US 20090192111A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0192111A1 Bader et al. (43) Pub. Date: Jul. 30, 2009
(54) MIR-124 REGULATED GENES AND (22) Filed: Dec. 1, 2008 PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION Related U.S. Application Data (60) Provisional application No. 60/991,709, filed on Dec. (75) Inventors: Andreas G. Bader, Austin, TX 1, 2007. (US); Jason F. Wiggins, Austin, TX (US); Lubna Patrawala, Publication Classification Cambridge, MA (US); Kevin (51) Int. Cl. Kelnar, Kyle, TX (US); Mike A63L/7088 (2006.01) Byrom, Austin, TX (US); David CI2O I/68 (2006.01) Brown, Austin, TX (US) A6IP35/00 (2006.01) Correspondence Address: (52) U.S. Cl...... 514/44; 435/6 Fulbright & Jaworski L.L.P. (57) ABSTRACT 600 Congress Avenue, Suite 2400 Austin, TX 78701 (US) The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR (73) Assignee: Asuragen, Inc., Austin, TX (US) 124, using miR-124 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or (21) Appl. No.: 12/325,917 treating the patient with an appropriate miRNA. Patent Application Publication Jul. 30, 2009 Sheet 1 of 12 US 2009/0192111A1
æfeulep(NO)
Patent Application Publication Jul. 30, 2009 Sheet 2 of 12 US 2009/0192111A1
EastEastEas 22%
22
S
-SE s s i --
i
O) () rt O. () ) < Š
O C O. O. O O CN O CO (O w r 3 S. yer e UObeO % Patent Application Publication Jul. 30, 2009 Sheet 3 of 12 US 2009/0192111A1
r (N y . E O O vs. T
O 2
s O. O Scy S. . E O C) O 8 co Y) CD uu O 2 > (). O (Y)
V CN s v O Z CY) E r CC s (). O O 2.
S. S S S o3 S.o oS. o we we won eAlee. Patent Application Publication Jul. 30, 2009 Sheet 4 of 12 US 2009/0192111A1
O CY)
O N. (DD V CNS. CDE O C (5
(5 O 9 vm
O Patent Application Publication Jul. 30, 2009 Sheet 5 of 12 US 2009/0192111A1
L) -- - g - -- CD + | | | | | | | + - - I I I I I + T + | | | | + | | | + | | | + | | | + | | + | | | | | | O + i + i is H.
O. O. gCN gO gCO gCO. gv. gCN o 99 SSSSc? SN Y Y i? V v. Y in 9 92.9 uO) eleIO % E EY E EE Patent Application Publication Jul. 30, 2009 Sheet 6 of 12 US 2009/0192111A1
- C se
O C C 9. t Cl to CO
S. t E CD t 2 o
O o O - C - - O w (gyuu) eZS loun Patent Application Publication Jul. 30, 2009 Sheet 7 of 12 US 2009/0192111A1
O
N CD
Patent Application Publication Jul. 30, 2009 Sheet 8 of 12 US 2009/0192111A1
920Z/1.?z||8GZ uo??e?noou??sodsÁed
O O O O O O LO r cy) 00Z 00|| (uu) ez's Jouni Patent Application Publication Jul. 30, 2009 Sheet 9 of 12 US 2009/0192111A1
O O O O O O O CN O CO CO V CN 3 S. v UO)eley.O. 9 Patent Application Publication Jul. 30, 2009 Sheet 10 of 12 US 2009/0192111A1
l N
C N
l 0. t g, RF C) vs S E O. 1. (S r C2 E SDet + c > D O Nt g g g g g V 8 3 3 S & C re ? Ov Xuequ nu le)
N
d N
to O ve O S was O o ver SN E 9 Y,: 5 no CD 2 E St - O L
+ -> god M o Lld Co Ltd O c) on Al 0 x) equinu leo o N
2
d ce. Y. S. S
S c. .. 5 2 E + c > d v d 9n 33 3 S S 5 ? Ol Xuequnu e3 Patent Application Publication Jul. 30, 2009 Sheet 11 of 12 US 2009/0192111A1
CO CO CN d O
O O
v N.
O cy) w v e 5 t N CD N D. c 5 w 2 N(5
E O 9 5 Co O.
-- & C O CN s 3. S 3 (uu) eunion Patent Application Publication Jul. 30, 2009 Sheet 12 of 12 US 2009/0192111A1
O Z
v LO CN
O) C/D CD N4 - C/D
Q OO L- S. cr)5 < ?h5 y Z co Y (O O ?h E :
| - T O O O O O O O CN O OO CO w CN V N UO)eleIO % US 2009/O 1921 11 A1 Jul. 30, 2009
MR-124 REGULATED GENES AND with synthetic hsa-miR-124 reduced viable cell numbers. In PATHWAYS AS TARGETS FOR addition, the inventors showed that miR-124 significantly THERAPEUTIC INTERVENTION increased the capacity of two therapeutic compounds (TRAIL, an apoptosis pathway activator in cancer cells, and etoposide, a topoisomerase II inhibitor that activates the apo 0001. This application claims priority to U.S. Provisional ptosis pathway in cancer cells and normal cells) to induce cell Application Ser. No. 60/991,709 filed Dec. 1, 2007, which is death in A549 or HeLa cells. Overexpression of synthetic incorporated herein by reference in its entirety. miR-124 in various cell lines decreased cell proliferation. In those studies, the inventors observed reduced proliferation of BACKGROUND OF THE INVENTION human breast cancer cells, (BT549), normal human breast 0002 I. Field of the Invention epithelial cells (MCF12A), human cervical cancer cells 0003. The present invention relates to the fields of molecu (HeLa), human prostate carcinoma cells (22RV1), human lar biology and medicine. More specifically, the invention basal cell carcinoma cells (TE 354.T), normal human skin relates to methods and compositions for the treatment of cells (TE 353.5 k), and human lung carcinoma cells (A549, diseases or conditions that are affected by microRNA CRL-5826, HTB-57). Overexpression of miR-124 in HeLa (miRNA) miR-124 expression or lack thereof, and genes and cells significantly reduced the number of cells in the G2/M cellular pathways directly and indirectly modulated by such. phase of the cell cycle when compared to cells transfected 0004 II. Background with a negative control miRNA. Also, others have recently 0005. In 2001, several groups used a cloning method to observed that epigenetic silencing of miR-124a in cancers isolate and identify a large group of “microRNAs (miRNAs) cells modulates activity the oncogene, CDK6 and the tumor from C. elegans, Drosophila, and humans (Lau et al., 2001; suppressor gene, Rb (Lujambio et al., 2007). Lee and Ambros, 2001: Lagos-Quintana et al., 2003). Several hundreds of miRNAs have been identified in plants and ani 0009 Bioinformatics analyses suggest that any given mals—including humans—which do not appear to have miRNA may bind to and alter the expression of up to several endogenous siRNAs. Thus, while similar to siRNAs, miR hundred different genes. In addition, a single gene may be NAS are distinct. regulated by several miRNAs. Thus, each miRNA may regu 0006 miRNAs thus far observed have been approximately late a complex interaction among genes, gene pathways, and 21-22 nucleotides in length, and they arise from longer pre gene networks. Mis-regulation or alteration of these regula cursors, which are transcribed from non-protein-encoding tory pathways and networks involving miRNAs are likely to genes (Carrington and Ambros, 2003). The precursors form contribute to the development of disorders and diseases such structures that fold back on themselves in self-complemen as cancer. Although bioinformatics tools are helpful in pre tary regions; they are then processed by the nuclease Dicer (in dicting miRNA binding targets, all have limitations. Because animals) or DCL1 (in plants) to generate the short double of the imperfect complementarity with their target binding stranded miRNA. One of the miRNA strands is incorporated sites, it is difficult to accurately predict the mRNA targets of into a complex of proteins and miRNA called the RNA miRNAs with bioinformatics tools alone. Furthermore, the induced silencing complex (RISC). The miRNA guides the complicated interactive regulatory networks among miRNAS RISC complex to a target mRNA, which is then cleaved or and target genes make it difficult to accurately predict which translationally silenced, depending on the degree of sequence genes will actually be mis-regulated in response to a given complementarity of the miRNA to its target mRNA. Cur miRNA. rently, it is believed that perfect or nearly perfect complemen 0010 Correcting gene expression errors by manipulating tarity leads to mRNA degradation, as is most commonly miRNA expression or by repairing miRNA mis-regulation observed in plants. In contrast, imperfect base pairing, as is represent promising methods to repair genetic disorders and primarily found in animals, leads to translational silencing. cure diseases like cancer. A current, disabling limitation of However, recent data Suggest additional complexity (Bagga this approach is that, as mentioned above, the details of the et al., 2005; Lim et al., 2005), and mechanisms of gene regulatory pathways and gene networks that are affected by silencing by miRNAs remain under intense study (Chendri any given miRNA, have been largely unknown. This repre mada et al., 2007; Kiriakidou et al., 2007). sents a significant limitation for treatment of cancers in which 0007 Recent studies have shown that changes in the a specific miRNA may play a role. A need exists to identify expression levels of numerous miRNAs are associated with the genes, genetic pathways, and genetic networks that are various cancers (reviewed in (Calin and Croce, 2006; regulated by or that may regulate expression of miRNAS. Esquela-Kerscher and Slack, 2006: Wiemer, 2007). miRNAs have also been implicated in regulating cell growth and cell SUMMARY OF THE INVENTION and tissue differentiation—cellular processes that are associ ated with the development of cancer. 0011. The present invention provides additional composi 0008. The inventors previously demonstrated that hsa tions and methods by identifying genes that are direct targets miR-124 is involved with the regulation of numerous cell for miR-124 regulation or that are indirect or downstream activities that represent intervention points for cancer therapy targets of regulation following the miR-124-mediated modi and for therapy of other diseases and disorders (U.S. patent fication of another gene(s) expression. Furthermore, the application Ser. No. 1 1/141,707 filed May 31, 2005 and Ser. invention describes gene, disease, and/or physiologic path No. 1 1/273,640 filed Nov. 14, 2005, each of which is incor ways and networks that are influenced by miR-124 and its porated herein by reference in its entirety). For example, cell family members. In certain aspects, compositions of the proliferation, cell division, and cell survival are frequently invention are administered to a Subject having, Suspected of altered in human cancers. Transfection of human lung carci having, or at risk of developing a metabolic, an immunologic, noma cells (A549) and human cervical cancer cells (HeLa) an infectious, a cardiovascular, a digestive, an endocrine, an US 2009/O 1921 11 A1 Jul. 30, 2009
ocular, a genitourinary, a blood, a musculoskeletal, a nervous nus (Lafora's disease or Unverricht disease), Huntington's system, a congenital, a respiratory, a skin, or a cancerous chorea, torsion dystonia, Blepharospasm, Restless legs, Sero disease or condition. tonin syndrome); Spinocerebellar disease (Friedreich's 0012. In particular aspects, a subject or patient may be ataxia (Spinocerebellar ataxia), Hereditary spastic paraple selected for treatment based on expression and/or aberrant gia, Primary cerebellar degeneration, cerebellar ataxia, expression of one or more miRNA or mRNA. In a further ataxia-telangiectasia Louis-Bar syndrome. Corticostriatal aspect, a subject or patient may be selected for treatment spinal degeneration); Anterior horn cell disease (Motor neu based on aberrations in one or more biologic or physiologic ron disease (Amyotrophic lateral Sclerosis, Progressive mus pathway(s), including aberrant expression of one or more cular atrophy, Progressive bulbar palsy, Pseudobulbar palsy, gene associated with a pathway, or the aberrant expression of Primary lateral Sclerosis); Syringomyelia and Syringobulbia; one or more protein encoded by one or more gene associated Disorders of the autonomic nervous system (Reflex sympa with a pathway. In still a further aspect, a Subject or patient thetic dystrophy); or multiple sclerosis. Nerve injuries may be selected based on aberrations in miRNA expression, include three main types of nerve fiber injury axonotmesis, or biologic and/or physiologic pathway(s). A subject may be neurapraxia and neurotmesis. assessed for sensitivity, resistance, and/or efficacy of a 00.15 Axonotmesis involves loss of the relative continuity therapy or treatment regime based on the evaluation and/or of the axon and its covering of myelin, but preservation of the analysis of miRNA or mRNA expression or lack thereof. A connective tissue framework of the nerve (the encapsulating subject may be evaluated for amenability to certain therapy tissue, the epineurium and perineurium, are preserved). prior to, during, or after administration of one or therapy to a Because axonal continuity is lost, wallerian degeneration Subject or patient. Typically, evaluation or assessment may be occurs. Typically, recovery occurs only through regeneration done by analysis of miRNA and/or mRNA, as well as com of the axons, a process requiring time. Axonotmesis is usually bination of other assessment methods that include but are not the result of a more severe crush or contusion than neura limited to histology, immunohistochemistry, blood work, etc. praxia. 0013. In some embodiments, an infectious disease or con 0016 Neurapraxia is an interruption in conduction of the dition includes a bacterial, viral, parasite, or fungal infection. impulse down the nerve fiber, and recovery takes place with Many of these genes and pathways are associated with vari out wallerian degeneration. This is the mildest form of nerve ous cancers and other diseases. Cancerous conditions injury. This is probably a biochemical lesion caused by a include, but are not limited to astrocytoma, anaplastic large concussion or other shock-like injuries to the fiber. In the case cell lymphoma, acute lymphoblastic leukemia, acute myeloid of the role nerve, neurapraxia is brought about by compres leukemia, angiosarcoma, breast carcinoma, B-cell lym sion or relatively mind, blunt blows, including some low phoma, Burkitt's lymphoma, bladder carcinoma, cholangio Velocity missile injuries close to the nerve. carcinoma, cervical carcinoma, carcinoma of the head and 0017 Neurotmesis is the most severe lesion. It occurs on neck, chronic lymphoblastic leukemia, chronic myeloid leu severe contusion, stretch, laceration, or Local Anesthetic Tox kemia, colorectal carcinoma, endometrial carcinoma, icity. Not only the axon, but the encapsulating connective Ewing's sarcoma, glioma, glioblastoma, glioblastoma multi tissue lose their continuity. The last (extreme) degree of neu forme, gastric carcinoma, hepatoblastoma, hepatocellular rotmesis is transsection, but most neurotmetic injuries do not carcinoma, Hodgkin lymphoma, Kaposi's sarcoma, leuke produce gross loss of continuity of the nerve but rather than mia, lung carcinoma, lipoma, leiomyosarcoma, liposarcoma, internal disruption of the architecture of the nerve sufficient to laryngeal squamous cell carcinoma, melanoma, mucosa-as involve perineurium and endoneuruim as well as axons and sociated lymphoid tissue B-cell lymphoma, medulloblas their covering. There is typically a complete loss of motor, toma, mantle cell lymphoma, myxofibrosarcoma, menin sensory and autonomic function. For neurotmesis, the Sun gioma, multiple myeloma, neuroblastoma, non-Hodgkin derland System is typically used for classification. lymphoma, nasopharyngeal carcinoma, non-Small cell lung 0018. The present invention provides methods and com carcinoma, ovarian carcinoma, oesophageal carcinoma, positions for identifying genes that are direct targets for miR oropharyngeal carcinoma, osteosarcoma, pancreatic carci 124 regulation or that are downstream targets of regulation noma, papillary carcinoma, prostate carcinoma, retinoblas following the miR-124-mediated modification of upstream toma, renal cell carcinoma, rhabdomyosarcoma, squamous gene expression. Furthermore, the invention describes gene cell carcinoma of the head and neck, Schwannoma, Small cell pathways and networks that are influenced by miR-124 lung cancer, salivary gland tumor, thyroid carcinoma, testicu expression in biological samples. Many of these genes and lar tumor, urothelial carcinoma, Wilm's tumor, wherein the pathways are associated with various cancers and other dis modulation of one or more gene is sufficient for a therapeutic eases. The altered expression or function of miR-124 in cells response. Typically a cancerous condition is an aberrant would lead to changes in the expression of these genes and hyperproliferative condition associated with the uncontrolled contribute to the development of disease or other conditions. growth or inability to undergo cell death, including apoptosis. Introducing miR-124 (for diseases where the miRNA is 0014. In still a further aspect, a nervous system condition down-regulated) or a miR-124 inhibitor (for diseases where can include a disease or injury to a neuronal cellor a nerve that the miRNA is up-regulated) into disease cells or tissues or includes, but is not limited to brain tumors; neuronal degen subjects would result in a therapeutic response. The identities eration; mental retardation; Cerebral degeneration (Leukod of key genes that are regulated directly or indirectly by miR ystrophy (Krabbe disease, Pelizaeus-Merzbacher disease), 124 and the disease with which they are associated are pro Cerebral lipidoses (Tay-Sachs disease), Alzheimer's disease, vided herein. Pick's disease, obstructive Hydrocephalus, Reye's syndrome, 0019. In certain aspects a cell may be an epithelial, an Parkinson's disease); extrapyramidal disease and abnormal endothelial, a mesothelial, a glial, a stromal, or a mucosal cell. movement disorders (Olivopontocerebellar atrophy, Shy The cell can be, but is not limited to a brain, a neuronal, a Drager syndrome, Essential tremor/familial tremor, Myoclo blood, an endometrial, a meninges, an esophageal, a lung, a US 2009/O 1921 11 A1 Jul. 30, 2009
cardiovascular, a liver, a lymphoid, a breast, a bone, a con carcinoma, prostate carcinoma, pheochromocytoma, rhab nective tissue, a fat, a retinal, a thyroid, a glandular, an adre domyosarcoma, squamous cell carcinoma of the head and nal, a pancreatic, a stomach, an intestinal, a kidney, a bladder, neck, Schwannoma, Small cell lung cancer, salivary gland a colon, a prostate, a uterine, an ovarian, a cervical, a testicu tumor, sporadic papillary renal carcinoma, thyroid carci lar, a splenic, a skin, a Smooth muscle, a cardiac muscle, or a noma, testicular tumor, or urothelial carcinoma. striated muscle cell. A cell, tissue, or Subject may be a cancer 0022. Embodiments of the invention include methods of cell, a cancerous tissue, harbor cancerous tissue, or be a modulating gene expression, or biologic or physiologic path Subject or patient diagnosed or at risk of developing a disease ways in a cell, a tissue, or a subject comprising administering or condition. In still a further aspect cancer includes, but is not to the cell, tissue, or Subject an amount of an isolated nucleic limited to astrocytoma, anaplastic large cell lymphoma, acute acid or mimetic thereof comprising a miR-124 nucleic acid, lymphoblastic leukemia, acute myeloid leukemia, angiosar mimetic, or inhibitor sequence in an amount Sufficient to coma, breast carcinoma, B-cell lymphoma, Burkitt's lym modulate the expression of a gene positively or negatively phoma, bladder carcinoma, cholangiocarcinoma, cervical modulated by a miR-124 miRNA. A "miR-124 nucleic acid carcinoma, carcinoma of the head and neck, chronic lympho sequence' or “miR-124 inhibitor includes the full length blastic leukemia, chronic myeloid leukemia, colorectal car precursor of miR-124, or complement thereof or processed cinoma, endometrial carcinoma, Ewing's sarcoma, glioma, (i.e., mature) sequence of miR-124 and related sequences set glioblastoma, glioblastoma multiforme, gastric carcinoma, forth herein, as well as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, hepatoblastoma, hepatocellular carcinoma, Hodgkin lym 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more phoma, Kaposi's sarcoma, leukemia, lung carcinoma, nucleotides of a precursor miRNA or its processed sequence, lipoma, leiomyosarcoma, liposarcoma, laryngeal squamous or complement thereof, including all ranges and integers cell carcinoma, melanoma, mucosa-associated lymphoid tis there between. In certain embodiments, the miR-124 nucleic Sue B-cell lymphoma, medulloblastoma, mantle cell lym acid sequence or miR-124 inhibitor contains the full-length phoma, myxofibrosarcoma, meningioma, multiple myeloma, processed miRNA sequence or complement thereof and is neuroblastoma, non-Hodgkin lymphoma, nasopharyngeal referred to as the “miR-124 full-length processed nucleic acid carcinoma, non-Small cell lung carcinoma, ovarian carci sequence' or “miR-124 full-length processed inhibitor noma, oesophageal carcinoma, oropharyngeal carcinoma, sequence.” In still further aspects, the miR-124 nucleic acid osteosarcoma, pancreatic carcinoma, papillary carcinoma, comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17. prostate carcinoma, retinoblastoma, renal cell carcinoma, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide segment (includ rhabdomyosarcoma, squamous cell carcinoma of the head ing all ranges and integers there between) or complementary and neck, Schwannoma, Small cell lung cancer, salivary gland segment of a miR-124 that is at least 75, 80, 85,90,95, 98.99 tumor, thyroid carcinoma, testicular tumor, urothelial carci or 100% identical to SEQ ID NO:1 to SEQID NO:52. The noma, or Wilm's tumor. general term miR-124 includes all members of the miR-124 0020. In certain aspects, the cell, tissue, or target may not family that share at least part of a mature miR-124 sequence. be defective in miRNA expression yet may still respond Mature miR-124 sequences include hsa-miR-124 (MI therapeutically to expression or over expression of a miRNA. MAT0000422), rno-miR-124 (MIMAT0000828), mmu miR-124 could be used as a therapeutic target for any of these miR-124 (MIMAT0000134), UAAGGCACGCG diseases. In certain embodiments miR-124 or its compliment GUGAAUGCC (SEQ ID NO:1); fru-miR-124 can be used to modulate the activity of miR-124 in a subject, (MIMAT0002896), tini-miR-124 (MIMAT0002897), dre organ, tissue, or cell. miR-124 (MIMAT0001819), UAAGGCACGCG 0021. A cell, tissue, or subject may be a cancer cell, a GUGAAUGCCAA (SEQ ID NO:2); ame-miR-124 (MI cancerous tissue, harbor cancerous tissue, or be a subject or MAT0001473), aga-miR-124 (MIMAT0001499), bmo-miR patient diagnosed or at risk of developing a disease or condi 124 (MIMAT0004-198), dps-miR-124 (MIMAT0001229), tion. In certain aspects a cancer cell is a neuronal, glial, lung, dme-miR-124 (MIMAT0000351), UAAGGCACGCG liver, brain, breast, bladder, blood, leukemic, colon, endome GUGAAUGCCAAG (SEQ ID NO:3); mdo-miR-124a (MI trial, stomach, skin, ovarian, fat, bone, cervical, esophageal, MAT0004102), ggo-miR-124a (MIMAT0002465), lla-miR pancreatic, prostate, kidney, epithelial, intestinal, muscle, 124a (MIMAT0002471), ptr-miR-124a (MIMAT0002469), adrenal, salivary gland, orthyroid cell. In still a further aspect ppa-miR-124a (MIMAT0002467), gga-miR-124a (MI cancer includes, but is not limited to astrocytoma, anaplastic MAT0001128), Xtr-miR-124 (MIMAT0003.683), ppy-miR large cell lymphoma, acute lymphoblastic leukemia, acute 124a (MIMAT0002468), mml-miR-124a (MI myeloid leukemia, angiosarcoma, breast carcinoma, B-cell MAT0002470), age-miR-124a (MIMAT0002466), ssc-miR lymphoma, bladder carcinoma, cervical carcinoma, carci 124a (MIMAT0002156), noma of the head and neck, chronic lymphocytic leukemia, UUAAGGCACGCGGUGAAUGCCA (SEQID NO:4); bta chronic myeloid leukemia, colorectal carcinoma, endome miR-124a (MIMAT0003811), UUAAGGCACGCG trial carcinoma, glioma, glioblastoma, gastric carcinoma, GUGAAUGCCAA (SEQ ID NO:5); chr-miR-124 (MI gastrinoma, hepatoblastoma, hepatocellular carcinoma, MAT0000494), cel-miR-124 (MIMAT0000282), Hodgkin lymphoma, Kaposi's sarcoma, leukemia, lung car UAAGGCACGCGGUGAAUGCCA (SEQ ID NO:6); gga cinoma, leiomyosarcoma, laryngeal squamous cell carci miR-124b (MIMAT0001174), UUAAGGCACG noma, melanoma, mucosa-associated lymphoid tissue B-cell CAGUGAAUGCCA (SEQ ID NO:7), or a complement lymphoma, medulloblastoma, mantle cell lymphoma, men thereof. In certain aspects, a subset of these miRNAs will be ingioma, myeloid leukemia, multiple myeloma, high-risk used that include some but not all of the listed miR-124 family myelodysplastic syndrome, mesothelioma, neurofibroma, members. In one aspect, miR-124 sequences have a core non-Hodgkin lymphoma, non-Small cell lung carcinoma, COSCSUS Sequence of U/-UAAGGCACGCG ovarian carcinoma, esophageal carcinoma, oropharyngeal GUGAAUGCC-/A-/A-7G (SEQ ID NO:8, wherein the carcinoma, osteosarcoma, pancreatic carcinoma, papillary bracketed nucleotides are optional). In one embodiment only
US 2009/O 1921 11 A1 Jul. 30, 2009
(SEQ ID NO:37)), mml-mir-124a (MI0002766, AUCAA 28, 29 or more nucleotides of the precursor miRNA or its GAUCAGAGGCUCUGCCCUCCGUGUUCA processed sequence, including all ranges and integers there CAGCGGACCUUGAUUUAAUGUCA UACAAUUAAG between. In certain embodiments, the miR-124 nucleic acid GCACGCGGUGAAUGCCAAGAGCGGAGCCUACGG sequence contains the full-length processed miRNA sequence and is referred to as the “miR-124 full-length pro CUGCACUUGAA (SEQ ID NO:38)), mmu-mir-124-1 cessed nucleic acid sequence. In still further aspects, a miR (MI0000716, AGGCCUCUCUCUCCGUGUUCACAGCG 124 comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, GACCUUGAUUUAAAUGUCCAUACAAUUAA 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including GGCACGCGGUGAAUGCCAAGAAUGGGGCUG (SEQ all ranges and integers there between) segment of miR-124 ID NO:39)), mmu-mir-124-2 (MI0000717, AUCAA that is at least 75, 80, 85,90, 95, 98, 99 or 100% identical to GAUCAGAGACUCUGCUCUCCGUGUUCA SEQ ID NOS provided herein. CAGCGGACCUUGAUUUAAUGUCA UACAAUUAAG 0025. In specific embodiments, a miR-124 or miR-124 GCACGCGGUGAAUGCCAAGAGCGGAGCCUACGG inhibitor containing nucleic acid is hsa-miR-124 or hsa-miR CUGCACUUGAA (SEQ ID NO:40)), mmu-mir-124-3 124 inhibitor, or a variation thereof. In a further aspect, a (MI0000150, CUCUGCGUGUUCACAGCGGACCUUGA miR-124 nucleic acid or miR-124 inhibitor can be adminis UUUAAUGUCUAUACAAUUAAGGCACGCG tered with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNAs or GUGAAUGCCAAGAG (SEQ ID NO:41)), ppa-mir-124a miRNA inhibitors. miRNAs or their complements can be (MI0002763, AUCAAGAUUAGAGGCUCUGCUCUC administered concurrently, in sequence, or in an ordered pro CGUGUUCACAGCGGACCUUGAUUUAAUGUC AUA gression. In certain aspects, a miR-124 or miR-124 inhibitor CAAUUAAGGCACGCGGUGAAUGCCAA can be administered in combination with one or more of let-7, miR-15, miR-16, miR-20, miR-21, miR-26a, miR-126, miR GAGCGGAGCCUACGGCUGCACUUGA A (SEQ ID 143, miR-147, miR-188, miR-200, miR-215, miR-216, miR NO:42)), ppy-mir-124a (MI0002764, AUCAAGAUUA 292-3p, and/or miR-331. All or combinations of miRNAs or GAGGCUCUGCCCUCCGUGUUCACAGCG inhibitors thereof may be administered in a single formula GACCUUGAUUUAAUGUCA UACAAUUAAG tion. Administration may be before, during or after a second GCACGCGGUGAAUGCCAAGAGCGGAGCCUACGG therapy. CUGCACUUGAA (SEQ ID NO:43)), ptr-mir-124a 0026 miR-124 nucleic acids or complements thereof may (MI0002765, AUCAAGAUUAGAGGCUCUGCUCUC also include various heterologous nucleic acid sequences, CGUGUUCACAGCGGACCUUGAUUUAAUGUC AUA i.e., those sequences not typically found operatively coupled CAAUUAAGGCACGCGGUGAAUGCCAA with miR-124 in nature, Such as promoters, enhancers, and GAGCGGAGCCUACGGCUGCACUUGA A (SEQ ID the like. The miR-124 nucleic acid is a recombinant nucleic NO:44)), rno-mir-124-1 (MI0000893, AGGCCUCUCU acid, and can be a ribonucleic acid and/or a deoxyribonucleic CUCCGUGUUCACAGCGGACCUUGA acid. The recombinant nucleic acid may comprise a miR-124 UUUAAAUGUCCAUACAAUUAA GGCACGCG or miR-124 inhibitor expression cassette, i.e., a nucleic acid GUGAAUGCCAAGAAUGGGGCUG (SEQ ID NO:45)), segment that expresses a nucleic acid when introduce into an mo-mir-124-2 (MI0000894, AUCAAGAUCAGAGACU environment containing components for nucleic acid synthe CUGCUCUCCGUGUUCACAGCGGACCU sis. In a further aspect, the expression cassette is comprised in UGAUUUAAUGUCA UACAAUUAAGGCACGCG a viral vector, or plasmid DNA vector or other therapeutic GUGAAUGCCAAGAGCGGAGCCUACGGCUGCAC nucleic acid vector or delivery vehicle, including liposomes UUGAA (SEQ ID NO:46)), rno-mir-124-3 (MI0000892, and the like. In a particular aspect, the miR-124 nucleic acid UGAGGGCCCCUCUGCGUGUUCACAGCG is a synthetic nucleic acid. Moreover, nucleic acids of the GACCUUGAUUUAAUGUCUAUACAAUUA invention may be fully or partially synthetic. In certain AGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC aspects, viral vectors can be administered at 1x10, 1x10, (SEQ ID NO:47)), ssc-mir-124a (MI0002450, AGGCCU 1x10 1x10, 1x10, 1x107, 1x10, 1x10, 1x10, 1x10'', CUCUCUCCGUGUUCACAGCGG ACCU 1x10', 1x10", 1x10" pfu or viral particle (vp). UGAGUUAAAUGUCCAUACAAUUAA GGCACGCG 0027. In a particular aspect, the miR-124 nucleic acid or GUGAAUGCCAAGAAUGGGGCUG (SEQ ID NO:48)), miR-124 inhibitor is a synthetic nucleic acid. Moreover, tni-mir-124-1 (MI0003288, CUCUCCGUGUUCACAGCG nucleic acids of the invention may be fully or partially syn GACCUUGAUUUAAUGUCUUACAAUUAAG thetic. In still further aspects, a DNA encoding such a nucleic GCACGCGGUGAAUGCCAAGAG (SEQID NO:49)), tini acid of the invention can be administered at 0.001, 0.01, 0.1, mir-124-2 (MI0003355, 1, 10, 20, 30, 40, 50, 100, 200, 400, 600, 800, 1000, 2000, to GCCUCUCCUCGUGUUCACAGCGG ACCU 4000 ug or mg, including all values and ranges there between. UGAUUUAAAUGUCCAUACAAUUAAGGCA CGCG In yet a further aspect, nucleic acids of the invention, includ GUGAAUGCCAAGAGAG (SEQ ID NO:50)), tini-mir ing synthetic nucleic acid, can be administered at 0.001, 0.01, 124-3 (MI0003212, 0.1. 1, 10, 20, 30, 40, 50, 100, to 200 ug or mg per kilogram GGUUUGAGCUCUUUGUGUUCACAGUG (kg) of body weight. Each of the amounts described herein GACCUUGAUUUAAUUUCAAUACAAUUAA may be administered over a period of time, including 0.5, 1,2, GGCACGCGGUGAAUGCCAAGAGAGAA (SEQ ID 3, 4, 5, 6, 7, 8, 9, 10, minutes, hours, days, weeks, months or NO:51)), Xtr-mir-124 (MI0004930, UAAGUCUCUGACU years, including all values and ranges there between. CUCCGUGUUCACAGCGGACCUUGA 0028. In certain embodiments, administration of the com UUUAAUGUCAUACAAUU AAGGCACGCG position(s) can be enteral or parenteral. In certain aspects, GUGAAUGCCAAGAGUGGAGCCUAC (SEQ ID enteral administration is oral. In further aspects, parenteral NO:52)), or a complement thereof. administration is intralesional, intravascular, intracranial, 0024. In certain aspects, a miR-124 nucleic acid, or a intrapleural, intratumoral, intraperitoneal, intramuscular, segment or a mimetic thereof, will comprise 5, 6, 7, 8, 9, 10. intralymphatic, intraglandular, Subcutaneous, topical, intra 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, bronchial, intratracheal, intranasal, inhaled, or instilled. US 2009/O 1921 11 A1 Jul. 30, 2009
Compositions of the invention may be administered region tion refers to the expression levels or activities of a gene or its ally or locally and not necessarily directly into a lesion. related gene product or protein, e.g., the mRNA levels may be 0029. In certain aspects, the gene or genes modulated modulated or the translation of an mRNA may be modulated, comprises 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 20, 25, etc. Modulation may increase or up regulate a gene or gene 30, 35, 40, 45, 50, 100, 150, 200 or more genes or combina product or it may decrease or down regulate a gene or gene tions of genes identified in Tables 1, 3, 4, and/or 5. In still product. further aspects, the gene or genes modulated may exclude 1. 0033 Still a further embodiment includes methods of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, treating a patient with a pathological condition comprising 45, 50, 100, 150, 175 or more genes or combinations of genes one or more of step of (a) administering to the patient an identified in Tables 1, 3, 4, and/or 5. Modulation includes amount of an isolated nucleic acid comprising a miR-124 modulating transcription, mRNA levels, mRNA translation, nucleic acid sequence in an amount Sufficient to modulate the and/or protein levels in a cell, tissue, or organ. In certain expression of a cellular pathway; and (b) administering a aspects the expression of a gene or level of a gene product, second therapy, wherein the modulation of the cellular path Such as mRNA or encoded protein, is down-regulated or way sensitizes the patient to the second therapy. A cellular up-regulated. In a particular aspect the gene modulated com pathway may include, but is not limited to one or more path prises or is selected from (and may even exclude) 1, 2, 3, 4, 5, way described in Table 2 below or a pathway that is know to 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, include one or more genes of Tables 1,3,4, and/or 5. A second 24, 25, 26.27, 28, or all of the genes identified in Tables 1, 3, therapy can include administration of a second miRNA or 4, and/or 5, or any combinations thereof. In certain embodi therapeutic nucleic acid, or may include various standard ments a gene modulated or selected to be modulated is from therapies. Such as chemotherapy, radiation therapy, drug Table 1. In further embodiments a gene modulated or selected therapy, immunotherapy, and the like. Embodiments of the to be modulated is from Table 3. In still further embodiments invention may also include the determination or assessment a gene modulated or selected to be modulated is from Table 4. of a gene expression profile for the selection of an appropriate In yet further embodiments a gene modulated or selected to be therapy. modulated is from Table 5. 0034 Embodiments of the invention include methods of 0030 Embodiments of the invention may also include treating a Subject with a pathological condition comprising obtaining or assessing a gene expression profile or miRNA one or more of the steps of (a) determining an expression profile of a target cell prior to selecting the mode of treatment, profile of one or more genes selected from Table 1,3,4, and/or e.g., administration of a miR-124 nucleic acid, inhibitor of 5; (b) assessing the sensitivity of the subject to therapy based miR-124, or mimetics thereof. The database content related on the expression profile; (c) selecting a therapy based on the to all nucleic acids and genes designated by an accession assessed sensitivity; and (d) treating the Subject using number or a database Submission are incorporated herein by selected therapy. Typically, the pathological condition will reference as of the filing date of this application. In certain have as a component, indicator, or result the mis-regulation of aspects of the invention one or more miRNA or miRNA one or more gene of Table 1, 3, 4, and/or 5. inhibitor may modulate a single gene. In a further aspect, one 0035. Further embodiments include the identification and or more genes in one or more genetic, cellular, or physiologic assessment of an expression profile indicative of miR-124 pathways can be modulated by one or more miRNAs or status in a cell or tissue comprising expression assessment of complements thereof, including miR-124 nucleic acids and one or more gene from Table 1, 3, 4, and/or 5, or any combi miR-124 inhibitors in combination with other miRNAs. nation thereof. 0031 miR-124 nucleic acids may also include various 0036. The term “miRNA is used according to its ordinary heterologous nucleic acid sequences, i.e., those sequences not and plain meaning and refers to a microRNA molecule found typically found operatively coupled with miR-124 in nature, in eukaryotes that is involved in RNA-based gene regulation. Such as promoters, enhancers, and the like. The miR-124 See, e.g., Carrington et al., 2003, which is hereby incorpo nucleic acid is a recombinant nucleic acid, and can be a rated by reference. The term can be used to refer to the ribonucleic acid or a deoxyribonucleic acid. The recombinant single-stranded RNA molecule processed from a precursor or nucleic acid may comprise a miR-124 expression cassette. In in certain instances the precursor itself. a further aspect, the expression cassette is comprised in a 0037. In some embodiments, it may be useful to know viral, or plasmid DNA vector or other therapeutic nucleic acid whether a cell expresses a particular miRNA endogenously or vector or delivery vehicle, including liposomes and the like. whether such expression is affected under particular condi In a particular aspect, the miR-124 nucleic acid is a synthetic tions or when it is in a particular disease state. Thus, in some nucleic acid. Moreover, nucleic acids of the invention may be embodiments of the invention, methods include assaying a fully or partially synthetic. cell or a sample containing a cell for the presence of one or 0032. A further embodiment of the invention is directed to more marker gene or mRNA or other analyte indicative of the methods of modulating a cellular pathway comprising admin expression level of a gene of interest. Consequently, in some istering to the cell an amount of an isolated nucleic acid embodiments, methods include a step of generating an RNA comprising a miR-124 nucleic acid sequence in an amount profile for a sample. The term “RNA profile' or “gene expres Sufficient to modulate the expression, function, status, or state sion profile' refers to a set of data regarding the expression of a cellular pathway, in particular those pathways described pattern for one or more gene or genetic marker in the sample in Table 2 or the pathways known to include one or more (e.g., a plurality of nucleic acid probes that identify one or genes from Table 1, 3, 4, and/or 5. Modulation of a cellular more markers from Tables 1,3,4, and/or 5); it is contemplated pathway includes, but is not limited to modulating the expres that the nucleic acid profile can be obtained using a set of sion of one or more gene. Modulation of a gene can include RNAS, using for example nucleic acid amplification or inhibiting the function of an endogenous miRNA or provid hybridization techniques well know to one of ordinary skill in ing a functional miRNA to a cell, tissue, or subject. Modula the art. The difference in the expression profile in the sample US 2009/O 1921 11 A1 Jul. 30, 2009
from the patient and a reference expression profile, Such as an ing a functional miRNA to a cell, tissue, or subject. Modula expression profile from a normal or non-pathologic sample, is tion refers to the expression levels or activities of a gene or its indicative of a pathologic, disease, or cancerous condition. A related gene product (e.g., mRNA) or protein, e.g., the mRNA nucleic acid or probe set comprising or identifying a segment levels may be modulated or the translation of an mRNA may of a corresponding mRNA can include all or part of 1, 2, 3, 4, be modulated. Modulation may increase or up regulate a gene 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or gene productor it may decrease or down regulate a gene or 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, gene product (e.g., protein levels or activity). 40, 41,42, 43,44, 45,46,47, 48,49, 50, 51, 52,53,54, 55,56, 0042 Still a further embodiment includes methods of 57, 58, 59, 60, 61, 62, 100, 200, 500, or more nucleotides, administering an miRNA or mimic thereof, and/or treating a including any integer or range derivable there between, of a Subject or patient having, Suspected of having, or at risk of gene, genetic marker, a nucleic acid, mRNA or a probe rep developing a pathological condition comprising one or more resentative thereof that is listed in Tables 1, 3, 4, and/or 5 or of step (a) administering to a patient or Subject an amount of identified by the methods described herein. an isolated nucleic acid comprising a miR-124 nucleic acid 0038 Certain embodiments of the invention are directed sequence or a miR-124 inhibitor in an amount Sufficient to to compositions and methods for assessing, prognosing, or modulate expression of a cellular pathway; and (b) adminis treating a pathological condition in a patient comprising mea tering a second therapy, wherein the modulation of the cellu Suring or determining an expression profile of one or more lar pathway sensitizes the patient or Subject, or increases the marker(s) in a sample from the patient, wherein a difference efficacy of a second therapy. An increase in efficacy can in the expression profile in the sample from the patient and an include a reduction in toxicity, a reduced dosage or duration expression profile of a normal sample or reference expression of the second therapy, or an additive or synergistic effect. A profile is indicative of pathological condition and particularly cellular pathway may include, but is not limited to one or cancer (e.g., In certain aspects of the invention, the cellular more pathway described in Table 2 below or a pathway that is pathway, gene, or genetic marker is or is representative of one know to include one or more genes of Tables 1, 3, 4, and/or 5. or more pathway or marker described in Table 1, 2, 3, 4, The second therapy may be administered before, during, and/ and/or 5, including any combination thereof. or after the isolated nucleic acid or miRNA or inhibitor is 0039. Aspects of the invention include diagnosing, assess administered ing, or treating a pathologic condition or preventing a patho 0043. A second therapy can include administration of a logic condition from manifesting. For example, the methods second miRNA ortherapeutic nucleic acid such as a siRNA or can be used to screen for a pathological condition; assess antisense oligonucleotide, or may include various standard prognosis of a pathological condition; stage a pathological therapies, such as pharmaceuticals, chemotherapy, radiation condition; assess response of a pathological condition to therapy, drug therapy, immunotherapy, and the like. Embodi therapy, or to modulate the expression of a gene, genes, or ments of the invention may also include the determination or related pathway as a first therapy or to render a Subject sen assessment of gene expression or gene expression profile for sitive or more responsive to a second therapy. In particular the selection of an appropriate therapy. In a particular aspect, aspects, assessing the pathological condition of the patient a second therapy is a chemotherapy. A chemotherapy can can be assessing prognosis of the patient. Prognosis may include, but is not limited to paclitaxel, cisplatin, carboplatin, include, but is not limited to an estimation of the time or doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib, doc expected time of Survival, assessment of response to a etaxel, methotrexate, capecitabine, Vinorelbine, cyclophos therapy, and the like. In certain aspects, the altered expression phamide, gemcitabine, amrubicin, cytarabine, etoposide, of one or more gene or marker is prognostic for a patient camptothecin, dexamethasone, dasatinib, tipifarnib, bevaci having a pathologic condition, wherein the marker is one or Zumab, sirolimus, temsirolimus, everolimus, lonafamib, more of Table 1, 3, 4, and/or 5, including any combination cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, thereof. trastuzumab, nocodazole, Sorafenib, Sunitinib, bortezomib, 0040. A further embodiment of the invention is directed to alemtuzumab, gemtuzumab, to situmomab or ibritumomab. methods of modulating a cellular pathway comprising admin 0044 Embodiments of the invention include methods of istering to the cell an amount of an isolated nucleic acid treating a Subject with a disease or condition comprising one comprising a miR-124 nucleic acid sequence or a miR-124 or more of the steps of (a) determining an expression profile inhibitor. A cell, tissue, or Subject may be a cancer cell, a of one or more genes selected from Table 1, 3, 4, and/or 5; (b) cancerous tissue or harbor cancerous tissue, or a cancer assessing the sensitivity of the Subject to therapy based on the patient. The database content related to all nucleic acids and expression profile; (c) selecting a therapy based on the genes designated by an accession number or a database Sub assessed sensitivity; and (d) treating the Subject using a mission are incorporated herein by reference as of the filing selected therapy. Typically, the disease or condition will have date of this application. as a component, indicator, or resulting mis-regulation of one 0041. A further embodiment of the invention is directed to or more gene of Table 1, 3, 4, and/or 5. methods of modulating a cellular pathway comprising admin 0045. In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more istering to the cell an amount of an isolated nucleic acid miRNA may be used in sequence or in combination; for comprising a miR-124 nucleic acid sequence in an amount instance, any combination of miR-124 or a miR-124 inhibitor Sufficient to modulate the expression, function, status, or state with another miRNA. Further embodiments include the iden of a cellular pathway, in particular those pathways described tification and assessment of an expression profile indicative in Table 2 or the pathways known to include one or more of miR-124 status in a cell or tissue comprising expression genes from Table 1, 3, 4, and/or 5. Modulation of a cellular assessment of one or more gene from Table 1, 3, 4, and/or 5. pathway includes, but is not limited to modulating the expres or any combination thereof. sion of one or more gene(s). Modulation of a gene can include 0046. The term “miRNA is used according to its ordinary inhibiting the function of an endogenous miRNA or provid and plain meaning and refers to a microRNA molecule found US 2009/O 1921 11 A1 Jul. 30, 2009 in eukaryotes that is involved in RNA-based gene regulation. ovarian carcinoma, oesophageal carcinoma, pancreatic carci See, e.g., Carrington et al., 2003, which is hereby incorpo noma, prostate carcinoma, renal cell carcinoma, rhabdomyo rated by reference. The term can be used to refer to the sarcoma, squamous cell carcinoma of the head and neck, or single-stranded RNA molecule processed from a precursor or thyroid carcinoma. in certain instances the precursor itself. 0051. In certain aspects, miR-124 and miR-20 are admin 0047. In some embodiments, it may be useful to know istered to patients with astrocytoma, acute myeloid leukemia, whether a cell expresses a particular miRNA endogenously or breast carcinoma, bladder carcinoma, cervical carcinoma, whether such expression is affected under particular condi colorectal carcinoma, endometrial carcinoma, glioma, glio tions or when it is in a particular disease state. Thus, in some blastoma, gastric carcinoma, hepatocellular carcinoma, embodiments of the invention, methods include assaying a Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell or a sample containing a cell for the presence of one or cell lymphoma, myxofibrosarcoma, multiple myeloma, neu more marker gene or mRNA or other analyte indicative of the roblastoma, non-Hodgkin lymphoma, non-Small cell lung expression level of a gene of interest. Consequently, in some carcinoma, ovarian carcinoma, oesophageal carcinoma, embodiments, methods include a step of generating an RNA osteosarcoma, pancreatic carcinoma, prostate carcinoma, profile for a sample. The term “RNA profile' or “gene expres squamous cell carcinoma of the head and neck, thyroid car sion profile' refers to a set of data regarding the expression cinoma, or urothelial carcinoma. pattern for one or more gene or genetic marker or miRNA in 0.052 Aspects of the invention include methods where the sample (e.g., a plurality of nucleic acid probes that iden miR-124 and miR-21 are administered to patients with astro tify one or more markers from Tables 1, 3, 4, and/or 5); it is cytoma, acute lymphoblastic leukemia, acute myeloid leuke contemplated that the nucleic acid profile can be obtained mia, breast carcinoma, Burkitt's lymphoma, bladder carci using a set of RNAS, using for example nucleic acid amplifi noma, colorectal carcinoma, endometrial carcinoma, glioma, cation or hybridization techniques well know to one of ordi glioblastoma, gastric carcinoma, hepatocellular carcinoma, nary skill in the art. The difference in the expression profile in melanoma, mantle cell lymphoma, neuroblastoma, non-small the sample from the patient and a reference expression pro cell lung carcinoma, ovarian carcinoma, oesophageal carci file. Such as an expression profile of one or more genes or noma, pancreatic carcinoma, prostate carcinoma, renal cell miRNAs, are indicative of which miRNAs to be adminis carcinoma, rhabdomyosarcoma, or squamous cell carcinoma tered. of the head and neck. 0048. In certain aspects, miR-124 and let-7 can be admin 0053. In still further aspects, miR-124 and miR-26a are istered to patients with acute lymphoblastic leukemia, acute administered to patients with anaplastic large cell lymphoma, myeloid leukemia, angiosarcoma, breast carcinoma, bladder acute lymphoblastic leukemia, acute myeloid leukemia, carcinoma, cervical carcinoma, carcinoma of the head and angiosarcoma, breast carcinoma, B-cell lymphoma, Burkitt's neck, chronic lymphoblastic leukemia, chronic myeloid leu lymphoma, bladder carcinoma, cervical carcinoma, carci kemia, colorectal carcinoma, endometrial carcinoma, noma of the head and neck, chronic lymphoblastic leukemia, glioma, glioblastoma, gastric carcinoma, hepatocellular car chronic myeloid leukemia, colorectal carcinoma, glioma, cinoma, Hodgkin lymphoma, Kaposi's sarcoma, leukemia, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, leiomyosarcoma, melanoma, medulloblas Kaposi's sarcoma, leukemia, lung carcinoma, leiomyosar toma, myxofibrosarcoma, multiple myeloma, neuroblas coma, melanoma, multiple myeloma, neuroblastoma, non toma, non-Hodgkin lymphoma, non-Small cell lung carci Hodgkin lymphoma, non-small cell lung carcinoma, ovarian noma, ovarian carcinoma, oesophageal carcinoma, carcinoma, oesophageal carcinoma, osteosarcoma, pancre pancreatic carcinoma, prostate carcinoma, squamous cell car atic carcinoma, prostate carcinoma, renal cell carcinoma, cinoma of the head and neck, salivary gland tumor, thyroid rhabdomyosarcoma, Small cell lung cancer, or testicular carcinoma, or urothelial carcinoma. tumor. 0049 Further aspects include administering miR-124 and 0054. In yet further aspects, miR-124 and miR-126 are miR-15 to patients with astrocytoma, acute myeloid leuke administered to patients with astrocytoma, acute myeloid mia, breast carcinoma, B-cell lymphoma, bladder carcinoma, leukemia, breast carcinoma, Burkitt's lymphoma, bladder cervical carcinoma, carcinoma of the head and neck, chronic carcinoma, cervical carcinoma, colorectal carcinoma, myeloid leukemia, colorectal carcinoma, endometrial carci endometrial carcinoma, Ewing's sarcoma, glioma, glioblas noma, glioma, glioblastoma, gastric carcinoma, hepatoblas toma, gastric carcinoma, hepatoblastoma, hepatocellular car toma, hepatocellular carcinoma, Hodgkin lymphoma, lung cinoma, Hodgkin lymphoma, leukemia, lung carcinoma, carcinoma, laryngeal squamous cell carcinoma, melanoma, melanoma, mantle cell lymphoma, meningioma, non medulloblastoma, mantle cell lymphoma, myxofibrosar Hodgkin lymphoma, non-small cell lung carcinoma, ovarian coma, multiple myeloma, neuroblastoma, non-Hodgkin lym carcinoma, oesophageal carcinoma, oropharyngeal carci phoma, non-Small cell lung carcinoma, ovarian carcinoma, noma, osteosarcoma, pancreatic carcinoma, papillary carci oesophageal carcinoma, pancreatic carcinoma, prostate car noma, prostate carcinoma, renal cell carcinoma, rhabdomyo cinoma, renal cell carcinoma, rhabdomyosarcoma, squamous sarcoma, squamous cell carcinoma of the head and neck, cell carcinoma of the head and neck, or thyroid carcinoma. Schwannoma, Small cell lung cancer, or thyroid carcinoma 0050. In still further aspects, miR-124 and miR-16 are 0055. In a further aspect, miR-124 and miR-143 are administered to patients with astrocytoma, breast carcinoma, administered to patients with astrocytoma, anaplastic large B-cell lymphoma, bladder carcinoma, colorectal carcinoma, cell lymphoma, acute lymphoblastic leukemia, acute myeloid endometrial carcinoma, glioblastoma, gastric carcinoma, leukemia, breast carcinoma, B-cell lymphoma, bladder car hepatoblastoma, hepatocellular carcinoma, Hodgkin lym cinoma, cervical carcinoma, chronic lymphoblastic leuke phoma, laryngeal squamous cell carcinoma, melanoma, mia, chronic myeloid leukemia, colorectal carcinoma, medulloblastoma, mantle cell lymphoma, myxofibrosar endometrial carcinoma, glioma, glioblastoma, gastric carci coma, multiple myeloma, non-small cell lung carcinoma, noma, hepatocellular carcinoma, Hodgkin lymphoma, leuke US 2009/O 1921 11 A1 Jul. 30, 2009
mia, lung carcinoma, melanoma, medulloblastoma, mantle 0060. In certain aspects, miR-124 and miR-216 are cell lymphoma, multiple myeloma, non-Hodgkin lymphoma, administered to patients with astrocytoma, breast carcinoma, non-Small cell lung carcinoma, ovarian carcinoma, oesoph cervical carcinoma, carcinoma of the head and neck, colorec ageal carcinoma, osteosarcoma, pancreatic carcinoma, pros tal carcinoma, endometrial carcinoma, glioma, glioblastoma, tate carcinoma, renal cell carcinoma, squamous cell carci gastric carcinoma, hepatocellular carcinoma, Hodgkin lym noma of the head and neck, Small cell lung cancer, thyroid phoma, leukemia, lung carcinoma, mucosa-associated lym carcinoma, or testicular tumor. phoid tissue B-cell lymphoma, non-Hodgkin lymphoma, non-Small cell lung carcinoma, ovarian carcinoma, oesoph 0056. In still a further aspect, miR-124 and miR-147 are ageal carcinoma, osteosarcoma, prostate carcinoma, squa administered to patients with astrocytoma, breast carcinoma, mous cell carcinoma of the head and neck, or testicular tumor. bladder carcinoma, cervical carcinoma, colorectal carci 0061. In a further aspect, miR-124 and miR-292-3p are noma, endometrial carcinoma, glioma, glioblastoma, gastric administered to patients with astrocytoma, anaplastic large carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, cell lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, lipoma, melanoma, mantle cell lymphoma, myx leukemia, angiosarcoma, breast carcinoma, B-cell lym ofibrosarcoma, multiple myeloma, non-Hodgkin lymphoma, phoma, bladder carcinoma, cervical carcinoma, chronic non-Small cell lung carcinoma, ovarian carcinoma, oesoph myeloid leukemia, colorectal carcinoma, endometrial carci ageal carcinoma, osteosarcoma, pancreatic carcinoma, pros noma, Ewing's sarcoma, glioma, glioblastoma, gastric carci tate carcinoma, renal cell carcinoma, squamous cell carci noma, hepatoblastoma, hepatocellular carcinoma, Kaposi's noma of the head and neck, or thyroid carcinoma. sarcoma, leukemia, lung carcinoma, lipoma, leiomyosar 0057. In yet another aspect, miR-124 and miR-188 are coma, liposarcoma, laryngeal squamous cell carcinoma, administered to patients with astrocytoma, anaplastic large melanoma, myxofibrosarcoma, multiple myeloma, neuro cell lymphoma, acute myeloid leukemia, breast carcinoma, blastoma, non-Hodgkin lymphoma, nasopharyngeal carci B-cell lymphoma, Burkitt's lymphoma, bladder carcinoma, noma, non-Small cell lung carcinoma, ovarian carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, col oesophageal carcinoma, osteosarcoma, pancreatic carci orectal carcinoma, endometrial carcinoma, glioma, glioblas noma, prostate carcinoma, renal cell carcinoma, rhabdomyo toma, gastric carcinoma, hepatocellular carcinoma, leuke sarcoma, squamous cell carcinoma of the head and neck, mia, lung carcinoma, melanoma, multiple myeloma, non Schwannoma, Small cell lung cancer, thyroid carcinoma, tes Hodgkin lymphoma, non-small cell lung carcinoma, ovarian ticular tumor, urothelial carcinoma, or Wilm's tumor. carcinoma, oesophageal carcinoma, pancreatic carcinoma, 0062. In still a further aspect, miR-124 and miR-331 are prostate carcinoma, renal cell carcinoma, squamous cell car administered to patients with astrocytoma, anaplastic large cinoma of the head and neck, thyroid carcinoma, or testicular cell lymphoma, acute lymphoblastic leukemia, acute myeloid tumor. leukemia, angiosarcoma, breast carcinoma, B-cell lym 0058. In yet a further aspect, miR-124 and miR-200b/c are phoma, bladder carcinoma, cervical carcinoma, carcinoma of administered to patients with anaplastic large cell lymphoma, the head and neck, chronic lymphoblastic leukemia, colorec breast carcinoma, B-cell lymphoma, cervical carcinoma, tal carcinoma, endometrial carcinoma, glioma, glioblastoma, chronic lymphoblastic leukemia, colorectal carcinoma, gastric carcinoma, hepatocellular carcinoma, Kaposi's sar glioma, glioblastoma, gastric carcinoma, hepatocellular car coma, leukemia, lung carcinoma, leiomyosarcoma, laryngeal cinoma, leukemia, lung carcinoma, lipoma, multiple squamous cell carcinoma, melanoma, myxofibrosarcoma, myeloma, non-small cell lung carcinoma, ovarian carcinoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, oesophageal carcinoma, osteosarcoma, pancreatic carci ovarian carcinoma, oesophageal carcinoma, osteosarcoma, noma, prostate carcinoma, rhabdomyosarcoma, squamous pancreatic carcinoma, prostate carcinoma, renal cell carci cell carcinoma of the head and neck, thyroid carcinoma, or noma, rhabdomyosarcoma, squamous cell carcinoma of the testicular tumor. head and neck, Small cell lung cancer, thyroid carcinoma, or 0059. In other aspects, miR-124 and miR-215 are admin testicular tumor. istered to patients with astrocytoma, anaplastic large cell 0063. It is contemplated that when miR-124 or a miR-124 lymphoma, acute lymphoblastic leukemia, acute myeloid inhibitor is given in combination with one or more other leukemia, angiosarcoma, breast carcinoma, B-cell lym miRNA molecules, the two different miRNAs or inhibitors phoma, bladder carcinoma, cervical carcinoma, chronic lym may be given at the same time or sequentially. In some phoblastic leukemia, chronic myeloid leukemia, colorectal embodiments, therapy proceeds with one miRNA or inhibitor carcinoma, endometrial carcinoma, Ewing's sarcoma, and that therapy is followed up with therapy with the other glioma, glioblastoma, gastric carcinoma, hepatoblastoma, miRNA or inhibitor 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, hepatocellular carcinoma, Hodgkin lymphoma, Kaposi's sar 35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, coma, leukemia, lung carcinoma, lipoma, leiomyosarcoma, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, 1, 2, 3, 4, liposarcoma, melanoma, mucosa-associated lymphoid tissue 5, 6, 7 days, 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. B-cell lymphoma, mantle cell lymphoma, myxofibrosar 11, or 12 months or any such combination later. coma, multiple myeloma, neuroblastoma, non-Hodgkin lym 0064. Further embodiments include the identification and phoma, nasopharyngeal carcinoma, non-Small cell lung car assessment of an expression profile indicative of miR-124 cinoma, ovarian carcinoma, oesophageal carcinoma, status in a cell or tissue comprising expression assessment of osteosarcoma, pancreatic carcinoma, prostate carcinoma, ret one or more gene from Table 1, 3, 4, and/or 5, or any combi inoblastoma, renal cell carcinoma, rhabdomyosarcoma, nation thereof. squamous cell carcinoma of the head and neck, Schwannoma, 0065. The term “miRNA is used according to its ordinary Small cell lung cancer, salivary gland tumor, thyroid carci and plain meaning and refers to a microRNA molecule found noma, testicular tumor, urothelial carcinoma, or Wilm's in eukaryotes that is involved in RNA-based gene regulation. tumor. See, e.g., Carrington et al., 2003, which is hereby incorpo US 2009/O 1921 11 A1 Jul. 30, 2009
rated by reference. The term can be used to refer to the include, but is not limited to an estimation of the time or single-stranded RNA molecule processed from a precursor or expected time of Survival, assessment of response to a in certain instances the precursor itself or a mimetic thereof. therapy, and the like. In certain aspects, the altered expression 0066. In some embodiments, it may be useful to know of one or more gene or marker is prognostic for a patient whether a cell expresses a particular miRNA endogenously or having a pathologic condition, wherein the marker is one or whether such expression is affected under particular condi more of Table 1, 3, 4, and/or 5, including any combination tions or when it is in a particular disease state. Thus, in some thereof. embodiments of the invention, methods include assaying a 0069 Predicted gene targets are shown in Table 3. Target cell or a sample containing a cell for the presence of one or genes whose mRNA expression levels are affected by hsa more miRNA marker gene or mRNA or other analyte indica tive of the expression level of a gene of interest. Conse miR-124 represent particularly useful candidates for cancer quently, in some embodiments, methods include a step of therapy and therapy of other diseases or conditions through generating an RNA profile for a sample. The term “RNA manipulation of their expression levels. profile' or “gene expression profile' refers to a set of data 0070 Certain embodiments of the invention include deter regarding the expression pattern for one or more gene or mining expression of one or more marker, gene, or nucleic genetic marker in the sample (e.g., a plurality of nucleic acid acid segment representative of one or more genes, by using an probes that identify one or more markers or genes from Tables amplification assay, a hybridization assay, or protein assay, a 1, 3, 4, and/or 5); it is contemplated that the nucleic acid variety of which are well known to one of ordinary skill in the profile can be obtained using a set of RNAs, using for art. In certain aspects, an amplification assay can be a quan example nucleic acid amplification or hybridization tech titative amplification assay, such as quantitative RT-PCR or niques well know to one of ordinary skill in the art. The the like. In still further aspects, a hybridization assay can difference in the expression profile in the sample from a include array hybridization assays or solution hybridization patient and a reference expression profile, Such as an expres assays. The nucleic acids from a sample may be labeled from sion profile from a normal or non-pathologic sample, or a the sample and/or hybridizing the labeled nucleic acid to one digitized reference, is indicative of a pathologic, disease, or or more nucleic acid probes. Nucleic acids, mRNA, and/or cancerous condition. In certain aspects the expression profile nucleic acid probes may be coupled to a Support. Such Sup is an indicator of a propensity to or probability of (i.e., risk factor for a disease or condition) developing Such a condition ports are well known to those of ordinary skill in the art and (s). Such a risk or propensity may indicate a treatment, include, but are not limited to glass, plastic, metal, or latex. In increased monitoring, prophylactic measures, and the like. A particular aspects of the invention, the Support can be planar nucleic acid or probe set may comprise or identify a segment or in the form of a bead or other geometric shapes or configu of a corresponding mRNA and may include all or part of 1, 2, rations known in the art. Proteins are typically assayed by 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, immunoblotting, chromatography, or mass spectrometry or 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33,34, 35,36, 37,38, other methods known to those of ordinary skill in the art. 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55, 0071. The present invention also concerns kits containing 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more segments, compositions of the invention or compositions to implement including any integer or range derivable there between, of a methods of the invention. In some embodiments, kits can be gene or genetic marker, or a nucleic acid, mRNA or a probe used to evaluate one or more marker molecules, and/or representative thereofthat is listed in Tables 1, 3, 4, and/or 5 express one or more miRNA or miRNA inhibitor. In certain or identified by the methods described herein. embodiments, a kit contains, contains at least or contains at 0067. Certain embodiments of the invention are directed most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, to compositions and methods for assessing, prognosing, or 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, treating a pathological condition in a patient comprising mea 36, 37,38, 39, 40, 41,42, 43,44, 45,46, 47,48, 49, 50, 51, 52, Suring or determining an expression profile of one or more 53, 54, 55, 56, 57, 58, 59, 60, 61, 100, 150, 200 or more miRNA or marker(s) in a sample from the patient, wherein a probes, recombinant nucleic acid, or synthetic nucleic acid difference in the expression profile in the sample from the molecules related to the markers to be assessed oran miRNA patient and an expression profile of a normal sample or ref or miRNA inhibitor to be expressed or modulated, and may erence expression profile is indicative of pathological condi include any range or combination derivable therein. Kits may tion and particularly cancer (e.g., In certain aspects of the comprise components, which may be individually packaged invention, the miRNAS, cellular pathway, gene, or genetic or placed in a container, Such as a tube, bottle, vial, Syringe, or marker is or is representative of one or more pathway or other Suitable container means. Individual components may marker described in Table 1, 2, 3, 4, and/or 5, including any also be provided in a kit in concentrated amounts; in some combination thereof. embodiments, a component is provided individually in the 0068 Aspects of the invention include diagnosing, assess same concentration as it would be in a solution with other ing, or treating a pathologic condition or preventing a patho components. Concentrations of components may be provided logic condition from manifesting. For example, the methods as 1x, 2x, 5x, 10x, or 20x or more. Kits for using probes, can be used to screen for a pathological condition; assess synthetic nucleic acids, recombinant nucleic acids, or non prognosis of a pathological condition; stage a pathological synthetic nucleic acids of the invention for therapeutic, prog condition; assess response of a pathological condition to nostic, or diagnostic applications are included as part of the therapy, or to modulate the expression of a gene, genes, or invention. Specifically contemplated are any such molecules related pathway as a first therapy or to render a Subject sen corresponding to any miRNA reported to influence biological sitive or more responsive to a second therapy. In particular activity or expression of one or more marker gene or gene aspects, assessing the pathological condition of the patient pathway described herein. In certain aspects, negative and/or can be assessing prognosis of the patient. Prognosis may positive controls are included in some kit embodiments. The US 2009/O 1921 11 A1 Jul. 30, 2009
control molecules can be used to verify transfection effi herein with respect to miRNA molecules, miRNA, genes, and ciency and/or control for transfection-induced changes in Certain embodiments of the invention include determining cells. expression of one or more marker, gene, or nucleic acid 0072 Certain embodiments are directed to a kit for assess representative thereof, by using an amplification assay, a ment of a pathological condition or the risk of developing a hybridization assay, or protein assay, a variety of which are pathological condition in a patient by nucleic acid profiling of well known to one of ordinary skill in the art. In certain a sample comprising, in Suitable container means, two or aspects, an amplification assay can be a quantitative amplifi more nucleic acid hybridization or amplification reagents. cation assay, such as quantitative RT-PCR or the like. In still The kit can comprise reagents for labeling nucleic acids in a further aspects, a hybridization assay can include array sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization hybridization assays or Solution hybridization assays. The probes. Amplification reagents include, but are not limited to nucleic acids from a sample may be labeled from the sample amplification primers, reagents, and enzymes. and/or hybridizing the labeled nucleic acid to one or more 0073. In some embodiments of the invention, an expres nucleic acid probes. Nucleic acids, mRNA, and/or nucleic sion profile is generated by steps that include: (a) labeling acid probes may be coupled to a Support. Such supports are nucleic acid in the sample; (b) hybridizing the nucleic acid to well known to those of ordinary skill in the art and include, but a number of probes, or amplifying a number of nucleic acids, are not limited to glass, plastic, metal, or latex. In particular and (c) determining and/or quantitating nucleic acid hybrid aspects of the invention, the Support can be planar or in the ization to the probes or detecting and quantitating amplifica form of a bead or other geometric shapes or configurations tion products, wherein an expression profile is generated. See known in the art. Protein are typically assayed by immunob U.S. Provisional Patent Application 60/575,743 and the U.S. lotting, chromatography, or mass spectrometry or other meth Provisional Patent Application 60/649.584, and U.S. patent ods known to those of ordinary skill in the art. application Ser. No. 1 1/141,707 and U.S. patent application 0077. The present invention also concerns kits containing Ser. No. 1 1/273,640, all of which are hereby incorporated by compositions of the invention or compositions to implement reference. methods of the invention. In some embodiments, kits can be 0074 Methods of the invention involve diagnosing and/or used to evaluate one or more marker molecules, and/or assessing the prognosis of a patient based on a miRNA and/or express one or more miRNA. In certain embodiments, a kit a marker nucleic acid expression profile. In certain embodi contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, ments, the elevation or reduction in the level of expression of 7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, a particular gene or genetic pathway or set of nucleic acids in 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41, a cell is correlated with a disease state or pathological condi 42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, tion compared to the expression level of the same in a normal 59, 60, 61,100, 150, 200 or more probes, recombinant nucleic or non-pathologic cell or tissue sample. This correlation acid, or synthetic nucleic acid molecules related to the mark allows for diagnostic and/or prognostic methods to be carried ers to be assessed oran miRNA to be expressed or modulated, out when the expression level of one or more nucleic acid is and may include any range or combination derivable therein. measured in a biological sample being assessed and then Kits may comprise components, which may be individually compared to the expression level of a normal or non-patho packaged or placed in a container, such as a tube, bottle, vial, logic cell or tissue sample. It is specifically contemplated that Syringe, or other Suitable container means. Individual com expression profiles for patients, particularly those Suspected ponents may also be provided in a kit in concentrated of having or having a propensity for a particular disease or amounts; in some embodiments, a component is provided condition Such as cancer, can be generated by evaluating any individually in the same concentration as it would be in a oforsets of the miRNAs and/or nucleic acids discussed in this Solution with other components. Concentrations of compo application. The expression profile that is generated from the nents may be provided as 1x, 2x, 5x, 10x, or 20x or more. Kits patient will be one that provides information regarding the for using probes, synthetic nucleic acids, recombinant nucleic particular disease or condition. In many embodiments, the acids, or non-synthetic nucleic acids of the invention for profile is generated using nucleic acid hybridization or ampli therapeutic, prognostic, or diagnostic applications are fication, (e.g., array hybridization or RT-PCR). In certain included as part of the invention. Specifically contemplated aspects, an expression profile can be used in conjunction with are any such molecules corresponding to any miRNA other diagnostic and/or prognostic tests, such as histology, reported to influence biological activity or expression of one protein profiles in the serum and/or cytogenetic assessment. or more marker gene or gene pathway described herein. In 0075. The methods can further comprise one or more of certain aspects, negative and/or positive controls are included the steps including: (a) obtaining a sample from the patient, in Some kit embodiments. The control molecules can be used (b) isolating nucleic acids from the sample, (c) labeling the to verify transfection efficiency and/or control for transfec nucleic acids isolated from the sample, and (d) hybridizing tion-induced changes in cells. the labeled nucleic acids to one or more probes. Nucleic acids 0078 Certain embodiments are directed to a kit for assess of the invention include one or more nucleic acid comprising ment of a pathological condition or the risk of developing a at least one segment having a sequence or complementary pathological condition in a patient by nucleic acid profiling of sequence of to a nucleic acid representative of one or more of a sample comprising in Suitable container means, two or more genes or markers in Table 1, 3, 4, and/or 5. nucleic acid hybridization or amplification reagents. The kit 0076. It is contemplated that any method or composition can comprise reagents for labeling nucleic acids in a sample described herein can be implemented with respect to any and/or nucleic acid hybridization reagents. The hybridization other method or composition described herein and that dif reagents typically comprise hybridization probes. Amplifica ferent embodiments may be combined. It is specifically con tion reagents include, but are not limited to amplification templated that any methods and compositions discussed primers, reagents, and enzymes. US 2009/O 1921 11 A1 Jul. 30, 2009
0079. In some embodiments of the invention, an expres least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90,91, 92,93, 94, sion profile is generated by steps that include: (a) labeling 95, 96, 97,98, 99% identical to the mature sequence of the nucleic acid in the sample; (b) hybridizing the nucleic acid to specified miRNA. a number of probes, or amplifying a number of nucleic acids, 0084. It will be further understood that shorthand nota and (c) determining and/or quantitating nucleic acid hybrid tions are employed such that a generic description of agene or ization to the probes or detecting and quantitating amplifica marker thereof, or of a miRNA refers to any of its gene family tion products, wherein an expression profile is generated. See members (distinguished by a number) or representative frag U.S. Provisional Patent Application 60/575,743 and the U.S. ments thereof, unless otherwise indicated. It is understood by Provisional Patent Application 60/649.584, and U.S. patent those of skill in the art that a “gene family’ refers to a group application Ser. No. 1 1/141,707 and U.S. patent application of genes having the same coding sequence or miRNA coding Ser. No. 1 1/273,640, all of which are hereby incorporated by sequence. Typically, miRNA members of a gene family are reference. identified by a number following the initial designation. For 0080 Methods of the invention involve diagnosing and/or example, miR-16-1 and miR-16-2 are members of the miR assessing the prognosis of a patient based on a miRNA and/or 16 gene family and “mir-7 refers to miR-7-1, miR-7-2 and a marker nucleic acid expression profile. In certain embodi miR-7-3. Moreover, unless otherwise indicated, a shorthand ments, the elevation or reduction in the level of expression of notation refers to related miRNAs (distinguished by a letter). a particular gene or genetic pathway or set of nucleic acids in Exceptions to these shorthand notations will be otherwise a cell is correlated with a disease state or pathological condi identified. tion compared to the expression level of the same in a normal 0085. Other embodiments of the invention are discussed or non-pathologic cell or tissue sample. This correlation throughout this application. Any embodiment discussed with allows for diagnostic and/or prognostic methods to be carried respect to one aspect of the invention applies to other aspects out when the expression level of one or more nucleic acid is of the invention as well and vice versa. The embodiments in measured in a biological sample being assessed and then the Example and Detailed Description section are understood compared to the expression level of a normal or non-patho to be embodiments of the invention that are applicable to all logic cell or tissue sample. It is specifically contemplated that aspects of the invention. expression profiles for patients, particularly those Suspected I0086. The terms “inhibiting,” “reducing,” or “prevention.” of having or having a propensity for a particular disease or or any variation of these terms, when used in the claims and/or condition Such as cancer, can be generated by evaluating any the specification includes any measurable decrease or com oforsets of the miRNAs and/or nucleic acids discussed in this plete inhibition to achieve a desired result. application. The expression profile that is generated from the 0087. The use of the word “a” or “an when used in con patient will be one that provides information regarding the junction with the term “comprising in the claims and/or the particular disease or condition. In many embodiments, the specification may mean “one but it is also consistent with profile is generated using nucleic acid hybridization or ampli the meaning of"one or more.” “at least one.” and “one or more fication, (e.g., array hybridization or RT-PCR). In certain than one.” aspects, an expression profile can be used in conjunction with I0088. Throughout this application, the term “about is other diagnostic and/or prognostic tests, such as histology, used to indicate that a value includes the standard deviation of protein profiles in the serum and/or cytogenetic assessment. error for the device or method being employed to determine 0081. The methods can further comprise one or more of the value. the steps including: (a) obtaining a sample from the patient, 0089. The use of the term “or' in the claims is used to (b) isolating nucleic acids from the sample, (c) labeling the mean “and/or unless explicitly indicated to refer to alterna nucleic acids isolated from the sample, and (d) hybridizing tives only or the alternatives are mutually exclusive, although the labeled nucleic acids to one or more probes. Nucleic acids the disclosure supports a definition that refers to only alter of the invention include one or more nucleic acid comprising natives and “and/or.” at least one segment having a sequence or complementary 0090. As used in this specification and claim(s), the words sequence of to a nucleic acid representative of one or more of “comprising (and any form of comprising, such as "com genes or markers in Table 1, 3, 4, and/or 5. prise' and "comprises”), “having (and any form of having, 0082 It is contemplated that any method or composition such as “have and “has'), “including' (and any form of described herein can be implemented with respect to any including, such as “includes and “include’) or “containing other method or composition described herein and that dif (and any form of containing, such as “contains and “con ferent embodiments may be combined. It is specifically con tain’) are inclusive or open-ended and do not exclude addi templated that any methods and compositions discussed tional, unrecited elements or method steps. herein with respect to miRNA molecules, miRNA, genes and 0091. Other objects, features and advantages of the nucleic acids representative of genes may be implemented present invention will become apparent from the following with respect to synthetic nucleic acids. In some embodiments detailed description. It should be understood, however, that the synthetic nucleic acid is exposed to the proper conditions the detailed description and the specific examples, while indi to allow it to become a processed or mature nucleic acid, Such cating specific embodiments of the invention, are given by as a miRNA under physiological circumstances. The claims way of illustration only, since various changes and modifica originally filed are contemplated to cover claims that are tions within the spirit and scope of the invention will become multiply dependent on any filed claim or combination of filed apparent to those skilled in the art from this detailed descrip claims. tion. 0083. Also, any embodiment of the invention involving specific genes (including representative fragments there of), DESCRIPTION OF THE DRAWINGS mRNA, or miRNAs by name is contemplated also to cover 0092. The following drawings form part of the present embodiments involving miRNAS whose sequences are at specification and are included to further demonstrate certain US 2009/O 1921 11 A1 Jul. 30, 2009 aspects of the present invention. The invention may be better <0.01 are indicated by an asterisk or circles, respectively. understood by reference to one or more of these drawings in Abbreviation: miR-124a, hsa-miR-124a: NC, negative con combination with the detailed description of specific embodi trol miRNA. ments presented herein. 0101 FIG. 9. Percent (%) proliferation of hsa-miR-124a treated human prostate cancer cells relative to cells treated 0093 FIG. 1. Genes affected by hsa-miR-124a that func with negative control miRNA (100%). Abbreviations: miR tion in the regulation of the cell cycle. A description of the 124a, hsa-miR-124a, siEg5, siRNA against the motor protein graph and the function of each molecule are presented in kinesin 11 (Eg5): NC, negative control miRNA. Standard Table 9. Molecules in circles are differentially expressed deviations are indicated in the graph. upon transfection withhsa-miR-124a (see also Table 1). Solid 0102 FIG. 10. Long-term effects of hsa-miR-124a on cul lines represent direct interactions between molecules (e.g., tured human PPC-1, PC3 and Du145 prostate cancer cells. phosphorylation); dotted lines indicate indirect interactions. Equal numbers of prostate cancer cells were electroporated Lines that end in arrows indicate an activating action; lines with 1.6 uMhsa-miR-124a or negative control miRNA (NC). that end into circles denote an inhibitory action. G1, gap 1 seeded and propagated in regular growth medium. When the phase; S, synthesis phase; G2, gap 2 phase; M. mitosis phase; control cells reached confluence (days 4 and 11 for PPC-1; R1, restriction point 1; R2, restriction point 2. days 7 and 14 for PC3 and Du 145), cells were harvested, 0094 FIG. 2. Percent (%) proliferation of hsa-miR-124a counted and electroporated again with the respective miR treated lung cancer cells relative to cells treated with negative NAS. The population doubling and cumulative cell counts control miRNA (100%). Abbreviations: miR-124a, hsa-miR were calculated and plotted on a linear Scale. Arrows repre 124a: siEg5, siRNA against the motor protein kinesin 11 sent electroporation days. Abbreviation: miR-124a, hsa-miR (Eg5); Etopo, etoposide: NC, negative control miRNA. Stan 124a: NC, negative control miRNA. 0103 FIG. 11. Average tumor volumes in groups of four dard deviations are indicated in the graph. (n=4) mice carrying human PC3 prostate cancer Xenografts. 0095 FIG. 3. Dose dependent inhibition of various lung Palpable tumors were treated with hsa-miR-124a (black cancer cell lines by hsa-miR-124a using Alamar Blue prolif circles) or with a negative control miRNA (NC, white eration assays. Cell proliferation is reported as % prolifera squares) on days 38 and 40 (arrows). Standard deviations are tion relative to % proliferation of mock-transfected cells (0 shown in the graph. The p value for data points obtained on pM=100% proliferation). Standard deviations are indicated day 41 is shown (p=0.0266). Abbreviation: miR-124a, hsa in the graphs. Abbreviations: NC, negative control miRNA. miR-124a: NC, negative control miRNA. 0096 FIG. 4. Long-term effects of hsa-miR-124a on cul 0104 FIG. 12. Percent (%) proliferation of hsa-miR-124a tured human H226 lung cancer cells. Equal numbers of H226 treated human liver cancer cells relative to cells treated with cells were electroporated with 1.6 uMhsa-miR-124a or nega negative control miRNA (100%). Abbreviations: miR-124a, tive control miRNA (NC), seeded and propagated in regular hsa-miR-124a, siEg5, siRNA against the motor protein kine growth medium. When the control cells reached confluence sin 11 (Eg5): NC, negative control miRNA. Standard devia (days 6, and 17 and 25), cells were harvested, counted and tions are indicated in the graph. electroporated again with the respective miRNAs. The popu lation doubling and cumulative cell counts was calculated and DETAILED DESCRIPTION OF THE INVENTION plotted on a linear scale. Arrows represent electroporation days. Abbreviation: miR-124a, hsa-miR-124a: NC, negative 0105. The present invention is directed to compositions control miRNA. and methods relating to the identification and characteriza 0097 FIG. 5. Percent (%) proliferation of H460 lung can tion of genes and biological pathways related to these genes cer cells following administration of various combinations of as represented by the expression of the identified genes, as microRNAs. A positive sign under each bar in the graph well as use of miRNAs related to such, for therapeutic, prog indicates that the miRNA was present in the administered nostic, and diagnostic applications, particularly those meth combination. Standard deviations are shown in the graph. ods and compositions related to assessing and/or identifying Abbreviations: Etopo, etoposide: NC, negative control pathological conditions directly or indirectly related to miR miRNA. 124 expression or the aberrant expression thereof. 0106. In certain aspects, the invention is directed to meth 0098 FIG. 6. Average tumor volumes in mice harboring ods for the assessment, analysis, and/or therapy of a cell or xenografts of A549 lung cancer cells treated with hsa-miR Subject where certain genes have a reduced or increased 124a or with a negative control miRNA (NC). Standard devia expression (relative to normal) as a result of an increased or tions are shown in the graph. Thep value, indicating statistical decreased expression of any one or a combination of miR-124 significance, is shown for values obtained on day 16 (p=0. family members (including, but not limited to SEQID NO:1 0036). to SEQID NO:52) and/or genes with an increased expression 0099 FIG. 7. Tumor volumes in mice harboring (relative to normal) as a result of an increased or decreased xenografts of H460 lung cancer cells treated with hsa-miR expression of one or a combination of miR-124 family mem 124a or with a negative control miRNA (NC). Circles repre bers. The expression profile and/or response to miR-124 sent the presence of a tumor in a mouse on the indicated day. expression or inhibition may be indicative of a disease or an Numbers inside circles represent the tumor volume in mm. individual with a condition, e.g., cancer. 0100 FIG. 8. Average tumor volumes in groups of six 0107 Prognostic assays featuring any one or combination (n-6) mice carrying human H460 lung cancer Xenografts. of the miRNAs listed or the markers listed (including nucleic Palpable tumors were treated with hsa-miR-124a (white acids representative thereof) could be used in assessment of a squares) or with a negative control miRNA (NC, black dia patient to determine what if any treatment regimen is justi monds) on days 11, 14, and 17 (arrows). Standard deviations fied. As with the diagnostic assays mentioned above, the are shown in the graph. Data points with p values <0.05 and absolute values that define low expression will depend on the US 2009/O 1921 11 A1 Jul. 30, 2009
platform used to measure the miRNA(s). The same methods 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, described for the diagnostic assays could be used for prog 125, 126, 127, 128, 129, 130, 140, 145, 150, 160, 170, 180, nostic assays. 190, 200 or more residues in length, including any integer or any range there between. I. THERAPEUTIC METHODS 0111. In certain embodiments, synthetic miRNA have (a) 0108 Embodiments of the invention concern nucleic a “miRNA region' whose sequence or binding region from 5' acids that perform the activities of or inhibit endogenous to 3' is identical or complementary to all or a segment of a miRNAs when introduced into cells. In certain aspects, mature miRNA sequence, and (b) a “complementary region' nucleic acids are synthetic or non-synthetic miRNA. whose sequence from 5' to 3' is between 60% and 100% Sequence-specific miRNA inhibitors can be used to inhibit complementary to the miRNA sequence in (a). In certain sequentially or in combination the activities of one or more embodiments, these synthetic miRNA are also isolated, as endogenous miRNAS in cells, as well those genes and asso defined above. The term “miRNA region” refers to a region ciated pathways modulated by the endogenous miRNA. on the synthetic miRNA that is at least 75, 80, 85,90, 95, or 0109 The present invention concerns, in some embodi 100% identical, including all integers there between, to the ments, short nucleic acid molecules that function as miRNAS entire sequence of a mature, naturally occurring miRNA or as inhibitors of miRNA in a cell. The term "short” refers to a length of a single polynucleotide that is 15, 16, 17, 18, 19. sequence or a complement thereof. In certain embodiments, 20, 21, 22, 23, 24, 25, 50, 100, or 150 nucleotides or fewer, the miRNA region is or is at least 90,91, 92,93, 94.95, 96.97, including all integers or ranges derivable there between. The 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or nucleic acid molecules are typically synthetic. The term "syn 100% identical to the sequence of a naturally-occurring thetic' refers to nucleic acid molecule that is isolated and not miRNA or complement thereof. produced naturally in a cell. In certain aspects the sequence 0112 The term “complementary region' or “comple (the entire sequence) and/or chemical structure deviates from ment” refers to a region of a nucleic acid or mimetic that is or a naturally-occurring nucleic acid molecule, such as an is at least 60% complementary to the mature, naturally occur endogenous precursor miRNA or miRNA molecule or ring miRNA sequence. The complementary region is or is at complement thereof. While in some embodiments, nucleic least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,74, acids of the invention do not have an entire sequence that is 75, 76, 77,78, 79,80, 81,82, 83, 84,85, 86,87, 88, 89,90,91, identical or complementary to a sequence of a naturally 92,93,94, 95, 96, 97,98,99,99.1,99.2, 99.3,99.4,99.5, 99.6, occurring nucleic acid, such molecules may encompass all or 99.7. 99.8, 99.9 or 100% complementary, or any range deriv part of a naturally-occurring sequence or a complement able therein. With single polynucleotide sequences, there thereof. It is contemplated, however, that a synthetic nucleic may be a hairpin loop structure as a result of chemical bond acid administered to a cell may Subsequently be modified or ing between the miRNA region and the complementary altered in the cell Such that its structure or sequence is the region. In other embodiments, the complementary region is same as non-synthetic or naturally occurring nucleic acid, on a different nucleic acid molecule than the miRNA region, Such as a mature miRNA sequence. For example, a synthetic in which case the complementary region is on the comple nucleic acid may have a sequence that differs from the mentary Strand and the miRNA region is on the active strand. sequence of a precursor miRNA, but that sequence may be 0113. In other embodiments of the invention, there are altered once in a cell to be the same as an endogenous, synthetic nucleic acids that are miRNA inhibitors. A miRNA processed miRNA or an inhibitor thereof. The term "isolated inhibitor is between about 17 to 25 nucleotides in length and means that the nucleic acid molecules of the invention are comprises a 5' to 3' sequence that is at least 90% complemen initially separated from different (in terms of sequence or tary to the 5' to 3' sequence of a mature miRNA. In certain structure) and unwanted nucleic acid molecules Such that a embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, population of isolated nucleic acids is at least about 90% 21, 22, 23, 24, or 25 nucleotides in length, or any range homogenous, and may be at least about 95, 96, 97,98, 99, or derivable therein. Moreover, an miRNA inhibitor may have a 100% homogenous with respect to other polynucleotide mol sequence (from 5' to 3') that is or is at least 70, 75, 80, 85,90, ecules. In many embodiments of the invention, a nucleic acid 91, 92,93, 94, 95, 96, 97,98, 99,99.1, 99.2, 99.3, 99.4, 99.5, is isolated by virtue of it having been synthesized in vitro 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range separate from endogenous nucleic acids in a cell. It will be derivable therein, to the 5' to 3' sequence of a mature miRNA, understood, however, that isolated nucleic acids may be Sub particularly a mature, naturally occurring miRNA. One of sequently mixed or pooled together. In certain aspects, Syn skill in the art could use a portion of the miRNA sequence that thetic miRNA of the invention are RNA or RNA analogs. is complementary to the sequence of a mature miRNA as the miRNA inhibitors may be DNA or RNA, or analogs thereof. sequence for a miRNA inhibitor. Moreover, that portion of the miRNA and miRNA inhibitors of the invention are collec nucleic acid sequence can be altered so that it is still com tively referred to as “synthetic nucleic acids.” prises the appropriate percentage of complementarity to the 0110. In some embodiments, there is a miRNA or a syn sequence of a mature miRNA. thetic miRNA having a length of between 17 and 130 resi 0114. In some embodiments, of the invention, a synthetic dues. The present invention concerns miRNA or synthetic miRNA or inhibitor contains one or more design element(s). miRNA molecules that are, are at least, or are at most 15, 16, These design elements include, but are not limited to: (i) a 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, replacement group for the phosphate or hydroxyl of the nucle 34,35,36, 37,38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, otide at the 5' terminus of the complementary region; (ii) one 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, 67, or more Sugar modifications in the first or last 1 to 6 residues 68, 69,70, 71,72, 73,74, 75,76, 77,78, 79,80, 81, 82, 83, 84, of the complementary region; or, (iii) noncomplementarity 85, 86, 87, 88, 89,90,91, 92,93, 94, 95, 96, 97,98, 99, 100, between one or more nucleotides in the last 1 to 5 residues at 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, the 3' end of the complementary region and the corresponding US 2009/O 1921 11 A1 Jul. 30, 2009
nucleotides of the miRNA region. A variety of design modi as a result of bonding between the miRNA region and the fications are known in the art, see below. complementary region. The linker constitutes the hairpin 0115. In certain embodiments, a synthetic miRNA has a loop. It is contemplated that in Some embodiments, the linker nucleotide at its 5' end of the complementary region in which region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, the phosphate and/or hydroxyl group has been replaced with 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, another chemical group (referred to as the “replacement 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in design). In some cases, the phosphate group is replaced, length, or any range derivable therein. In certain embodi while in others, the hydroxyl group has been replaced. In ments, the linker is between 3 and 30 residues (inclusive) in particular embodiments, the replacement group is biotin, an length. amine group, a lower alkylamine group, an aminohexyl phos I0121. In addition to having a miRNA or inhibitor region phate group, an acetyl group, 2"O-Me (2'oxygen-methyl), and a complementary region, there may be flanking DMTO (4,4'-dimethoxytrity1 with oxygen), fluorescein, a sequences as well at either the 5' or 3' end of the region. In thiol, or acridine, though other replacement groups are well some embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, known to those of skill in the art and can be used as well. This 9, 10 nucleotides or more, or any range derivable therein, design element can also be used with a miRNA inhibitor. flanking one or both sides of these regions. 0116. Additional embodiments concern a synthetic I0122) Methods of the invention include reducing or elimi miRNA having one or more Sugar modifications in the first or nating activity of one or more miRNAS in a cell comprising last 1 to 6 residues of the complementary region (referred to introducing into a cell a miRNA inhibitor (which may be as the 'Sugar replacement design). In certain cases, there is described generally hereinas an miRNA, so that a description one or more Sugar modifications in the first 1, 2, 3, 4, 5, 6 or of miRNA, where appropriate, also will refer to a miRNA more residues of the complementary region, or any range inhibitor); or Supplying or enhancing the activity of one or derivable therein. In additional cases, there are one or more more miRNAs in a cell. The present invention also concerns Sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues inducing certain cellular characteristics by providing to a cell of the complementary region, or any range derivable therein, a particular nucleic acid, such as a specific synthetic miRNA have a sugar modification. It will be understood that the terms molecule or a synthetic miRNA inhibitor molecule. However, “first and “last’ are with respect to the order of residues from in methods of the invention, the miRNA molecule or miRNA the 5' end to the 3' end of the region. In particular embodi inhibitor need not be synthetic. They may have a sequence ments, the sugar modification is a 2"O-Me modification, a 2F that is identical to a naturally occurring miRNA or they may modification, a 2H modification, a 2'amino modification, a not have any design modifications. In certain embodiments, 4'thioribose modification or a phosphorothioate modification the miRNA molecule and/or the miRNA inhibitor are syn on the carboxy group linked to the carbon at position 6'. In thetic, as discussed above. further embodiments, there are one or more Sugar modifica I0123. The particular nucleic acid molecule provided to the tions in the first or last 2 to 4 residues of the complementary cell is understood to correspond to a particular miRNA in the region or the first or last 4 to 6 residues of the complementary cell, and thus, the miRNA in the cell is referred to as the region. This design element can also be used with a miRNA “corresponding miRNA. In situations in which a named inhibitor. Thus, a miRNA inhibitor can have this design ele miRNA molecule is introduced into a cell, the corresponding ment and/or a replacement group on the nucleotide at the 5' miRNA will be understood to be the induced or inhibited terminus, as discussed above. miRNA function. It is contemplated, however, that the 0117. In other embodiments of the invention, there is a miRNA molecule introduced into a cell is not a mature synthetic miRNA or inhibitor in which one or more nucle miRNA but is capable of becoming or functioning as a mature otides in the last 1 to 5 residues at the 3' end of the comple miRNA under the appropriate physiological conditions. In mentary region are not complementary to the corresponding cases in which a particular corresponding miRNA is being nucleotides of the miRNA region (“noncomplementarity”) inhibited by a miRNA inhibitor, the particular miRNA will be (referred to as the “noncomplementarity design). The non referred to as the “targeted miRNA. It is contemplated that complementarity may be in the last 1,2,3,4, and/or 5 residues multiple corresponding miRNAs may be involved. In particu of the complementary miRNA. In certain embodiments, there lar embodiments, more than one miRNA molecule is intro is noncomplementarity with at least 2 nucleotides in the duced into a cell. Moreover, in other embodiments, more than complementary region. one miRNA inhibitor is introduced into a cell. Furthermore, a 0118. It is contemplated that synthetic miRNA of the combination of miRNA molecule(s) and miRNA inhibitor(s) invention have one or more of the replacement, Sugar modi may be introduced into a cell. The inventors contemplate that fication, or noncomplementarity designs. In certain cases, a combination of miRNA may act at one or more points in synthetic RNA molecules have two of them, while in others cellular pathways of cells with aberrant phenotypes and that these molecules have all three designs in place. Such combination may have increased efficacy on the target 0119 The miRNA region and the complementary region cell while not adversely effecting normal cells. Thus, a com may be on the same or separate polynucleotides. In cases in bination of miRNA may have a minimal adverse effect on a which they are contained on or in the same polynucleotide, Subject or patient while Supplying a sufficient therapeutic the miRNA molecule will be considered a single polynucle effect, Such as amelioration of a condition, growth inhibition otide. In embodiments in which the different regions are on of a cell, death of a targeted cell, alteration of cell phenotype separate polynucleotides, the synthetic miRNA will be con or physiology, slowing of cellular growth, sensitization to a sidered to be comprised of two polynucleotides. second therapy, sensitization to a particular therapy, and the 0120 When the RNA molecule is a single polynucleotide, like. there can be a linker region between the miRNA region and 0.124 Methods include identifying a cell or patient in need the complementary region. In some embodiments, the single of inducing those cellular characteristics. Also, it will be polynucleotide is capable of forming a hairpin loop structure understood that an amount of a synthetic nucleic acid that is US 2009/O 1921 11 A1 Jul. 30, 2009 provided to a cellor organism is an “effective amount,” which tering to the cell or organism a nucleic acid molecule that refers to an amount needed (or a sufficient amount) to achieve functions as the corresponding miRNA once inside the cell. a desired goal. Such as inducing a particular cellular charac The form of the molecule provided to the cell may not be the teristic(s). form that acts a miRNA once inside the cell. Thus, it is 0.125. In certain embodiments of the methods include pro contemplated that in some embodiments, a synthetic miRNA viding or introducing to a cell a nucleic acid molecule corre or a nonsynthetic miRNA is provided such that it becomes sponding to a mature miRNA in the cell in an amount effec processed into a mature and active miRNA once it has access tive to achieve a desired physiological result. to the cell's miRNA processing machinery. In certain 0126. Moreover, methods can involve providing synthetic embodiments, it is specifically contemplated that the miRNA or nonsynthetic miRNA molecules. It is contemplated that in molecule provided is not a mature miRNA molecule but a these embodiments, that methods may or may not be limited nucleic acid molecule that can be processed into the mature to providing only one or more synthetic miRNA molecules or miRNA once it is accessible to miRNA processing machin only one or more nonsynthetic miRNA molecules. Thus, in ery. The term “nonsynthetic' in the context of miRNA means certain embodiments, methods may involve providing both that the miRNA is not “synthetic.' as defined herein. Further synthetic and nonsynthetic miRNA molecules. In this situa more, it is contemplated that in embodiments of the invention tion, a cell or cells are most likely provided a synthetic that concern the use of synthetic miRNAs, the use of corre miRNA molecule corresponding to a particular miRNA and a sponding nonsynthetic miRNAS is also considered an aspect nonsynthetic miRNA molecule corresponding to a different of the invention, and vice versa. It will be understand that the miRNA. Furthermore, any method articulated using a list of term “providing an agent is used to include “administering miRNAS using Markush group language may be articulated the agent to a patient. without the Markush group language and a disjunctive article 0.131. In certain embodiments, methods also include tar (i.e., or) instead, and vice versa. geting a miRNA to modulate in a cell or organism. The term 0127. In some embodiments, there is a method for reduc “targeting a miRNA to modulate” means a nucleic acid of the ing or inhibiting cell proliferation in a cell comprising intro invention will be employed so as to modulate the selected ducing into or providing to the cell an effective amount of (i) miRNA. In some embodiments the modulation is achieved an miRNA inhibitor molecule or (ii) a synthetic or nonsyn with a synthetic or non-synthetic miRNA that corresponds to thetic miRNA molecule that corresponds to a miRNA the targeted miRNA, which effectively provides the targeted sequence. In certain embodiments the methods involves miRNA to the cellor organism (positive modulation). In other introducing into the cell an effective amount of (i) a miRNA embodiments, the modulation is achieved with a miRNA inhibitor molecule having a 5' to 3' sequence that is at least inhibitor, which effectively inhibits the targeted miRNA in 90% complementary to the 5' to 3' sequence of one or more the cell or organism (negative modulation). mature miRNA. 0.132. In some embodiments, the miRNA targeted to be 0128 Certain embodiments of the invention include meth modulated is a miRNA that affects a disease, condition, or ods of treating a pathologic condition, in particular cancer, pathway. In certain embodiments, the miRNA is targeted e.g., lung or liver cancer. In one aspect, the method comprises because a treatment can be provided by negative modulation contacting a target cell with one or more nucleic acid, Syn of the targeted miRNA. In other embodiments, the miRNA is thetic miRNA, or miRNA comprising at least one nucleic acid targeted because a treatment can be provided by positive segment having all or a portion of a miRNA sequence. The modulation of the targeted miRNA or its targets. segment may be 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 0133. In certain methods of the invention, there is a further 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides or nucleotide step of administering the selected miRNA modulator to a cell, analog, including all integers there between. An aspect of the tissue, organ, or organism (collectively “biological matter”) invention includes the modulation of gene expression, in need of treatment related to modulation of the targeted miRNA expression or function or mRNA expression or func miRNA or in need of the physiological or biological results tion within a target cell. Such as a cancer cell. discussed herein (such as with respect to a particular cellular 0129. Typically, an endogenous gene, miRNA or mRNA is pathway or result like decrease in cell viability). Conse modulated in the cell. In particular embodiments, the nucleic quently, in some methods of the invention there is a step of acid sequence comprises at least one segment that is at least identifying a patient in need of treatment that can be provided 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid by the miRNA modulator(s). It is contemplated that an effec sequence to one or more miRNA or gene sequence. Modula tive amount of a miRNA modulator can be administered in tion of the expression or processing of an endogenous gene, Some embodiments. In particular embodiments, there is a miRNA, or mRNA can be through modulation of the process therapeutic benefit conferred on the biological matter, where ing of a mRNA, such processing including transcription, a “therapeutic benefit” refers to an improvement in the one or transportation and/or translation with in a cell. Modulation more conditions or symptoms associated with a disease or may also be effected by the inhibition or enhancement of condition or an improvement in the prognosis, duration, or miRNA activity with a cell, tissue, or organ. Such processing status with respect to the disease. It is contemplated that a may affect the expression of an encoded product or the sta therapeutic benefit includes, but is not limited to, a decrease in bility of the mRNA. In still other embodiments, a nucleic acid pain, a decrease in morbidity, a decrease in a symptom. For sequence can comprise a modified nucleic acid sequence. In example, with respect to cancer, it is contemplated that a certain aspects, one or more miRNA sequence may include or therapeutic benefit can be inhibition of tumor growth, preven comprise a modified nucleobase or nucleic acid sequence. tion of metastasis, reduction in number of metastases, inhi 0130. It will be understood in methods of the invention bition of cancer cell proliferation, induction of cell death in that a cell or other biological matter Such as an organism cancer cells, inhibition of angiogenesis near cancer cells, (including patients) can be provided a miRNA or miRNA induction of apoptosis of cancer cells, reduction in pain, molecule corresponding to a particular miRNA by adminis reduction in risk of recurrence, induction of chemo- or radi US 2009/O 1921 11 A1 Jul. 30, 2009
osensitivity in cancer cells, prolongation of life, and/or delay sponding to one or more different miRNA molecules. It is of death directly or indirectly related to cancer. contemplated that the following, at least the following, or at 0134) Furthermore, it is contemplated that the miRNA most the following number of different nucleic acid or compositions may be provided as part of a therapy to a miRNA molecules may be provided or introduced: 1, 2, 3, 4, patient, in conjunction with traditional therapies or preventa 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, tive agents. Moreover, it is contemplated that any method 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, discussed in the context of therapy may be applied as preven 40, 41,42, 43,44, 45,46,47, 48,49, 50, 51, 52,53,54, 55,56, tatively, particularly in a patient identified to be potentially in 57, 58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, 72,73, need of the therapy or at risk of the condition or disease for 74, 75,76, 77,78, 79,80, 81, 82, 83, 84, 85,86, 87,88, 89,90, which a therapy is needed. 91, 92,93, 94, 95, 96, 97,98, 99, 100, or any range derivable 0135. In addition, methods of the invention concern therein. This also applies to the number of different miRNA employing one or more nucleic acids corresponding to a molecules that can be provided or introduced into a cell. miRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or II. PHARMACEUTICAL FORMULATIONS AND toxicity, modify its bioavailability, and/or decrease the dos DELIVERY age or frequency needed. In certain embodiments, the thera 0.137 Methods of the present invention include the deliv peutic drug is a cancer therapeutic. Consequently, in some ery of an effective amount of a miRNA or an expression embodiments, there is a method of treating cancer in a patient construct encoding the same. An "effective amount of the comprising administering to the patient the cancer therapeu pharmaceutical composition, generally, is defined as that tic and an effective amount of at least one miRNA molecule amount sufficient to detectably and repeatedly to achieve the that improves the efficacy of the cancertherapeutic or protects stated desired result, for example, to ameliorate, reduce, non-cancer cells. Cancer therapies also include a variety of minimize or limit the extent of the disease or its symptoms. combination therapies with both chemical and radiation Other more rigorous definitions may apply, including elimi based treatments. Combination chemotherapies include but nation, eradication or cure of disease. are not limited to, for example, 5-fluorouracil, alemtuzumab, 0.138 A. Administration amrubicin, bevacizumab, bleomycin, bortezomib, buSulfan, 0.139. In certain embodiments, it is desired to kill cells, camptothecin, capecitabine, cisplatin (CDDP), carboplatin, inhibit cell growth, inhibit metastasis, decrease tumor or tis cetuximab, chlorambucil, cisplatin (CDDP), cyclophospha Sue size, and/or reverse or reduce the malignant or disease mide, camptothecin, COX-2 inhibitors (e.g., celecoxib), phenotype of cells. The routes of administration will vary, cyclophosphamide, cytarabine, dactinomycin, dasatinib, naturally, with the location and nature of the lesion or site to daunorubicin, dexamethasone, docetaxel, doxorubicin be targeted, and include, e.g., intradermal, Subcutaneous, (adriamycin), EGFR inhibitors (gefitinib and cetuximab), regional, parenteral, intravenous, intramuscular, intranasal, erlotinib, estrogen receptor binding agents, etoposide systemic, and oral administration and formulation. Direct (VP16), everolimus, farnesyl-protein transferase inhibitors, injection, intratumoral injection, or injection into tumor vas gefitinib, gemcitabine, gemtuzumab, ibritumomab, ifosfa culature is specifically contemplated for discrete, Solid, mide, imatinib mesylate, larotaxel, lapatinib, lonafarnib, accessible tumors, or other accessible target areas. Local, mechlorethamine, melphalan, methotrexate, mitomycin, regional, or systemic administration also may be appropriate. navelbine, nitroSurea, nocodazole, Oxaliplatin, paclitaxel, pli For tumors of>4 cm, the volume to be administered will be comycin, procarbazine, raloxifene, rituximab, sirolimus, Sor about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, afenib, Sunitinib, tamoxifen, taxol, taxotere, temsirolimus, a volume of about 1-3 ml will be used (preferably 3 ml). tipifarnib, to situmomab, transplatinum, trastuzumab, Vin 0140 Multiple injections delivered as a single dose com blastin, Vincristin, or vinorelbine or any analog or derivative prise about 0.1 to about 0.5 ml volumes. Compositions of the variant of the foregoing. invention may be administered in multiple injections to a 0.136 Generally, inhibitors of miRNAs can be given to tumor or a targeted site. In certain aspects, injections may be decrease the activity of an endogenous miRNA. Similarly, spaced at approximately 1 cm intervals. nucleic acid molecules corresponding to the mature miRNA 0.141. In the case of surgical intervention, the present can be given to achieve the opposite effect as compared to invention may be used preoperatively, to render an inoperable when inhibitors of the miRNA are given. For example, inhibi tumor Subject to resection. Alternatively, the present inven tors of miRNA molecules that increase cell proliferation can tion may be used at the time of Surgery, and/or thereafter, to be provided to cells to increase proliferation or decrease cell treat residual or metastatic disease. For example, a resected proliferation. The present invention contemplates these tumor bed may be injected or perfused with a formulation embodiments in the context of the different physiological comprising a miRNA or combinations thereof. Administra effects observed with the different miRNA molecules and tion may be continued post-resection, for example, by leaving miRNA inhibitors disclosed herein. These include, but are not a catheter implanted at the site of the surgery. Periodic post limited to, the following physiological effects: increase and Surgical treatment also is envisioned. Continuous perfusion decreasing cell proliferation, increasing or decreasing apop of an expression construct or a viral construct also is contem tosis, increasing transformation, increasing or decreasing cell plated. viability, activating or inhibiting a kinase (e.g., Erk), activat 0.142 Continuous administration also may be applied ing/inducing or inhibitinghTert, inhibit stimulation of growth where appropriate, for example, where a tumor or other promoting pathway (e.g., Stat 3 signaling), reduce or increase undesired affected area is excised and the tumor bed or tar viable cell number, and increase or decrease number of cells geted site is treated to eliminate residual, microscopic dis at a particular phase of the cell cycle. Methods of the inven ease. Delivery via Syringe or catherization is contemplated. tion are generally contemplated to include providing or intro Such continuous perfusion may take place for a period from ducing one or more different nucleic acid molecules corre about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to US 2009/O 1921 11 A1 Jul. 30, 2009
about 12-24 hours, to about 1-2 days, to about 1-2 wk or pass through the particular gauge of needle required for injec longer following the initiation of treatment. Generally, the tion. A syringe system has also been described for use in gene dose of the therapeutic composition via continuous perfusion therapy that permits multiple injections of predetermined will be equivalent to that given by a single or multiple injec quantities of a solution precisely at any depth (U.S. Pat. No. tions, adjusted over a period of time during which the perfu 5,846,225). sion occurs. 0150 Solutions of the active compounds as free base or 0143 Treatment regimens may vary as well and often pharmacologically acceptable salts may be prepared in water depend on tumor type, tumor location, immune condition, target site, disease progression, and health and age of the Suitably mixed with a surfactant, Such as hydroxypropylcel patient. Certain tumor types will require more aggressive lulose. Dispersions may also be prepared in glycerol, liquid treatment. The clinician will be best suited to make such polyethylene glycols, mixtures thereof, and in oils. Under decisions based on the known efficacy and toxicity (if any) of ordinary conditions of storage and use, these preparations the therapeutic formulations. contain a preservative to prevent the growth of microorgan 0144. In certain embodiments, the tumor or affected area isms. The pharmaceutical forms suitable for injectable use being treated may not, at least initially, be resectable. Treat include sterile aqueous solutions or dispersions and sterile ments with compositions of the invention may increase the powders for the extemporaneous preparation of sterile inject resectability of the tumor due to shrinkage at the margins or able solutions or dispersions (U.S. Pat. No. 5,466,468, spe by elimination of certain particularly invasive portions. Fol cifically incorporated herein by reference in its entirety). In lowing treatments, resection may be possible. Additional all cases the form must be sterile and must be fluid to the treatments Subsequent to resection may serve to eliminate extent that easy Syringability exists. It must be stable under microscopic residual disease at the tumor or targeted site. the conditions of manufacture and storage and must be pre 0145 Treatments may include various “unit doses. A unit served against the contaminating action of microorganisms, dose is defined as containing a predetermined quantity of a Such as bacteria and fungi. The carrier can be a solvent or therapeutic composition(s). The quantity to be administered, dispersion medium containing, for example, water, ethanol, and the particular route and formulation, are within the skill polyol (e.g., glycerol, propylene glycol, and liquid polyeth of those in the clinical arts. A unit dose need not be adminis ylene glycol, and the like), Suitable mixtures thereof, and/or tered as a single injection but may comprise continuous infu vegetable oils. Proper fluidity may be maintained, for sion over a set period of time. With respect to a viral compo example, by the use of a coating, such as lecithin, by the nent of the present invention, a unit dose may conveniently be maintenance of the required particle size in the case of dis described in terms of ug or mg of miRNA or miRNA mimetic. persion and by the use of surfactants. The prevention of the Alternatively, the amount specified may be the amount action of microorganisms can be brought about by various administered as the average daily, average weekly, or average antibacterial and antifungal agents, for example, parabens, monthly dose. chlorobutanol, phenol, Sorbic acid, thimerosal, and the like. 014.6 miRNA can be administered to the patient in a dose In many cases, it will be preferable to include isotonic agents, or doses of about or of at least about 0.5, 1, 5, 10, 15, 20, 25, for example, Sugars or Sodium chloride. Prolonged absorp 30, 35, 40, 45,50, 60, 70, 80,90, 100, 110, 120, 130, 140, 150, tion of the injectable compositions can be brought about by 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, the use in the compositions of agents delaying absorption, for 280, 290, 300, 310,320, 330,340,350, 360, 370, 380,390, example, aluminum monostearate and gelatin. 400, 410, 420, 430, 440, 450, 460, 470, 480,490, 500, 510, 0151. In certain formulations, a water-based formulation 520, 530, 540, 550,560, 570,580,590, 600, 610, 620, 630, is employed while in others, it may be lipid-based. In particu 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, lar embodiments of the invention, a composition comprising 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, a tumor Suppressor protein or a nucleic acid encoding the 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, same is in a water-based formulation. In other embodiments, 1000 ug or mg, or more, or any range derivable therein. the formulation is lipid based. Alternatively, the amount specified may be the amount 0152 For parenteral administration in an aqueous solu administered as the average daily, average weekly, or average tion, for example, the solution should be suitably buffered if monthly dose, or it may be expressed in terms of mg/kg, necessary and the liquid diluent first rendered isotonic with where kg refers to the weight of the patient and the mg is Sufficient Saline or glucose. These particular aqueous solu specified above. In other embodiments, the amount specified tions are especially suitable for intravenous, intramuscular, is any number discussed above but expressed as mg/m (with Subcutaneous, intratumoral, intralesional, and intraperitoneal respect to tumor size or patient Surface area). administration. In this connection, sterile aqueous media 0147 B. Injectable Compositions and Formulations which can be employed will be known to those of skill in the 0148. In some embodiments, the method for the delivery artin light of the present disclosure. For example, one dosage of a miRNA or an expression construct encoding Such or may be dissolved in 1 ml of isotonic NaCl solution and either combinations thereof is via systemic administration. How added to 1000 ml of hypodermoclysis fluid or injected at the ever, the pharmaceutical compositions disclosed herein may proposed site of infusion, (see for example, "Remington's also be administered parenterally, Subcutaneously, directly, Pharmaceutical Sciences' 15th Edition, pages 1035-1038 intratracheally, intravenously, intradermally, intramuscu and 1570-1580). Some variation in dosage will necessarily larly, or even intraperitoneally as described in U.S. Pat. Nos. occur depending on the condition of the Subject being treated. 5,543,158; 5,641,515 and 5,399,363 (each specifically incor The person responsible for administration will, in any event, porated herein by reference in its entirety). determine the appropriate dose for the individual subject. 0149 Injection of nucleic acids may be delivered by Moreover, for human administration, preparations should Syringe or any other method used for injection of a solution, meet Sterility, pyrogenicity, general safety and purity stan as long as the nucleic acid and any associated components can dards as required by FDA Office of Biologics standards. US 2009/O 1921 11 A1 Jul. 30, 2009
0153. As used herein, a “carrier' includes any and all 71, 72,73,74, 75,76, 77,78, 79,80, 81, 82,83, 84,85, 86, 87, Solvents, dispersion media, vehicles, coatings, diluents, anti 88, 89,90 days or more. It is contemplated that one agent may bacterial and antifungal agents, isotonic and absorption be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, delaying agents, buffers, carrier Solutions, Suspensions, col 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, loids, and the like. The use of Such media and agents for 33,34,35,36, 37,38, 39, 40, 41, 42, 43,44, 45,46, 47, 48,49, pharmaceutical active Substances is well known in the art. 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, Except insofar as any conventional media or agent is incom 67,68, 69,70, 71,72, 73,74, 75,76, 77,78, 79,80, 81, 82,83, patible with the active ingredient, its use in the therapeutic 84, 85,86, 87, 88,89, and/or 90, any combination thereof, and compositions is contemplated. Supplementary active ingre another agent is given on day 1, 2, 3, 4, 5, 6,7,8,9, 10, 11, 12. dients can also be incorporated into the compositions. 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 0154 The phrase “pharmaceutically acceptable' refers to 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41,42, 43,44, 45,46, molecular entities and compositions that do not produce an 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, allergic or similar untoward reaction when administered to a 64, 65,66, 67,68, 69,70,71, 72,73,74, 75,76, 77,78, 79,80, human. 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combina 0155 The nucleic acid(s) are administered in a manner tion thereof. Within a single day (24-hour period), the patient compatible with the dosage formulation, and in Such amount may be given one or multiple administrations of the agent(s). as will be therapeutically effective. The quantity to be admin Moreover, after a course of treatment, it is contemplated that istered depends on the Subject to be treated, including, e.g., there is a period of time at which no treatment is administered. the aggressiveness of the disease or cancer, the size of any This time period may last 1, 2, 3, 4, 5, 6, 7 days, and/or 1, 2, tumor(s) or lesions, the previous or other courses of treat 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months ment. Precise amounts of active ingredient required to be or more, depending on the condition of the patient, such as administered depend on the judgment of the practitioner. their prognosis, strength, health, etc. Suitable regimes for initial administration and Subsequent 0160 Various combinations may be employed, for administration are also variable, but are typified by an initial example miRNA therapy is “A” and a second therapy is “B”: administration followed by other administrations. Such administration may be systemic, as a single dose, continuous over a period of time spanning 10, 20, 30, 40, 50, 60 minutes, A/B/A BAA/B BABA A/A/B A/B/B BAA/A A/B/B/B and/or 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, BAA/B/B BABABA BABAAB A/A/B/B A/B/A/B A/B/B/A 19, 20, 21, 22, 23, 24 or more hours, and/or 1, 2, 3, 4, 5, 6, 7, days or more. Moreover, administration may be through a BABAA/A BAA/B/A BA/A/B A/A/A/B BAA/A/A A/B/A/A time release or Sustained release mechanism, implemented by formulation and/or mode of administration. A/A/B/A 0156 C. Combination Treatments 0.161 Administration of any compound or therapy of the 0157. In certain embodiments, the compositions and present invention to a patient will follow general protocols for methods of the present invention involve a miRNA, or expres the administration of Such compounds, taking into account sion construct encoding such. These miRNA composition can the toxicity, if any, of the vector or any protein or other agent. be used in combination with a second therapy to enhance the Therefore, in Some embodiments there is a step of monitoring effect of the miRNA therapy, or increase the therapeutic effect toxicity that is attributable to combination therapy. It is of another therapy being employed. These compositions expected that the treatment cycles would be repeated as nec would be provided in a combined amount effective to achieve essary. It also is contemplated that various standard therapies, the desired effect, such as the killing of a cancer cell and/or as well as Surgical intervention, may be applied in combina the inhibition of cellular hyperproliferation. This process may tion with the described therapy. involve contacting the cells with the miRNA or second 0162. In specific aspects, it is contemplated that a second therapy at the same or different time. This may beachieved by therapy, such as chemotherapy, radiotherapy, immuno contacting the cell with one or more compositions or phar therapy, Surgical therapy or other genetherapy, is employed in macological formulation that includes or more of the agents, combination with the miRNA therapy, as described herein. or by contacting the cell with two or more distinct composi (0163 1. Chemotherapy tions or formulations, wherein one composition provides (1) 0164. A wide variety of chemotherapeutic agents may be miRNA; and/or (2) a second therapy. A second composition used in accordance with the present invention. The term “che or method may be administered that includes a chemotherapy, motherapy” refers to the use of drugs to treat cancer. A “che radiotherapy, Surgical therapy, immunotherapy or gene motherapeutic agent' is used to connote a compound or com therapy. position that is administered in the treatment of cancer. These 0158. It is contemplated that one may provide a patient agents or drugs are categorized by their mode of activity with the miRNA therapy and the second therapy within about within a cell, for example, whether and at what stage they 12-24 h of each other and, more preferably, within about 6-12 affect the cell cycle. Alternatively, an agent may be charac h of each other. In some situations, it may be desirable to terized based on its ability to directly cross-link DNA, to extend the time period for treatment significantly, however, intercalate into DNA, or to induce chromosomal and mitotic where several days (2,3,4, 5, 6 or 7) to several weeks (1,2,3, aberrations by affecting nucleic acid synthesis. Most chemo 4, 5, 6, 7 or 8) lapse between the respective administrations. therapeutic agents fall into the following categories: alkylat 0159. In certain embodiments, a course of treatment will ing agents, antimetabolites, antitumor antibiotics, mitotic last 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, inhibitors, and nitrosoureas. 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 0.165 a. Alkylating Agents 37,38,39, 40, 41, 42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53, 0166 Alkylating agents are drugs that directly interact 54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, 67,68, 69,70, with genomic DNA to prevent the cancer cell from prolifer US 2009/O 1921 11 A1 Jul. 30, 2009 20 ating. This category of chemotherapeutic drugs represents function properly. Radiotherapy may be used to treat local agents that affect all phases of the cell cycle, that is, they are ized solid tumors, such as cancers of the skin, tongue, larynx, not phase-specific. Alkylating agents can be implemented to brain, breast, or cervix. It can also be used to treat leukemia treat chronic leukemia, non-Hodgkin’s lymphoma, and lymphoma (cancers of the blood-forming cells and lym Hodgkin's disease, multiple myeloma, and particular cancers phatic system, respectively). of the breast, lung, and ovary. They include: buSulfan, 0.178 Radiation therapy used according to the present chlorambucil, cisplatin, cyclophosphamide (cytoxan), dacar invention may include, but is not limited to, the use of Y-rays, bazine, ifosfamide, mechlorethamine (mustargen), and mel X-rays, and/or the directed delivery of radioisotopes to tumor phalan. Troglitazaone can be used to treat cancer in combi cells. Other forms of DNA damaging factors are also contem nation with any one or more of these alkylating agents. plated such as microwaves, proton beam irradiation (U.S. Pat. (0167 b. Antimetabolites Nos. 5,760,395 and 4,870,287) and UV-irradiation. It is most 0168 Antimetabolites disrupt DNA and RNA synthesis. likely that all of these factors effect a broad range of damage Unlike alkylating agents, they specifically influence the cell on DNA, on the precursors of DNA, on the replication and cycle during S phase. They have been used to combat chronic repair of DNA, and on the assembly and maintenance of leukemias in addition to tumors of breast, ovary and the chromosomes. Dosage ranges for X-rays range from daily gastrointestinal tract. Antimetabolites include 5-fluorouracil doses of 50 to 200 roentgens for prolonged periods of time (3 (5-FU), cytarabine (Ara-C), fludarabine, gemcitabine, and to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage methotrexate. ranges for radioisotopes vary widely, and depend on the half 0169 5-Fluorouracil (5-FU) has the chemical name of life of the isotope, the strength and type of radiation emitted, 5-fluoro-2,4(1H.3H)-pyrimidinedione. Its mechanism of and the uptake by the neoplastic cells. Radiotherapy may action is thought to be by blocking the methylation reaction of comprise the use of radiolabeled antibodies to deliver doses deoxyuridylic acid to thymidylic acid. Thus, 5-FU interferes of radiation directly to the cancer site (radioimmunotherapy). with the synthesis of deoxyribonucleic acid (DNA) and to a Once injected into the body, the antibodies actively seek out lesser extent inhibits the formation of ribonucleic acid the cancer cells, which are destroyed by the cell-killing (cyto (RNA). Since DNA and RNA are essential for cell division toxic) action of the radiation. This approach can minimize the and proliferation, it is thought that the effect of 5-FU is to risk of radiation damage to healthy cells. create a thymidine deficiency leading to cell death. Thus, the 0179 Stereotactic radio-surgery (gamma knife) for brain effect of 5-FU is found in cells that rapidly divide, a charac and other tumors does not use a knife, but very precisely teristic of metastatic cancers. targeted beams of gamma radiotherapy from hundreds of 0170 c. Antitumor Antibiotics different angles. Only one session of radiotherapy, taking 0171 Antitumor antibiotics have both antimicrobial and about four to five hours, is needed. For this treatment a spe cytotoxic activity. These drugs also interfere with DNA by cially made metal frame is attached to the head. Then, several chemically inhibiting enzymes and mitosis or altering cellu scans and X-rays are carried out to find the precise area where lar membranes. These agents are not phase specific So they the treatment is needed. During the radiotherapy for brain work in all phases of the cell cycle. Thus, they are widely used tumors, the patient lies with their head in a large helmet, for a variety of cancers. Examples of antitumor antibiotics which has hundreds of holes in it to allow the radiotherapy include bleomycin, dactinomycin, daunorubicin, doxorubi beams through. Related approaches permit positioning for cin (Adriamycin), and idarubicin, Some of which are dis the treatment of tumors in other areas of the body. cussed in more detail below. Widely used in clinical setting 0180 3. Immunotherapy for the treatment of neoplasms, these compounds are admin 0181. In the context of cancer treatment, immunothera istered through bolus injections intravenously at doses rang peutics, generally, rely on the use of immune effector cells ing from 25-75 mg/m at 21 day intervals for adriamycin, to and molecules to target and destroy cancer cells. Trastuzumab 35-100 mg/m for etoposide intravenously or orally. (HerceptinTM) is such an example. The immune effector may 0172 d. Mitotic Inhibitors be, for example, an antibody specific for Some marker on the 0173 Mitotic inhibitors include plant alkaloids and other Surface of a tumor cell. The antibody alone may serve as an natural agents that can inhibit either protein synthesis effector of therapy or it may recruit other cells to actually required for cell division or mitosis. They operate during a affect cell killing. The antibody also may be conjugated to a specific phase during the cell cycle. Mitotic inhibitors com drug or toxin (chemotherapeutic, radionuclide, ricin. A chain, prise docetaxel, etoposide (VP16), paclitaxel, taxol, taxotere, cholera toxin, pertussis toxin, etc.) and serve merely as a vinblastine, Vincristine, and vinorelbine. targeting agent. Alternatively, the effector may be a lympho 0.174 e. Nitrosureas cyte carrying a surface molecule that interacts, either directly 0175 Nitrosureas, like alkylating agents, inhibit DNA or indirectly, with a tumor cell target. Various effector cells repair proteins. They are used to treat non-Hodgkin’s lym include cytotoxic T cells and NK cells. The combination of phomas, multiple myeloma, malignant melanoma, in addi therapeutic modalities, i.e., direct cytotoxic activity and inhi tion to brain tumors. Examples include carmustine and bition or reduction of ErbB2 would provide therapeutic ben lomustine. efit in the treatment of ErbB2 overexpressing cancers. (0176 2. Radiotherapy 0182. In one aspect of immunotherapy, the tumor or dis 0177 Radiotherapy, also called radiation therapy, is the ease cell must bear Some marker that is amenable to targeting, treatment of cancer and other diseases with ionizing radia i.e., is not present on the majority of other cells. Many tumor tion. Ionizing radiation deposits energy that injures or markers exist and any of these may be suitable for targeting in destroys cells in the area being treated by damaging their the context of the present invention. Common tumor markers genetic material, making it impossible for these cells to con include carcinoembryonic antigen, prostate specific antigen, tinue to grow. Although radiation damages both cancer cells urinary tumor associated antigen, fetal antigen, tyrosinase and normal cells, the latter are able to repair themselves and (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, US 2009/O 1921 11 A1 Jul. 30, 2009
Much3, PLAP, estrogen receptor, laminin receptor, erb Band that may be targeted for gene therapy of some form in com p155. An alternative aspect of immunotherapy is to combine bination with the present invention include, but are not lim anticancer effects with immune stimulatory effects. Immune ited to inducers of cellular proliferation, inhibitors of cellular stimulating molecules also exist including: cytokines such as proliferation, regulators of programmed cell death, cytokines IL-2, IL-4, IL-12, GM-CSF, gamma-IFN. chemokines such and other therapeutic nucleic acids or nucleic acid that encode as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 therapeutic proteins. ligand. Combining immune stimulating molecules, either as 0187. The tumor suppressor oncogenes function to inhibit proteins or using gene delivery in combination with a tumor excessive cellular proliferation. The inactivation of these Suppressor Such as MDA-7 has been shown to enhance anti genes destroys their inhibitory activity, resulting in unregu tumor effects (Ju et al., 2000). Moreover, antibodies against lated proliferation. The tumor Suppressors (e.g., therapeutic any of these compounds can be used to target the anti-cancer polypeptides) p53, FHIT, p16 and C-CAM can be employed. agents discussed herein. 0188 In addition to p53, another inhibitor of cellular pro 0183 Examples of immunotherapies currently under liferation is p16. The major transitions of the eukaryotic cell investigation or in use are immune adjuvants e.g., Mycobac cycle are triggered by cyclin-dependent kinases, or CDKs. terium bovis, Plasmodium falciparum, dinitrochlorobenzene One CDK, cyclin-dependent kinase 4 (CDK4), regulates pro and aromatic compounds (U.S. Pat. Nos. 5,801,005 and gression through the G1. The activity of this enzyme may be 5,739,169: Hui and Hashimoto, 1998; Christodoulides et al., to phosphorylate Rb at late G1. The activity of CDK4 is 1998), cytokine therapy e.g., interferons C, B and Y: IL-1, controlled by an activating Subunit, D-type cyclin, and by an GM-CSF and TNF (Bukowski et al., 1998; Davidson et al., inhibitory subunit, the p16INK4 has been biochemically 1998: Hellstrand et al., 1998) gene therapy e.g., TNF, IL-1, characterized as a protein that specifically binds to and inhib IL-2, p53 (Qinet al., 1998; Austin-Ward and Villaseca, 1998: its CDK4, and thus may regulate Rb phosphorylation (Ser U.S. Pat. Nos. 5,830,880 and 5,846,945) and monoclonal rano et al., 1993: Serrano et al., 1995). Since the p16INK4 antibodies e.g., anti-ganglioside GM2, anti-HER-2, anti protein is a CDK4 inhibitor (Serrano, 1993), deletion of this p185; Pietras et al., 1998: Hanibuchietal., 1998: U.S. Pat. No. gene may increase the activity of CDK4, resulting in hyper 5,824.311). Herceptin (trastuzumab) is a chimeric (mouse phosphorylation of the Rb protein. p16 also is known to human) monoclonal antibody that blocks the HER2-neu regulate the function of CDK6. receptor. It possesses anti-tumor activity and has been 0189 p16INK4 belongs to a newly described class of approved for use in the treatment of malignant tumors CDK-inhibitory proteins that also includes p16B, p19. (Dillman, 1999). A non-limiting list of several known anti p21WAF1, and p27KIP1. The p16INK4 gene maps to 9p21, a cancer immunotherapeutic agents and their targets includes chromosome region frequently deleted in many tumor types. (Generic Name/Target) Cetuximab/EGFR, Panitumuma/ Homozygous deletions and mutations of the p16INK4 gene EGFR, Trastuzumab?erbB2 receptor, Bevacizumab/VEGF, are frequent in human tumor cell lines. This evidence Sug Alemtuzumab/CD52, Gemtuzumab ozogamicin/CD33, Rit gests that the p16INK4 gene is a tumor Suppressor gene. This uximab/CD20, Tositumomab/CD20, Matuzumab/EGFR, interpretation has been challenged, however, by the observa Ibritumomab tiuxetan/CD20, Tositumomab/CD20, tion that the frequency of the p16INK4 gene alterations is HuPAM4/MUC1, MORAb-009/Mesothelin, G250/carbonic much lower in primary uncultured tumors than in cultured anhydrase IX, mAb 8H9/8H9 antigen, M195/CD33, Ipili cell lines (Caldas et al., 1994; Cheng et al., 1994; Hussussian mumab/CTLA4, HuDuc63/CS1, Alemtuzumab/CD53, et al., 1994; Kamb et al., 1994; Mori et al., 1994: Okamoto et Epratuzumab/CD22, BC8/CD45, HuJ591/Prostate specific al., 1994: Nobori et al., 1995: Orlow et al., 1994; Arap et al., membrane antigen, ha2O/CD20, Lexatumumab/TRAIL 1995). Restoration of wild-type p16INK4 function by trans receptor-2, Pertuzumab/HER-2 receptor, Mik-beta-1/IL-2R, fection with a plasmid expression vector reduced colony for RAV12/RAAG12, SGN-30/CD30, AME-133v/CD20, HeFi mation by some human cancer cell lines (Okamoto, 1994: 1/CD30, BMS-663513/CD137, Volociximab/anti-C.5B1 inte Arap, 1995). grin, GC1008/TGFB, HCD122/CD40, Siplizumab/CD2, 0190. Other genes that may be employed according to the MORAb-003/Folate receptor alpha, CNTO 328/IL-6, MDX present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, 060/CD30, Ofatumumab/CD20, and SGN-33/CD33. It is MEN-I, MEN-II, Zac1, p73, VHL, MMAC1/PTEN, DBCCR contemplated that one or more of these therapies may be 1. FCC, rsk-3, p27, p27/p16 fusions, p21/p27 fusions, anti employed with the miRNA therapies described herein. thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, 0184. A number of different approaches for passive immu myc, neu, raf, erb, fms, trk, ret, gsp, hist, abl, E1A, p300, genes notherapy of cancer exist. They may be broadly categorized involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, into the following: injection of antibodies alone; injection of BAI-1, GDAIF, or their receptors) and MCC. antibodies coupled to toxins or chemotherapeutic agents; (0191 5. Surgery injection of antibodies coupled to radioactive isotopes; injec 0.192 Approximately 60% of persons with cancer will tion of anti-idiotype antibodies; and finally, purging of tumor undergo Surgery of some type, which includes preventative, cells in bone marrow. diagnostic or staging, curative and palliative Surgery. Cura 0185. 4. Gene Therapy tive Surgery is a cancer treatment that may be used in con 0186. In yet another embodiment, a combination treat junction with other therapies, such as the treatment of the ment involves gene therapy in which atherapeutic polynucle present invention, chemotherapy, radiotherapy, hormonal otide is administered before, after, or at the same time as one therapy, gene therapy, immunotherapy and/or alternative or more therapeutic miRNA. Delivery of a therapeutic therapies. polypeptide or encoding nucleic acid in conjunction with a 0193 Curative surgery includes resection in which all or miRNA may have a combined therapeutic effect on target part of cancerous tissue is physically removed, excised, and/ tissues. A variety of proteins are encompassed within the or destroyed. Tumor resection refers to physical removal of at invention, some of which are described below. Various genes least part of a tumor. In addition to tumor resection, treatment US 2009/O 1921 11 A1 Jul. 30, 2009 22 by Surgery includes laser Surgery, cryoSurgery, electroSur tissues suggests that TRAIL may be useful as an anticancer gery, and microscopically controlled Surgery (Mohs Sur agent that induces apoptosis in cancer cells while sparing gery). It is further contemplated that the present invention normal cells. (Marsters et al., 1999). may be used in conjunction with removal of Superficial can 0198 There have been many advances in the therapy of cers, precancers, or incidental amounts of normal tissue. cancer following the introduction of cytotoxic chemothera 0194 Upon excision of part of all of cancerous cells, tis peutic drugs. However, one of the consequences of chemo Sue, or tumor, a cavity may be formed in the body. Treatment therapy is the development/acquisition of drug-resistant phe may be accomplished by perfusion, direct injection or local notypes and the development of multiple drug resistance. The application of the area with an additional anti-cancer therapy. development of drug resistance remains a major obstacle in Such treatment may be repeated, for example, every 1, 2, 3, 4, the treatment of such tumors and therefore, there is an obvi 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, ous need for alternative approaches Such as gene therapy. 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may 0199 Another form of therapy for use in conjunction with be of varying dosages as well. chemotherapy, radiation therapy or biological therapy (0195 6. Other Agents includes hyperthermia, which is a procedure in which a 0196. It is contemplated that other agents may be used in patient's tissue is exposed to high temperatures (up to 106° combination with the present invention to improve the thera F.). External or internal heating devices may be involved in peutic efficacy of treatment. These additional agents include the application of local, regional, or whole-body hyperther immunomodulatory agents, agents that affect the upregula mia. Local hyperthermia involves the application of heat to a tion of cell Surface receptors and GAP junctions, cytostatic Small area, such as a tumor. Heat may be generated externally and differentiation agents, inhibitors of cell adhesion, agents with high-frequency waves targeting a tumor from a device that increase the sensitivity of the hyperproliferative cells to outside the body. Internal heat may involve a sterile probe, apoptotic inducers, or other biological agents. Immunomodu including thin, heated wires or hollow tubes filled with warm latory agents include tumor necrosis factor, interferon alpha, water, implanted microwave antennae, or radiofrequency beta, and gamma; IL-2 and other cytokines; F42K and other electrodes. cytokine analogs; or MIP-1, MIP-1beta, MCP-1, RANTES, 0200. A patient's organ or a limb is heated for regional and other chemokines. It is further contemplated that the therapy, which is accomplished using devices that produce upregulation of cell Surface receptors or their ligands such as high energy, Such as magnets. Alternatively, some of the Fas/Fas ligand, DR4 or DR5/TRAIL (Apo-2 ligand) would patient's blood may be removed and heated before being potentiate the apoptotic inducing abilities of the present perfused into an area that will be internally heated. Whole invention by establishment of an autocrine or paracrine effect body heating may also be implemented in cases where cancer on hyperproliferative cells. Increases intercellular signaling has spread throughout the body. Warm-water blankets, hot by elevating the number of GAPjunctions would increase the wax, inductive coils, and thermal chambers may be used for anti-hyperproliferative effects on the neighboring hyperpro this purpose. liferative cell population. In other embodiments, cytostatic or 0201 Hormonal therapy may also be used in conjunction differentiation agents can be used in combination with the with the present invention or in combination with any other present invention to improve the anti-hyperproliferative effi cancer therapy previously described. The use of hormones cacy of the treatments. Inhibitors of cell adhesion are con may be employed in the treatment of certain cancers such as templated to improve the efficacy of the present invention. breast, prostate, ovarian, or cervical cancer to lower the level Examples of cell adhesion inhibitors are focal adhesion or block the effects of certain hormones such as testosterone kinase (FAKs) inhibitors and Lovastatin. It is further contem or estrogen. This treatment is often used in combination with plated that other agents that increase the sensitivity of a hyper at least one other cancer therapy as a treatment option or to proliferative cell to apoptosis, such as the antibody c225, reduce the risk of metastases. could be used in combination with the present invention to 0202 This application incorporates U.S. application Ser. improve the treatment efficacy. No. 1 1/349,727 filed on Feb. 8, 2006 claiming priority to U.S. 0.197 Apo2 ligand (Apo2L, also called TRAIL) is a mem Provisional Application Ser. No. 60/650,807 filed Feb. 8, ber of the tumor necrosis factor (TNF) cytokine family. 2005 herein by references in its entirety. TRAIL activates rapid apoptosis in many types of cancer III. miRNA Molecules cells, yet is not toxic to normal cells. TRAIL mRNA occurs in a wide variety of tissues. Most normal cells appear to be (0203 MicroRNA molecules (“miRNAs) are generally resistant to TRAIL's cytotoxic action, Suggesting the exist 21 to 22 nucleotides in length, though lengths of 19 and up to ence of mechanisms that can protect againstapoptosis induc 23 nucleotides have been reported. The miRNAs are each tion by TRAIL. The first receptor described for TRAIL, processed from a longerprecursor RNA molecule (“precursor called death receptor 4 (DR4), contains a cytoplasmic “death miRNA). Precursor miRNAs are transcribed from non-pro domain': DR4 transmits the apoptosis signal carried by tein-encoding genes. The precursor miRNAS have two TRAIL. Additional receptors have been identified that bind to regions of complementarity that enables them to form a stem TRAIL. One receptor, called DR5, contains a cytoplasmic loop- or fold-back-like structure, which is cleaved in animals death domain and signals apoptosis much like DR4. The DR4 by a ribonuclease III-like nuclease enzyme called Dicer. The and DR5 mRNAs are expressed in many normal tissues and processed miRNA is typically a portion of the stem. tumor cell lines. Recently, decoy receptors such as DcR1 and 0204 The processed miRNA (also referred to as “mature DcR2 have been identified that prevent TRAIL from inducing miRNA) becomes part of a large complex to down-regulate apoptosis through DR4 and DR5. These decoy receptors thus a particular target gene or its gene product. Examples of represent a novel mechanism for regulating sensitivity to a animal miRNAs include those that imperfectly basepair with pro-apoptotic cytokine directly at the cell's surface. The pref the target, which halts translation (Olsen et al., 1999; Segger erential expression of these inhibitory receptors in normal son et al., 2002). siRNA molecules also are processed by US 2009/O 1921 11 A1 Jul. 30, 2009
Dicer, but from a long, double-stranded RNA molecule. siR 96/31622; WO 97/10365; WO 97/27317; WO99/35505; WO NAs are not naturally found in animal cells, but they can 09923256; WO 09936760; WO0138580; WO 0168255; WO direct the sequence-specific cleavage of an mRNA target 03020898; WO 03040410; WO 03053586: WO 03087297; through a RNA-induced silencing complex (RISC) (Denliet WO 03091426; WO03100012: WO 04020085; WO al., 2003). 04027093: EP 373 203; EP 785 280; EP 799 897 and UK 8 0205 A. Array Preparation 803 000; the disclosures of which are all herein incorporated 0206 Certain embodiments of the present invention con by reference. cerns the preparation and use of mRNA or nucleic acid arrays, 0209. It is contemplated that the arrays can be high density miRNA or nucleic acid arrays, and/or miRNA or nucleic acid arrays, such that they contain 2, 20, 25, 50, 80, 100 or more probe arrays, which are macroarrays or microarrays of different probes. It is contemplated that they may contain nucleic acid molecules (probes) that are fully or nearly 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different complementary (over the length of the prove) or identical probes. The probes can be directed to mRNA and/or miRNA (over the length of the prove) to a plurality of nucleic acid, targets in one or more different organisms or cell types. The mRNA or miRNA molecules, precursor miRNA molecules, oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or nucleic acids derived from the various genes and gene 9 to 34, or 15 to 40 nucleotides in length in some embodi pathways modulated by miR-124 miRNAs and that are posi ments. In certain embodiments, the oligonucleotide probes tioned on a Support or Support material in a spatially separated are 5, 10, 15, to 20, 25, 30, 35, 40 nucleotides in length organization. Macroarrays are typically sheets of nitrocellu including all integers and ranges there between. lose or nylon upon which probes have been spotted. Microar 0210. The location and sequence of each different probe rays position the nucleic acid probes more densely such that sequence in the array are generally known. Moreover, the up to 10,000 nucleic acid molecules can be fit into a region large number of different probes can occupy a relatively small typically 1 to 4 square centimeters. Microarrays can be fab area providing a high density array having a probe density of ricated by spotting nucleic acid molecules, e.g., genes, oligo generally greater than about 60, 100, 600, 1000, 5,000, nucleotides, etc., onto Substrates or fabricating oligonucle 10,000, 40,000, 100,000, or 400,000 different oligonucle otide sequences in situ on a Substrate. Spotted or fabricated otide probes per cm. The surface area of the array can be nucleic acid molecules can be applied in a high density matrix about or less than about 1, 1.6,2,3,4,5,6,7,8,9, or 10cm. pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 0211 Moreover, a person of ordinary skill in the art could 1000 per square centimeter. Microarrays typically use coated readily analyze data generated using an array. Such protocols glass as the Solid Support, in contrast to the nitrocellulose are disclosed above, and include information found in WO based material offilter arrays. By having an ordered array of 9743450; WO 03023058: WO 03022421; WO 03029485; marker RNA and/or miRNA-complementing nucleic acid WO 03067217; WO 03066906; WO 03076928: WO samples, the position of each sample can be tracked and 03093810; WO 03100448A1, all of which are specifically linked to the original sample. incorporated by reference. 0207. A variety of different array devices in which a plu 0212 B. Sample Preparation rality of distinct nucleic acid probes are stably associated with 0213. It is contemplated that the RNA and/or miRNA of a the surface of a solid support are known to those of skill in the wide variety of samples can be analyzed using the arrays, art. Useful Substrates for arrays include nylon, glass, metal, index of probes, or array technology of the invention. While plastic, latex, and silicon. Such arrays may vary in a number endogenous miRNA is contemplated for use with composi of different ways, including average probe length, sequence tions and methods of the invention, recombinant miRNA or types of probes, nature of bond between the probe and the including nucleic acids that are complementary oridentical to array Surface, e.g. covalent or non-covalent, and the like. The endogenous miRNA or precursor miRNA can also be labeling and screening methods of the present invention and handled and analyzed as described herein. Samples may be the arrays are not limited in its utility with respect to any biological samples, in which case, they can be from biopsy, parameter except that the probes detect miRNA, or genes or fine needle aspirates, exfoliates, blood, tissue, organs, semen, nucleic acid representative of genes; consequently, methods saliva, tears, other bodily fluid, hair follicles, skin, or any and compositions may be used with a variety of different sample containing or constituting biological cells, particu types of nucleic acid arrays. larly cancer or hyperproliferative cells. In certain embodi 0208 Representative methods and apparatus for preparing ments, samples may be, but are not limited to, biopsy, or cells a microarray have been described, for example, in U.S. Pat. purified or enriched to some extent from a biopsy or other Nos. 5,143,854:5,202,231:5,242,974:5,288,644; 5,324,633; bodily fluids or tissues. Alternatively, the sample may not be 5,384,261; 5,405,783; 5,412,087; 5,424, 186; 5,429,807; a biological sample, but be a chemical mixture. Such as a 5,432,049; 5,436,327: 5,445,934; 5,468,613; 5,470,710; cell-free reaction mixture (which may contain one or more 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270; biological enzymes). 5,525,464; 5,527,681: 5,529,756; 5,532,128: 5,545,531; 0214) C. Hybridization 5,547,839; 5,554,501; 5,556,752; 5,561,071; 5,571,639; 0215. After an array or a set of probes is prepared and/or 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672; the nucleic acid in the sample or probe is labeled, the popu 5,610,287: 5,624,711; 5,631,134, 5,639,603; 5,654,413; lation of target nucleic acids is contacted with the array or 5,658,734; 5,661,028; 5.665,547; 5,667,972; 5,695,940; probes under hybridization conditions, where such condi 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; tions can be adjusted, as desired, to provide for an optimum 5,837, 196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; level of specificity in view of the particular assay being per 6,004,755; 6,087,102; 6,368,799; 6,383,749; 6,617, 112: formed. Suitable hybridization conditions are well known to 6,638,717; 6,720,138, as well as WO 93/17126; WO those of skill in the art and reviewed in Sambrook et al. (2001) 95/11995; WO95/21265; WO95/21944; WO95/35505; WO and WO95/2 1944. Of particular interest in many embodi US 2009/O 1921 11 A1 Jul. 30, 2009 24 ments is the use of stringent conditions during hybridization. arrays, their manufacture, and their characteristics, which is Stringent conditions are known to those of skill in the art. incorporated by reference in its entirety for all purposes. 0216. It is specifically contemplated that a single array or 0221 Particularly, arrays can be used to evaluate samples set of probes may be contacted with multiple samples. The with respect to pathological condition such as cancer and samples may be labeled with different labels to distinguish related conditions. It is specifically contemplated that the the samples. For example, a single array can be contacted invention can be used to evaluate differences between stages or Sub-classifications of disease, such as between benign, with a tumor tissue sample labeled with Cy3, and normal cancerous, and metastatic tissues or tumors. tissue sample labeled with Cy5. Differences between the 0222 Phenotypic traits to be assessed include character samples for particular miRNAS corresponding to probes on istics Such as longevity, morbidity, expected Survival, Suscep the array can be readily ascertained and quantified. tibility or receptivity to particular drugs or therapeutic treat 0217. The small surface area of the array permits uniform ments (drug efficacy), and risk of drug toxicity. Samples that hybridization conditions, such as temperature regulation and differ in these phenotypic traits may also be evaluated using salt content. Moreover, because of the small area occupied by the compositions and methods described. the high density arrays, hybridization may be carried out in 0223) In certain embodiments, miRNA and/or expression extremely small fluid volumes (e.g., about 250 ul or less, profiles may be generated to evaluate and correlate those including volumes of about or less than about 5, 10, 25, 50. profiles with pharmacokinetics or therapies. For example, 60, 70, 80,90, 100 ul, or any range derivable therein). In small these profiles may be created and evaluated for patient tumor Volumes, hybridization may proceed very rapidly. and blood samples prior to the patient's being treated or 0218 D. Differential Expression Analyses during treatment to determine if there are miRNA or genes 0219. Arrays of the invention can be used to detect differ whose expression correlates with the outcome of the patient’s ences between two samples. Specifically contemplated appli treatment. Identification of differential miRNAs or genes can cations include identifying and/or quantifying differences lead to a diagnostic assay for evaluation of tumor and/or blood between miRNA or gene expression from a sample that is samples to determine what drug regimen the patient should be normal and from a sample that is not normal, between a provided. In addition, it can be used to identify or select disease or condition and a cell not exhibiting Such a disease or patients suitable for a particular clinical trial. If an expression condition, or between two differently treated samples. Also, profile is determined to be correlated with drug efficacy or miRNA or gene expression may be compared between a drug toxicity, that profile is relevant to whether that patient is sample believed to be susceptible to a particular disease or an appropriate patient for receiving a drug, for receiving a condition and one believed to be not susceptible or resistant to combination of drugs, or for a particular dosage of the drug. that disease or condition. A sample that is not normal is one 0224. In addition to the above prognostic assay, Samples exhibiting phenotypic or genotypic trait(s) of a disease or from patients with a variety of diseases can be evaluated to condition, or one believed to be not normal with respect to determine if different diseases can be identified based on that disease or condition. It may be compared to a cell that is miRNA and/or related gene expression levels. A diagnostic normal with respect to that disease or condition. Phenotypic assay can be created based on the profiles that doctors can use traits include symptoms of, or Susceptibility to, a disease or to identify individuals with a disease or who are at risk to condition of which a component is or may or may not be develop a disease. Alternatively, treatments can be designed genetic, or caused by a hyperproliferative or neoplastic cellor based on miRNA profiling. Examples of such methods and compositions are described in the U.S. Provisional Patent cells. Application entitled “Methods and Compositions Involving 0220. An array comprises a solid support with nucleic acid miRNA and miRNA Inhibitor Molecules' filed on May 23, probes attached to the Support. Arrays typically comprise a 2005 in the names of David Brown, Lance Ford, Angie Cheng plurality of different nucleic acid probes that are coupled to a and Rich Jarvis, which is hereby incorporated by reference in surface of a substrate in different, known locations. These its entirety. arrays, also described as “microarrays' or colloquially 0225. E. Other Assays “chips' have been generally described in the art, for example, 0226. In addition to the use of arrays and microarrays, it is U.S. Pat. Nos. 5,143,854, 5,445,934, 5,744,305, 5,677, 195, contemplated that a number of different assays could be 6,040,193, 5,424,186 and Fodoret al., (1991), each of which employed to analyze miRNAs or related genes, their activi is incorporated by reference in its entirety for all purposes. ties, and their effects. Such assays include, but are not limited Techniques for the synthesis of these arrays using mechanical to, nucleic acid amplification, polymerase chain reaction, synthesis methods are described in, e.g., U.S. Pat. No. 5,384, quantitative PCR, RT-PCR, in situ hybridization, Northern 261, incorporated herein by reference in its entirety for all hybridization, hybridization protection assay (HPA) (Gen purposes. Although a planar array Surface is used in certain Probe), branched DNA (bDNA) assay (Chiron), rolling circle aspects, the array may be fabricated on a Surface of virtually amplification (RCA), single molecule hybridization detec any shape or even a multiplicity of Surfaces. Arrays may be tion (US Genomics), Invader assay (ThirdWave Technolo nucleic acids on beads, gels, polymeric Surfaces, fibers such gies), and/or Bridge Litigation Assay (Genaco). as fiber optics, glass or any other appropriate Substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety IV. NUCLEICACIDS for all purposes. Arrays may be packaged in Such a manner as 0227. The present invention concerns nucleic acids, modi to allow for diagnostics or other manipulation of an all inclu fied or mimetic nucleic acids, miRNAS, mRNAS, genes, and sive device, see for example, U.S. Pat. Nos. 5.856,174 and representative fragments thereof that can be labeled, used in 5,922,591 incorporated in their entirety by reference for all array analysis, or employed in diagnostic, therapeutic, or purposes. See also U.S. patent application Ser. No. 09/545, prognostic applications, particularly those related to patho 207, filed Apr. 7, 2000 for additional information concerning logical conditions such as cancer. The molecules may have US 2009/O 1921 11 A1 Jul. 30, 2009
been endogenously produced by a cell, or been synthesized or 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, produced chemically or recombinantly. They may be isolated 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, and/or purified. Each of the miRNAs described herein and 890,900,910,920,930,940,950,960,970,980,990, or 1000 includes the corresponding SEQID NO and accession num contiguous nucleotides. It is further understood that the bers for these miRNA sequences. The name of a miRNA is length of complementarity within a precursor miRNA or often abbreviated and referred to without a “hsa- prefix and other nucleic acid or between a miRNA probe and a miRNA will be understood as such, depending on the context. Unless or a miRNA gene are such lengths. Moreover, the comple otherwise indicated, miRNAs referred to in the application mentarity may be expressed as a percentage, meaning that the are human sequences identified as miR-X or let-X, where X is complementarity between a probe and its target is 90% or a number and/or letter. greater over the length of the probe. In some embodiments, 0228. In certain aspects, a miRNA probe designated by a complementarity is or is at least 90%. 95% or 100%. In Suffix '5P or “3P can be used. “5P indicates that the particular, Such lengths may be applied to any nucleic acid mature miRNA derives from the 5' end of the precursor and a comprising a nucleic acid sequence identified in any of SEQ corresponding “3P indicates that it derives from the 3' end of ID NOS described herein, accession number, or any other the precursor, as described on the world wide web at sanger. sequence disclosed herein. Typically, the commonly used ac.uk. Moreover, in some embodiments, a miRNA probe is name of the miRNA is given (with its identifying source in the used that does not correspond to a known human miRNA. It prefix, for example, "hsa' for human sequences) and the is contemplated that these non-human miRNA probes may be processed miRNA sequence. Unless otherwise indicated, a used in embodiments of the invention or that there may exist miRNA without a prefix will be understood to refer to a a human miRNA that is homologous to the non-human human miRNA. Moreover, a lowercase letter in a miRNA miRNA. In other embodiments, any mammaliancell, biologi name may or may not be lowercase; for example, hsa-mir cal sample, or preparation thereof may be employed. 130b can also be referred to as miR-130B. The term “miRNA 0229. In some embodiments of the invention, methods and probe' refers to a nucleic acid probe that can identify a par compositions involving miRNA may concern miRNA, mark ticular miRNA or structurally related miRNAs. ers (mRNAs), and/or other nucleic acids. Nucleic acids may 0232. It is understood that some nucleic acids are derived be, beat least, or beat most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, from genomic sequences or a gene. In this respect, the term 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 'gene' is used for simplicity to refer to the genomic sequence 31, 32,33, 34,35,36, 37,38, 39, 40, 41, 42,43, 44, 45, 46,47, encoding the precursor nucleic acid or miRNA for a given 48,49, 50,51,52,53,54, 55,56, 57,58, 59,60, 61, 62,63, 64, miRNA or gene. However, embodiments of the invention may 65, 66,67,68, 69,70, 71,72, 73,74, 75,76, 77,78, 79,80, 81, involve genomic sequences of a miRNA that are involved in 82, 83, 84,85, 86, 87, 88, 89,90,91, 92,93,94, 95, 96, 97,98, its expression, Such as a promoter or other regulatory 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, Sequences. 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 0233. The term “recombinant may be used and this gen 240, 250, 260, 270, 280, 290, 300, 310,320, 330, 340, 350, erally refers to a molecule that has been manipulated in vitro 360, 370, 380,390, 400, 410, 420, 430, 440, 450, 460, 470, or that is a replicated or expressed product of such a molecule. 480,490,500,510,520, 530, 540, 550,560,570,580, 590, 0234. The term “nucleic acid' is well known in the art. A 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, “nucleic acid as used herein will generally refer to a mol 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, ecule (one or more strands) of DNA, RNA or a derivative or 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, analog thereof, comprising a nucleobase. A nucleobase 960, 970, 980, 990, or 1000 nucleotides, or any range deriv includes, for example, a naturally occurring purine or pyri able therein, in length. Such lengths cover the lengths of midine base found in DNA (e.g., an adenine “A” a guanine processed miRNA, miRNA probes, precursor miRNA, “G” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, miRNA containing vectors, mRNA, mRNA probes, control an uracil “U” or a C). The term “nucleic acid encompasses nucleic acids, and other probes and primers. the terms "oligonucleotide' and “polynucleotide.” each as a 0230. In many embodiments, miRNA are 19-24 nucle subgenus of the term “nucleic acid.” otides in length, while miRNA probes are 19-35 nucleotides 0235. The term “miRNA generally refers to a single in length, depending on the length of the processed miRNA Stranded molecule, but in specific embodiments, molecules and any flanking regions added. miRNA precursors are gen implemented in the invention will also encompass a region or erally between 62 and 110 nucleotides in humans. an additional strand that is partially (between 10 and 50% 0231 Nucleic acids of the invention may have regions of complementary across length of strand), Substantially identity or complementarity to another nucleic acid. It is (greater than 50% but less than 100% complementary across contemplated that the region of complementarity or identity length of strand) or fully complementary to another region of can be at least 5 contiguous residues, though it is specifically the same single-stranded molecule or to another nucleic acid. contemplated that the region is, is at least, or is at most 6, 7, 8, Thus, nucleic acids of the invention may encompass a mol 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, ecule that comprises one or more complementary or self 26, 27, 28, 29, 30, 31, 32,33, 34, 35,36, 37,38, 39, 40, 41, 42, complementary strand(s) or “complement(s) of a particular 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, sequence. For example, precursor miRNA may have a self 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71,72, 73,74, 75,76, complementary region, which is up to 100% complementary. 77,78, 79,80, 81, 82, 83, 84,85, 86, 87, 88,89,90,91, 92,93, miRNA probes or nucleic acids of the invention can include, 94, 95, 96, 97,98, 99, 100, 110, 120, 130, 140, 150, 160, 170, can be or can be at least 60, 65,70, 75, 80, 85,90, 95, 96, 97, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 98.99 or 100% complementary to their target. 300, 310,320, 330, 340, 350, 360, 370, 380,390, 400, 410, 0236. It is understood that a “synthetic nucleic acid of the 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510,520, invention means that the nucleic acid does not have all or part 530, 540, 550,560,570, 580,590, 600, 610, 620, 630, 640, of a chemical structure or sequence of a naturally occurring US 2009/O 1921 11 A1 Jul. 30, 2009 26 nucleic acid. Consequently, it will be understood that the term 0240. As used herein “stringent condition(s) or “high “synthetic miRNA refers to a “synthetic nucleic acid' that stringency” are those conditions that allow hybridization functions in a cell or under physiological conditions as a between or within one or more nucleic acid strand(s) contain naturally occurring miRNA. ing complementary sequence(s), but preclude hybridization 0237 While embodiments of the invention may involve of random sequences. Stringent conditions tolerate little, if synthetic miRNAS or synthetic nucleic acids, in some any, mismatch between a nucleic acid and a target Strand. embodiments of the invention, the nucleic acid molecule(s) Such conditions are well known to those of ordinary skill in need not be “synthetic.” In certain embodiments, a non-syn the art, and are preferred for applications requiring high selec thetic nucleic acid or miRNA employed in methods and com tivity. Non-limiting applications include isolating a nucleic positions of the invention may have the entire sequence and acid, such as a gene or a nucleic acid segment thereof, or structure of a naturally occurring mRNA or miRNA precursor detecting at least one specific mRNA transcript or a nucleic or the mature mRNA or miRNA. For example, non-synthetic acid segment thereof, and the like. miRNAs used in methods and compositions of the invention 0241 Stringent conditions may comprise low salt and/or may not have one or more modified nucleotides or nucleotide high temperature conditions, such as provided by about 0.02 analogs. In these embodiments, the non-synthetic miRNA M to about 0.5 M NaCl at temperatures of about 42° C. to may or may not be recombinantly produced. In particular about 70° C. It is understood that the temperature and ionic embodiments, the nucleic acid in methods and/or composi strength of a desired stringency are determined in part by the tions of the invention is specifically a synthetic miRNA and length of the particular nucleic acid(s), the length and nucleo not a non-synthetic miRNA (that is, not a miRNA that quali base content of the target sequence(s), the charge composi fies as “synthetic'); though in other embodiments, the inven tion of the nucleic acid(s), and to the presence or concentra tion specifically involves a non-synthetic miRNA and not a tion of formamide, tetramethylammonium chloride or other synthetic miRNA. Any embodiments discussed with respect solvent(s) in a hybridization mixture. to the use of synthetic miRNAs can be applied with respect to 0242. It is also understood that these ranges, compositions non-synthetic miRNAs, and vice versa. and conditions for hybridization are mentioned by way of 0238. It will be understood that the term “naturally occur non-limiting examples only, and that the desired stringency ring refers to something found in an organism without any for a particular hybridization reaction is often determined intervention by a person; it could refer to a naturally-occur empirically by comparison to one or more positive or negative ring wildtype or mutant molecule. In some embodiments a controls. Depending on the application envisioned it is pre synthetic miRNA molecule does not have the sequence of a ferred to employ varying conditions of hybridization to naturally occurring miRNA molecule. In other embodiments, achieve varying degrees of selectivity of a nucleic acid a synthetic miRNA molecule may have the sequence of a towards a target sequence. In a non-limiting example, identi naturally occurring miRNA molecule, but the chemical struc fication or isolation of a related target nucleic acid that does ture of the molecule, particularly in the part unrelated specifi not hybridize to a nucleic acid under Stringent conditions may cally to the precise sequence (non-sequence chemical struc be achieved by hybridization at low temperature and/or high ture) differs from chemical structure of the naturally ionic strength. Such conditions are termed “low stringency’ occurring miRNA molecule with that sequence. In some or “low stringency conditions, and non-limiting examples of cases, the synthetic miRNA has both a sequence and non low stringency include hybridization performed at about 0.15 sequence chemical structure that are not found in a naturally M to about 0.9 MNaCl at a temperature range of about 20°C. occurring miRNA. Moreover, the sequence of the synthetic to about 50° C. Of course, it is within the skill of one in the art molecules will identify which miRNA is effectively being to further modify the low or high Stringency conditions to provided or inhibited; the endogenous miRNA will be Suite a particular application. referred to as the “corresponding miRNA. Corresponding 0243 A. Nucleobase. Nucleoside, Nucleotide, and Modi miRNA sequences that can be used in the context of the fied Nucleotides invention include, but are not limited to, all or a portion of 0244 As used herein a “nucleobase' refers to a heterocy those sequences in the SEQ IDs provided herein, as well as clic base. Such as for example a naturally occurring nucleo any other miRNA sequence, miRNA precursor sequence, or base (i.e., an A. T. G., C or U) found in at least one naturally any sequence complementary thereof. In some embodiments, occurring nucleic acid (i.e., DNA and RNA), and naturally or the sequence is or is derived from or contains all or part of a non-naturally occurring derivative(s) and analogs of Such a sequence identified herein to target a particular miRNA (or nucleobase. A nucleobase generally can form one or more set of miRNAs) that can be used with that sequence. Any 1, 2, hydrogen bonds (“anneal or “hybridize') with at least one 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, naturally occurring nucleobase in a manner that may substi 40, 50, 60, 70, 80,90, 100, 110, 120, 130 140, 150, 160, 170, tute for naturally occurring nucleobase pairing (e.g., the 180, 190, 200,210, 220, 230, 240,250, 260 or any number or hydrogen bonding between A and T. Gand C, and Aand U). range of sequences there between may be selected to the 0245 “Purine” and/or “pyrimidine' nucleobase(s) exclusion of all non-selected sequences. encompass naturally occurring purine and/or pyrimidine 0239. As used herein, “hybridization”, “hybridizes” or nucleobases and also derivative(s) and analog(s) thereof, “capable of hybridizing is understood to mean the forming including but not limited to, those a purine or pyrimidine of a double or triple stranded molecule or a molecule with Substituted by one or more of an alkyl, carboxyalkyl, amino, partial double or triple stranded nature. The term “anneal as hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol used herein is synonymous with “hybridize.” The term or alkylthiol moiety. Preferred alkyl (e.g., alkyl, carboxy “hybridization”, “hybridize(s) or “capable of hybridizing” alkyl, etc.) moieties comprise of from about 1, about 2, about encompasses the terms 'stringent condition(s) or “high 3, about 4, about 5, to about 6 carbon atoms. Other non stringency” and the terms “low stringency” or “low strin limiting examples of a purine or pyrimidine include a dea gency condition(s). Zapurine, a 2,6-diaminopurine, a 5-fluorouracil, a Xanthine, a US 2009/O 1921 11 A1 Jul. 30, 2009 27 hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bro miRNA molecule. Such nucleotides include those that can be mothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-me labeled with a dye, including a fluorescent dye, or with a thylguanine, a 8-thioguanine, an azaguanine, a 2-aminopu molecule such as biotin. Labeled nucleotides are readily rine, a 5-ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a available; they can be acquired commercially or they can be 5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propylu synthesized by reactions known to those of skill in the art. racil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N-dimethyladenine, an azaadenines, a 8-bromoadenine, a 0252 Modified nucleotides for use in the invention are not 8-hydroxyadenine, a 6-hydroxyaminopurine, a 6-thiopurine, naturally occurring nucleotides, but instead, refer to prepared a 4-(6-aminohexyl/cytosine), and the like. Other examples nucleotides that have a reactive moiety on them. Specific are well known to those of skill in the art. reactive functionalities of interest include: amino, sulfhydryl, 0246. As used herein, a “nucleoside” refers to an indi Sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, vidual chemical unit comprising a nucleobase covalently isocyanate, anhydride, monochlorotriazine, dichlorotriazine, attached to a nucleobase linker moiety. A non-limiting mono- or dihalogen Substituted pyridine, mono- or disubsti example of a “nucleobase linker moiety' is a Sugar compris tuted diazine, maleimide, epoxide, aziridine, Sulfonylhalide, ing 5-carbon atoms (i.e., a 5-carbon Sugar), including but acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hy not limited to a deoxyribose, a ribose, an arabinose, or a droxysuccinimide ester, imido ester, hydrazine, azidonitro derivative or an analog of a 5-carbon Sugar. Non-limiting phenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, examples of a derivative or an analog of a 5-carbon Sugar aldehyde, iodoacetyl, cyanomethyl ester, p-nitrophenyl ester, include a 2'-fluoro-2'-deoxyribose or a carbocyclic Sugar o-nitrophenyl ester, hydroxypyridine ester, carbonyl imida where a carbon is Substituted for an oxygen atom in the Sugar Zole, and the other Such chemical groups. In some embodi ring. Different types of covalent attachment(s) of a nucleo ments, the reactive functionality may be bonded directly to a base to a nucleobase linker moiety are known in the art nucleotide, or it may be bonded to the nucleotide through a (Kornberg and Baker, 1992). linking group. The functional moiety and any linker cannot 0247. As used herein, a “nucleotide' refers to a nucleoside substantially impair the ability of the nucleotide to be added further comprising a “backbone moiety'. A backbone moiety to the miRNA or to be labeled. Representative linking groups generally covalently attaches a nucleotide to another mol include carbon containing linking groups, typically ranging ecule comprising a nucleotide, or to another nucleotide to from about 2 to 18, usually from about 2 to 8 carbon atoms, form a nucleic acid. The “backbone moiety” in naturally where the carbon containing linking groups may or may not occurring nucleotides typically comprises a phosphorus moi include one or more heteroatoms, e.g. S. O. Netc., and may or ety, which is covalently attached to a 5-carbon Sugar. The may not include one or more sites of unsaturation. Of particu attachment of the backbone moiety typically occurs at either lar interest in many embodiments is alkyl linking groups, the 3'- or 5'-position of the 5-carbon sugar. However, other typically lower alkyl linking groups of 1 to 16, usually 1 to 4 types of attachments are known in the art, particularly when a carbon atoms, where the linking groups may include one or nucleotide comprises derivatives or analogs of a naturally more sites of unsaturation. The functionalized nucleotides (or occurring 5-carbon Sugar or phosphorus moiety. primers) used in the above methods of functionalized target 0248. A nucleic acid may comprise, or be composed generation may be fabricated using known protocols or pur entirely of a derivative or analog of a nucleobase, a nucleo chased from commercial vendors, e.g., Sigma, Roche, base linker moiety and/or backbone moiety that may be Ambion, Biosearch Technologies and NEN. Functional present in a naturally occurring nucleic acid. RNA with groups may be prepared according to ways known to those of nucleic acid analogs may also be labeled according to meth skill in the art, including the representative information found ods of the invention. As used herein a "derivative' refers to a in U.S. Pat. Nos. 4,404,289; 4,405,711; 4,337,063 and 5,268, chemically modified or altered form of a naturally occurring 486, and U.K. Patent 1,529.202, which are all incorporated by molecule, while the terms “mimic' or “analog refer to a reference. molecule that may or may not structurally resemble a natu 0253 Amine-modified nucleotides are used in several rally occurring molecule or moiety, but possesses similar embodiments of the invention. The amine-modified nucle functions. As used herein, a "moiety’ generally refers to a otide is a nucleotide that has a reactive amine group for Smaller chemical or molecular component of a larger chemi attachment of the label. It is contemplated that any ribonucle cal or molecular structure. Nucleobase, nucleoside and nucle otide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) otide analogs or derivatives are well known in the art, and can be modified for labeling. Examples include, but are not have been described (see for example, Scheit, 1980, incorpo limited to, the following modified ribo- and deoxyribo-nucle rated herein by reference). otides: 5-(3-aminoallyl)-UTP; 8-(4-amino)butyl-amino 0249 Additional non-limiting examples of nucleosides, ATP and 8-(6-amino)butyl-amino-ATP: N6-(4-amino)bu nucleotides or nucleic acids include tyl-ATP N6-(6-amino)butyl-ATP, N4-2.2-oxy-bis (0250 those in: U.S. Pat. Nos. 5,681,947, 5,652,099 and (ethylamine)-CTP; N6-(6-Amino)hexyl-ATP; 8-(6- 5,763,167, 5,614,617, 5,670.663, 5,872,232, 5,859,221, Amino)hexyl-amino-ATP: 5-propargylamino-CTP, 5,446,137, 5,886,165, 5,714,606, 5,672,697, 5,466,786, 5-propargylamino-UTP; 5-(3-aminoallyl)-dUTP; 8-(4- 5,792,847, 5,223,618, 5,470,967, 5,378,825, 5,777,092, amino)butyl-amino-dATP and 8-(6-amino)butyl-amino 5,623,070, 5,610,289, 5,602,240, 5,858,988, 5,214,136, dATP; N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, 5,700,922, 5,708,154, 5,728,525, 5,637,683, 6,251,666, N4-2.2-oxy-bis-(ethylamine)-dCTP; N6-(6-Amino)hexyl 5,480,980, and 5,728,525, each of which is incorporated dATP; 8-(6-Amino)hexyl-amino-dATP; 5-propargy herein by reference in its entirety. lamino-dCTP, and 5-propargylamino-dUTP. Such nucle 0251 Labeling methods and kits of the invention specifi otides can be prepared according to methods known to those cally contemplate the use of nucleotides that are both modi of skill in the art. Moreover, a person of ordinary skill in the fied for attachment of a label and can be incorporated into a art could prepare other nucleotide entities with the same US 2009/O 1921 11 A1 Jul. 30, 2009 28 amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP. 0261 C. Isolation of Nucleic Acids ATP, dCTP, dGTP, dTTP, ord UTP in place of a 5-(3-aminoal 0262 Nucleic acids may be isolated using techniques well lyl)-UTP. known to those of skill in the art, though in particular embodi ments, methods for isolating Small nucleic acid molecules, 0254 B. Preparation of Nucleic Acids and/or isolating RNA molecules can be employed. Chroma 0255. A nucleic acid may be made by any technique tography is a process often used to separate or isolate nucleic known to one of ordinary skill in the art, such as for example, acids from protein or from other nucleic acids. Such methods chemical synthesis, enzymatic production, or biological pro can involve electrophoresis with a gel matrix, filter columns, duction. It is specifically contemplated that miRNA probes of alcohol precipitation, and/or other chromatography. If the invention are chemically synthesized. miRNA from cells is to be used or evaluated, methods gen 0256 In some embodiments of the invention, miRNAs are erally involve lysing the cells with a chaotropic (e.g., guani recovered or isolated from a biological sample. The miRNA dinium isothiocyanate) and/or detergent (e.g., N-lauroylsar may be recombinant or it may be natural or endogenous to the cosine) prior to implementing processes for isolating cell (produced from the cell's genome). It is contemplated particular populations of RNA. that a biological sample may be treated in a way so as to 0263. In particular methods for separating miRNA from other nucleic acids, a gel matrix is prepared using polyacry enhance the recovery of small RNA molecules such as lamide, though agarose can also be used. The gels may be miRNA. U.S. patent application Ser. No. 10/667,126 graded by concentration or they may be uniform. Plates or describes Such methods and it is specifically incorporated by tubing can be used to hold the gel matrix for electrophoresis. reference herein. Generally, methods involve lysing cells Usually one-dimensional electrophoresis is employed for the with a solution having guanidinium and a detergent. separation of nucleic acids. Plates are used to prepare a slab 0257 Alternatively, nucleic acid synthesis is performed gel, while the tubing (glass or rubber, typically) can be used to according to standard methods. See, for example, Itakura and preparea tube gel. The phrase “tube electrophoresis” refers to Riggs (1980) and U.S. Pat. Nos. 4,704,362, 5,221,619, and the use of a tube or tubing, instead of plates, to form the gel. 5,583,013, each of which is incorporated herein by reference. Materials for implementing tube electrophoresis can be Non-limiting examples of a synthetic nucleic acid (e.g., a readily prepared by a person of skill in the art or purchased, synthetic oligonucleotide), include a nucleic acid made by in such as from C.B.S. Scientific Co., Inc. or Scie-Plas. vitro chemically synthesis using phosphotriester, phosphite, 0264 Methods may involve the use of organic solvents or phosphoramidite chemistry and Solid phase techniques and/or alcohol to isolate nucleic acids, particularly miRNA such as described in EP 266.032, incorporated herein by used in methods and compositions of the invention. Some reference, or via deoxynucleoside H-phosphonate intermedi embodiments are described in U.S. patent application Ser. ates as described by Froehler et al., 1986 and U.S. Pat. No. No. 10/667,126, which is hereby incorporated by reference. 5,705,629, each incorporated herein by reference. Various Generally, this disclosure provides methods for efficiently different mechanisms of oligonucleotide synthesis have been isolating Small RNA molecules from cells comprising: add disclosed in for example, U.S. Pat. Nos. 4,659.774, 4,816, ing an alcohol solution to a cell lysate and applying the 571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, alcohol/lysate mixture to a solid support before eluting the 5,574,146, 5,602.244, each of which is incorporated herein RNA molecules from the solid support. In some embodi by reference. ments, the amount of alcohol added to a cell lysate achieves 0258. A non-limiting example of an enzymatically pro an alcohol concentration of about 55% to 60%. While differ duced nucleic acid include one produced by enzymes in ent alcohols can be employed, ethanol works well. A solid amplification reactions such as PCRTM (see for example, U.S. Support may be any structure, and it includes beads, filters, Pat. Nos. 4,683.202 and 4,682,195, each incorporated herein and columns, which may include a mineral or polymer Sup by reference), or the synthesis of an oligonucleotide port with electronegative groups. A glass fiber filter or column described in U.S. Pat. No. 5,645,897, incorporated herein by has worked particularly well for such isolation procedures. reference. See also Sambrook et al., 2001, incorporated 0265. In specific embodiments, miRNA isolation pro cesses include: a) lysing cells in the sample with a lysing herein by reference). Solution comprising guanidinium, wherein a lysate with a 0259 Oligonucleotide synthesis is well known to those of concentration of at least about 1 M guanidinium is produced; skill in the art. Various different mechanisms of oligonucle b) extracting miRNA molecules from the lysate with an otide synthesis have been disclosed in for example, U.S. Pat. extraction Solution comprising phenol; c) adding to the lysate Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, an alcohol solution for forming a lysatefalcohol mixture, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is wherein the concentration of alcohol in the mixture is incorporated herein by reference. between about 35% to about 70%; d) applying the lysate/ 0260 Recombinant methods for producing nucleic acids alcohol mixture to a solid support; e) eluting the miRNA in a cell are well known to those of skill in the art. These molecules from the Solid Support with an ionic Solution; and, include the use of vectors (viral and non-viral), plasmids, f) capturing the miRNA molecules. Typically the sample is cosmids, and other vehicles for delivering a nucleic acid to a dried and resuspended in a liquid and Volume appropriate for cell, which may be the target cell (e.g., a cancer cell) or simply Subsequent manipulation. a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the V. Labels and Labeling Techniques context of a cell free system so long as the reagents for 0266. In some embodiments, the present invention con generating the RNA molecule are present. Such methods cerns miRNA that are labeled. It is contemplated that miRNA include those described in Sambrook, 2003, Sambrook, 2001 may first be isolated and/or purified prior to labeling. This and Sambrook, 1989, which are hereby incorporated by ref may achieve a reaction that more efficiently labels the CCC. miRNA, as opposed to other RNA in a sample in which the US 2009/O 1921 11 A1 Jul. 30, 2009 29 miRNA is not isolated or purified prior to labeling. In many Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor embodiments of the invention, the label is non-radioactive. 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Generally, nucleic acids may be labeled by adding labeled Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, nucleotides (one-step process) or adding nucleotides and Alexa Fluor 750; amine-reactive BODIPY dyes, such as labeling the added nucleotides (two-step process). BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, 0267 A. Labeling Techniques BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, 0268. In some embodiments, nucleic acids are labeled by BODIPY 630/650, BODIPY 650/655, BODIPY FL, catalytically adding to the nucleic acid an already labeled BODIPY R6G, BODIPY TMR, and, BODIPY-TR: Cy3, nucleotide or nucleotides. One or more labeled nucleotides Cy5,6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, can be added to miRNA molecules. See U.S. Pat. No. 6,723, Oregon Green 488, Oregon Green 500, Oregon Green 514, 509, which is hereby incorporated by reference. Pacific Blue, REG, Rhodamine Green, Rhodamine Red, 0269. In other embodiments, an unlabeled nucleotide or Renographin, ROX, SYPRO, TAMRA, 2',4',5'7"-Tetrabro nucleotides is catalytically added to a miRNA, and the unla mosulfonefluorescein, and TET. beled nucleotide is modified with a chemical moiety that 0275 Specific examples of fluorescently labeled ribo enables it to be subsequently labeled. In embodiments of the nucleotides are available from Molecular Probes, and these invention, the chemical moiety is a reactive amine Such that include, Alexa Fluor 488-5-UTP. Fluorescein-12-UTP, the nucleotide is an amine-modified nucleotide. Examples of BODIPY FL-14-UTP, BODIPYTMR-14-UTP. Tetramethyl amine-modified nucleotides are well known to those of skill rhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5- in the art, many being commercially available Such as from UTP and BODIPY TR-14-UTP. Other fluorescentribonucle Ambion, Sigma, Jena BioScience, and TriLink. otides are available from Amersham Biosciences, such as 0270. In contrast to labeling of cDNA during its synthesis, Cy3-UTP and Cy5-UTP. the issue for labeling miRNA is how to label the already 0276 Examples of fluorescently labeled deoxyribonucle existing molecule. The present invention concerns the use of otides include Dinitrophenyl (DNP)-11-dUTP, Cascade an enzyme capable of using a di- or tri-phosphate ribonucle Blue-7-dUTP, Alexa Fluor 488-5-dUTP. Fluorescein-12 otide or deoxyribonucleotide as a substrate for its addition to dUTP, Oregon Green 488-5-dUTP BODIPY FL-14-dUTP, a miRNA. Moreover, in specific embodiments, it involves Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, using a modified di- or tri-phosphate ribonucleotide, which is BODIPY TMR-14-dUTP. Tetramethylrhodamine-6-dUTP. added to the 3' end of a miRNA. Enzymes capable of adding Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas such nucleotides include, but are not limited to, poly (A) Red-12-dUTP, Texas Red-5-dUTP BODIPY TR-14-dUTP, polymerase, terminal transferase, and polynucleotide phos Alexa Fluor 594-5-dUTP BODIPY 630/650-14-dUTP, phorylase. In specific embodiments of the invention, a ligase BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA is contemplated as not being the enzyme used to add the label, dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7- and instead, a non-ligase enzyme is employed. Terminal OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP. transferase catalyzes the addition of nucleotides to the 3' 0277. It is contemplated that nucleic acids may be labeled terminus of a nucleic acid. Polynucleotide phosphorylase can with two different labels. Furthermore, fluorescence reso polymerize nucleotide diphosphates without the need for a nance energy transfer (FRET) may be employed in methods primer. of the invention (e.g., Klostermeier et al., 2002; Emptage, 0271 B. Labels 2001; Didenko, 2001, each incorporated by reference). 0272 Labels on miRNA or miRNA probes may be colo 0278 Alternatively, the label may not be detectable perse, rimetric (includes visible and UV spectrum, including fluo but indirectly detectable or allowing for the isolation or sepa rescent), luminescent, enzymatic, or positron emitting (in ration of the targeted nucleic acid. For example, the label cluding radioactive). The label may be detected directly or could be biotin, digoxigenin, polyvalent cations, chelator indirectly. Radioactive labels include ''I, P. P. and S. groups and the other ligands, include ligands for an antibody. Examples of enzymatic labels include alkaline phosphatase, (0279 C. Visualization Techniques luciferase, horseradish peroxidase, and B-galactosidase. 0280 A number of techniques for visualizing or detecting Labels can also be proteins with luminescent properties, e.g., labeled nucleic acids are readily available. Such techniques green fluorescent protein and phycoerythrin. include, microscopy, arrays, Fluorometry, Light cyclers or 0273. The colorimetric and fluorescent labels contem other real time PCR machines, FACS analysis, scintillation plated for use as conjugates include, but are not limited to, counters, Phosphoimagers, Geiger counters, MRI. CAT, anti Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL: Cas body-based detection methods (Westerns, immunofluores cade Blue; Cascade Yellow; coumarin and its derivatives, cence, immunohistochemistry), histochemical techniques, Such as 7-amino-4-methylcoumarin, aminocoumarin and HPLC (Griffey et al., 1997), spectroscopy, capillary gel elec hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins trophoresis (Cummins et al., 1996), spectroscopy; mass spec and erythrosins; fluorescein and its derivatives. Such as fluo troscopy; radiological techniques; and mass balance tech rescein isothiocyanate; macrocyclic chelates of lanthanide niques. ions, such as Quantum DyeTM: Marina Blue: Oregon Green; 0281. When two or more differentially colored labels are rhodamine dyes, such as rhodamine red, tetramethyl employed, fluorescent resonance energy transfer (FRET) rhodamine and rhodamine 6G, Texas Red; fluorescent energy techniques may be employed to characterize association of transfer dyes. Such as thiazole orange-ethidium heterodimer; one or more nucleic acid. Furthermore, a person of ordinary and, TOTAB. skill in the art is well aware of ways of visualizing, identify 0274 Specific examples of dyes include, but are not lim ing, and characterizing labeled nucleic acids, and accord ited to, those identified above and the following: Alexa Fluor ingly, such protocols may be used as part of the invention. 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Examples of tools that may be used also include fluorescent Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa microscopy, a BioAnalyzer, a plate reader, Storm (Molecular US 2009/O 1921 11 A1 Jul. 30, 2009 30
Dynamics), Array Scanner, FACS (fluorescent activated cell IDs described herein. Any nucleic acid discussed above may Sorter), or any instrument that has the ability to excite and be implemented as part of a kit. detect a fluorescent molecule. 0286 The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means VI. KITS of the kits will generally include at least one vial, test tube, 0282 Any of the compositions described herein may be flask, bottle, Syringe or other container means, into which a comprised in a kit. In a non-limiting example, reagents for component may be placed, and preferably, Suitably aliquot isolating miRNA, labeling miRNA, and/or evaluating a ted. Where there is more than one component in the kit (label miRNA population using an array, nucleic acid amplification, ing reagent and label may be packaged together), the kit also and/or hybridization can be included in a kit, as well reagents will generally contain a second, third or other additional for preparation of samples from blood samples. The kit may container into which the additional components may be sepa further include reagents for creating or synthesizing miRNA rately placed. However, various combinations of components probes. The kits will thus comprise, in suitable container may be comprised in a vial. The kits of the present invention means, an enzyme for labeling the miRNA by incorporating also will typically include a means for containing the nucleic labeled nucleotide or unlabeled nucleotides that are subse acids, and any other reagent containers in close confinement quently labeled. In certain aspects, the kit can include ampli for commercial sale. Such containers may include injection or fication reagents. In other aspects, the kit may include various blow molded plastic containers into which the desired vials Supports, such as glass, nylon, polymeric beads, and the like, are retained. and/or reagents for coupling any probes and/or target nucleic 0287. When the components of the kit are provided in one acids. It may also include one or more buffers, such as reac and/or more liquid Solutions, the liquid Solution is an aqueous tion buffer, labeling buffer, washing buffer, or a hybridization Solution, with a sterile aqueous solution being particularly buffer, compounds for preparing the miRNA probes, and preferred. components for isolating miRNA. Other kits of the invention 0288 However, the components of the kit may be pro may include components for making a nucleic acid array vided as dried powder(s). When reagents and/or components comprising miRNA, and thus, may include, for example, a are provided as a dry powder, the powder can be reconstituted Solid Support. by the addition of a suitable solvent. It is envisioned that the 0283 Kits for implementing methods of the invention Solvent may also be provided in another container means. In described herein are specifically contemplated. In some Some embodiments, labeling dyes are provided as a dried embodiments, there are kits for preparing miRNA for multi power. It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, labeling and kits for preparing miRNA probes and/or miRNA 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, arrays. In these embodiments, kit comprise, in Suitable con 300, 400, 500, 600, 700, 800, 900, 1000 ug or at least or at tainer means, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of the most those amounts of dried dye are provided in kits of the following: (1) poly(A) polymerase; (2) unmodified nucle invention. The dye may then be resuspended in any Suitable otides (G. A. T. C. and/or U); (3) a modified nucleotide solvent, such as DMSO. (labeled or unlabeled); (4) poly(A) polymerase buffer; and, 0289 Such kits may also include components that facili (5) at least one microfilter; (6) label that can be attached to a tate isolation of the labeled miRNA. It may also include nucleotide; (7) at least one miRNA probe; (8) reaction buffer; components that preserve or maintain the miRNA or that (9) a miRNA array or components for making such an array; protect against its degradation. Such components may be (10) acetic acid; (11) alcohol; (12) solutions for preparing, RNAse-free or protect against RNAses. Such kits generally isolating, enriching, and purifying miRNAS or miRNA will comprise, in Suitable means, distinct containers for each probes or arrays. Other reagents include those generally used individual reagent or solution. for manipulating RNA, such as formamide, loading dye, ribo 0290. A kit will also include instructions for employing nuclease inhibitors, and DNase. the kit components as well the use of any other reagent not 0284. In specific embodiments, kits of the invention included in the kit. Instructions may include variations that include an array containing miRNA probes, as described in can be implemented. the application. An array may have probes corresponding to 0291 Kits of the invention may also include one or more all known miRNAS of an organism or a particular tissue or of the following: Control RNA; nuclease-free water; RNase organ in particular conditions, or to a Subset of Such probes. free containers, such as 1.5 ml tubes; RNase-free elution The subset of probes on arrays of the invention may be or tubes; PEG or dextran; ethanol; acetic acid; sodium acetate; include those identified as relevant to a particular diagnostic, ammonium acetate; guanidinium; detergent; nucleic acid size therapeutic, or prognostic application. For example, the array marker; RNase-free tube tips; and RNase or DNase inhibi may contain one or more probes that is indicative or Sugges tors. It is contemplated that Such reagents are embodiments of tive of (1) a disease or condition (acute myeloid leukemia), kits of the invention. Such kits, however, are not limited to the (2) Susceptibility or resistance to a particular drug or treat particular items identified above and may include any reagent ment; (3) Susceptibility to toxicity from a drug or Substance; used for the manipulation or characterization of miRNA. (4) the stage of development or severity of a disease or con dition (prognosis); and (5) genetic predisposition to a disease VII. EXAMPLES or condition. 0292. The following examples are included to demon 0285 For any kit embodiment, including an array, there strate preferred embodiments of the invention. It should be can be nucleic acid molecules that contain or can be used to appreciated by those of skill in the art that the techniques amplify a sequence that is a variant of identical to or comple disclosed in the examples which follow represent techniques mentary to all or part of any of SEQIDs described herein. In discovered by the inventor to function well in the practice of certain embodiments, a kit or array of the invention can con the invention, and thus can be considered to constitute pre tain one or more probes for the miRNAs identified by the SEQ ferred modes for its practice. However, those of skill in the art US 2009/O 1921 11 A1 Jul. 30, 2009
should, in light of the present disclosure, appreciate that many h, 24 h, and 72 h post transfection. Total RNA was extracted changes can be made in the specific embodiments which are using RNAqueous(R-4PCR (Ambion) according to the manu disclosed and still obtain a like or similar result without facturer's recommended protocol. departing from the spirit and scope of the invention. 0295 mRNA array analyses were performed by Asuragen Services (ASuragen, Inc.; Austin, Tex., USA), according to Example 1 the company's standard operating procedures. Using the Gene Expression Analysis Following Transfection Message AmpTMII-96 aRNA Amplification Kit (Ambion, cat. no. 1819)2 ug of total RNA were used for target preparation with Hsa-miR-124a and labeling with biotin. cRNA yields were quantified using 0293 miRNAs are believed to regulate gene expression by an Agilent Bioanalyzer 2100 (Agilent Technologies, Inc.; binding to target mRNA transcripts and (1) initiating tran Santa Clara, Calif., USA) capillary electrophoresis protocol. Script degradation or (2) altering protein translation from the Labeled target was hybridized to Affymetrix mRNA arrays transcript. Translational regulation leading to an up or down (Human HG-U133A 2.0 arrays; Affymetrix, Inc.; Santa change in protein expression may lead to changes in activity Clara, Calif., USA) using the manufacturer's recommenda and expression of downstream gene products and genes that tions and the following parameters. Hybridizations were car are in turn regulated by those proteins. These numerous regu ried out at 45° C. for 16 hr in an Affymetrix Model 640 latory effects may be revealed as changes in the global mRNA hybridization oven. Arrays were washed and stained on an expression profile. Microarray gene expression analyses were Affymetrix FS450 Fluidics station, running the wash script performed to identify genes that are mis-regulated by hsa Midi euk2v3 450. The arrays were scanned on a Affymetrix miR-124a expression. GeneChip Scanner 3000. Summaries of the image signal 0294 Synthetic Pre-miRTM-hsa-miR-124a (Ambion; data, group mean values, p-values with significance flags, log Austin, Tex., USA) or two negative control (NC) miRNAs ratios and gene annotations for every gene on the array were (Pre-miRTM microRNA Precursor Molecule-Negative Con generated using the Affymetrix Statistical Algorithm MAS trol #1, Ambion, cat. no. AM17110 and Pre-miRTM 5.0 (GCOS v 1.3). Data were reported in a file (cabinet) con microRNA Precursor Molecule-Negative Control #2, taining the Affymetrix data and result files and in files (cel) Ambion, cat. no. AM17111) were reverse transfected into containing the primary image and processed cell intensities of quadruplicate samples of A549 cells for each of three time the arrays. Data were normalized for the effect observed by points. Cells were transfected using siPORTTM NeoFXTM the average of two negative control microRNA sequences and (Ambion, cat. no. AM4511) according to the manufacturer's then were averaged together for presentation. A list of genes recommendations using the following parameters: 200,000 whose expression levels varied by at least 0.7 log from the cells per well in a 6 well plate, 5.0 ul of NeoFX, 30 nM final average negative control was assembled. Results of the concentration of miRNA in 2.5 ml. Cells were harvested at 4 microarray gene expression analysis are shown in Table 1.
TABLE 1 Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.445113 membrane-associated ring finger MARCH2 1.44651 (C3HC4)2 HSS67284 membrane-associated ring finger MARCHS -1.1922 (C3HC4).5 HS.432862 membrane-associated ring finger MARCH6 -1.44433 (C3HC4) 6 HS.65377 membrane-associated ring finger MARCH9 142294 (C3HC4) 9 HS.4696.15 septin 10 SEPT10 -2.05922 HS.4696.15 septin 10 SEPT10 -2.02304 HS128,199 Septin 11 SEPT11 -1.73143 HS128,199 Septin 11 SEPT11 -1.4953S HSS10949 cDNA clone IMAGE: 5296106 -2.8575 -2.851.97 HS128753 full-length cDNA clone -2.72106 CSODD009YB17 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) HS.56O444 Transcribed locus -2.57552 HSSSO28 cDNA clone IMAGE: 6043059 -242829 HS.44O492 cDNA FLJ43100 fis, clone -2.32519 CTONG20O31 OO HS.454036 cDNA clone IMAGE: 4814292 -2.18762 HS.88045 cDNA FLJ45482 fis, clone -2.14874 BRTHA2OO1953 -2.14729 -2.10765 HS.383OSO Similar to esterase/N-deacetylase (EC -2.02776 3.5.1.—), 5 OK hepatic-rabbit US 2009/O 1921 11 A1 Jul. 30, 2009 32
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Ti le Gene Symbol NC #2) S.355655 cDNA FLJ36584 fis, clone -2.02022 S.S47541 TRACH2013450 // MRNA, cDNA DKFZp564A222 S.S62593 Transcribed locus -1965O1 -1.82654 S.549889 cDNA FLJ12874 fis, clone -1.791.33 NT2RP2003769 Transcribed locus -1.78964 cDNA FLJ26539 fis, clone KDNO9310 -1.723.63 Transcribed locus, weakly similar to -1.66449 NP 060312.1 hypothetical protein FLU20489 S. 135904 cDNA FLJ26959 fis, clone SLV00568 -1.65519 S.191482 cDNAc one IMAGE: 476.9453 -1.61616 S.372378 cDNAc one IMAGE: 4797099 -1.61128 S.406574 Transcribed locus -15936.2 S.173O3O cDNA FLJ34013 fis, clone -159231 FCBBF2002111 cDNA FLJ30010 fis, clone -1.59113 3NB692OOO154 S.27463 Transcribed locus, weakly similar to -158144 NP 055301.1 neuronal thread protein AD7c-NT Transcribed locus -1566.79 cDNA FLJ11381 fis, clone -156053 HEMBA1OOOSO1 S.491872 Transcribed locus, weakly similar to -1.SS238 NP 694983.1 hypothetical protein FLJ25952 S.SO/978 cDNA FLJ34896 fis, clone -1.53383 NT2NE2O1818O cDNA FLJ37777 fis, clone -153149 BRHIP2O26274 S.238996 Transcribed locus, weakly similar to -151518 XP 51 0104.1 S.499682 Transcribed locus -151318 -1.49041 S.29464 mRNA: -148947 clone D S.SSO906 cDNA FLJ33653 fis, clone -147234 BRAMY2O24715 S.356S30 Transcribed locus, strongly similar to -145472 XP 42 205. -140051 S.212709 full-length cDNA clone CSODJO13YE21 -1392O6 of T cel s (Jurkat cell line) Cot 10 normali S.1673.71 -138094 S.1O2941 cDNA: FLJ21531 fis, clone COLO6036 -1.36543 S.78OSO Transcribed locus, weakly similar to -136494 XP 51 0104.1 Arsenic transactivated protein 1 -135564 Transcribed locus -1.3506 Transcribed locus -132209 Transcribed locus -1.3O338 Transcribed locus -1.28178 mRNA: cDNA DKFZp451 KO63 (from -1.26815 clone D KFZp451 KO63) -1.24766 S. 69.504 Hypothetical LOC133993 -1.2O3O1 S.S61587 cDNA: FLJ22100 fis, clone HEP17127 -1.19883 S.467411 Transcribed locus, moderately similar to -1.1913S XP 512541.1 S.24359 cDNA FLJ11174 fis, clone -1.1838 PLACE OO7367 -1171.96 S.433345 Full-length cDNA clone -116946 CLOBB014ZHO4 of Neuroblastoma of Homo sapiens (human) -1.16405 US 2009/O 1921 11 A1 Jul. 30, 2009 33
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) -115814 -1.15514 S.631.87 DNA FLJ41910 fis, clone -114991 EBLM2007834 S.S61587 DNA: FLJ2 2100 fis, clone HEP17127 -1.14801 S.141OO3 DNA: FLJ2 1691 fis, clone COLO9555 -1146.67 HSS724 DNA clone IMAGE: 5286019 -109054 S.96918 OH11CR1J gene, loss of -1.08984 terozygosity, 11, chromosomal region gene J product S.S16159 ypothetical LOC38.8969 -104658 OO113 S.432924 ull length insert cDNAYI37C01 O1289 HS.44698 DNA FLJ42484 fis, clone O2778 RACE2O32182
S.176376 Transcribed OCS S.30977 cDNA FLJ3 513 fis, clone NT2R1OOO 27 S.143746 cDNA FLJ43450 fis, clone O6817 OCBBF2032968 S.56.1280 Transcribed OCS O8508 S.518129 Transcribed ocus, weakly similar to 10663 XP 51 0104. 1 S.406990 Phosphodies erase 4D interacting protein 10734 (myomegalin) Transcribed OCS 134O7 Transcribed OCS 14717 Transcribed ocus, weakly similar to 15046 NP 689672. 2 hypothetical protein Homo sapiens, clone IMAGE: 3930408, 15922 mRNA S.1031.59 Full length insert cDNA clone ZD51F08 16506 S.128076 Transcribed OCS 17721 S.526422 Similar to ankyrin repeat domain 20A fif 18723 S.S673S4 Hypothetica gene Supported by NM 03225 S.36OO28 Transcribed OCS 19194 S.416155 Glioma amp ified sequence 64 19709 2O4O1 S.452398 cDNA FLJ30740 fis, clone 2O445 FEBRA2OOO319 Transcribed OCS 21733 mRNA, cDNA DKFZp779L1068 (from 21741 clone DKFZ. p779L1068) S.370049 Hypothetica protein LOC157278 22335 S.113631 Transcribed ocus, weakly similar to 22639 NP 062553.1 hypothetical protein FLJ11267 HS.44898 cDNA FLJ40901 fis, clone 23966 UTERU20O3704 S.145804 cDNA clone IMAGE: 53.12086 2741 S.87734 Homo sapiens, Similar to deafness, 27749 autosomal dominant 5 homolog (human), clone I S.2OO141 Transcribed locus 27791 S.387014 Hypothetical LOC2196.38 28S99 S.446559 Full-length c DNA clone 29046 CSODKO1OYA20 of HeLa cells Cot 25 normalized of Homo sapiens (human) S.14691 Transcribed locus 29222 S.408455 cDNA FLJ33993 fis, clone 313.87 DFNES2007757 HS.44698 cDNA FLJ42484 fis, clone 31419 BRACE2O32182 S.22545 cDNA FLJ12935 fis, clone 31854 NT2RP2004982 S.322761 Hypothetical LOC4972.57 .32524 32571 US 2009/O 1921 11 A1 Jul. 30, 2009 34
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.12O170 Transcribed locus, moderately similar to 3.3979 XP 512541.1 S.374451 Homo sapiens, clone IMAGE:4454331, 34083 mRNA S.23606 Transcribed locus 34158 S.446446 Hypothetical LOC375010 34249 S.S36567 cDNA FLJ37859 fis, clone 35057 BRSSN2O15369 S.3O2631 cDNA clone IMAGE: 5286843 36052 S.174273 Transcribed locus 38715 S.371609 cDNA FLJ31683 fis, clone 391.64 NT2RI2005.353 S.S27872 Transcribed locus 39.529 S.371609 cDNA FLJ31683 fis, clone 40524 NT2RI2005.353 HS.S.096 Homo sapiens, clone IMAGE: 3858719, mRNA S.282800 Transcribed locus 41445 HS.8379 Full-length cDNA clone CSODJOO1YJO5 41851 of T cells (Jurkat cell line) Cot 10 normali S.SS2O18 Transcribed locus 42347 S.88156 Transcribed locus 427 OS S.151334 Transcribed locus 42983 S.405427 Homo sapiens, clone IMAGE: 5175565, 43347 mRNA S.13SOO cDNA FLJ31593 fis, clone 44009 NT2RI2OO2481 S.S3S360 cDNA clone IMAGE: 65OO775 45009 S.21423 cDNA FLJ30424 fis, clone 45296 BRACE2008.881, weakly similar to ZINCFINGER PROTEIN 195 S.21423 cDNA FLJ30424 fis, clone 46056 BRACE2008.881, weakly similar to ZINCFINGER PROTEIN 195 S.27688 Full-length cDNA clone 46675 CSODF012YD09 of Fetal brain of Homo Sapiens (human) S.536439 Transcribed locus 471.16 4.9415 S.2238O Full length insert cDNA clone ZD79H10 49977 S.314414 Homo sapiens, clone IMAGE: 5743779, S6S12 mRNA S.234.478 cDNA: FLJ22648 fis, clone HSIO7329 57549 S838S S.178144 Homo sapiens, clone IMAGE: 5743799, 67264 mRNA .6849S S.548682 Full-length cDNA clone 68836 CSODMO11YC22 of Fetal liver of Homo sapiens (human) S.126893 Transcribed locus .69863 S.328.236 cDNA clone IMAGE: 48.06358 70004 S.88156 Transcribed locus .70768 .70885 71742 mRNA, cDNA DKFZp779L1068 (from 78147 clone DKFZp779L1068) S. 53126 Transcribed locus, moderately similar to 81242 XP 517655.1 PREDICTED: similar to KIAAO 81859 S.444083 Transcribed locus .83349 83583 S.S16367 mRNA, cDNA DKFZp686P18215 843O2 (from clone DKFZp686P18215) S.370049 Hypothetical protein LOC157278 911.93 S.351126 Transcribed locus, moderately similar to ..99147 XP 517655.1 PREDICTED: similar to KIAAO US 2009/O 1921 11 A1 Jul. 30, 2009 35
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) 2.O1427 S.446671 Transcribed locus, strongly similar to 2.04867 NP 003156.1 syntaxin binding protein 1: S cDNA FLJ45259 fis, clone 2.14126 BRHIP2O2O695 218694 S.16O711 Transcribed locus 2.28638 S.436057 Transcribed locus 2.28848 S.418040 cDNA clone IMAGE:30367357 2.41037 S.443798 Transcribed locus 2.48069 S.146317 Transcribed locus, weakly similar to 2.486.36 XP 517655.1 PREDICTED: similar to KIAAO825 S.308060 LOC440570 2.548 S.99785 cDNA: FLJ21245 fis, clone COLO1184 2.69373 S.S23897 cDNA FLJ38112 fis, clone 3.38473 D3OST20022.72 3.498.31 S.462598 82-kD FMRP Interacting Protein 182-FIP -1.772S1 S.462598 82-kD FMRP Interacting Protein 182-FIP -1.34345 S.SS2S84 AP2 associated kinase 1 AAK1 1.23153 S.336768 4-aminobutyrate aminotransferase ABAT 12O681 S.336768 4-aminobutyrate aminotransferase ABAT 1.23674 S.429294 ATP-binding cassette, Sub-family A ABCA1 18146 (ABC1), member 1 S.429294 ATP-binding cassette, sub-family A ABCA1 199636 (ABC1), member 1 S.134585 ATP-binding cassette, Sub-family A ABCA12 4.51284 (ABC1), member 12 S.124649 ATP-binding cassette, Sub-family G ABCG1 2.6786S (WHITE), member 1 S.508148 abil-interactor ABI1 -11678 S.2OO136 acetyl-Coenzyme A acyltransferase 2 ACAA2 -3.11952 (mitochondrial 3-oxoacyl-Coenzyme A thiolase S.445040 acyl-Coenzyme A dehydrogenase, C-4 ACADM -148728 to C-12 straight chain S.81934 acyl-Coenzyme A dehydrogenase, ACADSB 1.2938S short branched chain S.363 137 acetyl-Coenzyme A acetyltransferase 2 ACAT2 -1.77551 (acetoacetyl Coenzyme A thiolase) S.446685 acyl-CoA thioesterase 2 ACOT2 1.07252 S.464137 acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 -1.37507 S.444959 acyl-Coenzyme A oxidase 2, branched ACOX2 -1.786O2 chain S.255491 acid phosphatase-like 2 ACPL2 2.42324 S.160976 acyl-CoA synthetase medium-chain ACSM3 2.02O3 family member 3 S.160976 acyl-CoA synthetase medium-chain ACSM3 2.47004 family member 3 S.SOO483 actin, alpha 2, Smooth muscle, aorta ACTA2 81371 S.438918 activin A receptor, type IB ACVR1B 13551 S.47O174 activin A receptor, type IIA ACVR2A 16595 S.356247 aminoacylase 1-like 2 ACY1L2 -1.22613 S.S16173 acylphosphatase 2, muscle type ACYP2 26039 S.522433 AD-003 protein AD-003 -1.1865 S.483944 ADAM metallopeptidase domain 19 ADAM19 21804 (meltrin beta) S.370287 ADAM metallopeptidase domain 23 ADAM23 O3009 S.370287 ADAM metallopeptidase domain 23 ADAM23 14332 S.370287 ADAM metallopeptidase domain 23 ADAM23 64919 S.534221 ADAM metallopeptidase with ADAMTS15 .30093 thrombospondin type 1 motif, 15 S.192215 adenylate cyclase 1 (brain) ADCY1 SO926 S.518892 alcohol dehydrogenase 6 (class V) ADH6 392.62 S.518892 alcohol dehydrogenase 6 (class V) ADH6 8487 S.375179 adenylosuccinate synthase like 1 ADSSL1 96.783 S.24878S 1-acylglycerol-3-phosphate O AGPAT3 1899S acyltransferase 3 US 2009/O 1921 11 A1 Jul. 30, 2009 36
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.S16543 alkylglycerone phosphate synthase AGPS -201298 HS.S16543 alkylglycerone phosphate synthase AGPS -153364 HS.S30009 anterior gradient 2 homolog (Xenopus AGR2 -193668 laevis) HS.S30009 anterior gradient 2 homolog (Xenopus AGR2 -111235 laevis) HS.19383 angiotensinogen (Serpin peptidase AGT 48949 inhibitor, clade A, member 8) HSSO2756 AHNAKnucleoprotein (desmoyokin) AHNAK -117042 HSSO2756 AHNAKnucleoprotein (desmoyokin) AHNAK -102415 adenylate kinase 2 AK2 -2.11SOS HS.470907 adenylate kinase 2 AK2 -1.70834 HS.493,362 adenylate kinase 3 AK3 -2.6709S HS.493,362 adenylate kinase 3 AK3 -2.32644 HS.10862 adenylate kinase 3-like 1 AK3L1 23455 HS.10862 adenylate kinase 3-like 1 AK3L1 43994 HS.S10373 adenylate kinase 7 AK7 4O726 HS.371240 A kinase (PRKA) anchor protein AKAP12 O4634 (gravin) 12 HS.371240 A kinase (PRKA) anchor protein AKAP12 12727 (gravin) 12 HS.371240 A kinase (PRKA) anchor protein AKAP12 17874 (gravin) 12 HS.S27348 A kinase (PRKA) anchor protein AKAP9 22674 (yotiao) 9 HS.S12807 aldo-keto reductase family 7, member AKR7A2 -158112 A2 (aflatoxin aldehyde reductase) HS.S12807 aldo-keto reductase family 7, member AKR7A2 -147339 A2 (aflatoxin aldehyde reductase) HS.S15542 AKT1 substrate 1 (proline-rich) AKT1S1 -1.17537 Hs.150693 Activated leukocyte cell adhesion ALCAM O1184 molecule HS.459.538 aldehyde dehydrogenase 1 family, ALDH1A3 34102 member A3 HS.40919 asparagine-linked glycosylation 2 ALG2 -137104 homolog (yeast, alpha-1,3- mannosyltransferase) HSSO7769 asparagine-linked glycosylation 5 ALGS -1428.68 homolog (yeast, dolichyl-phosphate beta-glucose HS.18472O Alstrom syndrome 1 ALMS1 43349 HS.18472O Alstrom syndrome 1 ALMS1 61137 HS.47 1096 amyotrophic lateral sclerosis 2 (juvenile) ALS2 11459 HS.471130 amyotrophic lateral sclerosis 2 (juvenile) ALS2CR13 2.32442 chromosome region, candidate 13 HSSS488O amyotrophic lateral sclerosis 2 (juvenile) ALS2CR1S 2.14659 chromosome region, candidate 15 HS.2951.37 autocrine motility factor receptor AMFR -1.01434 HS.211021 Alport syndrome, mental retardation, AMMECR1 -2.68372 midface hypoplasia and elliptocytosis HS.211021 Alport syndrome, mental retardation, AMMECR1 -2.24775 midface hypoplasia and elliptocytosis HS.211021 Alport syndrome, mental retardation, AMMECR1 -1.721.89 midface hypoplasia and elliptocytosis HS. 16229 associated molecule with the SH3 AMSH-LP -1.2422 domain of STAM (AMSH) like protein HS.49972S ankyrin 3, node of Ranvier (ankyrin G) ANK3 2.14295 HS.S.13875 ankyrin repeat and FYVE domain ANKFY1 -132868 containing 1 HS.S.13875 ankyrin repeat and FYVE domain ANKFY1 -1.2223 containing 1 HS.156727 ankylosis, progressive homolog (mouse) ANKH O9799 HS.156727 ankylosis, progressive homolog (mouse) ANKH 2.03558 HS.23.9154 ankyrin repeat, family A (RFXANK ANKRA2 68.394 like), 2 HS.482853 ankyrin repeat domain 32 ANKRD32 -1493O2 HS.463426 ankyrin repeat domain 40 ANKRD40 -1.31517 HS.S301.99 ankyrin repeat domain 46 ANKRD46 2.45585 HS.11.2909 ankyrin repeat domain 6 ANKRD6 O7684 US 2009/O 1921 11 A1 Jul. 30, 2009 37
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.6218O anillin, actin binding protein (scraps ANLN -3.04.043 homolog, Drosophila) HS.6218O anillin, actin binding protein (scraps ANLN -2.92.708 homolog, Drosophila) HS.38S913 acidic (leucine-rich) nuclear ANP32E -2.77779 phosphoprotein 32 family, member E HS.38S913 Acidic (leucine-rich) nuclear ANP32E -2.07845 phosphoprotein 32 family, member E HS.38S913 acidic (leucine-rich) nuclear ANP32E -1.72716 phosphoprotein 32 family, member E HS.165859 anthrax toxin receptor 1 ANTXR1 HS.480653 annexin A5 ANXAS HS.386434 annexin A7 ANXA7 HS.386434 annexin A7 ANXA7 HS.43O324 annexin A9 ANXA9 HS.43O324 annexin A9 annexin A9 ANXA9 HS.406238 aldehyde oxidase 1 AOX1 HS.101480 AP1 gamma Subunit binding protein 1 P1GBP1 HS.18894 adaptor-related protein complex 1, mu 2 P1M2 Subunit HS.18894 adaptor-related protein complex 1, mu 2 Subunit HS.121592 adaptor-related protein complex 1, Sigma -1.41432 2 subuni HS.121592 adaptor-related protein complex 1, Sigma -1.24493 2 subuni HS.387648 adaptor-related protein complex 1, sigma -104504 3 subuni HS.SOO104 adaptor-related protein complex 3, mu1 -1.67829 Subunit HSSSS936 APEX nuclease (apurinicfapyrimidinic -117148 endonuclease) 2 Hs.74565 amyloid beta (A4) precursor-like protein 1 97.456 HS.226307 apolipoprotein B mRNA editing -193604 enzyme, catalytic polypeptide-like 3B HS.S1546S apolipoprotein E 37948 HS.43498O amyloid beta (A4) precursor protein 20229 (peptidase nexin-II, Alzheimer disease) HS.43498O amyloid beta (A4) precursor protein 36582 (peptidase nexin-II, Alzheimer disease) HS.84084 amyloid beta precursor protein 32834 (cytoplasmic tail) binding protein 2 HS.446641 v-raf murine sarcoma 3611 viral -145485 oncogene homolog HS.416089 ADP-ribosylation factor interacting protein 1 (arfaptin 1) HS.416089 ADP-ribosylation factor interacting protein 1 (arfaptin 1) HS.138860 Rho GTPase activating protein 1 RHGAP1 -1.51577 HS.40O818 Rho GTPase activating protein 11A RHGAP11A -2.16059 HS.1591.61 Rho GDP dissociation inhibitor (GDI) RHGDIA -3.1823S alpha HS.1591.61 Rho GDP dissociation inhibitor (GDI) RHGDIA -2.07826 alpha HS.1591.61 Rho GDP dissociation inhibitor (GDI) RHGDIA -1.61522 alpha HS.1591.61 Rho GDP dissociation inhibitor (GDI) RHGDIA -159814 alpha Rho GDP dissociation inhibitor (G HS.443460 Rho guanine nucleotide exchange factor RHGEF1 OL 1.52476 (GEF) 10-like HS.2SOOO9 ADP-ribosylation factor-like 10C -158997 HS.18221S ADP-ribosylation factor-like 3 142368 HS.47O233 ADP-ribosylation factor-like 5 1.65731 HS.190440 ADP-ribosylation factor-like 6 -1.13113 interacting protein 2 S.51 6468 ADP-ribosylation-like factor 6 -2.72541 interacting protein 6 S.51 6468 ADP-ribosylation-like factor 6 -1.20713 interacting protein 6 US 2009/O 1921 11 A1 Jul. 30, 2009 38
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.269.542 armadillo repeat containing 1 ARMC1 -164954 S.269.542 armadillo repeat containing 1 ARMC1 -1.45211 S.471610 armadillo repeat containing 9 ARMC9 SO88 S.459070 aryl-hydrocarbon receptor nuclear ARNT2 41846 translocator 2 S.512908 cyclic AMP phosphoprotein, 19 kD ARPP-19 -2.21964 S.1491O3 arylsulfatase B ARSB -1.2747S S.528631 arylsulfatase D ARSD -1.14781 S.SO4187 Adipocyte-specific adhesion molecule ASAM -1.7SO17 S.16349 ATM ATR-Substrate Chk2-Interacting ASCIZ -1.28851 Zn2+-finger protein S.26516 ASF1 anti-silencing function 1 homolog ASF1B - 190378 B (S. cerevisiae) S.2O8414 activator of S phase kinase ASK -2.051 S.121028 asp (abnormal spindle)-like, ASPM -2.10725 microcephaly associated (Drosophila) S.SS8301 argininosuccinate synthetase ASS 3O242 S.2O9217 astrotactin 2 ASTN2 2.09888 S.2O9217 astrotactin 2 ASTN2 2.13406 S.370834 ATPase family, AAA domain containing 2 ATAD2 -3.16311 S.370834 ATPase family, AAA domain containing 2 ATAD2 -3.101.93 S.370834 ATPase family, AAA domain containing 2 ATAD2 -2.67OO1 S.370834 ATPase family, AAA domain containing 2 ATAD2 -142371 S.461285 AT-binding transcription factor 1 ATBF1 1.21411 S.461285 AT-binding transcription factor 1 ATBF1 13555 S.496487 activating transcription factor 4 (tax ATF4 -149983 responsive enhancer element B67) S.492740 Activating transcription factor 6 ATF6 1.12993 S.477126 ATG3 autophagy related 3 homolog (S. cerevisiae) ATG3 -1.695.24 S.88252 ATPase, Class VI, type 11C ATP11C 1.81479 S.SO6759 ATPase, Ca++ transporting, cardiac ATP2A2 2.05217 muscle, slow twitch 2 S.438489 ATP synthase, H+ transporting, ATP5S 1.2575 mitochondrial FO complex, Subunits (factor B) S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -3.948O2 9 kDa, VO subunite S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -3.66723 9 kDa, VO subunite ATPase, H+ transportin S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -3.50595 9 kDa, VO subunite S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -3.35879 9 kDa, VO subunite S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -3.06.293 9 kDa, VO subunite S.484.188 ATPase, H+ transporting, lysosoma ATP6VOE -2.27251 9 kDa, VO subunite S.388654 ATPase, H+ transporting, lysosoma ATP6V1 G1 -1.21519 13 kDa, V1 subunit G isoform 1 S.491737 ATPase, H+ transporting, lysosoma ATP6V1E 14584 50/57 kDa, V1 subunit H ATPase, Class II, type 9A ATP9A .755O1 S.465475 ATPase, Class II, type 9B ATP9B -1.27448 S.S33526 alpha thalassemiamental retardation ATRX 21083 syndrome X-linked (RAD54 homolog, S. cerevisiae) S.434961 ataxin 1 ATXN1 .78989 S.526425 ataxin 3 ATXN3 .7092 S.442658 aurora kinase B AURKB -3.28843 S.27 2011 UDP-Gal:betaGlcNAc beta 14 B4GALT1 -2-18O16 galactosyltransferase, polypeptide 1 S.27 2011 UDP-Gal:betaGlcNAc beta 14 B4GALT1 -168723 galactosyltransferase, polypeptide 1 S.27 2011 UDP-Gal:betaGlcNAc beta 14 B4GALT1 -1.55955 galactosyltransferase, polypeptide 1 S.27 2011 UDP-Gal:betaGlcNAc beta 14 B4GALT1 -1.30327 galactosyltransferase, polypeptide 1 S.464848 UDP-Gal:betaGlcNAc beta 14 B4GALT6 -1.74964 galactosyltransferase, polypeptide 6 US 2009/O 1921 11 A1 Jul. 30, 2009 39
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.464848 UDP-Gal:betaGlcNAc beta 14 B4GALT6 -158614 galactosyltransferase, polypeptide 6 HS.464848 UDP-Gal:betaGlcNAc beta 14 B4GALT6 -127649 galactosyltransferase, polypeptide 6 HS.5241.38 brain-specific angiogenesis inhibitor 2 BAI2 2.82O64 HS.54089 BRCA1 associated RING domain 1 BARD1 -1.18684 HS.509140 bromodomain adjacent to Zinc finger BAZ1A -145554 domain, 1A HS.509140 bromodomain adjacent to Zinc finger BAZ1A -130967 domain, 1A HSSO2915 Bardet-Biedl syndrome 1 B BS1 192669 HS2O8681 Bardet-Biedl syndrome 4 B BS4 1.15935 HS.438993 branched chain aminotransferase 1, B CAT1 -2.45797 cytosolic HS.438993 branched chain aminotransferase 1, CAT1 -2.14227 cytosolic HS.438993 branched chain aminotransferase 1, CAT1 -2.04249 cytosolic HS.193516 B-cell CLL/lymphoma 10 18O226 HS.469658 BCL2-like 11 (apoptosis facilitator) 124619 HS.469658 BCL2-like 11 (apoptosis facilitator) 1.76976 HS.478588 B-cell CLL/lymphoma 6 (zinc finger 1.24494 protein 51) HS.486542 BCL2-associated transcription factor 1 CLAF1 -1.2496 HS.212172 beta-caroteine 15,15'-monooxygenase 1 CMO1 1.121.46 HS.S2SS72 bradykinin receptor B2 DKRB2 1.2O3O4 HSSO2182 Brain-derived neurotrophic factor DNF 1.15806 opposite strand HSSO2182 brain-derived neurotrophic factor DNF 1.1632S HSSO2182 brain-derived neurotrophic factor DNF 2.66234 HS.184736 brain expressed X-linked-like 1 EXL1 1.OSO78 HS.S14527 baculoviral IAP repeat-containing 5 RC5 -2.92443 (survivin) HS.S14527 baculoviral IAP repeat-containing 5 B RC5 -2.84713 (survivin) HS.S14527 baculoviral IAP repeat-containing 5 RC5 -2.48729 (survivin) HS.S14527 Effector cell peptidase receptor 1 -1.SS356 HS.288.809 basic, immunoglobulin-like variable 6O758 motif containing HS.169348 Bloom syndrome LM HS283532 uncharacterized bone marrow protein MO39 BMO39 HS283532 uncharacterized bone marrow protein MO39 BMO39 HS-1274 bone morphogenetic protein 1 MP1 HS-1274 bone morphogenetic protein 1 MP1 HS.283454 BCL2 fadenovirus E1B 19 kDa NIP2 interacting protein 2 v-raf murine sarcoma viral oncogene homolog B1 HS. 194143 breast cancer 1, early onset RCA1 HS. 194143 breast cancer 1, early onset RCA1 HS.34O12 breast cancer 2, early onset RCA2 HS.S32799 BRCA1 interacting protein C-terminal RIP1 helicase 1 HS.S32799 BRCA1 interacting protein C-terminal RIP1 helicase 1 BB HS.S25299 breast cancer metastasis-suppressor 1 RMS1L ike HS.S25299 breast cancer metastasis-suppressor 1 B RMS1L ike HS.308045 barren homolog (Drosophila) RRN1 -1941.09 HS.244590 BTB (POZ) domain containing 3 TBD3 S6315 HS.S17830 biotinidase TD -1.34728 HS.S191.62 BTG family, member 2 TG2 40327 HS.469649 BUB1 budding uninhibited by UB1 -2.72123 benzimidazoles 1 homolog (yeast) HS.469649 BUB1 budding uninhibited by UB1 -2.66112 benzimidazoles 1 homolog (yeast) US 2009/O 1921 11 A1 Jul. 30, 2009 40
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.36708 BUB1 budding uninhibited by B UB1 B -2.4014 benzimidazoles 1 homolog beta (yeast) S.418533 BUB3 budding uninhibited by UB3 -1.288.1 benzimidazoles 3 homolog (yeast) S.124246 chromosome 10 open rea ling rame 1 19 Oor 19 -1.09868 S.14559 hromosome 10 open rea ing rame 3 Oor -2.96399 S.34492 hromosome 10 open rea ing rame 3 2 Oor 32 21753 S.446315 hromosome 10 open rea ing rame 45 Oor A5 -1.093O3 S.446315 hromosome 10 open rea ing rame 45 Oor A5 -1.03421 S.446315 hromosome 10 open reading frame 45 Oor A5 64975 S.42OO24 hromosome 10 open rea ling rame 4 6 Oor A6 -1.07798 S.499833 hromosome 10 open rea ing rame 74 Oor 74 -1.99852 S.499833 hromosome 10 open rea ing rame 74 Oor 74 -1.82678 S.93667 hromosome 10 open rea ing rame 7 8 Oor 78 -13269 S.93667 hromosome 10 open rea ing rame 7 8 Oor 78 -1.2.1737 S.14745 hromosome 10 open rea ing rame 9 Oor O4082 hromosome 11 open rea ing rame 3 2 1or 32 80699 S.473109 hromosome 11 open rea ing rame 9 1or -1.0544 S.88523 hromosome 13 open rea ing rame 3 3 or -1.60434 S.493062 hromosome 13 open rea ing rame 7 3 or -1.19491 S.446850 hromosome 14 open rea ing 86 OO 4or OO -1.37992 S.146040 hromosome 14 open rea ing 86 05 4or O5 3.08437 S.437941 hromosome 14 open rea ing 86 O6 4or O6 -158434 S.437941 hromosome 14 open rea ing 86 O6 4or O6 -1.2571.4 S.343173 hromosome 14 open rea ing 86 11 4or 11 -1.73122 S.437831 hromosome 14 open rea ing 86 11 4or 11... -2.07398 // chromosome 14 open reading frame 4or 32 2 S.1371.08 hromosome 14 open rea ing 86 12 12 -1.26989 HS.9043 hromosome 14 open rea ing 86 2O 2O -1.56964 S.370299 hromosome 14 open rea ing 86 25 25 -1.57587 S.20142 hromosome 14 open rea ing 86 42 42 -192889 S.123232 hromosome 14 open rea ing 86 43 43 -1.16551 S.162889 hromosome 14 open rea ing 86 45 45 -240228 S.162889 hromosome 14 open rea ing 86 45 45 -1.4913 S.297O6 hromosome 14 open rea ing 86 49 49 -1581.68 S.S104O7 hromosome 14 open rea ing 86 S4 S4 44686 S.309849 hromosome 14 open rea ing 86 59 59 23828 S.446357 hromosome 14 open rea ing rame 24 24 -288651 S.82098 hromosome 14 open rea ing rame 2 8 28 OS861 S.82098 hromosome 14 open rea ing rame 2 8 28 1918.4 S.17926O hromosome 14 open rea ing rame 4 52554 S.SSOS47 hromosome 14 open reading frame 44 12787 S.26OSSS hromosome 14 open rea ling rame 45 82442 S.S13392 hromosome 14 open rea ing rame 4 6 -1.12219 S.441.783 hromosome 14 open rea ing rame 7 8 296.38 S.S32683 hromosome 14 open rea ing rame 8 7 -1.6998.7 S.112160 hromosome 15 open rea ing rame 2 O Sort2O -1.06547 S.S25796 hromosome 15 open rea ing rame 2 3 Sor 23 -2.21496 S.160S6S hromosome 15 open rea ing rame 24 Sor 24 -1.14621 S.14347 hromosome 15 open rea ing rame 2 5 Sor 25 -1.39.177 SS10938 hromosome 15 open reading frame 29 Sor 29 .332O2 S.513261 hromosome 16 open rea ling rame 3 4 6or 34 -2.53906 S.513261 hromosome 16 open rea ing rame 3 4 6or 34 -1.741.23 S.2O3594 hromosome 16 open rea ing rame 4 6 6or A6 .25378 S.498890 hromosome 16 open rea ing rame 5 2 6or 52 44987 S.SS8473 hromosome 18 open reading frame 10 8or -1.16121 S.134726 hromosome 18 open rea ling rame 24 8or 24 -2.791.83 S.208701 hromosome 18 open rea ing rame 5 4 8or S4 -184765 S.S32835 hromosome 18 open rea ing rame 5 5 8or 55 -102679 hromosome 18 open rea ing rame 5 6 8or 56 17245 s.76277 hromosome 19 open rea ing rame 3 2 9or 32 16451 S.239666 ore 1 synthase, glycopro GA LT1 -1.34248 cetylgalactosamine 3-be alactosyltransferase S.2022O7 hromosome 1 open reading frame 102 O O2 34343 S.293563 hromosome 1 open reading frame 108 O O8. -135689 S.443551 hromosome 1 open reading frame 112 O 12 -3.33816 S.130746 hromosome 1 open reading frame 114 O 14 2474 S.498.317 hromosome 1 open reading frame 121 O 21 -1.3606 US 2009/O 1921 11 A1 Jul. 30, 2009 41
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2)
S.498.317 OOSOle pen reading frame 121 orf121 -1.17342 S.SS4892 OOSOle pen reading frame 124 orf124 -1.16234 S.SS6017 OOSOle pen reading frame 131 orf131 -1.45997 S.252967 OOSOle pen reading frame 144 orf144 -138903 S.252967 OOSOle pen reading frame 144 orf144 -13514 S.434498 OOSOle pen reading frame 155 orf15S -2O7 S.434498 OOSOle pen reading frame 155 orf15S -166964 S.523811 OOSOle pen reading frame 22 orf22 -1.69074 S.523811 OOSOle pen reading frame 22 orf22 -132688 S.523811 OOSOle pen reading frame 22 orf22 -1.2394 S.518662 OOSOle pen reading frame 24 orf24 -1.7059 S.112949 OOSOle pen reading frame 34 orf34 2974 S.52O192 OOSOle pen reading frame 55 orf SS -1.7S702 S.52O192 OOSOle pen reading frame 55 orf SS -1.67518 S.528699 OOSOle pen reading frame 79 orf79 -145216 S.528699 OOSOle pen reading frame 79 orf79 -1.1635S S.156625 OOSOle pen reading frame 80 orf&O S.156625 hromosome 1 open reading frame 80 orf&O S.172S10 hromosome 1 open reading frame 88 S.SS6O16 hromosome 1 open reading frame 96 S.524224 omplement component 1, r Subcomponen S.525264 omplement component 1, r C RL Subcomponent-like S.4583SS omplement component 1, S Subcomponen S.143736 hromosome 20 open reading frame 108 C20orf108 30283 S.143736 hromosome 20 open reading frame 108 C20orf108 79836 S.S16977 hromosome 20 open reading frame 112 C20orf112 .32831 S.S16977 hromosome 20 open reading frame 112 C20orf112 87434 S.283869 hromosome 20 open reading frame 121 C20orf121 -1.38738 S.283869 hromosome 20 open reading frame 121 C20orf121 -1.07381 S.472716 hromosome 20 open reading frame 129 C20orf129 -136816 S.266273 hromosome 20 open reading frame 172 C20orf172 -2O766 S.274422 hromosome 20 open reading frame 27 C20orf27 -19419 S.274422 hromosome 20 open reading frame 27 C20orf27 -1.72317 S.32O823 hromosome 20 open reading frame 72 C20orf72 -1.37017 S.190518 hromosome 21 open reading frame 45 C21orfas -1.88741 S.190518 hromosome 21 open reading frame 45 C21orfas -141595 S.2O8358 hromosome 21 open reading frame 63 C21orf63 -152188. S.208912 hromosome 22 open reading frame 18 C22Orf18 -1.57651 S.S16707 hromosome 2 open reading frame 17 C2Cr 7 51246 S.S16707 hromosome 2 open reading frame 17 C2Orf17 S2854 S.SS3S12 utative protein similar to nessy C3F -133476 (D O SO p f il c ) S.SS131 hromosome 3 open reading frame 23 68914 S.SS131 hromosome 3 open reading frame 23 264324 S.478.682 hromosome 3 open reading frame 6 -1.71881 S.368.454 hromosome 4 open reading frame 15 -1.1094 S.435991 hromosome 4 open reading frame 16 -1.22157 S. 166551 hromosome 5 open reading frame 3 -1.04141 S.483473 hromosome 5 open reading frame 5 22807 S.SSS954 hromosome 6 open reading frame 107 -1.69873 S.S2O287 hromosome 6 open reading frame 111 4713 S.88663 hromosome 6 open reading frame 139 -3.44482 S.485528 hromosome 6 open reading frame 141 13191 S.21945 hromosome 6 open reading frame 152 2155 S.21945 hromosome 6 open reading frame 152 46547 S.309231 hromosome 6 open reading frame 153 -131388 S.4864O1 hromosome 6 open reading frame 173 -2.225O1 S.31917 hromosome 6 open reading frame 176 -3.521.07 S.S9554 hromosome 6 open reading frame 182 -130989 S.347144 hromosome 6 open reading frame 192 -1.57852 S.41852O hromosome 6 open reading frame 51 -1.14052 S.S19930 Chromosome 6 open reading frame 62 -1.29276 S.214043 hromosome 6 open reading frame 79 -1.41464 S.283.683 C hromosome 8 open reading frame 4 39952 S.171455 C hromosome 8 open reading frame 47 40888 S.3684O2 C hromosome 8 open reading frame 55 -1.2SS13 C hromosome 8 open reading frame 61 17136 US 2009/O 1921 11 A1 Jul. 30, 2009 42
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.414028 chromosome 9 open reading frame 116 HS2O1258 chromosome 9 open reading frame 122 HS.388742 Chromosome 9 open reading frame 125 HS.4938O8 chromosome 9 open reading frame 127 HS.S35972 chromosome 9 open reading frame 132 HS.522412 chromosome 9 open reading frame 16 HS.522412 chromosome 9 open reading frame 16 HS.43S381 chromosome 9 open reading frame 39 HS.257.556 chromosome 9 open reading frame 41 HS.257.556 chromosome 9 open reading frame 41 HS.308.074 Chromosome 9 open reading frame 5 HS2O8914 chromosome 9 open reading frame 64 HS.S30283 chromosome 9 open reading frame 80 HS.374421 chromosome 9 open reading frame 81 HS.4284.46 carbonic anhydrase XI HS.155097 carbonic anhydrase II HS. 63287 carbonic anhydrase IX HS.443891 cache domain containing 1 HS.476358 Calcium channel, voltage-dependent, L type, alpha 1D Subunit HS.476358 calcium channel, Voltage-dependent, L CACNA1D 2.SO3O2 type, alpha 1D Subunit HS.194746 calcium channel, Voltage-dependent, CACNA1G 3.39333 alpha 1G subunit HS.194746 calcium channel, Voltage-dependent, CACNA1G 3.42834 alpha 1G subunit HS.4902O3 caldesmon 1 CALD1 86428 HS.43S457 calmodulin-like 4 CALML4 -1.15167 HS.77S3 calumenin CALU -1.7749 HS.77S3 calumenin CALU -132093 HS.77S3 calumenin CALU -1.27131 HS.77S3 calumenin CALU -1.13115 Hs.144114 Calcium calmodulin-dependent protein CAMK2D OS 161 kinase (CaM kinase) II delta Hs.144114 Calcium calmodulin-dependent protein CAMK2D 12993 kinase (CaM kinase) II delta Hs.144114 calcium calmodulin-dependent protein CAMK2D .33867 kinase (CaM kinase) II delta Hs.144114 calcium calmodulin-dependent protein CAMK2D 39652 kinase (CaM kinase) II delta Hs.144114 calcium calmodulin-dependent protein CAMK2D 47631 kinase (CaM kinase) II delta HS.370581 CAP, adenylate cyclase-associated CAP1 -113885 protein 1 (yeast) HS.370581 CAP, adenylate cyclase-associated CAP1 -1.12518 protein 1 (yeast) HS.502842 calpain 1, (muI) large subunit CAPN1 HS.350899 calpain 2, (mII) large subunit CAPN2 HS.248153 calpain 5 CAPNS HS.S12867 cancer Susceptibility candidate 4 CASC4 HS.181855 cancer Susceptibility candidate 5 CASCS HS.368982 caspase 2, apoptosis-related cysteine CASP2 peptidase (neural precursor cell expressed HS.368982 caspase 2, apoptosis-related cysteine CASP2 -1.34704 peptidase (neural precursor cell expressed HS.368982 caspase 2, apoptosis-related cysteine CASP2 -130O26 peptidase (neural precursor cell expressed HS.368982 caspase 2, apoptosis-related cysteine CASP2 -1.25427 peptidase (neural precursor cell expressed HS.328O caspase 6, apoptosis-related cysteine CASP6 -1395.42 peptidase HS.9216 caspase 7, apoptosis-related cysteine CASP7 -206042 peptidase HS-74034 caveolin 1, caveolae protein, 22 kDa CAV -2.78632 HS-74034 caveolin 1, caveolae protein, 22 kDa CAV -2.1214 US 2009/O 1921 11 A1 Jul. 30, 2009 43
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.153934 core-binding factor, runt domain, alpha 1.2O888 Subunit 2; translocated to, 2 S.460988 core-binding factor, beta Subunit -2.70489 S.460988 core-binding factor, beta Subunit -1.58O3S S.349283 Chromobox homolog 5 (HP1 alpha -1.99947 homolog, Drosophila) S.55846 coiled-coil domain containing 10 CCDC10 1.33261 S.412019 coiled-coil domain containing 28A CCDC28A -1.23644 S.327O68 coiled-coil domain containing 6 CCDC6 -2.15971 S.327O68 coiled-coil domain containing 6 CCDC6 -2.O1278 S.303649 chemokine (C-C motif) ligand 2 CCL2 -1.74877 S.851.37 cyclin A2 CCNA2 -3.33175 S.851.37 Cyclin A2 CCNA2 -2.60576 S.23960 cyclin B1 CCNB1 -2.80793 S.23960 cyclin B1 CCNB1 -2.64472 S. 194698 cyclin B2 CCNB2 -2.2702 S.408658 cyclin E2 CCNE2 -2.27126 S.408658 cyclin E2 -1.71865 S.1600 chaperonin containing TCP1, subunit 5 -1.5989 (epsilon) CD164 antigen, sialomucin -341558 CD164 antigen, sialomucin -3.38079 CD164 antigen, sialomucin -3.25399 CD24 antigen (Small cell lung carcinoma 1.13881 cluster 4 antigen) S.479214 CD38 antigen (p45) -1.72773 S.374127 CDC16 cell division cycle 16 homolog -1.17129 (S. cerevisiae) S.374127 CDC16 cell division cycle 16 homolog DC16 -102271 (S. cerevisiae) S.334562 cell division cycle 2, G1 to S and G2 to M -2.74273 S.334562 cell division cycle 2, G1 to S and G2 to M -2.63937 S.334562 Cell division cyc le 2, G1 to S and G2 to M -2.61709 S.334562 Cell division cyc le 2, G1 to S and G2 to M -2.36056 S.524947 CDC20 cell division cycle 20 homolog -3.03263 (S. cerevisiae) S.153546 CDC23 (cell division cycle 23, yeast, C DC23 -1.77994 homolog) S.1634 cell division cyc e 25A DC25A -2.82429 S.1634 cell division cyc e 25A DC25A -2.79743 S. 656 cell division cyc DC25C -1.73437 S. 656 cell division cyc DC25C -131429 S.463,295 Cell division cyc le 27 DC27 -1.978.37 S.463,295 cell division cyc e 27 DC27 -1411.85 S.463,295 cell division cyc e 27 DC27 -1.36668 S.463,295 cell division cyc e 27 DC27 -1.34818 S.467637 cell division cyc e 42 (GTP binding DC42 -1.17023 protein, 25 kDa) S.467637 cell division cyc e 42 (GTP binding DC42 2.53366 protein, 25 kDa) S.467637 cell division cyc e 42 (GTP binding CDC42 3.27549 protein, 25 kDa) S.369574 CDC42 effector protein (Rho GTPase 1.38367 binding) 3 S.369574 CDC42 effector protein (Rho GTPase CDC42EP3 191269 binding) 3 S.369574 CDC42 effector protein (Rho GTPase 2O1896 binding) 3 S.SO8829 CDC42 smalle ector 2 -2.14599 S.SO8829 CDC42 smalle ector 2 -15 6215 S.SO8829 CDC42 smalle ector 2 -156059 S.474217 CDC45 cell division cycle 45-like (S. cerevisiae) -166652 S.405958 CDC6 cell division cycle 6 homolog (S. cerevisiae) -394.951 S.405958 CDC6 cell division cycle 6 homolog (S. cerevisiae) -3.29246 S.2345.45 cell division cyc e associated 1 -3.47053 S.33366 cell division cyc e associated 2 -1.49882 S.524216 cell division cyc eassociated 3 cell -2.18457 division cycle associated 3 S.524216 cell division cyc e associated 3 DCA3 -2.12949 S.34,045 cell division cyc e associated 4 DCA4 -140998 US 2009/O 1921 11 A1 Jul. 30, 2009 44
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.434886 cell division cycle associated 5 DCAS -2.09246 HS.S2O245 cell division cycle associated 7-like DCA7L -1.OS903 HS.S24571 cell division cycle associated 8 DCA8 -140849 HS.461086 cadherin 1, type 1, E-cadherin DH1 170513 (epithelial) HS.89436 cadherin 17, LI cadherin (liver-intestine) 1.63977 HS.19.192 cyclin-dependent kinase 2 -2.72265 HS.19.192 cyclin-dependent kinase 2 -2.43817 HS.95577 cyclin-dependent kinase 4 -2.95739 HS.119882 cyclin-dependent kinase 6 -2.36362 HS.119882 cyclin-dependent kinase 6 -2.OO742 HS.119882 cyclin-dependent kinase 6 -1.82506 HS.382306 Cyclin-dependent kinase 8 -1.69632 HS.382306 Cyclin-dependent kinase 8 -1.56.738 HS.S2S324 cyclin-dependent kinase inhibitor 2C -1.37376 (p18, inhibits CDK4) HS.84113 cyclin-dependent kinase inhibitor 3 C D -2.653.84 (CDK2-associated dual specificity phosphatase HS.84113 cyclin-dependent kinase inhibitor 3 -2.5688S (CDK2-associated dual specificity phosphatase HS.444924 CDP-diacylglycerol synthase CDS1 (phosphatidate cytidylyltransferase) 1 HS.444924 CDP-diacylglycerol synthase CDS1 (phosphatidate cytidylyltransferase) 1 HS. 122908 DNA replication factor DT1 HS. 122908 DNA replication factor DT1 HS.S12682 carcinoembryonic antigen-related cell EACAM1 adhesion molecule 1 (biliary glycoprotein) HS.495230 cerebral endothelial cell adhesion CEECAM1 molecule 1 HSS7652 cadherin, EGF LAG seven-pass G-type CELSR2 receptor 2 (flamingo homolog, Drosophila) HSS7652 cadherin, EGF LAG seven-pass G-type ELSR2 86.204 receptor 2 (flamingo homolog, Drosophila) HS.1594 centromere protein A, 17 kDa ENPA -3.18771 HS.1594 centromere protein A, 17 kDa ENPA -1.7703 Hs.75573 centromere protein E, 312 kDa ENPE -2.094.09 HS.497741 centromere protein F, 350/400ka ENPF -2.37959 (mitosin) HS.497741 centromere protein F, 350/400ka C ENPF -2.10529 (mitosin) HS2OO39S centromere protein H ENPH -150918 HS.S33828 centromere protein J ENPJ -1.5592 HSSO316S centaurin, delta 2 ENTD2 1.12553 HSSO4009 KIAA1052 protein ep164 -1.04867 HS-363396 complement factor H 1.3O117 HS-363396 complement factor H 2.43226 HS.154224 complement factor H fit complement 2.13324 factor H-related 1 HSSS8457 complement factor H-related 4 fif 19876S complement factor H-related 3 HS.18O141 cofilin 2 (muscle) -293902 HS.18O141 cofilin 2 (muscle) i? cofilin 2 (muscle) FL2 -2.85342 HS.18O141 cofilin 2 (muscle) FL2 -2.71961 HS.444818 CGG triplet repeat binding protein 1 CGGBP1 -1.33141 HSSO1513 comparative gene identification CGI-37 -1.26782 transcript 37 HSSO1513 comparative gene identification CGI-37 -1.26573 transcript 37 HS.463465 WD repeat domain 50 CGI-48 -164651 HS.79018 chromatin assembly factor 1, Subunit A CHAF1A -123151 (p150) HS.256O1 chromodomain helicase DNA binding CHD3 1.57624 protein 3 HS-24529 CHK1 checkpoint homolog (S. pombe) CHEK1 -2.28739 US 2009/O 1921 11 A1 Jul. 30, 2009 45
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS-24529 CHK1 checkpoint homolog (S. pombe) HEK1 -2.22291 HS-24529 CHK1 checkpoint homolog (S. pombe) HEK1 -2.18967 HS.434286 checkpoint Suppressor 1 HES1 49966 HS.434286 checkpoint Suppressor 1 HES1 57973 HS.S16874 chromogramin B (Secretogranin 1) HGB 72318 HS.496323 Cysteine-rich hydrophobic domain 1 HIC1 -1.69798 HS.476930 chromatin modifying protein 2B HMP2B -127962 HS.2797.04 chromatin accessibility complex 1 HRAC1 -1.23092 HS.534593 Similar to RIKEN cDNA 1700009P17 chromosome 1 -1.28965 open reading frame 192 HS.110488 carbohydrate (chondroitin) synthase 1 HSY1 -13 1988 HS.198.998 conserved helix-loop-helix ubiquitous HUK -198322 kinase HS.13S471 calcium and integrin binding 1 C B1 -1.05209 (calmyrin) HS. 129634 Cyclin-dependent kinase 2-interacting C -1323.71 protein HS.119594 citron (rho-interacting, serine/threonine T kinase 21) HS.444.028 cytoskeleton associated protein 2 KAP2 HS.173724 creatine kinase, brain KB HS.2981.98 chemokine-like factor Superfamily 3 KLFSF3 HS.2981.98 chemokine-like factor Superfamily 3 KLFSF3 HS.380627 chemokine-like factor Superfamily 6 KLFSF6 HS.380627 chemokine-like factor Superfamily 6 KLFSF6 HS.440494 chemokine-like factor Superfamily 7 KLFSF7 HS.374378 CDC28 protein kinase regulatory KS1B subunit 1B HS.837.58 CDC28 protein kinase regulatory KS2 subunit 2 HSSS4803 chloride channel CLIC-like 1 CC LCC1 HS.495674 Chloride channel 4 LCN4 HS.43906O claudin 1 LDN1 HS.43906O claudin 1 HS.86.368 calmegin HS.301.478 calmin (calponin-like, transmembrane) HS.1756.13 claspin homolog (Xenopus laevis) HS.2966S calsyntenin 1 HS.11463 cytidylate kinase HSS719 chromosome condensation-related SMC associated protein 1 HS.148590 cornifelin cornifelin HS.483454 calponin 3, acidic HS.483454 Calponin 3, acidic HS.274579 cyclin M1 HS.460923 CCR4-NOT transcription complex, subunit 1 HS.157606 CCR4-NOT transcription complex, CNOT6 subunit 6 HS.5234.46 collagen, type XI, alpha 1 COL11A1 HS.5234.46 collagen, type XI, alpha 1 COL11A1 HS. 1013O2 collagen, type XII, alpha 1 COL12A1 HS.172928 collagen, type I, alpha 1 COL1A1 HS.172928 collagen, type I, alpha 1 COL1A1 HS.172928 collagen, type I, alpha 1 COL1A1 HS.47629 collagen, type XXI, alpha 1 if collagen, COL21A1 type XXI, alpha 1 HS.17441 collagen, type IV, alpha 1 COL4A1 HS.17441 collagen, type IV, alpha 1 COL4A1 HS.471S25 collagen, type IV, alpha 3 (Goodpasture COL4A3 antigen) HS.369089 collagen, type IV, alpha 5 (Alport syndrome) HS.145586 collagen, type IV, alpha 6 COL4A6 HS.145586 collagen, type IV, alpha 6 COL4A6 87491 HS.210283 collagen, type V, alpha 1 COLSA1 36412 HS.210283 collagen, type V, alpha 1 COLSA1 48443 HS.476.218 collagen, type VII, alpha 1 COL7A1 O5271 HS.476.218 collagen, type VII, alpha 1 COL7A1 O9717 US 2009/O 1921 11 A1 Jul. 30, 2009 46
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol COMM domain containing 5 fit COMM COMMDS 18784 domain containing 5 S.S32231 coatomer protein complex, Subunit COPG2 48591 gamma 2 S.SOS652 coatomer protein complex, Subunit Zeta 1 COPZ1 9788 S.289092 coactosin-like 1 (Dictyostelium) COTL1 48488 S.289092 coactosin-like 1 (Dictyostelium) COTL1 .32679 S.7S360 carboxypeptidase E CPE 19391 S.127126 cytoplasmic polyadenylation element CPEB4 O6491 binding protein 4 S.127126 cytoplasmic polyadenylation element CPEB4 41208 binding protein 4 S.199877 copine IV CPNEA 69765 S.476982 coproporphyrinogen oxidase CPOX 26337 S.149252 carbamoyl-phosphate synthetase 1, CPS1 69539 mitochondrial S.149252 carbamoyl-phosphate synthetase 1, CPS1 447S3 mitochondrial carnitine palmitoyltransferase 1A (liver) CPT1A 34O21 Crumbs homolog 3 (Drosophila) CRB3 14995 crystallin, mu CRYM 1329 S.474833 casein kinase 1, epsilon CSNK1E 17153 S.443681 chondroitin Sulfate proteoglycan 2 CSPG2 O7451 (versican) S.443681 chondroitin Sulfate proteoglycan 2 CSPG2 O8543 (versican) S.443681 chondroitin Sulfate proteoglycan 2 CSPG2 1818 (versican) S.24485 chondroitin Sulfate proteoglycan 6 CSPG6 S6026 (bamacan) S.24485 chondroitin Sulfate proteoglycan 6 CSPG6 17463 (bamacan) S.5.30904 cysteine and glycine-rich protein 2 CSRP2 60358 S.444468 CTD (carboxy-terminal domain, RNA CTDSP1 O9632 polymerase II, polypeptideA) Small phosphatas S.445981 catenin (cadherin-associated protein), CTNNA1 94658 alpha 1, 102 kDa S.58488 catenin (cadherin-associated protein), CTNNAL1 .7894 alpha-like 1 S.166O11 catenin (cadherin-associated protein), CTNND1 66793 delta 1 S.128065 cathepsin C CTSC 3O469 S.128065 cathepsin C CTSC .25866 S.546248 cathepsin D (lysosomal asparty CTSD 11754 peptidase) S.181301 cathepsin S CTSS 44435 S.789 chemokine (C-X-C motif) ligand 1 CXCL1 2.71.28 (melanoma growth stimulating activity, alpha) S.75765 chemokine (C-X-C motif) ligand 2 CXCL2 2.68663 S.89714 chemokine (C-X-C motif) ligand 5 CXCLS 2.89046 S.89714 chemokine (C-X-C motif) ligand 5 CXCLS 6063 S.89714 chemokine (C-X-C motif) ligand 5 CXCLS SS161 S.443.061 Chromosome X open reading frame 45 CXorf245 47797 S.443.061 chromosome X open reading frame 45 CXorf245 S.443.061 chromosome X open reading frame 45 CXorf245 S.12248 CXXC finger 4 CXXC4 S.1891.19 CXXC finger 5 // CXXC finger 5 CXXC5 S.465413 cytochrome b-5 CYB5 S.465413 cytochrome b-5 CYB5 S.465413 cytochrome b-5 CYB5 S.221941 cytochrome b reductase 1 CYBRD1 S.437O60 cytochrome c, somatic CYCS S.26704 Cytoplasmic FMR1 interacting protein 1 CYFIP1 S.S19702 cytoplasmic FMR1 interacting protein 2 CYFIP2 S.S19702 cytoplasmic FMR1 interacting protein 2 CYFIP2 fit cytoplasmic FMR1 interacting protein S.95120 cytoglobin CYGB US 2009/O 1921 11 A1 Jul. 30, 2009 47
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.255664 cytoplasmic linker 2 cytoplasmic CYLN2 21467 linker 2 S.522863 Chromosome Y open reading frame 15A -10077 S.154654 cytochrome P450, family 1, Subfamily -2.16666 B, polypeptide 1 S.154654 cytochrome P450, family 1, Subfamily CYP1B1 -1.87882 B, polypeptide 1 S.154654 cytochrome P450, family 1, Subfamily CYP1B1 -162631 B, polypeptide 1 S.91546 cytochrome P450, family 26, Subfamily CYP26B1 -1.22772 B, polypeptide 1 S.150276 cytochrome P450, family 3, Subfamily CYP3A5 2O104 A, polypeptide 5 S.150276 cytochrome P450, family 3, Subfamily CYP3A5 35169 A, polypeptide 5 S.150276 cytochrome P450, family 3, Subfamily CYP3A5 S4568 A, polypeptide 5 S.417.077 cytochrome P450, family 51, subfamily CYP51A1 -145SS A, polypeptide 1 S.417.077 cytochrome P450, family 51, subfamily CYP51A1 -1.32422 A, polypeptide 1 S.371597 ynein 2 light intermediate chain D2LIC 32776 S.371597 ynein 2 light intermediate chain D2LIC S1611 S. 751.89 eath-associated protein DAP -149054 S.270570 ihydrolipoamide branched chain DBT -1.2195 transacylase E S.45832O DC12 protein DC12 -110743 S. 507755 oublecortin and CaM kinase-like 1 DCAMKL1 -2.902 iscoidin, CUB and LCCL domain DCBLD1 O5197 containing 1 iscoidin, CUB and LCCL domain DCBLD1 48436 containing 1 S.315167 efective in sister chromatid cohesion DCC1 homolog 1 (S. cerevisiae) S.443875 DCP2 decapping enzyme homolog (S. cerevisiae) DCP2 -181125 S.328865 ynactin 4 (p62) DCTN4 -2.02467 S.328865 ynactin4 (p62) DCTN4 -131851 S.179852 Dendritic cell-derived ubiquitin-like DC-UbP 32734 protein S.446564 amage-specific DNA binding protein 2, DDB2 LHX3 14095 48 kDa LIM homeobox 3 iscoidin domain receptor family, DDR1 4327 member 1 iscoidin domain receptor family, DDR1 68595 member 1 iscoidin domain receptor family, DDR1 .8O2S6 member 1 iscoidin domain receptor family, DDR1 8964.8 member 1 S.SO3794 DEAD (Asp-Glu-Ala-Asp) box DDX10 -1421.52 poly ide 10 S.3634.92 DE sp-Glu-Ala-Asp) box DDX18 -1.05918 poly e 18 S.223141 DE sp-Glu-Ala-Asp) box DDX21 if -130791 poly e 21 filf Zinc finger protein 596 ZNF596 S.S10328 DE sp-Glu-Ala-Asp) box DDX24 -1.19965 poly S.311609 DE sp-Glu-Ala-Asp) box DDX39 -1.08985 poly S.9912O DE sp-Glu-Ala-Asp) box DDX3Y SO168 poly e3, Y-linked DE sp-Glu-Ala-Asp) box DDX42 -1.1377 poly S.190622 DE sp-Glu-Ala-Asp) box DDX58 18939 poly S.190622 DE sp-Glu-Ala-Asp) box DDX58 20084 polypeptide 58 S.2998.78 degenerative spermatocyte homolog 1, DEGS1 -1.777O1 ipid desaturase (Drosophila) S.22393 density-regulated protein DENR -137677 US 2009/O 1921 11 A1 Jul. 30, 2009 48
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.22393 density-regulated protein E NR -1.257 24 HS.445098 DEP domain containing 1 PDC1 -3.6264 HS.445098 DEP domain containing 1 PDC1 -3.46414 HS.445098 DEP domain containing 1 PDC1 -2.92.426 HS.445098 DEP domain containing 1 PDC1 -2.39652 HS.482233 DEP domain containing 1B PDC1B -3.433.54 HS.524488 diacylglycerol kinase, alpha 80 kDa KA 2677 HS.469022 deoxyguanosine kinase UOK O4628 HSSO3134 7-dehydrocholesterol reductase CR7 -1.8O162 HSSO3134 7-dehydrocholesterol reductase HCR7 HS.83765 dihydrofolate reductase HFR HS.83765 dihydrofolate reductase HFR HS.83765 dihydrofolate reductase HFR HS.83765 dihydrofolate reductase HFR HS.18788 dehydrogenase/reductase (SDR family) HRS10 member 10 HS.18788 dehydrogenase/reductase (SDR family) RS10 member 10 HS.18788 dehydrogenase/reductase (SDR family) DHRS10 member 10 HS.3269SO dehydrogenase/reductase (SDR family) DHRS4 member 4 HS.294.03 DEAH (Asp-Glu-Ala-His) box DHX40 polypeptide 40 HS.191518 DEAH (Asp-Glu-Ala-His) box polypeptide 9 HS2831.27 Diaphanous homolog 3 (Drosophila) HS.508141 diaphanous homolog 3 (Drosophila) HS.87889 Dicer1, Dcr-1 homolog (Drosophila) HS.87889 Dicer1, Dcr-1 homolog (Drosophila) HSSO6603 DIP13 beta Hs.177275 hypothetical protein d122O8.2 Hs.177275 Hypothetical protein dJ122O8.2 HS.4747 dyskeratosis congenita 1, dyskerin HS.4747 dyskeratosis congenita 1, dyskerin HS.4747 dyskeratosis congenita 1, dyskerin HS.S11979 DKFZP434B0335 protein HS.294.103 LMBR1 domain containing 2 HS.444.668 hypothetical protein DKFZp434K2435 HS.485899 CTTNBP2 N-terminal like HS.491626 Ring finger protein 170 HS.410889 putative ankyrin-repeat containing protein HS.356719 DKFZP564JO863 protein HS.323S 62 implantation-associated protein HS.323S 62 implantation-associated protein HS.386989 DKFZP566O084 protein HS.497518 hypothetical protein DKFZp761N1114 HS.497518 hypothetical protein DKFZp761N1114 HS.497518 hypothetical protein DKFZp761N1114 HS.S32968 hypothetical protein DKFZp762E1312 HS.2921S6 dickkopfhomolog 3 (Xenopus laevis) HS.2921S6 Dickkopf homolog 3 (Xenopus laevis) HS.2921S6 dickkopfhomolog 3 (Xenopus laevis) HS. 134296 deleted in liver cancer 1 HS.S27922 deleted in lymphocytic leukemia, 1 HS.S48247 deleted in lymphocytic leukemia, 2 BCMS upstream neighbor-like C MS UNL HS.S48247 deleted in lymphocytic leukemia, 2 E f BCMS upstream neighbor-like I CMisis S. HS.77695 discs, large homolog7 (Drosophila) HS.5324.46 DNA2 DNA replication helicase 2-like (yeast) HS.490745 DnaJ (Hsp40) homolog, subfamily B, DNAB6 member 6 HS.499OOO DnaJ (Hsp40) homolog, subfamily C, DNAJC1 -2.62796 member 1 HS.499OOO DnaJ (Hsp40) homolog, subfamily C, DNAJC1 -2.54O13 member 1 US 2009/O 1921 11 A1 Jul. 30, 2009 49
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.499OOO DnaJ (Hsp40) homolog, subfamily C, DNAJC1
S.521764 DNAJC16
S.S36063 DNAJC6 10817
DNAJC9 32488
DNAJC9 11517
ynein, cytoplasmic, light intermediate DNCLI1 1779 polypeptide 1 S.1591.9S edicator of cytokinesis 1 DOCK1 2.26656 S.476,284 edicator of cytokinesis 3 DOCK3 66379 S.406156 edicator of cytokinesis 7 DOCK7 19771 S.132599 edicator of cytokinesis 8 DOCK8 50055 S.132599 edicator of cytokinesis 8 DOCK8 2.35211 S.279832 ocking protein 4 DOK4 3361 S.279832 ocking protein 4 DOK4 37223 S.502914 ipeptidylpeptidase 3 DPP3 O1747 S.502914 ipeptidylpeptidase 3 DPP3 O7768 S. 533644 py-19-like 2 (C. elegans) DPY19L2 1825 S.33SO34 ihydropyrimidine dehydrogenase DPYD 98.042 S.S19659 ihydropyrimidinase-like 3 DPYSL3 .73075 S.S19659 ihydropyrimidinase-like 3 DPYSL3 SO947 S.1OOO58 ihydropyrimidinase-like 4 DPYSL4 O9712 S.1OOO58 ihydropyrimidinase-like 4 DPYSL4 2.60688 S.1917OS DEAQ box polypeptide 1 (RNA DQX1 27392 ependent ATPase) S.14868O opamine receptor D1 interacting DRD1 IP O7102 protein S.279583 DORA reverse strand protein 1 DREV1 O6286 S.369998 Dbf\-related factor 1 DRF1 17251 S.412597 esmoglein 2 DSG2 .9102 S.412597 Desmoglein 2 DSG2 34315 S.126774 enticleless homolog (Drosophila) DTL 4.10861 S.126774 enticleless homolog (Drosophila) DTL 3 43887 S.471873 eoxythymidylate kinase (thymidylate DTYMK 866.36 kinase) S.471873 eoxythymidylate kinase (thymidylate DTYMK 71737 kinase) S.171695 ual specificity phosphatase 1 DUSP1 50727 S.130988 ual-specificity tyrosine-(Y)- DYRK1B 351.98 phosphorylation regulated kinase 1B S.126403 yslexia Susceptibility 1 candidate 1 DYX1C1 7048 S.4O9210 Zinc finger DAZ interacting protein 3 DZIP3 O7621 S.4O9210 Zinc finger DAZ interacting protein 3 DZIP3 2468 S.S23526 E2F transcription factor 8 E2F8 3.18656 S.474479 ELL associated factor 1 EAF1 2.101.97 S.522636 emopamil binding protein (sterol EBP 26922 isomerase) S.522636 emopamil binding protein (sterol EBP isomerase) S.1961.76 enoyl Coenzyme A hydratase 1, ECH1 peroxisomal S.518299 epithelial cell transforming sequence 2 ECT2 Oncogene S.518299 epithelial cell transforming sequence 2 ECT2 .73218 Oncogene S.492.445 E3 ubiquitin protein ligase, HECT 2.022 domain containing, 1 S.48273O EGF-like repeats and discoidin I-like 2.8031 domains 3 S.134857 EF-hand calcium binding domain 2 EFCAB2 1.71885 S.134857 EF-hand calcium binding domain 2 EFCAB2 101445 S.76224 EGF-containing fibulin-like extracellular EFEMP1 1.83654 matrix protein 1 S.76224 EGF-containing fibulin-like extracellular EFEMP1 1.3128S matrix protein 1 S.403594 EF-hand domain family, member A2 EFEHA2 131663 US 2009/O 1921 11 A1 Jul. 30, 2009 50
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.257224 EF-hand domain family, member B EFEHB 1.OO964 S.465374 EF-hand domain family, member D2 EFEHD2 -2.46123 S. 132483 EGF-like-domain, multiple 4 EGFL4 187874 S.494977 EGF-like-domain, multiple 5 EGFL5 180931 S.3688O8 EH-domain containing 3 EHD3 1.71415 S.461178 eukaryotic translation initiation factor EIF1AY -110984 1A, Y-linked S.44.9415 Eukaryotic translation initiation factor EIF2C2 -1.12295 2C, 2 S.47 1492 Eukaryotic translation initiation factor EIF2C4 180642 2C, 4 S.151777 eukaryotic translation initiation factor 2, EIF2S1 -273226 subunit 1 alpha, 35 kDa S.151777 eukaryotic translation initiation factor 2, EIF2S1 -2.09459 subunit 1 alpha, 35 kDa S.404056 eukaryotic translation initiation factor 3, EIF3S1 -228229 subunit 1 alpha, 35 kDa S.404056 eukaryotic translation initiation factor 3, EIF3S1 -1.79959 subunit 1 alpha, 35 kDa S.404056 eukaryotic translation initiation factor 3, EIF3S1 -1499 subunit 1 alpha, 35 kDa S.129673 Eukaryotic translation initiation factor EIF4A1 -1.15915 4A, isoform 1 S.476782 eukaryotic translation initiation factor EIF4E3 41972 4E member 3 S.476782 eukaryotic translation initiation factor EIF4E3 578 4E member 3 S.411641 eukaryotic translation initiation factor EIF4EBP1 -139677 4E binding protein 1 S.4337SO eukaryotic translation initiation factor 4 EIF4G1 -1.03814 gamma, 1 S.467084 eukaryotic translation initiation factor 4 EIF4G3 26S23 gamma, 3 S.SS832S eukaryotic translation initiation factor 5 EIF5 -193228 S.SS832S eukaryotic translation initiation factor 5 EIF5 -1.86911 S.46523 ELK3, ETS-domain protein (SRF ELK3 -2456SS accessory protein 2) S.46523 ELK3, ETS-domain protein (SRF ELK3 -1.25066 accessory protein 2) S.192221 elongation factor, RNA polymerase II, 2 ELL2 -1.91899 S.192221 elongation factor, RNA polymerase II, 2 ELL2 -162813 S.192221 elongation factor, RNA polymerase II, 2 ELL2 -1.57786 S.SS8SSO elongation factor RNA polymerase II ELL3 13O84 like 3 S.SS8SSO elongation factor RNA polymerase II ELL3 71885 like 3 hypothetical protein Ells1 Ells1 24292 engulfment and cell motility 1 (ced-12 ELMO1 22869 homolog, C. elegans) S.25597 elongation of very long chain fatty acids ELOVL1 -2.76914 (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 S.25597 e ongation of very long chain fatty acids ELOVL1 -2.59687 ( FEN1/Elo2, SUR4/Elo3, yeast)-like 1 S.101915 e ongation of very long chain fatty acids ELOVL4 71.465 (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 ELOVL family member 5, elongation of ELOVL5 -2.45897 long chain fatty acids S.S11915 enolase 2 (gamma, neuronal) ENO2 49254 S.224171 enolase 3 (beta, muscle) ENO3 13782 S.51 1916 endosulfine alpha ENSA -1.274O1 S.51 1916 endosulfine alpha ENSA -1.25068 S.51 1916 endosulfine alpha ENSA 18864 S.444389 ectonucleoside triphosphate ENTPD4 OS884 diphosphohydrolase 4 S.437422 erythrocyte membrane protein band 4.1- EPB41L1 95706 like 1 S.371218 EPH receptor A4 EPHA4 1881 S.462.445 B9 protein EPPB9 47687 S.200412 epiplakin 1 EPPK1 15271 S.200412 epiplakin 1 EPPK1 31746 US 2009/O 1921 11 A1 Jul. 30, 2009 51
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.497788 glutamyl-prolyl-tRNA synthetase EPRS O2469 HS-3426 Era G-protein-like 1 (E. coli) ERAL.1 O6767 S.SS8519 ERO1-like beta (S. cerevisiae) ERO1LB O4461 S.9948O establishment of cohesion 1 homolog 2 ESCO2 2.44684 (S. cerevisiae) S.9948O establishment of cohesion 1 homolog 2 ESCO2 .78936 (S. cerevisiae) S.153479 extra spindle poles like 1 (S. cerevisiae) ESPL1 91154 S.153479 extra spindle poles like 1 (S. cerevisiae) ESPL1 .82O69 S.369438 v-ets erythroblastosis virus E26 ETS1 6735 oncogene homolog 1 (avian) S.22634 ets variant gene 1 ETV1 88347 S.125867 Enah Vasp-like EVL 13764 S.498248 exonuclease 1 EXO1 2.25O23 S.546354 exosome component 2 EXOSC2 3212 S.493887 exosome component 3 EXOSC3 11772 S.294O41 exosome component 8 EXOSC8 S286 S.357637 exostoses (multiple)-like 2 EXTL2 22O71 S. 1024.08 Eyes absent homolog 4 (Drosophila) EYA4 19608 S. 194669 enhancer of Zeste homolog 1 EZH1 2O347 (Drosophila) S.444082 enhancer of Zeste homolog 2 EZH2 78348 (Drosophila) S.S17293 F11 receptor F11R 8927 S.S17293 F11 receptor F11R 85886 S.435782 coagulation factor XIII, B polypeptide F13B 78.363 S.482562 coagulation factor II (thrombin) receptor F2R 2.34626 S.425O2 coagulation factor II (thrombin) F2RL2 2.82395 receptor-like 2 S.30054 coagulation factor V (proaccelerin, labile F5 786.64 actor) coagulation factor VIII, procoagulant F8 97.013 component (hemophilia A) S.SO3S46 atty acid desaturase 1 FADS1 .6424 S.444200 etal Alzheimer antigen FALZ O7428 S.S67322 amily with sequence similarity 13, FAM13C1 79836 member C1 S.436854 amily with sequence similarity 19 FAM19AS 40543 (chemokine (C-C motif)-like), member AS S.548148 amily with sequence similarity 29, FAM29A 93.931 member A S.548148 amily with sequence similarity 29, FAM29A 82376 member A S.533468 amily with sequence similarity 29, FAM29A 3457 member A S.121536 amily with sequence similarity 54, FAM54A 2.61482 member A S.121536 amily with sequence similarity 54, FAM54A 11101 member A S.404323 amily with sequence similarity 64, FAM64A 37793 member A S.49548O amily with sequence similarity 69, FAM69B 2.23O3 member B S.33966S amily with sequence similarity 72, FAM72A 2.16905 member A amily with sequence similarity 73, FAM73A 23104 member A amily with sequence similarity 73, FAM73A 2.1617 member A HS. 124951 amily with sequence similarity 84, FAM84B 2.32367 member B HS-38516 amily with sequence similarity 89, FAM89A 2.11277 member A HS.284153 Fanconi anemia, complementation group A FANCA 1.32474 HSSS4740 Fanconi anemia, complementation group B FANCB 1.13523 HS2O8388 Fanconi anemia, complementation group EANCD2 2.84.826 D2 Fanconi anemia, complementation group EANCD2 1.60374 D2 US 2009/O 1921 11 A1 Jul. 30, 2009 52
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.434873 Fanconi anemia, complementation group G EANCG -1.5852 S.244.139 Fas (TNF receptor Superfamily, member FAS 17228 6) S.244.139 Fas (TNF receptor Superfamily, member FAS 24.654 6) S.244.139 Fas (TNF receptor Superfamily, member FAS 31S6S 6) S.244.139 Fas (TNF receptor Superfamily, member FAS 4722 6) S.475872 F-box and leucine-rich repeat protein 2 17038 S.SS8474 F-box and leucine-rich repeat protein 21 S.SS8474 F-box and leucine-rich repeat protein 21 S.SS8475 F-box and leucine-rich repeat protein 4 S.458959 F-box protein 22 S. 64691 F-box protein 28 S.406787 F-box protein 3 S.421095 F-box protein 30 S.23158 F-box protein 41 s.339577 F-box protein 43 S.S2OSO6 F-box protein 5 S.S2OSO6 F-box protein 5 S.494985 F-box and WD-40 domain protein 2 S.S19029 F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila) S.445748 FCH and double SH3 domains 2 CHSD2 S.335918 airnesyl diphosphate synthase (farnesyl DPS pyrophosphate synthetase, dimethylallylt S. 69.745 erredoxin reductase 2.8746 flap structure-specific endonuclease 1 -2.23817 flap structure-specific endonuclease 1 -2.1121 fibrinogen alpha chain -2.37948 fibrinogen alpha chain -228712 FYVE, RhoGEF and PH domain 1.13339 containing 4 S.284244 fibroblast growth factor 2 (basic) -1.70317 S.1420 fibroblast growth factor receptor 3 2.07112 (achondroplasia, thanatophoric dwarfism) S.436636 ormin homology 2 domain containing 3 HOD3 2.33O86 S.137516 idgetin-like GNL1 -2.0818 S.137516 idgetin-like GNL1 -1.68787 S.S26972 filamin A interacting protein 1 LIP1 S.S29778 eucine zipper protein FKSG14 KSG14 S. 1046SO mago-nashi homolog LJ10292 S.513,126 hypothetical protein LJ10719 LJ10719 S.513,126 hypothetical protein LJ10719 LJ10719 S.513,126 hypothetical protein LJ10719 LJ10719 S.839S hypothetical protein LJ10781 LJ10781 S.212774 hypothetical protein FLJ10808 LJ10808 S.212774 hypothetical protein FLJ10808 LJ10808 S.212774 hypothetical protein FLJ10808 LJ10808 S.SS6432 Hypothetical protein FLJ10979 LJ10979 S.15238S hypothetical protein FLJ10980 LJ1098O S.S67288 hypothetical protein 1OOO LJ11OOO S.274448 Hypothetical protein FLJ11029L LJ11029 S.368853 hypothetical protein FLJ12443 LJ12443 S.4823O1 Hypothetical protein FLJ13611 LJ13611 S.387.057 hypothetical protein FLJ13710 LJ13710 S.47125 hypothetical protein FLJ13912 LJ13912 S.47125 hypothetical protein FLJ13912 LJ13912 S.55148 hypothetical protein FLJ14466 L14466 S.190983 hypothetical protein FLJ14624 LJ14624 S.190983 hypothetical protein FLJ14624 LJ14624 S.190983 hypothetical protein FLJ14624 LJ14624 S.437195 hypothetical protein FLJ14627 L14627 S.321689 hypothetical protein FLJ14981 LJ14981 S.518926 hypothetical protein FLJ20054 20054 S.47558 FLJ20105 protein LJ2O105 -164963 S.418581 FLJ20160 protein LJ2O16O 2.47673 S.418581 FLJ20160 protein 2.483OS US 2009/O 1921 11 A1 Jul. 30, 2009 53
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.148677 hypothetical protein FLJ20232 LJ2O232 17884 S.S18727 RNA-binding protein LJ2O273 65332 S.S18727 RNA-binding protein LJ2O273 61792 S.S18727 RNA-binding protein LJ2O273 37823 S.3S1798 FLJ20298 protein LJ2O298 66429 S.368710 hypothetical protein FLJ20364 LJ2O364 S.426696 imeless-interacting protein LJ2O516 S.33O663 hypothetical protein FLJ20641 LJ2O641 S.33O663 hypothetical protein FLJ20641 LJ2O641 S.96852 hypothetical protein FLJ21128 LU21128 S.5493.31 ASAP 21159 S.369368 Hypothetical protein FLJ21924 LU21924 S.187SOS hypothetical protein FLJ22222 LJ22222 S.424711 hypothetical protein FLJ22313 L2231.3 S.424711 hypothetical protein FLJ22313 L2231.3 S.424711 hypothetical protein FLJ22313 L2231.3 S.45979S eucine Zipper domain protein L22386 S.114111 LJ22471 S.20971S LJ22624 S.3S1173 LJ2SOO6 LJ2SOO6 S.52934O LJ25067 LJ2SO67 S.1656O7 LJ25416 LJ25416 S.404OOO 30655 LJ30655 S.404OOO Hyp O he t C al p r Ot ei l L J30655 LJ30655 S.SS6067 hypothetical protein FLJ31306 LJ31306 S.349306 Hypothetical protein FLJ31951 LJ31951 S.448041 LJ323.63 S.362702 LJ32745 LJ32745 S.40646O hypothetical protein FLJ33814 LJ33814 S.462829 ikely ortholog of mouse schlafen 8/9 LJ34922 S.SS6039 FLJ35348 LJ35348 S.400698 hypothetical protein LJ35630 LJ3563O S.91930 hypothetical protein FLJ35808 LJ358O8 S.29692 Hypothetical protein FLJ36031 LJ36031 S.148768 Hypothetical protein FLJ36166 LJ36166 S.234681 hypothetical protein FLJ36812 LJ36812 S.289044 CDC20-like protein LJ37927 S.210586 othetical protein FLJ38725 LJ38725 S.210586 othetical protein FLJ38725 LJ38725 S.44817 FLJ40142 protein LJ4O142 S.4342SO othetical protein FLJ40629 LJ4O629 S.467793 hypothetical protein FLJ40869 LJ40869 S.53O438 LJ46154 protein LJ46154 S.SO 6309 LJ46688 protein LJ46688 S.44.8889 LJ90757 protein LJ90757 S.44.8889 LJ90757 protein LJ90757 S.476448 amin B, beta (actin binding protein LNB 7 8 S.41296 bronectin leucine rich transmembrane LRT3 SO282 protein 3 S.45971S FLYWCH-type zinc finger 1 FLYWCH1 O3851 S.24889 ormin 2 FMN2 353.05 S.3O3476 flavin containing monooxygenase 5 FMO5 .725.65 S.2O3717 fibronectin 1 FN1 O9597 S.438.064 FNS protein FNS 39882 S.189409 ormin binding protein 1 FNBP1 32S66 S.298.735 ormin binding protein 3 FNBP3 2.29703 S.298.735 ormin binding protein 3 FNBP3 2.23899 S.298.735 ormin binding protein 3 FNBP3 95234 S.239 orkhead box M1 FOXM1 63S11 S.370666 orkhead box O1A (rhabdomyosarcoma) FOXO1A 16937 S.297452 orkhead box Q1 FOXO1 20527 S.3694.48 Fraser syndrome 1 FRAS1 36333 S.3694.48 Fraser syndrome 1 FRAS1 2.70237 S.12753S FERM domain containing 3 FRMD3 75635 S.12753S FERM domain containing 3 FRMD3 O4118 S.369384 FERM domain containing 4A FRMD4A 28615 S.30561 fibrinogen silencer binding protein FSBP 35416 RAD54 homolog B (S. cerevisiae) RADS4B US 2009/O 1921 11 A1 Jul. 30, 2009 54
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.34892O FSH primary response (LRPR1 FSHPRH1 -2.69849 homolog, rat) 1 S.34892O FSH primary response (LRPR1 FSHPRH1 -1.74732 homolog, rat) 1 S.S13522 usion (involved in t(12; 16) in malignant FUS -1086.67 iposarcoma) S.29978 rataxin -1.70992 S.413137 FXYD domain containing ion transport 14961 regulator 2 S.413137 FXYD domain containing ion transport 31436 regulator 2 S.173859 rizzled homolog7 (Drosophila) OS336 S.3353 Ras-GTPase-activating protein SH3 -3.2146 domain-binding protein S.3353 Ras-GTPase-activating protein SH3 -2.67307 domain-binding protein S.3353 Ras-GTPase-activating protein SH3 -1.7465 domain-binding protein S.3353 Ras-GTPase-activating protein SH3 -1.16863 domain-binding protein S.167017 gamma-aminobutyric acid (GABA) B GA BBR1 64427 receptor, 1 S.511316 GA binding protein transcription factor, GA -1.671 62 beta subunit 2 S.24969 gamma-aminobutyric acid (GABA) A GA BRAS -1.70953 receptor, alpha 5 S.24969 gamma-aminobutyric acid (GABA) A GA BRAS -1.38757 receptor, alpha 5 S.302352 gamma-aminobutyric acid (GABA) A GA BRB3 -159092 receptor, beta 3 S.804.09 growth arrest and DNA-damage GA 88766 inducible, alpha S.294.088 GAJ protein GA -2.79.177 S.278959 galanin GA -1.213 S.3299.78 UDP-N-acetyl-alpha-D- GA LNT11 28416 galactosamine:polypeptide N acetylgalactosaminyltransferase S.S.34374 UDP-N-acetyl-alpha-D- GA LNT4 -1.82726 galactosamine:polypeptide N acetylgalactosaminyltransferase S.SO1911 UDP-N-acetyl-alpha-D- GA LNTL4 52977 galactosamine:polypeptide N acetylgalactosaminyltransferase S.499659 GTPase activating Rap/RangAP GA 92.745 domain-like 4 S.322852 growth arrest-specific 2 like 1 GAS2L1 -1.61419 S.20575 Growth arrest-specific 2 like 3 GAS2L3 -19064 S.75335 glycine amidinotransferase (L- GATM 22063 arginine:glycine amidinotransferase) S.SS6063 opposite strand transcription unit to GATS 20979 STAG3 S. 62661 guanyla e binding protein 1, interferon GB 12929 inducibl e, 67 kDa i? guanylate binding p S. 62661 guanyla e binding protein 1, interferon GB 54-182 inducibl e, 67 kDa S. 62661 guanyla e binding protein 1, interferon GB 67365 inducibl e, 67 kDa i? guanylate binding p guanyla e binding protein 2, interferon GB 66864 inducibl e guanylate binding protein 2, interferon 99681 inducible guanylate binding protein S.86724 GTP cyclohydrolase 1 (dopa-responsive -199276 dystonia) S.293971 germ cell-less homolog 1 (Drosophila) -1.14224 S.4843.13 germ cell-less homolog 1 (Drosophila) -1.17319 S.315562 glutamate-cysteine ligase, modifier -2.78511 Subunit S.315562 Glutamate-cysteine ligase, modifier -2.45471 Subunit US 2009/O 1921 11 A1 Jul. 30, 2009 55
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.315562 glutamate-cysteine ligase, modifier GCLM .26658 Subunit HS.435741 glycine cleavage system protein H GCSEH (aminomethyl carrier) HS.435741 glycine cleavage system protein H GCSEH (aminomethyl carrier) HS.S15258 growth differentiation factor 15 GDF15 2.31472 HS.49962O gem (nuclear organelle) associated GEMIN4 21779 protein 4 HS.483921 gem (nuclear organelle) associated GEMINS 77235 protein 5 HS.2771.54 G elongation factor, mitochondrial 2 GFM2 19729 HS.460336 golgi associated, gamma adaptin ear GGA2 2013 containing, ARF binding protein 2 HS.78619 gamma-glutamyl hydrolase (conjugase, GGEH 93222 folylpolygammaglutamyl hydrolase) HSSS498 geranylgeranyl diphosphate synthase 1 GG 2686 HS.S32593 gap junction protein, alpha 7, 45 kDa s 94477 (connexin 45) HS2O2O11 GK001 protein KOO1 11277 HS.S2225S G kinase anchoring protein 1 KAP1 272O1 HS. 69089 galactosidase, alpha LA 15553 HS.443031 Galactosidase, beta 1 LB1 59027 HS.131673 glucocorticoid induced transcript 1 LCCI1 OO364 HS.111867 GLI-Kruppel family member GLI2 LI2 2S283 HS.116448 glutaminase LS 24749 HS.212606 glutaminase 2 (liver, mitochondrial) LS2 1439S HS.381.256 glycolipid transfer protein LTP .997S4 HS.381.256 glycolipid transfer protein LTP 21499 HS.368538 glutamate dehydrogenase 2 LUD2 O293 HS.14958S glutamate-ammonia ligase (glutamine LULD1 O8826 synthetase) domain containing 1 HS.415312 CG9886-like LYCTK 2O524 HSSS1552 KIAA1196 protein GM632 O3667 HSSS1552 KIAA1196 protein GM632 O5692 HS.234896 geminin, DNA replication inhibitor GMNN 47841 HS.S15O18 guanine nucleotide binding protein (G GNA13 2.47089 protein), alpha 13 HS.S15O18 Guanine nucleotide binding protein (G GNA13 S8408 protein), alpha 13 HS.S15O18 guanine nucleotide binding protein (G GNA13 51352 protein), alpha 13 HS.134587 guanine nucleotide binding protein (G GNAI1 21805 protein), alpha inhibiting activity polype HS.269782 Guanine nucleotide binding protein (G GNAQ 11832 protein), q polypeptide HS.125898 GNAS complex locus GNAS O648 HS.125898 GNAS complex locus GNAS 2.OO192 HS.43O425 guanine nucleotide binding protein (G GNB1 83826 protein), beta polypeptide 1 HS.43O425 guanine nucleotide binding protein (G GNB1 2.00349 protein), beta polypeptide 1 HS.1SSO90 guanine nucleotide binding protein (G GNBS 1154 protein), beta 5 HS.431101 guanine nucleotide binding protein (G GNG12 91611 protein), gamma 12 HS.431101 guanine nucleotide binding protein (G GNG12 .1241 protein), gamma 12 HS.431101 guanine nucleotide binding protein (G GNG12 O3355 protein), gamma 12 HS.5324O1 golgi transport 1 homolog A (S. cerevisiae) GOLT1A 2.607 OS HS.62275 golgi transport 1 homolog B (S. cerevisiae) GOLT1B 4O902 HS.62275 golgi transport 1 homolog B (S. cerevisiae) GOLT1B 23646 HS.191539 golgi associated PDZ and coiled-coil GOPC 2O331 motif containing HS.191539 golgi associated PDZ and coiled-coil GOPC 41408 motif containing HS. 194691 G protein-coupled receptor, family C, GPCRSA group 5, member A US 2009/O 1921 11 A1 Jul. 30, 2009 56
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.148266 glycerol-3-phosphate dehydrogenase 2 PD2 -2.27771 (mitochondrial) HS.148266 glycerol-3-phosphate dehydrogenase 2 PD2 -1.85335 (mitochondrial) HS.19049S glycoprotein (transmembrane) nmb PNMB 60921 HSSS8674 G protein-coupled receptor 113 PR113 8613 HS.15O131 G protein-coupled receptor 115 PR115 31636 HS.516604 G protein-coupled receptor 155 PR155 6O148 HS.23132O G protein-coupled receptor 160 PR160 34179 HS. 194691 G protein-coupled receptor, family C, PRCSA -1.34424 group 5, member A HS.489353 G-protein signalling modulator 2 PSM2 -166056 (AGS3-like, C. elegans) HS.489353 G-protein signalling modulator 2 PSM2 (AGS3-like, C. elegans) HS.76686 glutathione peroxidase 1 PX1 HS.467733 GREB1 protein REB1 HS-36982S grainyhead-like 3 (Drosophila) RHL3 HS.51422O granulin RN HS.51422O granulin RN HS.51422O granulin RN HS.309763 G-rich RNA sequence binding factor 1 RSF1 HS.309763 G-rich RNA sequence binding factor 1 HS.309763 G-rich RNA sequence binding factor 1 Hs.170904 Growth hormone regulated TBC protein 1 HS.445733 Glycogen synthase kinase 3beta HS2O3634 glutathione S-transferase omega 2 HS.S2O459 general transcription factor II, i HS.276925 GTP binding protein 1 HS.386189 G-2 and S-phase expressed 1 HS.386189 G-2 and S-phase expressed 1 HS.386189 G-2 and S-phase expressed 1 HS.386189 G-2 and S-phase expressed 1 fff hypothetical gene Supported by BCO69212 HS.477879 H2A histone family, member X HS.1191.92 H2A histone family, member Z HS.1191.92 H2A histone family, member Z HS.S1826S hypothetical protein H41 HS.S1826S Hypothetical protein H41 HS.47O611 histone acetyltransferase 1 Hs.29.1079 HESB like domain containing 1 HBLD1 HS.378532 HBS1-like (S. cerevisiae) HS.438SSO KIAA.0056 protein CAP-D3 HS.S67295 chromosome condensation protein G HCAP HS.S67295 chromosome condensation protein G HCAP HS2O516 histone deacetylase 4 HDAC4 HS.438782 histone deacetylase 5 HDACS HS.209958 HEAT repeat containing 1 HEATR1 HS.546260 Helicase, lymphoid-specific HELLS HS.546260 helicase, lymphoid-specific HELLS HS.546260 helicase, lymphoid-specific HELLS HS.529317 hect domain and RLD 6 HERC6 HS.S13008 hexosaminidase A (alpha polypeptide) HEXA HS.S86SO hedgehog acyltransferase HHAT HS.14224.5 HERV-H LTR-associating 3 HHLA3 HS.1241.56 hippocampus abundant transcript 1 HIAT1 HSSS5996 hippocampus abundant transcript-like 1 HIATL1 HS.S21171 hypoxia-inducible protein 2 HIG2 HS.S21171 hypoxia-inducible protein 2 HIG2 HS. 72325 histidine triad nucleotide binding protein 3 HINT3 HS.39746S Homeodomain interacting protein kinase 2 HIPK2 HS-7644 histone 1, H1c HIST1H1C HS.484950 histone 1, H2ac HIST1H2AC HS.51011 histone 1, H2ag. HIST1H2AG HS.546314 histone 1, H2bc HIST1H2BC HS.546314 histone 1, H2bc HIST1H2BC HS.130853 histone 1, H2bd HIST1H2BD HS.130853 histone 1, H2bd HIST1H2BD HS.130853 Histone 1, H2bd HIST1H2BD US 2009/O 1921 11 A1 Jul. 30, 2009 57
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.130853 Histone 1, H2bd IST1H2BD 3.31633 S. 70937 histone 1, H3h HIST1H3H 2.3O897 S.46423 histone 1, H4c HIST1H4C -198509 S.421737 histone 1, H4h HIST1H4H 3.01933 S.421737 histone 1, H4h HIST1H4H 3.29807 S.53O461 Histone 2, H2aa HIST2H2AA 2.12275 S.53O461 histone 2, H2aa HIST2H2AA 2.84316 S.53O461 histone 2, H2aa HIST2H2AA 3.20575 S.2178 histone 2, H2be IST2H2BE 3.2941 S.55468 Histone 2, H4 HIST2H4 1.5663 S.371350 Holocarboxylase synthetase (biotin HLCS 2.21798 (proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase) S.196952 hepatic leukemia factor 1.04531 S. 197086 high-mobility group protein 2-like 1 -135713 S.434953 high-mobility group box2 -2.03362 S.72SSO hyaluronan-mediated motility receptor -3.1347 (RHAMM) S.72SSO hyaluronan-mediated motility receptor HMMR -2.73.338 (RHAMM) S.42151 histamine N-methyltransferase HNMT 192O6 S.42151 histamine N-methyltransferase HNMT 93O24 S.202166 heterogeneous nuclear ribonucleoprotein HNRPH1 -16109 H1 (H) S.202166 heterogeneous nuclear ribonucleoprotein HNRPH1 -1.085O2 H1 (H) S.129051 homer homolog 1 (Drosophila) HOMER1 8O166 S.378836 Hook homolog 1 (Drosophila) HOOK1 71795 S. 77348 hydroxyprostaglandin dehydrogenase HPGD O61 5-(NAD) S.5341.69 heat shock 70 kDa protein 14 HSPA14 -139294 S.90093 heat shock 70 kDa protein 4 HSPA4 -1.29062 S.11614 HSPCO65 protein HSPCO65 2.57539 S.S2947S hypothetical protein HSPC111 HSPC111 -1.27724 S.372208 HSPC159 protein HSPC159 81017 S.907S3 HIV-1 Tat interactive protein 2, 30 kDa HTATIP2 2.35107 S.421649 5-hydroxytryptamine (serotonin) HTR2B 42638 receptor 2B S.546478 BR domain containing 3 BRDC3 O1982 S.353214 intercellular adhesion molecule 3 CAM3 -231627 S.417022 intestinal cell (MAK-like) kinase CK 46572 S.SO4609 inhibitor of DNA binding 1, dominant D1 -164509 negative helix-loop-helix protein S.S67240 iduronate 2-sulfatase (Hunter syndrome) DS 19532 S.S67240 iduronate 2-sulfatase (Hunter syndrome) DS 2O866 S.S67240 iduronate 2-sulfatase (Hunter syndrome) DS 33917 S.S67240 iduronate 2-sulfatase (Hunter syndrome) DS 36826 S.315177 interferon-related developmental FRD2 -1.2166 regulator 2 S.4O1316 insulin-like growth factor binding GFBP1 -1.64161 protein 1 S.45O230 insulin-like growth factor binding GFBP3 -2.6144 protein 3 S.45O230 insulin-like growth factor binding GFBP3 -24886 protein 3 S.2S2543 IKK interacting protein KIP -2.22335 S.2S2543 IKK interacting protein KIP -2.14205 S.4673O4 interleukin 11 L11 -367212 S.130652 Interleukin 17D L17D 1.63864 S.S32082 Interleukin 6 signal transducer (gp130, L6ST 1.73339 oncostatin M receptor) S.S32082 Interleukin 6 signal transducer (gp130, 1944O6 oncostatin M receptor) S.624 interleukin 8 -2.07134 S.465885 interleukin enhancer binding factor 3, -1.36934 90 kDa S.144936 IGF-II mRNA-binding protein 1 MP-1 -1581.59 S.367992 inositol(myo)-1 (or 4)-monophosphatase 2 MPA2 -1.OO389 S.438689 inositol monophosphatase domain MPAD1 -1.2956 containing 1 US 2009/O 1921 11 A1 Jul. 30, 2009 58
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.438689 inositol monophosphatase domain MPAD1 -122495 containing 1 S.36975S inositol polyphosphate-5-phosphatase F NPPSF 1234.48 S.465744 Insulin receptor NSR 1.06549 S.465744 insulin receptor NSR 1.1958 S.465744 Insulin receptor NSR 146677 S.482269 importin 11 PO11 -107067 S.41 1865 importin 4 PO4 -192311 S.43OSS1 IQ motif containing GTPase activating QGAP1 -2.71932 protein IQ motif containing GTPase activating QGAP1 -2.36104 protein S.133294 IQ motif containing GTPase activating QGAP3 -214329 protein 3 S.133294 IQ motif containing GTPase activating QGAP3 -193274 protein 3 S.3O1904 interferon stimulated exonuclease gene SG2OL2 -1.2O778 20 kDa-like 2 S.3O1904 interferon stimulated exonuclease gene SG2OL2 -1.OS117 20 kDa-like 2 S.429052 integrin, beta 1 TGB1 -3.028O2 S.429052 integrin, beta 1 TGB1 -2.91707 S.429052 integrin, beta 1 TGB1 -2.17534 S. 166539 integrin beta 3 binding protein (beta,3- TGB3BP -2.O2SS1 endonexin) S.443650 umonji, AT rich interactive domain 1B ARID1B 15969 (RBP2-like) S.443650 umonji, AT rich interactive domain 1B ARID1B 23534 (RBP2-like) S.443650 umonji, AT rich interactive domain 1B ARID1B 37239 (RBP2-like) S.368.944 juxtaposed with another Zinc finger gene 1 AZF1 -2.16226 S. 531819 jumonji domain containing 1A MD1A O1766 S.371013 jumonji domain containing 2B MD2B 6286 S.371013 jumonji domain containing 2B MD2B .95999 S.334017 tubulin, alpha, ubiquitous K-ALPHA-1 -135471 S.334017 tubulin, alpha, ubiquitous if tubulin, K-ALPHA-1 -129311 alpha, ubiquitous S.334017 tubulin, alpha, ubiquitous K-ALPHA-1 -1.29099 S.524390 tubulin, alpha, ubiquitous if tubulin, K-ALPHA-1 -125129 alpha, ubiquitous S.524390 tubulin, alpha, ubiquitous K-ALPHA-1 -1.13449 S.131838 katanin p50 (ATPase-containing) KATNA1 -1.22168 subunit A1 S.243596 katanin p50 subunit A-like 1 KATNAL1 -1.21293 S.153S21 potassium voltage-gated channel, Shaw KCNC4 19395 related subfamily, member 4 S.463985 potassium inwardly-rectifying channel, KCN16 3.12427 Subfamily J, member 16 S.42OO16 potassium channel, Subfamily T. KCNT2 42217 member 2 S.52O210 KDEL (Lys-Asp-Glu-Leu) endoplasmic KDELR2 -1.19309 reticulum protein retention receptor 2 S.52O210 KDEL (Lys-Asp-Glu-Leu) endoplasmic KDELR2 -1.18837 reticulum protein retention receptor 2 S.SS4798 KDEL (Lys-Asp-Glu-Leu) endoplasmic KDELR3 -2.2101 reticulum protein retention receptor 3 S.SS4798 KDEL (Lys-Asp-Glu-Leu) endoplasmic K DELR3 -150849 iculum protein retention receptor 3 S.151761 AAO100 gene product AAO1OO 84019 S.81892 AAO101 KIAA0101 AAO1O1 -232423 S.81892 AAO1O1 -143559 S.9997 AA0256 gene product AAO256 18229 S.S2O710 AA0265 protein AAO265 -1.95842 S.S2O710 AA0265 protein AAO265 -1.51772 S.S2O710 AA0265 protein AAO265 -142047 S.S29959 AAO274 AAO274 .2473S S.47S334 AA0280 protein AAO28O 3.1133 S.47S334 AA0280 protein AAO28O 74.146 S.533787 AA0286 protein AAO286 -1985.42 US 2009/O 1921 11 A1 Jul. 30, 2009 59
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.S33787 KIAA0286 protein AAO286 .74506 HS.456SO7 KIAAO319-like AAO319L. O2S49 HSSS8466 KIAAO323 AAO323 O2258 Hs.1956.67 KIAAO329 AAO329 14037 HS.35490 KIAA0350 protein AAO3SO O8686 HS.10O874 KIAAO494 AAO494 HS.10O874 KIAAO494 AAO494 HS.10O874 KIAAO494 AAO494 KIAAO500 protein AAOSOO HSSS28O1 KIAAOSO7 AAOSO7 HS.301658 KIAAOS13 AAOS13 HS.495349 KIAAOS 15 AAOS 15 HS.7426 KIAAO841 AAO841 HS.4808.19 KIAAO882 protein AAO882 HS.91662 KIAAO888 protein AAO888 HS.91662 KIAAO888 protein AAO888 HS.65135 KIAAO913 AAO913 HS.432397 KIAAO934 Hs.120855 KIAAO960 protein Hs.120855 KIAAO960 protein HS.151220 palladin HS.151220 palladin HS.151220 palladin HS.443673 KIAA1002 protein HS-387856 KIAA1043 protein HS.21554 KIAA1107 HS.408142 KIAA1109 HS.368548 Family with sequence similarity 63, member B HS.368548 Family with sequence similarity 63, K 164 member B HS.29292S KIAA1212 212 HS.S27S24 KIAA1280 protein 280 HSSO9008 KIAA1333 333 HSSO9008 KIAA1333 333 HSSO9008 KIAA1333 333 HSSO9008 KIAA1333 333 HS.2117OO KIAA1411 411 HS.472044 hypothetical protein KIAA1434 434 HS.472044 hypothetical protein KIAA1434 434 HS.472044 hypothetical protein KIAA1434 434 HS.4796.77 KIAA1458 protein 458 HS.4796.77 KIAA1458 protein 458 HS.13043S KIAA1524 524 HS.13043S KIAA1524 524 HS.S15351 KIAA1533 533 HS.S14554 KIAA1618 618 HS.419171 KIAA1671 protein 671 KIAA1702 protein 702 HSSO7922 KIAA1704 704 HS.209561 KIAA1715 715 HS.87128 KIAA1815 815 HS.117136 KIAA1912 protein 912 HS28872 KIAA1946 946 HS.483329 KIAA1961 gene 961 HS.8878 kinesin family member 11 F 1 1 HS-3104 kinesin family member 14 F14 HS-3104 kinesin family member 14 F14 HS.307529 kinesin family member 15 F15 HS.301052 kinesin family member 18A i? kinesin F18A amily member 18A HS.97858 Kinesin family member 1B HS.97858 kinesin family member 1B Hs.73625 kinesin family member 20A HS.119324 kinesin family member 22 HS.119324 kinesin family member 22 HS.270845 kinesin family member 23 HS-69360 kinesin family member 2C HS-69360 kinesin family member 2C HS.36967O kinesin family member 3B US 2009/O 1921 11 A1 Jul. 30, 2009 60
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.36967O kinesin family member 3B 37049 S.21611 kinesin family member 3C 31582 S.279766 kinesin family member 4A S.435557 kinesin family member 5C S.3762O6 Kruppel-like factor 4 (gut) HS.40SS Kruppel-like factor 6 HS.40SS Kruppel-like factor 6 HS.40SS Kruppel-like factor 6 s.150557 Kruppel-like factor 9 S.495854 kelch-like 15 (Drosophila) S.S12576 killer cell lectin-like receptor subfamily C, member S.2O107 kinesin 2 S.3OOSS9 kinetochore associated 1 S.4144O7 kinetochore associated 2 S.1595.57 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) S.22933S Kringle containing transmembrane K REMEN1 protein 1 ubiquitin-conjugating enzyme variant Kua Kua S.118554 actamase, beta 2 LACTB2 S.118554 actamase, beta 2 LACTB2 S.497O39 aminin, gamma 1 (formerly LAMB2) LAMC1 S.496684 ysosomal-associated membrane protein 2 LAMP2 S.496684 ysosomal-associated membrane protein 2 LAMP2 S.496684 ysosomal-associated membrane protein 2 LAMP2 S.467807 ysosomal-associated protein LAPTM4A transmembrane 4 alpha La ribonucleoprotein domain family, LARP1 member 1 S.416755 La ribonucleoprotein domain family, LARP6 member 6 S.285976 LAG1 longevity assurance homolog 2 LASS2 (S. cerevisiae) S.27 OS25 LAG1 longevity assurance homolog 5 LASSS (S. cerevisiae) S.468044 ikely ortholog of mouse limb-bud and LBH 2.9809S heart gene likely ortholog of mouse li S.435166 amin B receptor LBR -236514 S.213289 ow density lipoprotein receptor D R -2.03319 (familial hypercholesterolemia) S.213289 ow density lipoprotein receptor D R -1.SS439 (familial hypercholesterolemia) S.23581 Leptin receptor S.23581 eptin receptor S.374.191 eprecan-like 1 REL1 eptin receptor overlapping transcript ROT S.S31776 ectin, galactoside-binding, soluble, 2 LGALS2 (galectin 2) HS.4082 ectin, galactoside-binding, soluble, 8 (galectin 8) S.SOf798 ipoma HMGIC fusion partner S.445265 LIM homeobox2 LHX2 S.4965.45 LIM homeobox 4 LHX4 S.4.69593 LIM and Senescent cell antigen-like LIMS1 domains 1 S.4.69593 LIM and Senescent cell antigen-like LIMS1 domains 1 S.23616 in-28 homolog B (C. elegans) LIN28B -2.56884 S.91393 in-7 homolog C (C. elegans) LINTC -2.25246 S.91393 in-7 homolog C (C. elegans) LINTC -2.20511 S.91393 in-7 homolog C (C. elegans) LINTC -1.44311 S.12O817 in-9 homolog (C. elegans) LIN9 -1.3572 S.127445 ipase A, lysosomal acid, cholesterol LIPA -1.87712 esterase (Wolman disease) S.459940 ipopolysaccharide-induced TNF factor LITAF -292415 S.459940 ipopolysaccharide-induced TNF factor LITAF -249069 S.465295 ectin, mannose-binding, 1 LMAN1 -1.26264 US 2009/O 1921 11 A1 Jul. 30, 2009 61
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.158852 ectin, mannose-binding 2-like if lectin, LMAN2L. 3844 mannose-binding 2-like S.491359 aminAC 33749 S.89497 amin B 3 36368 S.518084 Hypothetical protein LOC116064 LOC 16064 2.41821 S.518084 hypothetical protein LOC116064 LOC 16064 46921 S. 10651O hypothetical protein LOC116236 LOC 16236 35506 S.31409 hypothetical protein LOC120376 LOC 2O376 76479 S.746SS Hypothetical protein LOC124512 LOC 24512 33O14 S.171130 hypothetical protein BCO14608 LOC 28153 1545 S.171130 hypothetical protein BCO14608 LOC 28153 2.01562 S.474210 hypothetical protein LOC128977 LOC 28977 37265 S.100743 hypothetical protein BCO15395 LOC 30940 18246 S.483.259 hypothetical protein MGC12103 LOC 33619 40895 S.481569 hypothetical protein LOC134145 LOC 34145 22968 S.192586 similar to mouse 2310016A09Rik gene LOC 34147 83777 hypothetical protein LOC144871 LOC 44871 .47892 S.4101.26 hypothetical protein LOC145837 LOC 45837 14848 S.135094 hypothetical protein LOC146909 LOC 46909 2.72781 S.336588 hypothetical protein LOC147670 LOC 47670 O7518 S355162 hypothetical protein LOC147965 LOC 47965 33707 S. 531822 hypothetical protein LOC150759 LOC 50759 23594 HS.4988 hypothetical protein LOC151162 LOC 51162 OO691 S.SS86SS similar to hepatocellular carcinoma LOC S1194 486.18 associated antigen HCA557b S.259046 hypothetical protein BCO10062 LOC .92O28 S.153799 hypothetical protein LOC158402 LOC 10633 S.192877 hypothetical protein LOC169834 LOC 19901 S.38O920 hypothetical protein LOC201725 LOC2O1725 2.62 S.38O920 hypothetical protein LOC201725 LOC2O1725 S.205952 Hypothetical protein LOC201895 LOC2O1895 S.205952 Hypothetical protein LOC201895 LOC2O1895 S.17SS63 hypothetical protein LOC203274 LOC2O3274 S.496658 similar to solute carrier family 25, LOC2O3427 member 16 Hs.7626 hypothetical protein LOC219854 LOC2198.54 S.131417 Hypothetical protein LOC253039 LOC2S3O39 S.12326 hypothetical protein LOC257396 LOC2S7396 S.376O41 hypothetical protein LOC283070 LOC283O70 S.SS8716 hypothetical protein LOC283130 LOC283130 S.436276 hypothetical protein LOC283400 LOC2834OO S.259347 hypothetical protein LOC283464 LOC283464 S.259347 hypothetical protein LOC283464 LOC283464 hypothetical protein LOC283481 LOC283481 S.117167 hypothetical protein LOC283537 LOC283537 S.S61967 hypothetical protein LOC283788 LOC283788 S.406976 hypothetical protein LOC283874 LOC28.3874 hypothetical protein LOC285943 LOC28S943 S.SS8072 hypothetical protein LOC338620 LOC33862O S.1O3939 hypothetical protein LOC3394.48 LOC3394.48 S.1O3939 hypothetical protein LOC3394.48 LOC3394.48 S.S33212 hypothetical protein LOC340109 LOC340109 S.4SOOST hypothetical LOC344595 LOC344595 S.3S1582 similar to hypothetical testis protein LOC3S2909 Oil 8C3Cle. S.45828S hypothetical LOC375,010 fill hypothetical LOC37SO10 LOC4O113 LOC4O1131 S.23459 hypothetical LOC388727 LOC388,727 85395 HS.S215 hypothetical LOC400843 LOC40O843 27.083 S.S17791 hypothetical LOC4O1052 LOC4O1052 6O118 S.3856SO hypothetical gene Supported by LOC4O1068 22439 BCO281.86 S.S34807 hypothetical LOC4O1394 fill hypothetical LOC4O1394 O7536 LOC4O2578 LOC4O2578 S.S34807 hypothetical LOC4O1394 fill hypothetical LOC4O1394 S7808 LOC4O2578 LOC4O2578 S.S12257 hypothetical LOC4O1449 fit family with LOC4O1449 15272 sequence similarity 66, member C FAM66C FAM66E US 2009/O 1921 11 A1 Jul. 30, 2009 62
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) LOC4O1629 LOC4O1630 LOC4O1629 72622 LOC4O1630 S.474095 hypothetical gene Supported by LOC44O160 AK022914: AKO95211; BCO16035: BC041856: BX248778 S. 192643 LOC440173 LOC440173 2O596 S.549433 LOC44.0667 f. LOC44O669 LOC44.0667 f. 34729 LOC44O688 LOC44.0669 LOC44O688 hypothetical gene Supported by LOC441130 -1.13484 AKO26843; BX640678 similar to RIKEN cDNA 2310016C16 LOC493.869 -1.22366 similar to RIKEN cDNA 2510006C20 LOC494143 -2.71573 gene S.S.S9276 putative NFkB activating protein LOC497661 2688S S.469254 hypothetical protein LOC51315 LOCS1315 39745 S.469254 hypothetical protein LOC51315 LOCS1315 S2108 S.469254 hypothetical protein LOC51315 LOCS1315 96.249 S.549342 hypothetical protein LOC54103 LOCS4103 16933 S.355559 hypothetical protein LOC550643 LOCSSO 643 2.54798 S.185489 hypothetical protein A-211C6.1 LOCS7149 -1905O2 S.350700 hypothetical protein LOC90288 LOC90288 O1511 S.351461 hypothetical protein BCO16861 ft/ LOC90557 2.33225 hypothetical protein DKFZp434E2321 DKFZp434E2321 S.444338 prematurely terminated mRNA decay LOC91431 -104.871 actor-like S.28O990 novel 58.3 KDA protein LOC91.614 8188 S.190394 Hypothetical protein BC001 610 LOC91661 -1.07787 S.369763 hypothetical protein LOC92558 LOC92558 37412 S.398111 hypothetical protein BCO15148 LOC93O81 -1421.27 S.152944 oss of heterozygosity, 11, chromosomal LOH11CR2A 3699 region 2, gene A S.18O178 LON peptidase N-terminal domain and LONRF1 -1.852O2 ring finger S.143792 eucine rich repeat and fibronectin type LRFN3 44215 II domain containing 3 ow density lipoprotein receptor-related LRP11 -143395 protein 11 eucine rich repeat containing 19 LRRC19 .61682 eucine rich repeat containing 49 LRRC49 65546 eucine rich repeat (in FLII) interacting LRRFIP1 SS611 protein LSM2 homolog, U6 small nuclear RNA LSM2 -1.19716 associated (S. cerevisiae) S.515255 LSM4 homolog, U6 small nuclear RNA LSM4 -110515 associated (S. cerevisiae) S.515255 LSM4 homolog, U6 small nuclear RNA LSM4 -1.0212 associated (S. cerevisiae) S.524648 eukotriene A4 hydrolase -122343 S.289019 atent transforming growth factor beta 818.6 binding protein 3 S.155048 Lutheran blood group (Auberger b LU 24443 antigen included) S.18616 eucine Zipper protein 5 LUZP5 -1.84564 S.425427 hypothetical protein FLJ20425 LYAR -161007 S.468048 ySocardiolipin acyltransferase LYCAT -2.3596S S.15866S Ly6/neurotoxin 1 LYNX1 2.9112 S.432395 LY6/PLAUR domain containing 1 LYPD1 18646 S.125291 Lysophospholipase-like 1 LY PLAL1 .89692 S.13623S LysM, putative peptidoglycan-binding, LYSMD3 -1.1.191 domain containing 3 S.5.23221 eucine Zipper, putative tumor 23552 Suppressor 2 S.140452 mannose-6-phosphate receptor binding -194943 protein 1 S.28312 MAD2 mitotic arrest deficient-like 1 MAD2L1 -2.51145 (yeast) MAD2 mitotic arrest deficient-like 1 MAD2L1 -2.48232 (yeast) US 2009/O 1921 11 A1 Jul. 30, 2009 63
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.S17617 V-maf musculoaponeurotic fibrosarcoma MAFF 66059 oncogene homolog F (avian) S.269528 Mak3 homolog (S. cerevisiae) 16189 S.269528 Mak3 homolog (S. cerevisiae) 75418 S.1850SS mal, T-cell differentiation protein-like 19366 S.444627 mastermind-like 3 (Drosophila) O3755 S.188464 mannosidase, alpha, class 2B, member 2 19584 S.368,281 Microtubule-associated protein 2 .27489 S.433332 Mitogen-activated protein kinase kinase .7O622 interacting protein 1 S.2116O1 mitogen-activated protein kinase kinase MAP3K12 21363 kinase 12 S.2116O1 mitogen-activated protein kinase kinase MAP3K12 75107 kinase 12 S.145605 mitogen-activated protein kinase kinase MAP3K2 306O2 kinase 2 S.145605 Mitogen-activated protein kinase kinase MAP3K2 24925 kinase 2 S.269775 mitogen-activated protein kinase kinase MAP3K7IP2 58.644 kinase 7 interacting protein 2 S.269775 mitogen-activated protein kinase kinase MAP3K7IP2 36.177 kinase 7 interacting protein 2 S.S17949 microtubule-associated protein 4 MAP4 34906 S.431SSO mitogen-activated protein kinase kinase MAP4K4 10562 kinase kinase 4 S.431SSO mitogen-activated protein kinase kinase MAP4K4 21588 kinase kinase 4 S.485233 mitogen-activated protein kinase 14 MAPK14 17889 S.513661 mitogen activated protein kinase binding MAPKBP1 11226 protein 1 S.S15860 microtubule-associated protein, RP/EB MAPRE3 641OS amily, member 3 S.S15860 microtubule-associated protein, RP/EB MAPRE3 .7594 amily, member 3 S.S19909 myristoylated alanine-rich protein kinase MARCKS S9242 C substrate S.209614 MARVEL domain containing 1 MARVELD1 3O457 S.S13706 MARVEL domain containing 3 MARVELD3 O8477 S.27690S microtubule associated serine/threonine MASTL 62644 kinase-like S.1894.45 matrilin 2 MATN2 2392 S.198158 MAWD binding protein MAWBP O64 S.S17586 myoglobin MB 82459 S.458312 methyl-CpG binding domain protein 5 MBDS 24O77 S.478OOO muscleblind-like (Drosophila) MBNL1 92316 S.478OOO muscleblind-like (Drosophila) MBNL1 41977 S.478OOO muscleblind-like (Drosophila) MBNL1 28311 S.478OOO Muscleblind-like (Drosophila) MBNL1 17164 S.S11397 melanoma cell adhesion molecule MCAM 21725 melanoma cell adhesion molecule S.483104 mutated in colorectal cancers MCC 6236 S.167531 methylcrotonoyl-Coenzyme A MCCC2 16197 carboxylase 2 (beta) S.170422 MCF.2 cell line derived transforming O7163 sequence-like S.170422 MCF.2 cell line derived transforming 21451 sequence-like S.532826 myeloid cell leukemia sequence 1 MCL1 -2.38298 (BCL2-related) S.198363 MCM10 minichromosome maintenance MCM10 -3.67476 deficient 10 (S. cerevisiae) S.198363 MCM10 minichromosome maintenance MCM10 -3.14371 deficient 10 (S. cerevisiae) S.198363 MCM10 minichromosome maintenance MCM10 -2.6166 deficient 10 (S. cerevisiae) MCM2 minichromosome maintenance MCM2 -1.64223 deficient 2, mitotin (S. cerevisiae) MCM3 minichromosome maintenance MCM3 -145867 deficient 3 (S. cerevisiae) US 2009/O 1921 11 A1 Jul. 30, 2009 64
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol MCM4 minichromosome maintenance MCM4 -280012 ficient 4 (S. cerevisiae) CM4 minichromosome maintenance MCM4 -24O2O7 ficient 4 (S. cerevisiae) CM4 minichromosome maintenance MCM4 -2.0644 ficient 4 (S. cerevisiae) CM4 minichromosome maintenance MCM4 -190396 ficient 4 (S. cerevisiae) S.S17582 CM5 minichromosome maintenance MCMS -2.28141 ficient 5, cell division cycle 46 (S. cerevisiae) S.S17582 CM5 minichromosome maintenance MCMS -164733 ficient 5, cell division cycle 46 (S. cerevisiae) S.444118 CM6 minichromosome maintenance MCM6 -1.3262 ficient 6 (MIS5 homolog, S. pombe) cerevisae) S.43872O S.CM7 minichromosome maintenance MCM7 ficient 7 (S. cerevisiae) S.43872O CM7 minichromosome maintenance MCM7 ficient 7 (S. cerevisiae) S.437582 CM8 minichromosome maintenance MCM8 ficient 8 (S. cerevisiae) S.S35239 mucolipin 3 MCOLN3 S.427236 MyoD family inhibitor domain MDFIC containing fit MyoD family inhibitor omain contain S.427236 MyoD family inhibitor domain DFIC containing S.427236 MyoD family inhibitor domain DFIC .77906 containing S.369849 Mdm2, transformed 3T3 cell double 14346 minute 2, p53 binding protein (mouse) S.368866 hypothetical protein MDS025 O25 15319 S.233119 malic enzyme 2, NAD(+)-dependent, Ds -1.34462 mitochondrial S.233119 malic enzyme 2, NAD(+)-dependent, -117652 mitochondrial Mediator of RNA polymerase II -1.06214 transcription, Subunit 28 homolog (yeast) S.268675 MADS box transcription enhancer factor M .71546 2, polypeptide A (myocyte enhancer actor S.184339 maternal embryonic leucine Zipper MELK -3.0O861 kinase S.433213 methyltransferase like 2 / hypothetical METTL2 -1.082O6 protein FLJ12760 FLJ1276O S.432818 Microfibrillar-associated protein 3 MFAP3 -133928 S. 7678 major facilitator Superfamily domain MFSD3 4O961 containing 3 S.130692 Hypothetical protein MGC10946 MGC10946 -108651 S.425178 hypothetical protein MGC11102 MGC11102 -1.22482 S.546428 hypothetical protein MGC11266 MGC11266 -16299 S.99.196 hypothetical protein MGC11324 if MGC11324 -2.275.27 hypothetical protein MGC11324 S.460617 hypothetical protein MGC13024 MGC13024 79446 S.347408 Hypothetical protein MGC13102 MGC13102 17064 S.2563O1 multidrug resistance-related protein fif MGC13170 -1.23603 multidrug resistance-related protein S.S33747 hypothetical protein MGC 13183 fif MGC131.83 -1584.84 hypothetical protein MGC 13183 S.368399 FERM domain containing 5 MGC14161 72.705 S.SS8588 similar to RIKEN cDNA 1200014N16 MGC14289 -1.89713 gene S.3O323 hypothetical protein MGC15634 MGC15634 -1.62444 S.373941 if Hypothetical gene MGC16733 similar to MGC16733 494-68 S.S33723 CG12113 S.380228 hypothetical protein MGC17839 MGC17839 .29437 S.257664 hypothetical protein MGC17943 MGC17943 -1.34111 S.314261 Hypothetical protein MGC21644 MGC21644 2091 S.347524 hypothetical protein MGC24665 MGC24665 -19388 US 2009/O 1921 11 A1 Jul. 30, 2009 65
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gen e Symbol NC #2) HS.4253 hypothetical protein MGC2574 MG C2574 -1.70946 S.48343 hypothetical protein MGC26963 MG C26963 -3.61698 S.356467 Hypothetical protein MGC2747 MG C2747 34962 S.483.796 hypothetical protein MGC3265 MG C3265 8.559 S.408O8 hypothetical protein MGC33926 MG C33926 14901 S.413457 Chromosome 11 open reading frame 35 MG C3S138 95509 S.S.S9182 if CDNA clone IMAGE: 4837775 S.3S1133 hypothetical protein MGC35558 MG C35558 17753 S.374414 hypothetical protein MGC39606 MG C39606 2437 HS-6920 Hypothetical protein MGC45562 MG C45562 56375 HS-6920 hypothetical protein MGC45562 MG C45562 2.51953 S.441708 eucine-rich repeat kinase 1 MG C45866 -120743 S.345588 hypothetical protein MGC45871 MG C45871 -15647 S.345588 hypothetical protein MGC45871 MG C45871 -135041 S.S60915 hypothetical protein MGC4677 fif MG C4677 -156693 hypothetical LOC541471 LOCS41471 hypothetical protein MGC5370 MG C5370 O6303 S.13662 hypothetical protein MGC5508 MG C5508 -2.29289 S.SOfS84 hypothetical protein MGC9850 MG C98SO 28469 S.526494 ahogunin, ring finger 1 MG RN1 12992 S.SO1928 icrotubule associated monoxygenase, MICAL2 2.27797 ponin and LIM domain containing 2 S.80976 igen identified by monoclonal MK 67 -2.891.89 ibody Ki-67 S.80976 igen identified by monoclonal MK 67 -2.41542 ibody Ki-67 S.80976 igen identified by monoclonal MK 67 -2.121.96 ibody Ki-67 S.80976 igen identified by monoclonal MK 67 -1.7S32 ibody Ki-67 S.481307 LF1 interacting protein ML -3.50592 S.49.3585 myeloid lymphoid or mixed-lineage ML -131182 leukemia (trithorax homolog, Drosophila) S.487188 Myeloid/lymphoid or mixed-lineage ML 194359 leukemia (trithorax homolog, Drosophila) S.S33499 Membrane associated DNA binding MNAB 168856 protein S.2S3552 MAX binding protein MN 1.32128 S. 196437 MOB1, Mps One Binder kinase MO -3.20419 activator-like 1B (yeast) S. 196437 MOB1, Mps One Binder kinase MO -2.19267 activator-like 1B (yeast) S. 196437 MOB1, Mps One Binder kinase MO -2.06639 activator-like 1B (yeast) S. 196437 MOB1, Mps One Binder kinase MO -1.35494 activator-like 1B (yeast) S.437153 MondoA MONDOA O3873 S.521086 motile sperm domain containing 3 MO SPD3 15951 HS.240 M-phase phosphoprotein 1 MPHOSPH1 -1.04733 S.344400 M-phase phosphoprotein 6 MPHOSPH6 -16802 S. 507175 M-phase phosphoprotein 9 MPHOSPH9 -133309 S. 507175 M-phase phosphoprotein 9 MPHOSPH9 -1.27568 S.493919 myelin protein zero-like 1 MPZL.1 -1.587O6 S.493919 myelin protein zero-like 1 MPZL.1 -121636 S.493919 myelin protein zero-like 1 MPZL.1 -1.2O361 S.1O1840 major histocompatibility complex, class MR 1 13452 I-related S.279652 mitochondrial ribosomal protein L4 MRPL4 -12165 S. 75859 mitochondrial ribosomal protein L49 MRPL49 -1.25511 S.411125 mitochondrial ribosomal protein S12 MRPS12 -1.24674 S.S33291 MRS2-like, magnesium homeostasis MRS2L OS364 factor (S. cerevisiae) S.156519 mutS homolog 2, colon cancer, MSH2 -1.271.83 nonpolyposis type 1 (E. Coii) S. 134470 Musashi homolog 2 (Drosophila) MSI2 344O6 S.87752 moesin MSN -1.35O17 S.339024 methionine sulfoxide reductase B3 MSRB3 -1.OS195 S.894.04 mish homeo box homolog 2 (Drosophila) MSX2 11101 US 2009/O 1921 11 A1 Jul. 30, 2009 66
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.S13626 metallothionein 1F (functional) MT 1.18931 HS.S13626 metallothionein 1F (functional) MT 149789 HS. 193268 methylthioadenosine phosphorylase MTAP -1.25422 HSSO2773 membrane-type 1 matrix MT CBP-1 -3.68512 metalloproteinase cytoplasmic tail binding protein-1 S.502773 membrane-type 1 matrix MT CBP-1 -2.92784 metalloproteinase cytoplasmic tail binding protein-1 HS.269944 mitochondrial carrier homolog 2 (C. elegans) MT CH2 12443 HS.377155 metadherin MT DH -196269 HS.377155 metadherin MT DH -193929 HS.31O16 metal response element binding MT -1.04464 transcription factor 2 HS.435974 methylenetetrahydrofolate MT -1.69882 dehydrogenase (NADP+ dependent) 1 HS.479954 methylenetetrahydrofolate MT -14306 dehydrogenase (NADP+ dependent) 2 like HSSO7536 myotubularin related protein 6 MT -1.77082 HS.498.187 5-methyltetrahydrofolate-homocysteine MT -1.323 methyltransferase HS.485527 methylmalonyl Coenzyme A mutase MUT 10356 HSSO1023 MAX interactor 1 .95993 HS.380906 myeloid-associated differentiation MYADM -143997 marker HS.380906 myeloid-associated differentiation MYADM -1.38718 marker HS.445898 v-myb myeloblastosis viral oncogene MYBL1 -3.26889 homolog (avian)-like 1 Hs.1797.18 v-myb myeloblastosis viral oncogene MYBL2 -1326O1 homolog (avian)-like 2 HS.370040 c-myc binding protein MYCBP -3.2538 HS.370040 c-myc binding protein MYCBP -1.34931 HS.82116 myeloid differentiation primary response MYD88 -1.09524 gene (88) HS.46O109 Myosin, heavy polypeptide 11, Smooth MYH11 -190836 muscle HSSO4687 myosin, light polypeptide 9, regulatory 261.46 HS.481720 myosin X MYO10 -1.67665 HS.481720 Myosin X MYO10 -1.15977 HS.462777 myosin ID MYO1D .68759 HS.21213 myosin VA (heavy polypeptide 12, MYOSA 4SOOS myoxin) HS.21213 myosin VA (heavy polypeptide 12, MYOSA 62243 myoxin) HSSO3137 NAD synthetase 1 NA DSYN1 44189 HSSO3137 NAD synthetase 1 NA DSYN1 49212 HSSO727 N-acetylglucosaminidase, alpha NAGLU 17799 (Sanfilippo disease IIIB) HS.10430S NACHT, leucine rich repeat and PYD NA LP1 8288S (pyrin domain) containing 1 HS.3S1851 nanos homolog 1 (Drosophila) NANOS1 2.72O79 HS.S24599 nucleosome assembly protein 1-like 1 NA -166365 HS.S24599 nucleosome assembly protein 1-like 1 NA -149322 HS.S24599 60S ribosomal protein L6 (RPL6A) NA P1L1 -1.12756 HS. 6618O nucleosome assembly protein 1-like 2 NA P1L2 1834 HS.21365 nucleosome assembly protein 1-like 3 NA P1L3 42937 HS.S16471 Nck-associated protein 5 NA 57263 HS.324271 N-acyl-phosphatidylethanolamine NA PE-PLD -1.63822 hydrolyzing phospholipase D S.324271 N-acyl-phosphatidy ethanolamine NA PE-PLD -1.591.87 hydrolyzing phospholipase D HS.324271 N-acyl-phosphatidylethanolamine NA PE-PLD -1.52464 hydrolyzing phospholipase D HSSSS985 NMDA receptor regulated 1 NA -117163 HS2OO943 NMDA receptor regulated 2 NA -166609 HS2OO943 NMDA receptor regulated 2 NA -1.4174 S.2OO943 NMDA receptor regulated 2 NA -12328 US 2009/O 1921 11 A1 Jul. 30, 2009 67
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.319334 nuclear autoantigenic sperm protein -1.O2SOS (histone-binding) S.491172 neurobeachin 65917 S.491172 neurobeachin 92.913 S.412293 nuclear receptor coactivator 1 21726 S.322430 NDRG family member 4 2.21026 S.SO2S28 NADH dehydrogenase (ubiquinone) Fe–S -1.31414 protein 3, 30 kDa (NADH-coenzyme Q reductase S.SS5882 nebulin N S.437385 NECAP endocytosis associated 2 N CAB P2 S.1565 neural precursor cell expressed, N developmentally down-regulated 4 S.521461 neurofilament, light polypeptide 68 kDa N S.521461 Neurofilament, light polypeptide 68 kDa N S.521461 neurofilament, light polypeptide 68 kDa N S.405467 nei endonuclease VIII-like 3 (E. coli) N L3 S.153704 NIMA (never in mitosis genea)-related N kinase 2 If NIMA (never in mitosis gene S.153704 NIMA (never in mitosis genea)-related N E -2.33339 kinase 2 S.1295SO NIMA (never in mitosis genea)-related N E -1.31387 kinase 4 S. 197071 NIMA (never in mitosis genea)-related N E -2.53692 kinase 6 S. 197071 NIMA (never in mitosis genea)-related N E -1.8551 kinase 6 S.24119 NIMA (never in mitosis genea)-related NEK7 53595 kinase 7 S.455336 nasal embryonic LHRH factor N F 48971 S.370359 Nuclear factor IB N -106.797 S.73090 nuclear factor of kappa light polypeptide N -193871 gene enhancer in B-cells 2 (p49, p100) S.448588 nerve growth factor receptor NGFRAP1 -152893 (TNFRSF16) associated protein 1 S.369924 NHL repeat containing 2 N -139749 S.494457 ninjurin 1 N OSO39 S.370367 non imprinted in Prader-Willi/Angelman N -136816 syndrome 2 S.S67289 nipSnap homolog 3B (C. elegans) N PSNAP3B 26388 S.S67289 nipSnap homolog 3B (C. elegans) N PSNAP3B 2.15883 S.54473 NK2 transcription factor related, locus 5 N KX2-5 60664 (Drosophila) S.2O8759 nemo like kinase N 22495 S.2O8759 nemo like kinase N 23634 S.112242 normal mucosa of esophagus specific 1 -3.76104 S.418367 neuromedin U -1.35758 S.SO3911 nicotinamide N-methyltransferase -2.5314 S.SO3911 nicotinamide N-methyltransferase NNMT -2.32083 S.376.064 nucleolar protein 5A (56 kDa with NOLSA -1.26261 KKE/D repeat) S. 69851 nucleolar protein family A, member 1 NOLA1 -133268 (H/ACA Small nucleolar RNPs) S.S23238 nucleolar and coiled-body NOLC1 -1.13473 phosphoprotein 1 likely ortholog of mouse neighbor of NOPE O1313 Punc E11 S.18978O nitric oxide synthase trafficker NOSTRIN -1.25711 S.132370 NADPH oxidase 1 NOX1 -1.8453 S.75514 nucleoside phosphorylase -1.87778 S.237028 natriuretic peptide receptor Ciguanylate NPR3 -167883 cyclase C S. 91622 neuronal pentraxin receptor 65391 S.3712S neuropeptide Y receptor Y2 2.87693 S.5.21926 nuclear receptor binding protein 2 53575 S.453951 neuregulin 1 77579 S.471200 Neuropilin 2 -251,084 S.363558 HCV NS3-transactivated protein 2 62867 S.372OOO neutral sphingomyelinase (N-SMase) -1.01183 activation associated factor US 2009/O 1921 11 A1 Jul. 30, 2009 68
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.153952 5'-nucleotidase, ecto (CD73) NTSE -2.25153 S.213061 Nuclear casein kinase and cyclin NUCKS -1.83593 dependent kinase substrate 1 S.213061 Nuclear casein kinase and cyclin NUCKS -1.41169 dependent kinase substrate 1 S.213061 Nuclear casein kinase and cyclin NUCKS -1.25709 dependent kinase substrate 1 S.213061 nuclear casein kinase and cyclin NUCKS1 -143043 dependent kinase substrate 1 nudix (nucleoside diphosphate linked NUDT19 -1.851.38 moiety X)-type motif 19 S.188882 Nudix (nucleoside diphosphate linked NUDT3 -145819 moiety X)-type motif3 S.SO 6325 nudix (nucleoside diphosphate linked NUDT4 -1.22772 moiety X)-type motif 4 S.356699 nudix (nucleoside diphosphate linked NUDT4 .. -2.53923 moiety X)-type motif 4 NUDT4P1 S.356699 nudix (nucleoside diphosphate linked NUDT4 .. -1.60875 moiety X)-type motif 4 NUDT4P1 nuclear fragile X mental retardation NUFIP1 -1.34278 protein interacting protein 1 nuclear fragile X mental retardation NUFIP1 -1.27415 protein interacting protein 1 S.S24574 nucleoporin 107 kDa NUP107 -1.263SS S.372099 nucleoporin 160 kDa NUP160 -1.63572 S.444276 nucleoporin 37 kDa NUP37 -128.191 S.475103 nucleoporin 50 kDa NUPSO -145184 S.475103 nucleoporin 50 kDa NUPSO -1.39414 S.43O435 nucleoporin 54 kDa NUP54 -159421 S.S11093 nucleolar and spindle associated protein 1 NUSAP1 -2.3605 S.S11093 nucleolar and spindle associated protein 1 NUSAP1 -2.33333 S.25O10 nuclear transport factor 2-like export NXT2 -2.04794 factor 2 nuclear transport factor 2-like export NXT2 -1.87275 factor 2 S.404088 sarcoma antigen NY-SAR-48 NY-SAR-48 -1.26639 S.467634 O-acyltransferase (membrane bound) OACT2 -1.4826 domain containing 2 S.549512 Opa interacting protein 5 OIP5 -3.00223 S.357004 olfactomedin-like 2A OLFML2A 49582 S.4787.08 optic atrophy 1 (autosomal dominant) OPA1 -1.17613 S.4787.08 optic atrophy 1 (autosomal dominant) OPA1 -1.10312 S.409081 opsin 3 (encephalopsin, panopsin) OPN3 -1.32804 S.S22087 opioid receptor, Sigma 1 OPRS1 - 190353 S.S22087 opioid receptor, Sigma 1 OPRS1 -162272 S.17908 origin recognition complex, Subunit 1 ORC1L, -1.60903 like (yeast) S.49760 origin recognition complex, Subunit 6 ORC6L -238.188 homolog-like (yeast) S.SO2688 oxysterol binding protein OSBP -110455 S.S2O259 oxysterol binding protein-like 3 OSBPL3 -1.52275 S.S2O259 oxysterol binding protein-like 3 OSBPL3 -1.14884 S.270851 OTU domain containing 4 OTUD4 -1.59582 S.30532 OTU domain containing 6B OTUD6B -2.29222 S.524331 ovostatin 2 OWOS2 -168574 S.148778 oxidation resistance 1 OXR1 3573 S.148778 oxidation resistance 1 OXR1 41333 S.475970 oxidative-stress responsive 1 OXSR1 -14717 S.321709 purinergic receptor P2X, ligand-gated P2RX4 345O2 ion channel, 4 S.SOOO47 procollagen-proline, 2-oxoglutarate 4 P4HA1 -2.25798 dioxygenase (proline 4-hydroxylase), alpha S.118964 GATA zinc finger domain containing p66alpha -118512 2A S.S25626 phosphofurin acidic cluster sorting PACS2 141153 protein 2 S.S25626 phosphofurin acidic cluster sorting PACS2 199778 protein 2 US 2009/O 1921 11 A1 Jul. 30, 2009 69
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.435714 p21/Cdc42, Rac1-activated kinase 1 PAK1 1.782S4 (STE20 homolog, yeast) S.31 O231 PAK1 interacting protein 1 PAK1IP1 149793 S.465933 pantothenate kinase 1 PANK1 1.5753 S.253726 poly(A) polymerase alpha PAPOLA 149923 S.5.24491 3'-phosphoadenosine 5'-phosphosulfate PAPSS2 4.30952 synthase 2 S.5.24491 3'-phosphoadenosine 5'-phosphosulfate PAPSS2 2.91296 synthase 2 S.147229 progestin and adipoCR receptor family PAQR5 38694 member V S.39.1828 par-6 partitioning defective 6 homolog PARD6B 3.1316 beta (C. elegans) S.SO4538 poly (ADP-ribose) polymerase family, PARP11 27914 member 11 S.4O9412 poly (ADP-ribose) polymerase family, PARP2 66216 member 2 S.4O9412 poly (ADP-ribose) polymerase family, PARP2 28179 member 2 S.4O9412 poly (ADP-ribose) polymerase family, PARP2 26004 member 2 S.436319 parvin, alpha PARVA 20289 S. 104741 PDZ binding kinase PBK 3.13144 S.493.096 Pre-B-cell leukemia transcription factor 1 PBX 47769 S.S33OSS p300, CBP-associated factor PCA S.1993.43 protocadherin alpha 9 i? protocadherin PC A9 alpha Subfamily C, 2 / protocadherin a PC AC2 PC AC1 if PC HA13 if PC HA12 PC HA11 if PC HA10 HS.1993.43 protocadherin alpha 9 fit protocadherin PC HA9 142632 alpha Subfamily C, 2 protocadherin a PC HAC2 PC HAC1 if PC A13 PC A12 PC HA11 if PC A. Of S.SOOS12 polycomb group ring finger 5 PCG 5 .49539 S.SOOS12 polycomb group ring finger 5 PCG 5 46584 S.SOOS12 polycomb group ring finger 5 PCG 5 .38566 S.3O848O protein-L-isoaspartate (D-aspartate) O PCMTD O8009 methyltransferase domain containing 1 S.3O848O protein-L-isoaspartate (D-aspartate) O PCMTD methyltransferase domain containing 1 S.362817 pericentrin 1 PCNT1 S.3706OS pecanex-like 2 (Drosophila) PCNXL2 S.3706OS pecanex-like 2 (Drosophila) PCNXL2 S.3706OS Pecanex-like 2 (Drosophila) PCNXL2 S.8944 procollagen C-endopeptidase enhancer 2 PCOLCE2 S.522640 proprotein convertase subtilisinkexin PCSK1N type 1 inhibitor S.368542 proprotein convertase subtilisinkexin PCSKS type 5 S.368542 proprotein convertase subtilisinkexin PCSKS type 5 S.368542 Proprotein convertase subtilisin?kexin PCSKS type 5 S.4781SO programmed cell death 10 PDCD10 S.352298 platelet derived growth factor D PDGFD S.458573 platelet-derived growth factor receptor PDGFRL ike PDLIM1 interacting kinase 1 like PDIK1L pyruvate dehydrogenase kinase, PDK1 isoenzyme 1 S.8364 pyruvate dehydrogenase kinase, PDK4 isoenzyme 4 S.480311 PDZ and LIM domain 5 PDLIMS US 2009/O 1921 11 A1 Jul. 30, 2009 70
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.480311 PDZ and LIM domain 5 PDZ and PDLIMS 43.123 LIM domain 5 S.480311 PDZ and LIM domain 5 DLIMS .23481 S.480311 PDZ and LIM domain 5 DLIMS O9421 S.480311 PDZ and LIM domain 5 DLIMS OO615 S.533040 PDZ and LIM domain 7 (enigma) DLIM7 55311 S.533040 PDZ and LIM domain 7 (enigma) 36693 S.444751 PDZ domain containing 1 O6O13 S.391481 PDZ domain containing 6 S2836 S.S17216 phosphoprotein enriched in astrocytes 15 6779 S.S17216 phosphoprotein enriched in astrocytes 15 17028 S. 7886 pellino homolog 1 (Drosophila) S3945 S. 105103 pellino homolog 2 (Drosophila) 52135 S.523816 pellino homolog 3 (Drosophila) 23966 S. 164682 peroxisome biogenesis factor 1 24024 S.SOf 680 phosphonoformate immuno-associated 29441 protein 5 6-phosphofructo-2-kinasef fructose-2,6- 44929 biphosphatase 2 S.43318O DNA replication complex GINS protein PSF2 S.229988 GPI deacylase PGAP1 44515 S.1561.78 plasma glutamate carboxypeptidase PGCP 23O44 S.23363 phosphoglucomutase 2 PGM2 .32892 S.23363 phosphoglucomutase 2 PGM2 77539 S.23363 phosphoglucomutase 2 PGM2 .3856 S.26612 phosphoglucomutase 2-like 1 PGM2L1 25726 S.SS3496 phosphoglucomutase 3 PGM3 O5073 S.1267O6 1-aminocyclopropane-1-carboxylate PHACS SO676 synthase S.514303 prohibitin OOO59 S.23862 hytoceramidase, alkaline .70O81 S.23862 hytoceramidase, alkaline 471 OS S.23862 hytoceramidase, alkaline 3924 S.435933 HD finger protein 10 55.222 S.1599.18 HD finger protein 14 2242 S.371977 HD finger protein 16 1 6 42662 S.46O124 HD finger protein 19 565.15 S.46O124 HD finger protein 19 32722 S.3O4362 HD finger protein 20-like 1 3OS42 S.S.02458 HD finger protein 21A 25549 S.356SO1 HD finger protein 6 4.4838 S.154036 pleckstrin homology-like domain, family .7486 A member 2 S.477114 pleckstrin homology-like domain, family 38182 B, member 2 S.SS8732 pleckstrin homology-like domain, family .331.69 B , member 3 S.499.704 hytanoyl-CoA hydroxylase interacting S9009 protein-like S.443733 phosphatidylinositol 4-kinase type 2 beta 62981 S.514846 protein inhibitor of activated STAT, 2 67722 S.514846 Protein inhibitor of activated STAT, 2 76893 S.1371.54 phosphatidylinositol glycan, class A 64119 (paroxysmal nocturnal hemoglobinuria) S.175343 phosphoinositide-3-kinase, class 2, alpha 77584 polypeptide S.175343 Phosphoinositide-3-kinase, class 2, alpha 30933
S.175343 Phosphoinositide-3-kinase, class 2, alpha O7223
S.SS3498 phosphoinositide-3-kinase, catalytic, 33909 alpha polypeptide S. 132225 phosphoinositide-3-kinase, regulatory 13739 subunit 1 (p85 alpha) S.371344 phosphoinositide-3-kinase, regulatory O6086 subunit 2 (p85 beta) S.170510 phosphoinositide-3-kinase, regulatory 48927 Subunit 3 (p55, gamma) US 2009/O 1921 11 A1 Jul. 30, 2009 71
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.149032 phosphoinositide-3-kinase, regulatory C -1.13893 subunit 4, p150 HSSS6S78 phosphatidylinositol 4-kinase, catalytic, 21523 alpha polypeptide HS.S29438 phosphatidylinositol 4-kinase, catalytic, C 17674 alpha polypeptide LOC22O686 HS260603 Phosphatidylinositol-4-phosphate 5 14329 kinase, type II, beta HS.41352S polycystic kidney disease 1-like 2 15593 HS.181272 polycystic kidney disease 2 (autosomal C 35233 dominant) HS.40758O plakophilin 4 KP4 HS.437451 phospholipase A1 member A LA1A HS.154104 pleiomorphic adenoma gene-like 2 LAGL2 HS.431173 phospholipase C, beta 1 LCB1 (phosphoinositide-specific) HS2O2010 phospholipase C-like 2 LCL2 HS2O2010 phospholipase C-like 2 LCL2 HS.128.933 phospholipase C-like 3 LCL3 HS.292419 Phosphatidylinositol-specific LCXD2 phospholipase C, X domain containing 2 HS.478230 phospholipase D1, phophatidylcholine LD1 specific HS.478230 phospholipase D1, phophatidylcholine LD1 specific HS.498.252 phospholipase D family, member 5 LDS 95598 HS.7037 pallidin homolog (mouse) LDN -1.80514 HS.7037 pallidin homolog (mouse) LDN -1.18319 HS.445489 pleckstrin homology domain containing, LEKHB1 O1316 amily B (evectins) member 1 HS.509343 pleckstrin homology domain containing, LEKHC1 -2.61276 amily C (with FERM domain) member 1 HS.509343 pleckstrin homology domain containing, LEKHC1 -2.25718 amily C (with FERM domain) member 1 HS.509343 pleckstrin homology domain containing, LEKHC1 -1.88276 amily C (with FERM domain) member 1 HS.189781 pleckstrin homology domain containing, LEKHG1 1.05708 amily G (with RhoGef domain) member 1 HS.164.162 pleckstrin homology domain containing, LEKHH2 2.4O781 amily H (with MyTH4 domain) member 2 HS.514242 pleckstrin homology domain containing, LEKHM1 1.3O239 amily M (with RUN domain) member 1 HS.329989 polo-like kinase 1 (Drosophila) -2O7924 HS.172052 polo-like kinase 4 (Drosophila) -232191 HS.172052 polo-like kinase 4 (Drosophila) -2.27272 HS.172052 polo-like kinase 4 (Drosophila) i? polo -192856 ike kinase 4 (Drosophila) HS.477866 procollagen-lysine, 2-oxoglutarate 5 LOD2 -2.13748 dioxygenase 2 HS.477866 procollagen-lysine, 2-oxoglutarate 5 LOD2 -2.11609 dioxygenase 2 HS.77422 proteolipid protein 2 (colonic LP2 -1.22623 epithelium-enriched) HS.477869 phospholipid scramblase 4 C LSCR4 -28O174 HS.476,209 plexin B1 C 162737 HS.2182 pro-melanin-concentrating hormone PMCH -1.86413 HS.372O31 peripheral myelin protein 22 PMP22 -2.63762 HSSS8367 postmeiotic segregation increased 2-like 5 PMS2L5 1.26411 HS.264 patatin-like phospholipase domain PNPLA4 1.06474 containing 4 HS.16426 podocalyxin-like PODXL -1.32O73 HS.421608 polymerase (DNA directed), alpha POLA -1.32853 HS2O1897 polymerase (DNA directed), alpha 2 POLA2 -1.8OOO2 (70 kD subunit) HS.279413 polymerase (DNA directed), delta 1, POLD1 -1.03211 catalytic subunit 125 kDa HS.162777 polymerase (DNA directed), epsilon 2 POLE2 -2.7769 (p59 subunit) US 2009/O 1921 11 A1 Jul. 30, 2009 72
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.108112 polymerase (DNA directed), epsilon 3 POLE3 (p17 subunit) HS.135756 polymerase (DNA directed) kappa POLK HS.241517 polymerase (DNA directed), theta POLQ 61821 HS.46O298 polymerase (RNA) III (DNA directed) POLR3E 55522 polypeptide E (80 kD) HS28.2387 Polymerase (RNA) III (DNA directed) POLR3G 46957 polypeptide G (32 kD) HS.S3OO77 paraOXonase 2 PON2 13258 HS.33142O phosphoribosyl pyrophosphate PAT 93.237 amidotransferase HS.33142O phosphoribosyl pyrophosphate 71664 amidotransferase HS.530749 protein tyrosine phosphatase, receptor 12S63 type, fpolypeptide (PTPRF), interacting HS.S17076 protective protein for beta-galactosidase 11581 (galactosialidosis) HS-381072 peptidylprolyl isomerase F (cyclophilin OS479 F) HS-381072 peptidylprolyl isomerase F (cyclophilin 80713 F) HS.2S6639 peptidyl prolyl isomerase H (cyclophilin H) HS.451090 peptidylprolyl isomerase (cyclophilin)- 93631 ike 5 Hs.192233 periplakin C .74529 HS286O73 protein phosphatase 1D magnesium 31417 dependent, delta isoform HS.444403 protein phosphatase 1, regulatory 36524 (inhibitor) subunit 12B HS.S21937 protein phosphatase 1, regulatory 49094 (inhibitor) subunit 16A HS.S1815S protein phosphatase 2 (formerly 2A), O4353 regulatory subunit B", alpha HS.334.868 protein phosphatase 2, regulatory PP2RSE 31338 subunit B (B56), epsilon isoform HS.495128 Protein phosphatase 6, catalytic Subunit CC) 6C 374OS HS.3664O1 protein regulator of cytokinesis 1 RC1 61069 HSS233O2 peroxiredoxin 3 RDX3 S8887 HS.148105 prickle-like 2 (Drosophila) RICKLE2 18704 HSS34339 primase, polypeptide 1,49 kDa RIM1 .46383 HS.485640 primase, polypeptide 2A, 58 kDa RIM2A SO349 HS.485640 primase, polypeptide 2A, 58 kDa RIM2A 385.18 HS.485640 primase, polypeptide 2A, 58 kDa RIM2A 33074 HS.433068 protein kinase, cAMP-dependent, RKAR2B 35769 regulatory, type II, beta HS.S31704 protein kinase C, alpha C RKCA 2181 HS.221497 PROO149 protein ROO149 O3492 HS.304792 proline synthetase co-transcribed ROSC 37988 homolog (bacterial) HS.304792 proline synthetase co-transcribed ROSC 92295 homolog (bacterial) HS.304792 proline synthetase co-transcribed ROSC 65093 homolog (bacterial) HS.374973 PRP4 pre-mRNA processing factor 4 69717 homolog (yeast) HS.374973 PRP4 pre-mRNA processing factor 4 6O194 homolog (yeast) HS.77498 phosphoribosyl pyrophosphate RPSAP1 18715 synthetase-associated protein 1 HS.534492 proline rich 7 (synaptic) C 16679 HS.435699 protease, serine, 3 (mesotrypsin) C RSS3 19249 HS.191215 pleckstrin homology, Sect and coiled PSCD1 169 coil domains 1(cytohesin 1) HS.36OO33 DNA replication complex GINS protein PSF1 788.98 PSF1 HS.19372S proteasome (prosome, macropain) 26S PSMD5 61581 subunit, non-ATPase, 5 HS.4138O1 proteasome (prosome, macropain) PSME4 -2.OO632 activator subunit 4 US 2009/O 1921 11 A1 Jul. 30, 2009 73
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.4138O1 proteasome (prosome, macropain) PSME4 1.61373 activator subunit 4 HS.471917 proteasome (prosome, macropain) PSMF1 -1.21949 inhibitor subunit 1 (PI31) HS.172SSO polypyrimidine tract binding protein 1 -2.78.375 HS.172SSO polypyrimidine tract binding protein 1 -2.65.173 HS.172SSO polypyrimidine tract binding protein 1 -2.63976 HS.172SSO polypyrimidine tract binding protein 1 -2.63633 HS.172SSO polypyrimidine tract binding protein 1 -2.61287 HS.172SSO polypyrimidine tract binding protein 1 -2.48951 HS.26989S polypyrimidine tract binding protein 2 HS.26989S polypyrimidine tract binding protein 2 HS.494.538 patched homolog (Drosophila) HS.491322 PTK2B protein tyrosine kinase 2 beta Hs.227777 protein tyrosine phosphatase type IVA, member 1 Hs.227777 protein tyrosine phosphatase type IVA, member 1 Hs.227777 protein tyrosine phosphatase type IVA, -1.59097 member 1 Hs.227777 protein tyrosine phosphatase type IVA, -1.35933 member 1 Hs.227777 Protein tyrosine phosphatase type IVA, 98833 member 1 HS.470477 protein tyrosine phosphatase type IVA, -1.26364 member 2 HS.470477 protein tyrosine phosphatase type IVA, -1.25613 member 2 HS. 61812 protein tyrosine phosphatase, non TPN12 -2.50939 receptor type 12 HS.63489 protein tyrosine phosphatase, non 87317 receptor type 6 HSSS8433 pituitary tumor-transforming 1 -2.20164 HS.474O1O pituitary tumor-transforming 1 -1.55298 interacting protein HS.S21097 pituitary tumor-transforming 3 C TTG3 -158106 HSSO6652 PWP1 homolog (S. cerevisiae) P1 -109208 HS-332197 peroxidasin homolog (Drosophila) C DN .14244 HS-332197 peroxidasin homolog (Drosophila) DN 2.9412 HS.75438 quinoid dihydropteridine reductase PR -14076 HS.51O324 quaking homolog, KH domain RNA 8 : -1.11137 binding (mouse) HS.513484 quinolinate phosphoribosyltransferase PRT 1253 HS.191179 RAB11 family interacting protein 1 B11 FIP1 -1.32558 (class I) HS.406788 RAB11 family interacting protein 4 B11 FIP4 39055 (class II) HS-512492 RAB15, member RAS onocogene family B15 56277 HS-512492 RAB15, member RAS onocogene family B15 62729 HS.369.017 RAB2, member RAS oncogene family B2 -1.03651 HS.369.017 RAB2, member RAS oncogene family B2 -101.457 HS.S24590 RAB21, member RAS oncogene family B21 -1586.36 HS.S24590 RAB21, member RAS oncogene family B21 -1.44147 HS.S24590 RAB21, member RAS oncogene family B21 -113511 HS.3797 RAB26, member RAS oncogene family B26 98.21 HS.3797 RAB26, member RAS oncogene family B26 2.55672 HS.298651 RAB27A, member RAS oncogene B27A -1.6O256 amily HS.301853 RAB34, member RAS oncogene family -2.03641 HS.301853 RAB34, member RAS oncogene family -196036 HS.24970 RAB39B, member RAS oncogene 2.42681 amily HS.24970 RAB39B, member RAS oncogene 2.93719 amily HS.2S367 RAB4B, member RAS oncogene family 141231 HS.2S367 RAB4B, member RAS oncogene family 1.55.256 HS.2S367 RAB4B, member RAS oncogene family 1.57251 HSSO3222 RAB6A, member RAS oncogene family -191365 HSSO3222 RAB6A, member RAS oncogene family -142256 US 2009/O 1921 11 A1 Jul. 30, 2009 74
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.554921 RAB6A, member RAS oncogene family -19879 // RAB6C, member RAS oncogene amily RAB8A, member RAS oncogene family -1.41121 S.389733 RAB8E3, member RAS oncogene family -14505 S.SS1518 rabaptin, RAB GTPase binding effector 11893 protein 1 S.555978 rabaptin, RAB GTPase binding effector BEP2 O9S46 protein 2 S.446425 RAB, member of RAS oncogene family 16822 ike 2B III RAB, member of RAS oncogene family-like 2A S.446425 RAB, member of RAS oncogene family 72341 ike 2B III RAB, member of RAS oncogene family-like 2A S.444360 RAB, member of RAS oncogene family -1.81614 ike 3 S.SS8376 ras-related C3 botulinum toxin substrate RAC -1.28282 (rho family, Small GTP binding protei S.SS8376 ras-related C3 botulinum toxin substrate 1 C -1.1215 S.S.05469 Rac GTPase activating protein 1 CGAP1 -2.9SO39 S.375684 D18 homolog (S. cerevisiae) D18 -167716 S.81848 D21 homolog (S. pombe) D21 -122098 S.446554 . D51 homolog (RecA homolog, E. coli) D51 -2.27717 (S. cerevisiae) S.SO4SSO D51 associated protein 1 -3.SS496 S.30561 D54 homolog B (S. cerevisiae) -1.08081 S.292154 recombination activating gene 1 -1.13271 activating protein 1 S.431400 retinoic acid induced 14 14 -2.11871 S. 6906 v-ral simian leukemia viral oncogene LA -1.57377 homolog A (ras related) S. 106.185 ral guanine nucleotide dissociation GDS .33841 stimulator S. 106.185 ral guanine nucleotide dissociation 86441 stimulator S.432842 Ral GEF with PH domain and SH3 16611 binding motif 1 S.24763 RAN binding protein 1 -1.53333 S.1838OO Ran GTPase activating protein 1 -1.70082 S.1838OO Ran GTPase activating protein 1 -158115 S.36992O RAP1B, member of RAS oncogene -2.23787 amily RAP1, GTPase activating protein 1 RAP1GA1 27.096 RAP2A, member of RAS oncogene RAP2A -191799 amily S.119889 RAP2C, member of RAS oncogene RAP2C -158749 amily S.119889 RAP2C, member of RAS oncogene RAP2C -147988 amily S.119889 RAP2C, member of RAS oncogene RAP2C -1.41492 amily S.113912 Rap guanine nucleotide exchange factor RAPGEF2 -1.46202 (GEF)2 S.558443 RAS p21 protein activator 4 if RASA4 S824 hypothetical protein FLJ21767 FLJ21767 S.558443 RAS p21 protein activator 4 if RASA4 3.61211 hypothetical protein FLJ21767 FLJ21767 S.1291.36 RAS and EF-hand domain containing RASEF -2.3736 S.125293 RasGEF domain family, member 1A RASGEF1A 200713 S.379970 Ras association (RalGDS/AF-6) domain RASSF2 1943.18 amily 2 S.346527 Ras association (RalGDS/AF-6) domain RASSF3 -1161.86 amily 3 S.S29677 Ras association (RalGDS/AF-6) domain RASSF6 1.62967 amily 6 S.26994.1 Ras association (RalGDS/AF-6) domain RASSF8 -132982 amily 8 S.408528 retinoblastoma 1 (including -1.20143 Osteosarcoma) US 2009/O 1921 11 A1 Jul. 30, 2009 75
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.188SS3 retinoblastoma binding protein 6 BBP6 1.11464 HS.434993 Ras-associated protein Rap1 BJ 1.18327 HS2O7745 retinoblastoma-like 1 (p107) BL1 -2.OO961 HS.11170 RNA binding motif protein 14 BM14 -1.53215 HS.11663.O RNA binding motif protein 20 BM2O 1.14796 HS.470412 RNA binding motif, single stranded BMS1 -199679 interacting protein HS.470412 RNA binding motif, single stranded BMS1 -1.597O2 interacting protein HS.470412 RNA binding motif, single stranded RBMS1 -151043 interacting protein HS.470412 RNA binding motif, single stranded RBMS1 -147133 interacting protein HS.263671 radixin 1.39089 HS.263671 radixin 180454 HS.23S069 RecQ protein-like (DNA helicase Q1 -2.28531 ike) HS.23S069 RecQ protein-like (DNA helicase Q1 -2.07482 ike) HS.23S069 RecQ protein-like (DNA helicase Q1 -2.03886 ike) HS.23S069 RecQ protein-like (DNA helicase Q1 -1.87239 ike) HS.463O41 arginine-glutamic acid dipeptide (RE) 1.30624 repeats HS.4404O1 all-trans-13, 14-dihydroretinol saturase 1.0215S HS.4404O1 all-trans-13, 14-dihydroretinol saturase 1.25994 HS.232021 REV3-like, catalytic subunit of DNA 137671 polymerase Zeta (yeast) HS. 139226 replication factor C (activator 1) 2, -1486.32 40kDa HS. 139226 replication factor C (activator 1) 2, -14243 40kDa HS.115474 replication factor C (activator 1) 3, -2.31176 38 kDa HS.115474 replication factor C (activator 1) 3, -201625 38 kDa HS.S.1847S replication factor C (activator 1) 4, -1998.43 37 kDa HSSO6989 replication factor C (activator 1) 5, -293661 36.5 kDa HSSO6989 replication factor C (activator 1) 5, -2.69851 36.5 kDa HS.1368O ring finger and FYVE-like domain -1.73O88 containing HS.444899 RFT1 homolog (S. cerevisiae) RFT1 -135848 HS. 77510 ring finger and WD repeat domain 3 RFWD3 -1.7061 HSSO9622 ral guanine nucleotide dissociation RGL2 301.31 stimulator-like 2 HSSO1728 ras homolog gene family, member G HOG -1.27666 (rho G) HSSS245S RAP1 interacting factor homolog (yeast) F1 -1.08.23 HSSS245S RAP1 interacting factor homolog (yeast) F1 -1.OOS23 regulated in glioma O933S HS.434924 regulating synaptic membrane MS3 2.1506S exocytosis 3 HS.491234 Ras-like without CAAX1 46481 HS.491234 Ras-like without CAAX1 53593 HS.491234 Ras-like without CAAX1 57.192 HS.491234 Ras-like without CAAX1 .70037 HS.491234 Ras-like without CAAX1 2.221 67 HS.127032 relaxin 2 LN2 S8052 HS.S32851 ribonuclease H2, large subunit RNASEH2A -1.7O633 HS.S18545 ribonuclease L. (2',5'-oligoisoadenylate RNASEL 12248 synthetase-dependent) HS.4691.99 ring finger protein 103 RNF103 35088 HS.44685 ring finger protein 141 RNF141 -135539 HS.1782O Rho-associated, coiled-coil containing ROCK1 -122899 protein kinase 1 US 2009/O 1921 11 A1 Jul. 30, 2009 76
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.306307 Rho-associated, coiled-coil containing ROCK1 protein kinase 1 HS.269988 ROD1 regulator of differentiation 1 (S. pombe) ROD1 18649 HS.469264 ribose 5-phosphate isomerase A (ribose RPLA .78744 5-phosphate epimerase) HSSS8384 ribosomal protein L19 ribosomal RPL19 protein L19 HS.380933 ribosomal protein L22-like 1 HS.356371 ribosomal protein L28 HS.478582 ribosomal protein L39-like HS.518244 ribophorin I HS.408073 Ribosomal protein S6 HS.148767 RCD1 required for cell differentiation1 homolog (S. pombe) HS.532461 Ras-related GTP binding C RAGC HS.S15536 related RAS viral (r-ras) oncogene RAS homolog HS.5O2004 related RAS viral (r-ras) oncogene RRAS2 3.41426 homolog 2 HS.5O2004 related RAS viral (r-ras) oncogene RRAS2 2.95.738 homolog 2 HS.472213 Ribosome binding protein 1 homolog RRBP1 .64308 80 kDa (dog) HS.472213 ribosome binding protein 1 homolog RRBP1 573.18 80 kDa (dog) HS.472213 ribosome binding protein 1 homolog RRBP1 49967 80 kDa (dog) HSSS8393 ribonucleotide reductase M1 polypeptide RM1 73693 HSSS8393 ribonucleotide reductase M1 polypeptide RM1 57029 HS.226390 ribonucleotide reductase M2 polypeptide RM2 3.67646 HS.226390 ribonucleotide reductase M2 polypeptide RM2 3.3362 HS.S24.809 restin (Reed-Steinberg cell-expressed RSN 23138 intermediate filament-associated protein) HS.S24.809 restin (Reed-Steinberg cell-expressed RSN O7857 intermediate filament-associated protein) HS.S26920 rhabdoid tumor deletion region gene 1 RTDR1 66682 HS.S11096 Rtf1, Paf1/RNA polymerase II complex RTF1 4O165 component, homolog (S. cerevisiae) HS.47517 reticulon 2 661.99 HS.47517 reticulon 2 717-7 HS.133337 RWD domain containing 4A 2.37591 HS.54649 putative nucleic acid binding protein 79623 RY-1 HS.54649 putative nucleic acid binding protein RY1 RY-1 HS.65641 sterile alpha motif domain containing 9 SAMD9 2507 HS.41383S sin3-associated polypeptide, 30 kDa SAP30 S3811 HS.4.99960 SAR1 gene homolog A (S. cerevisiae) SAR1A 19671 HS.486292 Squamous cell carcinoma antigen SART2 55722 recognized by T cells 2 HSSO6663 Squamous cell carcinoma antigen SART3 .73216 recognised by T cells 3 HS145497 spindle assembly 6 homolog (C. elegans) SASS6 14581 HS.28491 spermidine?spermine N1 SAT 16964 acetyltransferase HS.10846 spermidine?spermine N1 SAT2 62909 acetyltransferase 2 HS.110445 Shwachman-Bodian-Diamond syndrome SBDS O8895 HS.110445 Shwachman-Bodian-Diamond syndrome SBDS SBDSP 20921 ... Shwachman-Bodian-Diamond syndrome pseudoge HS.438794 SET binding factor 2 SBF2 O9612 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 45542 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 78.245 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 2.06156 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 2.48393 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 2.54707 HS.482S87 Secretory carrier membrane protein 1 SCAMP1 3.02SO3 HSSS8396 stearoyl-CoA desaturase (delta-9- SCD 146391 desaturase) US 2009/O 1921 11 A1 Jul. 30, 2009 77
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.SS8396 stearoyl-CoA desaturase (delta-9- SCD .37392 desaturase) S.379191 stearoyl-CoA desaturase 5 SCD5 21783 S.492938 Sciellin SCEL 42SO2 S.93485 Sodium channel, voltage-gated, type II, SCN2A2 SS241 alpha 2 S.435274 Sodium channel, voltage-gated, type III, alpha S.130989 Sodium channel, nonvoltage-gated 1 SCNN1A alpha S.480815 short coiled-coil protein SCOC S.476365 Sterol carrier protein 2 SCP2 S.27 O107 SDA1 domain containing 1 S DAD1 S.2O0804 Syndecan binding protein (Syntenin) S DCBP S.356270 Succinate dehydrogenase complex, S DHD Subunit D, integral membrane protein S.435719 sidekick homolog 2 (chicken) S.12O790 CTCL tumor antigen se57-1 S. 166924 SEC13-like 1 (S. cerevisiae) S.211612 SEC24 related gene family, member A (S. cerevisiae) S.59804 SECIS binding protein 2 S.301048 SEH1-like (S. cerevisiae) S.301048 SEH1-like (S. cerevisiae) S.S28721 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphor S.SSOS26 Sema domain, immunoglobulin domain EMA4G 66918 (Ig), transmembrane domain (TM) and short cyt S.371957 SUMO1/sentrin specific peptidase 1 21968 s. 275775 Selenoprotein P. plasma, 1 s C C 1 3.35585 S.518326 stress-associated endoplasmic reticulum 2.SSO68 protein 1 S.518326 stress-associated endoplasmic reticulum E R C 2.291.99 protein 1 S.518326 stress-associated endoplasmic reticulum E R C 1.SS424 protein 1 S.525557 Serpin peptidase inhibitor, clade A E R PINA1 193719 (alpha-1 antiproteinase, antitrypsin), membe S.525557 Serpin peptidase inhibitor, clade A E R PINA1 2.69097 (alpha-1 antiproteinase, antitrypsin), membe S.104879 serpin peptidase inhibitor, clade B E R PINB9 2.06905 (ovalbumin), member 9 S.104879 serpin peptidase inhibitor, clade B S E RPINB9 83307 (ovalbumin), member 9 S.478153 Serpin peptidase inhibitor, clade I S E RPINI1 54454 (neuroserpin), member 1 S.548672 sestrin 1 ESN 993S1 S.469S43 sestrin 2 ESN2 31211 S.12O633 Sestrin 3 ESN3 OO409 S.480792 SET domain-containing protein 7 ETT O9659 S.44373S PRSET domain containing protein 8 ET8 61495 S.47 1011 splicing factor 3b, subunit 1, 155 kDa F3B1 24O28 S.47 1011 splicing factor 3b, subunit 1, 155 kDa F3B1 1432 S. 68714 Splicing factor, arginine serine-rich 1 FRS1 17971 (splicing factor 2, alternate splicing f S.S33122 splicing factor, arginine?serine-rich 10 FRS10 38503 (transformer 2 homolog, Drosophila) S.479693 splicing factor, arginine?serine-rich 11 S FRS11 OO768 S. 6891 splicing factor, arginine?serine-rich 6 S FRS6 SOO6 S.44269 shugoshin-like 2 (S. pombe) SGOL2 2.66873 S.44269 shugoshin-like 2 (S. pombe) SGOL2 2.568.64 S.499984 sphingosine-1-phosphate lyase 1 SGPL1 67514 S.499984 sphingosine-1-phosphate lyase 1 SGPL1 3.8589 S.1593.68 SH3 multiple domains 1 SH3MD1 72135 S.3O1804 SH3 multiple domains 2 SH3MD2 13498 US 2009/O 1921 11 A1 Jul. 30, 2009 78
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HSS56866 SH3 domain containing, Ysc84-like 1 S 1.48937 (S. cerevisiae) HS.123253 SHC SH2-domain binding protein 1 S -350024 HS.7SO69 serine hydroxymethyltransferase 2 -138347 (mitochondrial) HS.7SO69 serine hydroxymethyltransferase 2 HMT2 -116072 (mitochondrial) HS.410977 SID1 transmembrane family, member 2 DT2 1.38653 HSS251.98 TAL 1 (SCL) interrupting locus L -238936 HS.1461.86 single-minded homolog 2 (Drosophila) M2 160666 HS.268774 signal-induced proliferation-associated 1 PA1L2 1.15833 like 2 HS.112058 CD27-binding (Siva) protein VA -1.2054 HS.112058 CD27-binding (Siva) protein s VA -106964 HS.23348 S-phase kinase-associated protein 2 KP2 -3.35993 (p45) HS.23348 S-phase kinase-associated protein 2 KP2 -32O865 (p45) HS.23348 S-phase kinase-associated protein 2 KP2 -2.6835S (p45) HS.298.345 stem-loop (histone) binding protein -2.63949 HSSOSS45 Solute carrier family 11 (proton-coupled 1.70586 divalent metalion transporters), membe HSSOSS45 Solute carrier family 11 (proton-coupled 19944 divalent metalion transporters), membe HS.75231 Solute carrier family 16 (monocarboxylic -233265 acid transporters), member 1 HS.75231 Solute carrier family 16 (monocarboxylic -2.31664 acid transporters), member 1 HS.75231 Solute carrier family 16 (monocarboxylic -2.08744 acid transporters), member 1 HS.75231 Solute carrier family 16 (monocarboxylic -1.72763 acid transporters), member 1 HSSO4317 Solute carrier family 16 (monocarboxylic LC16A14 97925 acid transporters), member 14 HS.7S317 Solute carrier family 16 (monocarboxylic 11369 acid transporters), member 2 HS.485,760 Solute carrier family 17 (anion sugar LC17AS -1.394.41 transporter), member 5 HS.30246 solute carrier family 19 (thiamine -16085 transporter), member 2 HS.125482 Solute carrier family 22 (organic cation LC22A15 10374 transporter), member 15 HS.143436 Solute carrier family 22 (extraneuronal 12722 monoamine transporter), member 3 HS.443572 Solute carrier family 22 (organic cation -1.54401 transporter), member 5 HS-310449 solute carrier family 23 (nucleobase .73231 transporters), member 1 HS.111024 solute carrier family 25 (mitochondrial -143875 carrier; citrate transporter), member 1 HS.4866 solute carrier family 26, member 11 HS.302.738 solute carrier family 26 (sulfate transporter), member 2 HS.302.738 solute carrier family 26 (sulfate transporter), member 2 HS.302.738 solute carrier family 26 (sulfate -1.61653 transporter), member 2 HS.419240 solute carrier family 2 (facilitated 10459 glucose transporter), member 3 HS.419240 solute carrier family 2 (facilitated 70527 glucose transporter), member 3 HS.419240 solute carrier family 2 (facilitated 90675 glucose transporter), member 3 HS.419240 solute carrier family 2 (facilitated glucose transporter), member 3 s HS.S42233 solute carrier family 30 (zinc transporter), member 6 HS.S42233 solute carrier family 30 (zinc transporter), member 6 US 2009/O 1921 11 A1 Jul. 30, 2009 79
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.S33903 solute carrier family 30 (zinc S 2746 transporter), member 7 S.S33903 Solute carrier family 30 (zinc S 24817 transporter), member 7 S.S32315 Solute carrier family 31 (copper 29064 transporters), member 1 S.S32315 Solute carrier family 31 (copper 41874 transporters), member 1 S.154O73 solute carrier family 35, member B1 19479 S.182885 solute carrier family 35, member B2 O296 S.158748 solute carrier family 35, member F3 66741 S.292509 solute carrier family 35, member F5 .13878 S.413434 solute carrier family 39 (zinc 46413 transporter), member 10 S.491232 solute carrier family 39 (zinc S 3285 transporter), member 14 S.432690 solute carrier family 39 (zinc S S2698 transporter), member 9 S.306448 solute carrier family 41, member 2 13911 S.306448 solute carrier family 41, member 2 O582 S.51822O solute carrier family 41, member 3 3 S.51822O solute carrier family 41, member 3 4211 S.4947OO solute carrier family 44, member 1 .91768 S.4947OO solute carrier family 44, member 1 63703 S.4947OO solute carrier family 44, member 1 3.0969 S.480188 solute carrier family 44, member 5 38426 S.1056O7 e carrier family 4, sodium 54.877 bicarbonate transporter-like, member 11 S.S60907 Solute carrier family 4, sodium 36366 bicarbonate cotransporter, member 5 S.370636 Solute carrier family 4, Sodium SS 17528 bicarbonate cotransporter, member 8 S.44424 solute carrier family 6, member 15 S 39234 S.14846 Solute carrier family 7 (cationic amino S2518 acid transporter, y+ system), member 1 S.SO4966 Solute carrier organic anion transporter 67878 family, member 1B3 S.521557 SLD5 homolog / SLD5 homolog S LDS 51953 S.SOO972 STE20-like kinase (yeast) S LK 80416 S.S17070 Secretory leukocyte peptidase inhibitor S LPI OOO64 S.1677OO SMAD, mothers against DPP homolog 5 SMADS 17949 (Drosophila) S.1677OO SMAD, mothers against DPP homolog 5 SMADS 11905 (Drosophila) S.546339 Small acidic protein SMAP 48376 S.546339 Small acidic protein if Small acidic SMAP 18439 protein S.476179 SWI/SNF related, matrix associated, SMARCC1 55548 actin dependent regulator of chromatin, Subf S.476179 SWI/SNF related, matrix associated, SMARCC1 S4247 actin dependent regulator of chromatin, Subf S.476179 SWI/SNF related, matrix associated, SMARCC1 26259 actin dependent regulator of chromatin, Subf S.119023 SMC2 structural maintenance of -2.3983S chromosomes 2-like 1 (yeast) S.119023 SMC2 structural maintenance of -2.21741 chromosomes 2-like 1 (yeast) S.S8992 SMC4 structural maintenance of -2.23418 chromosomes 4-like 1 (yeast) S.S8992 SMC4 structural maintenance of -1.88314 chromosomes 4-like 1 (yeast) S.8118 structural maintenance of chromosomes SMCHD1 -1.55959 flexible hinge domain containing 1 S.8118 structural maintenance of chromosomes SMCHD1 -1.28447 flexible hinge domain containing 1 S.8118 structural maintenance of chromosomes SMCHD1 -1246.75 flexible hinge domain containing 1 US 2009/O 1921 11 A1 Jul. 30, 2009 80
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) HS.331268 SMILE protein SMILE -149332 HS2O2179 survival of motor neuron 1, telomeric SMN1, , SMN2 -1.14845 Survival of motor neuron 2, centromeric HS.433337 spermine oxidase SMOX -1.28388 HS.433337 spermine oxidase SMOX -1.03309 HS.486.357 sphingomyelin phosphodiesterase, acid SMPDL3A -1.62965 like 3A HS.S212 single-strand selective monofunctional SMUG1 1.1219 uracil DNA glycosylase HS.S15O11 SMAD specific E3 ubiquitin protein SMURF2 1.60074 ligase 2 HS.S15O11 SMAD specific E3 ubiquitin protein SMURF2 1.71702 ligase 2 HS-1274O6 SET and MYND domain containing 3 SMYD3 -1.81401 HS.43275S Sorting nexin associated golgi protein 1 SNAG1 -13S123 HS.167317 synaptosomal-associated protein, 25 kDa SNAP2S 2.2641 HS.167317 synaptosomal-associated protein, 25 kDa SNAP2S 2.37493 HS.459952 Stannin SNN 2.44046 HS280378 Small nuclear ribonucleoprotein SNRPB2 -2.39942 polypeptide B" HS.464734 Small nuclear ribonucleoprotein D1 SNRPD1 -1.8753 polypeptide 16 kDa HS.192326 Sorting nexin family member 27 SNX27 .1421 HS-31 6890 Sorting nexin 5 SNX5 -1.14759 HS-31 6890 Sorting nexin 5 SNX5 -1.03699 HS.356647 Sorting nexin 6 SNX6 -2.19379 HS.356647 sorting nexin 6 SNX6 -2.05642 HS.496.383 Sterol O-acyltransferase (acyl SOAT1 19849 Coenzyme A: cholesterol acyltransferase) 1 HS.S17262 SON DNA binding protein SON -122097 HS.S17262 SON DNA binding protein SON -109787 HSSS845O Sorbin and SH3 domain containing 1 SORBS1 13729 HS.878 Sorbitol dehydrogenase SORD -148759 HS.4851.9S sortilin 1 SORT1 O1531 HS.518438 SRY (sex determining region Y)-box 2 SOX2 51679 HS.357901 SRY (sex determining region Y)-box 4 SOX4 25978 HS.357901 SRY (sex determining region Y)-box 4 SOX4 478.78 HS.2316 SRY (sex determining region Y)-box 9 SOX9 -1.897.41 (campomelic dysplasia, autosomal sex ewes HS.2316 SRY (sex determining region Y)-box 9 SOX9 -150674 (campomelic dysplasia, autosomal sex ewes HS.524461 Sp1 transcription factor SP1 -1.25481 HS.524461 Sp1 transcription factor SP1 -1.2495 HS.524461 Sp1 transcription factor SP1 -1.2019 HS.S14033 sperm associated antigen 5 SPAGS -2.08749 HS.S27090 spermatogenesis associated 18 homolog SPATA18 2.13251 (rat) HS.103147 spermatogenesis associated 20 SPATA2O .74O75 HS.408467 Spermatogenesis associated 6 SPATA6 O8874 HS.S25518 spermatogenesis associated 7 SPATA7 16118 HS.S25518 spermatogenesis associated 7 SPATA7 606O2 HS.381,225 spindle pole body component 24 SPBC24 -1.29212 homolog (S. cerevisiae) HS.421956 spindle pole body component 25 SPBC25 -3.85245 homolog (S. cerevisiae) HS.42194 signal peptidase complex subunit 3 SPCS3 -1.17448 homolog (S. cerevisiae) HS.431045 Spectrin domain with coiled-coils 1 SPECC1 41964 Hs.150O87 SPFH domain family, member 1 SPFH1 -1.7124 Hs.150O87 SPFH domain family, member 1 SPFH1 -122728 HS.440414 spastic paraplegia 20, Spartin (Troyer SPG20 -2.13037 syndrome) HS.241503 spastic paraplegia 3A (autosomal SPG3A O6782 ominant) HS.522672 spindlin family, member 3 SPIN3 7492S HS-62604 SPOC domain containing 1 SPOCD1 341SS HS.401,537 signal peptide peptidase-like 2A SPPL2A -1.25698 US 2009/O 1921 11 A1 Jul. 30, 2009 81
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.3O1540 Sepiapterin reductase (7.8- SPR .82932 dihydrobiopterin:NADP+ oxidoreductase) S.SO31.78 Spectrin, beta, non-erythrocytic 1 SPTBN1 2976 S.S29892 sequestosome 1 SQSTM1 42587 S.195659 v-src sarcoma (Schmidt-Ruppin A-2) SRC 32887 viral oncogene homolog (avian) S.489040 Sorcin SRI 34605 S.76244 spermidine synthase SRM 60483 S.23782S signal recognition particle 72 kDa SRP72 17216 S.15154 Sushi-repeat-containing protein, X SRPX 2.07806 linked S.288178 TROVE domain family, member 2 SSA2 .73O81 S.10273S single-stranded DNA binding protein 2 SSBP2 464 S.10273S single-stranded DNA binding protein 2 SSBP2 2.06512 S.196983 sperm specific antigen 2 SSFA2 13277 S.207459 ST6 beta-galactosamide alpha-2,6- ST6GAL1 .21227 sialyltranferase 1 S.98265 ST6 beta-galactosamide alpha-2,6- 84.133 sialyltranferase 2 ST8 alpha-N-acetyl-neuraminide alpha 38116 2,8-sialyltransferase 4 ST8 alpha-N-acetyl-neuraminide alpha 6526 2,8-sialyltransferase 4 S.188606 START domain containing 10 STARD10 O6176 S.47O943 signal transducer and activator of STAT1 11395 transcription 1.91 kDa S.80642 signal transducer and activator of STAT4 32949 transcription 4 S.25590 Stanniocalcin 1 STC1 96.514 S.25590 Stanniocalcin 1 STC1 29341 S.352341 stress 70 protein chaperone, microsome STCH 11468 associated, 60 kDa S.2O805 STEAP family member 3 STEAP3 60471 S.337295 stress-induced-phosphoprotein 1 STIP1 31807 (Hsp70, Hsp90-organizing protein) S.25O822 serine/threonine kinase 6 STK6 3.40582 S.25O822 serine/threonine kinase 6 STK6 2.83369 S.25O822 serine/threonine kinase 6 STK6 2.22636 S.348,326 stathmin-like 3 STMN3 1.61593 S.2S3903 stomatin STOM 152633 S.2S3903 stomatin STOM 1.0987 S.21958 storkhead box 2 STOX2 1.05666 S.S22578 steroid sulfatase (microsomal), STS 162674 arylsulfatase C, isozyme S S.43812 Syntaxin 10 STX10 1.05792 S.S238SS Syntaxin 12 STX12 1.O1497 S.130643 Syntaxin 17 STX17 1.77384 S.288229 Syntaxin binding protein 1 STXBP1 143683 S.SO8958 Syntaxin binding protein 6 (amisyn) STXBP6 2.67956 S.24979 serine/threoninetyrosine kinase 1 STYK1 1.07694 S.448070 SUB1 homolog (S. cerevisiae) f// SUB1 SUB1 1.22735 homolog (S. cerevisiae) pseudogene 1 SUB1P1 S.186512 Succinate-CoA ligase, GDP-forming, SUCLG2 3.47892 beta subunit S.186512 Succinate-CoA ligase, GDP-forming, SUCLG2 3.21.52 beta subunit S.186512 Succinate-CoA ligase, GDP-forming, SUCLG2 2.98.048 beta subunit S.281902 SGT1, Suppressor of G2 allele of SKP1 SUGT1 1.31 (S. cerevisiae) S.162O16 sulfatase 2 S ULF 2.66907 sulfatase 2 ULF2 2.73.783 S.436123 Sulfotransferase family, cytosolic, 1C, SULT1C1 2.01252 member 1 S.436123 Sulfotransferase family, cytosolic, 1C, SULT1C1 2.12614 member 1 S.213724 Suppressor of Ty 16 homolog (S. cerevisiae) S 1.4652 S.2861.45 SRB7 Suppressor of RNA polymerase B 2.06851 homolog (yeast) US 2009/O 1921 11 A1 Jul. 30, 2009 82
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.2861.45 SRB7 Suppressor of RNA polymerase B SURB7 74676 homolog (yeast) S.512465 Surfeit 4 SURF4 S7149 S.512465 Surfeit 4 SURF4 42496 S.494827 Sushi domain containing 1 SUSD1 21596 S.435277 synaptogyrin 3 SYNGR3 93,769 S.480615 synaptopodin 2 SYNPO2 95139 S.480615 synaptopodin 2 SYNPO2 12017 S.80919 synaptophysin-like 1 SYPL1 3.38439 S.80919 synaptophysin-like 1 SYPL1 95282 S.3105.45 synaptotagmin I SYT1 60701 S.3105.45 synaptotagmin I SYT1 81623 S.32984 synaptotagmin XI SYT11 33604 S.188256 TAK1-binding protein 3 TAB3 2S396 S.2792.45 transforming, acidic coiled-coil TACC1 23007 containing protein 1 S. 104019 transforming, acidic coiled-coil TACC3 S8666 containing protein 3 S. 692 tumor-associated calcium signal TACSTD1 2.3O134 transducer 1 S.SO3998 transgelin TAGLN 91915 S.SO3998 transgelin TAGLN 2.56O72 S. 61590 TPR domain, ankyrin-repeat and coiled TANC 28.123 coil-containing S.13854 T-cell activation protein phosphatase 2C TA-PP2C 13956 S.6918 hreonyl-tRNA synthetase-like 2 TARSL2 19846 S.12956 ax1 (human T-cell leukemia virus type TAX1BP3 43209 ) binding protein 3 S.12956 ax1 (human T-cell leukemia virus type TAX1BP3 34309 ) binding protein 3 S.SS8562 TBC1 domain family, member 10A 754.25 S.3698.19 TBC1 domain family, member 16 2O748 S. 105891 TBC1 domain family, member 3 if O8387 TBC1 domain family, member 3C S.475629 TBC1 domain family, member 5 S.475629 TBC1 domain family, member 5 S.484678 TBC1 domain family, member 7 5709 S.442657 TBC1 domain family, member 8 (with 73295 GRAM domain) S.495656 transducin (beta)-like 1X-linked 47039 S.2S1830 T-box 18 22633 S.SOSOO4 transcription elongation factor A (SII), 2 31996 S.51 1504 Transcription factor 12 (HTF4, helix S3336 oop-helix transcription factors 4) S.SSS894 transcription factor 19 (SC1) S746 S.371282 transcription factor 3 (E2A 2752 immunoglobulin enhancer binding actors E12/E47) S.446392 -complex-associated-testis-expressed 1 2.58705 ike S.S16087 estis expressed sequence 261 1.21638 S.511476 estis expressed sequence 9 2.01224 S473152 transcription factor AP-2 gamma 1.19787 (activating enhancer binding protein 2 gamma) S473152 transcription factor AP-2 gamma TFAP2C 1.25248 (activating enhancer binding protein 2 gamma) S.79353 transcription factor Dp-1 TFDP1 2.62S62 S.79353 transcription factor Dp-1 TFDP1 2.29669 S.79353 transcription factor Dp-1 TFDP1 2.19872 S.79353 Transcription factor Dp-1 TFDP1 1.429O.S S.S16578 issue factor pathway inhibitor TFPI 2O2628 (lipoprotein-associated coagulation inhibitor) S.S16578 Tissue factor pathway inhibitor TFPI 1.98713 (lipoprotein-associated coagulation inhibitor) US 2009/O 1921 11 A1 Jul. 30, 2009 83
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol NC #2) S.S16578 issue factor pathway inhibitor TFPI -140011 (lipoprotein-associated coagulation inhibitor) S.529618 transferrin receptor (p90, CD71) TFRC -2.06349 S.12393 TDP-glucose 4,6-dehydratase TGDS -109049 S.S13530 transforming growth factor beta 1 TGFB11 138866 induced transcript 1 S.133379 Transforming growth factor, beta 2 1931.03 S.82O28 transforming growth factor, beta -1945O1 receptor II (70/80 kDa) S.482390 transforming growth factor, beta -2.12203 receptor III (betaglycan, 300 kDa) S.482390 Transforming growth factor, beta -2.10583 receptor III (betaglycan, 300 kDa) S.S17033 transglutaminase 2 (C polypeptide, TGM2 -3.20595 protein-glutamine-gamma glutamyltransferase) S.S17033 transglutaminase 2 (C polypeptide, TGM2 -2.04406 protein-glutamine-gamma glutamyltransferase) S.S17033 transglutaminase 2 (C polypeptide, TGM2 -1.78471 protein-glutamine-gamma glutamyltransferase) S.14894 trans-golgi network protein 2 TGOLN2 S.479971 THAP domain containing 6 THAP6 S.2O3O hrombomodulin THEBD S.2O3O hrombomodulin THEBD S.164226 hrombospondin 1 THEBS1 S.164226 hrombospondin 1 THEBS1 S.2OOOO hree prime histone mRNA exonuclease 1 THEX1 S.SS3878 hrombospondin, type I, domain THSD1 .. containing 1 if thrombospondin, type I, THSD1P omain c S.443O81 THUMP domain containing 3 THUMPD3 -1191.84 S.278391 oll-like receptor adaptor molecule 2 TICAM2 -1.80389 S.118631 imeless homolog (Drosophila) TIMELESS -1.03072 S.104839 TIMP metallopeptidase inhibitor 2 TIMP2 O9933 S.209431 TIP41, TOR signalling pathway TIPRL -1933O2 regulator-like (S. cerevisiae) S.209431 TIP41, TOR signalling pathway TIPRL -14105 regulator-like (S. cerevisiae) S.S15122 hymidine kinase 1, Soluble -2.489 S.S15122 hymidine kinase 1, Soluble -2.3099 S.512619 hymidine kinase 2, mitochondrial 2.OO3O4 S.37SOO1 alin 1 27688 S.S29591 translocation protein 1 -145673 S.S29591 translocation protein 1 -132688 S.351316 transmembrane 4 L six family member 1 -1.24857 S.31130 transmembrane 7 superfamily member 2 45683 S.555971 transmembrane BAX inhibitor motif -1.25666 containing 1 S.S10745 transmembrane emp24 protein transport TMED4 .71641 domain containing 4 S.482873 transmembrane emp24 protein transport -1.33367 domain containing 5 S.144513 transmembrane protein with EGF-like 41511 and two follistatin-like domains 2 S.437409 Transmembrane protein 20 -1.87807 S.129614 transmembrane protein 27 13364 S.8769 42.559
transmembrane protein 47 S.476525 transmembrane protein 48 -1.34569 S.433668 transmembrane protein 50B 983.89 S.2O2S17 transmembrane protein 55A 14151 S.523262 transmembrane protein 59 -1.063O8 S.116240 transmembrane protein 67 O6596 S.42OO76 transmembrane protein 68 67253 S.485 606 transmembrane protein 77 -15814 S.S13734 Tropomodulin 2 (neuronal) 2.41916 S.11355 hymopoietin -2.6SO71 S.11355 hymopoietin -2.6112 US 2009/O 1921 11 A1 Jul. 30, 2009 84
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.11355 Thymopoietin TMPO 85058 S.11355 hymopoietin TMPO .70745 S.SS6258 trophoblast-derived noncoding RNA TncRNA S6784 S.S23789 Trophoblast-derived noncoding RNA TncRNA 83062 S.443577 tumor necrosis factor receptor TNFRSF21 .99853 Superfamily, member 21 S.443577 tumor necrosis factor receptor TNFRSF21 .83323 Superfamily, member 21 S.482497 Transportin 1 TNPO1 2.38902 S.1936.13 transportin 3 TNPO3 26913 S.1936.13 transportin 3 TNPO3 21284 S.407740 Erinucleotide repeat containing 6A TNRC6A. 53347 S.80618 Erinucleotide repeat containing 6C TNRC6C 41076 S.471381 ensin 1 tensin 1 TNS 2.23004 S.S28574 opoisomerase (DNA) I, mitochondrial TOP1MT 61288 S.156346 opoisomerase (DNA) II alpha 170 kDa TOP2A 3 451.21 S.156346 opoisomerase (DNA) II alpha 170 kDa TOP2A 2.71292 S. 53.454 opoisomerase (DNA) II binding protein 1 TOPBP1 486.18 S.496459 orsin A interacting protein 1 TOR1AIP1 34467 S.496459 orsin A interacting protein 1 TOR1AIP1 14929 S.496459 orsin A interacting protein 1 TOR1AIP1 14894 S.252682 orsin family 1, member B (torsin B) TOR1B SO129 S.SS4791 tumor protein p53 inducible protein 11 TP53I11 18773 S.S.O649 tumor protein p53 inducible protein 3 TP53I3 8759 S.492.261 tumor protein p53 inducible nuclear TP53INP1 2.56175 protein 1 S.516994 tumor protein p53 inducible nuclear 22242 protein 2 S.473296 tumor protein D52-like 2 TPD52L2 90007 S.133892 tropomyosin 1 (alpha) TPM 3.2798 S.3OO772 Tropomyosin 2 (beta) TPM2 24243 S.3OO772 tropomyosin 2 (beta) TPM2 2.25258 S.466088 Tropomyosin 4 TPM4 19271 S.432424 tripeptidyl peptidase II TPP2 O6767 S.27964O translocated promoter region (to TPR 18552 activated MET oncogene) S.558468 trans-prenyltransferase TPRT 324O1 S.24.458O TPX2, microtubule-associated, homolog TPX2 2.48558 (Xenopus laevis) trafficking protein particle complex 4 TRAPPC4 634O7 trafficking protein particle complex 4 TRAPPC4 6043 trafficking protein particle complex 6A TRAPPC6A 6066 Trf (TATA binding protein-related TRFP 26727 actor)-proximal homolog (Drosophila) S.51 6826 tribbles homolog 3 (Drosophila) TRIB3 O1059 S.SSS909 tripartite motif-containing 14 TRIM14 2.18727 S.490287 tripartite motif-containing 24 TRIM24 3813S S.490287 tripartite motif-containing 24 TRIM24 38717 S.1594.08 tripartite motif-containing 3 TRIM3 20424 S.1594.08 tripartite motif-containing 3 TRIM3 89824 S.212957 tripartite motif-containing 59 TRIMS9 54122 S.368,928 tripartite motif-containing 9 TRIM9 8.9995 S.368985 Thyroid hormone receptor interactor 12 TRIP12 21 6301 S.436187 hyroid hormone receptor interactor 13 TRIP13 O8916 S.524.399 trophinin associated protein (tastin) TROAP 31723 S.288178 TROVE domain family, member 2 TROVE2 47133 S.288178 TROVE domain family, member 2 TROVE2 34204 S.2SO687 transient receptor potential cation TRPC1 S1598 channel, Subfamily C, member 1 transient receptor potential cation TRPC1 6526 channel, Subfamily C, member 1 transient receptor potential cation TRPC1 .73898 channel, Subfamily C, member 1 S.21187 TruB pseudouridine (psi) synthase TRUB1 2.42347 homolog 1 (E. coli) S.21187 TruB pseudouridine (psi) synthase TRUB1 2.253.84 homolog 1 (E. coli) S.21187 TruB pseudouridine (psi) synthase TRUB1 1.03454 homolog 1 (E. coli) S.145925 estis specific A2 homolog (mouse) TSGA2 1.33296 US 2009/O 1921 11 A1 Jul. 30, 2009 85
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol HS.7SO66 translin TSN 2.38669 HS.7SO66 translin TSN 2.17376 HS.7SO66 translin TSN 94214 HS.16529 etraspanin 12 TSPAN12 S222 HS-310453 etraspanin 14 tetraspanin 14 TSPAN14 362O7 HS-310458 etraspanin 2 TSPAN2 13685 HS.441664 etraspanin 7 TSPANT 74728 HS.284.141 TSPY-like 4 TSPYL4 16724 HS.S13195 etratricopeptide repeat domain 23 TTC23 2.04805 HS.S10213 etratricopeptide repeat domain 7B TTC7B S2316 HS.79170 etratricopeptide repeat domain 9 TTC9 26096 HS.16984O TTK protein kinase TTK 28O142 HS.358997 tubulin tyrosine ligase TTL 38282 HS.358997 tubulin tyrosine ligase TTL 21128 HS.440899 weety homolog 3 (Drosophila) TTYH3 SS269 HS.75318 tubulin, alpha 1 (testis specific) A1 O8OO1 HS.436O3S tubulin alpha 6 if tubulin alpha 6 A6 19356 HS.436O3S tubulin alpha 6 6 14334 HS.S33059 tubulin, beta polypeptide 47079 HS.S33059 tubulin, beta polypeptide 15728 HS.S33059 tubulin, beta polypeptide if tubulin, beta 14511 polypeptide HS.433615 tubulin, beta, 2 61272 HS.433615 tubulin, beta, 2 S2911 HS.S12712 tubulin, beta 2 tubulin, beta O6679 polypeptide paralog
HS.S11743 tubulin, beta 3 U HS.S11743 tubulin, beta 3 U HS. 193491 tubulin, beta 6 TUBB6 HS.279669 tubulin, gamma 1 UBG1. HS.426324 tumor Suppressor candidate 3 TUSC3 HS.353O3S TWIST neighbor TWISTNB HS.353O3S TWIST neighbor TWISTNB HS.S14685 twisted gastrulation homolog 1 TWSG1 (Drosophila) Hs.17987 axilin alpha HS.125221 hioredoxin domain containing HS.125221 hioredoxin domain containing HS.38S986 ubiquitin-conjugating enzyme E2B (RAD6 homolog) HS.93OO2 ubiquitin-conjugating enzyme E2C HS.3441.65 Ubiquitin-conjugating enzyme E2FI (UBC8 homolog, yeast) HS.163776 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) HS.406068 ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) HS.462306 ubiquitin-conjugating enzyme E2S UBE2S .70792 HS.S199 ubiquitin-conjugating enzyme E2T UBE2T 45046 (putative) HS.491.695 Ubiquitin-conjugating enzyme E2 UBE2V2 45046 variant 2 HS.491.695 Ubiquitin-conjugating enzyme E2 UBE2V2 28.108 variant 2 Hs.118351 ubiquitin protein ligase E3C UBE3C 91103 HS.153678 UBX domain containing 6 UBXD6 O34O7 HS.145469 ubiquitin carboxyl-terminal hydrolase UCHLS 36253 L5 HS.145469 ubiquitin carboxyl-terminal hydrolase UCHLS 264.92 L5 HS.1441.97 UDP glycosyltransferase 8 (UDP UGT8 20054 galactose ceramide galactosyltransferase) HS.127310 U2AF homology motif (UHM) kinase 1 UHMK1 HS.108106 ubiquitin-like, containing PHD and UHRF1 RING finger domains, 1 HS2O57 uridine monophosphate synthetase UMPS (orotate phosphoribosyltransferase and orotidi US 2009/O 1921 11 A1 Jul. 30, 2009 86
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.2057 uridine monophosphate synthetase UMPS 21064 (orotate phosphoribosyltransferase and orotidi S.158.357 Unc-5 homolog C (C. elegans)-like UNCSCL 93767 S.438O72 unc-84 homolog A (C. elegans) UNC84A 25936 S.438O72 unc-84 homolog A (C. elegans) UNC84A 373O2 S.191334 uracil-DNA glycosylase UNG 12SO1 S.1593.09 uroplakin 1A UPK1A 25889 S.136778 ubiquitin specific peptidase 10 USP10 O6342 S.464416 ubiquitin specific peptidase 14 (tRNA USP14 40594 guanine transglycosylase) S.166068 ubiquitin specific peptidase 37 USP37 17024 S.96513 Ubiquitin specific peptidase 40 USP40 12769 S.467524 Ubiquitin specific peptidase 48 USP48 O6636 S.406703 UTP15, U3 small nucleolar UTP15 13351 ribonucleoprotein, homolog (yeast) vesicle-associated membrane protein 1 WAMP1 83.895 (synaptobrevin 1) S.25348 vesicle-associated membrane protein 2 WAMP2 O336 (synaptobrevin 2) S.25348 vesicle-associated membrane protein 2 WAMP2 25148 (synaptobrevin 2) S. 66708 vesicle-associated membrane protein 3 WAMP3 3.43922 (cellubrevin) S. 66708 vesicle-associated membrane protein 3 WAMP3 3.00517 (cellubrevin) S. 66708 vesicle-associated membrane protein 3 WAMP3 2.95829 (cellubrevin) S.S15130 vang-like 1 (van gogh, Drosophila) WANGL1 2.38658 S.S15130 Vang-like 1 (van gogh, Drosophila) WANGL1 63434 S.S15130 vang-like 1 (van gogh, Drosophila) WANGL1 S8932 S.99477 vang-like 2 (van gogh, Drosophila) WANGL2 90408 S.1651.9S VAMP (vesicle-associated membrane WAPA 27708 protein)-associated protein A, 33 kDa S.5141.99 vesicle amine transport protein 1 WAT1 10246 homolog (T. californica) S.267659 vav 3 oncogene 18062 S.24917O ventral anterior homeobox2 OS896 S355927 voltage-dependent anion channel 2 37345 S.491597 voltage-dependent anion channel 3 29732 S.491597 voltage-dependent anion channel 3 O445S S.24135 transmembrane protein vezatin 626.15 S.534364 willin 1 3 89723 S.487027 villin 2 (eZrin) 2.02301 S.511668 vacuolar protein sorting 13C (yeast) O261 S.511668 Vacuolar protein sorting 13C (yeast) 65247 S.2SSO15 vacuolar protein sorting 24 (yeast) 14503 S.2SSO15 vacuolar protein sorting 24 (yeast) 2101 S.2SSO15 vacuolar protein sorting 24 (yeast) 321.52 S.447547 vacuolar protein sorting 35 (yeast) O5515 S.148721 vacuolar protein sorting 41 (yeast) 34209 S.148721 vacuolar protein sorting 41 (yeast) S398 S.4.22662 vaccinia related kinase 1 36691 S.44333O vaccinia related kinase 3 624 S.51.6114 WW domain binding protein 1 31978 S.385998 WD repeat and HMG-box DNA binding DHD1 2.67897 protein 1 S.385998 WD repeat and HMG-box DNA binding DHD1 923.71 protein 1 S.385998 WD repeat and HMG-box DNA binding HD1 85968 protein 1 S.128548 WD repeat domain 1 O2S63 S.128548 WD repeat domain 1 O7342 S.S32056 WD repeat domain 17 98877 S.133331 WD repeat domain 31 39708 S.4937SO WD repeat domain 40A 37629 S.463465 WD repeat domain 50 78047 S.47809S WD repeat domain 56 44822 S.47809S WD repeat domain 56 46879 S.97933 WD repeat domain 63 2.30932 US 2009/O 1921 11 A1 Jul. 30, 2009 87
TABLE 1-continued Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miRhsa-miR-124a. Log2 (mir124 UniGene ID Gene Title Gene Symbol S.25O154 WD repeat domain 76 WDR76 28428 S.389438 WD and tetratricopeptide repeats 2 WDTC2 35418 S.113876 Wol -Hirschhorn syndrome candidate 1 WHSC1 10369 S.113876 Wol -Hirschhorn syndrome candidate 1 WHSC1 21057 S.32099 Wol -Hirschhorn syndrome candidate 1 WHSC1L1 O11 OS like S.386.299 p53 arget Zinc finger protein WIG1 S.SO 6985 WD repeat and SOCS box-containing 2 WSB2 S.SO 6985 WD repeat and SOCS box-containing 2 WSB2 S.477921 WW domain containing transcription WWTR1 regu ator 1 Xeroderma pigmentosum, XPC CO plementation group C S.370770 Exportin 1 (CRM1 homolog, yeast) XPO1 S.8S951 exportin, tRNA (nuclear export receptor XPOT fort RNAs) S.227656 Xenotropic and polytropic retrovirus XPR1 receptor S.SO3692 Yes associated protein 1, 65 kDa YAP1 S.SO3692 Yes associated protein 1, 65 kDa YAP1 S.82719 Yip domain family, member 6 YIPF6 S.82719 Yip domain family, member 6 YIPF6 S.82719 Yip domain family, member 6 YIPF6 S.391944 YOD1 OTU deubiquinating enzyme 1 YOD1 226119 hom olog (yeast) S.391944 YOD1 OTU deubiquinating enzyme 1 YOD1 2.10226 homolog (yeast) S.S.17436 yipp ee-like 1 (Drosophila) YPEL1 19587 S.463613 yipp ee-like 2 (Drosophila) YPEL2 94.554 S.513491 yipp ee-like 3 (Drosophila) YPEL3 2.75211 S.1OO56 YSG2 12171 hom olog (mouse) S.11747 YTH domain family, member 1 YTHDF1 17086 S.9836S Zinc binding alcohol dehydrogenase, ZADH1 .55913 domain containing 1 S.444451 sterile alpha motif and leucine Zipper ZAK .37311 containing kinase AZK S.444451 sterile alpha motif and leucine Zipper ZAK 10919 containing kinase AZK S.444451 sterile alpha motif and leucine Zipper ZAK 2113 containing kinase AZK S.444451 sterile alpha motif and leucine Zipper ZAK 3428S containing kinase AZK S.518301 Zinc finger and BTB domain containing ZBTB38 21687 38 S.190477 Zinc finger CCCH-type containing 6 ZC3HDC6 O9859 S.370424 Zinc finger protein, X-linked ZFX 14659 S.482660 Zinc finger, FYVE domain containing 16 ZFYVE16 O9813 S.S33986 Zinc finger, MYM-type 6 ZMYM6 6116S S.499.453 Zinc finger protein 11B ZNF11B SO934 S.181552 Zinc finger protein 140 (clone pHZ-39) ZNF140 04575 S.145956 Zinc finger protein 226 ZNF226 75717 S.499.429 Zinc finger protein 25 (KOX 19) ZNF25 271 O1 S.314246 Zinc finger protein 271 ZNF271 41129 S.489722 Zinc finger protein 277 ZNF277 11347 S.458986 Zinc finger protein 291 ZNF291 33906 S.458986 Zinc finger protein 291 ZNF291 394O6 S.288.773 Zinc finger protein 294 ZNF294 61094 S.4363SO Zinc finger protein 302 ZNF302 SS881 S.435774 Zinc finger protein 33A ZNF33A 697 S4 S.494557 Zinc finger protein 367 ZNF367 3.04638 S.S30930 Zinc finger protein 423 ZNF423 .90391 S.S291.78 Zinc finger protein 512 ZNF512 .33O88 S.S291.78 Zinc finger protein 512 ZNF512 35578 S.3494.44 Zinc finger protein 558 ZNF558 48459 S.51 1848 Zinc finger protein 569 ZNF569 11338 S.522147 Zinc finger protein 658 ZNF658 21013