF4A knockdown results in the arrest of the BC cell cycle. was significantly decreased in KIF4A shRNA‑transfected T24 The cell cycle is known to be precisely controlled by various and 5637 cells (Fig. S1A and B). regulators to mediate cell proliferation. The present study then Subsequently, the effects of KIF4A on the proliferation analyzed the differences in the cell cycle between the control of BC cells were detected through colony formation, MTT and KIF4A‑depleted T24 and 5637 cells. The results revealed and CCK‑8 assays. The results of colony formation assays that the depletion of KIF4A increased the percentage of T24 and revealed that the number of colonies formed was markedly 5637 cells in the S phase (Fig. S2A), suggesting the arrest of the decreased following the knockdown of KIF4A in T24 and cell cycle. In addition, the expression of the cell cycle markers, 5637 cells (Fig. 2A). Similarly, the results of MTT assay cyclin D1 and cyclin A was detected by western blot analysis, revealed that the KIF4A‑depleted T24 and 5637 cells exhib‑ and the results revealed the evident decrease in cyclin D1 and ited an evidently decreased absorbance value at the 570 nm cyclin A expression in the KIF4A‑depleted T24 and 5637 cells, wavelength (Fig. 2B). Similarly, through CCK‑8 assays, it was consistent with the aforementioned results shown in in Fig. S2A found that the depletion of KIF4A led to a decrease in the (Fig. S2B). On the whole, these data demonstrated that KIF4A absorbance value at the 490 nm wavelength, suggesting the depletion resulted in cell cycle arrest in BC. 6 ZHENG et al: KIF4A COOPERATES WITH CDCA3 TO PROMOTE BLADDER CANCER PROGRESSION

Figure 2. KIF4A promotes the proliferation of BC cells in vitro. (A) Colony formation assays revealed the difference in the proliferative capacity of T24 and 5637 cells transfected with control or KIF4A shRNA plasmids. Scale bar, 5 mm. (B) MTT assays showing the proliferative capacity of BC cells transfected with control or KIF4A shRNA plasmids. (C) CCK‑8 assays exhibited the proliferation of BC cells was inhibited after KIF4A depletion. (D) Western blot analysis showing the expression levels of PCNA in control or KIF4A shRNA‑transfected T24 and 5637 cells. (E) Western blot analysis showing the expression of Ki67 in control or KIF4A shRNA‑transfected BC cells. Results are presented as the mean ± SEM; *P<0.05, **P<0.01 and ***P<0.001, vs. control. KIF4A, kinesin family member 4A; BC, bladder cancer; PCNA, proliferating cell nuclear antigen.

KIF4A promotes the tumor growth of BC cells in vivo. The that in the controls (Fig. 3B and C). Collectively, these results aforementioned results (Figs. 2 and S2) provided the evidence indicated that KIF4A promoted the tumor growth of BC cells that KIF4A promoted cell proliferation and affected the cell in mice. cycle of BC in vitro. To further investigate whether KIF4A knockdown can suppress tumor growth, in vivo animal assays KIF4A promotes BC development by promoting the expression were performed. T24 cells stably transfected with control or of CDCA3. As it was determined that KIF4A regulated cell KIF4A shRNA plasmids were injected into nude mice. After proliferation in BC both in vitro and in vivo, the regulatory 2 weeks, tumors began to form. A total of five representative mechanisms underlying the promoting effects of KIF4A on tumor samples in each group were photographed and are BC cell proliferation were then investigated. shown in Fig. 3A. After 7 weeks, the tumors were isolated, The aforementioned results (Fig. S2) indicated that the tumor volumes were compared, and the growth curves were depletion of KIF4A significantly led to cell cycle arrest in calculated. From the tumor growth curves, it was noted that the BC. Through the analysis of TCGA data, it was found that tumors in the KIF4A‑depleted groups were markedly smaller the CDCA family members CDCA1, CDCA3 and CDCA8, than those of the control group (Fig. 3A). To confirm the effec‑ which are key regulators of the cell cycle, were significantly tive decrease, KIF4A expression was detected in tumor tissues, highly expressed in BC tissues. Through TCGA data, it was and the results of both western blot analysis and ICH revealed further found that KIF4A expression significantly and posi‑ that the expression of KIF4A in the tumors derived from tively correlated with the expression of CDCA1 (Fig. S3A, left KIF4A‑depleted cells was markedly decreased compared with panel), CDCA3 (Fig. 4A) and CDCA8 (Fig. S3A, right panel) INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021 7

Figure 3. KIF4A promotes tumor growth of BC cells in mice. (A) Representative images of tumors in nude mice formed by T24 cells infected with control or KIF4A shRNA lentivirus (n=5 in each group). Volume of tumors from different groups was measured. Scale bar, 5 mm. (B) Western blot analysis showing the expression level of KIF4A in control tissues and in tumor tissues derived from BC cells in which KIF4A was knocked down. (C) Immunohistochemical staining results revealed the expression level of KIF4A in control and KIF4A‑depleted tumor tissues. Scale bar, 5 mm. Results are presented as the mean ± SEM; *P<0.05 and **P<0.01, vs. control. KIF4A, kinesin family member 4A; BC, bladder cancer. in BC, suggesting that KIF4A regulates the expression of these proliferation induced by KIF4A knockdown was evidently proteins. reversed by CDCA3 overexpression (Fig. 4F). Additionally, Importantly, by performing luciferase assays, the present CDCA3 overexpression following KIF4A depletion reversed study further examined whether KIF4A can transcription‑ the suppression of the proliferation of T24 and 5637 cells, which ally promote CDCA3 expression. The pGL‑CDCA3 plasmid was confirmed through MTT assays (Fig. 4G). Collectively, containing the promoter region of CDCA3 was co‑transfected these data demonstrate that KIF4A transcriptionally activates with pEnter‑vector or pEnter‑KIF4A plasmid into T24 cells. the expression of CDCA3. According to the results, it was show that KIF4A could promote the activation of CDCA3 promoter in T24 cells KIF4A cooperates with CDCA3 to promote the growth of BC. (Fig. 4B). However, it was noted that KIF4A could not promote The aforementioned results presented in Fig. 4 revealed that the activation of CDCA1 and CDCA8 (Fig. S3B). Of note, KIF4A could bind to the CDCA3 promoter and transactivate through ChIP assays, it was found that KIF4A antibody could CDCA3, further promoting the proliferation of BC cells. The be specifically co‑immunoprecipitated by the promoter frag‑ present study then aimed to confirm this finding using clinical ment of CDCA3 in T24 cells. Moreover, IgG antibody could samples. IHC assays were performed using the tumor tissue not be co‑immunoprecipitated, suggesting the specific binding samples surgically obtained from human BC tissues, and the of KIF4A with CDCA3 promoter (Fig. 4C). It was also found expression levels of both KIF4A and CDCA3 were detected that KIF4A could not bind with the promoter of CDCA1 and and analyzed in continuous slices of tumor tissues. Notably, it CDCA8 (Fig. S3C). It was thus determined that KIF4A could was found that the expression of CDCA3 was mainly located not regulate the expression of CDCA1 and CDCA8. in the cytoplasm and evidently associated with the expression Subsequently, RT‑qPCR and western blot analysis were of KIF4A (P<0.001, Fig. 5 and Table II). Based on these results, further conducted to detect the expression levels of CDCA3 in it was determined that KIF4A promotes the progression of BC both KIF4A overexpression and depleted T24 cells. The over‑ through the transcriptional activation of CDCA3. expression of CDCA3 and KIF4A in T24 cells was observed (Fig. S4). In addition, the knockdown of KIF4A decreased the Discussion expression level of CDCA3 at the mRNA and protein level, respectively (Fig. 4D and E). Over the years, targeted therapy for BC has attracted increasing To further explore whether KIF4A promotes the prolif‑ attention with its numerous advantages (28). Due to the high eration of BC cells through the transcriptional activation of metastasis of cancer, advancements in targeted therapy are CDCA3, rescue assays were then performed. Through colony urgently required (29‑31). At present, multiple molecular formation assays, it was revealed that the inhibition of cell markers of BC, which have potential value for the diagnosis 8 ZHENG et al: KIF4A COOPERATES WITH CDCA3 TO PROMOTE BLADDER CANCER PROGRESSION

Figure 4. KIF4A transcriptionally activates the expression of CDCA3. (A) TCGA data revealed the correlation between KIF4A and CDCA3 expression in human BC tissues. (B) Luciferase activity of pGL3‑Basic, pGL3‑CDCA3 in T24 cells co‑transfected with pEnter‑KIF4A or pEnter‑vector plasmids analyzed by luciferase reporter assays. (C) PCR amplification of the anti‑IgG or anti‑KIF4A antibody enriched CDCA3 promoter fragment in T24 cells performing ChIP assays. (D) KIF4A and CDCA3 expression level in pEnter‑vector or pEnter‑KIF4A transfected T24 cells were detected by western blot analysis. (E) KIF4A and CDCA3 expression level in control‑ or KIF4A shRNA‑transfected T24 cells were detected by RT‑qPCR. (F) Colony formation assays showing the difference in the proliferative capacity between T24 cells transfected with the indicated shRNAs and/or plasmids. (G) Left panel, MTT assays exhibited the difference in the proliferative capacity between T24 cells transfected with the indicated shRNAs and/or plasmids. Right panel, the difference in the proliferative capacity between 5637 cells transfected with the indicated shRNAs and/or plasmids. Scale bar, 5 mm. pcDNA3.1‑KIF4A vs. pcDNA3.1‑vector, shKIF4A vs. shControl, and shKIF4A + pcDNA3.1‑CDCA3 vs. shKIF4A + pcDNA3.1‑vector. Results are presented as the mean ± SEM; **P<0.01 and ***P<0.001, vs. respective control. KIF4A, kinesin family member 4A; BC, bladder cancer; CDCA3, cell division cycle‑associated protein 3. and prognosis of BC, have already been revealed (32). To Furthermore, KIF4A promoted BC cell proliferation in vitro improve the prognosis of patients with BC, novel therapeutic and in vivo by transactivating CDCA3 (Fig. 6). Therefore, targets still need to be developed. Importantly, the present KIF4A may be considered as a novel therapeutic target for BC. study found that a member of kinesins, KIF4A, was associ‑ KIF4A is known to be involved in the regulation of ated with the poor prognosis of patients with BC. KIF4A was chromosome congression and spindle dynamics during also associated with the clinical features of patients with BC. mitosis (33,34). In the present study, it was found KIF4A that INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021 9

Table II. Association between KIF4A and CDCA3 expression in 159 patients with BC.

KIF4A ------All patients (n=159) Low (n=58) High (n=101) χ2 P‑value

CDCA3 18.849 <0.001 Low (n=71) 39 32 High (n=88) 19 69

Figure 6. Regulatory model for the role of KIF4A in BC progression. In the present study, it was found that KIF4A transcriptionally activated CDCA3, promoted cell proliferation through the control of cell cycle and further promoted BC development. KIF4A, kinesin family member 4A; BC, bladder cancer; CDCA3, cell division cycle‑associated protein 3.

regulator, and contributed to the control of cell cycle in BC cells, which may affect the growth of BC. Notably, KIF4A may also prevent cell apoptosis and thus promote tumorigen‑ esis (36). Whether KIF4A regulates the development of BC by affecting cell apoptosis is also worthy of further study. As is known, KIF4A serves as an oncogene and is involved in multiple types of tumors, such as breast, colorectal and oral cancer (20,37,38). KIF4A overexpression blocks cancer cell growth in the stomach (39). In breast cancer, KIF4A could mediate the Rad51 pathway through the interact with BRCA2 (40). Similarly, an increased KIF4A expression level Figure 5. Expression of CDCA3 is positively associated with KIF4A in has also been considered as a potential clinical and prognostic human BC tissues. Immunohistochemical staining assays showing CDCA3 and KIF4A expression levels in tissues from patients with BC. Scale bar, biomarker in prostate cancer (41). The present study demon‑ 5 mm. KIF4A, kinesin family member 4A; BC, bladder cancer; CDCA3, cell strated that KIF4A was associated with a poor prognosis division cycle‑associated protein 3. of BC, and affected the progression of BC by regulating proliferation. The present study, together with other studies on KIF4A in cancer development, indicated the oncogene role affected the proliferation of BC cells in vitro and in mice, of KIF4A in multiple types of cancer. However, the specific which was largely due to the effects on chromosomes and effects of KIF4A among different tumors also require further spindle. Another study demonstrated that KIF4A depletion led investigation. to the defects of chromosome formation and spindle organiza‑ In the present study, it was found that the CDCA family tion, subsequently resulting in cell cycle arrest, consistent with proteins, CDCA1, CDCA3 and CDCA8, were highly expressed our conjecture (18). in BC tissues according to TCGA data. Further analyses The effects of KIF4A on the cell cycle have been exten‑ confirmed that the expression of KIF4A positively correlated sively studied in cancer cells. KIF4A ablation has been shown with CDCA1, CDCA3 and CDCA8 expression in BC tissues. to cause the activation of SAC and further lead to cell cycle However, through ChIP and luciferase assays, it was found that arrest at the G2/M phase (35). Another study indicated that only CDCA3 could be regulated by KIF4A. Therefore, these HCC cells were arrested in the G2/M phase caused by KIF4A findings confirmed that KIF4A could affect the progression of knockdown (36). Similarly, the present study found that KIF4A BC by regulating CDCA3 expression. depletion blocked the BC cell cycle. Of note, it was also found Previous research has demonstrated that CDCA3 expres‑ that KIF4A promoted the transcription of CDCA3, a cell cycle sion is related to an improved overall survival of patients with 10 ZHENG et al: KIF4A COOPERATES WITH CDCA3 TO PROMOTE BLADDER CANCER PROGRESSION

BC (42). Notably, it was found that KIF4A activated the expres‑ Authors' contributions sion of CDCA3, and further promoted the development of BC. In fact, it has been confirmed that kinesins cab transcriptional PZ, KWu, ZG and ZL performed the molecular biology regulate CDCA family protein expression and promote cancer experiments and drafted the manuscript. HL, WL, XW, ZS, progression. For example, KIF18B has been shown to promote FX, KWa and QH participated in the design of the study and the proliferation of pancreatic ductal adenocarcinoma (PDAC) performed the statistical analysis. PZ, KWu and ZL conceived via activating CDCA8 expression (43). the study, participated in the study design and coordination, Apart from KIF4A, several proteins promote cancer and assisted in the drafting of the manuscript. PZ and ZL development by transcriptionally activating CDCA3. HoxB3 confirmed the authenticity of all the raw data. All authors have can promote prostate cancer progression via the promotion read and approved the final manuscript. of CDCA3 expression (44). As a cell cycle regulator, CDCA3 also promotes the development of cancer progression, such Ethics approval and consent to participate as oral cancer (45). CDCA3 is also high expression in BC tissues. A previous study indicated that CDCA3 promoted the All experiments involving human tissue were approved by the proliferation of colorectal cancer cells via the activation of the IACC of the First Hospital of Xi'an Jiaotong University (approval cyclin D1 signaling pathway (46). The present study screened no. 2020‑03‑B003). Animal maintenance and operation in this CDCA3 as a downstream protein of KIF4A through ChIP study was approved by the Institutional Animal Care Committee assays; further molecular mechanisms need to be studied in (IACC) of the First Hospital of Xi'an Jiaotong University. view of its role in BC development. In the future, the authors aim to examine the mechanisms through which KIF4A further Patient consent for publication influences the BC cell cycle and proliferation by regulating CDCA3 transcription. Not applicable. There are several other factors which are involved in the progression of BC. For example, CDODA‑Me has been Competing interests shown to decrease specificity protein transcription factors and to exhibit anti‑neoplastic activity in bladder cancer cells by The authors declare that they have no competing interests. inducing reactive oxygen species (ROS) (47). Another study demonstrated the importance of the microenvironment of BC, References providing evidence that the predominance of M2‑polarized 1. Williams SB, Shan Y, Jazzar U, Mehta HB, Baillargeon JG, Huo J, macrophages affected the angiogenesis, tumor grade and inva‑ Huo J, Senagore AJ, Orihuela E, Tyler DS, et al: Comparing siveness of BC (48). The present study found that KIF4A plays survival outcomes and costs associated with radical cystectomy a role in BC progression. However, it should also be determined and trimodal therapy for older adults with Muscle‑Invasive bladder cancer. JAMA Surg 153: 881‑889, 2018. whether KIF4A affects ROS and the microenvironment, and 2. Giulietti M, Occhipinti G, Righetti A, Bracci M, Conti A, the underling mechanisms need to be elucidated. Notably, Ruzzo A, Cerigioni E, Cacciamani T, Principato G and Piva F: the present study demonstrated the effects of KIF4A on the Emerging biomarkers in bladder cancer identified by network analysis of transcriptomic data. Front Oncol 8: 450, 2018. apoptosis of BC cells. Further studies are required however, to 3. Terzic M, Ladjevic IL, Ladjevic N, Terzic S, Dotlic J, detect the expression of p70S6K to investigate the capacity of Cekerevac M, Arsenovic N, Laganà AS and Vereczkey A: BC cells to form spheres following apoptosis, according to a Anaplastic T‑cell lymphoma of the urinary bladder with unspe‑ cific clinical and radiological characteristics ‑ a unique case previous study (49). report. Eur J Gynaecol Oncol 40: 136‑139, 2019. In conclusion, the present study found that KIF4A was highly 4. Tan WS, Rodney S, Lamb B, Feneley M and Kelly J: Management of non‑muscle invasive bladder cancer: A comprehensive analysis expressed in human BC tissues and was associated with the of guidelines from the United States, Europe and Asia. Cancer prognosis and clinicopathological characteristics of patients. It Treat Rev 47: 22‑31, 2016. was also confirmed that KIF4A promoted the proliferation of 5. Wang Y, Chang Q and Li Y: Racial differences in Urinary bladder cancer in the United States. Sci Rep 8: 12521, 2018. BC cells in vitro and in mice in vivo. Furthermore, KIF4A tran‑ 6. Crabb SJ and Douglas J: The latest treatment options for bladder scriptionally activated the expression of CDCA3, and therefore cancer. Br Med Bull 128: 85‑95, 2018. contributed to the progression of BC. Therefore, KIF4A may 7. Sakaguchi M, Maebayashi T, Aizawa T, Ishibashi N and Saito T: Clinical results for bladder cancer treated by radiotherapy prove to be a promising molecular target for the treatment of BC. without concurrent standard chemotherapy. Anticancer Res 36: 5519‑5525, 2016. Acknowledgements 8. Li R, Metcalfe MJ, Ferguson JE III, Mokkapati S, Nogueras Gonzalez GM, Dinney CP, Navai N, McConkey DJ, Sahai SK and Kamat AM: Effects of thiazolidinedione in patients Not applicable. with active bladder cancer. BJU Int 121: 244‑251, 2018. 9. DeGeorge KC, Holt HR and Hodges SC: Bladder cancer: Diagnosis and treatment. Am Fam Physician 96: 507‑514, 2017. Funding 10. Abbosh PH, McConkey DJ and Plimack ER: Targeting signaling transduction pathways in bladder cancer. Curr Oncol Rep 17: 58, No funding was received. 2015. 11. Liang YJ and Yang WX: Kinesins in MAPK cascade: How kinesin motors are involved in the MAPK pathway? Gene 684: 1‑9, 2019. Availability of data and materials 12. Rath O and Kozielski F: Kinesins and cancer. Nat Rev Cancer 12: 527‑539, 2012. 13. Chudy A, Gajewska B, Gutowicz M and Baranczyk‑Kuzma A: The datasets used and/or analyzed during the present study are Intracellular transport proteins: Classification, structure and func‑ available from the author on reasonable request. tion of kinesins. Postepy Hig Med Dosw (Online) 65: 588‑596, 2011. INTERNATIONAL JOURNAL OF MOlecular medicine 47: 99, 2021 11

14. Heintz TG, Heller JP, Zhao R, Caceres A, Eva R and Fawcett JW: 34. Nunes Bastos R, Gandhi SR, Baron RD, Gruneberg U, Nigg EA Kinesin KIF4A transports integrin β1 in developing axons of and Barr FA: Aurora B suppresses microtubule dynamics and cortical neurons. Mol Cell Neurosci 63: 60‑71, 2014. limits central spindle size by locally activating KIF4A. J Cell 15. Wu G and Chen PL: Structural requirements of chromokinesin Biol 202: 605‑621, 2013. Kif4A for its proper function in mitosis. Biochem Biophys Res 35. Wan Q, Shen Y, Zhao H, Wang B, Zhao L, Zhang Y, Bu X, Commun 372: 454‑458, 2008. Wan M and Shen C: Impaired DNA double‑strand breaks repair 16. Mazumdar M, Sundareshan S and Misteli T: Human chromo‑ by kinesin family member 4A inhibition renders human H1299 kinesin KIF4A functions in chromosome condensation and non‑small‑cell lung cancer cells sensitive to cisplatin. J Cell segregation. J Cell Biol 166: 613‑620, 2004. Physiol 234: 10360‑10371, 2019. 17. Tipton AR, Wren JD, Daum JR, Siefert JC and Gorbsky GJ: 36. Huang Y, Wang H, Lian Y, Wu X, Zhou L, Wang J, Deng M and GTSE1 regulates spindle microtubule dynamics to control Huang Y: Upregulation of kinesin family member 4A enhanced cell Aurora B kinase and Kif4A chromokinesin on chromosome proliferation via activation of Akt signaling and predicted a poor arms. J Cell Biol 216: 3117‑3132, 2017. prognosis in hepatocellular carcinoma. Cell Death Dis 9: 141, 2018. 18. Tang F, Pan MH, Lu Y, Wan X, Zhang Y and Sun SC: Involvement 37. Minakawa Y, Kasamatsu A, Koike H, Higo M, Nakashima D, of Kif4a in Spindle formation and chromosome segregation in Kouzu Y, Sakamoto Y, Ogawara K, Shiiba M, Tanzawa H and Mouse Oocytes. Aging Dis 9: 623‑633, 2018. Uzawa K: Kinesin family member 4A: A potential predictor for 19. Wu G, Zhou L, Khidr L, Guo XE, Kim W, Lee YM, Krasieva T progression of human oral cancer. PLoS One 8: e85951, 2013. and Chen PL: A novel role of the chromokinesin Kif4A in DNA 38. Wang H, Lu C, Li Q, Xie J, Chen T, Tan Y, Wu C and Jiang J: The damage response. Cell Cycle 7: 2013‑2020, 2008. role of Kif4A in doxorubicin‑induced apoptosis in breast cancer 20. Matsumoto Y, Saito M, Saito K, Kanke Y, Watanabe Y, cells. Mol Cells 37: 812‑818, 2014. Onozawa H, Hayase S, Sakamoto W, Ishigame T, Momma T, et al: 39. Gao J, Sai N, Wang C, Sheng X, Shao Q, Zhou C, Shi Y, Sun S, Enhanced expression of KIF4A in colorectal cancer is associated Qu X and Zhu C: Overexpression of chromokinesin KIF4 inhibits with lymph node metastasis. Oncol Lett 15: 2188‑2194, 2018. proliferation of human gastric carcinoma cells both in vitro and 21. Taniwaki M, Takano A, Ishikawa N, Yasui W, Inai K, in vivo. Tumour Biol 32: 53‑61, 2011. Nishimura H, Tsuchiya E, Kohno N, Nakamura Y and Daigo Y: 40. Lee YM and Kim W: Association of human kinesin superfamily Activation of KIF4A as a prognostic biomarker and therapeutic protein member 4 with BRCA2‑associated factor 35. Biochem target for lung cancer. Clin Cancer Res 13: 6624‑6631, 2007. J 374: 497‑503, 2003. 22. Hou G, Dong C, Dong Z, Liu G, Xu H, Chen L, Liu L, Wang H 41. Gao H, Chen X, Cai Q, Shang Z and Niu Y: Increased KIF4A and Zhou W: Upregulate KIF4A enhances proliferation, invasion expression is a potential prognostic factor in prostate cancer. of hepatocellular carcinoma and indicates poor prognosis across Oncol Lett 15: 7941‑7947, 2018. human cancer types. Sci Rep 7: 4148, 2017. 42. Li S, Liu X, Liu T, Meng X, Yin X, Fang C, Huang D, Cao Y, 23. Phan NN, Wang CY, Li KL, Chen CF, Chiao CC, Yu HG, Weng H, Zeng X and Wang X: Identification of biomarkers Huang PL and Lin YC: Distinct expression of CDCA3, CDCA5, correlated with the TNM staging and overall survival of patients and CDCA8 leads to shorter relapse free survival in breast cancer with bladder cancer. Front Physiol 8: 947, 2017. patient. Oncotarget 9: 6977‑6992, 2018. 43. Li B, Liu B, Zhang X, Liu H and He L: KIF18B promotes the 24. Zhang Y, Yin W, Cao W, Chen P, Bian L and Ni Q: CDCA3 is proliferation of pancreatic ductal adenocarcinoma via activating a potential prognostic marker that promotes cell proliferation in the expression of CDCA8. J Cell Physiol 235: 4227‑4238, 2020. gastric cancer. Oncol Rep 41: 2471‑2481, 2019. 44. Chen J, Zhu S, Jiang N, Shang Z, Quan C and Niu Y: HoxB3 25. Dou D, Ren X, Han M, Xu X, Ge X, Gu Y, Wang X and Zhao S: promotes prostate cancer cell progression by transactivating CircUBE2D2 (hsa_circ_0005728) promotes cell proliferation, CDCA3. Cancer Lett 330: 217‑224, 2013. metastasis and chemoresistance in triple‑negative breast cancer 45. Uchida F, Uzawa K, Kasamatsu A, Takatori H, Sakamoto Y, by regulating miR‑512‑3p/CDCA3 axis. Cancer Cell Int 20: 454, Ogawara K, Shiiba M, Tanzawa H and Bukawa H: Overexpression 2020. of cell cycle regulator CDCA3 promotes oral cancer progression 26. Chen Q, Zhou L, Ye X, Tao M and Wu J: MiR‑145‑5p suppresses by enhancing cell proliferation with prevention of G1 phase proliferation, metastasis and EMT of colorectal cancer by arrest. BMC Cancer 12: 321, 2012. targeting CDCA3. Pathol Res Pract 216: 152872, 2020. 46. Zhang W, Lu Y, Li X, Zhang J, Zheng L, Zhang W, Lin C, Lin W 27. Livak KJ and Schmittgen TD: Analysis of relative gene expres‑ and Li X: CDCA3 promotes cell proliferation by activating sion data using real‑time quantitative PCR and the 2(‑Delta Delta the NF‑κB/cyclin D1 signaling pathway in colorectal cancer. C(T)) method. Methods 25: 402‑408, 2001. Biochem Biophys Res Commun 500: 196‑203, 2018. 28. Yamaoka T, Kusumoto S, Ando K, Ohba M and Ohmori T: 47. Takeuchi H, Taoka R, Mmeje CO, Jinesh GG, Safe S and Receptor tyrosine kinase‑targeted cancer therapy. Int J Mol Kamat AM: Urol Oncol. CDODA‑Me decreases specificity Sci 19: 3491, 2018. protein transcription factors and induces apoptosis in bladder 29. He YT, Li DJ, Liang D, Zheng RS, Zhang SW, Zeng HM, cancer cells through induction of reactive oxygen species. Urol Chen WQ and He J: Incidence and mortality of BC in China. Oncol 34: 337.e11‑8, 2016. Zhonghua Zhong Liu Za Zhi 40: 647‑652, 2018 (In Chinese). 48. Takeuchi H, Tanaka M, Tanaka A, Tsunemi A and Yamamoto H: 30. Yang Y, Zhao Z, Xie C and Zhao Y: Dual‑targeting liposome Predominance of M2‑polarized macrophages in bladder cancer modified by glutamic hexapeptide and folic acid for bone meta‑ affects angiogenesis, tumor grade and invasiveness. Oncol static breast cancer. Chem Phys Lipids 228: 104882, 2020. Lett 11: 3403‑3408, 2016. 31. Zhao Z, Zhao Y, Xie C, Chen C, Lin D, Wang S, Lin D, Cui X, 49. Takeuchi H, Mmeje CO, Jinesh GG, Taoka R and Kamat AM: Guo Z and Zhou J: Dual‑active targeting liposomes drug delivery Sequential gemcitabine and tamoxifen treatment enhances apop‑ system for bone metastatic breast cancer: Synthesis and biolog‑ tosis and blocks transformation in bladder cancer cells. Oncol ical evaluation. Chem Phys Lipids 223: 104785, 2019. Rep 34: 2738‑2744, 2015. 32. Soria F, Krabbe LM, Todenhofer T, Dobruch J, Mitra AP, Inman BA, Gust KM, Lotan Y and Shariat SF: Molecular This work is licensed under a Creative Commons markers in bladder cancer. World J Urol 37: 31‑40, 2019. Attribution-NonCommercial-NoDerivatives 4.0 33. Dong Z, Zhu C, Zhan Q and Jiang W: Cdk phosphorylation International (CC BY-NC-ND 4.0) License. licenses Kif4A chromosome localization required for early mitotic progression. J Mol Cell Biol 10: 358‑370, 2018.