What Mediates Cor:Fhua Interactions?

WHAT MEDIATES COR:FHUA INTERACTIONS?

Alec Brown

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

December 2018

Committee:

Ray Larsen, Advisor

Vipaporn Phuntumart

Jill Zeilstra-Ryalls

Alec A. Brown

ABSTRACT

Ray Larsen, Advisor

TonB-dependent transporters (TBDT) are a class of outer membrane proteins found in gram-negative bacteria. These proteins serve as transporters for a variety of specific ligands and as receptors exploited by bacteriophage and toxins. The binding of a cognate ligand on the external surface of the TBDT induces a conformational change on the inner-facing (periplasmic) surface of the protein. The change in response to ligand occupancy renders a region in the extreme amino terminus (termed the “TonB-box”) accessible to the cytoplasmic membrane protein TonB. The interaction of TonB with this, and potentially other periplasmically-exposed regions facilitates energy transfer from TonB to the TBDT, driving a conformational change that provides for the vectoral transfer of the bound ligand from the outer to the inner surface, with subsequent ligand release into the periplasmic space. The mechanism of energy transfer and the subsequent transport event remains unclear.

The gram-negative bacterium Escherichia coli contains eight distinct TBDTs including the ferric hydroxamate transporter FhuA. In addition to providing for the uptake of Fe(III)- ferrochrome conjugates, FhuA is recognized as a receptor by 80, T1 and T5 bacteriophage. As such, these viruses present potential tools for addressing the fundamental mechanism of active transport and the coupling of TonB to that process. Beyond using FhuA as a receptor for infection,

80 and T1 also encode a small putative lipoprotein (termed “Cor”) that is trafficked to the inner surface of the outer membrane, where it renders FhuA unable to transport bound ligand.

Expression of cloned 80 cor gene in E. coli, is sufficient to curtail FhuA-mediated transport of both TonB-dependent and –independent ligands. In this thesis, phylogenetic comparisons between

80 and cor gene homologues of other bacteriophage are used to predict potential amino acids essential for Cor protein function, and site-directed mutagenesis to engineer mutant Cor derivatives to test those predictions.

iii

ACKNOWLEDGEMENTS

I would first like to give a warm and sincerest thanks to Dr. Larsen who has been instrumental to my growth both as a scientist and as a person. I cannot thank you enough for all the help and mentorship you have shown me over these past 6 years. I would also like to thank my committee, Dr. Zeilstra and Dr. Phuntumart, who have time and again gone above and beyond to help me reach my goals. I have had the pleasure of getting to know the entire biology and chemistry faculty at Bowling Green State University, all of whom have collectively helped me along my journey. To the many fellow students that worked alongside me in the labs, you all have taught me so much and helped to make these past 6 years some of my best. Finally, I would to thank my family that have supported me all my life. I could not have accomplished all I have without you all!

TABLE OF CONTENTS

Page

CHAPTER I. BACKGROUND AND SPECIFIC AIMS ...... 1

Introduction...... 1

Uptake and utilization of iron by gram negative bacteria ...... 3

The TonB transport system ...... 5

FhuA and the role of TonB-Dependent Transporters ...... 7

The Cor protein: categorization, function and the unknown ...... 13

Specific aims...... 16

CHAPTER II. MATERIALS AND METHODS ...... 18

Media...... 18

φ80 and Colicin B preparations ...... 18

Bacterial strains and plasmids ...... 19

PCR, ligation, cloning and DNA sequencing ...... 23

Phenotyping Cor derivatives ...... 28

Sequence analyses ...... 29

CHAPTER III. RESULTS ...... 30

Establishing controls for evaluating Cor functionality ...... 30

Sequence analyses results ...... 32

Determination of residues of interest ...... 34

Complete loss of Cor phenotype ...... 40

Partial loss of Cor phenotype ...... 42

No loss of Cor phenotype ...... 42

CHAPTER IV. DISCUSSION AND CONCLUSION ...... 43

Discussion...... 43

Conclusion...... 45

REFERENCES...... 47

LIST OF TABLES

Table Page

1 Strains used in this study...... 20

2 Plasmids used in this study ...... 21

3 Custom primers used in this study ...... 25

4 Preliminary results ...... 31

5 Putative prophage hits from BLASTp sequence analysis ...... 37

6 Spot titers assay results ...... 39

vii

LIST OF FIGURES

Figure Page

1 Structural components of TBDT ...... 9

2 Construction of pRA033 and pRA038 vectors ...... 22

3 Overview of site-specific mutagenesis strategy ...... 27

4 Preliminary data ...... 31

5 Secondary structure predictions ...... 33

6 BLASTp multiple sequence alignment ...... 38

CHAPTER I. BACKGROUND AND SPECIFIC AIMS

Introduction

Prokaryotes are single-celled organisms comprising the Domains Eubacteria and

Archaea. Eubacteria exist as two distinct clades (gram-positive and gram-negative) evident primarily on the basis of their cell wall architecture. Gram-positive bacteria contain a thick layer of peptidoglycan along with other associated compounds to form a functional cell wall that acts to separate the bacterial cytoplasm from the environment. By contrast, gram-negative bacteria have evolved a dual membrane system, with an outer membrane (OM) that provides a diffusion barrier as the interface with the environment. Unlike the inner, cytoplasmic membrane (CM), the OM is an asymmetric lipid bilayer, with a phospholipid inner leaflet and an outer leaflet that includes lipid-anchored polysaccharides that impede the passage of hydrophobic molecules that are readily soluble in standard lipid bilayers (Nikaido, 2003).

To allow for the passage of smaller, hydrophilic molecules, the OM contains a class of integral membrane proteins (termed porins) that provide aqueous channels for the diffusion of small (< 600 Da) hydrophilic molecules (Koch, 1998). Porins form characteristic -barrel structures, with a long loop region stacked within the porin opening that partially occludes the porin channel (Koch, 1998). X-ray crystallographic analyses of porins helped to elucidate a common secondary structure consisting of anti-parallel -strands, leading to a tertiary -barrel archetype structure. Functional differences between porins are determined primarily by surface residues, loop topography and barrel size (Cowan et al., 1992). Porins made up of either 14 or 16

-strands typically display no particular substrate bias and provide for passive diffusion. Certain porins favor specific substrates to provide for facilitated diffusion; the barrels of such porins are typically formed by 18 -strands (Galdiero et al., 2012).

The inner face of the OM forms a boundary with an aqueous compartment, termed the periplasmic space. Within this compartment resides a thin layer of peptidoglycan, covalently bound to the inner leaflet of the OM by lipoproteins. This corset of peptidoglycan functions to define and maintain cell shape, and to contain internal turgor pressure. (Koch and Woeste, 1992).

The fluid component of the periplasmic space (known as the periplasm) contains a wide array of soluble proteins that includes hydrolytic enzymes, chemoreceptors, chaperones and other binding proteins. The periplasm also contains a variety of osmoprotectants, including a family of negatively-charged membrane-derived oligosaccharides (MDOs) that generate a Donnan potential across the OM and contribute to the hydrostatic pressure of the periplasmic space

(Kennedy, 1982).

The inner boundary of the periplasmic space is defined by the (CM), which encloses the cell proper. The CM acts as a permeability barrier and is rich in proteins that couple energy to the vectoral trafficking of molecules and ions in and out of the cytoplasm it encloses. The CM supports a variety of crucial cellular processes, including energy transformation, lipid biosynthesis, protein secretion and replication (Silhavy et al., 2010). Thus, the CM serves as an interface that couples cytoplasmic processes to support cell wall functions associated with the periplasmic space and the OM.

For over 70 years the gram-negative bacterium Escherichia coli has been the most extensively studied model organism. As such, it has served to establish many fundamental aspects of cellular and molecular biochemistry and physiology (Russo, 2003). Numerous strains of E. coli have been adapted to laboratory settings, where their rapid growth rate on relatively simple medium facilitated early research. These characteristics afforded the identification and harnessing of a variety of gene transfer strategies that both support research and form the basis of

3 bioengineering (Lee, 1996; Blount, 2015). In the context of this thesis, E. coli historically is the primary model for understanding microbial iron transport mechanisms (Noinaj et al., 2010) and thus serves here as the organism for the present study.

Uptake and utilization of iron by gram negative bacteria

Iron is an essential element for most living things. As a solute, iron can exist in several oxidation states; either the oxidized, ferric form (Fe3+) or the reduced, ferrous form (Fe2+), depending upon the environment (Papanikolaou and Pantopoulos, 2005). When bound to protein, iron’s role in oxido-reduction processes is versatile, reflecting the properties that influence the specificity and selectivity of iron as a nucleophile (Mackenzie et al., 2008). As such, iron can serve as a cofactor for proteins that mediate a wide variety of oxidation / reduction processes in biological systems (Hentze et al., 2004). Thus, for most living systems, iron is an essential nutrient. Under conditions of iron starvation, enzymes required for oxidative phosphorylation are down-regulated, often with resultant sub-basal levels of cellular respiration (Oxele et al.,

1999). Iron also plays a role in gene regulation/expressions of proteins involved in an array of transport mechanisms, DNA biosynthesis and cellular growth (McHugh et al., 2013).

Interestingly, a very few species occupying specialized niches where iron availability is problematic (for example, Lactobacillus plantarum in milk) have replaced iron with other trace metals (primarily copper) to support their essential redox-dependent processes (Archibald, 1983).

Acquisition and utilization of iron by microorganisms such as E. coli poses two major challenges. The first challenge is to bind environmental iron and the second challenge is how to transfer the bound iron from the environment into the cell. The first of these complications is physically problematic, as access to environmental iron is greatly limited in pH-neutral aerobic environments where soluble iron is rapidly oxidized, forming ferric hydroxide complexes with

4 ferric ion disassociation values ranging between 10-9 to 10-18 M (Miethke and Marahiel, 2007).

To overcome the scarcity of bioavailable iron, many microorganisms have evolved the ability to synthesize and secrete secondary metabolites called siderophores to facilitate iron assimilation.

Siderophores are complex compounds that chelate iron via high affinity binding to ferric ion.

Although the exact dissociation value of many siderophores remains unknown, efficacy of siderophore activity demands a lower dissociation value. Known values of well-studied

-35 -30 siderophores include yersiniabactin (Kd of 10 M) and enterobactin (Kd of 10 M), which allow for the extraction of ferric ion from oxidized compounds (Perry et al., 1999; Raymond et al.,

2003). Mechanistically, siderophores utilize a collection of highly electronegative oxygen molecules which, in turn, act as nucleophiles for binding of ferric ion (Neilands, 1995). Once bound, siderophore structure aids in stabilization and shielding of ferric ion (Neilands, 1995). By doing so, the siderophore-iron complex forms a soluble compound in aerobic environments at both neutral and physiological pH, which is then suitable for transport into the cell (Harrington and Crumbliss, 2009).

While many ferric-siderophore complexes are relatively small and highly soluble, it would seem iron-siderophore complexes are too rare and iron demand too great for passive diffusion through porins to support cell needs. Indeed, evolution has selected a large family of

-barrel proteins that capture ferric-siderophores at the outer membrane, then transport them against a concentration gradient to accumulate in the periplasm, where a second set of binding proteins capture and present them to CM transporters that transport the ferric siderophore complex into the cytoplasm (Postle and Larsen, 2007; Noinaj et al., 2010; Krewulak and Vogel,

2011). While transfer into the cytoplasm is driven by the hydrolysis of ATP, the initial transport across the OM lacks a local energy source. Instead, this transport is coupled to the ion

5 electrochemical potential of the cytoplasmic membrane by a protein called “TonB” (Hanke and

Braun, 1975; 1976; Bradbeer, 1993).

The TonB transport system

Transport of ferric-siderophore complexes across the OM of E. coli requires binding of siderophores to a specific class of OM proteins known as TonB-Dependent Transporters

(TBDT). These proteins both bind to and actively transport iron-bearing siderophores across the

OM. The energy source for this active transport is the ion electrochemical gradient that exists across the CM (Bradbeer, 1993). This spatial separation between energy source and energy sink is overcome by the periplasmic protein TonB. (Braun et al., 1996; Letain and Postle 1997;

Gresock et al., 2011).

Structurally, TonB can be divided into three distinct domains (Postle and Good, 1983).

The first is an amino-terminal, transmembrane -helix that functions as a signal anchor in the

CM (Postle and Skare, 1988; Roof et al., 1991) and couples TonB to the ion-electrochemical gradient via its association with a multi-protein complex with the integral CM proteins ExbB and

ExbD (Bradbeer, 1993; Karlsson et al., 1993; Braun et al., 1996). ExbB and ExbD are members of a family of proton and sodium translocators that includes the flagellar motor proteins MotA and MotB which couple flagellar rotation to the proton gradient (Zhai et al., 2003). ExbD is proposed to act as a chaperone protein aiding in stabilization of TonB confirmations required to achieve an energized state (Gresock et al., 2015). It would then follow that ExbB functions as the energy conduit between the electrochemical gradient and TonB energization. The ratio of

TonB:ExbB:ExbD complex is found in the cell as 7 ExbB and 2 ExbD proteins for every 1 TonB protein, making TonB the limiting protein. (Higgs et al., 2002; Postle and Held, 2002).

The second domain is a linker region containing an abundance of prolines that forms a long axial structure (Evans et al., 1986) sufficient to span the distance between the CM and the

OM (Köhler et al., 2010). While it has been suggested that this domain is important for stabilization of a TonB conformation involved in energy transfer (Khursigara et al., 2005), it is not essential for this energy transfer (Larsen et al., 1993).

The third domain is a mixed -helical/ -sheet carboxyl-terminal domain. This domain interacts with the “TonB box”, a heptapeptide sequence in the amino-terminal domain of TBDTs which is periplasmically available (Gudmundsdottir et al., 1989; Kadner et al., 2000). Genetic studies initially identified this amino-terminal domain as important for interaction with TonB

(Heller et al., 1988; Günter and Braun, 1990; Kadner et al., 1990). Subsequent in vivo chemical crosslinking studies verified the role of the TonB box in physical interactions with TonB (Larsen et al., 1997). Mutational analyses of TonB revealed that residues 155-165 in the TonB carboxyl- terminal domain and residues 6-13 in the TBDT TonB box are required for TBDT transport

(Vakharia-Rao et al., 2007). Furthermore, changes in these regions have a multitude of consequences, including loss of sensitivity to ligand binding within TBDT, loss of active transport and/or loss of binding between TonB and TBDT.

The mechanism by which TonB energizes TBDT active transport remains unresolved, although it is evident that TonB undergoes a series of conformational changes in this process

(Larsen et al., 1999). Consistent with this, the interaction between energized TonB and TBDT allows for active transport of bound ligand across the OM (Chakraborty et al., 2003) and describes the opening steps of the TonB pathway. Further, solved structures of the TonB carboxyl-terminus co-crystallized with TBDT suggest a distinct conformational change in TBDT

7 which limits TBDT from binding additional ligand during active transport (Shultis et al., 2006;

Pawalek et al., 2006).

Following successful translocation into the periplasm, siderophore-specific periplasmic binding proteins traffic the siderophore-iron complex to the CM (Stephens et al., 1995). From there, siderophore is translocated across the CM and into the cytoplasm via ATP-binding cassette

(ABC) transporters (Postle and Larsen, 2007; Krewulak and Vogel, 2008; 2011). Once the iron- complex enters the cytoplasm, the iron is released through the reduction of ferric iron to ferrous iron via ferric iron reductases (Schröder et al., 2003), which in some cases requires hydrolysis of the siderophore to liberate the iron (Marahiel and Miethke, 2013). Ferrous iron may then be incorporated into various metallo-proteins to be used for different biological processes (Lau et al., 2016). Additionally, excess ferrous iron in the cytoplasm acts as a cofactor for the Ferric

Uptake Regulator (FUR) protein, which helps to mediate gene expression of proteins involved in iron homeostasis by down regulating transcription of certain genes and by acting as an activator for others (Troxell and Hassan, 2013).

FhuA and the role of TonB-Dependent Transporters

TonB-dependent transporters are a structurally homologous class of OM transport proteins that are distributed broadly among gram-negative bacteria. These transporters share three general regions (Figure 1); a carboxyl-terminal -barrel region that aids in maintaining structural integrity, a high-affinity globular domain (also known as the “cork” domain) with two loops of interest that binds to specific ligands at its external facing side and finally, a periplasmic facing side of the globular domain that interfaces with TonB at the TonB box, allowing for the system to be energized for active transport (Noinaj et al., 2010). Additionally, the periplasmic

8 facing side of the cork domain displays the TonB box motif, essential for TonB recognition and subsequent high-affinity transport across the OM (Kadner et al, 1990).

The model organism E. coli encodes eight distinct TBDTs, seven of which provide for iron transport, while the TBDT BtuB provides for the active transport of cobalamin across the

OM (Weiner et al., 2006). FepA is the only TBDT in E. coli that binds an [Fe3+]-complexed siderophore with E. coli origins (enterobactin), while the remaining E. coli TBDTs provide for the transport of other ferric chelates; Cir and Fiu bind a variety of catechol siderophores, including partial hydrolysis products of enterobactin (Nikaido and Rosenberg, 1990). FecA binds ferric citrate (Braun and Wagegg, 1981), and FhuE binds [Fe3+]-coprogen (Sauer et al, 1987).

ChuA is specific for heme binding and gene coding for this TBDT is typically present in pathogenic strains of E. coli (Nagy et al., 2001). The TBDT FhuA binds [Fe3+]-ferrochrome, the first siderophore to be discovered (Neilands, 1952) and is the subject of the research described in this thesis.

Figure 1. Structural components of TBDT. Ton-B dependent outer membrane receptor FhuA

(green) coupled with the surrounding components of the TonB energy transduction system. The

FhuA receptor is shown as a β-barrel, with a cork domain that can be opened and closed by the amino-terminal cork (dark blue). The ribbon structure represents the solved co-crystal structure of FhuA with carboxy terminal region of TonB (Pawelek et al., 2006) and the NMR structure of the ExbD periplasmic domain (Garcia-Herrero et al., 2007). ExbB and ExbD proteins form a complex that harnesses energy from the electrochemical potential of the CM for use by TonB to drive the active transport of iron complexes across TBDT. Adapted from Ivanov (2012).

The mature FhuA protein is composed of 723 amino acids, forming a 22 -stranded OM protein (Ferguson et al., 1998). Residues 14-160 form the amino-terminal “cork domain”, a globular domain which resides within in the -barrel, where it physically occludes the what would otherwise be an aqueous channel (Ferguson et al., 1998). At the extreme amino-terminus, residues 6-13 contain the conserved TonB box sequence, which undergoes conformational changes to signal ligand occupancy (Moeck et al., 1996). The cork domain mainly consists of four -sheets and features characteristic loop structures that play key roles in ligand binding and translocation (Ferguson et al., 1998). The binding of ligand at the cork domain is further stabilized by conserved amino acids within the inner-facing surface of the -barrel (Ferguson et al., 1998). Aromatic amino acids are predominantly utilized as binding residues for [Fe3+]- ferrochrome within FhuA. The solved crystal structure of FhuA indicates that the size of the cork domain is sufficient to block diffusion of [Fe3+]-ferrochrome and suggests the presence of a pocket to the side of the cork domain which may be involved in ligand transport into the cell

(Ferguson et al., 1998).

As noted above, and reviewed by Braun (2009), FhuA provides for the capture and active transport of [Fe3+]-ferrochrome, a hydroxamate siderophore produced by fungi and exploited by a wide range of gram negative bacteria, including E. coli. Investigations into the specific binding sites of FhuA led to the discovery that other ligands were capable of binding to FhuA including the “Trojan horse” antibiotic albomycin that mimics ferrochrome, the bacterial toxin

Colicin M and bacteriophages T1, T5 and 80 which utilized FhuA for entry into the cell

(Hantke and Braun, 1975). Entry of ligand via the FhuA channel is mediated by ligand binding to an external facing loop within the -barrel region called the gating loop (Killmann et al., 1995;

Ferguson et al., 1998; Zeth et al., 2008). The gating loop (residues 316-356) binds to ligand for

11 recruitment of ligand to specific binding site within in the barrel and subsequent entry across the outer membrane (Killmann et al., 1995). Interestingly, different ligands require interactions with different, specific residues within the gating loop. The bacteriophages T1, T5 and 80 require interactions with residues found in the 322-336 subdomain while ferrochrome and albomycin require interactions with residues 335-355 (Killman et al., 1998; Ferguson et al., 2000). The transport of ferrochrome also requires ligand interactions with a binding loop within the external facing side of the cork domain (Killman et al., 1997; Ferguson et al., 1998).

Studies involving site specific mutations in fhuA gene revealed differences between required binding sites within the cork domain for the bacteriophages T1, T5 and 80, thus leading to differences in E. coli sensitivity to these parasites (Braun et al., 2004; Bös et al, 1998).

Moreover, replacement of the cork domain of TBDT with cork domains from other bacterial species conferred transport of these bacteriophage as well as ferrochrome (Killmann et al, 2001).

Similarly, experiments with the TBDT FepA found that deletion of the amino-terminal cork domain resulted in loss of the ability to transport FepA specific ligands into the cell (Vakharia and Postle, 2002) further suggesting that sites in the cork domain of TBDT are required for ligand and TonB binding as well.

It is currently believed that two major conformational changes in FhuA are required for the active transport of FhuA specific ligands into the periplasm. The first is a consequence of ligand binding to the cork domain (Moeck et al., 1996) and the second takes place upon TonB binding to the TonB box (Eisenhauer et al., 2005). Both of these binding events aid in destabilizing the binding sites of the cork domain, allowing for dissociation of bound ligand and subsequent transport into the cell. The first of these allosteric changes, when FhuA is bound to ligand, results in several, smaller-scale conformational changes as elucidated by Ferguson et al.

(1998) in their description of x-ray crystallographic structure of FhuA bound to ligand. First, a hexapeptide sequence of hydrophobic residues at position 24-29 goes from a helix structure to an unwound coil when ligand is bound to FhuA. This “switch helix” is then positioned along-side the ligand binding site. The presence of these hydrophobic residues helps to destabilize ligand:FhuA interactions. Second, a tryptophan at position 22 of FhuA is localized to the opening of the pore after ligand binding where it may play a role in occluding the pore opening until

TonB binds to FhuA for active transport. Third, allosteric changes in FhuA when bound to ligand results in positional changes of external loops which are involved in initial recruitment of ligand to the FhuA binding site. This suggests additional ligand binding is likely prevented until bound ligand is transported into the cell. Finally, the TonB box is also moved upward into the barrel and this conformational change acts to “activate” the TonB box so that energized TonB can bind to FhuA in a fashion that energizes ligand transport.

The second major confirmation change required for ligand transport takes place upon

TonB binding to FhuA. The solved crystal structure of FhuA in complex with the carboxyl- terminus of TonB suggests that the carboxyl-terminal residues 155-165 are likely involved in binding to the TonB box of TBDT (Eisenhauer et al., 2005). This is consistent with earlier genetics studies (Heller et al., 1988; Günter and Braun, 1990; Kadner et al., 1990) and with a subsequent more precise mutational analysis of in vivo TonB:FhuA crosslinking (Vakharia-Rao et al., 2007). Once energized TonB is in complex with ligand-bound FhuA, TonB then energizes active transport of FhuA in a manner that is not fully understood. Studies of ligand-bound FhuA has led to two competing mechanical models for the vectoral transport and release of bound ligand into the periplasm.

The first model extends the “switch helix” scenario as described above (Moeck et al.,

1996): When FhuA binds ligand, the switch helix is positioned within the -barrel and acts to disrupt both the binding site and certain residues of the barrel itself (Ferguson et al., 1998). This may result in a widening of the barrel lumen, which would allow enough space for ligand to enter the periplasm (Eisenhauer et al., 2005).

The second model suggests that the amino-terminal domain of FhuA (including the cork domain) becomes partially, if not fully, displaced from the -barrel (Scott et al., 2000). During this displacement, the cork domain no longer obstructs the entrance into the periplasm and subsequent entry of the ligand via unidirectional diffusion may be permitted. Experimental evidence for this model is presently lacking (Wiener, 2005).

A variety of experimental strategies have been employed to dissect the mechanism of

TonB dependent transport, but a consensus has not been reached, primarily because in vitro physical data are not consistent with in vivo functional data, as reviewed by Postle and Larsen

(2007). Research in the subsequent decade has done little to reconcile this conflict. The research presented in this thesis provides a foundation for examining this question from a different angle, involving a phage-encoded protein called “Cor” that disrupts FhuA-mediated transport.

The Cor protein: categorization, function and the unknown

The two known phage that interact with FhuA and require TonB energization are T1 and

80 (Killmann et al., 1995 and 1998). These two phage are quite different, with T1 being a lytic phage and 80 being a temperate, lambdoid phage. Further, these phage require different recognition sites for attachment to FhuA within the cork domain (Killmann et al., 1995).

Interestingly, both phage share a highly-conserved gene (cor), that encodes the Cor protein.

When the cor gene is expressed in E. coli, host cells lose sensitivity to nearly all known FhuA specific ligands including ferrochrome, albomycin, the bacteriotoxin colicin M as well as T1 and

80; leading to host cell immunity (Matsumoto et al., 1985; Kozyrev and Rybchin, 1987; Uc-

Mass et al., 2004). Like T1 and 80, T5 also utilizes FhuA for entry into E. coli (Pedruzzi et al,

1998). Unlike T1 and 80 however, T5 does not require TonB energization for entry into the cell

(Braun et al., 1994). Remarkably, T5 utilizes similar binding regions within the gating loop as T1 and 80 but is somehow able to trigger its own release into the cell. Infection by 80 , T1 and T5 all result in loss of sensitivity of FhuA to FhuA specific ligands.

The 80 genome is 46.1 kb in length and contains 79 ORFs; with 51 of them corresponding to known or apparent functions including head/tail manufacturing, DNA packaging, infection process and its specificity, transcription regulation, phage DNA metabolism, cell lysis and additional miscellaneous functions (Rotman et al., 2012). Gene regions 21 and 25 of 80 function as two major tail fiber genes whose product are instrumental in the docking of 80 to host cell and subsequent release of genetic information. Genes homologous to 80 21 and 25 are found in other lambdoid phage as well (Rotman et al., 2012).

Unlike other lambdoid phage however, 80 encodes three gene located between 21 and 25 that are only present in phage that specifically utilize FhuA for E. coli entry. The precise function of

Gene 22 and 23 (referred to in the literature as gp22 and gp23) protein product has yet to be determined. However, putative sequence analyses suggest that gp22 and gp23 play a key role in determining FhuA specificity (Wietzorrek et al., 2006). Gene 24 (starting at 80 genome position 21298) is the gene for cor and is also present in HK022, N15 and ES18 lambdoid phage.

80 and T1 exhibit gene homology between three specific genes; corresponding to 80 gp22, gp23 and cor. The T1 genome is 48.8 kb in length and contains 64 distinct genomic regions, with

15 gene region 30 corresponding to cor gene (Robert et al., 2004). T1 is the only non-lambdoid phage categorized to date that codes for a functional Cor-type protein.

80 cor encodes for a 77 amino acid product containing 2 regions of interest. The first is an N-terminal (aa 1-16) leader sequence which is common among secretory bacterial lipoproteins, and can be further divided into 3 distinct subregions; a positively charged N- terminal region, a hydrophobic central region, and a C-terminal polar region that specifies a peptidase cleavage site (von Heijne et al., 1985). Cor protein contains a signal peptidase (SP) II recognition sequence (LTGC) at amino acids 13-16, which resembles the SPII consensus recognition site of LA(G,A)C (von Heijne et al., 1989). SPII cleaves the lipoprotein so that C16 becomes the +1 N-terminus and this same cysteine residue (while still in CM cell envelope) is simultaneously acylated (Wu, 1996). The remaining 61 amino acids (C-terminal aa 16-77 of full length Cor) defines the mature Cor protein sequence.

Preliminary studies of Cor predict that Cor is a lipoprotein that is trafficked to the periplasm and anchored to the inner leaflet of the OM (Ivanov, 2012). Evidence for Cor being a lipoprotein includes the aforementioned presence of a highly-conserved signal peptidase II recognition site for transport across the CM after translation and a carboxyl-terminal polar region that is consistent with known E. coli lipoproteins (Ivanov, 2012). The journey of Cor from translation in the CM to being lipid anchored to the inner leaflet of the OM is likely consistent with other lipoproteins in E. coli, involving Sec-dependent insertion of the nacent polypeptide into the CM, where phosphatidylglycerol/prolipoprotein diacyglycerol transferase attaches a lipid anchor, followed by prolipoprotein signal peptidase LspA cleavage of the amino terminal signal sequence (Goldberg and Liechti, 2012). The resulting lipoprotein is then loaded by the ABC Lol

CDE complex onto LolA, which ferries it across the periplasmic space to LolB on the

16 periplasmic face of the OM. LolB then mediates insertion of Cor into the OM. (Okuda and

Tokuda, 2011; Tokuda and Matsuyama, 2004).

Once anchored in the OM, the mature Cor protein likely interacts with the periplasmically available amino-terminal region of the FhuA cork domain (Uc-Mass et al., 2004;

Ivanov, 2012). However, where Cor specifically binds to FhuA, and how exactly this acts to block energized FhuA transport remains a mystery. Does binding of Cor protein prevent a conformational change that is required for FhuA transport? Does Cor cause a conformational change that shuts off the FhuA pathway? Does the Cor protein sterically occlude the opening through which ligand is transported into the cell? To provide a foundation to address these questions, more information regarding FhuA:Cor interaction is required. The data presented in this thesis aims to identify the specific Cor amino acid residues that are essential for its function.

By doing so, a better understanding of which the regions of Cor engage FhuA and what this might suggest regarding the mechanism of FhuA-mediated transport will be achieved.

Specific aims

Aim One: Verify that plasmids carrying the cor gene confer cor phenotypes.

Previously, recombinant plasmids containing wild-type cor gene (pRA033) and a cor gene derivative with an in-frame hexa-histidine-encoding modification at the 3’ end of the open reading frame (pRA038) were constructed. The phenotypes resulting from the expression of these genes in the E. coli strain W3110 will be determined relative to W3110 carrying the parent plasmid lacking the cor gene in order to establish baseline activities for subsequent testing of derivatives of these plasmids.

Aim Two: Identify conserved sequence elements among Cor proteins.

Using sequence alignment comparisons and algorithms that predict secondary structural features, amino acid residues having the potential to disrupt Cor function will be identified.

Amino acid residues representing possible structural features thought to be important for protein function, either as components that provide for appropriate folding, trafficking, and structural integrity of these proteins, or as interfaces for interaction with other proteins will be selected for investigation.

Aim Three: Test the role of conserved residues thought to be important for Cor function.

Using site-specific mutagenesis, amino acid residues identified in Aim Two will be altered and the resulting Cor derivatives will be tested for function. All mutations will code for alanine substitutions of the residues of interest. The R group of alanine is a methyl group, which is uncharged, relatively small, and has physical properties that differ from any of the target amino acids. Functional assays will be used to examine the impact of the engineered amino acid changes on Cor function.

CHAPTER II. MATERIALS AND METHODS

Media

Bacterial strains were cultured in Luria-Bertani formulation of lysogeny broth (“LB” =

450 µl 10N NaOH, 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 1 L ddH20) and on LB agar

(“LBA” =m LB + 16 g BactoAgar) (Miller, 1972). Both liquid cultures and agar plates were supplemented with 100 µg ml-1 ampicillin where required. 80 and Colicin B sensitivity assays were performed on tryptone (T = 10 g tryptone, 8 g NaCl and 15 g BactoAgar in 1 L ddH20) plates overlaid with cells suspended in T-top agar (T-top = 10 g tryptone, 8 g NaCl and 7.5 g

-1 BactoAgar in 1 L ddH20) (Miller, 1972) supplemented with 100 µg ml ampicillin and 0.01% w/v D-arabinose. All cultures were grown at 37°C, with liquid cultures shaken at 200-250 rpm for aeration.

80 and Colicin B preparations

The enterobacteria phage φ80vir was acquired from the laboratory of Dr. Kathleen Postle

(Pennsylvania State University), having come into her possession in the late 1970’s while a graduate student in the laboratory of William Reznikoff (University of Wisconsin). The earlier history of this phage is unclear, but sequence analysis (Ivanov and Larsen, unpublished) indicate that it is a mosaic of the original φ80 lysogen and an unknown phage(s). Phage stocks are grown from individual plaques on E. coli W3110 lawns, then expanded in broth cultures similarly to the method for growing phage λ using the protocol of Sambrook and Russell (2001), as adapted by

Cramer (MS Thesis, BGSU 2008). All assays were performed using 10-fold serial dilutions in T broth for φ80 sensitivity assays from a φ80 phage stock with a concentration 5x1012 pfu ml-1.

Colicin B was prepared by Kate Butler (Butler, 2013) from E. coli W3110 transformed with the plasmid pES3 (kindly provided by V. Braun; Max Planck Institute, Tübengin, Germany), which

19 bears the gene that encodes colicin B (Pressler et al., 1986). All assays were performed using 5- fold serial dilutions colicin B.

Bacterial strains and plasmids

The bacterial strains used in this study are listed in Table 1. All assays were performed using the K12 E. coli strain W3110 (Hill and Harnish, 1981), with cloning of plasmids containing cor gene derivatives performed in DH5 E. coli competent cells purchased from New

England Biolabs (New England Biolabs Inc, Ipswich, MA). The plasmids used in this study are listed in Table 2. The plasmid pRA033 was constructed by Ivanov (2012) using a polymerase chain reaction (PCR)-generated amplimer of the φ80 cor gene with primers that added EcoRI sites immediately flanking each side of the gene. The cor was restricted with EcoRI and inserted into a similarly restricted pBAD24 vector (Guzman et al., 1995) at the EcoRI site at position

1313 within the multi-cloning site. The plasmid pRA038 was similarly constructed; in this case the cor gene was amplified by PCR using with custom primers that added flanking EcoRI sites and nucleotides coding for in-frame expression of a hexa-histidine motif at the 3’ terminus of cor. For both pRA033 and pRA038, cor was inserted downstream of the arabinose promoter

(pBAD promoter) in the multicopy plasmid pBAD24 (Guzman, 1995) such that the start codon was 34 residues downstream from the transcription initiation site and 10 nucleotides downstream of Shine-Dalgarno sequence allowing for ribosomal binding. The pBAD promoter also acts as promoter for araC regulator gene, whose product acts as both an activator or repressor of pBAD activity based upon arabinose levels in the cell. Moreover, pBAD promoter allowed for targeted growth of cor gene product with addition of arabinose. pRA033 and pRA038 also carries a blaM gene which allows for selection of transformants on and maintenance of plasmids in ampicillin- containing media.

Table 1. Bacterial strains used in this study.

E. coli strain Relevant genotype Reference/Source

W3110 K12 E. coli rrnD rrnE inversion. Hill and Harnish, 1981.

DH5 F’ E.coli proA+B+ lacIq Δ(lacZ)M15 New England Biolabs, Inc. zzf::Tn10 (TetR)/fhuA2 Δ(argF-lacZ)U169 phoA glnV44 φ80 Δ(lacZ)M15 gyrA96 recA1 endA1 thi-1 hsdR17.

Table 2. Plasmids used in this study.

Plasmid Relevant genotype/phenotype Reference/Source pBAD24 araBAD promoter, araC, ampr (vector) Guzman et al., 1995. pRA033 pBAD24 derivative with wild type cor gene Ivanov, 2012. pRA038 pBAD24 derivative with cor gene having His6 Ivanov, 2012. tag at 3’ terminus pRA077 pRA033 (cor) derivative with C12A mutation Constructed during this study. pRA078 pRA038 (cor His6) derivative with C12A Constructed during this study. mutation pRA079 pRA038 (cor His6) derivative with E22A Constructed during this study. mutation pRA080 pRA033 (cor) derivative with R31A mutation. Constructed during this study. pRA081 pRA038 (cor His6) derivative with R31A Constructed during this study. mutation pRA082 pRA033 (cor) derivative with F45A mutation Constructed during this study. pRA083 pRA038 (cor His6) derivative with F45A Constructed during this study. mutation pRA084 pRA033 (cor) derivative with W47A mutation Constructed during this study. pRA085 pRA038 (cor His6) derivative with W47A Constructed during this study. mutation pRA086 pRA033 (cor) derivative with W49A mutation Constructed during this study. pRA087 pRA038 (cor His6) derivative with W49A Constructed during this study. mutation. pRA088 pRA033 (cor) derivative with F55A mutation. Constructed during this study. pRA089 pRA038 (cor His6) derivative with F55A Constructed during this study. mutation. pRA090 pRA033 (cor) derivative with C60A mutation. Constructed during this study. pRA091 pRA038 (cor His6) derivative with C60A Constructed during this study. mutation.

A araC ori ori araC

pRA033 pBAD pRA038 pBAD

4,846 bp 4,864 bp EcoR1 EcoR1 MCS MCS (1313) (1313) cor cor (234 bp) (252 bp)

blaM blaM

B +1 S.D …TACCCGTATCTTTTGGGCTAGCAGGAGGAATTC/ATG/AGA/AAA/CTG/ATT/ATC/CGC/ pBAD EcoR1 M R K L I I S ATG/GCA/GGC/GCT/GTC/ATG/CTT/ACA/GGA/TGC/GCT/GGC/GTA/ATT/GAG/ M T R A V M L T G C A G V I E AAA/CAG/GAA/CCA/GTT/TGC/AGC/GGC/ACT/GCA/ATC/GTT/GGC/GGT/CAG/ K Q E P V C S G T A I V G G Q GAA/ACT/ACG/GTT/CAG/ATT/TAC/GGT/GTG/CGT/AAA/CAA/AAC/AAC/CAG/ E T T V Q I Y G V R K Q N N Q ACG/CAG/TAC/CGG/GCT/GGA/TAC/CCT/TTC/AGC/TGG/CGC/TGG/GTA/AGT/ T Q Y R A G Y P F S W R W V S GCG/AAT/ACA/TTT/ACC/GAA/ACA/ACC/TGC/AAA/TAA/GAATTCACCAT… A N T F T Q T T C K STOP EcoR1 C +1 S.D …TACCCGTATCTTTTGGGCTAGCAGGAGGAATTC/ATG/AGA/AAA/CTG/ATT/ATC/CGC/ pBAD EcoR1 M R K L I I S ATG/GCA/GGC/GCT/GTC/ATG/CTT/ACA/GGA/TGC/GCT/GGC/GTA/ATT/GAG/ M T R A V M L T G C A G V I E AAA/CAG/GAA/CCA/GTT/TGC/AGC/GGC/ACT/GCA/ATC/GTT/GGC/GGT/CAG/ K Q E P V C S G T A I V G G Q GAA/ACT/ACG/GTT/CAG/ATT/TAC/GGT/GTG/CGT/AAA/CAA/AAC/AAC/CAG/ E T T V Q I Y G V R K Q N N Q ACG/CAG/TAC/CGG/GCT/GGA/TAC/CCT/TTC/AGC/TGG/CGC/TGG/GTA/AGT/ T Q Y R A G Y P F S W R W V S GCG/AAT/ACA/TTT/ACC/GAA/ACA/ACC/TGC/AAA/CAT/CAT/CAT/CAT/CAT/CAT/ A N T F T Q T T C K H H H H H H TAA/GAATTCACCAT…

STOP EcoR1

Figure 2. Construction of pRA033 and pRA038 vectors. A. Map of vectors constructs with relevant features. B. pRA033 vector; MCS region including inserted wild-type cor gene. The cor gene was inserted into MCS of pBAD24 (Guzman et al., 1995) vector at EcoRI site at position

1313. C. pRA038 vector; MCS region including inserted cor gene with an additional 6-His tag immediately following K77. The cor gene start codon is positioned 10 nucleotides away from the start of the Shine Dalgarno sequence allowing for ribosomal binding. Abbreviations: ori

(orange), origin of replication; MCS (yellow), multicloning site; +1, site of initiation of transcription; S.D, Shine-Dalgarno sequence, blaM, ampicillin resistance gene (dark blue).

PCR, ligation, cloning and DNA sequencing

Custom primer combinations (Table 3) targeting specific sites within the cor gene were synthesized by Invitrogen (Thermo Fisher Scientific Corp. Waltham, MA) and used to generate

PCR amplimers using a Bio-Rad T100 Thermal Cycler (Integrated DNA Technologies,

Coralville, IA). Reactions consisted of approximately 1-10 ng of plasmid containing cor gene, 50 pmol each primer, 10 nM each dNTP, 2.5 units 5X Long Amp Taq reaction buffer (New England

Biolabs Inc, Ipswich, MA), and 0.1 units Long Amp Hot Start Taq DNA polymerase (New

England Biolabs). The amplification protocol cycled through the following steps: an initial melting at 94°C for 1 min, 34 cycles of 94°C for 30 sec, 55°C for 45 sec, 65°C for 6 min; with a final extension incubation of 65°C for 10 min. The completed reaction mixtures were then digested with 1 unit of DpnI/l reaction mixture (New England Biolabs) at 37°C per manufacture’s protocol to degrade methylated DNA, thereby targeting the DNA of the original plasmid. Products were then resolved by electrophoresis through 1% agarose gels in 0.5X Tris- borate EDTA buffer (45 mM Tris-borate, 1 mM EDTA; Maniatis et al., 1982). Samples that were found to contain 4.8 Kb amplimers (size of plasmids) were purified using QIAquick PCR

24 purification kit (QIAGEN, Valencia, CA), as per the manufacturer’s protocol. Purified products were stored at -20°C.

Table 3. Custom primers used in this study*.

Primer Name Purpose Sequence (5’-3’). Additional changes to plasmid (purpose of change) ORA0707 Forward CCAGCACGTTAACCAGTTGCT HpaI site insert (ligation) Primer C12A AGCGGCACTGCAATCGTTGGC NheI site insert (verification) ORA0708 Reverse GGACGAGAGGCCTGTTTCTCA StuI site insert (ligation) Primer C12A ATTACGCCAGCGCATCC ORA0711 Forward GTGCGTAAAGTTAACAACCAG HpaI site insert (ligation) Primer R31A ACGCAGTACCGGGCTGG ORA0712 Reverse CTGGTTCAGCTGAGCACGCAC PvuII site insert (ligation) Primer R31A ACCGTAGATCTGAACCGT BglII site insert (verification) ORA0714 Reverse GGGCTGAATACGTATCCAGCC SnaBI site insert (ligation) Primer W47A CGGTACTGCGTCTGG EcoRV site deletion and W49A (verification) ORA0715 Forward GGCTGGAAGGCCTTTCAGCGC StuI site insertion (ligation) Primer W47A TCGCTGGGTAAGTGCG ORA0717 Forward GGCTGGAAGGCCTTTCAGCTG StuI site insertion (ligation) Primer W49A GCGCGCTGTAAGTGCG ORA0720 Reverse GGACTTGGCCAGCGCCAGCTG MscI site insertion (ligation) Primer F55A AAAGGATATCCAGCCCGGTAC and C60A TG ORA0721 Forward GGCGCTACGTAAGCGCTAATA SnaBI site insertion (ligation) Primer F55A CAGCTACCGAAACAACCTGCA AfeI site insertion AA (verification) ORA0722 Forward GGCGCTACGTAAGCGCTAATA SnaBI site insertion (ligation) Primer C60A CATTTACCGAAACAACCGCTA AfeI site insertion AA (verification) ORA0723 Reverse GGCCAACGACAGCTGAGCCGT PvuII site insert (ligation) Primer E22A GCAAACTGGTTCCTGTTTCTC ORA0724 Forward GGGCATGGCCATCGTTGGCGG MscI site insertion (ligation) Primer E22A TCAGGCTACTACTGTACAGAT BsrGI site insertion T (verification) ORA0727 Reverse GGCACGTGTTTACGCACACCG PmlI site insert (ligation) Primer TAAATCTGAACCGTAGTTTCC F45A TG ORA0729 Forward GGTTAACAACCAGACGCAGTA HpaI site insert (ligation) Primer F45A CCGGGCTGGTTATCCTGCTAG EcoRV site deletion C (verification) *These primers were used to introduce site specific mutations in the cor+ plasmid while also

adding specific restriction enzyme sites that were used for circularization of plasmid during

ligation (green) and verification of the mutation (red where appropriate).

For transformations, 1 l circularized DNA product (approximately 10 ng) were added to

20 l DH5 E. coli competent cells (New England Biolabs). Transformations were performed following manufacture’s protocol and were spread on lysogeny broth (LB) agar plates with added 100 µg ml-1 ampicillin. At least 4 colonies were selected from each plate and subcultured on LB agar plates with 100 µg ml-1 ampicillin to streak for isolation. After overnight incubation,

3 colonies were inoculated in LB broth with 100 µg ml-1 ampicillin and incubated for 16 hours at

37°C with shaking. Plasmids were isolated using alkaline lysis procedure followed by phenol:choloroform extraction and subsequent ethanol wash as described by Maniatis et al.,

1982.

Plasmids were analyzed for mutations in the cor gene by digestion with appropriate verification restriction endonuclease (Table 3) and visualization of bands on 1% agarose gels.

For each cor derivative, a unique band pattern was visualized. Wild-type cor plasmid and cor plasmid with His6 tag (pRA033 and pRA038) were also digested with verification restriction enzyme and visualized on 1% agarose gels as negative controls. Mutant plasmids that exhibited the expected band pattern were sequence verified at the DNA Sequencing and Genotyping

Facility at the University of Chicago Comprehensive Cancer Center using Sanger dideoxy sequencing.

Figure 3. Overview of site-specific mutagenesis strategy. pRA033 and pRA038 were used as template DNA and a set of SNPs are induced using a PCR strategy specific to the amino acid of interest. Mutant PCR products were then circularized at a specific site and transformed into E. coli competent cells and grown on LBA supplemented with 100 µg ml-1 ampicillin. Plasmid DNA was then purified from these cells and screened for the desired mutation by restriction endonuclease analysis. Those that were successfully screened were then sequenced to confirm mutation and transformed into W3110 E. coli cells for phenotyping via spot titer assay.

Phenotyping Cor derivatives

Once sequence verified, plasmid containing cor mutation were transformed into W3110

E. coli cells (fhuA+) using a modified version of Chung et al., (1989) TSS procedure as follows:

W3110 cells were grown overnight in LB broth at 37°C with shaking. A 200 l aliquot of the overnight W3110 was subcultured into 5 mL LB broth and incubated at 37°C with shaking until early exponential phase was reached (optical density of 0.3-0.4 at an absorbance of 550 in a

Spectronic 20 spectrophotometer with a pathlength of 1.5 cm). A 1 l aliquot of plasmid

(approximately 1-10 ng) was added to 20 l of early-exponential phase W3110 cells and incubated on ice for 30 min. The mixture was then heat shocked at 42°C for 30 sec, incubated on ice for 5 min, and 750 l S.O.C. (0.5% Yeast Extract, 2% Tryptone, 10 mM NaCl, 2.5 mM KCl,

10 mM MgCl2, 10 mM MgSO4, 20 mM Glucose) was added and mixed. The mixture was then incubated at 37°C for 1 hr. A 100 l aliquot was were spread on a single LB with 100 µg ml-1 ampicillin plate, which were then incubated at 37°C overnight. At least 4 colonies were selected from each plate and subcultured on LB agar plates with ampicillin to streak for isolation. After overnight incubation, 3 colonies were inoculated into LB broth with ampicillin and incubated for

16 hours at 37°C with shaking.

Spot-titer assays for determining relative activities of colicins and bacteriophage were performed as previously described (Larsen et al, 2003). Briefly, serial 5-fold dilutions of colicin

B preparations and 10-fold serial dilutions of 80 bacteriophage (stock concentration of 5x1012 pfu/ml) were applied as 5 µl aliquots to lawns of W3110 cells containing the indicated plasmids that had been grown to early exponential-phase in T-broth, then plated on T-plates as 100 µl aliquots suspended in 3 ml of T-top agar supplemented with 0.01% w/v D-arabinose and 100 µg ml-1 ampicillin as indicated. Following the application of colicin or bacteriophage dilutions, the

29 plates were incubated at 37˚C for 16 hours and then visually scored for clearing of the lawn. 80 bacteriophage specifically requires FhuA for entry and subsequent infection of E. coli cells.

Sequence analyses

Mature 80 Cor secondary structure prediction was achieved using Jpred4 Protein

Secondary Structure Prediction Server (Drozdetskiy et al., 2015) and further elucidated via sequence gazing. Mature 80 Cor sequence (aa 16-77, resulting in a final length of 61 residues) was then compared to GenBank entries in the National Center for Biotechnology Information

(NCBI) database. BLASTp was used with default parameters and Cor ortholog sequences identified. Cor orthologs were aligned with Cor sequences from 80 and T1 bacteriophage.

Multiple sequence alignments were curated for subsequent analyses. Both closely and distant related Cor orthologs were used to provide consensus sequence and conservation of each amino acid residue was calculated.

CHAPTER III. RESULTS

Establishing controls for evaluating Cor functionality

Plasmids pBAD24, pRA033 and pRA038 (Table 2) were transformed into W3110 E. coli cells. The resulting transformants were then phenotypically tested for Cor functionality using spot titer procedure that determines 80 bacteriophage and colicin B resistance (Table 4 and

Figure 4). For cells carrying pBAD24, lysis was observed out to the 10-7 dilution. Because the starting concentration of 80 was 5 x 1012 pfu and 5 µl of each dilution was applied, this indicates that 2.5 x 103 pfu of 80 are sufficient to produce lysis. In contrast, cells carrying plasmids expressing either the wild type or the his-tagged cor gene, plasmids pRA033 and pRA038 respectively, were resistant to undiluted 80 as there was no evidence of lysis even using undiluted phage. Thus, as expected, cells carrying the empty pBAD24 vector remained susceptible to 80 infection, whereas cells carrying the cor+ plasmids were resistant to 80 infection. The presumed mechanism of resistance is that Cor protein blocks transport of 80 through FhuA.

Cells carrying any of the three plasmids were sensitive to colicin B. Because colicin B uses a different TBDT (FepA), this indicates that Cor-mediated inhibition is specific for FhuA.

The bacteriophage and colicin B profiles established here for the bacteria carrying the empty vector and those carrying plasmids expressing wild type or his-tagged Cor protein served as negative and positive controls for Cor function. They were used as a reference point for evaluating the activities of the Cor mutant proteins.

Table 4. Preliminary resultsa

Plasmid 80 Colicin B pBAD24 -7,-7,-7b -5,-5,-3 pRA033 R,R,R -5,-3,-5 pRA038 R,R,-1 -5,-5,-5 aSpot tests were performed in triplicate. bThe numbers recorded are as the exponent of the greatest 10-fold dilution of 80 and greatest 5- fold dilution of Colicin B for which a zone of clearing was observed. cR indicates resistance (no zones of clearing were observed).

Figure 4. Preliminary data. Images of plates showing of 80 spot titering on lawns of E. coli

W3110 with (from left to right) the empty plasmid vector pBAD24, plasmid pRA033 expressing wild type Cor, and plasmid pRA038 expressing the his-tagged version of Cor. All lawns were prepared by suspending the cells in T-top supplemented with 0.01% w/v arabinose and 100 µg ml-1 ampicillin, with the T-plates also containing 0.01% w/v arabinose and 100 µg ml-1 ampicillin.

Sequence analyses results

Computational analyses of mature 80 Cor protein via Jnet revealed four predicted extended regions consistent with -sheet structure within Cor at positions 12-18, 24-31, 35-40, and 48-51. Predictions of potential -helix structures was performed using Lupas algorithms, resulting in no hits. Finally, Jnet was used to determine sites of buried residues (not localized to the outer facing surface of the protein) and revealed residues with 25% solvent accessibility

(Jnet_25) as well 5% and 0% solvent accessibility (Jnet_5 and Jnet_0 respectively) with reliability of each residue scored. Predicted -sheet architecture was further supported by a high number of proximal valine:isoleucine residues which have a greater propensity towards -sheet formation than -helices (Fujiwara et al., 2012). Additionally, proline residues are typically not found in -helices, and so where present in Cor they are thought to define two disordered regions at positions 10 and 44. Jnet analysis revealed no particular secondary structure for the N-terminal region of Cor; which may act as a spacer region between interfacing with the OM at C1 and interacting with FhuA downstream. Concurrently, Jnet analysis revealed no particular secondary structure for the C-terminal region of Cor; which may function to help stabilize Cor:FhuA interactions. These predictions alone are insufficient to define which residues are essential to Cor function, and so additional sequence analyses were performed to determine potential residues of interest.

Figure 5. Secondary structure predictions. A. Mature 80 Cor sequence analyses and B. T1

Cor sequence analyses via Jnet secondary structure prediction algorithms revealed stretches of extended region consistent with beta-sheet structure (indicated as E) and revealed no stretches of alpha-helices (as indicated using Lupas algorithms). Jnet_25,5,0 indicated individual amino acids predicted to be buried (indicated as B) with solvent accessibilities of 25%, 5% and 0% respectively. Reliability of buried residue prediction was indicated on a scale 1-9 with 9 being of highest confidence.

Determination of residues of interest

BLASTp searches with mature 80 Cor sequence yielded over 200 hits that included bacterial sequences from a wide array of species. Presumably, bacterial genomic sequences were identified by virtue of the presence of prophages. Of these hits, a final list of 22 (Table 5) representing both close and distant phylogenetic relationships to 80 Cor was generated and used to construct a consensus sequence (that included 80 and T1 mature Cor sequences), with percent conservation calculated (Figure 6). Sequence identity varied between 80 Cor and Cor orthologs ranging between 98%-31% sequence identity. This was determined to give an optimal consensus sequence as a consensus sequence built from only highly identical sequences would not have produced a sequence that would reveal non-essential residues as may pertain to Cor phenotype; and a consensus sequence built from only sequences of low similarity to Cor may not have produced an amino acid sequence that was indicative of functional Cor protein. When comparing the 61 residues of mature 80 Cor sequence to curated sequences from BLASTp to form a consensus sequence, 26 residues were conserved among the proteins at a level of 75% or greater. All aliphatic, non-polar residues were eliminated from further study as these residues typically do not play key roles in direct interaction with other proteins, and are often localized to the inner facing surface of the protein where they contribute to stability via hydrophobic interactions. Concurringly, Jnet analysis predicts all but one of these aliphatic, non-polar residues

(G20) are buried.

The remaining were further narrowed down by considering the T1 sequence, as T1 phage are known to block FhuA mediated transport upon infection of E. coli cells. Furthermore,

T1 shares only 31% sequence identity to 80 Cor sequence. It was thus assumed that residues shared by both the consensus and T1 sequence would be more likely to indicate essential

residues for Cor function. This process eliminated residues Q21 K32 Q36 T37 and Y39 as they are replaced with A21 M32 E36 M37 and L39 in T1 sequence. Finally, C1 is acylated as part of the trans- cytoplasmic membrane trafficking mechanism and is involved in interacting with the inner leaflet of the OM, so any mutations to that residue would presumably address the role of the acylated residue in the appropriate partitioning of Cor, rather than Cor function itself. Thus, a final pool of 10 residues of interest were identified: E22, R31, K32, Y39, R40, F45, W47, W49, F55, C60.

Among these 10, 8 were further investigated in this thesis. Additional rationales for the 8 selected amino acids are as follows:

C12, C60: Cysteine residues are capable of forming disulfide bonds that may play a role in

Cor protein tertiary and/or quaternary structure. Sequence analysis of FhuA reveals no periplasmically-available cysteine residues. However, these cysteines may play an important role as either an intrastrand bond or act as part of a heteromultimer, forming a dimer with an additional Cor protein. An intra-strand bond would give more information on the folding of Cor and how this relates to its function. A heteromultimer may indicate the need for dimerization and further our understanding on how Cor functions.

E22, R31: Negatively or positively charged amino acids may play a role in forming a salt bridge either within the Cor protein or with FhuA.

W47, W49: Two closely associated bulky aromatic residues that are separated by a single amino acid. The two tryptophan residues may play a role in sterically hindering entrance of bound ligand across the FhuA channel in a mechanism similar to the FhuA residue Trp22 upon ligand binding. These tryptophan residues may also play a role in placing the middle arginine residue in a favorable position to contribute to either an intra-strand or inter-strand salt bridge, potentially directly interacting with FhuA.

F45, F55: Surface available phenylalanine residues may act in resonance stacking due to pi-orbital features of aromatic residues. This would require proximity of phenylalanine residues either to each other or to other aromatic residues. This feature may indicate phenylalanine residues important in stabilizing intrastrand bonds (and by extension, helping to define Cor architecture) within Cor or interaction between Cor and FhuA.

Table 5. Putative prophage hits from BLASTp sequence analysis*.

Accession Number Taxa Strain Name % Identity with 80 Cor

WP_047344600 Enterobacter kobei ATCC BAA-260 98.3%

WP_063855460 Enterobacter cloacae BIDMC 33A 95.1%

WP_077064174 Enterobacter cloacae WCHECI-C4 90.2%

WP_059445235 Enterobacter asburiae B1-3 90.2%

WP_064326447 Lelliottia amnigena CHS 78 90.2%

EGK63255 Enterobacter hormaechei ATCC 49162 85.3%

WP_058662431 Enterobacter hormaechei CIP 103441 83.6%

WP_058648233 Enterobacter hormaechei EN-314 83.6%

WP_040017206 Enterobacter ludwigii CCUG 51323 77.0%

WP_057696354 Escherichia coli CD301 82.0%

ASV55564 Lelliottia jeotgali PFL01 72.3%

WP_049848435 Trabulsiella odontotermitis BCRC 17577 77.0%

WP_087713525 Enterobacter xiangfangensis 10-17 60.6%

WP_015976802 Salmonella enterica ATCC BAA-1577 66.7%

WP_101453192 Serratia marcescens 448 68.3%

WP_071696715 Citrobacter freundii 47N 61.0%

WP_072277505 Erwinia persicina NBRC 102418 65.0%

WP_071557824 Klebsiella pneumoniae 11227-1 62.9%

WP_015689748 Rahnella aquatilis ATCC 33071 60.3%

WP_072271919 Citrobacter freundii GTC 09479 60.0%

WP_088219554 Enterobacter kobei ATCC BAA-260 51.6%

OJO77810 Escherichia coli BK327_13430 42.2%

*BLASTp searches with mature 80 Cor protein resulted in over 200 hits which were manually curated, resulting in these 22 putative prophage sequences.

Figure 6. BLASTp multiple sequence alignment. Mature 80 Cor Protein (aa 16-77) along with T1 Cor sequence and Cor othologs found in bacterial species (putative prophage). Starting at C15 of full Cor sequence (N-terminal amino acid of mature Cor) sequences are aligned with consensus and percent conservation calculated.

Table 6. Spot titer assay resultsa.

Plasmid Cor derivative 80 Col B pBAD24 None -7,-7,-7b -5,-5,-3 pRA033 Wild-type Cor R,R,R -5,-3,-5 pRA038 Cor His6 R,R,-1 -5,-5,-5 pRA077 pRA033 C12A -6,-6,-5 -3,-3,-5 pRA078 pRA038 C12A -6,-6,-6 -3,-3,-3 pRA079 pRA038 E22A -4,-5,-4 -5,-5,-5 pRA080 pRA033 R31A -7,-8,-7 -5,-5,-5 pRA081 pRA038 R31A -7,-7,-8 -5,-5,-5 pRA082 pRA033 F45A R,R,R -5,-5,-5 pRA083 pRA038 F45A -1,-1,-1 -5,-3,-5 pRA084 pRA033 W47A -4,-5,-4 -5,-5,-3 pRA085 pRA038 W47A -5,-6,-5 -5,-5,-5 pRA086 pRA033 W49A -5,-5,-6 -5,-5,-5 pRA087 pRA038 W49A -5,-5,-5 -5,-5,-5 pRA088 pRA033 F55A -7,-7,-8 -5,-5,-5 pRA089 pRA038 F55A -8,-7,-7 -5,-5,-5 pRA090 pRA033 C60A -6,-6,-7 -5,-5,-3 pRA091 pRA038 C60A -6,-6,-6 -5,-3,-5 aAll tests were performed in triplicate. R indicates resistance to infection. bThe numbers recorded are as the exponent of the greatest 10-fold dilution of 80 and greatest 5- fold dilution of Colicin B for which a zone of clearing was observed.

Given that wild-type Cor protein blocks FhuA entry, screens using serial dilutions of 80 demonstrated Cor’s ability to retain/lose wild-type phonotype when an amino acid of interest was changed by measuring the efficiency of 80 infection when exposed to W3110 E. coli cells with expressed cor derivative. Colicin B is a bacterial toxin that specifically binds to a different

E. coli TBDT (FepA) for entry and subsequent infection, and acts as a negative control; demonstrating that Cor does not block function of other TBDT nor does it interfere with TonB energization. The function of each Cor mutant protein was evaluated by a spot titer assay of sensitivity to 80 and colicin B (Table 6). Data from the preliminary results were used for comparison. As expected, cells with all plasmids were sensitive to colicin B infection, confirming Cor functions independent of TonB nor does Cor affect other E. coli TBDTs. Based upon the 80 sensitivities of E. coli W3110 with plasmids encoding mutant Cor proteins, the mutations could be categorized as rendering the protein non-functional, partially functional, or fully functional.

Complete loss of Cor phenotype

A complete loss of the Cor protein phenotype was considered to be 80 sensitivity to

10-6 – 10-8 (corresponding to 2.5 x 104 to 2.5 x 102 pfu required for clearing) of plasmid-bearing bacteria which was the range of pBAD24 plasmid with no Cor present (10-7 = 2.5 x 103 pfu required for clearing). These derivatives include C12A (pRA077 and pRA078), R31A (pRA080 and pRA081), F55A (pRA088 and pRA089) and C60A (pRA090 and pRA091). W3110 cells with plasmid containing C12A and C60A Cor derivatives display similar susceptibility to 80 infection, indicating likely disulfide bridge formation between the two residues. This is further supported given that neither FhuA nor TonB contain a periplasmically available cysteine residue for sulfide bonding. Interestingly, residues C12 and C60 both flank predicted extended regions of

41 the -sheets and a disulfide bridge between these two cysteines would fold Cor; localizing extended regions close to each other with potential sheet stacking. Intrastrand bond between residues C12 and C60 would also mandate these residues be inner facing and would not be available for multimerization with other Cor proteins. However, multimerization of Cor proteins may yet play an important role in blocking FhuA function.

The presence of a negatively charged residue at position 31 is a hallmark of Cor and Cor orthologs. Sequence analysis revealed the R31 residue to be present among nearly all Cor orthologs, with the few exception substituting a lysine residue (including T1 Cor sequence) at the same position. Secondary structure prediction suggested R31 to be exposed to the surface, supporting interstrand binding with another protein. Moreover, FhuA entails periplasmically accessible positively charged residues which may form a salt bridge with R31. Results of R31A functional assay (pRAO80 and pRA081) supports R31 importance as substitution with an alanine results in loss of Cor function. Though R31 may form a key interaction between Cor and FhuA, why this interaction is specific between FhuA and Cor remains a mystery as other TBDTs contain periplasmically accessible positively charged amino acids as well.

Spot titer assay results indicates F55A (pRA088 and pRA089) leads to loss of Cor function. Secondary structure predictions suggest F55 to be inner facing and likely interacts with other Cor residues via resonance effects. This suggests the possibility that F55 is required for proper Cor folding and may act to place charged residues in an optimal space as to promote

Cor:FhuA binding. The importance F55 element may also include formation of confirmation required for induced-fit binding to chaperone proteins or FhuA or promotion of a more ordered secondary structure upon potential binding to OM or FhuA.

Partial loss of Cor phenotype

A partial loss of the Cor protein phenotype was determined by mutants who showed 80 sensitivity out to 10-1 – 10-5 (corresponding to 2.5 x 109 to 2.5 x 105 pfu required for clearing) is inconsistent with either the absence of Cor protein (pBAD24) or presence of Cor protein

(pRA033 and pRA038). These derivatives include W47A (pRA084 and pRA085), W49A

(pRA086 and pRA087 and E22A (pRA079). One possible explanation for two conserved tryptophan residues was to sterically occlude the entry of FhuA; which would perform a similar role to Trp22 of FhuA upon ligand binding. Additionally, T1 Cor substitutes tryptophan residues at positions 47 and 49 with other bulky residues (phenylalanine and tyrosine respectively). Bulky amino acids at this position may aid in optimize conformational changes and/or or binding events required for Cor:FhuA interactions but substitution of an alanine at either position is insufficient to decrease 80 infection sensitivity to observed pBAD24 levels (no cor gene). The E38A substitution was predicted to be surface available and was a candidate for salt bridge formation with FhuA. These data suggest that E38 does not play a crucial role in binding of Cor to FhuA, however it may aid in stabilization of Cor to FhuA or the OM via a secondary ionic bond or stabilization by hydrogen bonding.

No loss of Cor phenotype

Spot titer results of F45A derivative revealed similar phenotype as wild-type Cor protein.

This residue was shown not play a functional role in Cor activity and thus provides little insight on which amino acids are responsible for Cor phenotype.

CHAPTER IV. DISCUSSION AND CONCLUSION

Discussion

Cor protein is encoded by the temperate bacteriophage 80 and specifically targets/blocks the TBDT FhuA. T1 (lytic phage) also encodes for a Cor type protein, with presumed similar function to 80 Cor but only shares 31% sequence similarity to the 80 variety. Initial studies of Cor pointed to conversion resistance from lysogeny to lytic cycles as the purpose of cor gene conservation (Kozyrev and Rybchin., 1987). This cannot be true for T1 or other potential putative prophage which do not undergo lysogenic maintenance. A possible explanation is that, upon cell lysis, newly manufactured phage must first navigate through the immediate debris field before finding another cell to infect. Included in this debris field would be

FhuA proteins to which newly formed 80 or T1 could bind and potentially inject their genetic material into open space. By coding for a protein that specifically bind and blocks FhuA, newly synthesized virus has an increased chance of navigating through immediate debris to find other cells. In this way, Cor is advantageous to these phage and cor remains a conserved gene product.

In this thesis, the structure of Cor is illuminated via sequence analyses of 80 Cor, T1

Cor and orthologs; and by functional assays of Cor derivatives containing substitution of an amino acid of interest to alanine. Results of this study predicts Cor to exhibit -sheet secondary structure with potential stacking of extended regions atop one another. Functional assays of C12A and C60A derivatives suggest disulfide bridge formation between the two would place extended regions in close proximity, revealing an important aspect of both secondary and tertiary Cor structure. Spot titer assay identified residue R31 as a top candidate for direct Cor:FhuA interaction. All analyzed Cor sequences contain either an arginine or lysine residue at position

31. It is unlikely however that all analyzed Cor sequences display Cor phenotype as large

44 sequence dissimilarities between 80 cor and other analyzed sequences exists. Thus, differences in Cor functionality may be indicative of Cor’s ability to adopt a certain conformation rather than its ability to conserve residues responsible for Cor:FhuA binding.

Phenylalanine residues at positions 45 and 55 were 96% and 100% conserved among observed sequences respectively and both were predicted to be buried. However, F45 mutation resulted in no change to Cor phenotype while F55 resulted in loss of phenotype. One potential interpretation of this discrepancy between the two phenylalanines involves disulfide bridge between C12 and C60 which would fold Cor in a manner that would be conducive to beta-sheet stacking. In this hypothetical model, F55 may be involved in resonance stacking with other aromatics. Based on functional assays, it is unlikely these resonance interactions would occur with W47 or W49 as changing these residues to alanine did not reflect similar loss of function.

Interactions between F55 and FhuA remain a possibility; or F55 may only a play an essential role in maintaining proper protein structure.

Tryptophan residues at positions 47 and 49 were hypothesized to physically block FhuA opening, based upon FhuA crystallization data revealing W22 of FhuA is localized to the pore opening prior to TonB energization and subsequent entry of ligand into the periplasm (Ferguson et al., 1998). The spot titer results for derivatives W47A and W49A revealed only a partial loss of

Cor phenotype, thereby eliminating this possibility as an essential Cor mechanism. Along with

E22, these three amino acids likely aid in adopting conformations which optimize Cor function but are not required for Cor function.

Secondary structural analysis predicted -sheet secondary structures and results from functional assays C12 and C60 derivatives are consistent with an intrastrand disulfide bridge between these two residues. Together, the data allows for the first indication of Cor tertiary

45 structure; a complex of 4 extended regions which form an overlapping stack of -sheets. At 61 amino acids in length, the small size and specific structure of Cor likely causes an allosteric change in FhuA via an induced fit mechanism at a periplasmically available region. Based on conserved sequences, it is also likely that the Cor phenotype in putative prophage is based upon the ability of Cor to assume the proper conformation, as opposed to the presence (or absence) of residues involved in potential salt bridge formations with FhuA or residues involved in sterically occluding FhuA pore opening.

The “expansion” model and the cork displacement model are two competing theories that help describe TBDT mechanisms upon TonB binding. Results presented in this study favor the expansion model above cork displacement. FhuA contains a network of nearly 60 hydrogen bonds and 9 salt bridges that help to tether the cork domain to the inner surface of the -barrel

(Locher et al., 1998). It is unlikely that TonB transfers enough energy to shear this network of bonds as to allow the cork domain to be temporarily displaced. Moreover, a cork displacement event would likely require additional proteins for FhuA remodeling, a phenomenon which has not been observed. Cor is a small lipoprotein that is predicted to bind at a specific FhuA location, thereby preventing a necessary conformational change in FhuA. Cor preventing access through a specific channel to the side of the cork domain is physically and thermodynamically a more plausible rationale.

Conclusion

This thesis provides a basis to better understand Cor structure, how Cor functions mechanistically and how Cor interacts with FhuA. Cor derivatives were designed, constructed and transformed into W3110 E. coli cells to test for Cor derivative function. In parallel with sequence analyses, an induced-fit model between Cor and FhuA emerged. For future studies, Cor

derivatives with added His6 tag can be purified via nickel exchange column and analyzed via

NMR for more structural information. X-ray crystallographic analysis of co-precipitated Cor bound to FhuA would provide a more detailed look of Cor mechanism. Another future study should include testing cor derivatives that exhibited partial Cor phenotype under differing temperatures as it may give an indication how important these residues are for overall Cor stability.

REFERENCES

Archibald, F. 1983. Lactobacillus plantarum, an organism not requiring iron. FEMS Microbiol.

Lett. 19:29-32.

Blount, ZD. 2015. The natural history of model organisms: The unexhausted potential of E. coli. eLife

2015;4:e05826. DOI: 10.7554/eLife.05826. (Cited as requested by publisher).

Bos, C., Lorenzen, D., V. Braun. 1998. Specific in vivo labelling of cell surface-exposed protein loops:

Reactive cysteines in the predicted gating loop mark a ferrochrome binding site and a ligand-

induced conformational change of the Escherichia coli FhuA protein. J. Bacteriol. 180:605-

613.

Bradbeer, C. 1993. The proton motive force drives the outer membrane transport of cobalamin in

Escherichia coli. J. Bacteriol. 175:3146-3150.

Braun, V. 2009. FhuA (TonA), the career of a protein. J. Bacteriol. 191:3431-3436.

Braun, V., Gaisser, S., Herman, C., Kampfenkel, K., Killman H., Traub, I. 1996. Energy-coupled transport

across the outer membrane of Escherichia coli: ExbB binds ExbD and TonB in vitro, and leucine

13 in the periplasmic region and aspartate 25 in the transmembrane region are important for ExbD

activity. J. Bacteriol. 178:2836-2845.

Braun, V., Killmann, H., Hermann, C. 1994. Inactivation of FhuA at the cell surface of Escherichia coli

K-12 by a phage T5 lipoprotein at the periplasmic face of the outer membrane. J. Bacteriol.

176:4710-4717.

Braun, V., and Kilmann, H. 1994. Energy-dependent receptor activities of Escherichia coli K-12:

mutated TonB proteins alter FhuA receptor activities to phages T5, T1, phi 80 and to colicin M.

FEMS Microbiol. Lett. 119:71-76.

Braun, V., Schaller, K., Wolf, H. 1973. A common receptor protein for phage T5 and colicin M in the

outer membrane of E. coli B. Biochim. Biophys. Acta. 323:87-97.

Butler K. 2013. Functional complementation of ExbD. E. coli by homologous ExbD genes. MS Thesis,

Bowling Green State University, Bowling Green, Ohio.

Chakraborty R., Lemke, EA., Cao, Z., Klebba, PE., Helm, D. 2003. Identification and mutational studies

of conserved amino acids in the outer membrane receptor protein, FepA, which affects transport

but not binding of ferric enterobactin in Escherichia coli K-12. Biometals. 16:507-518.

Chung, CT., Neimela, SL., Miller, RH. 1989. One-step preparation of competent Escherichia coli.

Transformation of bacterial cells in the same solution. PNAS. 86:2172-2175.

Cowan, SW., Schirmer, T., Rummel, G., Steiert, M., Ghosh, R., Pauptit, RA., Jansonius, JN.,

Rosenbusch, JP. 1992. Crystal structures explain functional properties of two E. coli porins.

Nature. 358:727-733.

Cramer, T. J. 2008. Genetic Mosaicism Between The Bacteriophage φ80 And Bacteriophage λ. MS

Degree, Biology. Bowling Green State University.

Drozdetskiy AC., Procter J., Barton GJ. 2015. JPred4: a protein secondary structure prediction server.

Nucl. Acids Res. 43(W1):W389-394.

Edgar, RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.

Nucleic Acids Res. 32:1792-1797.

Eisenhauer, AH., Shames, S., Pawelek, PD., Coulton, JW. 2005. Siderophore transport through

Escherichia coli outer membrane receptor FhuA with disulfide-tethered cork and barrel domains.

J. Biol. Chem. 280:30754-30580.

Elish, ME., Pierce, JR., Earhart, CF. 1988. Biochemical analysis of spontaneous fepA mutants of

Escherichia coli. J. Gen. Microbiol. 134:1355–1364.

Evans, JS., Levine, BA., Trayer, IP., Dorman, CJ., Higgins, CF. 1986. Sequence-imposed structural

constraints in the TonB protein of E. coli. FEBS Lett. 208:211-216.

Ferguson, AD., Braun, V., Coulton, JW., Diederichs, K., Welte, W., Hofmann, E. 2000. Crystal structure

of the antibiotic albomycin in complex with the outer membrane transporter FhuA. Protein Sci.

9:956-963.

Ferguson, AD., Hofmann, E., Coulton, JW., Diederichs, K., Welte, W. 1998. Siderophore-mediated iron

transport: crystal structure of FhuA with bound lipopolysaccharide. Science. 282:2215-2220.

Galdiero, S., Falanga A., Marco, M., Tarallo, R., Pepa, MED., D’Oriano, V., Galdiero, M. 2012.

Microbe-host interactions: structure and role of gram-negative bacterial porins. Curr. Prot. Pept.

Sci. 13:843-854.

Goldberg, G., and Liechti, JB. 2012. Outer membrane biogenesis in Escherichia coli, Neisseria

meningiditis, and Helicobacter pylori: paradigm deviations in H. pylori. Front. Cell. Infect.

Microbiol. Apr 11;2:29. Doi: 10.3389/fcimb.2012.00029. eCollection 2012.

Gresock, MG., Savenkova, MI., Larsen, RA., Ollis, AA., Postle, K. 2003. Death of the TonB shuttle

hypothesis. Front Microbiol 2:206 http://dx.doi.org/10.3389/fmicb.2011.00206.

Gresock, MG., Kastead, KA., Postle, K. 2015. From homodimer to heterodimer and back: Elucidating

the TonB energy transduction cycle. J. Bacteriol. 197:3433-3445.

Gudmundsdottir, A., Bell PE., Lundrigan, MD., Bradbeer, C., Kadner, RJ. 1989. Point mutations in a

conserved region (TonB box) of Escherichia coli outer membrane protein BtuB affect vitamin B12

transport. J. Bacteriol. 171:6526-6533.

Günter, K., Braun, V. 1990 In vivo evidence for FhuA outer membrane receptor interaction with the

TonB inner membrane protein of Eschericia coli. FEBS Lett. 274:85-88.

Guzman, L., Belin, D., Carson, MJ., Beckwith, J. 1995. Tight Regulation, Modulation, and High-Level

Expression by Vectors Containing the Arabinose pBAD Promoter. J. Bacteriol. 177: 4121-4130.

Hancock, RW., Braun, V. 1976. Nature of the energy requirement for the irreversible adsorption of

bacteriophages T1 and phi80 to Escherichia coli. J. Bacteriol. 125:409-415.

Hantke, K., and Braun, V. 1975. Membrane receptor dependent iron transport in Escherichia coli. FEBS

Lett. 49:301-305.

Harrington, JM., and Crumbliss, AL. 2009. The redox hypothesis in siderophore-mediated iron uptake.

Biometals. 22:679–689.

Harris, WR., Carrano, CJ., Cooper, SR., Avdeef, A., Sofen, SR., Bregante, TL., Raymond, KN. 1979.

Coordination chemistry of microbial iron transport compounds. 9. Stability constants for catechol

models of enterobactin J. Am. Chem. Soc. 100:5362–5370.

Heller, KJ., Kadner, RJ., Günther, K. 1988. Suppression of the btuB451 mutation by mutations in the

tonB gene suggests a direct interaction between TonB and TonB-dependent receptor proteins in

the outer membrane of Escherichia coli. Gene. 64:147-153.

Hentze, MW., Muckenthaler, MU., Andrews, NC. 2004. Balancing acts: molecular control of mammalian

iron metabolism. Cell. 117:285–29.

Higgs, PI, Larsen, RA, Postle, K. 2002. Quantification of known components of the Escherichia coli

TonB energy transduction system: TonB, ExbB, ExbD, and FepA. Mol. Microbiol. 44:271-281.

Hill, C. W., and B. W. Harnish. 1981. Inversions between ribosomal-RNA genes of Escherichia coli. Proc.

Natl. Acad. Sci USA. 78:7069-7072.

Huang, KC., Mukhopadhyay, R., Wen, B., Gitai, Z., Wingreen, NS. 2008. Cell shape and cell-wall

organization in gram-negative bacteria. Proc. Nat. Acad. Sci. USA. 105:19282-19287.

Ivanov, Y. 2012. The role of moron genes in the Escherichia coli enterobacteria phage Phi-80. Ph.D.

Dissertation. Bowling Green State University. Biological Sciences.

Kadner, RJ., Bell, PE., Nau, CD., Brown, JT., Konisky, J. 1990. Genetic suppression demonstrates

interaction of TonB protein with outer membrane transport proteins in Escherichia coli. J.

Bacteriol. 172:3826–3829.

Kadner, RJ., Bradbeer, C., Cadieux, N. 2000. Sequence changes in the Ton box region of BtuB affect its

transport activites and interactions with TonB protein. J. Bacteriol. 182:5954-5961.

Karlsson, M., Hannavy, K., Higgins, CF. 1993. ExbB acts as a chaperone-like protein to stabilize TonB

in the cytoplasm. Mol. Microbiol. 8:389-396.

Kennedy, EP. 1982. Osmotic regulation and the biosynthesis of membrane-derived oligosaccharides in

Escherichia coli. Proc. Natl. Acad. Sci USA. 79:1092-1095.

Killmann, H., Videnov G., Jung, G., Schwarz, H., Braun, V. 1995. Identification of receptor binding sites

by competitive peptide mapping: phages T1, T5, and phi 80 and colicin M bind to the gating loop

of FhuA. J. Bacteriol. 177:694–698.

Killmann, H., Herrmann, C., Wolff, H., Braun, V. 1998. Identification of a new site for ferrochrome

transport by comparison of the FhuA proteins of Escherichia coli, Salmonella paratyphi B,

Salmonella typhimurium, and Pantoea agglomerans. J. Bacteriol. 180:3845–3852.

Koch, A. L., and S. Woeste. 1992. Elasticity of the sacculus of Escherichia coli. J. Bacteriol. 174:4811–

4819.

Koch, A. L. 1998. The biophysics of the gram-negative periplasmic space. Crit. Rev. Microbiol. 24:23–

59.

Köhler, SD., Weber, A., Howard, SP., Welte, W., Drescher, M. 2010. The proline-rich domain of TonB

possesses and extended polyproline II-like conformation of sufficient length to span the

periplasm of Gram-negative bacteria. Protein Sci. 19:625-630.

Kozyrev, DP., and Rybchin, VN. 1987. Lysogenic conversion caused by phage phi 80: III. The mapping

of the conversion gene and additional characterization of the phenomenon.

Genetika, 23:793-801. (Translated to English from Russian).

Krewulak, KD., and Vogel, HJ. 2008. Structural biology of bacterial iron uptake Biochim. Biophys. Acta.

1778:1781-1804.

Krewulak, KD., and Vogel, HJ. 2011. TonB or not TonB: is that the question? Biochem. Cell Biol. 89:87-

97.

Khursigara, CM, De Crescenzo, G., Pawelek, PD, Coulton, JW. 2005. Deletion of the proline-rich region

of TonB disrupts formation of a 2:1 complex with FhuA, an outer membrane receptor of

Escherichia coli. Protein Sci. 14:1266-1273.

Larsen, RA., Wood, GE., Postle. K. 1993. The conserved proline-rich motif is not essential for energy

transduction by Escherichia coli TonB protein. Mol. Microbiol. 10:943-953.

Larsen, RA., Foster-Hartnett, D., McIntosh, MA., Postle, K. 1997. Regions of Escherichia coli TonB

and FepA proteins essential for in vivo physical interactions. J. Bacteriol 179:3213-3221.

Larsen, RA., Thomas, MG., Postle, K. 1999. Protonmotive force, ExbB, and ligand-bound FepA drive

conformational changes in TonB. Mol. Microbiol. 31:943-953.

Larsen, RA., Postle, K. 2001. Conserved residues Ser(16) and His(20) and their relative positioning are

essential for TonB activity, cross-linking of TonB with ExbB, and the ability of TonB to respond

to proton motive force. J. Biol. Chem. 276:8111-8117 .

Larsen, RA., Chen, GJ., Postle, K. 2003. Performance of standard phenotypic assays for TonB activity,

as evaluated by varying the level of functional, wild-type TonB. J. Bacteriol. 185:4699-4706.

Larsen, RA., Letain, T., Postle, K. 2003. In vivo evidence of TonB shuttling between the cytoplasmic

and outer membrane in Escherichia coli. Mol. Microbiol. 49:211-218.

Lau, CKY., Vogel, HJ., Krewulak, KD. 2016. Bacterial ferrous iron transport: the Feo system. FEMS

Microbiol. Rev. 40:273-298.

Lederberg, J., and Tatum, EL. 1946. Gene recombination in E. coli. Nature. 158:558.

Lee, SY. 1996. High cell-density culture of Escherichia coli. Trends Biotechnol. 14:98-105.

Letain, TE., and Postle, K. 1997. TonB appears to transduce energy by shuttling between the cytoplasmic

membrane and the outer membrane in gram-negative bacteria. Mol. Microbiol. 24:271-283.

Locher, K. P., B. Rees, R. Koebnik, A. Mitschler, L. Moulinier, J. P. Rosenbusch, and D. Moras. 1998.

Transmembrane signaling across the ligand-gated FhuA receptor: crystal structures of free and

ferrichrome-bound states reveal allosteric changes. Cell 95:771-778.

Mackenzie, EL., Iwasaka, K., Tsuji, Y. 2008. Intracellular iron transport and storage: from molecular

mechanisms to health implications. Antioxid. Redox Signal. 10:997–1030.

Matsumoto, M., Ichikawa, N., Tanaka, S., Morita, T., Matsushiro, A. 1985. Molecular cloning of ϕ80

adsorption-inhibiting cor gene. Jpn. J. Genet., 60:475-483.

Maniatis, T., Fritsch, EF., Sambrook, J. 1982. Molecular cloning. Cold Spring Harbor Laboratory

Press. Cold Spring Harbor, NY.

McHugh, JP., Rodriguez-QuiÒones, F., Tehrani, HA., Svistunenko, DA., Poole, RK., Cooper, CE.,

Andrews, SC. 2003. Global iron-dependent gene regulation in Escherichia coli: A new mechanism

for iron homeostasis. J. Biol. Chem. 278:29478-29486.

Miethke, M., and Marahiel, MA. 2007. Siderophore-based iron acquisition and pathogen control.

Microbiol. Mol. Biol. Rev. 71:413–451.

Miller, JH. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Cold

Spring Harbor, NY.

Moeck, GS., Tawa, P., Xiang, H., Ismail, AA., Turnbull, JL., Coulton, JW. 1996. Ligand‐induced

conformational change in the ferrochrome–iron receptor of Escherichia coli K‐12. Mol.

Microbiol. 22:459-471.

Nagy, G., Dobrindt, U., Kupfer, M., Emödy, L., Karch, H., Hacker, J. 2001. Expression of hemin

receptor molecule ChuA is influenced by RfaH in uropathogenic Escherichia coli strain 536.

Infect Immun. 69:1924–1928

Neilands, JB. 1952. A crystalline organo-iron pigment from a rust fungus (Ustilago sphaerogena). J. Am.

Chem. Soc. 74:4846-4847.

Neilands, JB. 1995. Siderophores: structure and function of microbial iron transport compounds. J. Biol.

Chem. 270: 26723-26726.

Nikaido, H. 2003. Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol.

Biol. Rev.67:593- 656.

Nikaido, H., and Rosenberg, EY. 1990. Cir and Fiu proteins in the outer membrane of Escherichia coli

catalyze transport of monomeric catechols: study with beta-lactam antibiotics containing

catechol and analogous groups. J Bacteriol. 172:1361–1367.

Noinaj, N., Guillier, M., Barnard, TJ., Buchanan, SK. 2010. TonB-dependent transporters: regulation,

structure, and function. Annu. Rev. Microbiol. 64:43-60.

Oexle, H., Gnaiger, E., Weiss., G. 1999. Iron-dependent changes in cellular energy metabolism: influence

on citric acid cycle and oxidative phosphorylation. Biochem. Biophys. Acta. 1413:99-107.

Okuda, S., and Tokuda, H. 2011. Lipoprotein sorting in bacteria. Annu. Rev. Microbiol. 65:239-259.

Papanikolaou, G., and Pantopoulos, K. 2005. Iron metabolism and toxicity. Toxicol. Appl. Pharmacol.

202:199–211.

Pawelek. PD., Croteau, N., Ng-Thow-Hing, C., Khursigara, CM., Moiseeva, N., Allaire, M., Coulton,

JW. 2006. Structure of TonB in complex with FhuA, E. coli outer membrane receptor. Science.

312:1399-1402.

Pedruzzi, I., Rosenbusch, JP., Locher, KP. 1998. Inactivation in vitro of the Escherichia coli outer

membrane protein FhuA by a phage T5-encoded lipoprotein. FEMS Microbiol. Lett. 168:119-

125.

Perry, RD., Balbo, PB., Jones, HA., Fetherston, JD., DeMoll, E. 1999. Yersiniabactin from Yersinia pestis:

biochemical characterization of the siderophore and its role in iron transport and regulation.

Microbiol. 145:1181-1190.

Postle, K., and Good, RF. 1983. DNA sequence of the Escherichia coli tonB gene. Proc. Natl. Acad.

Sci. USA 80:5235-5239.

Postle, K., and Skare, JK. 1988. Escherichia coli TonB protein is exported from the cytoplasm without

the proteolytic cleavage of its amino terminus. J. Biol. Chem. 263:11000-11007.

Postle, K., and Larsen, RA. 2007. TonB-dependent energy transduction between outer and cytoplasmic

membranes. Biometals. 20:453-465.

Postle, K., and Held, KG. 2002. ExbB and ExbD do not function independently in TonB-dependent

energy transduction. J. Bacteriol. 184:5170-5173.

Pressler U., Braun V., Wittmann-Liebold B., Benz R. 1986. Structural and functional properties of

colicin B. J. Biol. Chem. 261:2654-2659.

Raymond, KN., Dertz, EA., Kim, SS. 2003. Enterobactin: An archetype for microbial iron transport. Proc.

Natl. Acad. Sci. USA. 100:3584-3588.

Roof, SK, Allard, JD, Bertrand, KP, Postle, K. 1991. Analysis of Escherichia coli TonB membrane

topology by use of PhoA fusions. J. Bacteriol. 173:5554-5557.

Roberts, MD., Martin, NL., Kropinski, AM. 2004. The genome and proteome of coliphage T1. Virology

318:245-266.

Rotman, E., Kouzminova, E., Plunkett, G.III., Kuzminov, A. 2012. Genome of Enterobacteriophage

Lula/phi80 and insights into its ability to spread in the laboratory environment. J. Bacteriol.

194:6802-6817.

Russo, E. 2003. The birth of biotechnology. Nature. 421:456-457.

Sauer, M., Hantke, K., Braun, V. 1987 Ferric-coprogen receptor FhuE of Escherichia coli: processing

and sequence common to all TonB-dependent outer membrane receptor proteins. J Bacteriol.

169:2044–2049.

Schröder, F., and Vries, S. 2003. Microbial ferric iron reductases. FEMS Microbiol. Rev. 27:427-447.

Scott, DC., Cao, Z., Qi, Z., Bauler, M., Igo, JD., Newton, C., Salette, M., Klebba, PE. 2001.

Exchangeability of N termini in the ligand-gated porins of Escherichia coli. J. Biol. Chem.

276:13025–13033.

Shultis, DD., Purdy, MD., Banchs, CN., Wiener, MC. 2006. Outer membrane active transport. Structure

of the BtuB:TonB complex. Science 312:1396-1399.

Silhavy, TJ, Kahne, D., Walker, S. 2010. The bacterial cell envelope. Cold Spring Harbor Perspect. Biol.

2(5):a000414. doi: 10.1101/cshperspect.a000414. Epub 2010 Apr 14.

Stephens, DL., Choe MD., Earhart, CF. 1995. Escherichia coli periplasmic protein FepB binds

ferrienterobactin. Microbiology 141:1647-1654.

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: molecular

evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum

parsimony methods. Mol. Biol. Evol. 28:2731-2739.

Tokuda, H, Matsuyama, S. 2004. Sorting of lipoproteins to the outer membrane in E. coli. Biochim

Biophys Acta 1693:5-13.

Troxell, B., and Hassan, HM. 2013. Transcriptional regulation by Ferric Uptake Regulator (Fur) in

pathogenic bacteria. Front Cell Infect. Microbiol. Oct 2;3:59. doi: 10.3389/fcimb.2013.00059.

eCollection 2013.

Uc-Mass, A., Loeza, EV., Garza, M., Guarneros, G., Hernandez-Sanchez, J., Kameyama, L. 2004. An

orthologue of the cor gene is involved in the exclusion of temperate lambdoid phages. Evidence

that Cor inactivates FhuA receptor functions. Virology. 329:425-433.

Vakharia, HL. and Postle, K. 2002. FepA with globular domain deletions lacks activity. J. Bacteriol.

184:5508-5512.

Vakaria-Rao, H., Kastead, KA., Savenkova, MI., Bulathsinghala, CM., Postle, K. 2007. Deletion and

substitution analysis of the Escherichia coli TonB Q160 region. J. Bacteriol. 189:4662-4670. von Heijne, G. 1985. Signal sequences. The limits of variation. J. Mol. Biol. 184:99-105. von Heijne, G. 1989. The structure of signal peptides from bacterial lipoproteins. Pro. Eng. 2:531-534.

Wagegg, W. and Braun, V. 1981. Ferric citrate transport in Escherichia coli requires outer membrane

receptor protein FecA. J Bacteriol. 145:156–163.

Wiener, MC., Shultis, DD., Purdy, MD., Banchs, CN. 2006. Outer membrane active transport: structure

of the BtuB:TonB complex. Science. 312:1396-1399

Wiener, MC. 2005. TonB-dependent outer membrane transport: going for Baroque? Curr. Opin. Strcuct.

Biol. 15:394.

Wietzorrek A, Schwarz H, Herrmann C, Braun V. 2006. The genome of the novel phage Rtp, with a

rosette-like tail tip, is homologous to the genome of phage T1. J. Bacteriol. 188:1419 –1436.

Wu, H.C. 1996. Biosynthesis of lipoproteins, p. 1005-1014. In F. C. Neidhardt (ed.), Escherichia coli

and Salmonella: Cellular and Molecular Biology vol. 1. American Society for Microbiology

Press, Washington D.C.

Zeth, K., Romer, C., Patzer, SI., Braun, V. 2008. Crystal structure of colicin M, a novel phosphatase

specifically imported by Escherichia coli. J. Biol. Chem. 283:25324-25331.

Zhai, YF., Heijne, W., Saier, MH. 2003. Molecular modeling of the bacterial outer membrane receptor

energizer, ExbBD/TonB, based on homology with the flagellar motor, MotAB. Biochim.

Biophys. Acta. 1614:201-210.