Investigating the Biological Roles of ABCE1 in Neuroblastoma

Investigating the biological roles of ABCE1 in neuroblastoma

Jixuan Gao

A thesis in fulfilment of the requirements for the degree of

Doctor of Philosophy (Medicine)

Children’s Cancer Institute

School of Women’s and Children’s Health, Faculty of Medicine

University of New South Wales

Sydney, Australia

2018

Thesis/Dissertation Sheet

Surname/Family Name : Gao Given Name/s : Jixuan Abbreviation for degree as give in : PhD the University calendar Faculty : Medicine School : Women’s and Children’s Health Thesis Title : Investigating the biological roles of ABCE1 in neuroblastoma

Amplification of MYCN is one of the strongest prognostic factors for poor outcome in neuroblastoma, the most common extra-cranial solid tumour in children. With less than 50% of such patients surviving their disease, better therapies are needed. MYC transcription factors up-regulate protein synthesis to drive cancer progression. Since inhibiting protein synthesis is detrimental to the progression of c-MYC driven cancers, targeting this process may offer therapeutic benefit for MYCN-driven neuroblastoma. ABCE1 is a MYC target gene and encodes an ATP-binding cassette protein that powers the dissociation of ribosomes into small and large subunits. This process allows translation re-initiation and continued protein synthesis to provide essential building blocks for cancer growth and metastasis. High tumour ABCE1 expression is correlated with reduced survival of neuroblastoma patients. ABCE1 is thus a putative therapeutic target in MYCN-driven neuroblastoma. Therefore, experiments were conducted to test whether targeting ABCE1-mediated translation can block neuroblastoma progression. ABCE1 suppression by short interfering RNAs impaired the proliferation and migration of MYCN- amplified neuroblastoma cell lines. In contrast, ABCE1 knockdown did not affect these malignant characteristics in neuroblastoma or fibroblast cell lines lacking MYCN amplification. ABCE1 suppression also sensitised neuroblastoma cells to the chemotherapeutics topotecan, mafosfamide and etoposide, further supporting ABCE1 as a potential target in neuroblastoma. Polysome profiling showed that ABCE1 knockdown in MYCN-amplified SK-N-BE(2) neuroblastoma cells reduced translation efficiency. Similar decreases in translation were observed in all other MYCN- amplified cell lines tested, but not in cell lines lacking MYCN amplification. Induction of MYCN expression in the SH-EP Tet21N neuroblastoma cell line substantially increased translation; however, ABCE1 knockdown returned translation to basal levels. Therefore, ABCE1 is required for the elevated translation driven by MYCN dysregulation. In mice xenografted with MYCN-amplified neuroblastoma cells, ABCE1 suppression delayed tumour growth at both subcutaneous and orthotopic sites, prolonging the survival of tumour-bearing mice. This study shows that targeting ABCE1-mediated translation is a promising approach to selectively impair the progression of MYCN-amplified neuroblastoma.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

…………………….…………… ….………………….…………… .……16/04/2019.…….…

Signature Witness Signature Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE Date of completion of

USE ONLY requirements for Award:

iii

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ………16/04/2019.…….…

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ......

Date ...... 16/04/2019.…….…

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ......

Date ...... 16/04/2019.…….…

INCLUSION OF PUBLICATIONS STATEMENT

UNSW is supportive of candidates publishing their research results during their candidature as detailed in the UNSW Thesis Examination Procedure.

Publications can be used in their thesis in lieu of a Chapter if: • The student contributed greater than 50% of the content in the publication and is the “primary author”, ie. the student was responsible primarily for the planning, execution and preparation of the work for publication • The student has approval to include the publication in their thesis in lieu of a Chapter from their supervisor and Postgraduate Coordinator. • The publication is not subject to any obligations or contractual agreements with a third party that would constrain its inclusion in the thesis

Please indicate whether this thesis contains published material or not.

This thesis contains no publications, either published or submitted for publication ☒ (if this box is checked, you may delete all the material on page 2)

Some of the work described in this thesis has been published and it has been documented in the relevant Chapters with acknowledgement (if this box is

☐ checked, you may delete all the material on page 2)

This thesis has publications (either published or submitted for publication) ☐ incorporated into it in lieu of a chapter and the details are presented below

CANDIDATE’S DECLARATION I declare that: • I have complied with the Thesis Examination Procedure • where I have used a publication in lieu of a Chapter, the listed publication(s) below meet(s) the requirements to be included in the thesis. Name Signature Date (dd/mm/yy) Jixuan Gao 16/04/19

Postgraduate Coordinator’s Declaration (to be filled in where publications are used in lieu of Chapters) I declare that: • the information below is accurate • where listed publication(s) have been used in lieu of Chapter(s), their use complies with the Thesis Examination Procedure • the minimum requirements for the format of the thesis have been met. PGC’s Name PGC’s Signature Date (dd/mm/yy)

vii

Acknowledgements

I would like to thank my supervisor Dr Michelle Henderson for her constant support, guidance and patience throughout my PhD. Thank you so much for the countless pieces of invaluable advice you have given me over the years; for nurturing my independent research skills and for always looking out for me. You have been an incredible mentor and an educator and instrumental to all the successes I have had over the years. Thank you to my co-supervisor Prof Murray Norris for all the advice, guidance and support you have provided me. Thank you to my co-supervisor Dr Klaartje Somers for the incredible scientific discussions we have had; the ideas you have given me and advice on life as a scientist. This thesis would not have been possible without your support.

I would like to thank Children’s Cancer Institute (CCI) for providing me with the facilities I needed to complete my PhD. Also to the Animal Facility staff members at CCI who have trained me on all the techniques I needed to complete the animal experiments. Thank you to Drs Tzong Tyng Hung and Jamie Fletcher for training me and assisting me with the imaging of the orthotopic xenografts and to UNSW for providing the IVIS SpectrumCT In Vivo Imaging System required for this experiment. Thank you to Dr Kate Hannan and Prof Ross Hannan at ANU for providing the facilities and helping me with the polysome profiling experiments. Thank you to Drs Ling Zhong and Sydney Liu for assisting me with the tandem mass spectrometry experiments and to Bioanalytical Mass Spectrometry Facility (BMSF) for providing the mass spectrometer for completing this experiment.

Thank you to all the members of ET/MD research group who I have had the privilege of working with. Thank you to Drs Alvin Kamilli and Jamie Fletcher for providing the COG-N-519 cells and invaluable advice regarding the patient-derived xenografts. Also to Dr Jayne Murray for assisting me with the xenografts and advice on all problems regarding mice. Thanks to Dr Chelsea Mayoh for analysing the mass spectrometry data and to Dr MoonSun Jung for analysing the clinical data. Thank you to Drs Emanuele Valli, Denise Yu and Lin Xiao, Miss Rebekka Williams, Mawar Karsa, Jourdin Rouaen, Angelika Bongers and Amanda Russel who have made the past four years so much fun.

iii

Thank you to my family who have provided me with endless support. Thank you for all the love and care you have given me.

Abstract

ABCE1 suppression by short interfering RNAs impaired the proliferation and migration of MYCN-amplified neuroblastoma cell lines. In contrast, ABCE1 knockdown did not affect these malignant characteristics in neuroblastoma or fibroblast cell lines lacking MYCN amplification. ABCE1 suppression also sensitised neuroblastoma cells to the chemotherapeutics topotecan, mafosfamide and etoposide, further supporting ABCE1 as a potential target in neuroblastoma.

Polysome profiling showed that ABCE1 knockdown in MYCN-amplified SK-N-BE(2) neuroblastoma cells reduced translation efficiency. Similar decreases in translation were observed in all other MYCN-amplified cell lines tested, but not in cell lines lacking MYCN amplification. Induction of MYCN expression in the SH-EP Tet21N neuroblastoma cell line substantially increased translation; however, ABCE1 knockdown returned translation to basal levels. Therefore, ABCE1 is required for the elevated translation driven by MYCN dysregulation.

In mice xenografted with MYCN-amplified neuroblastoma cells, ABCE1 suppression delayed tumour growth at both subcutaneous and orthotopic sites, prolonging the survival of tumour-bearing mice. This study shows that targeting ABCE1-mediated

v translation is a promising approach to selectively impair the progression of MYCN- amplified neuroblastoma.

Abbreviations:

4EBP eIF4E bind protein ABC ATP-binding cassette transporter ABCB1 ATP-binding cassette protein ‘B1’ ABCC ATP-binding cassette protein C family ABCE1 ATP-binding cassette protein ‘E1’ ABCF1 ATP-binding cassette protein ‘F1’ aCGH Array comparative genomic hybridisation AKT V-akt murine thymoma viral oncogene homolog ALK Anaplastic lymphoma kinase AML Acute myeloid leukaemia ATP Adenosine triphosphate BCA Bicinchoninic acid BCL2 B-cell lymphoma 2 BDNF Brain derived neurotrophic factor BET Bromodomain and extra-terminal domain Brd Bromodomain-containing protein BrPA Bromo-pyruvate BSA Bovine serum albumin CDK Cyclin dependent kinase CEM Carboplatin, etoposide, melphalan CMA Chromosome microarray c-MYC Avian myelocytomatosis virus oncogene cellular homolog CT Computed tomography DEF Digestive organ expansion factor DFMO Difluoromethylornithine DMEM Dulbecco’s modified eagle medium EDTA Ethylenediaminetetraacetic acid EFS Event-free survival eIF Eukaryotic translation initiation factor ERK Extracellular Signal-Regulated Kinase FACT Facilitates chromatin transcription FBS Foetal bovine serum FDA Food and drug administration FDG Fluorodeoxyglucose FISH Fluorescent in situ hybridisation GABRAPL2 GABA type A receptor associated protein like 2 GD2 Disialoganglioside GFP Green fluorescent protein GLS1 Glutaminase GMCSF Granulocyte-macrophage colony-stimulating factor H&E Hematoxylin and eosin HPLC High-performance liquid chromatography HVA Homovanillic acid IC50 Half maximal inhibition concentrations IDRF Image defined risk factor IL-2 Interleukin-2 IMDM Iscove's Modified Dulbecco's Medium

vii

INF Interferon INRG International Neuroblastoma Risk Group INRGSS International Neuroblastoma Risk Group staging system INSS International Neuroblastoma Staging System ITS Insulin-transferrin-selenium JAK Janus kinase MAPK Mitogen-activated protein kinase MDM2 Mouse double minute 2 homolog MEK MAPK/ERK kinase MET Mesenchymal-epithelial transition factor MDR1 Multidrug resistance protein 1 MIBG Metaiodobenzylguanidine MKI Mitosis-karyorrhexis index MLL Mixed-lineage leukemia MMP Matrix metalloproteinases MNK MAPK interacting kinases mTORC1 Mammalian target of rapamycin complex 1 MYCN V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog NF-kB Nuclear factor kappa-light-chain-enhancer of activated B cells NME1 Nucleoside diphosphate kinase A NRAS Neuroblastoma RAS Viral Oncogene Homolog OS Overall survival PBS Phosphate buffered saline PDGF Platelet-derived growth factor PELO Protein pelota homolog PET Positron emission tomography P-gp p-glycoprotein PHOX2B Paired-like homeobox 2b PI3K Phosphatidylinositol-3-Kinase Raf Rapidly accelerated fibrosarcoma RhoA Ras homolog gene family, member A ROCK Rho-associated protein kinase ROS1 Proto-oncogene tyrosine-protein kinase RPL Ribosomal protein of the large subunit of the ribosome RPS Ribosomal protein of the small subunit of the ribosome RT Room temperature SCA Segmental chromosomal aberration siRNA Short interfering RNA STAT Signal transducer and activator of transcription STMN1 Stathmin 1 TCA Tricarboxylic acid TH Tyrosine hydroxylase Trk Tropomycin receptor kinase Tris Tris(hydroxymethyl)aminomethane UTR Untranslated region VCM Viral conditioned media VEGF Vascular endothelial growth factor VMA Vanillylmandelic acid

viii

Presentations:

The following presentations have arisen from this thesis:

Oral presentations:

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2017, May). Targeting ribosome recycling inhibits the malignant phenotypes of neuroblastoma., Translational control, the Achilles’ heel of cancer conference, Peter MacCallum Cancer Center, Melbourne, Australia.

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2016, November). ABCE1 drives malignant characteristics in neuroblastoma. 44th Tow Coast Association Health & Medical Research Early Career Awards, Sydney, Australia. * Awarded prize for best oral presentation

Poster presentations:

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2017, April). ABCE1 regulates the translational profile of neuroblastoma to drive tumor progression. Poster presented at the AACR Annual Meeting 2017, Walter E. Washington Convention Center, Washington, D.C, USA.

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2016, December). ABCE1 drives malignant characteristics in neuroblastoma. Rapid fire poster presentation at the Cancer Therapeutics CRC retreat, Queenscliff, Australia. * Awarded prize for best rapid fire poster presentation

Gao, J., Somers K., Hannan K.M., Valli E., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2016, June). ABCE1 drives malignant characteristics in neuroblastoma. Poster presented at the Advances in Neuroblastoma Research Congress, Cairns, Australia.

Gao, J., Somers K., Hannan K.M., Valli E., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2016, June). ABCE1 drives malignant characteristics in neuroblastoma. Poster presented at the 24th Australian Society for Medical Research NSW Annual Scientific Meeting, Sydney, Australia. * Awarded Eppendorf prize for best poster

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2015, December). ABCE1 drives malignant characteristics in neuroblastoma. Poster presented at the Cancer Therapeutics CRC retreat, Lancemore Hill, Australia.

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2015, July). ABCE1 drives malignant characteristics in neuroblastoma. Poster presented at the Cancer Therapeutics CRC student symposium, Melbourne, Australia. * Award runner-up prize for poster presentation

Gao, J., Somers K., Hannan K.M., Fletcher J. I., Murray J., Liu, B., Sivarajasingam, S., Hannan R.D., Pearson R.B., Haber M., Norris, M.D., Henderson, M.J. (2014, November). ABCE1 drives malignant characteristics in neuroblastoma. Poster presentation at the 42th Tow Coast Association Health & Medical Research Early Career Awards, Sydney, Australia.

Table of Contents:

Thesis/dissertation sheet ii Originality statement iv Copyright statement v Authenticity statement vi Acknowledgement vii Abstract ix Abbreviations xi Presentations xiii Table of contents xv List of figures xx List of tables xxii

Chapter 1: Introduction 1 1.1 Childhood neuroblastoma 2 1.2 Histopathology and symptoms of neuroblastoma 2 1.3 Diagnosis and prognosis of neuroblastoma 3 1.3.1 Imaging 4 1.3.2 Staging systems for spread of disease 5 1.3.3 Serological diagnostic tests 7 1.3.4 Histopathology 8 1.3.5 Age of diagnosis as a prognostic indicator 10 1.3.6 Analysis of chromosomal aberrations 10 1.3.7 Analysis of genetic aberrations 11 1.3.7.1 MYCN amplification 11 1.3.7.2 PHOX2B 12 1.4 Current treatments 13 1.4.1 Surgery 13 1.4.2 Induction chemotherapy 14 1.4.3 Consolidation chemotherapy 15 1.4.3.1 Myeloablative chemotherapy 15 1.4.3.2 Radiotherapy 16 1.4.3.3 Autologous stem cell transplant 16 1.4.4 Post-consolidation therapy 17 1.4.4.1 Retinoid therapy 17 1.4.4.2 Immunotherapy 17 1.4.5 Treatment regimen for relapsed or refractory disease 18 1.4.6 Side-effects of current treatment 19 1.5 Targeting key molecular drivers of neuroblastoma 19 1.5.1 ALK activating mutations and their inhibitors 20 1.5.2 Targeting the RAS/Raf/MEK/ERK (MAPK) pathway 21 1.5.3 Inhibitors of cyclin dependent kinases (CDKs) 22 1.5.4 Activating p53 as a therapeutic strategy 23 1.5.5 The PI3K/AKT pathway and its inhibitors 24 1.5.6 MYCN and its inhibitors 26 1.5.6.1 Contribution of MYCN to normal development 26 xi

1.5.6.2 MYCN amplification, overexpression and 26 hyperactivity are linked to neuroblastoma progression 1.5.6.3 MYCN promotes malignant transformation, 27 C tumour growth and metastasis C 1.5.6.4 Direct inhibitors of MYCN activity, 29 transcription and MYCN destabilisers 1.5.6.5 Downstream metabolic pathways regulated by 30 MYCN 1.5.6.5.1 Targeting MYCN-driven energy 31 production 1.5.6.5.2 Up-regulation of protein synthesis 32 by c-MYC and MYCN 1.6 The specific targeting of translation in MYC-driven cancers as a novel 35 therapeutic approach 1.6.1 Inhibitors of ribosome biogenesis 36 1.6.2 Inhibitors of eIF4E 36 1.6.3 Inhibitors of eIF4A 37 1.6.4 Inhibitors of translation in neuroblastoma 38 1.7 MYCN regulated ABC transporter family members as targets to block 40 protein translation in neuroblastoma 1.7.1 ABC transporter family members as therapeutic targets in 40 oncology 1.7.2 Soluble members of the ABC superfamily 43 1.8 ABCF1 43 1.9 ABCE1 44 1.9.1 The ABCE1 protein as a therapeutic target in neuroblastoma 44 1.9.2 Structure of ABCE1 45 1.9.3 Biological roles of ABCE1 45 1.9.3.1 Role of ABCE1 in mRNA translation 46 1.9.3.1.1 Translation initiation 48 1.9.3.1.2 Translation termination 48 1.9.3.1.3 Ribosome recycling 49 1.9.3.1.4 Exploiting ABCE1-mediated translation 51 for MYC-driven cancer therapy 1.9.4 Other functions of ABCE1 51 1.9.4.1 Inhibition of interferon - RNAseL pathway 51 1.9.4.2 Assembly of viral capsids 53 1.9.4.3 Elimination of reactive oxygen species 54 1.10 Summary and thesis perspectives 54

Chapter 2: Materials and methods 56 2.1 Materials 57 2.1.1 Reagents and animals 57 C 2.1.1.1 Cell culture 57 2.1.1.2 Western blots 59 2.1.1.3 Transfection reagents and reagents for cloning of 59 C DNA plasmids xii

C C 2.1.1.4 Assays to measure cellular phenotype 60 2.1.1.5 Cytotoxic drugs and targeted inhibitors 60 2.1.1.6 Tumour microarray 61 C 2.1.1.7 Mass spectrometry C 2.1.1.8 Polysome profiling reagents 61 2.1.1.9 RNA extraction and PCR reagents 61 2.1.1.10 Animals 62 2.1.2 Equipment 62 2.1.2.1 Cell culture 62 2.1.2.2 Isolation, quantification and analysis of protein 62 2.1.2.3 Polysome profiling 63 2.1.2.4 qRT-PCR 63 2.1.2.5 Animal work 63 2.2 Methods 63 2.2.1 Tissue culture maintenance 63 2.2.2 siRNA and plasmid transfections 64 2.2.3 Protein extraction and Western blots 67 2.2.3.1 Protein extraction from cell lines 67 2.2.3.2 Protein extraction from tumour cells 68 2.2.3.3 Western blotting 68 2.2.4 BrdU Proliferation assay 69 2.2.5 Puromycin incorporation assay 70 2.2.5.1 The effect of ABCE1 suppression on the rate of 70 protein synthesis 2.2.5.2 Measuring endogenous rates of protein synthesis 71 in neuroblastoma cell lines 2.2.6 Subcutaneous xenografts of neuroblastoma cells 72 2.2.6.1 The impact of shRNA-mediated ABCE1 72 suppression on growth of neuroblastoma tumour xenografts 2.2.6.2 Investigating the anti-growth effects of ABCE1- 73 targeting nanoparticles on neuroblastoma tumours 2.2.6.3 Experimental metastasis model 74 2.2.7 Tandem mass spectrometry 74 2.2.8 Clonogenic assays 75 2.2.9 Cytotoxicity assays - combination of ABCE1 suppression with 76 standard chemotherapeutics or translation inhibitors 2.2.10 Transwell migration and invasion assays 77 2.2.11 Polysome profiling 79 2.2.12 Statistical analysis 80

Chapter 3: Investigating the effect of ABCE1 knockdown on the malignant 81 characteristics of neuroblastoma cells 3.1 Introduction 82 3.2 Results 85 3.2.1 High expression of ABCE1 is linked to poorer clinical outcome 85 xiii

and high MYCN expression in neuroblastoma patients C 3.2.2 Selection of appropriate cell line models for studying the role of 88 ABCE1 in neuroblastoma 3.2.3 Comparable and sustained ABCE1 knockdown is achieved 90 across cell lines chosen to study the role of ABCE1 in supporting C malignant characteristics C 3.2.4 ABCE1 suppression selectively reduces the number of dividing 92 cells in MYCN-amplified neuroblastoma cell lines with minimal impact on cell lines lacking MYCN amplification 3.2.5 Knockdown of ABCE1 affects the colony forming ability of 94 MYCN-amplified neuroblastoma cells 3.2.6 Using an inducible MYCN expression system to test the 95 selectivity of the inhibitory effect of ABCE1 knockdown in MYCN expressing neuroblastoma cells 3.2.7 ABCE1 knockdown does not induce apoptosis in neuroblastoma 97 cells 3.2.8 ABCE1 knockdown impairs the migration of MYCN-amplified 97 neuroblastoma cells 3.2.9 ABCE1 suppression blocks the invasion of extracellular matrix 99 by MYCN-amplified neuroblastoma cells 3.2.10 Investigating the effect of combining ABCE1 suppression with 100 standard-of-care chemotherapies 3.2.11 High ABCE1 expression may support the progression of c-MYC 107 expressing neuroblastomas 3.3 Discussion 110

Chapter 4: Investigating the molecular mechanisms that underlie the pro- 121 oncogenic functions of ABCE1 4.1 Introduction 122 4.2 Results 127 4.2.1 ABCE1 suppression reduces translation efficiency and rate of 127 protein synthesis in MYCN-amplified SK-N-BE(2) neuroblastoma cells 4.2.2 ABCE1 knockdown does not impair translation in neuroblastoma 131 and fibroblast cell lines that do not possess MYCN amplification 4.2.3 ABCE1 suppression returns MYCN-driven protein synthesis to 133 baseline levels 4.2.4 MYCN-amplified neuroblastoma cell lines exhibit higher levels 136 of baseline protein synthesis 4.2.5 Neuroblastoma cells lacking MYCN amplification do not up- 138 regulate ribosome recycling factors to compensate for suppression of ABCE1 4.2.6 ABCE1 suppression does not appear to alter the level of specific 141 proteins 4.2.7 Inhibitors of translation are not highly selective against MYCN- 144 amplified neuroblastoma cells 4.2.8 ABCE1 suppression modestly potentiates the efficacy of 146 translation inhibitors xiv

4.3 Discussion 151

Chapter 5: Investigating the role of ABCE1 in neuroblastoma tumour 160 biology 5.1 Introduction 161 5.2 Results 166 5.2.1 Development of a cultured neuroblastoma cell line for examining 166 the impact of inducible ABCE1 knockdown 5.2.2 Inducible ABCE1 suppression blocks the growth and migration 168 C of the cultured SK-N-BE(2) TGL cells 5.2.3 Long-term ABCE1 knockdown delays the growth of 169 neuroblastoma tumours and prolongs the survival of tumour bearing mice 5.2.4 Long-term ABCE1 knockdown reduces the development of 172 neuroblastoma metastases 5.2.5 Investigating the role of ABCE1 in a MYCN-amplified 175 neuroblastoma patient-derived neuroblastoma xenograft 5.2.6 Suppression of ABCE1 expression through intratumoral 181 injections of star nanoparticles complexed with ABCE1-specific siRNAs 5.3 Discussion 184

Chapter 6: Concluding remarks and future perspectives 192

Appendix 203

References 210

List of Figures

1.1 c-MYC transcriptionally up-regulates translation factors and 33 ribosomal components to enhance translation 1.2 ABC transporter superfamily consists of 48 proteins that classified 40 into 7 subfamilies, ranging from ABCA to ABCG 1.3 Summary of the roles of ABCE1 in mRNA translation 47 1.4 The role of ABCE1 in the release of polypeptide chain 49 1.5 ATP hydrolysis of ABCE1 powers ribosome recycling 50 1.6 ABCE1 can inhibit the RNAseL-JNK pathway to block apoptosis 53 3.2.1 High ABCE1 expression in neuroblastoma patients predicts poor 86 outcome and is associated with MYCN amplification 3.2.2 Neuroblastoma cell lines with MYCN or c-MYC expression tend to 89 exhibit higher levels of ABCE1 protein expression compared to cell lines lacking MYC expression. 3.2.3 Efficient ABCE1 knockdown was achieved by siRNA transfections 91 across different neuroblastoma cell lines 3.2.4 Impact of ABCE1 knockdown across a panel of neuroblastoma cell 93 lines 3.2.5 MYCN-amplified neuroblastoma cells demonstrated impaired colony 94 formation after ABCE1 suppression 3.2.6 Forced MYCN expression in the SH-EP Tet21N cells sensitises 96 proliferation of the cells to ABCE1 knockdown 3.2.7 Impact of ABCE1 suppression on the migration of neuroblastoma 98 cells 3.2.8 Invasion of extra-cellular matrix by SK-N-BE(2) cells was inhibited 99 upon ABCE1 suppression 3.2.9. The impact of combining ABCE1 suppression with 101 chemotherapeutics that induce topoisomerase-mediated DNA damage on the viability of MYCN-amplified neuroblastoma cells 3.2.10 ABCE1 knockdown potentiates the anti-growth effects of 103 mafosfamide against MYCN-amplified neuroblastoma cells 3.2.11 The impact of combining ABCE1 suppression with cisplatin on the 105 viability of MYCN-amplified neuroblastoma cells 3.2.12 The impact of combining ABCE1 suppression with the microtubule- 106 targeting agent, vincristine, on the viability of MYCN-amplified neuroblastoma cells 3.2.13 ABCE1 is predictive of poor outcome in neuroblastoma patients with 108 high c-MYC expression and no MYCN amplification 4.2.1 ABCE1 suppression reduces the translation efficiency of MYCN- 128 amplified SK-N-BE(2) neuroblastoma cells 4.2.2 ABCE1 knockdown reduced protein synthesis in MYCN-amplified 130 neuroblastoma cell lines 4.2.3 ABCE1 knockdown did not reduce translation in the neuroblastoma 132 and fibroblast cell lines lacking MYCN amplification 4.2.4 ABCE1 expression and the rate of protein synthesis increase 134 following MYCN expression in the SH-EP Tet21N cells

4.2.5 ABCE1 knockdown reduces elevated protein synthesis caused by 135 xvi

forced MYCN expression in the SH-EP Tet21N cells 4.2.6 MYCN-amplified neuroblastoma cell lines exhibited higher levels of 137 protein synthesis compared to neuroblastoma cell lines lacking MYCN-amplification 4.2.7 ABCE1 knockdown did not increase in the expression of PELO, a 139 potential compensatory ribosome recycling factor in neuroblastoma cells 4.2.8 Potential ‘rescue’ ribosome recycling factor, PELO was more 140 abundantly expressed in MYCN-amplified neuroblastoma cell lines 4.2.9 ABCE1 knockdown failed to consistently alter the expression of 143 GABARAPL2 4.2.10 Inhibition of protein synthesis using translation inhibitors did not 145 exert selectivity against MYCN-amplified neuroblastoma cell lines 4.2.11 ABCE1 suppression in MYCN-amplified neuroblastoma cells subtly 147 potentiated the efficacy of the eIF4A inhibitor, silvestrol 4.2.12 ABCE1 suppression in MYCN-amplified neuroblastoma cells does not 148 affect the efficacy of the eIF4E inhibitor, ribavirin 4.2.13 ABCE1 suppression in MYCN-amplified neuroblastoma cells does not 150 affect the efficacy of the AKT inhibitor, MK-2206 5.2.1 Development of an inducible ABCE1 expression system 167 5.2.2 Impact of inducible ABCE1 suppression on the colony forming 168 ability and migration of MYCN-amplified neuroblastoma cell lines 5.2.3 Effect of ABCE1 suppression on the growth of neuroblastoma 170 tumours and the survival of tumour-bearing mice 5.2.4 ABCE1 depletion significantly reduced the development of MYCN- 173 amplified neuroblastoma metastases in the orthotopic xenograft model. 5.2.5 Transient ABCE1 knockdown in MYCN-amplified neuroblastoma 176 patient-derived xenograft COG-N-519 cell line significantly reduced cell proliferation 5.2.6 ABCE1 knockdown by lentiviral shRNAs transduced into COG-N- 177 519 cells significantly reduced cell proliferation 5.2.7 ABCE1 suppression in COG-N-519 tumour xenografts significantly 179 delays tumour progression 5.2.8 The impact of administering ABCE1-specific siRNAs complexed 182 with star nanoparticles on the growth of MYCN-amplified neuroblastoma tumours

xvii

List of Tables:

1.1 Clinical stages of neuroblastoma based on the INSS classification 6 system 1.2 Clinical stages of neuroblastoma based on the INRG staging system 7 1.3 Histological characteristics as predictors of outcome 9 2.1 Characteristics of cell lines used in this study 58 2.2 Transfection conditions for neuroblastoma and fibroblast cell lines 65 2.3 Seeding densities for BrdU incorporation assay in 96 well plates 70 2.4 Conditions for puromycin incorporation assay: 71 2.5 Seeding densities and incubation conditions for colony forming 76 assays in 6-well plates 2.6 Concentration of drugs used in cytotoxicity assays 77 2.7 Conditions for Transwell migration assay 78 3.2.1 Multivariate analysis of event-free survival in neuroblastoma 87 patients 3.2.2 Multivariate analysis of overall survival in neuroblastoma patients 87 4.2.1 Proteins altered by more than 2-fold after ABCE1 knockdown by 142 siRNA1 4.2.2 Proteins altered by more than 2-fold after ABCE1 knockdown by 142 siRNA2

xviii

Chapter 1: Introduction

1.1 Childhood neuroblastoma

Neuroblastoma is an extracranial solid tumour in children. With an incidence rate of 7.9 cases per million children worldwide, it accounts for a relatively small proportion of childhood malignancies (6-8%) but causes a disproportionate amount of cancer-related mortalities (10-15%) [1]. Neuroblastoma is a complex disease in that a subset of patients classified as ‘low-risk’ experience spontaneous regression, resulting in a 5 year overall survival rate (OS) of 70% for the disease [2, 3], whereas, the five year survival rate of ‘high-risk’ patient cases remains around 40%, despite the use of intensive, multimodal chemotherapy [4]. Furthermore, a large proportion of neuroblastoma patients who are treated successfully suffer from severe long-term side effects of chemotherapy such as hearing loss and development of acute myeloid leukaemia due to targeting of non-malignant cells [5]. For this reason, the search for new treatments has shifted towards finding potent, targeted therapies that are more selective towards cancer cells, potentially decreasing side effects and reducing both morbidity and mortality. To succeed in the quest for more effective treatments, a thorough understanding of the pathogenesis of neuroblastoma as well as the current treatments available for this disease is required. Investigating the shortcomings of existing therapeutics will identify which therapeutics require further development to potentiate their clinical efficacy. An understanding of the molecular basis of the development, progression and spread of neuroblastoma will identify the key molecular targets that drive these processes. Knowing this and the types of molecular-based therapies available in the clinic will uncover the drivers of neuroblastoma progression that do not have clinically effective therapeutic inhibitors. Future drug development should, thus, be focused on finding inhibitors against these targets to provide more selective and more efficacious treatments for neuroblastoma.

1.2 Histopathology and symptoms of neuroblastoma

Neuroblastoma typically arises during embryonic development from non-committed neural crest cells [4]. Normally, neural crest cells differentiate to become part of the sympathetic nervous system, which is why primary neuroblastoma tumours most often occur in the adrenal medulla or the sympathetic ganglia. Adrenal tumours account for 50-70% of all primary tumours and patients with these tumours have significantly poorer event-free and overall survival compared to those with primary tumours at other

2 locations [6, 7]. Furthermore, the majority of patients with metastatic neuroblastoma have primary neuroblastoma tumours in the adrenal medulla [8]. Other common places for tumour development include the abdominal, retroperitoneal, thoracic and pelvic cavities and occasionally the neck region. Metastases are mostly found in the bone marrow (accounting for ~70% of cases), bone, lymph nodes, liver, intracranial regions and skin [6]. About 50% of neuroblastoma cases present with metastasis at diagnosis, which is associated with poor outcome [4, 9].

Given that neuroblastoma is a cancer of the sympathetic nervous system, sensory problems such as ataxic gait and vision impairment can occur [10]. However, the most common symptoms of neuroblastoma include fever, fatigue and abdominal swelling, pain and digestive problems that are the consequences of obstructive tumours in the abdominal or retroperitoneal cavity [10]. These common symptoms are non-precise, non-specific diagnostic indicators of neuroblastoma because they can be associated with many other disorders [11]. Furthermore, the presence or absence of symptoms is not reflective of the extent or progression of neuroblastoma. For example, in a study examining thoracic neuroblastoma, only a small proportion of patients who presented with disease based on scans of the thorax, showed symptoms of thoracic disease such as coughing, shortness of breath and chest pain [12]. Consequently, there is a significant lag time between the onset of the first symptoms and accurate diagnosis of neuroblastoma, making early diagnosis extremely difficult [10].

1.3 Diagnosis, risk classification and prognosis of neuroblastoma

Given the ambiguous nature of symptoms associated with neuroblastoma, much effort has been placed into finding more accurate diagnostic methods for this disease. These diagnostic methods not only detect the characteristics that signify the presence of neuroblastoma but also enable clinicians to evaluate the severity of the patient’s disease. Accurate diagnosis and risk classification aid clinicians in administering appropriate treatments for each patient and enable more aggressive chemotherapies to be given only to the patients who require such treatment. About 30-40% of neuroblastoma patients are diagnosed with high-risk neuroblastoma with a five-year event-free survival (EFS) of around 40% and these patients require intensive, multimodal treatment strategies [3]. Patients with low risk disease can be effectively treated without the need of intensive chemotherapy that may have severe long-term side effects [13-15]. The current system

3 of pre-treatment risk stratification is based on the molecular profiles of tumours (including MYCN amplification, DNA ploidy and deletion of chromosome locus 11q), age of diagnosis, histologic category (based on the amount of stroma), grade of tumour differentiation and tumour spread (stage) [3, 16].

In order to pinpoint the diagnosis and risk classification of neuroblastoma, a comprehensive set of tests are performed. These include imaging to measure the spread or stage of the disease, histopathology to examine the degree of differentiation and amount of stroma, testing for MYCN gene amplification, serological diagnostic tests for neurotransmitters and chromosomal microarray analysis for chromosomal aberrations. Imaging is usually the first approach to detect the presence, location and spread of a tumour. Examining the amount of stroma using histopathology and the levels of more specific metabolic markers of neuroblastoma such as serum neuron-specific enolase pinpoints the diagnosis of the disease as neuroblastoma. Then, the presence of genetic aberrations such as MYCN amplification and segmental chromosome aberrations are examined to finalise the risk assessment of the patient.

1.3.1 Imaging

Imaging technologies serve multiple purposes in the clinical work-up of neuroblastoma including disease diagnosis, localisation of the tumours to allow precise and/or total surgical excision and evaluation of disease stage. Ultrasound is one of the main imaging tools used today; it is a non-invasive technique that helps physicians to visualize the presence of the primary tumour [17]. Ultrasound can also be used to guide biopsies, minimising the risk of infections or other associated complications [18]. However, it is difficult to make a conclusive diagnosis of neuroblastoma with non-specific imaging techniques such as ultrasound [19].

For more sensitive and specific identification of tumours arising from sympathetic nervous tissue, the ability of neuroblastoma cells to accumulate neurotransmitters is exploited. For example, iodine-123 metaiodobenzylguanidine (123I-MIBG) is an analogue of the neurotransmitter, norepinephrine which, when administered systemically, can be accumulated by tumour cells of neuronal origin, allowing these tumours to be imaged by scintigraphy [20]. This technique not only gives some evidence that the observed tumours are neuronal in origin, it also detects distant metastases, allowing clinicians to determine the clinical stage [21]. Besides aiding in

4 disease diagnosis, 123I-MIBG imaging is also used to monitor response to therapy. Usually 123I-MIBG uptake reduces with treatment, indicating reduced disease burden which is correlated with better patient survival rates [22]. The limitation with 123I-MIBG imaging is that this technique generates 2-dimensional, planar images that do not give accurate details of the tumour location that are needed for surgical resection of the tumour.

The 3-dimensional location of neuroblastoma tumours can be pinpointed using positron emission tomography (PET) or computed tomography (CT) scans [23-25]. Similar to the 123I-MIBG scans, PET or CT also rely on accumulation of radiolabelled substrates inside neuroblastoma cells. The most commonly used substrates are 18F- fluorodeoxyglucose (FDG) or the neurotransmitter precursor, 18F-3,4- dihydroxyphenylalanine [21, 26].

1.3.2 Staging systems for spread of disease

The International Neuroblastoma Staging System (INSS) is a widely used staging system that was established in the 1980s and revised in the 1990s [27-29]. Patients are classified into one of 6 groups according to the extent of metastatic spread (Table 1.1) [29]. Based on this system, studies have reported that stage 4 patients have significantly worse outcome (five year survival 30-40%) than patients in the other groups who had five year survival rates of ≥75% [27, 30, 31]. This staging system has been shown to be beneficial to direct the types of treatment that patients can receive. For example, for stage 1-3 patients with localised disease, surgery alone was shown to significantly improve patient outcome [32].

The INRG staging system (INRGSS) is a pre-treatment staging system and it is advantageous over INSS in that classifying patients into the different stages is made prior to surgical resection of the primary tumour and secondary tumours in the surrounding region [33]. This prevents the staging to be affected by the amount of tumours excised by the surgeon which can vary greatly and make staging less accurate [33]. With the INRGSS, patients are classified into 4 stages; stage L1 (equivalent to INSS stage 1), stage L2 (equivalent to INSS stages 2 and 3), stage MS (equivalent to INSS stage 4S), and stage M (equivalent to INSS stage 4; Table 1.2) [33]. Similar to the INSS, early stage patients in the INRGSS groups L1 and L2 have very good prognosis with EFS >92% and OS>95% and surgery alone is of particular benefit to these patients

[34]. Together with other genetic and biological indicators of patient outcome, this staging system is used by doctors for risk stratification and selection of treatment strategies.

Table 1.1: Clinical stages of neuroblastoma based on the INSS classification system

INSS clinical stage Characteristics of INSS clinical stage

1 Localised tumour; complete gross resection

2A Unilateral tumour; incomplete gross resection; no lymph node involvement

2B Unilateral tumour; complete or incomplete gross resection; lymph node involvement

3 Tumour infiltrating midline and/or regional lymph node involvement

4S Localised tumour with dissemination only to skin, liver and bone marrow

4 Dissemination of tumour to bone, bone marrow, liver, distant lymph nodes and/or organs

This table lists a summary of the distinguishing characteristics for each stage based on the INSS classification system [29].

Table 1.2: Clinical stages of neuroblastoma based on the INRG staging system [33][33][33][33][33][33][33][33]

INRGSS Equivalent Characteristics of INRGSS clinical stage clinical stage INSS stage

L1 1 Localized tumour without image defined risk factors (IDRFs).

L2 2 or 3 Localised tumour with 1 or 2 IDRFs

M 4 Distant metastasis with non-regional lymph node involvement

MS 4S Metastatic disease with metastases confined to skin, liver and/or bone marrow, diagnosed younger than 18 months

This table lists a summary of the distinguishing characteristics for each stage based on the INRG staging system. An example of an IDRF would be the extent of tumour encasing the aorta and these factors are used to determine whether a tumour is able to be excised by surgery [33].

1.3.3 Serological diagnostic tests

Several serological markers obtained from the blood, serum or urine of patients can indicate the presence of neuroblastoma. Metabolites of the neurotransmitters dopamine and catecholamine can be easily measured by performing high-performance liquid chromatography (HPLC) on patients’ urine and blood samples. Neurotransmitter metabolites excreted in the urine include dopamine, vanillylmandelic (VMA) and homovanillic (HVA) acids. Detection of VMA in urine is a highly sensitive diagnostic tool with 80.7% sensitivity [35]. The sensitivities of homovanillic acid (HVA) and dopamine are lower, at 71.9 and 61.3% respectively [35]. The detection of their elevated levels in blood as opposed to urine samples can be used to identify patients with neuroblastoma with the best sensitivity of 100% [36]. Detection of VMA and HVA are routinely used for the diagnosis of neuroblastoma. Interestingly, the ratio of VMA to HVA can also be predictive of outcome such that patients with urinary VMA/HVA ratio

7 of less than 0.50 have greater chance of relapse than patients with a ratio greater than or equal to 0.50 [37].

Enzymes that are required for the metabolism of neuronal cells specifically, such as neuron-specific enolase (NSE), were also found to be elevated in patients with neuroblastoma compared to patients with the more benign ganglioneuroblastoma and can thus be used as a diagnostic marker of the disease [11]. NSE can be measured via immunoassays [38, 39]. With NSE, a serum level of the enzyme at > 30ng/ml is considered to be elevated and those neuroblastoma patients presenting with increased levels of the enzyme had significantly worse survival rates [37, 38]. Interestingly, patients who had a complete response to currently used treatment including multimodal chemotherapy, radiotherapy and surgery showed ~82% decrease in their serum NSE, suggesting this marker may also be used to monitor response to treatment [38].

Less specific markers for neuroblastoma such as serum ferritin and lactate dehydrogenase levels are also routinely measured as part of the diagnostic process. Studies have shown that elevated levels of these products are often detected in patients with advanced, INSS stage 4 neuroblastoma and are correlated with poor patient outcome [8, 40, 41]. While testing for serological markers of neuroblastoma is part of the diagnostic protocol and can assist in predicting patient outcome, it is not used as part of the formal risk classification systems.

1.3.4 Histopathology

In 1984, Shimada et al studied the histology of patient tumours and discovered that tumours containing a high proportion of undifferentiated, mitotic cells were associated with very poor outcome [42]. The Shimada histolopathological classification is routinely used for diagnosis and risk assessment of neuroblastoma (refer to Table 1.3) and fresh haematoxylin and eosin (H&E) stained patient biopsies can be used to diagnose neuroblastoma and predict patient outcome. In histopathology, three major features are examined and these are the mitosis-karyorrhexis index (MKI), which is the proportion of cells in mitosis, the degree of neuronal differentiation and the amount of Schwannian stroma [43, 44]. In addition, these analyses can be used to distinguish neuroblastoma from two other, less aggressive tumours derived from the neural crest, known as ganglioneuroblastoma and ganglioneuroma [11]. Neuroblastomas exhibit stroma-poor histology as opposed to these more benign tumours that tend to display a

8 stroma-rich or stroma-dominant histology [45]. Neuroblastoma patients who have particularly poor outcome tend to have intermediate to high MKIs and poorly differentiated tumours; however, the age of diagnosis is also taken into account to determine whether the histology is considered favourable (Table 1.3) [45]. For example, if the age of diagnosis is <1.5 years, poorly differentiated tumours with intermediate MKI can be considered favourable but if patients are between 1.5-5 years of age, tumours need to be differentiating with low MKI to be classified as favourable (Table 1.3) [45]. Studies have demonstrated that patients with favourable histology have four year overall survival of around 95% whereas that of patients with unfavourable histology is around 50% [30, 44, 45]. This suggests classifying patients based on histology can be used to accurately predict clinical outcome.

Table 1.3: Histological characteristics as predictors of outcome

Age at Histological features Outcome diagnosis

<1.5 years • Poorly differentiated or differentiating Favourable tumours

• Low to intermediate MKI • Undifferentiated tumours Unfavourable

• High MKI

1.5-5years • Differentiating tumours Favourable

• Low MKIs • Undifferentiated or poorly differentiated Unfavourable tumours

• Intermediate to high MKIs

>5years N/A Unfavourable, irrespective of histology

MKI stands for mitosis-karyorrhexis index (MKI) which is the proportion of cells in mitosis [45].

1.3.5 Age of diagnosis

Being a paediatric malignancy, age of diagnosis is one of the critical factors that determine a patient’s clinical outcome. Early studies have shown that children who are diagnosed with neuroblastoma over the age of one have poorer outcome compared to those diagnosed earlier in life, irrespective of stage or MYCN status [46, 47]. An age of diagnosis of later than 12 months has also been correlated with other poor prognostic factors such as unfavourable histology and late stage disease [30]. Subsequent studies confirmed that patients between the ages of 12-18 months have significantly better survival rate than those who are diagnosed at 18-24 months of age [31, 48] and that stage 4 patients who were older than 18 months had an EFS and OS of 28% and 31% respectively while those under 18 months had an EFS and OS of 63% and 68% respectively [3]. Therefore, an age older than 18 months rather than 12 months is now accepted as an indicator of poor outcome. Age of diagnosis is one of the major prognostic factors used to predict patient outcome and perform risk classification.

1.3.6 Analysis of chromosomal aberrations

Chromosome aberrations include changes in ploidy (chromosome copy number) and segmental chromosome aberrations (SCAs) and can be detected using array comparative genomic hybridisation (aCGH) or chromosomal microarray analysis (CMA). Both types of aberrations are powerful predictors of poor outcome in neuroblastoma. Neuroblastoma patients with diploid DNA in their tumour cells show significantly worse clinical outcome compared to patients with near triploid DNA [30, 49, 50]. SCAs are gains or losses of chromosomal segments in neuroblastoma and the most frequent SCAs include losses of 1p (26% of patients), 3p (7%), 4p (4%) or 11q (25%) and gains of 1q (26%), 2p (17.5%) or 17q (35%) [51]. Patients with SCAs have significantly worse EFS and OS compared to patients without SCAs [7, 31, 49, 51-53]. Interestingly, the number of SCAs also impacts prognosis such that patients with multiple SCAs have significantly poorer prognosis than those with a single SCA [51]. Chromosomal abnormalities are linked to poor cancer outcome because they typically carry genes that are relevant to cancer progression. For example, chromosome 2p carries the MYCN gene and gains in this gene is a major prognostic factor in neuroblastoma (see next 2 sections) [4, 54]. Loci 1p and 11q contain tumour suppressors such as CASP8, STMN1 and MLL while tumours with 17q gain overexpression of oncogenes such as NME1 and

PPRM1D which is why patients with these SCAs have significantly worse survival rates than those who do not [55, 56]. Out of the seven most common SCAs in neuroblastoma, deletion of 11q is the most powerful predictor of outcome [51]. This is partly because tumours with 11q deletions are more susceptible to chromosomal breaks (i.e. exhibit chromosomal instability) compared to tumours with other SCAs [57]. As loss of 11q, along with diploidy and MYCN amplification (discussed in the next section) hold significant prognostic and diagnostic value they constitute key molecular markers in the INRG risk classification system for neuroblastoma [16].

1.3.7 Major genetic aberrations of neuroblastoma

As research continues into the molecular drivers of neuroblastoma, many novel prognostic markers are being discovered. However, the presence of MYCN amplification is the only genetic aberration taken into account during risk assessment by clinicians. For this reason, tests to examine the MYCN amplification status of patients’ tumours are routinely performed. For patients with family history of neuroblastoma, the presence of the PHOX2B tumour suppressor is also examined.

1.3.7.1 MYCN amplification

The MYCN gene was discovered in 1983 when scientists found a region of DNA, related to the c-MYC oncogene, that was amplified up to 100-fold in a proportion of neuroblastoma cell lines, resulting in increases in MYCN mRNA levels [58]. Later the gene was found to be amplified in ~20% of newly diagnosed neuroblastoma tumours and in 45% of high-risk neuroblastomas [59]. The MYCN gene encodes the MYCN transcription factor which is a 66-kDa protein, belonging to the MYC family of basic- helix-loop-helix-leucine zipper transcription factors [60]. However, unlike c-MYC, which has a wide distribution across different types of adult tissues, MYCN is predominantly expressed in developing neural tissue and to a lesser extent in pre-B cells and the developing kidney and intestines [61]. Similar to its paralogue c-MYC, MYCN interacts with its cofactor MAX to bind to E-box sequences (e.g. CACGTG) in various gene promoters to activate the transcription of oncoproteins and repress the transcription of tumour suppressors that will ultimately enhance the aggressiveness of neuroblastoma [60, 62]. Thus, MYCN amplification was shown to be associated with more rapid disease progression and poor outcome and today, the presence of this amplification remains the most accepted single genetic biomarker for neuroblastoma and most

11 important objective molecular marker for poor neuroblastoma outcome [63]. Along with age of diagnosis, histology, tumour stage and chromosomal changes such as ploidy and 11q deletion, MYCN amplification in neuroblastoma tumours is also used for risk classification of neuroblastoma patients.

Tests to identify MYCN amplification in tumours are routinely used as part of the diagnostic protocol. Southern blotting was previously used to determine MYCN copy number but this technique is limited as it requires large amounts of tissue and results can be affected by contamination from stromal cells, blood cells and other non- neuroblastoma tissue resulting in relatively high false negative rates [64]. In contrast, fluorescent in situ hybridisation (FISH) is a technique that can detect changes in MYCN gene copy number by application of fine needle aspiration cytology (FNAC), which involves taking biopsies from the primary tumour site in the abdomen or common metastatic locations such as skin, inguinal lymph node, skull and bone marrow [65, 66] [67]. The sensitive FISH technique allows accurate identification of MYCN amplification early in the diagnostic process.

Although the survival rate for neuroblastoma patients in general has increased over the years, this has not been the case with patients who have MYCN-amplified tumours. A comprehensive study in 2009 found that even in non-stage 4 patients, the presence of MYCN amplification indicates five year EFS of 46% and OS of 53% whereas those without amplification of MYCN have much higher EFS (87%) and OS (95%) [3]. In 2017, despite improvements in treatment regimens throughout the 8 years since 2009, the survival rate for patients with MYCN-amplified neuroblastoma still remains unimproved at around 40% [68]. For this reason, finding better, more effective treatments for MYCN-amplified neuroblastoma is a focus of neuroblastoma research.

1.3.7.2 PHOX2B

Testing for PHOX2B positivity is routinely performed during the diagnostic process for patients with a family history of neuroblastoma [4]. PHOX2B is a homeodomain transcription factor and loss of function mutation in this gene accounts for 6.4% of inherited neuroblastoma [69]. PHOX2B is a master regulator of autonomic nervous system development and its role as a tumour suppressor is supported by evidence that forced PHOX2B overexpression reduced the growth rate of neuroblastoma cells whereas PHOX2B mutants did not have this effect [69, 70]. PHOX2B knockdown

12 increases neuroblastoma xenograft growth and metastasis to the lungs and bone marrow, thus supporting its role as a tumour suppressor in neuroblastoma [71].

In summary, the most powerful prognostic factors of those described above are used to determine a patient’s level of risk and type of therapy they require. The current pre- treatment risk stratification is based on the molecular profiles of tumours (MYCN amplification, diploidy, and 11q deletion), age of diagnosis, histologic category, grade of tumour differentiation, and tumour spread (INRG stage) [3, 16]. Characteristics that would classify patients into the high-risk category are listed in Appendix Table 1. Finding new ways of treating these patients is a key research focus as these patients often respond poorly to the available treatments. Over the years, various molecular drivers of high-risk neuroblastoma have been discovered. Although small molecule inhibitors for these aberrations are not FDA approved for neuroblastoma, participating in clinical trials of these agents may be beneficial for high-risk, relapsed or refractory patients with these molecular aberrations. These treatments will be discussed in the next section.

1.4 Current Treatments

The treatment of neuroblastoma currently involves four stages: surgery, induction chemotherapy, consolidation therapy and post-consolidation therapy. The type of treatment given to each patient is determined by the risk group to which they have been assigned. The characteristics revealed by the diagnostic tests described above enable clinicians to assign patients into the proper risk categories and administer appropriate treatments to each patient [72]. Usually, for children with low-risk localised disease, surgery is sufficient. If patients are placed in the high-risk category based on factors described in Appendix Table 1, high-dose chemotherapy is required. Currently, retinoic acid and anti-GD2 antibodies are the only molecular target-based therapies used as part of the standard regimen but upcoming agents have recently been shown to provide therapeutic benefit for those who have those specific molecular aberrations.

1.4.1 Surgery

Surgery is used for all stages of neuroblastoma; however, it is particularly beneficial for those with localised disease. A number of studies have demonstrated that surgery alone can cure localised neuroblastomas lacking MYCN amplification, particularly in infants (under 12 months of age). For example, stage 1 and 2 patients who received surgery

13 alone had a 4-year overall survival (OS) rate of 98-99% [73]. Furthermore, in patients with localised disease but without MYCN-amplification, the survival rate of those who received surgery alone was not significantly different from the survival rate of those who received chemotherapy as well [74, 75]. Recently, minimal invasive surgery, which involves inserting an optical port in the umbilicus and removing tumours using electrocautery or harmonic scalpel devices, has been reported to be effective with a five year OS of 97.7% in low-risk neuroblastoma patients [76]. This will further minimise the complications and trauma associated with the surgical procedures.

For patients with stage 4 or M disease, the benefit of surgery is debatable. Often a few rounds of induction chemotherapy (described below) are performed to reduce tumour burden prior to the application of surgery in these patients [77]. In a study with late stage neuroblastoma patients, no significant difference in OS was observed between patients who had complete tumour resection and those with macroscopic residue or those who only had a biopsy taken [78]. More recent studies have confirmed such findings. For example, Simon et al (2013) found that even when 90% of the primary tumour is resected after chemotherapy in stage 4 patients, the EFS or OS did not significantly improve [77]. A systematic review of the literature by Mullassery et al in 2014 showed that while the five-year OS of stage 3 patients can benefit from gross total resection of the tumour, the procedure made no difference in stage 4 or MYCN- amplified patients [79]. Put together, these studies indicate that while surgery is critical for those with localised disease, it is insufficient for patients with high-risk or metastatic neuroblastoma who require other forms of treatment to control their disease.

1.4.2 Induction chemotherapy

Current treatment of late stage neuroblastoma involves multiple cycles of induction chemotherapy to reduce tumour burden [80]. Induction chemotherapy for neuroblastoma consists of platinum-based therapies (cisplatin or carboplatin), alkylating agents (cyclophosphamide), anthracyclines (doxorubicin), epipodophyllotoxins (etoposide) and vinca-alkaloids (vincristine) [80-83]. Platinum-based therapies induce double strand crosslinks and the formation of adducts between GG and AG residues in the DNA [84-86]. The DNA damage caused by these agents activates apoptotic pathways in malignant cells more so than in healthy cells [85, 87]. Cyclophosphamide is a DNA methylating agent that elicits cytotoxicity by crosslinking the DNA. This drug

14 stimulates both DNA-DNA interstrand crosslinks and DNA-protein crosslinks that lead to single strand breaks and apoptosis [88, 89]. Both doxorubicin and etoposide stimulate topoisomerase-mediated DNA damage. Topoisomerases are enzymes that alter the topology of DNA by cleaving and rapidly re-ligating DNA [90]. Etoposide is thought to inhibit the ligation function of topoisomerase II and this stimulates both single strand and double strand breaks in the DNA, leading to apoptosis [91, 92]. Doxorubicin is known to intercalate into DNA and stabilize the DNA-topoisomerase cleavage complex, leading to double stranded breaks in the DNA [93, 94]. Interestingly, when given with the formaldehyde releasing pro-drug, AN-9, doxorubicin can induce DNA adducts and stimulate topoisomerase II-independent DNA breakage and apoptosis [95]. The mechanism of action of vincristine differs from other induction chemotherapeutics because it targets the microtubules instead of DNA. Like other vinca-alkaloids, vincristine binds to the ends of the microtubules, destabilizes the lateral interactions between protofilaments and increases tubulin depolymerisation [96-98]. These effects on the microtubules prevent proper formation of the mitotic spindle, leading to mitotic arrest and cell death [97-99]. Together, these five chemotherapeutics form the basis of the induction treatment regimen for neuroblastoma patients.

1.4.3 Consolidation therapy

After the bulk of disease has been eliminated with surgery and induction chemotherapy, consolidation and post-consolidation therapies are required to remove remaining neuroblastoma cells [72]. Residual neuroblastoma cells may arise due to intrinsic or acquired resistance to the induction chemotherapeutics. To remove these drug resistant cells, patients are treated with consolidation therapy that consists of high dose chemotherapy in combination with radiotherapy and followed by autologous stem cell transplantation.

1.4.3.1 Myeloablative chemotherapy

As part of the consolidation therapy, patients are given high dose chemotherapy which usually consists of carboplatin combined with etoposide and melphalan (CEM) [100, 101]. Carboplatin has a similar mechanism of action to cisplatin; however, compared to cisplatin, the induction of adducts and DNA crosslinking by carboplatin is much weaker [85]. The advantage is that carboplatin elicits fewer side effects than cisplatin so that higher doses can be given [14, 81]. Melphalan is an alkylating nitrogen mustard

15 derivative that elicits cytotoxic effects on cancer cells by inducing the formation of adducts and interstrand crosslinks in the DNA [102, 103]. Recently, a combination of busulfan and melphalan was found to be more effective than CEM as consolidation treatment for neuroblastoma [104]. Like melphalan, busulfan kills malignant cells by targeting the DNA but it preferentially induces intrastrand crosslinks at the GA or GG residues [105, 106].

1.4.3.2 Radiotherapy

Radiotherapy is often used in combination with dose intensive chemotherapy. 131Iodine labelled metaiodobenzylguanidine (131I- MIBG) was the first move towards targeted therapies for neuroblastoma because like other neural crest-derived tissues, most neuroblastoma tumours accumulate MIBG through their nor-epinephrine transporters, which are not expressed in most other tissues [104, 107]. External beam radiation of the primary tumour can extend five-year EFS from 29% to 45% [108]. Furthermore, high- risk neuroblastoma patients who received 131I-MIBG treatment had significantly improved relapse-free survival that was characterised by the absence of non- haematological toxicities upon combination with high dose chemotherapy [109, 110]. In addition, Lutetium 177-dotatate, a somatostatin receptor analogue linked to radionuclide currently being developed might be suitable for treating patients resistant to 131I-MIBG [111].

1.4.3.3 Autologous stem cell transplant

Since the primary aim of consolidation therapy is to remove any micro-metastases such as those typically occurring in the bone marrow, the high dose chemotherapy used as part of the consolidation therapy is given sufficient intensity to cause myeloablation. Immunosuppression caused by myeloablation can result in severe infections such as septicaemia [112]. To rebuild haematopoietic capacity in the bone marrow, haematopoietic stem cell transplant is usually given after the high dose consolidation chemotherapy. Originally, bone marrow stem cells were used for transplantation [113, 114]. The bone marrow was usually collected after several cycles of induction chemotherapy and transplanted back into the patients. Matthay et al (1999) found that patients had improved survival rates when treated with high dose chemotherapy in combination with autologous bone marrow transplant (three year EFS of 34%) compared to those treated with chemotherapy alone (three-year EFS of 22%) [113].

However, bone marrow transplants take a long time to engraft causing slow haematopoietic recovery and sepsis still occurs in about 50% of patients [113, 114]. Therefore, peripheral blood stem cells are now increasingly being used, offering faster haematopoietic recovery (<15 days) and fewer cases of sepsis [115].

1.4.4 Post-consolidation therapy

Post-consolidation therapy is the third stage of therapy for neuroblastoma and aims to further remove minimal residual disease and prevent relapse. It involves the use of cis- retinoic acid, anti-GD2 antibodies and cytokines such as interleukin 2 and granulocyte- macrophage colony-stimulating factor.

1.4.4.1 Retinoid therapy

Retinoic acid was one of the first agents used to treat minimal residual disease. Retinoic acids are derivatives of vitamin A that can reduce MYCN protein expression, impair cell proliferation and induce neuronal differentiation [116]. Both cis- and trans-retinoic acids possess these properties in vitro but 13-cis-retinoic acid is much more stable and elicits more tolerable side effects in vivo than trans-retinoic acids [117]. When 13-cis- retinoic acid entered the clinic, the results were highly promising. The use of 13-cis retinoic acid dramatically improved five-year EFS and OS of high-risk neuroblastoma patients compared to those who received continuation of chemotherapy or radiotherapy [108, 113]. For post-relapse patients in remission, combining 13-cis retinoic acid with immunotherapies has been found to extend EFS and OS further [118]. For this reason, 13-cis-retinoic acid and the immunotherapies described below form the basis of the current post-consolidation therapy for neuroblastoma patients.

1.4.4.2 Immunotherapies

Over the past decade exploiting the patient’s immune system has become a promising novel therapeutic approach for adult and paediatric malignancies. Immunotherapies currently in development encompass immune checkpoint inhibitors as well as antibodies or chimeric antigen T (CAR-T) cells targeting tumour-specific antigens to activate cytotoxic T cells against tumour cells [119, 120]. While some of these therapies are in pre-clinical development for neuroblastoma, the most successful immunotherapy for this paediatric malignancy constitutes monoclonal antibodies directed against the cell surface ganglioside, GD2. Since the 1980s, neuroblastoma cells and tumours have been

17 known to express high levels of GD2 whereas the distribution of GD2 in normal tissues is limited to melanocytes, neurons and peripheral pain nerves [121]. Neutrophils, macrophages and monocytes stimulated by anti-GD2 antibodies can induce lysis of tumour cells through a mechanism called antibody-dependent cell-mediated cytotoxicity (ADCC) [122]. Many generations of antibodies against GD2 have been developed and are relatively well tolerated. Dinutuximab (Ch14.18), a chimeric human–murine anti- GD2 monoclonal antibody, is highly efficacious in clinical studies in neuroblastoma. When dinutuximab is given in combination with irinotecan and temozolomide to stage M neuroblastoma patients, 53% of patients reached objective responses (either partial or complete response) compared to 6% of patients in the group receiving the irinotecan- temozolomide-temsirolimus combination [123]. Combining dinutuximab with cytokines can potentiate its anti-tumour effect. For example, Yu et al (2010) found that patients treated using dinutuximab in combination with co-stimulatory cytokines interleukin-2 (IL-2) and granulocyte-macrophage colony-stimulating factor (GM-CSF), had significantly better two-year EFS (66%) compared to those treated with retinoic acid alone (EFS of 46%) [124]. The use of dinutuximab in combination with GM-CSF and IL-2 has recently received FDA approval for neuroblastoma [125, 126]. Other anti- GD2 antibodies have shown similar efficacy, particularly in patients in second remission [118, 127].

1.4.5 Treatment regimen for relapsed or refractory disease

For patients with relapsed or refractory (resistant to induction therapy) neuroblastoma, treatment options can be limited. The standard therapy for these patients involves administration of cyclophosphamide or the related drug, temozolomide, in combination with either of the topoisomerase inhibitors, topotecan or irinotecan [15, 128, 129]. Topotecan elicits cytotoxic effects by increasing the binding of topoisomerase I to the DNA and stimulating topoisomerase I-mediated DNA cleavage [130]. Irinotecan has a very similar mode of action but has been shown to be more potent than topotecan [131]. While this regimen shows some degree of success for patients with relapsed disease, treating relapsed neuroblastoma remains a major challenge. Over the past few years, a number of new molecular target-based agents have been tested in patients with relapsed or refractory neuroblastoma and several of these agents have shown some promising results in improving survival rates in these patients.

1.4.6 Side effects of current treatment

With the exception of anti-GD2 monoclonal antibodies and retinoic acid, the treatment of neuroblastoma is primarily composed of chemotherapy and radiotherapy that indiscriminately targets all proliferating cells. Therefore, toxic side effects pose a major problem associated with high dose chemotherapy and radiotherapy. Haematological disorders such as neutropenia (abnormally low levels of neutrophils) and leukopenia (reduction in the number of white blood cells) remain the most common side effects associated with chemotherapy [132]. A range of non-haematological side effects can also occur with chemotherapy. For example, hearing impairment and speech disabilities can stem from the use of cisplatin, however, these effects are less severe when patients are treated with carboplatin [132, 133]. Following hearing loss, the next most common side effects of chemotherapy include endocrine complications such as dependent diabetes, severe hypoglycaemia and delayed puberty [133]. Occasionally, the use of chemotherapeutics such as etoposide can also lead to the formation of secondary malignancies such as acute myeloid leukaemia [5, 134]. Toxicity can also be caused by radiotherapy. High-risk neuroblastoma patients who have received total body irradiation are more likely to experience severely impaired dental development compared to patients who have only received high dose chemotherapy and autologous stem cell transplant [135, 136]. Combining standard chemotherapeutics and radiotherapy with new molecular-based therapies may reduce the dosage of each treatment and the severity of the associated side effects. For this reason, the search for molecular-based therapies has become a major focus of research into potential therapeutics for neuroblastoma.

1.5 Targeting key molecular drivers of neuroblastoma

Over the past few years, several molecular drivers of neuroblastoma progression have been identified and a number of small molecule inhibitors have been developed to target these specific molecular aberrations. Although none have received FDA approval for use in neuroblastoma patients, some of the inhibitors in clinical trials for other malignancies are showing promising results, particularly when combined with standard chemotherapy. Ongoing preclinical studies are occurring alongside for most of these inhibitors to find regimens that further enhance their potency.

1.5.1 ALK activating mutations and their inhibitors

Activating mutations in the ALK gene are the most common cause of hereditary neuroblastoma [137]. Point mutations, copy number gain or amplification of ALK are associated with increased mortality [137, 138]. ALK encodes a receptor tyrosine kinase called anaplastic lymphoma kinase. Aberrations in ALK can arise from germline or sporadic mutations and about 25% of neuroblastomas harbour increased ALK gene copy number [139]. Point mutations in ALK occur in about 6-8% of neuroblastomas with the most common mutation occurring at R1275 (responsible for 43% of all point mutations), followed by F1174 (30% of all point mutations) and F1245 (12% of all point mutations) [138, 140]. The F1174L and R1275Q mutations possess gain of function kinase activity [141] and siRNA-mediated knockdown of the F1174L mutated ALK increased apoptosis and reduced cell growth in neuroblastoma cell lines and neuroblasts that rely on ALK hyperactivity [141, 142]. Similarly, the ALK R1275Q mutation was shown to down-regulate genes involved in adhesion to the extracellular matrix, thus promoting metastasis and tumour penetrance [143]. ALK hyperactivity can drive cell growth by up-regulating MYCN transcription and activating downstream oncogenic pathways including Ras/Raf/MEK; JAK/STAT and PI3K/AKT [144]. These observations suggested that inhibiting ALK activity might help treat patients with activating ALK mutations in their tumours.

Several ALK inhibitors have been tested against neuroblastoma but their clinical efficacy for this disease is yet to be demonstrated. Crizotinib has so far been the most promising ALK inhibitor. For certain adult cancers (e.g. non-small cell lung carcinoma with ALK mutations), crizotinib is an FDA approved inhibitor of ALK, MET and ROS1 kinases and has been tested in phase I/II clinical trials for paediatric malignancies including relapsed neuroblastoma [145, 146]. The first paediatric clinical trial showed that the inhibitor was well tolerated but while it was effective for anaplastic large cell lymphoma, only 9% of patients with neuroblastoma had responded and 70% of patients still had progressive disease (the remaining patients had stable disease) [145]. Other ALK inhibitors that have demonstrated promising results against neuroblastoma in preclinical studies include ceritinib (currently in a clinical trial for neuroblastoma NCT02780128), PF-06463922, PF-2341066, alectinib and TAE684 [139, 144, 147- 149]. Preclinical studies have shown multiple ways of potentiating the efficacy of ALK inhibitors. For example, cyclophosphamide and topotecan can potentiate the anti-

20 tumorigenic effects of crizotinib against xenografts of neuroblastoma cell lines with various ALK mutations [150]. Another method of potentiating the efficacy of crizotinib is by increasing its systemic availability. This can be achieved by dual inhibition of ABCG2 and ABCB1 by the compound elacridar, which increases the plasma concentration of crizotinib in mice [151]. Stabilising p53, by using an inhibitor of MDM2 known as CGM097 potentiated the effects of ceritinib in pre-clinical models [147], as did blocking cell proliferation by targeting cyclin dependent kinases CDK4 and CDK6 with ribociclib in neuroblastoma xenograft models [152]. Given that ALK inhibitors such as crizotinib are well tolerated in children and a substantial proportion of neuroblastomas exhibit hyperactive ALK mutations, finding methods of potentiating the efficacy of ALK inhibitors in neuroblastoma patients is worthwhile and might improve current treatment strategies for the disease.

1.5.2 Targeting the RAS/Raf/MEK/ERK (MAPK) pathway

Activating mutations in the RAS-Raf-MEK-mitogen-activated protein kinase (MAPK) pathway are rare events in neuroblastoma but their presence potently drives the malignant phenotypes of neuroblastoma [153]. Growth factor receptors such as EGFR can activate the small guanosine triphosphatase RAS that activates MAPK kinases (such as MEK) which then activate MAPKs that include ERK1, ERK2 and ERK5, as well as the c-Jun amino-terminal kinases (JNK1, JNK2 and JNK3) and p38 kinases [154]. These MAPKs can promote the transcription of a variety of oncogenes to support tumour progression [154]. Neuroblastomas that depend on hyperactivated RAS/MAPK can be particularly susceptible to its blockade. For example, inhibition of RAS activity in neuroblastoma increased the levels of the CDK inhibitor p27 to block G1-S phase transition and reduce cell growth [155, 156]. Detrimental effects on cell growth can also stem from the reduction in MYCN expression and activity of the cell cycle promoters, Rb and E2F1 that occur in response to RAS inhibition [155]. Besides cell growth, an active RAS/MAPK pathway is also required for TrkB- and brain derived neurotrophic factor (BDNF)-induced cell migration and invasion of extracellular matrix [157]. Another mechanism by which the RAS/MAPK pathway can support neuroblastoma progression is by stimulating the activity of other oncogenic pathways such as the PI3K/AKT/mTORC1 pathway [158]. Therefore, since hyperactivation of the RAS-Raf- MEK-MAPK pathway can promote aggressive phenotypes in neuroblastoma cells

21 leading to tumour progression, inhibitors of this pathway can potentially offer therapeutic benefit for patients with activating mutations in this pathway.

Several inhibitors of the RAS/Raf/MEK/ERK (MAPK) pathway have been tested in preclinical models for neuroblastoma, with trametinib entering clinical trials for paediatric malignancies including neuroblastoma (NCT02780128; NCT02124772). Trametinib is a MEK inhibitor (FDA approved for certain adult cancers) that reduces phosphorylation of ERK and exerts anti-growth effects at nanomolar concentrations against a variety of neuroblastoma cell lines with RAS/MEK/ERK activation [159, 160]. Since RAS activation can also stimulate the activity of the PI3K/AKT/mTOR pathway, the efficacy of trametinib can be potentiated with mTOR inhibitors such as metformin [160]. Binimetinib is another inhibitor of MEK that induces apoptosis in a variety of neuroblastoma cell lines and synergises with the CDK4/6 inhibitor, ribociclib, in neuroblastoma xenografts in vivo [161, 162]. However, unlike trametinib, this inhibitor has not made it to clinical trial for neuroblastoma. Targeting multiple proteins in the signalling cascade has been reported to be more effective than targeting MEK itself. For example, when tested against a panel of neuroblastoma cell lines with RAS/ERK activation, the dual RAF/MEK inhibitor CH5126766 more potently reduced the viability of neuroblastoma cells (IC50<50nM) compared to trametinib (IC50>100nM) [159]. These studies show that targeting the RAS/Raf/MEK/ERK pathway is worth further investigation as a novel therapeutic option for neuroblastoma patients with activation of this pathway.

1.5.3 Inhibitors of cyclin dependent kinases (CDKs)

Suppression of cyclin-dependent kinase 2 (CDK2) is known to reduce the growth of neuroblastoma cells by inhibiting the transition from G1 to S phase [163]. CDK2 inhibitors have now been tested for neuroblastoma in pre-clinical studies. One of these, AT7519, is cytotoxic particularly to MYCN-amplified neuroblastoma cell lines and exerts potent anti-tumorigenic effects against neuroblastoma xenografts and tumours in the genetically engineered TH-MYCN mouse model [164]. The dual CDK2 and CDK9 inhibitor, dinaciclib, exerts similar anti-growth effects on neuroblastoma cells and tumours but unlike AT7519, dinaciclib is able to inhibit the growth of neuroblastoma cells and tumours lacking MYCN-amplification [165]. Dinaciclib also potentiates the chemotherapeutic etoposide [165]. Other cyclin dependent kinases including CDK4 and

CDK6 can cooperate with cyclin D to phosphorylate RB, which then activates E2F to promote G1-S phase cell cycling [166]. Ribociclib targets CDK4 and CDK6 and exerts potent anti-growth effects against neuroblastoma cell lines, particularly those with RAS/MAPK mutations [162]. Ribociclib induces cell cycle arrest and tumour growth delay in neuroblastoma xenografts and synergises with the MEK1/2 inhibitor, binimetinib [162]. Ribociclib (LEE011) is currently in clinical trials for neuroblastoma (NCT01747876).

1.5.4 Activating p53 as a therapeutic strategy

Mutations in TP53 that encodes the p53 tumour suppressor are typically rare events in neuroblastoma. These loss-of-function mutations have been reported in only 2.4% of neuroblastoma samples taken at diagnosis, with an increase in the proportion of tumours showing TP53 mutations up to 15% in relapsed neuroblastoma patients [167, 168]. The p53 transcription factor acts as a tumour suppressor in multiple ways [169]. Activated p53 can increase the levels of the CDK inhibitor p21 to block cell cycle progression or increase the level of BAX and PUMA to induce apoptosis in neuroblastoma cells [170]. It also transcribes micro RNAs that induce differentiation of neuroblastoma cells [171]. Interestingly, p53 is directly up-regulated by the MYCN oncoprotein [172]. While this may seem counterintuitive, it has been hypothesized that rapid cell proliferation stimulated by MYCN causes a DNA damage mediated stress response, leading to activation of p53 and induction of apoptosis to prevent normal cells transforming into cancerous cells [173].

While loss-of-function mutations in TP53 can signify poor outcome, it is important to note that the vast majority of neuroblastoma tumours have wildtype p53. Patients with tumours wildtype for p53 can benefit from agents that enhance the activity of p53. A critical regulator of p53 activity is the E3 ubiquitin ligase, MDM2, which targets p53 for proteasomal degradation. Thus, due to its role in destabilising p53, MDM2 is linked to malignant phenotypes in neuroblastoma [174]. In relapsed neuroblastoma patients with wildtype p53, abnormalities in regulators upstream of p53, such as amplification of MDM2 were common [168] and MDM2 knockdown in neuroblastoma cells reduced cell growth by increasing the stability and expression of p53 [175, 176]. Therefore, targeting MDM2 to activate p53 may be a good therapeutic strategy that would be beneficial to the majority of neuroblastoma patients.

The most advanced inhibitor of MDM2 is a pyrrolidine called RG7112 (Nutlin-3a). This compound binds to and inhibits the function of MDM2 to stabilize p53 and reduces viability of neuroblastoma cells whilst inducing their differentiation [171]. In SH-SY5Y neuroblastoma xenografts, RG7112 reduces VEGF secretion by the neuroblastoma cells and potentiates the anti-tumorigenic effects of the therapeutic anti-VEGFR antibody, bevacizumab [177]. RG7388 is a second generation MDM2-p53 antagonist that exerts potent cytotoxic effects against a variety of p53 wildtype neuroblastoma cell lines (IC50<200nM) through up-regulating pro-apoptotic proteins such as PUMA [178]. This compound also potentiates the effect of temozolomide in vitro, a standard chemotherapeutic for patients with relapsed neuroblastoma [178]. Inhibitors of MDM2 currently in clinical trials are mostly administered for haematological malignancies but one trial is now underway for neuroblastoma (NCT02780128).

1.5.5 The PI3K/AKT pathway and its inhibitors

Neuroblastoma can exhibit hyperactivation of the PI3K/AKT/mTOR pathway. About 60% of primary neuroblastomas have constitutive phosphorylation of AKT at either S473 or T308 residues, indicating AKT activation, and these patients have significantly worse EFS and OS compared to those who lack activation of this pathway [179]. Phosphatidylinositol-3-kinase (PI3K) is a lipid kinase that phosphorylates membrane phospholipids, which in turn stimulates the phosphorylation and activation of AKT [180]. AKT has over 20 downstream targets, some of which have oncogenic effects in neuroblastoma cells and tumours [181]. For example, MYCN stability can be sustained through activation of the AKT pathway [182]. This occurs when AKT phosphorylates and inactivates GSK3β which in turn prevents GSK3β from phosphorylating and destabilizing MYCN [183]. MYCN is a major driver of neuroblastoma progression (described in the next section) [4, 72, 184]. Activation of the PI3K/AKT/mTOR pathway in neuroblastoma can also increase secretion of the pro-angiogenic factor, vascular endothelial growth factor (VEGF) [182]. One of the downstream targets of AKT, mammalian target of rapamycin complex 1 (mTORC1) can up-regulate anabolic processes including the synthesis of lipids, nucleic acids and proteins to provide the essential building blocks for cancer growth [185]. Consistent with this, inhibition of this pathway can reduce the tumour burden in neuroblastoma xenografts [186].

Over recent years, many inhibitors targeting the phosphatidylinositol-3-kinase (PI3K)/AKT/mammalian target of rapamycin (mTOR) pathway have been developed based on its reported role in cancer progression. As a large proportion of neuroblastomas exhibit hyperactivation of this pathway, these inhibitors are being tested for their therapeutic potential in this disease. Because the PI3K/AKT/mTORC1 pathway regulates several metabolic processes in the cell, inhibitors exert anti-tumorigenic effects through various mechanisms. Since AKT can stabilize MYCN through GSK3β, certain inhibitors of AKT such as NBT-272 can decrease the level of MYCN expression and this potently blocks the progression of neuroblastoma tumours in pre-clinical models [187]. Similar to AKT inhibition, targeting PI3K with the inhibitor, LY294002, can inhibit the growth of neuroblastoma cells and tumours in part through destabilization of MYCN [188], although LY294002 seems effective against neuroblastomas regardless of MYCN status [189]. The AKT inhibitor, MK2206, reduces the growth of neuroblastoma tumours by inducing the production of reactive oxygen species and has synergistic effects with the commonly used standard chemotherapeutic, etoposide [190]. Blocking mTORC1 activity with rapamycin or its analogues, such as CCI-779, everolimus or INK128, impairs glucose metabolism and VEGF secretion and also targets neuroblastomas with NRAS mutations [158, 186, 191].

Recently, several inhibitors of the PI3K/AKT/mTORC1 pathway have been tested in clinical trials for neuroblastoma. For example, MK-2206 has been tested in phase I clinical trials in paediatric oncology but the results were somewhat disappointing as no objective responses were achieved (only stable disease) [192]. The mTOR inhibitor temsirolimus has also been tested in a clinical trial for paediatric malignancies. In this trial, temsirolimus was administered in combination with the AKT inhibitor, perifosine but none of the four neuroblastoma patients responded to the treatment [193]. Combining inhibitors of this pathway with standard chemotherapeutics may slightly improve response rate. For example, in 18 relapsed or refractory neuroblastoma patients, temsirolimus when administered in combination with irinotecan and temozolomide gave a partial response in 1 patient [123]. However, in this study, 8 of the 18 patients experienced serious side effects, including grade 3 or 4 neutropenia [123]. These studies suggest that while targeting the PI3K/AKT/mTORC1 pathway reduces malignancy in preclinical neuroblastoma models, their effectiveness in neuroblastoma patients is yet to be demonstrated.

1.5.6 MYCN and its inhibitors

1.5.6.1 Contribution of MYCN to normal development

Although MYCN is widely recognised as driver of neuroblastoma progression and amplification of the MYCN gene is one of the key prognostic factors of poor clinical outcome in neuroblastoma, it is important to note that appropriate and timely expression of MYCN is necessary for normal development. As a transcription factor in neural progenitor cells, MYCN is associated with differential regulation of genes required for normal neural differentiation and proliferation such as CDC2L2, CD44 and HOXC10 [194]. Knockout models of MYCN in mouse embryos have indicated that MYCN is necessary for normal embryonic development of the neuronal system: knockout of the gene led to problems with the development of the brain and eyes, ataxia and behavioural abnormalities and was lethal at embryonic stage [61]. After embryonic development, the level of MYCN gradually reduces so that its expression is repressed in most adult tissues [195].

1.5.6.2 MYCN amplification, overexpression and hyperactivity are linked to neuroblastoma progression

As discussed above, MYCN amplification is strongly prognostic of poor clinical outcome such that even nowadays patients with MYCN-amplified neuroblastoma tumours have a five-year survival rate of around 40% compared to over 80% for patients lacking this aberration [68]. Despite the power of MYCN amplification in predicting poor outcome, it is important to note that MYCN hyperactivity can occur in the absence of MYCN gene amplification. One reason for this phenomenon is that overexpression of the MYCN protein can occur in neuroblastomas without MYCN- amplification [196]. This is clinically relevant as MYCN overexpression was shown to be predictive of poor outcome in patients without MYCN amplification [197]. The level of MYCN protein and thus MYCN activity can be increased by factors that block MYCN degradation, such as through the mitotic kinase, Aurora kinase A, which stabilizes MYCN by preventing its degradation by the ubiquitin ligase, FBXW7 [198, 199]. Expression of co-activators (such as MAX) and co-repressors (MAD) also dictate the activity of MYCN such that high levels of MAX can increase MYCN activity whereas high levels of MAD can reduce transcriptional activation by MYCN [60, 200, 201]. Hence, hyperactivity of the MYCN transcription factor can occur independently

26 from MYCN gene amplification and MYCN activity becomes a more accurate predictor of clinical outcome. A number of studies have demonstrated this concept by examining the correlation between MYCN activity (measured by the expression of MYCN regulated genes) and clinical outcome. Fredlund et al (2008) showed that overexpression of MYCN target genes correlates with increased relapse and reduced survival in neuroblastoma patients whereas low expression of MYCN target genes is associated with neuronal differentiation and better clinical outcome [202]. These data are supported by another study that showed how activation of a set of MYCN target genes, known as a ‘MYC activity signature’, can be used to predict poor clinical outcome in neuroblastoma patients, regardless of MYCN amplification status [203]. More recently, similar findings have been reported in MYC-driven adult cancers in addition to neuroblastoma [204]. These findings raise the possibility that targeting factors that regulate MYCN activity or the downstream MYCN regulated pathways could potentially be just as potent as reducing the expression of the MYCN transcription factor itself.

One of the reasons as to why MYCN deregulation can lead to neuroblastoma development and progression is that MYCN, like c-MYC, regulates cancer associated pathways such as cell proliferation, apoptosis and tumour metastasis, as well as metabolic processes that support persistent growth and spread of neuroblastoma through generation of nucleotides and proteins [205-207]. MYCN and c-MYC share many common downstream target genes and can functionally replace each other in neuroblastoma [184, 208]. Studying downstream molecular pathways up-regulated by MYCN becomes therapeutically important because targeting the MYCN protein itself has challenges (as described in section 1.6.6.4) and blocking MYCN up-regulated pathways can be an effective method of stopping the progression of MYCN-driven neuroblastoma.

1.5.6.3 MYCN promotes malignant transformation, tumour growth and metastasis

The direct oncogenic effects of MYCN on cell transformation, cell proliferation, tumour growth and metastasis have been studied intensively over the past few decades. The role of MYCN in malignant transformation was demonstrated by the TH-MYCN mouse model, in which forced MYCN expression in non-malignant neuroectodermal cells transformed these cells into malignant neuroblastoma [184].

In this transgenic mouse model, MYCN is regulated by a tyrosine hydroxylase (TH) promoter, thus selectively targeting MYCN expression to neuroectodermal cells [184]. This TH-MYCN mouse model is now widely used within the neuroblastoma research domain as the development and progression of the resulting neuroblastoma in the mice closely resembles the human disease driven by MYCN amplification [184]. More recently, the ability for MYCN to drive malignant transformation has been demonstrated in another model. Upon forced MYCN expression, primary neural crest cells isolated from mice can also be transformed into neuroblastoma cells capable of forming tumours when xenografted into immunocompromised mice [209]. The genetic make-up of these tumours closely resembled that of human neuroblastoma [209]. These two models together demonstrate that MYCN can promote the transformation of non- malignant neural crest-derived cells into neuroblastoma.

Genome wide mRNA expression analyses performed in neuroblastoma cell lines and patient tumours have shown that MYCN up-regulates a number of genes needed for cell cycle progression [210, 211]. These MYCN targets include Cdc25A, which is needed for G1-S phase transition, and Cdc6/7, which is needed for DNA replication [210, 211]. Supporting these findings, MYCN knockdown in neuroblastoma cells reduced levels of proteins involved in cell cycling (such as CDK6 and cyclin E), blocked the G1 to S phase transition and ultimately slowed neuroblastoma tumour growth [142, 212, 213]. As discussed above, several inhibitors targeting CDKs, including the MYCN-target gene CDK6, have been tested in neuroblastoma with some, such as ribociclib, entering clinical trials.

Besides malignant transformation and unlimited growth, MYCN has been shown to promote the various cellular processes that contribute to tumour metastasis. Tumour metastasis requires the detachment of cancer cells from the basement membrane; acquiring a mesenchymal phenotype; intravasation and extravasation; invading into secondary locations before forming secondary tumours [214]. MYCN supports tumour metastasis by reducing the attachment of cells to the basement membrane and allowing them to migrate to secondary locations [215]. The transcription factor also represses the expression of anti-metastatic proteins such as CD9 and the metastatic suppressor NDRG1 to enhance metastasis [216, 217]. To date, no agents targeting metastasis been tested in neuroblastoma.

1.5.6.4 Direct inhibitors of MYCN activity, transcription and MYCN destabilisers

Given that the activity of MYCN is largely dictated by its interaction with MAX, targeting this interaction has been a rational therapeutic strategy for neuroblastoma. However, this has proven to be technically challenging [200]. Firstly, MYC transcription factors and MAX have an extensive interaction surface area that is stabilized by hydrophobic interactions and extensive hydrogen bonds [218]. It is difficult for small molecules, with their small interaction surface, to disrupt the multiple interactions that exist in protein-protein binding. Furthermore, protein-to-protein interfaces are often flat with no pockets for small molecule inhibitors to bind [219]. Nevertheless, several MYCN/MAX disruptors have been discovered over the years, the first being 10058-F4. Identified through a yeast two-hybrid assay system, the compound was effective in reducing the in vitro growth of certain adult cancer and neuroblastoma cells in a MYC dependent manner [201, 220]. However, the MYCN/MAX disruptors, including 10058-F4, have high half maximal inhibitory concentrations (IC50s) in the range of 40-64 µM and the compounds exerted no anti-growth effects in vivo [201, 220, 221]. To date, no small molecules targeting the MYCN/MAX interaction have shown in vivo pre-clinical efficacy nor progressed to clinical trials.

Other methods of directly inhibiting MYCN activity are now being explored as therapeutic strategies for neuroblastoma. These include i) inhibiting the transcription of the MYCN gene and ii) enhancing MYCN protein degradation. One approach to suppress MYCN transcription is by disrupting the binding of bromodomain and extra- terminal domain (BET) proteins (BRD2, BRD3 and BRD4) to acetylated histones located upstream of growth-promoting genes. Binding of BET proteins to these acetylated histones would normally activate RNA polymerase II and the expression of several oncogenes including MYCN. Therapeutics such as JQ1 and OTX015 competitively block the binding of BRD4 to promoters upstream of oncogenes such as MYCN [222]. Consequently, these small molecule inhibitors have shown anti-tumour effects in MYC-driven tumours including neuroblastoma [223-225]. Another chromatin-associated protein that up-regulates the transcription of MYCN is Facilitates Chromatin Transcription (FACT) [226]. The curaxin, CBL0137, is able to modulate the function of FACT and alter chromatin conformation in a manner that reduces MYCN transcription [226, 227]. This leads to reductions in neuroblastoma cell and tumour growth and lengthens the survival of neuroblastoma-bearing mice [226]. CBL0137 also

29 potentiates the anti-tumorigenic effects of cisplatin, etoposide, vincristine, temozolomide and cyclophosphamide [226]. CBL0137 is currently in a phase I clinical trial in adults.

Inhibiting the activity of MYCN can also be achieved by reducing the stability of the MYCN protein. The mitotic kinase, Aurora kinase A, directly interacts with the ubiquitin ligase, FBXW7, to block the degradation of MYCN [198]. Consequently, targeting Aurora kinase A can destabilize and reduce the level of MYCN protein. At nanomolar concentrations, Aurora kinase A inhibitors, such as MLN8054 and MLN8237, are effective in reducing the levels of MYCN protein and this inhibits the growth of MYCN-amplified neuroblastoma cells and tumours [198, 199, 228, 229]. Aurora kinase B inhibitors have also been tested pre-clinically in neuroblastoma but these compounds do not seem to reduce MYCN expression; instead their mechanism of action lies in the up-regulation of p53-mediated apoptosis [229]. MLN8237, also known as alisertib, has been tested in neuroblastoma patients but as a single agent, it has limited efficacy with the best response being stable disease [230]. However, when combined with irinotecan and temozolomide in patients with relapsed or refractory neuroblastoma, 31.8% of patients reached objective response with 22.7% of patients showing complete response [231]. A Phase II clinical trial of alisertib in neuroblastoma is currently ongoing. In all, the studies conducted so far imply that targeting Aurora kinases could lead to a promising method of treating advanced neuroblastoma.

1.5.6.5 Downstream metabolic pathways regulated by MYCN

The methods of inhibiting MYCN driven tumour progression described above are focused on reducing the activity of the MYCN protein itself. However, MYCN can also up-regulate a number of downstream metabolic pathways and inhibition of certain of these can offer selective anti-cancer effects against MYCN-amplified neuroblastoma [232-235]. Since MYCN up-regulates numerous downstream pathways, each consisting of individual molecular targets, identification of a single molecular target that, upon its inhibition, will counteract the pleiotropic effect of MYCN hyperactivity and halt MYCN-driven neuroblastoma progression is difficult. To find such a molecular target requires a thorough understanding of the metabolic processes heavily reliant upon MYCN in MYCN-driven neuroblastomas, without which these cancer cells cannot survive.

Besides directly enhancing expression of proteins that promote cell growth and migration, MYCN can support tumour progression by up-regulating metabolic processes that provide energy, nucleotides and proteins needed for tumour growth and metastasis. Cancer cell metabolism is one of the critical processes regulated by MYCN and c-MYC transcription factors [206]. Relevant metabolic processes include the breakdown of glucose, amino acids and fatty acids to generate ATP as well as anabolic processes such as the synthesis of molecules like DNA, RNA and proteins.

1.5.6.5.1 Targeting MYCN-driven energy production

The breakdown of glutamine (glutaminolysis) to generate energy is a catabolic process known to be driven by c-MYC and MYCN [236, 237]. During glutaminolysis, glutamine is converted by glutaminases into glutamate, which is then converted into α- ketoglutarate that then enters the tricarboxylic acid (TCA) cycle. Overexpression of c- MYC increases glutaminolysis whereas its knockdown impairs the process in c-MYC driven cancer cells such as those derived from glioma [236, 238]. Glutaminolysis is also a process proven to be important in neuroblastoma: MYCN directly up-regulates enzymes involved in glutaminolysis and MYCN knockdown inhibits glutaminolysis, delaying neuroblastoma tumour progression [237]. The dependence of MYCN-amplified neuroblastoma on glutaminolysis suggests that inhibition of this process would target neuroblastomas with hyperactive MYCN. Indeed, glutamine deprivation induces Bax- dependent apoptosis in MYCN-driven neuroblastoma but has no impact on the viability of neuroblastoma cells lacking MYCN amplification [233]. A number of glutaminase (GLS) inhibitors have been tested for adult cancers in preclinical studies. For example, the GLS1 inhibitor CB839 potentiates the anti-growth effects of mTORC1 inhibitors against ovarian cancer. However, inhibitors of glutaminolysis have not been tested for neuroblastoma.

MYCN-amplified neuroblastomas also exhibit heightened glycolysis, a process that releases energy from the breakdown of glucose. The elevated glycolytic rates observed for MYCN-amplified neuroblastoma cells arise through the transcriptional up-regulation of glycolytic enzymes by MYCN, including hexokinases 1 and 2 [235, 239], while up- regulation of lactate exporters, MCT1 and MCT2, by MYCN prevents intracellular lactate accumulation to harmful levels, thus enabling glycolysis to occur continuously [234]. Not surprisingly, MYCN-amplified neuroblastoma cells are particularly

31 susceptible to inhibitors of glycolysis. For example, 3-bromo-pyruvate (3-BrPA) is an analogue of pyruvate that blocks glycolysis and exerts greater cytotoxic effects on MYCN-amplified neuroblastoma cells compared to cells lacking MYCN amplification [234].

In addition, through directly enhancing the expression of mitochondrial and cytoplasmic proteins needed for oxidative phosphorylation, fatty acid B-oxidation and the TCA cycle, MYCN also drives the generation of ATP [240, 241]. For this reason, targeting mitochondrial function can selectively reduce the growth of MYCN-amplified neuroblastoma cells [240].

1.5.6.5.2 Up-regulation of protein synthesis by c-MYC and MYCN

Besides the breakdown of substances to generate ATP, MYC factors can also up- regulate the synthesis of essential cellular building blocks such as proteins. There is significant evidence to suggest that c-MYC driven cancers are dependent on higher rates of protein synthesis to support their rapid cell growth and metastasis, thus highlighting a potential Achilles’ heel that may be vulnerable to any disruptors of translation [207]. Increased mRNA translation can be promoted through c-MYC mediated up-regulation of ribosomal RNAs and proteins [238, 242]. These ribosomal RNAs and proteins assemble to form functional ribosomes, thereby increasing translation of all mRNAs and enhancing protein synthesis in a global, non-gene specific manner (Figure 1.1). Molecular biology studies in lymphocytes have shown that c-MYC stimulates the binding of RNA polymerase I to the promoters of rDNA and promotes the transcription of these genes to produce the structural 18S and 28S rRNAs [243-245] and c-MYC was shown to up-regulate ribosomal proteins and translation factors in a variety of cancers, including B-lymphocytes, cervical cancer and liver cancer cells [242, 246, 247]. In this way, c-MYC equips the cell with a highly active translational machinery to sustain elevated protein synthesis. The role of c-MYC in driving translation has been most clearly demonstrated in the Eu-MYC transgenic mouse (a model of c-MYC driven cancer) in which the over-expression of c-MYC drives the development and progression of B-cell lymphoma [248]. In this model, c-MYC overexpression increases the rate of global protein synthesis, leading to cell cycle progression, enhanced cell size and lymphoma progression [249, 250]. The high dependency on elevated protein synthesis in this model is borne out by the observation that mice with one functional copy or

32 haploinsufficiency in the gene encoding the ribosomal protein, RPL24, show reduced lymphoma progression and proliferation of lymphoma cells [246, 251]. The importance of hyperactive translation machinery to c-MYC driven cancer progression is not limited to lymphomas. For example, knockdown of HSPC111, a protein involved in the production of 18S and 28S rRNAs, inhibits ribosome biogenesis leading to reduced growth of c-MYC driven breast cancer cells [252]. Therefore, due to the addiction of c- MYC driven cancers to enhanced global protein synthesis, targeting an aspect of protein synthesis may be particularly lethal to these cancers.

Figure 1.1: c-MYC transcriptionally up-regulates ribosomal components and translation factors to enhance translation. Red arrows indicate ribosomal proteins and RNAs, which are known to be promoted by both c-MYC and MYCN. These ribosomal proteins and RNAs increase global protein synthesis. eIF5A is up-regulated by c-MYC and it contributes to both global and gene-specific protein synthesis. Up- regulation of eukaryotic initiation factors eIF4A, eIF4E, and eIF4G by c-MYC can increase cap-dependent translation. This predominantly increases the expression of proteins encoded by the transcripts that are regulated by cap-dependent translation. Prolonged disruptions to the expression of eIF4A, eIF4E and eIF4G can ultimately affect global protein synthesis.

While c-MYC can enhance translation in a global manner, this factor can also up- regulate translation initiation factors that enhance the translation of mRNAs in a gene- specific manner (Figure 1.1). c-MYC has been reported to up-regulate translation initiation factors eIF4A, eIF4E and eIF4G, which form the eIF4F complex [247, 253, 254]. eIF4F binds to the 5’ cap of mRNAs and stimulates cap-dependent translation (Figure 1.1). The translation of many oncogenes including c-MYC itself occurs in a cap- dependent manner [253, 255]. This up-regulation of c-MYC by eIF4E creates a positive feed-forward loop that enables c-MYC driven cancers to maintain high levels of mRNA translation. Blockade of cap-dependent translation by inhibiting translation initiation factors has proven to be detrimental to the growth and metastasis of c-MYC driven prostate cancers, acute lymphoblastic leukaemia, B-lymphomas and multiple myelomas [256-259]. Besides factors involved in translation initiation, proteins involved in other stages of translation have also been implicated in malignant characteristics. Despite its name, the c-MYC up-regulated eukaryotic initiation factor 5A (eIF5A) mainly contributes to the elongation stages of mRNA translation and has been implicated in the progression of c-MYC driven liver and breast cancers [260-264]. Knockdown of eIF5A reduces the expression of ROCK and RhoA [265]. These proteins regulate the assembly of cytoskeletal proteins to enable cell motility. Thus, by disrupting cytoskeletal dynamics, knockdown of eIF5A can reduce migratory capabilities of pancreatic ductal adenocarcinoma [265]. Therefore, besides enhancing global protein synthesis, c-MYC can also up-regulate translation initiation and elongation factors that promote the translation of specific mRNAs to heighten aggressive characteristics in MYC-driven cancers.

While the contribution of enhanced protein synthesis is well understood for c-MYC- driven cancers, the importance of this process in MYCN-driven cancers such as neuroblastoma is poorly studied and warrants further investigation. Several studies in neuroblastoma suggest that MYCN hyperactivity can up-regulate ribosomes and translation factors and that targeting the translational machinery might present a novel therapeutic strategy for this disease. High MYCN activity, as measured by the expression of a set of genes directly up-regulated by MYCN, has been correlated with poor clinical outcome in neuroblastoma [202]. Many genes that make up this MYCN activity “signature” encode ribosomal proteins, ribosomal RNAs and translation factors, implying that increased expression of the translation machinery may be linked to

34 neuroblastoma progression [202]. Consistent with these observations, forced expression of MYCN in neuroblastoma cells (SH-EP Tet21N) increased the expression of ribosomal proteins including RPLS12, RPLS20 and RPL26 [266]. More recently, the loss of a pre-rRNA processing factor, known as digestive organ expansion factor (DEF), was found to hinder the tumorigenesis of neuroblastoma in a zebra fish model with transgenic expression of MYCN. In comparison with DEF wildtype fish, those fish with loss of a functional DEF gene had lower levels of mature 18S rRNA and neuroblastoma cells in these fish showed increased apoptosis, as well as impaired cell proliferation and tumour progression [267]. Mechanistically, DEF knockdown and the associated problems in rRNA processing caused nucleolar stress that led to p53 dependent apoptosis in c-MYC and MYCN expressing human neuroblastoma cells [267]. Supporting the role of translation factors in neuroblastoma oncogenesis, Qu et al 2016 found that eIF4E knockdown in c-MYC-expressing SH-SY5Y neuroblastoma cells reduced the translation of HIF-2α, causing subsequent reduction in colony formation and invasion of extracellular matrix by the SH-SY5Y cells [268]. Interestingly, Delaidelli et al (2017) found conflicting evidence in that neuroblastoma progression could be inhibited by reducing the expression of a translation inhibitor, eEF2 kinase [269]. Phosphorylation of eEF2 by eEF2 kinase blocks translation elongation to conserve energy when cells experience nutrient deprivation. In mice subjected to caloric restriction, the growth of MYCN-amplified neuroblastoma xenografts reduced upon the knockdown of eEF2 kinase [269]. This study indicates the regulation of translation is complex and further investigations are needed to understand how the regulation of translation changes in response to stress. Therefore, to date, the contribution of protein synthesis to the progression of MYCN-driven neuroblastoma remains unclear.

1.6 The specific targeting of translation in MYC-driven cancers as a novel therapeutic approach

Given the dependence of MYC-driven cancers on efficient mRNA translation, exploring methods of targeting MYC-driven translation may elucidate an effective treatment strategy for MYCN-amplified neuroblastoma. Inhibitors of translation have been tested mostly in c-MYC driven cancers but their pre-clinical success to date implies that such agents may also be useful for a MYCN-amplified cancer such as neuroblastoma. These inhibitors include inhibitors of i) ribosome biogenesis, ii) eIF4E binding and iii) eIF4A.

1.6.1 Inhibitors of ribosome biogenesis

Therapeutic inhibitors of ribosome biogenesis have achieved pre-clinical success in a variety of c-MYC driven cancers. Administration of the RNA polymerase I inhibitors, CX-5461 and CX-6258, significantly delayed the tumour growth of c-MYC-driven prostate cancer models by reducing the amount of 45S rRNA [270]. Both drugs are well tolerated without severe adverse effects. The blockade of ribosome biogenesis by CX- 5461 also induces p53- dependent apoptosis and tumour delay in the Eµ-MYC lymphoma model through the generation of nucleolar stress [271, 272]. In addition, CX- 5461 has shown efficacy in other c-MYC-driven cancers including melanoma and pancreatic cancers [273] and is being tested in clinical trials for lymphoma patients (NCT02719977). The progression of Eμ‐Myc B‐cell lymphoma can also be impaired through the use of AKT inhibitors that indirectly block the production of ribosomes [274]. Inhibitors of ribosome assembly have also been developed but to date have not progressed to preclinical in vitro testing [275]. Put together, these preclinical studies suggest that targeting factors that promote ribosome biogenesis is a potential therapeutic strategy against c-MYC driven cancers.

1.6.2 Inhibitors of eIF4E

Pharmacological targeting of translation initiation factors could also be an attractive therapeutic option to inhibit the progression of c-MYC-driven cancers. Reducing the activity of eIF4E and thus of cap-dependent translation, has long been known to limit cell cycle progression and tumour formation [276-278]. Inhibitors of eIF4E have demonstrated some pre-clinical success. The most successful eIF4E inhibitor is ribavirin, which is an m7G cap mimic that competes with the 5’ cap for eIF4E binding [279]. Ribavirin selectively inhibits the in vitro growth of malignant breast cells without harming non-malignant cells and exerts anti-tumorigenic activity in vivo by blocking the growth and metastasis of c-MYC expressing breast cancer cells [280]. In a phase I clinical trial, when ribavirin was given to 13 patients with c-MYC driven acute myeloid leukaemia (AML), the therapeutic was well tolerated and most patients showed a reduction in the number of bone marrow and peripheral leukemic cells [281]. Despite its progress into clinical trials, a more recent study suggests that AML cells, collected from patients who received ribavirin, can acquire resistance to the drug by up-regulating

36 enzymes that conjugate glucuronic acid to ribavirin, which modifies its potency [282]. For this reason, inhibitors against these modifying enzymes are being tested in combination with ribavirin to overcome this resistance [282].

Other methods of reducing eIF4E activity that have been tested pre-clinically include compounds that disrupt the interaction between eIF4E and eIF4G, thus preventing cap- dependent translation. Synthetic peptides of 4EBP (an endogenous inhibitor of eIF4E) and 4EGI-1 (disrupts the eIF4E/eIF4G interaction) reduce c-MYC expression and block the growth of c-MYC-dependent cancer cell lines [283, 284]. Antisense oligonucleotides that target eIF4E inhibit the growth of c-MYC driven PC3 prostate cancer and MDA-MB-231 breast cancer xenografts by down-regulating eIF4E expression and reducing the protein levels of eIF4E translational targets including c- MYC, cyclin D1, VEGF and Bcl2 [285]. Another strategy involves the targeting of MAPK interacting kinases MNK1 and MNK2 which can phosphorylate eIF4E and increase the translation of specific mRNAs including those encoding the pro-survival factor MCL1 and pro-migratory factors MMP3 and MMP7 [286]. Treatment with the MNK1/2 inhibitor, CGP57380, reduced the migration of c-MYC overexpressing pancreatic ductal adenocarcinoma cells [287]. However, with the exception of ribavirin, none of these agents have been tested in clinical trials. Since high expression of eIF4E has been linked to poor clinical outcome in neuroblastoma patients and plays a role in the growth and migration of neuroblastoma cells [268], testing inhibitors of eIF4E against neuroblastoma may be worthwhile.

1.6.3 Inhibitors of eIF4A

Targeting other translation initiation factors of the eIF4F complex which is comprised of eIF4A, eIF4G and eIF4E, has also been shown to exert anti-tumorigenic effects against c-MYC-driven cancers. Rocaglates are secondary metabolites derived from plants of the Aglaia genus and include compounds such as silvestrol which constitute the most well characterised inhibitors of eIF4A activity. By targeting the two isoforms of eIF4A (eIF4E1 and eIF4A2), silvestrol selectively reduced the protein levels of eIF4A translational targets including c-MYC, RUNX1, MDM2, NOTCH1 and Bcl2 in c-MYC driven acute lymphoblastic leukaemia [256]. This caused apoptosis and cell cycle arrest, delaying the progression of leukaemia in vivo [256]. Silvestrol also exerts anti-oncogenic effects towards other models of c-MYC driven cancers such as AML,

37 melanoma and colorectal cancer [288-290]. Pateamine is another rocaglate and it inhibits the activity of eIF4A through two actions: i) by directly blocking the activity of eIFA itself and ii) by stimulating the activity of the endogenous eIF4A inhibitor, eIF4AI [291]. Other rocaglates developed more recently have demonstrated high potency against c-MYC driven multiple myeloma both in vitro (IC50s<10 nM) and in vivo [259]. These studies suggest that targeting protein synthesis may be a promising avenue of treatment for MYC-driven malignancies.

1.6.4 Inhibitors of translation in neuroblastoma

Although direct inhibitors of translation have not been tested in neuroblastoma, some small molecule inhibitors that exert some of their anti-tumorigenic effects by blocking mRNA translation indirectly have been tested in neuroblastoma. An inhibitor of polyamine biosynthesis, dimethylfluoroornithine (DFMO), exerts potent anti- tumorigenic effects against MYCN-driven neuroblastomas [232, 292, 293]. Polyamines are required for the activation of the eukaryotic initiation factor 5A (eIF5A) so part of the activity of DFMO may be mediated by inhibition of eIF5A. However, polyamines regulate many metabolic processes other than eIF5A-meditated translation and these include angiogenesis, apoptosis, cell proliferation and immune responses that can also promote tumour progression [294, 295]. Whether DFMO exerts its anti-oncogenic effects in neuroblastoma specifically by inhibiting eIF5A-meditated translation is currently unclear. Therefore, determining whether DFMO exerts anti-tumorigenic effects in neuroblastoma by altering mRNA translation remains an interesting biological question.

Other agents that indirectly inhibit translation and show pre-clinical efficacy in neuroblastoma include inhibitors of the PI3K/AKT/mTOR pathway. Since mTORC1 phosphorylates 4E-BP to release its inhibition on eIF4E, the activity of eIF4E can be blocked by targeting the PI3K/AKT/mTORC1 pathway [286]. Disruption in eIF4E activity leads to changes in cap-dependent translation. However, like DFMO, inhibition of the PI3K/AKT/mTOR pathway can elicit anti-tumorigenic effects through mechanisms other than inhibition of cap-dependent translation and these are often described to be their primary mechanism of action against neuroblastoma. Reduction in glucose metabolism, production of ROS and destabilization of MYCN protein are all believed to be mechanisms of action for mTORC1 and AKT inhibitors in neuroblastoma

[187, 190, 191]. To date, the impairment of mRNA translation by inhibitors of the PI3K/AKT/mTOR has only been proposed as a mechanism for anti-tumorigenic effects in adult cancers. For example, reduction in cap-dependent translation leading to decreases in proteins involved in cell proliferation such as cyclin D1 and PRPS2 as well as proteins involved in metastasis such as vimentin and CD44 has been demonstrated in Burkitt’s lymphoma, colon and prostate cancers [296] [251, 257]. Although inhibition of the PI3K/AKT/mTOR pathway has been reported to reduce the protein level of cyclin D1 and MYCN in neuroblastoma, none of these studies have shown that reduction in these proteins is caused by impaired translation [186, 297]. Thus, whether targeting mTORC1 and PI3K reduces cyclin D1 levels by blocking translation or enhancing degradation remains unknown. To date, the impact of PI3K/AKT/mTORC1 inhibitors on cap-dependent translation in neuroblastoma has never been legitimately proven and remains an open question. Furthermore, these agents demonstrated limited efficacy in clinical trials in neuroblastoma patients [123], meaning that investigating methods to improve their efficacy or identifying alternative approaches of targeting translation are worthwhile.

The dependence of MYC-driven cancers on elevated mRNA translation and the preclinical success of direct inhibitors of translation in c-MYC-driven cancers, together with the high degree of functional similarity between c-MYC and MYCN, suggest that exploring methods of inhibiting translation directly may be a valuable approach to disrupt the progression of MYCN-driven neuroblastomas. Over the years, a limited number of factors that play a role in mRNA translation have been linked to neuroblastoma biology or clinical outcome. Most of these molecules, such as DEF, do not possess readily druggable domains, making it difficult to target these molecules therapeutically. By contrast, one class of proteins known to consist of members that are directly regulated by MYC transcription factors is the superfamily of ATP-binding cassette (ABC) transporters [298, 299]. Furthermore, a subset of ABC proteins are linked to poor clinical outcome in neuroblastoma patients [299] and these ABC proteins possess readily druggable ATPase domains [300, 301]. Interestingly, although members of this gene superfamily are typically known for their role in transporting drugs and cellular metabolites, a handful of these ABC proteins appear to possess functions in mRNA translation. The possible functions of ABC proteins and reasons

39 why some of these should be investigated as a method of inhibiting translation and tumour progression in neuroblastoma will be discussed.

1.7 MYCN regulated ABC transporter family members as targets to block protein translation in neuroblastoma

The ABC transporter superfamily consists of 48 proteins that are classified, based on their amino acid sequence homology and their functions, into seven subfamilies ranging from ABCA to ABCG. ABC transporters typically consist of hydrophobic, α-helices that enable them to span the cell membrane together with twin ATP-binding domains that hydrolyse ATP to provide energy for the efflux of chemically dissimilar substrates out of the cell (Figure 1.2) [301]. The best-known function of ABC transporters is perhaps their ability to transport structurally dissimilar drugs out of the cells and this ability contributes to the multi-drug resistance phenotype of cancers [300-302].

Figure 1.2: ABC transporter superfamily consists of 48 functional proteins that are further classified into 7 subfamilies, ABCA to ABCG. ABC proteins in red are known to be directly up-regulated by MYCN and ABCC3 in blue is directly repressed by MYCN [299].

1.7.1 ABC transporter family members as therapeutic targets in oncology

ABC transporters should be investigated as therapeutic targets in oncology because they exhibit a multitude of cellular functions that can promote cancer progression. Firstly, the

40 ability of certain transporters to efflux structurally dissimilar drugs out of the cell creates multi-drug resistance that makes cancers particularly difficult to treat. Secondly, a handful of ABC transporters are directly regulated by MYCN and c-MYC and this implies they are needed to support the MYC-driven malignant phenotype. Thirdly, many of these transporters can efflux signalling molecules and metabolites that are critical for tumour growth and metastasis. These oncogenic functions of ABC transporters will be discussed.

In the context of cancer treatment, the most well characterised role of ABC transporters is their contribution to the multi-drug resistance phenotype, which is a major hindrance in cancer therapy [300]. The three transporters best known for this role are ABCB1 (also known as p-glycoprotein (Pgp) or MDR1), ABCC1 (MRP1) and ABCG2 (BCRP) which efflux a range of chemically dissimilar drugs out of the cells [301, 303]. Cancer cell lines that are resistant to various chemotherapeutics such as doxorubicin, cisplatin and docetaxel have been found to overexpress ABCB1 [304, 305]. Furthermore, inhibition or siRNA mediated knockdown of ABCB1 sensitises the chemoresistant cancer cells to various chemotherapeutics [306]. Besides chemotherapeutics, inhibition of ABC transporters can also increase the efficacy of molecular-based agents. For example, inhibition of ABCG2 and ABCB1 using the dual transporter inhibitor, elacridar, increased the bioavailability and the anti-oncogenic effects of the ALK inhibitor crizotinib and the BRAF inhibitor vemurafenib [307, 308]. Similarly, high ABCC1 expression is linked to reduced efficacy of chemotherapeutics such as ifosphamide, epirubicin and methotrexate and this may be one reason why patients with breast cancer, neuroblastoma and soft tissue sarcoma have poorer clinical outcome when their tumours express high levels of ABCC1 [299, 309, 310]. These studies demonstrate that certain ABC transporters play a critical role in multi-drug resistance and targeting these proteins may heighten the anti-cancer efficacy of a variety of therapeutics.

Another reason for targeting ABC transporters is that certain transporters are directly regulated by MYC factors and may contribute to the progression of MYC-driven cancers. A number of ABC transporters including ABCC1 and ABCE1 have been reported to be directly up-regulated by c-MYC and MYCN (Figure 1.2) [298, 299, 311, 312]. Transporters such as ABCC3 are transcriptionally repressed by these MYC factors (Figure 1.2) [298, 299]. These transporters have E boxes in their promoter regions that

41 enable direct binding of MYC factors [298, 299]. MYC factors drive cancer progression by up-regulating a repertoire of genes; the protein products of which drive cell cycling, motility, invasiveness and other aspects of cell biology that promote cancer progression [202, 206, 207, 238, 242]. Certain ABC transporters being a part of the MYC transcriptome suggests that these transporters may be required to support malignant phenotypes in MYC-driven cancers. Studies have supported this notion by showing MYC up-regulated ABC transporters such as ABCC1, ABCC4, ABCF2 and ABCG2 can be independent prognostic factors for cancers such as chronic myeloid leukaemia, colon cancer and neuroblastoma [298, 299, 313-315]. Furthermore, suppression of ABCC1 or ABCC4 reduces the growth of neuroblastoma cells and tumours [316, 317]. Interestingly, the anti-oncogenic effects of ABCC1 or ABCC4 suppression were observed in the absence of chemotherapy, implying that MYC-driven cancers may rely on ABC transporters to support malignant characteristics through mechanisms other than offering drug resistance [316, 317]. Their ability to support the MYC-driven malignant phenotype and promote the progression of these cancers makes them worthy therapeutic targets for MYC-driven cancers.

The reason why ABC transporters can drive cancer progression independent of drug efflux most likely lies in their roles in transport of endogenous substrates that are important to cancer biology. These molecules include pro-cholesterol and inflammatory lipids, such as prostaglandins and leukotrienes [318, 319]. Studies have demonstrated that MYC up-regulated ABC transporters, ABCC1 and ABCC4, can efflux prostaglandins E1 and E2 and leukotrienes B4, C4 and D4 [320-322]. These lipid signalling molecules can activate pro-oncogenic RAS/MAPK and PI3K/AKT pathways or NF-kB and BCL2 signalling that increase tumour cell proliferation, differentiation, migration and invasion [318, 319]. ABCG1, ABCA1 and ABCA2 are known to efflux cholesterol and lipids that can support the infiltration of pro-inflammatory immune cells into the tumour microenvironment [323]. Together, these studies suggest that ABC transporters possess drug-efflux independent functions that can support cancer progression.

These pro-oncogenic functions of ABC transporters can be inhibited by small molecules that block the activity of their ATPase – a feature that is common to all ABC transporters. Drug discovery efforts have been focused on ABCB1 or P-gp because it has been most strongly implicated in clinical drug resistance. The first generation of

ABCB1 inhibitors include cyclosporine A; however, these had limited efficacy in clinical trials [300]. Later generations of ABCB1 inhibitors demonstrate enhanced efficacy and they include cyclosporine A analogues such as PSC833 (valspodar), verapamil and XR9576 (tariquidar) [302, 304] [324] [325]. Besides ABCB1, inhibitors of other ABC transporters have also been developed. For example, Reversan inhibits the activity of ABCC1 and sensitises cancer cells, including neuroblastoma cells to vincristine, etoposide and daunorubicin [326]. ABCC4 has also been successfully inhibited with small molecule inhibitors known as ceefourin 1 and ceefourin 2 [327]. Although all of these inhibitors require further development to increase their clinical potency, these preclinical studies demonstrate that ABC transporters are readily druggable targets and their inhibition can suppress the malignant phenotypes of cancer.

1.7.2 Soluble members of the ABC superfamily

There are several members of the ABC transporter superfamily that are completely soluble and do not have a transmembrane transport domain. These include the ABCE1 and ABCF family proteins [328, 329], the cellular functions of which are believed to be independent of substrate efflux. ABCE1, ABCF1 and ABCF2 are ubiquitously expressed members of the ATP-binding cassette transporter superfamily that have been shown to be prognostic of neuroblastoma outcome and regulated by MYCN. Interestingly, ABCE1 and ABCF1 have been reported to possess functions relating to mRNA translation [299, 330, 331]. It has been previously discussed that blocking protein synthesis can be of particular therapeutic benefit for c-MYC driven cancers and that targeting of translation factors may also offer therapeutic benefit for MYCN driven neuroblastomas. The attribute that sets ABCE1 and ABCF proteins apart from other translation factors, such as eIF4E and DEF, is that these ABC proteins possess ATPases, similar to those on ABCB1, that may be readily inhibited using small molecule inhibitors [302, 324, 330, 332, 333].

1.8 ABCF1

The ABCF family consists of three related proteins but to date, ABCF1 (or ABC50) is the only one with proven functions in mRNA translation. ABCF1 was first suspected to have a function in translation initiation when human ABCF1 was observed to co- immunoprecipitate with the translation initiation factor eIF2 [334]. In human cells, ABCF1 was also shown to directly bind to S26 and L5 ribosomal proteins and was

43 associated with active ribosomes [334]. Later studies supported these data by showing that ABCF1 mutants with defective ATP hydrolysis presented with decreased ribosomal binding by eIF2, impairing mRNA translation initiation and protein synthesis [329, 335, 336]. In addition, ABCF1 knockdown in HL60 leukaemia cells was reported to exert inhibitory effects on translation [337]. Another role for ABCF1 is protection of cells from endoplasmic reticulum stress-induced apoptosis by preventing the phosphorylation of eIF2a [337]. More recently, an in vivo study demonstrated that, although double knockout of ABCF1 was embryonic lethal in Balb/c and C57/Bl6 mice, heterozygous knockout mice were viable [338], suggesting that partial pharmacological inhibition of the protein may be well-tolerated in vivo. Investigations into the potential oncogenic role of ABCF1 in translation and the possibility for therapeutic targeting are thus worthwhile.

1.9 ABCE1

ABCE1 is an evolutionarily conserved member of the ABC transporter superfamily and the only member of the ‘E’ subfamily [330, 339-341]. It is the most well characterised of the soluble ABC proteins.

1.9.1 The ABCE1 protein as a therapeutic target in neuroblastoma

A number of arguments can be made to support the hypothesis that ABCE1 is worth investigating as a potential therapeutic target for neuroblastoma. Firstly, high level expression of ABCE1 in the primary tumour was found to be associated with poor clinical outcome in a cohort of 251 neuroblastoma patients [299]. While its contribution to neuroblastoma biology remains a mystery, studies in various adult cancer models suggest that ABCE1 may contribute to the malignant characteristics of cancer cells. For example, suppression of ABCE1 (by siRNA mediated knockdown) in lung, oesophageal or breast cancer cells can impair growth, migration or invasion into the extracellular matrix by these cells [342-345]. Furthermore, study of tumour histology has shown that nodal lung metastases exhibit higher levels of ABCE1 compared to the primary tumour, suggesting that ABCE1 may be linked to the process of metastasis [345].

Secondly, ABCE1 is a direct downstream target of the oncogenic MYC factors [298, 299]. Both c-MYC and MYCN can directly bind to the promoter of ABCE1 and drive its transcription [298, 299]. This implies that MYC may require ABCE1 to execute some of its pro-tumorigenic functions. However, the biological role of ABCE1 in

MYC-driven cancers in particular has so far not been delineated, and therefore further investigation into the role of ABCE1 in this regard is warranted.

Thirdly, since one of the key metabolic processes driven by MYC factors is protein synthesis and MYC-driven tumours are addicted to increased protein synthesis [207], targeting a factor critical to this process in MYCN-driven neuroblastoma may offer similar anti-oncogenic effects as targeting MYC itself. Unlike many of the other translation factors such as eIF4E or ribosomal proteins such as RPL24, ABCE1 has a readily druggable ATPase domain, making it an attractive therapeutic target [332, 346]. Although the function of ABCE1 as a translation factor has not been reported in the context of MYC-driven cancers, a number of studies in lower order eukaryotes give sufficient evidence of the critical role of the protein in mRNA translation and these are discussed below.

1.9.2 Structure of ABCE1

According to studies done in archaea and yeast, the biological functions of ABCE1 are determined by the structural components of the protein. ABCE1 has two ATPase domains that share extensive sequence homology to those of other ABC transporters [332, 333]. These domains hydrolyse ATP to power the functions of ABCE1. However, ABCE1 has three structural features that set it apart from most other members of the ABC superfamily including the absence of a transmembrane domain and its localisation in the cytoplasm [347]. ABCE1 is also one of the few ABC proteins to contain two diamagnetic, iron-sulphur clusters (4Fe-4S2+) at its N-terminus that are thought to play a role in eliminating reactive oxygen species [332]. Finally, the two ATPase domains of ABCE1 are joined by a flexible hinge region that allows them to move in a scissor-like power stroke during ATP binding [333]. Mutations at the ATPase domains, hinge region or the 4Fe-4S2+ clusters can ablate the molecular functions of ABCE1 in ribosome recycling [333, 346].

1.9.3 Biological roles of ABCE1 In the following section, the described biological roles of ABCE1 will be discussed. In addition to extensive studies on the role of ABCE1 in mRNA translation, ABCE1 has also been found to enhance virus production, inhibit ribosomal degradation and scavenge reactive oxygen species (ROS).

1.9.3.1 Role of ABCE1 in mRNA translation mRNA translation occurs in a cyclical process consisting of four stages: i) an initiation phase in which the small subunit of the ribosome complexes with the mRNA and initiation factors to locate and engage the AUG start codon; ii) an elongation phase in which the large ribosomal subunit binds to the initiation complex and begins catalysing the peptide bond formation between amino acids; iii) the termination phase in which the ribosome reaches the stop codon and releases the polypeptide chain, and iv) the final stage in which ribosome recycling (dissociation of the two ribosome subunits) occurs (Figure 1.3) [348]. ABCE1 was firstly hypothesised to play a role in protein synthesis based upon the discovery that its amino acid sequence was closely related to that of GCN20, another ABC protein that was shown to function in translation in yeast [330, 348]. Follow-up studies have reported a contribution by ABCE1 to several stages of protein translation.

Figure 1.3: Summary of the roles of ABCE1 in mRNA translation. (1) In yeast, ABCE1 is required during translation initiation as it enables certain eukaryotic initiation factors (eIF1, eIF2 and eIF5) to bind to the ribosome to form the pre-initiation complex. (2) During translation termination in yeast, ABCE1 helps the ribosome to recognise the stop codon and stimulate the release of the polypeptide chain. (3) The most widely published function of ABCE1, proven in both yeast and archaeans, is its role in ribosome recycling. During this step, ATP hydrolysis by ABCE1 powers the dissociation of the ribosome into its large and small subunits, enabling translation to re-initiate. Note: This is a simplified diagram and not drawn to scale. Whether ABCE1 leaves the ribosome after ribosome recycling or remains on the ribosomes until initiation is a controversial area of research. Figure adapted from [349].

1.9.3.1.1 Translation initiation Early studies suggested a role for ABCE1 in translation initiation because of its reported association with certain eukaryotic initiation factors (eIF1, eIF3, eIF2 and eIF5) and the 40S ribosome subunit [339, 340]: in yeast, ABCE1 was essential in formation of the pre-initiation complex by promoting the binding of the eukaryotic initiation factors eIF1, eIF2 and eIF5 to the 40S subunit [340]. This was discovered by isolating the 40S subunit from cellular extracts of yeast cells with or without ABCE1 expression and probing for the presence of various translation initiation factors in the 40S fraction. Since initiation factors are small, they cannot sediment in the same fraction as the 40S ribosome subunit unless they are bound to the 40S subunit and yeast cells lacking ABCE1 expression were found to have reduced levels of eIF1, eIF2 and eIF5 associated with this fraction. Similarly, in human HeLa cells, co-immunoprecipitation experiments showed that ABCE1 directly interacts with eIF2 and eIF5, further supporting a possible role in translation initiation [339]. Ultimately, impairment in translation initiation caused by ABCE1 knockdown reduces protein synthesis in yeast cells [340].

1.9.3.1.2 Translation termination More in-depth, cell-free studies in lower organisms suggested that ABCE1 plays a role in the termination and post-termination stages of the translation cycle. In archaea and yeast, ABCE1 was shown to enter the translation cycle following the hydrolysis of GTP by eukaryotic release factor 3 (eRF3, or aRF3 in archaea; Figure 1.4A) [350, 351]. Binding of ATP to ABCE1 along with the dissociation of the GDP-bound eRF3 from the ribosome allows the association of ABCE1 with the post-termination complex (Figure 1.4B) [346]. The binding of ABCE1 to the ribosome causes eukaryotic release factor 1 (eRF1) to interact with the polypeptide chain, stimulating the release of the polypeptide from the ribosome (Figure 1.4C) [351]. Although the exact mechanics are unclear, ABCE1 is also required by the translational machinery to recognise the stop codon and prevent continued translation after the stop codon (a process known as stop codon ‘read-through’) in yeast [352]. This finding is supported by a later study in yeast that used ribosome footprinting, a technique that reveals the sequences of mRNAs occupied by ribosomes, to demonstrate that the absence of ABCE1 causes 80S ribosomes to continue translation in the 3’ untranslated regions (3’ UTRs) of mRNAs [353].

Figure 1.4: The role of ABCE1 in the release of polypeptide chain. eRF1 (pink) and eRF3 (purple) bind to the ribosome in (A). GTP hydrolysis of eRF3 enables ABCE1 (green) to bind to eRF1 in the ribosome in (B) and this induces eRF1 to stimulate the release of the polypeptide chain (C). Reproduced from [351].

1.9.3.1.3 Ribosome recycling The most extensively studied and well-supported role of ABCE1 in the translation cycle is its ability to dissociate a translating ribosome into separate small and large subunits at the end of a translation cycle, as best demonstrated in yeast and archaea. This dissociation of the ribosome subunits is known as ribosome recycling. Evidence of a role for ABCE1 in dissociating 80S ribosomes was provided by addition of yeast ABCE1 and ATP to protein lysates, which resulted in a decrease in the amounts of 80S monosomes and increased levels of free small and large ribosome subunits [354]. Despite the fact that ribosome dissociation in yeast can occur in the absence of ABCE1 through engagement of certain eukaryotic initiation factors and proteins DOM34 and HBS1, the efficiency of ribosome dissociation was dramatically heightened by the presence of ABCE1 and ATP [351, 354]. Later studies dissected key molecular stages in this ABCE1-mediated ribosome recycling process and showed that functional ATP binding and hydrolysis are needed for efficient ribosome recycling (Figure 1.5) [346, 350, 354-356]. In yeast, ATP-bound ABCE1 is thought to bind to the associated ribosomes and ATP hydrolysis dissociates the 80S ribosome into the 40S and 60S subunits, with tRNAs and mRNA bound on the 40S ribosome subunit [355]. Whether ABCE1 remains on the 40S ribosome remains debatable with one study showing the association of ABCE1 with the 40S ribosome until re-initiation and another study demonstrating the release of ABCE1 after ATP hydrolysis [350, 354]. However, both

49 studies have shown that this recycling process is critical in permitting the free subunits to re-initiate translation after translation termination.

Figure 1.5: ATP hydrolysis of ABCE1 powers ribosome recycling. At the end of the translation cycle, ATP-bound ABCE1 binds to the ribosome to form the post- termination complex. ATP hydrolysis by ABCE1 causes the complex to dissociate into the small and large ribosome subunits in the process of ribosome recycling. The tRNAs and mRNA are thought to remain on the 40S ribosome; however, whether ABCE1 leaves the 40S ribosome immediately after dissociation remains debatable. Adapted from [354].

Observations made in mammalian cells also support the role of ABCE1 as an important ribosome recycling factor in translation. Using lysates from rabbit reticulocyte or HeLa cells, Pisareva et al (2011) showed that the mammalian ABCE1, by interaction with release-like factors PELO and HBS1L, is essential in dissociating both ribosomes stalled in the 3’ untranslated region as well as translationally inactive, vacant 80S ribosomes [355]. These findings are complemented by another study performed in cultured leukaemia cells in which ABCE1 suppression caused 80S ribosomes to stall in the 3’ UTR of mRNAs [357]. Pisareva et al (2011) demonstrated that the mammalian ABCE1, by dissociating 80S ribosomes, allows the formation of the 48S initiation complex which is essential for re-initiation of the translation cycle thereby enabling continuous protein synthesis as required for cancer cell functioning [355]. The impairment of ribosome recycling caused by ABCE1 suppression was reported to ultimately lead to reduced protein synthesis and cell growth in non-malignant HEK293 [339, 358]. This suggests roles for ABCE1 in both ribosome recycling and translation

50 initiation. Taken together all these studies highlight that mammalian ABCE1 plays a critical role in mRNA translation similarly to that observed in lower order eukaryotes.

1.9.3.1.4 Exploiting ABCE1-mediated translation for MYC-driven cancer therapy Despite the critical role ABCE1 plays in mRNA translation and the dependence of MYC-driven cancers on heightened protein synthesis, the notion of exploiting ABCE1- mediated translation for MYC-driven cancer therapy has never been explored. Studies that have reported the reduction of cancer cell growth, migration and invasion of extracellular matrix by ABC1 suppression have not examined changes in translation as the underlying cause of these impaired malignant phenotypes [342-345]. However, this an area of research that warrants further investigation, particularly for MYC-driven cancers such as MYCN-amplified neuroblastoma. This is because, as described previously, MYC-driven cancers display elevated protein synthesis making them vulnerable to decreases in the expression of certain translation factors. This is why targeting protein synthesis offers potent anti-tumorigenic effects whilst giving minimal harm to non-malignant tissue in animal models [246, 251, 271]. Given that mRNA translation cannot occur efficiently, if at all, without ABCE1 expression, investigating whether targeting ABCE1-mediated translation can reduce the malignant phenotype of neuroblastoma is a worthwhile pursuit.

1.9.4 Other functions of ABCE1 Besides being involved in multiple stages of mRNA translation, ABCE1 is also known to contribute to other cellular processes. These include inhibition of the interferon- RNaseL pathway, assembly of viral capsids and elimination of reactive oxygen species.

1.9.4.1 Inhibition of the interferon - RNAseL pathway The first described role of ABCE1 in eukaryotic cells was its ability to inhibit the activity of RNaseL, giving rise to its other name of RNAseL Inhibitor (RLI) [347]. During viral infection of a mammalian cell, the viral dsRNAs and type I interferons (IFN-α and β) can activate an interferon-inducible 2-5 synthetase which converts ATP to PPi (pyrophosphate) and 2-5 oligoadenylates (Figure 1.6) (2-5A) [359]. These oligoadenylates stimulate the dimerization and activation of RNaseL, which then degrades ribosomal RNA, triggering c-Jun NH2-terminal kinase-mediated apoptosis [359]. Bisbal et al (1995) were first to demonstrate the ability of ABCE1 to bind to

RNAseL thereby preventing the cleavage of the targets of RNaseL, i.e. the 18S and 28S ribosomal RNAs (rRNAs) [347]. The role of ABCE1 as the inhibitor of RNaseL was later verified when ABCE1 suppression was found to increase rRNA cleavage in prostate cancer cells when the cells are stimulated by 2-5A [360]. Interestingly, when challenged with the chemotherapeutic camptothecin, an analogue of topotecan that has been found to activate the RNaseL pathway in prostate cancer cells, the suppression of ABCE1 was reported to sensitise the cancer cells to the drug by releasing the inhibition on RNAseL [360]. Topotecan is now used as a standard chemotherapeutic for the treatment of neuroblastoma and therefore the possibility of potentiating its activity through targeting ABCE1 should be explored.

Figure 1.6: ABCE1 can inhibit the RNAseL-JNK pathway to block apoptosis. Viruses, type I interferons and the chemotherapeutic camptothecin or its derivatives such as topotecan can activate RNAseL which cleaves structural ribosomal RNAs. The destruction of the ribosomes can stimulate JNK-mediated apoptosis. By inhibiting the activation of RNAseL, ABCE1 can offer protection against the apoptosis mediated by viruses, type I interferons or camptothecin analogues. Adapted from [359].

1.9.4.2 Assembly of viral capsids In addition to the above-described role of ABCE1 in viral infections, ABCE1 also functions catalytically in the assembly of viral capsids. The capsid proteins of certain viruses can spontaneously assemble around the viral genetic material. However, for other viruses like HIV and rabies, the process of capsid assembly requires host proteins, such as ABCE1. This was first demonstrated when a host protein of 68kDa (HP68) was co-immunoprecipitated with the HIV Gag polyprotein and HP68 was released once viral

53 assembly was complete [361]. HP68 isolated from the immunoprecipitation was sequenced and identified to be ABCE1 [361]. The binding of ABCE1 to the nucleocapsid proteins of HIV was later confirmed by Lingappa et al (2006) [362]. More recently, ABCE1 was also linked to assembly of rabies virus. This was demonstrated when an inhibitor of rabies viral production was found to bind to a multi-protein complex containing ABCE1 [363].

1.9.4.3 Elimination of reactive oxygen species The presence of two iron-sulphur clusters at the N-terminus offers ABCE1 the ability to scavenge reactive oxygen species (ROS), a role shared by ABCB7, another ABC transporter with an iron-sulphur domain. The importance of ABCE1 in eliminating ROS was clearly demonstrated in yeast. ABCE1 protects yeast cells from pro-oxidants and enables their survival under aerobic conditions in which they undergo oxidative metabolism to generate large amounts of ATP and hence ROS [364]. Zhai et al (2014) showed that ABCE1 mutants lacking the Fe-S cluster were unable to protect yeast cells from aerobic respiration, demonstrating that the Fe-S cluster was critical in the ROS scavenging function of ABCE1 [365]. Protection from ROS has significant implications in cancer biology in general, and in neuroblastoma biology in particular. Hypoxia, which often occurs in poorly vascularised areas of solid tumours and is exaggerated by the increased metabolic activity of cancer cells, can induce ROS production in solid cancers including neuroblastoma [366]. As high levels of ROS can be lethal to cells, most cancers have developed mechanisms of coping with high oxidative stress [366]. However, the role of ABCE1 in protecting cells from ROS is only documented in yeast and has not been reported in mammalian cells. One possible reason is that mammalian cells, particularly cancer cells, have more powerful anti-oxidants such as glutathione that can make this function of ABCE1 redundant [367].

1.10 Summary and thesis perspectives:

Despite improvements in risk stratification and therapeutic approaches, the five year OS of patients with high risk neuroblastoma is no more than 50% [72]. Significant research effort is now focused on finding molecular target-based therapies against specific pathways critical to the progression of neuroblastoma. Forced expression of MYCN in neural crest cells fuels their oncogenic transformation to neuroblastoma [184] and one of the most powerful predictors of poor outcome for neuroblastoma patients is

54 hyperactivation of the MYCN transcription factor [58, 59, 63, 202, 208]. Hence, multiple approaches to target MYCN signalling are currently being explored as treatment options for this disease. One of these entails the inhibition of critical pathways downstream of MYCN to which the neuroblastoma cells are addicted, such as the MYCN-driven increase in protein synthesis. [299]. ABCE1 is known to promote protein synthesis by enabling the separation of the ribosome subunits after translation termination, formation of the translation initiation complex, release of the polypeptide chain and identification of the stop codon at the end of translation [346]. This thesis examines the biological effects of suppressing ABCE1 in neuroblastoma cells and tumours and explores the underlying molecular mechanism of the observed biological effects.

Chapter 2: Materials and methods

2.1 Materials

2.1.1 Reagents, cell lines and animal models

2.1.1.1 Cell culture

Dulbecco’s modified Eagle medium (DMEM); RPMI1640 medium (RPMI), Iscove's Modified Dulbecco's Medium (IMDM), Minimum essential medium α (MEM-α), insulin-transferrin-selenium (ITS), Dulbecco’s phosphate buffered saline (PBS), trypsin solution (0.25% (w/v) trypsin in Hank’s solution), and foetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Reagents for Puck’s Ethylenediaminetetraacetic acid (EDTA) consisting of NaCl, KCl, Glucose, NaHCO3, EDTA were purchased from Ajax Finechem (Sydney, NSW, Australia) and HEPES solution was purchased from Thermo Fisher Scientific (Waltham, MA, USA). MycoAlertTM Mycoplasma Detection kit was purchased from Lonza (Basel, Switzerland). Dimethylsulfoxide (DMSO) Hybri-MaxTM was from Sigma-Aldrich (St. Louis, MO, USA). All sterile, 6-well plates, 96-well plates, flasks (T25, T52 and T150) and strip pipettes (2ml, 5ml, 10ml and 25ml) were purchased from Corning (Corning, NY, USA).

SK-N-BE(2), KELLY, CHP-134, SK-N-AS and SK-N-F1 cells were from Sigma- Aldrich (St. Louis, MO, USA; Table 2.1). MRC5 cells were from ATCC (Manassas, VA, United States; Table 2.1). The SK-N-BE(2) TGL cells were kindly provided by Dr Jamie Fletcher from Children’s Cancer Institute, Randwick, NSW, Australia. The SH- EP cell line was a gift from Dr June Biedler from Memorial Sloan-Kettering Cancer Centre, New York City, NY, USA and the SH-EP Tet21N cell line was from Dr Susan Cohn, Department of Pediatrics, Northwestern University Medical School, Chicago, IL, USA (Table 2.1). All cell lines have been STR profiled. The COG-N-415, COG-N-440, COG-N-496 and COG-N-519 cell lines were established in the laboratory of Dr. C. Patrick Reynolds and obtained through the Children's Oncology Group (COG) Cell Culture and Xenograft Repository (Table 2.1; https://www.cogcell.org/cellreqs- nbl.php). These cells were STR profiled and compared to reference profiles from COG with 100% match. All cell lines are mycoplasma negative.

Table 2.1: Characteristics of cell lines used in this study

Cell line Tissue of origin MYCN p53 status ALK status amplification

SK-N-BE(2) Relapsed neuroblastoma; + Cys135Phe Wildtype from bone marrow mutation metastasis

KELLY Neuroblastoma; from human + Wildtype Phe1174Leu brain mutation

CHP-134 Relapsed neuroblastoma; + Wildtype Wildtype from human adrenal gland

SK-N-AS Neuroblastoma; from bone ̶ Mutant Wildtype marrow metastasis Homozygous deletion of exons 10–11c

SK-N-FI Neuroblastoma; from bone ̶ Met246Arg Wildtype marrow metastasis mutation

SH-EP Neuroblastoma; from bone ̶ Wildtype Phe1174Leu marrow metastasis mutation

COG-N-415 Neuroblastoma from + Wildtype Phe1174Leu peripheral blood mutation

COG-N-440 Neuroblastoma from + Wildtype Wildtype peripheral blood

COG-N-496 Diagnostic neuroblastoma + homozygous Wildtype from bone marrow p53 truncation TP53 p.Arg342Ter

COG-N-519 Relapsed neuroblastoma; + Loss of one Wildtype from peripheral blood allele; Gly245Ser mutant in the other

MRC5 Lung fibroblast ̶ Wildtype Unknown + indicates presence of MYCN amplification; ̶ indicates the absence of MYCN amplification [368-372]

2.1.1.2 Western blots

Reagents used for protein isolation and Western blot analyses were purchased according to the following: 4-15% Tris-HCl gradient polyacrylamide gels from Bio-Rad (Sydney, Australia); Ponceau stain, bovine serum albumin (BSA), protease inhibitor cocktail, dithiothreitol (DTT), glycerol, bromophenol blue, and Tween®-20 were purchased from Sigma-Aldrich (St. Louis, MO, USA); 500mM sodium fluoride and 100mM orthovanadate were purchased from New England Biolabs (Ipswich, MA, USA); tris(hydroxymethyl)aminomethane (Tris), EDTA, sodium chloride, glycine, methanol and sodium dodecyl sulphate (SDS) from Ajax Finechem (Sydney, NSW, Australia); Nonidet P-40 from Fluka (Buchs, Switzerland); IgepalTM and sodium deoxycholate were from Sigma-Aldrich (St. Louis, MO, USA); skim milk powder from Coles (Melbourne, VIC, Australia); Precision Plus Protein™ Dual Colour Standards, and Clarity Western ECL chemiluminescence substrate from Bio-Rad (Sydney, NSW, Australia); ProtranTM 0.45uM nitrocellulose blotting membranes from Amersham (Buckinghamshire, England) and BCA protein assay kit was obtained from Pierce (Rockford, IL, USA); 3mm Chr blotting paper from Whatman (Maidstone, UK); and β- mercaptoethanol from Thermo Fisher Scientific (Waltham, MA, USA). Radioimmunoprecipitation (RIPA) buffer for cell lysis was made using some of the above products such that it consisted of 50mM Tris pH 7.4, 150mM NaCl, 0.2% Nonidet P-40, 50mM NaF, 5mM EDTA, 0.1mM orthovanadate, plus 1 in 100 dilution of the protease inhibitor cocktail from Sigma-Aldrich. Tumour lysis buffer consists of 0.5% sodium deoxycholate, 1% IgepalTM, 0.1% SDS and 2x PBS.

Antibodies were purchased from the following locations: anti-ABCE1 antibody (# ab32270) and anti-GABARAPL2 antibody (# ab137511) from Abcam (Cambridge, UK); anti-MYCN antibody clone B8.4B (# sc-53993) and anti-c-MYC antibody clone 9E10 (# sc-40) from Santa Cruz Biotechnology (Dallas, TX, USA); anti-puromycin antibody clone 12D10 (# MABE343) from Merck Millipore (Billerica, MA, USA); anti- total actin antibody (# A2066) from Sigma-Aldrich (St. Louis, MO, USA);

2.1.1.3 Transfection reagents and reagents for cloning of DNA plasmids

Non-targeting siRNA Smartpool (sequences are proprietary), ON-TARGETplus ABCE1-specific siRNA duplex 1 (siRNA1; UGUCUCAGCUUGAAAUUAC) and duplex 2 (siRNA2; CAAAGACACAGGCAAUUGU), pTRIPZTM lentiviruses with

59 control non-targeting shRNA or ABCE1 specific shRNA (Dx24; ATTAAATAGACATCAGCAG), in vivo purified ON-TARGETplus control siRNA (Ctrl; GCAAGCUGACCCUGAAGUUCUU) and ON-TARGETplus siRNA ABCE1- specific siRNA duplex 1 for in vivo administration (siRNA1; UGUCUCAGCUUGAAAUUACUU) and TranslentiviralTM packaging mix were purchased from Dharmacon (Lafayette, CO, USA). Lipofectamine2000TM, Lipofectamine RNAimaxTM and Opti-MEMTM were purchased from Thermo Fisher Scientific (Waltham, MA, USA); α-Select Gold Competent Bacterial Cells were purchased from Bioline (Eveleigh, NSW, Australia); LB broth was from Sigma-Aldrich (St. Louis, MO, USA); QiaprepTM spin miniprep kit was purchased from Qiagen (Hilden, Germany); SalI restriction enzyme and H buffer were from Promega (Fitchburg, WI, USA); low EEO agarose was from AppliChem (St. Louis, MO, USA); DNA Gel Loading Dye (6X) from Thermo Fisher Scientific (Waltham, MA, USA); Doxycycline hydrochloride and carbenicillin, disodium salt were purchased from MP Biomedicals (Santa Ana, CA, USA). Polybrene infection/transfection reagent was from Merck Millipore (Billerica, MA, USA).

2.1.1.4 Assays to measure cellular phenotype

Cell Proliferation ELISA, BrdU (colorimetric) kit was from Sigma-Aldrich (St. Louis, MO, USA); puromycin was bought from InvivoGen (San Diego, CA, USA); Falcon® Permeable Support for 24 Well Plate with 8.0μm Transparent PET Membrane (Transwell migration inserts) and Corning® BioCoat™ Growth Factor Reduced Matrigel Invasion Chamber with 8.0μm PET Membrane (Transwell invasion inserts) and human type IV collagen were from Corning (Corning, NY, USA); Giemsa and May-Grünwald stains and platelet derived growth factor (PDGF) were from Sigma- Aldrich (St. Louis, MO, USA); acetic acid was bought from Ajax Finechem (Sydney, NSW, Australia).

2.1.1.5 Cytotoxic drugs and targeted inhibitors

Cytotoxic drugs were purchased from manufacturers as follows: vincristine and etoposide (VP-16) from Sigma-Aldrich (St. Louis, MO, USA); cisplatin and doxorubicin were from Pfizer Australia (Perth, WA, Australia); topotecan (hycamtin) was from Novartis (Basel, Switzerland) and mafosfamide was from Sapphire Bioscience (Sydney, NSW, Australia); silvestrol was from Focus Bioscience (St Lucia,

QLD, Australia); ribavirin and MK-2206 HCl were from Selleck Chemicals (Houston, TX, USA).

2.1.1.6 Tumour microarray

Neuroblastoma tumour microarrays, numbers 13_002, 14_001 and 14_002, were obtained from the tumour bank at the Children’s Hospital of Westmead (project approval number 2013006). Antibodies used for the staining include anti-ABCE1 EPR15373(B) C-terminal antibody (1:500 dilution), purchased from Abcam (catalogue number ab185548) and anti-c-MYC antibody clone Y69 (1:200 dilution), purchased from Abcam (catalogue number ab32072).

2.1.1.7 Mass spectrometry

RIPA buffer was as described for Western blots. Dithiothreitol (DTT) for reduction was purchased from Bio-rad (Sydney, NSW, Australia); iodoacetamide and ammonium were from Sigma-Aldrich (St. Louis, MO, USA); trypsin from Promega (Fitchburg, WI, USA); 200uL Stage Tips and heptafluorobutyric acid were from Thermo Scientific (Waltham, MA, United States); NaCl; acetonitrile and formic acid were from Ajax Finechem (Sydney, NSW, Australia).

2.1.1.8 Polysome profiling reagents

Reagents for hypotonic wash and lysis buffers include: tris(hydroxymethyl)aminomethane (Tris), KCl, MgCl2, sodium deoxycholate, cycloheximide, dithiothreitol (DTT) and protease inhibitor, each of which were from Sigma-Aldrich (St. Louis, MO, USA); sucrose was purchased from Sigma-Aldrich (St. Louis, MO, USA); Ultrapure RNAse and DNAse-free water was from Thermo Fischer Scientific (Waltham, MA, USA); Triton X-100 was from Sigma-Aldrich (St. Louis, MO, USA); RNase Secure was from Thermo Fisher Scientific (Waltham, MA, USA) and RNasin was from Promega (Fitchburg, WI, USA).

2.1.1.9 RNA extraction and PCR reagents

Qiagen Spin Miniprep kit was purchased from Qiagen (Hilden, Germany); ethanol was from Ajax Finechem; Taqman human ABCE1 probe (Hs01003010_g1) was from Thermo Fisher Scientific (Waltham, MA, USA); RNasin was from Promega (Fitchburg, WI, USA); KAPA probe fast mastermix was from ABI prism (Waltham, MA, USA);

DTT for RNA work and M-MLV Reverse transcriptase were from Thermo Fisher Scientific (Waltham, MA, USA).

2.1.1.10 Animal studies

The Balb/c nu/nu (nude), NOD-SCID and NOD-SCID Gamma (NSG) mice were purchased from Australian Bio Resources (ABR; Moss Vale, NSW, Australia). Regular mouse food was purchased from Gordon's Specialty Stock Feeds (Yanderra, NSW, Australia). Irradiated rat or mouse food (with or without 600mg/kg of doxycycline) was purchased from Specialty Feeds (Glen Forrest, WA, Australia); star nanoparticles were developed at the Australian Centre for Nanomedicine (UNSW) and kindly provided to us by Dr Joshua Mccarroll (UNSW, Randwick, Australia); D-luciferin potassium salt was purchased from Gold Biotechnology (St. Louis, MO, USA); 1mL insulin syringes with 27g or 29g needles were purchased from Terumo Corporation (Tokyo, Japan). Dry ice for snap freezing tumours after harvest was from Coregas (Yennora, NSW, Australia). Isoflurane inhalation anaesthetic was purchased from IsoThesia (Dublin, OH, USA). Anti-Ki67 antibody Clone: SP6 (diluted 1:400) was purchased from ThermoScientific (catalogue number RM-9106-S1) and Eosin Y Solution with Phloxine was purchased from Sigma-Aldrich (catalogue number: HT110332) and Shandon Instant Hematoxylin Kit was from ThermoFisher Scientitfic (catalogue number: LP6765015).

2.1.2 Equipment

2.1.2.1 Cell culture

Cell culture was performed in a Biological Safety Cabinet Class II (AES Environmental Pty Ltd, Australia). CytoFAST Elite Cytotoxic Safety Cabinets were from Faster S.R.L. (Ferrara, Italy). Centrifugation (Sigma Laborzentrifugen GmbH, model 3-10, Germany) was used for collection of cells. Cell counts were performed using a Neubauer haemocytometer from Dutec Diagnostics (Sydney, Australia). Cells were visualised using as inverted microscope from Olympus Optical Company (Tokyo, Japan). Readouts for the BrdU proliferation assays were measured using the Benchmark Plus Microplate Spectrophotometer from Biorad (Hercules, CA, USA) with measurement wavelengths set at 370nm and reference wavelength at 492nm.

2.1.2.2 Isolation, quantification and analysis of protein

Microcentrifuges (Model 5415D) from Eppendorf (Hamburg, Germany) were used to isolate protein. Protein concentrations were determined using the BCA Protein Assay kit (Pierce Biotechnology, Rockford, IL, USA). The Benchmark Plus Microplate Spectrophotometer (Biorad) as described for the BrdU proliferation assay with the measurement wavelength set at 570nm was used to measure colour changes that occur based on the protein concentration. The Hoefer Mighty SmallTM II and Mini Transphor units (Model TE22) (Amersham Biosciences, Sydney, Australia) were used for polyacrylamide gel electrophoresis and transfer of proteins. Densitometric images of protein were captured using the Versadoc apparatus (Bio-Rad Laboratories, Sydney, Australia). Densitometry of the protein bands was performed using the Image J software (NIH, USA).

2.1.2.3 Polysome profiling

Thinwall, polypropylene tubes and ultracentrifuge with SW 41 Ti Swinging-Bucket Rotor were from Beckmann Coulter (Brea, CA, United States); Foxy R1 fraction collector was from Teledyne ISCO (Lincoln, NE, USA), Gradient MasterTM Base Unit was purchased from Biocomp (Fredericton, NB, Canada).

2.1.2.4 qRT-PCR

7900HT Fast Real-time PCR system was from Applied Biosystems (Foster City, CA, USA).

2.1.2.5 Animal work

IVIS SpectrumCT In Vivo Imaging System was from PerkinElmer (Waltham, MA, United States); CytoFAST Elite Cytotoxic Safety Cabinets were from Faster S.R.L. (Ferrara, Italy). Wall Mount Laboratory Animal Anesthesia System was purchased from VetEquip Inc. (Livermore, CA, USA).

2.2 Methods

2.2.1 Tissue culture maintenance

All cell lines were typically grown in T75 flasks. The neuroblastoma cell lines, SK-N- BE(2), SK-N-AS, SK-N-F1 and SH-EP and the human embryonic kidney cell line, HEK293T, were cultured in DMEM supplemented with 10% FBS and split on a twice weekly basis in the ratios of 1:3, 1:6, 1:2, 1:6 and 1:20 respectively. The SK-N-BE(2)

63 thymidine-GFP-luciferase (SK-N-BE(2) TGL) parental and pTRIPZ-transduced cell lines were cultured in the same medium without puromycin or doxycycline unless otherwise specified and split 1:5 twice a week. The SH-EP Tet21N cells were cultured in DMEM with 10% FBS without doxycycline unless otherwise specified and split 1:2- 1:3 twice a week. KELLY and CHP-134 neuroblastoma cell lines were cultured in RPMI1640 medium with 10% FBS and split on a twice weekly basis in the ratios of 1:8 and 1:6 respectively. The MRC5 fibroblast cells were grown in MEM-α with 10% FBS and split 1:2 twice a week. Splitting of the cells was performed by removing the media and adding 2ml of trypsin (0.25% (w/v) trypsin in Hank’s solution) per T75 flask; incubation at 37oC for 2mins and collection by adding 8ml of media with 10% FBS. Since the SK-N-BE(2) and SK-N-BE(2) TGL pTRIPZ cells contain suspension cell populations, the media removed from the original flasks were kept and used to inactivate the trypsin. COG-N-519 cells were grown in IMDM with 20% FBS and 1:1000 dilution of insulin-transferrin-selenium (ITS). The cells were split 1:3 to 1:5 twice a week. These cells were split by incubating the cells at 37oC for 2mins with 4ml of Puck’s EDTA (140mM NaCl, 140mM NaCl, 5.5mM Glucose, 4mM NaHCO3, 0.8mM EDTA, 9mM HEPES) followed by inactivation using 8ml of the media. After removal from flasks, all cell lines were then pelleted by centrifugation. Media was removed; cells were then resuspended in fresh media and appropriate amounts of cells were placed into new flasks. Cell lines that display clumping such as the SK-N-BE(2) cells were mixed repeatedly with 1 ml pipette in 1ml of the appropriate media before a proportion of the cells were split into new flasks. All cells were cultured at 37°C in a humidified atmosphere of 5% CO2. All cell lines have been STR profiled and confirmed to be the correct cell lines. All cell cultures were routinely screened for mycoplasma every 6 months using the MycoAlertTM mycoplasma test kit (Lonza, Switzerland) and were consistently found to be free of contamination.

2.2.2 siRNA transfections and plasmid transductions

To achieve transient suppression of ABCE1, transfection of ABCE1-specific siRNAs siRNA1 and siRNA2, alongside control, non-targeting siRNA (Dharmacon) was performed using Lipofectamine 2000 or RNAimax (Thermo Fisher Scientific) according to manufacturer’s protocol (Table 2.2). At 16-20 hours prior to transfection, cells were seeded in 2ml of media into 6-well plates at the number specified in Table 2.2. Briefly, siRNAs with a final concentration of 10-20nM were incubated for 5mins at

64 room temperature in Opti-MEM (250ul/well). Lipofectamine 2000 was diluted 1:50 and Lipofectamine RNAimax was diluted 1:100 in Opti-MEM and incubated for 5mins at room temperature. Then equal volumes of the Lipofectamine 2000 or RNAimax mix were added into the siRNA mix and incubated for a further 20mins at room temperature. After this incubation, 500ul of the transfection mix were added into each well of the 6- well plate. The transfection reagent remained in contact with the cells until they were re-seeded for subsequent assays.

Table 2.2: Transfection conditions for neuroblastoma and fibroblast cell lines

Cell line Number of Final concentration Transfection cells/well of siRNAs reagent

SK-N-BE(2) 1.5x105 10nM Lipofectamine 2000

KELLY 1.5x105 10nM Lipofectamine 2000

CHP-134 1x105 10nM Lipofectamine RNAimax

SK-N-AS 2x105 10nM Lipofectamine 2000

SK-N-F1 1.5x105 10nM Lipofectamine 2000

SH-EP 1x105 10nM Lipofectamine 2000

COG-N-415 1x105 10nM Lipofectamine 2000

COG-N-440 1x105 10nM Lipofectamine 2000

COG-N-496 1x105 10nM Lipofectamine 2000

COG-N-519 1.5x105 10nM Lipofectamine 2000

MRC5 1x105 20nM Lipofectamine 2000

Stable suppression of ABCE1 for in vivo xenografts was performed by transducing luciferase-positive SK-N-BE(2) TGL cells or COG-N-519 cells with pTRIPZ lentiviruses carrying either a non-targeting control or ABCE1 specific shRNA. Glycerol stock of bacteria carrying pTRIPZ plasmids were expanded by inoculating LB broth with 100ug/ml of Carbenicillin and incubation on a 37oC shaker overnight. The plasmids were extracted using Qiagen DNA extraction mini-prep kits according to manufacturer’s instructions. To check that the extracted DNA samples were pTRIPZ plasmids, 100ng of the samples were digested with Sal I restriction enzyme at 37oC for 1hr. Then the digest was mixed with 6x DNA loading dye (Thermo Scientific) and resolved on a 0.8% agarose gel (made up using Tris acetic acid buffer and 1:10000 dilution of Gel Red) with the GelPilotTM 1kb plus DNA ladder. The digested fragments were visualised using GelDocTM (Biorad).

To produce the lentiviruses, 7x105 HEK293T cells were seeded into each well of a 6- well plate an incubated at 37oC for 16-24hr until the transfection. For each well of target neuroblastoma cells, 3 wells of HEK293T cells were seeded (this increased the viral load to be transduced into target cells). For each well of HEK293T cells, 2ug of plasmid and 2ul of the Translentiviral Packaging MixTM (Dharmacon) were diluted with total volume of 250ul of Opti-MEMTM (Life Technologies) while Lipofectamine 2000 (Life Technologies) was diluted 1:50 in Opti-MEM (250ul was prepared for each well). The diluted mixtures were incubated separately at room temperature for 5-10mins before equal volumes of Lipofectamine 2000 were added to each tube of plasmid and Translentiviral packaging mix. These mixtures were incubated for 30mins at room temperature before the medium on the HEK293T cells were changed to 2ml of serum- free DMEM (Life Technologies) per well and 500ul of the transfection mixtures were added to each well. After 6-8 hours, the media were removed and 2ml of DMEM with 10% FBS were added into each well. About 40-48 hours after the media change, viral conditioned media (VCM) were collected from the HEK293T cells that received fresh DMEM with 10% FBS. The VCM were filtered using a Millex filter unit with 0.45um pore size (Merck Millipore). Then VCM from every 9 wells (18mls) were aliquoted into a separate 50ml tube and centrifuged at 3000g for 24 h at 4°C. Following centrifugation, all but the last 5ml of the media were removed and the remaining media were frozen at - 80oC until transduction. This process was repeated at the 72 hours time point. After the

66 final collection of the VCM, 1ug/ml of doxycycline was added to the HEK293T cells and the expression of RFP was examined to confirm successful transduction.

For inducible knockdown of ABCE1 in neuroblastoma cell lines, 5x104 SK-N-BE(2) TGL or 1x105 COG-N-519 cells were seeded into each well of a 6-well plate and incubated at 37oC for 16 hours. An extra well of mock transduced cells was also seeded. In FalconTM tubes, polybrene was added to the VCM harvested at 72 hours post- transfection. For either cell line, each well received 8ug/ml of polybrene added to 1.5ml of concentrated VCM (harvested form approximately 3 wells of HEK293T cells) and 0.5ml of serum-free DMEM in a FalconTM tube. For mock-transduced cells, regular media (either DMEM containing 10% FBS for SK-N-BE(2) TGL or IMDM with 20% FBS and 5% ITS for COG-N-519) and 8μg/ml of polybrene were added to each well. The plates were centrifuged at 30oC and 500g for 2 hours and then incubated for 4 hours at 37oC. After this incubation, the VCM-polybrene mixture was replaced using the VCM harvested from HEK293T cells at 48 hours post-transfection as previously described. The plates were centrifuged again under the same conditions and incubated at 37oC overnight. Media were then replaced with their regular growth media (i.e. DMEM with 10% FBS for SK-N-BE(2) TGL or IMDM with 20% FBS and 5% ITS for COG-N- 519) and the cells were incubated in the same conditions for 48 hours before 2μg/ml of puromycin was added to SK-N-BE(2) TGL cells or 1μg/ml of puromycin was added to COG-N-519 cells to select for successfully transduced cells. Media were changed every 3 days for 2 weeks to replace fresh puromycin until all mock transduced cells had died. The viral transduced SK-N-BE(2) TGL and COG-N-519 cells were expanded and cellular extracts were harvested to analyse the degree of ABCE1 knockdown before cells were frozen in liquid nitrogen until in vivo experiments. Mycoplasma test were performed using media harvested from the cells 3 weeks after puromycin removal. Both lines were mycoplasma negative.

2.2.3 Protein extraction and Western blots

2.2.3.1 Protein extraction from cell lines

Protein extraction for Western blotting was performed on total cell lysates. Cells were harvested from sub-confluent cultures using trypsin; collected via centrifugation and washed once with cold PBS. Cells were resuspended in 1mL cold radioimmunoprecipitation (RIPA) buffer per 5x106 cells (PBS with 150mM NaCl, 1%

Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) containing 10μl of protease inhibitor cocktail (4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride, 104mM, Aprotinin, 80μM, Bestatin, 4mM, E-64, 1.4 mM, Leupeptin, 2mM, Pepstatin A, 1.5mM) and 1μl of sodium fluoride (500mM) and 1µl of orthovanadate (100mM). The lysates were mixed using a vortex and incubated on ice in Eppendorf tubes for 10- 15mins. After the incubation, the lysates were mixed by vortex again before the lysates were centrifuged for 15-20min at 4°C, 20817g and the supernatant fluid collected. For each sample, 5μl of the extract was taken for quantification of protein concentration which was measured using the BCA Protein Assay kit (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer’s instructions. The remainders of extracts were stored at -80°C until Western blotting. Extracts from HEY cells with or without c-MYC knockdown were used as negative and positive controls for c-MYC Western blot and were kindly provided by Dr MoonSun Jung.

2.2.3.2 Protein extraction from tumour cells

Approximately 0.5ml to 1ml of tumour lysis buffer was added to snap-frozen tumour samples followed by grinding with cold mortar and pestle on dry ice and transferred to 50ml Falcon tubes. Samples were incubated on ice for 30mins with vortexing every 10mins and then subjected to centrifugation at 4oC and 20817g for 20mins. Then supernatant was collected and transferred to another Eppendorf tube for storage at - 80oC. BCA assay was performed as previously described.

2.2.3.3 Western blotting

Protein samples were prepared by mixing 20μg protein with 6x loading buffer (300mM Tris, pH 6.8, 35% glycerol, 0.05% bromophenol blue, 6% β-mercaptoethanol, 9% SDS) and made up to a total volume of 15μl using Milli-Q water. Samples were then loaded alongside 6μl of a protein ladder (Precision Plus Protein™ Dual Colour Standards, Bio- Rad), into a pre-cast 4-15% Tris-HCl gradient gel (Bio-Rad), and electrophoresed for 1- 2h at 120V in a Hoefer Mighty SmallTM II vertical unit system using a running buffer containing 25mM Tris (pH 8.3), 192mM glycine and 0.1% SDS. Proteins were then transferred to a HybondTM–C extra nitrocellulose membrane in the Hoefer Mighty SmallTM Transphor using transfer buffer, containing 25mM Tris/glycine (pH 8.2) and 20% (v/v) methanol, at 200mA for 2 hours (90mins for cleaved caspase 3 blots) at 4oC. The gel was positioned on the anode side of the membrane. Prior to transfer, four sheets

68 of blotting paper and nitrocellulose membrane (cut to the same dimensions as the gel) were pre-soaked in chilled transfer buffer for 20min. Following transfer, the membrane was stained with Ponceau S (0.1% w/v Ponceau S in 5% acetic acid) for 5min to confirm efficient transfer and equal loading. Prior to probing, membranes were blocked for 1h in TBS (10mM Tris-HCl pH 8.0, 150mM NaCl) containing 5% (w/v) skim milk at room temperature (RT). Membranes were then washed three times in TBS-T (containing 0.05% Tween®-20), and incubated with primary antibody solution prepared in TBS-T (unless otherwise indicated) for 2-4h at room temperature (RT), or overnight at 4°C. The primary antibodies and dilutions used were: MYCN (B8.4B) (1:500 diluted in 2.5% skim milk); ABCE1 (1:3,000); puromycin (1:8,000); GABARAPL2 (1:1,000); c-MYC (9E10) (1:500 diluted in 2.5% skim milk); total actin (1:2,000 in 2% bovine serum albumin); caspase 3 (1:500 in 5% skim milk). Membranes were washed with TBS-T, three times for 5min each, before being subjected to incubation with an appropriate horseradish peroxidase-conjugated secondary antibody diluted in TBS-T with 5% skim milk (1:10,000) for 1-2h at RT. Membranes were washed three times in TBS-T for 5min each, and developed using SuperSignal® according to the manufacturer’s instructions, and then detected using X-ray films or Chemidoc (Biorad) for the appropriate exposure time. Densitometric images were captured using the Geldoc (Biorad) and subsequent quantitation of bands was achieved using the computer software Image J (NIH, USA). If protein expression was estimated using densitometry, at least two independent runs were performed for each protein of interest.

2.2.4 BrdU Proliferation assay

The impact of ABCE1 suppression on cell proliferation was measured using the BrdU incorporation assay kit (colorimetric) from Roche. At 24 hours post-transfection, the cells were seeded in 96-well plates in duplicates at the densities described in Table 2.3. BrdU incorporation assays were performed at 72 hours post-transfection with siRNAs. For the COG-N-519 cells transduced with pTRIPZ lentiviruses, the cells were seeded into 96well plates at 72 hours after induction with doxycycline and then incubated for another 72 hours before the assay was performed. The BrdU incorporation assay was performed according to manufacturer’s instructions with minor changes. These changes include centrifugation of the 96-well plates with SK-N-BE(2) and CHP-134 cells at 201g for 1min before removing the media to collect suspension cells or loosely adherent cells. After the fixation step, wells were dried using a hair dryer and background was

69 blocked using PBS containing 10% FBS. Colour change in the substrate was measured at 5-10mins after addition of the substrate using Benchmark plus plate reader at the indicated wavelengths. Experiments were repeated three times for all lines except the KELLY cells, for which four runs were performed.

Table 2.3: Seeding densities for BrdU incorporation assay in 96 well plates:

Cell line Number of cells per well containing 100ul of media

SK-N-BE(2) 1.2x104

KELLY 1x104

CHP-134 1x104

SK-N-AS 1.2x104

SK-N-F1 1x104

SH-EP 5x103

COG-N-440 1.2x104

COG-N-496 8x103

COG-N-519 (untransduced) 8x103

COG-N-519 with pTRIPz 4x103 lentiviruses

MRC5 5x103

2.2.5 Puromycin incorporation assay

2.2.5.1 The effect of ABCE1 suppression on the rate of protein synthesis

To examine the effect of ABCE1 suppression on the rate of protein synthesis, puromycin incorporation assays were performed on a panel of neuroblastoma (SK-N- BE(2), CHP-134, KELLY, SK-N-AS, SK-N-FI, SH-EP and SH-EP Tet21N) and fibroblast (MRC5) cell lines. The experiments were performed at 54 hours after transfection with ABCE1 siRNA for all cell lines but additional time points (24 hours

70 and 72 hours post-transfection) were also performed for the SK-N-AS cells. For the SH- EP Tet21N cells, puromycin incorporation was performed when MYCN was suppressed with doxycycline for 3-14days. The puromycin incorporation assay was performed according to Schmidt et al, 2009 with minor changes. Briefly, the cells were diluted to concentrations of 1-2x105cells/ml in 15ml tubes (CorningTM) and pulsed or incubated o with 0.5-2μg/ml of puromycin for 10-15 minutes at 37 C in 5% CO2. Concentration of cells and puromycin varied according to cell line (summarised in Table 2.4). After the pulse, cells were collected by centrifugation and resuspended in full media without puromycin and incubated in 6-well plates at 4-6x105cells/well for 1hr at 37oC. Cells were harvested, extracts prepared and Western blots were performed using anti- puromycin antibody (Merck; 1:8000 dilution) according to section 2.2.2. Experiments were repeated three times for all lines except the SH-EP Tet21N cells, for which four independent runs were performed and the SH-EP parental cell line for which two independent runs were performed.

Table 2.4: Conditions for puromycin incorporation assay:

Cell line Concentration (cells/ml) Concentration of puromycin

SK-N-BE(2) 2x105 0.5μg/ml

KELLY 2x105 0.5μg/ml

CHP-134 2x105 0.5μg/ml

SK-N-AS 2x105 0.5μg/ml

SK-N-F1 2x105 1μg/ml

SH-EP 2x105 1μg/ml

SH-EP Tet21N 2x105 1μg/ml

MRC5 1x105 2μg/ml

2.2.5.2 Measuring endogenous rates of protein synthesis in neuroblastoma cell lines

Puromycin incorporation was used to compare the baseline rates of protein synthesis across a panel of neuroblastoma cell lines with (SK-N-BE(2), CHP-134, KELLY) or

71 without (SK-N-AS, SK-N-F1, SH-EP) MYCN amplification. Unlike the experiments comparing the effects of knockdown where higher concentrations of puromycin were used to ensure cell lines with lower basal rates of protein synthesis could produce puromycin-labelled proteins at detectable levels when probed with the anti-puromycin antibody, to measure endogenous rates of protein synthesis, all cell lines were diluted to 2x105cells/ml and pulsed with 0.5μg/ml of puromycin. Other aspects of the protocol were as described in 2.2.4.1. Experiments were repeated three times.

2.2.6 Subcutaneous xenografts of neuroblastoma cells

2.2.6.1 The impact of shRNA-mediated ABCE1 suppression on growth of neuroblastoma tumour xenografts

The effect of prolonged ABCE1 suppression on neuroblastoma tumour growth was investigated through the subcutaneous engraftment of SK-N-BE(2) TGL cells and COG-N-519 carrying control (Ctrl) or ABCE1-specific lentivirally transduced shRNAs into immunocompromised mice. For SK-N-BE(2) TGL cells, Balb/c nu/nu mice were used; for COG-N-519 cells, NSG mice were used. Both strains of mice were purchased from Australian Bio Resources and acclimatised for 1 week prior to experiment. The SK-N-BE(2) TGL cells were grown in DMEM with 10% FBS (without puromycin or doxycycline) for 2 weeks before they were harvested using trypsin. The COG-N-519 cells were grown in full IMDM with 20% FBS and 5% ITS (without puromycin or doxycycline) for 2 weeks before they were harvested using Puck’s EDTA. The SK-N- BE(2) TGL cells were diluted to 2.5x107cells/ml; washed and resuspended in ice cold, sterile PBS before 200ul of the suspension were injected into one of the dorsal flanks of each Balb/c nude mouse at 6-7 weeks of age (5x106 cells/mouse). The COG-N-519 cells were diluted to 5x106 cells/ml; washed and resuspended in ice cold, sterile PBS before 200ul of the suspension were injected into one of the dorsal flanks of each NSG mouse at 6-7 weeks of age (1x106 cells/mouse). Once each tumour reached 50mm3, mice were placed on either control rat/mouse feed or feed containing 600mg/kg of doxycycline (Specialty Feeds). The ingested doxycycline should induce the production of either the non-targeting control shRNA or the ABCE1 specific shRNA that should suppress ABCE1 expression. For each experiment, there were 4 groups each with 10 mice and the groups received the following treatments:

1. Mice carrying tumours with control shRNA and given food without doxycycline

2. Mice carrying tumours with control shRNA and given food with doxycycline 3. Mice carrying tumours with ABCE1-specific shRNA and given food without doxycycline 4. Mice carrying tumours with ABCE1-specific shRNA and given food with doxycycline

Tumour growth was measured every second day using Vernier calipers and sizes were calculated using the formula: (height x width x length)/2. Mice were euthanized when tumours reached 1000mm3. Tumours were snap-frozen for Western blot analysis of ABCE1 suppression. Protein extraction from tumours is outlined in section 2.2.3 (ethics approval numbers are 15/139A and 17/42B). For immunohistochemistry, tumours were fixed in 10% neutral buffered formalin (purchased from Thermo Fisher Scientific; catalogue number FNNJJ018) for 24-48hours before been stored in 70% ethanol. The samples were sent to the Garvan’s Histopathology Facility located at the Kinghorn Cancer centre where they were cut, mounted and stained with anti-Ki67 antibody (1:400 dilution) or H&E stain (according to manufacturer’s instructions). Samples were visualised at

2.2.6.2 Investigating the anti-growth effects of ABCE1-targeting nanoparticles on neuroblastoma tumours

Balb/c nude mice at 6-7 weeks of age were engrafted with 5x106 SK-N-BE(2) TGL cells that were luciferase positive but not transduced with lentiviruses. Acclimatisation of mice and preparation and injection of cells were carried out as described. When tumours reached 200-300mm3, intratumoral injections of siRNA-complexed star nanoparticles were performed every 72 hours. For each injection, a total of 4mg/kg of siRNA-nanoparticles were injected into each tumour so this equated to 80ug of siRNA and 80ug of nanoparticles for each ~20g mouse. However, optimisations of the siRNA to nanoparticle ratio performed by Dr Joshua MacCarroll showed that a ratio of 1:3 gave optimal siRNA delivery. Therefore, for each injection of a ~20g mouse, 40ug of siRNA and 120ug of star nanoparticles were diluted in sterile RNAse and DNAse-free water, mixed together and incubated for 5-15mins before the mixes were injected into the tumours of mice. For each group, there were mice. Monitoring of tumour growth and endpoints were the same as previously described 2.2.6.1 (ethics approval 17/42B).

2.2.6.3 Experimental metastasis model

To determine the impact of ABCE1 suppression on metastasis, the SK-N-BE(2) TGL cells carrying control (Ctrl) or ABCE1-specific lentiviral shRNAs were injected intravenously into immunocompromised NOD/SCID mice. This experiment used 10 mice for each of the 4 groups as described in 2.2.6.1. For cells or mice in groups that were destined to receive doxycycline, the doxycycline was added to the media or their diet respectively, 1 week prior to intravenous inoculation of cells. Furthermore, during this week, cells were harvested using 10mM of EDTA instead of trypsin to preserve cell surface markers that might influence metastatic activity. Preparation of cells for injection was as described in section 2.2.6.1 and cells were injected using 29G needles. A week after the inoculation of cells, the mice were imaged using the Xenogen IVIS Spectrum imaging system. The SK-N-BE(2) TGL cells express luciferase and bioluminesce in the presence of luciferin. Thus, 10mins prior imaging, the mice were administered D-luciferin at a dose of 150mg/kg intraperitoneally using a 27G needle. They were then anaesthetised with 2-3% isoflurane using a Sleep Easy anaesthetic machine prior to and during imaging. The mice were euthanized 7 weeks after inoculation of neuroblastoma cells or prior to this time if breathing difficulties (due to tumour metastases) were observed (ethics approval 15/139A).

2.2.7 Tandem mass spectrometry

Tandem mass spectrometry was performed on SK-N-BE(2) cells at 48 hours post- transfection with control or ABCE1 specific siRNAs. Proteins from the cells were extracted using RIPA buffer (50mM Tris pH 7.4, 150mM NaCl, 0.2% NP-40, 50mM NaF, 5mM EDTA, 0.1mM orthovanadate and protease inhibitor cocktail [Sigma- Aldrich]) and quantified using the BCA assay (Pierce, Thermo Scientific). Reduction of the proteins was performed by treating 30μg of protein lysate with 5mM of DTT and incubation at 37oC for 30 mins. Alkylation of the proteins was performed by incubation with 10mM of iodoacetamide at 37oC for 30 mins. Proteins were digested by treating the samples at pH 7.4 with trypsin (Promega), added at a trypsin-to-protein ratio of 1:100 and incubated overnight at 37oC. Stage Tips (200ul from Thermo Scientific) were equilibrated using 1M NaCl in 20% Acetonitrile (ACN) and 0.4% formic acid; 20% ACN in 0.4% formic acid; 100% ACN and 1M NaCl in 20% ACN and 0.4% formic acid. Digested proteins (5-8μg) were diluted in 20% ACN in 0.4% formic acid and

74 centrifugation used to remove impurities before loading into the equilibrated Stage Tips. Samples were washed with 20% ACN in 0.4% formic acid before being eluted with 500mM ammonium acetate and dried with Speedy Vac. Dried samples were reconstituted in 10μl of 1% formic acid in 0.05% Heptafluorobutyric Acid. Digest peptides were separated by nanoLC using an Ultimate NanoRSLC Ultra-Performance Liquid Chromatography (UPLC) and autosampler system (Dionex, Amsterdam, Netherlands). Samples (2.5µl) were concentrated and desalted onto a micro C18 precolumn (300µm x 5mm, Dionex) with H2O:CH3CN (98:2, 0.1 % TFA) at 15µl/min. After a 4 min wash the pre-column was switched (Valco 10 port UPLC valve, Valco, Houston, TX, USA) into line with a fritless nano column (75µm x ~15cm) containing C18AQ media (1.9µm, 120 Å Dr Maisch, Ammerbuch-Entringen Germany). Peptides were eluted using a linear gradient of H2O:CH3CN (98:2, 0.1 % formic acid) to H2O:CH3CN (64:36, 0.1 % formic acid) at 200nl/min over 2 hours. High voltage 2000 V was applied to low volume Titanium union (Valco; Houston, TX, USA) with the column oven heated to 45°C (Sonation, Biberach, Germany) and the tip positioned ~ 0.5 cm from the heated capillary (T=300°C) of a QExactive Plus (Thermo Electron, Bremen, Germany) mass spectrometer. Positive ions were generated by electrospray and the QExactive operated in data dependent acquisition mode (DDA). The label-free quantification (LFQ) intensity values generated from the run were compared between the different treatments to identify changes in the relative expression of proteins. Experiments were repeated three times. Dr Ling Zhong and Sydney Liu from BMSF provided the facilities and assisted in this procedure.

2.2.8 Clonogenic assays

Clonogenic assays were performed on SK-N-BE(2) cells at 24 hours after transfection with control or ABCE1 specific siRNAs or untreated SK-N-BE(2), SK-N-BE(2) TGL, KELLY, CHP-134, SK-N-AS or SH-EP cells that were harvested during log-phase growth. All cell lines were harvested with trypsin; counted using haemocytometers and diluted in their respective media to the concentrations described in Table 2.5 before 2mls of the cell suspension were aliquoted into each well of 6-well plates. For each o condition, 3 wells were seeded and all lines were incubated at 37 C with 5% CO2 for the length of time described in Table 2.5. For cell lines with incubation times of 12 days, media was changed at 7 days after seeding. After the incubation period, the media were removed and 1ml of 0.5% crystal violet in 50% methanol was added to each well. The

75 plates were fixed for 20-60mins before the crystal violet stain was removed and plates were washed twice with water. Plates were left to dry overnight; then imaged with Imagelab and colonies equal to or larger than 0.5mm counted manually using ImageJ. Experiments were repeated three times for all lines.

Table 2.5: Seeding densities and incubation conditions for colony forming assays in 6-well plates

Cell line Density Cells per Media change at 7 Incubation (cells/ml) well days after seeding time (days)

SK-N-BE(2) 250 500 Yes 12

KELLY 250 500 Yes 12

CHP-134 150 300 No 9

SK-N-AS 500 1,000 Yes 12

SH-EP 75 150 No 9

2.2.9 Cytotoxicity assays - combination of ABCE1 suppression with standard chemotherapeutics or translation inhibitors

At 24 hours after transfection with control or ABCE1 specific siRNAs (siRNA1 and 2), clonogenic assays were set up with SK-N-BE(2) cells in similar conditions as previously described. However, after cells were diluted to 250 cells/ml, the cell suspension was aliquoted into 15ml Falcon tubes and appropriate amounts of chemotherapeutic drugs or translation inhibitors (drugs) were added (Table 2.6). Then the cells with the drugs were aliquoted into 6-well plates. For each siRNA and concentration of drug, 3 wells were prepared. The SK-N-BE(2) cells, were incubated for o 12 days at 37 C with 5% CO2. At 7 days after seeding, medium was changed to DMEM with 10% FBS without any drugs or vehicle. After the 12 day incubation, colonies were fixed by incubating the plates in 0.5% crystal violet in 50% methanol for 20-60 mins and washing twice with water. Colonies were quantified as previously described. For each siRNA, the number of colonies in each drug treatment was expressed as a percentage of colonies formed by the transfected cells without any drug treatment. Dose-response curves were generated using the point-to-point curve in GraphPad Prism

76 and IC50s were calculated deducted using these curves. Experiments were repeated three times for all agents except for mafosphamide (four runs).

Table 2.6: Concentration of drugs used in cytotoxicity assays

Doses

Drugs 1 2 3 4 5 6

Cisplatin (μM) 0.001 0.01 0.1 1 10

Doxorubicin (nM) 0.1 1 5 10 100

Etoposide (nM) 10 50 100 150 200

Vincristine (nM) 0.01 0.25 0.5 0.75 1 2

Mafosphamide (μM) 0.05 0.5 1 2 4 6

Topotecan (nM) 0.32 1.6 8 40 200

MK-2206 (μM) 0.75 1.5 3 6 12 24

Ribavirin (μM) 1.6 8 40 200 1000

Silvestrol (nM) 0.0128 0.064 0.32 1.6 8 40

2.2.10 Transwell migration and invasion assays

The migration of SK-N-BE(2), CHP-134 and SK-N-AS cells was measured using polystyrene TranswellTM inserts that had a PET membrane with 8μm pores. Firstly, type IV human collagen was diluted to 10μg/μl using 10mM acetic acid. Then 40-60μls of collagen were used to coat the underside of the inserts that were left to calibrate at room temperature for 1hr. The inserts were then placed into 24-well companion plates containing 500μls of serum-free media in the wells. Another 600μls of serum-free media were added into the inserts, which were incubated for 30mins at 37oC and 5%

CO2. After that, the Transwell inserts were placed in media containing 500μl of 10% FBS, which acted as a chemoattractant. Cells were harvested; diluted in 500μl of serum- free media and then seeded into the TranswellTM inserts at the cell densities and time points indicated in Table 2.7. Duplicate inserts were set up for each siRNA and cell line.

o Cells were allowed to migrate for 3-18 hours at 37 C in 5% CO2 before inserts were fixed in 100% methanol for 20mins and air dried overnight. The cells were stained using Giemsa (diluted 1:25 in water) and May Grünwald (diluted 1:4 in water) stains for 20mins and air-dried for 3 hours. Then the inserts were excised using a scalpel; mounted on glass slides and coverslips were fixed on top using nail polish. Photos of the inserts were taken using the Olympus BX53 microscope with Olympus DP73 camera at 200x magnification. For each insert, 2 photos for each the 5 fields-of-view were taken – one photo for the top of the insert (non-migrated cells) and one of the bottom of the insert (migrated cells). The number of migrated cells was calculated as a percentage of the total number of cells (migrated + non-migrated) and known as the migration index. Experiments were repeated three times for all cell lines.

Table 2.7: Conditions for TranswellTM migration assay

Cell line Cell density Seeding time Incubation time (cells/insert) (hours) (hours after transfection or induction with doxycycline)

SK-N-BE(2) 6x104 56 18

SK-N-BE(2) TGL 6x104 48 18

CHP-134 5x104 72 3

SK-N-AS 3x104 56 16

Transwell invasion assays were performed with the SK-N-BE(2) cells in a similar fashion as described for the migration assay. The 24-well inserts with 8μm pores were manually coated with human type IV collagen as previously described; however, these inserts were pre-coated with growth factor reduced MatrigelTM. Furthermore, after coating with collagen, the inserts were incubated in serum-free media for 2 hours or overnight before seeding the cells. The SK-N-BE(2) cells were harvested for this assay at 48 hours post-transfection and diluted in DMEM with 2% FBS to 1.2x105cells/ml. Then, 750μl of 10% FBS with 25ng/ml of platelet derived growth factor (PDGF; Sigma) were added to the wells of the companion plate. Next 500μl of the cell suspension were

o added into the inserts and incubated at 37 C with 5% CO2 for 48 hours. The methods for fixing, staining, imaging and quantification were as previously described in section 2.2.10. Experiments were repeated three times.

2.2.11 Polysome profiling

Cellular extracts for polysome profiling were prepared from SK-N-BE(2) cells at 48 hours post-transfection. All centrifugation steps performed (including Eppendorf and Falcon tubes) were kept at 4oC unless otherwise specified. Lysis and wash buffers were prepared prior to cell harvest. Hypotonic wash buffer was made up of 5mM Tris pH 7.5,

1.5mM KCl, 2.5mM MgCl2 (all from Sigma) in RNAse, DNAse-free water (Gibco).

Hypotonic lysis buffer consisted of 5mM Tris pH 7.5, 1.5mM KCl, 2.5mM MgCl2, 0.5% (v/v) Triton X-100 and 0.5% (w/v) Sodium deoxycholate (Sigma). This solution was treated with RNase secure (1 in 25 dilution; Ambion) followed by heating at 60oC for 10mins. Then 50μg/ml cycloheximide (Sigma-Aldrich), 1:100 dilution of protease inhibitor (Sigma-Aldrich), 3mM DTT (Sigma-Aldrich) and 120U/ml of RNasin (Promega) were added. Just before use, cells were collected, counted and 3x107 cells were diluted in 15ml of cold DMEM with 10% FBS and 50μg/ml of cycloheximide (CHX) in cooled Falcon tubes which were then incubated on a rotating wheel at 4oC for 15mins. Cells were then washed with 4ml of ice cold PBS containing 50μg/ml of CHX. Cells were resuspended in 6ml of ice cold hypotonic wash buffer, aliquoted into 6 ice cold Eppendorf tubes and centrifuged at 4oC. Separation into 6 tubes enabled all traces of wash buffer to be removed after centrifugation and prevented dilution of the lysis buffer. After the removal of the wash buffer, the cell pellets for each siRNA treatment were resuspended in 120ul of ice cold hypotonic lysis buffer and combined into one tube. The cells were vortexed and incubated on ice for 10mins before they were vortexed again and centrifuged at 20817g for 15mins at 4oC. The supernatant was aliquoted into another ice cold Eppendorf tube and centrifuged again for 5mins because a lipid layer often formed over supernatant when large numbers of SK-N-BE(2) cells were used. The supernatant was transferred into another cold Eppendorf tube and 10μl as taken for BCA assay. The remaining volume of cellular extract was measured and lysis buffer was added to ensure that all samples had equal volume. Then 100μl of lysates (from ~2.5x107 cells) were then loaded onto 10-40% sucrose gradients and centrifuged for 2 hours at 36000rpm on the SWTi 40 rotor and 4oC with 15mins of

79 acceleration and deceleration. After the centrifugation, samples were loaded onto the Foxy R1 Fractionator to measure the amount of ribosomal proteins in each fraction by UV absorbance. The sensitivity was set at 0.5 and chart recorder was set at 60. Fractions collected were stored at -80oC for future Western blots if required. Experiments were repeated three times.

2.2.12 Statistical analysis

One sample t-test on GraphPad Prism was used for the BrdU incorporation assays, puromycin incorporation assays, densitometric analysis of Western blots, polysome profiling and clonogenic assays. One-way analysis of variance (One-way ANOVA) was used to detect significant changes in IC50s for the cytotoxicity assays, the Transwell migration and invasion assays and changes in metastatic burden in tumour-bearing mice. Mantel-Cox regression was used to analysis changes in Kaplan-Meier survival curves of tumour bearing mice. Statistical analysis of the mass spectrometry was performed by Dr Chelsea Mayoh using R Bioconductor. Statistical analysis of associations between ABCE1 expression and prognosis was performed by Dr MoonSun Jung using SPSS software v22 (IBM, Sydney, Australia).

Chapter 3: Investigating the effect of ABCE1 knockdown on the malignant characteristics of neuroblastoma cells

3.1 Introduction

Children with high-risk neuroblastomas have particularly low survival rates and respond poorly to chemotherapy [3, 72]. Although amplification of MYCN only accounts for 20% of all cases, the proportion of MYCN-amplified neuroblastomas increases to 45% in high-risk cases [59]. Amplification or overexpression of MYCN is a powerful driver of neuroblastoma progression and a strong indicator of poor clinical outcome in this disease [3, 63, 203]. The correlation between MYCN and neuroblastoma progression exists because the MYCN transcription factor up-regulates multiple genetic programs that drive malignant phenotypes of neuroblastoma. These aggressive phenotypes include unlimited cell proliferation, evasion of apoptosis, tumour metastasis and resistance to chemotherapy [1, 4, 210-212, 215]. Despite the critical role MYCN plays in the progression of neuroblastoma, finding methods to directly block the function of MYCN has been a formidable task. Therefore, new ways of targeting the downstream effectors of MYCN are being investigated as an avenue of treatment for this disease.

The ATP-binding cassette protein E1 (ABCE1) is a downstream effector of MYC that should be explored as a therapeutic target in neuroblastoma for a number of reasons. Firstly, the transcription of ABCE1 is directly up-regulated by both MYCN and c-MYC factors and high expression of ABCE1 expression is linked to poor clinical outcome in neuroblastoma patients [298, 299]. Together, these observations imply that ABCE1 is a part of the MYC transcriptional program and may be needed to sustain an aggressive, MYC-driven phenotype.

Secondly, the proposed function of ABCE1 in mRNA translation further supports a possible role in the malignant phenotypes of MYC-driven cancers. ABCE1 is believed to hydrolyse ATP to fuel a stage in translation known as ribosome recycling [346, 354]. Ribosome recycling refers to the dissociation of a ribosome into its small and large ribosome subunits. Studies in lower order organisms as well as mammalian cells such as the HeLa and HEK293T lines suggest that ABCE1 is critical in promoting this process and thereby enabling translation re-initiation [339, 340, 351]. Although ABCE1- mediated translation has not been investigated in the context of MYC-driven malignancies, disrupting the function of other translation factors can be detrimental to the progression of c-MYC driven cancers such Burkitt’s lymphoma, prostate cancers and acute myeloid leukaemia (AML) [246, 274, 278, 288]. Since a large component of

82 the MYCN transcriptome is composed of genes that encode translation factors, ribosomal RNAs and ribosomal proteins required for mRNA translation [202, 242, 266], it is likely that MYCN-driven neuroblastomas are just as reliant on efficient mRNA translation as c-MYC-driven cancers. Therefore, it is possible for ABCE1, a factor proven to regulate translation in many organisms, to play a critical role in MYCN driven neuroblastoma and thus targeting ABCE1 may reduce the aggressive phenotype of this cancer.

Another reason for exploring the therapeutic potential of targeting ABCE1 in neuroblastoma is that there is constant need to find molecular-based agents that can potentiate the efficacy of standard chemotherapeutics. Chemoresistance is a major contributor to refractory or relapsed neuroblastoma and these cases have particularly poor outcome [4, 72, 373]. Resistance to chemotherapy pose a major problem in the treatment of neuroblastoma, particularly in high-risk cases that often exhibit MYCN amplification [4, 72, 373]. Another reason for finding methods of heightening chemotherapeutic efficacy is that chemotherapeutics can cause severe side effects such as leukopenia, endocrine disorders and ototoxicity [14, 132, 133]. Therefore, any method of reducing the doses required to achieve effective response of chemotherapies is greatly needed. Furthermore, if ABCE1-targeting agents are developed for neuroblastoma, they will most likely be administered in combination with standard-of- care chemotherapeutics (cisplatin, vincristine, etoposide, topotecan, cyclophosphamide, doxorubicin). For this reason, it is useful to determine which of these chemotherapeutics can be potentiated by targeting ABCE1. Studies on this aspect of ABCE1 are very limited, although ABCE1 suppression was found to sensitise MYC-driven prostate cancer cells to camptothecin and its analogues such as topotecan [360]. Therefore, examining the impact of ABCE1 suppression on frontline chemotherapeutics used for neuroblastoma is worthwhile.

Together, the clinical observations of ABCE1 expression in neuroblastoma and its possible roles in reducing chemosensitivity and mRNA translation suggest that ABCE1 may play a vital role in fuelling the progression of neuroblastoma. Therefore, targeting ABCE1 may impair malignant phenotypes and enhance chemosensitivity in neuroblastoma. This chapter reports the impact of siRNA-mediated ABCE1 suppression on the aggressive characteristics of neuroblastoma cells as well as its ability to enhance the potency of certain standard-of-care chemotherapeutics. The outcomes of such

83 investigations are important in determining whether targeting ABCE1 should be explored further as an avenue of treatment for neuroblastoma.

Therefore, the aims of this chapter were to:

1. To investigate the clinical significance of high ABCE1 expression in neuroblastoma patient tumours 2. To investigate the effects of ABCE1 suppression on the proliferation and migration of neuroblastoma cell lines with or without MYCN 3. To examine whether ABCE1 suppression can sensitise neuroblastoma cells to standard-of-care chemotherapeutics for neuroblastoma

3.2 Results

3.2.1 High expression of ABCE1 is linked to poorer clinical outcome and high MYCN expression in neuroblastoma patients

An earlier study of 250 neuroblastoma patients suggested a relationship between ABCE1 expression and outcome [299]. To investigate this link further, RNA sequencing and patient survival data from the Tumor Neuroblastoma SEQC 498 RPM seqc cohort were accessed through the R2 Genomics Analysis and Visualization Platform (r2.amc.nl/). When patients were grouped based on having high or low expression (dichotomised at the median of the cohort) those expressing higher levels of ABCE1 mRNA had significantly worse EFS and OS compared to those with low expression (hazard ratio (HR) of recurrence = 3.762 with 95% confidence interval (CI) = 2.696 to 5.248 for EFS and HR of recurrence = 8.280 with 95% CI = 4.713 to 14.545 for OS; Figure 3.2.1A and B and Appendix Tables 2 and 3). When the relationship between MYCN and ABCE1 expression was examined further using data from the same cohort, tumours with MYCN amplification were seen to exhibit higher levels of ABCE1 mRNA expression (P=7.1e-62; Figure 3.2.1C). ABCE1 protein expression was also elevated in MYCN-amplified neuroblastoma cells. Given this relationship, the value of ABCE1 as an independent prognostic factor was investigated using multivariate analysis. Following adjustment for age ≥18months, stage 3 or 4 and MYCN amplification (Appendix Tables 2 and 3), high ABCE1 expression was still highly correlated to significantly reduced EFS and OS (P<0.001 and HR = 2.458 for EFS; P<0.001 and HR=3.443 for OS; Tables 3.2.1 and 3.2.2). Interestingly, while both stage 3 or disease and age ≥18months were independently prognostic of poor outcome for both EFS and OS, the presence of MYCN amplification lost association with reduced EFS in this multivariate model (P=0.223 and HR=1.239 for MYCN amplification; Tables 3.2.1 and 3.2.2).

Figure 3.2.1: High ABCE1 expression in neuroblastoma patients predicts poor outcome and is associated with MYCN amplification. Kaplan-Meier survival analysis indicating that high ABCE1 expression in 498 neuroblastoma patients is correlated with poor (A) event-free and (B) overall survival. (A-B) Patients were dichotomised as expressing low or high levels of ABCE1 relative to the median expression value for the cohort. (C) Neuroblastoma patients with MYCN amplification exhibit higher ABCE1 mRNA expression in their tumours compared to those without MYCN amplification (P=7.1e-62). Expression of ABCE1 mRNA measured via RNA sequencing and data were obtained from the Tumor Neuroblastoma SEQC 498 RPM seqc cohort (R2 Genomics and Visualization Platform). (D) ABCE1 protein expression is also higher in MYCN- amplified neuroblastoma patients. Tumour microarrays obtained from the Children’s Hospital of Westmead. P-values for (A) and (B) were derived from Log-rank test while for (C) the p-value was derived from One Way ANOVA. P-value for (D) was obtained from two tailed t-test. (A-C) Data extracted and analysed by Dr MoonSun Jung.

Table 3.2.1: Multivariate analysis of event-free survival in 498 neuroblastoma patients

Tumor Neuroblastoma SEQC 498 RPM seqc cohort was accessed through the R2 Genomics Analysis and Visualization Platform (r2.amc.nl/). Data was extracted and analysed by Dr MoonSun Jung using the Cox-regression model.

Table 3.2.2: Multivariate analysis of overall survival in 498 neuroblastoma patients

3.2.2 Selection of appropriate cell line models for studying the role of ABCE1 in neuroblastoma

To identify appropriate cell line models to study the role of ABCE1, a panel of neuroblastoma cell lines was surveyed to determine if ABCE1 protein expression was linked to MYCN protein expression as observed in clinical samples (Figure 3.2.2A). The panel included six MYCN-amplified neuroblastoma cell lines which as expected expressed high levels of MYCN protein (Figure 3.2.2A). NBL-S lacks amplification of MYCN amplification but stabilization of the MYCN protein in this line results in detectable expression of MYCN protein, albeit at much lower levels compared to the MYCN-amplified cell lines as shown in Figure 3.2.2A. Within the panel there were two c-MYC expressing neuroblastoma cell lines (SH-SY5Y and NB69) that for the purpose of further analysis were classified along with NBL-S and the seven MYCN-amplified neuroblastoma cell lines as ‘MYCN or c-MYC expressing’ cell lines. Although ABCE1 was expressed across the panel of cell lines, there was a trend where the MYCN or c- MYC expressing cell lines exhibited higher levels of ABCE1 expression (Figure 3.2.2B). Real-time quantitative PCR (RT-qPCR) data did not fully support this observation because most MYCN-amplified neuroblastoma cell lines had similar levels of ABCE1 mRNA compared to cell lines lacking MYCN amplification (Appendix Figure 1). Only the MYCN-amplified SK-N-BE(2) and the c-MYC expressing NB69 neuroblastoma cells had higher ABCE1 mRNA expression (Appendix Figure 1).

Based on the protein expression of MYCN or c-MYC and ABCE1 across the different cell lines, 7 different cell lines were chosen to study the biological roles of ABCE1. Three MYCN-amplified neuroblastoma cell lines, SK-N-BE(2), KELLY and CHP-134, were selected for their high ABCE1 expression and suitability for experimentation. Since ABCE1 expression was also a prognostic factor independently of MYCN amplification, three neuroblastoma cell lines lacking MYCN amplification that expressed moderate to high levels of ABCE1 (SK-N-AS, SK-N-F1 and SH-EP) were also included in this study. Another important feature of the SK-N-AS, SK-N-F1 and SH-EP cell lines is that none of these cell lines express c-MYC, allowing the role of ABCE1 to be studied in the absence of all MYC factors. Since mRNA translation is a fundamental process required for the survival of all cells, targeting ABCE1, as a proposed essential component of this process, may inevitably pose toxicity towards non-

88 malignant cells. Therefore, the impact of targeting ABCE1 was also assessed in a non- malignant MRC5 fibroblast cell line.

Figure 3.2.2: Neuroblastoma cell lines with MYCN or c-MYC expression exhibit higher levels of ABCE1 protein expression compared to cell lines lacking MYC expression. (A) Western blot showing the expression of ABCE1, MYCN and c-MYC proteins in a panel of neuroblastoma cell lines and a non-malignant fibroblast cell line. Western blot is representative of two independent runs. (B) Densitometry of Western blot in (A) showing a trend of higher ABCE1 expression in cell lines that express MYCN or c-MYC. Points are representative of the means of two independent protein extract isolations. P value was derived from unpaired two-tailed t-test. Since only NB69 and SH-SY5Y cells expressed c-MYC, extracts from ovarian HEY cells with or without c-MYC knockdown served as negative and positive controls in the Western blot examining c-MYC expression in neuroblastoma cell lines without MYCN amplification (Appendix Figure 2).

3.2.3 Comparable and sustained ABCE1 knockdown is achieved across cell lines chosen to study the role of ABCE1 in supporting malignant characteristics

To determine whether ABCE1 expression can be suppressed using siRNAs and to investigate the approximate duration of this suppression, a time course of ABCE1 suppression was examined in three neuroblastoma cell lines (SK-N-BE(2), CHP-134 and SK-N-AS) following transfection with control or ABCE1 specific siRNAs, siRNA1 and siRNA2. ABCE1 expression was monitored for 1-5 days after transfection. In these lines, ABCE1 suppression was observed from 48 hours onwards with comparable knockdown achieved by both siRNAs (Figure 3.2.3A). Therefore, to study the immediate effects of ABCE1 suppression, most cellular assays were performed between 48-72 hours post-transfection. When ABCE1 suppression was extended to additional cell lines and compared back to SK-N-BE(2) and CHP-134 cell lines, the two independent ABCE1 specific siRNAs caused a comparable ~50% decrease in ABCE1 protein in the MYCN-amplified neuroblastoma cell lines (Figure 3.2.3B and C) and were similarly effective in the additional neuroblastoma cell lines without MYCN amplification (Figure 3.2.3.D and E) and the MRC5 fibroblast cell line (Figure 3.2.3F and G) with ~70% reduction in protein levels. ABCE1 expression measured at the 54 hours post-transfection was normalised to actin loading control to adjust for loading inconsistencies in all cell lines.

Figure 3.2.3: Efficient ABCE1 knockdown was achieved by siRNA transfections across different neuroblastoma cell lines. (A) Time course of ABCE1 suppression by 10nM of ABCE1-specific oligonucleotides siRNA1 and siRNA2 in neuroblastoma cell lines SK-N-BE(2), CHP-134 and SK-N-AS. ABCE1 suppression was observed from 48 to 120 hours after transfection in all cell lines. (B) Western blots and (C) respective densitometric analysis performed on lysate harvested from MYCN-amplified neuroblastoma cell lines at 54 hours post-transfection and showed the degree of ABCE1 knockdown is similar to that observed in (D, E) neuroblastoma cell lines lacking MYCN amplification and (F, G) fibroblast cell line. Results in (A) represent 1 experiment. Results in (B-E) represent a mean of 3 experiments ± standard error and p-values were derived from one sample t-test. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

3.2.4 ABCE1 suppression selectively reduces the number of dividing cells in MYCN-amplified neuroblastoma cell lines with minimal impact on cell lines lacking MYCN amplification

To examine the impact of ABCE1 suppression on the number of dividing cells, a BrdU incorporation assay was performed at 72 hours post-transfection across the seven cell lines. BrdU is a nucleotide analogue so the amount of incorporation over a set time indicates the rate of cell division. In the MYCN-amplified cell lines, SK-N-BE(2), KELLY and CHP-134, cells treated with the ABCE1 specific siRNAs, siRNA1 and siRNA2, exhibited significantly reduced proliferation compared to cells treated with control siRNA (Figure 3.2.4A-C). Despite the clinical correlation between high ABCE1 expression and poor outcome being independent of MYCN amplification, knockdown of ABCE1 did not affect the proliferation of SK-N-AS, SK-N-F1 or SH-EP neuroblastoma cells or the MRC5 fibroblast cells (Figures 3.4D-G). Thus in vitro, the growth inhibitory effects of targeting ABCE1 appeared to be limited to cells with MYCN gene amplification.

Figure 3.2.4: Impact of ABCE1 knockdown on cell proliferation across a panel of neuroblastoma cell lines. Graphs showing BrdU incorporation upon ABCE1 knockdown in the MYCN-amplified neuroblastoma cell lines (A) SK-N-BE(2), (B) KELLY and (C) CHP-134 and neuroblastoma cell lines without MYCN amplification (D) SH-EP, (E) SK-N-AS and (F) SK-N-F1 neuroblastoma cell lines or (G) fibroblast cell line MRC5. Cells were seeded into plates at 24 hours post-transfection before cell proliferation was measured by the relative amount of BrdU incorporation at 72 hours post-transfection. Representative Western blots from these experiments performed on lysates harvested at 54 hours post-transfection are shown in Figure 3.2.3. Results represent the mean of three independent experiments ± standard error. P-values were derived from one sample t-test. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

3.2.5 Knockdown of ABCE1 affects the colony forming ability of MYCN-amplified neuroblastoma cells

A limitation of the BrdU incorporation assay being performed at 72 hours post- transfection, is that anti-growth effects of ABCE1 knockdown may be observed at later time points in the cell lines without MYCN amplification. To determine the impact of ABCE1 suppression in a long-term growth assay, colony forming assays were performed on SK-N-BE(2), CHP-134 and SK-N-AS cell lines. These cell lines were selected as the time course of ABCE1 knockdown in these lines had revealed sustained ABCE1 suppression for a substantial period of the assay (Figure 3.2.3A). Similar to the BrdU proliferation assays, the colony formation of the MYCN-amplified cell lines (SK- N-BE(2) and CHP-134) was impaired upon ABCE1 suppression (Figure 3.2.5A and B) but not for the SK-N-AS cell line, consistent with the notion that neuroblastoma cells without MYCN amplification are less reliant on ABCE1 (Figure 3.2.5C).

Figure 3.2.5: MYCN-amplified neuroblastoma cells demonstrated impaired colony formation after ABCE1 suppression. Colony forming assays following ABCE1 knockdown in (A) SK-N-BE(2), (B) CHP-134 cells and (C) SK-N-AS neuroblastoma cells. Colony forming assays were set up 24-48 hours post-transfection and colonies fixed 12 days later for SK-N-BE(2) and SK-N-AS cells or 9 days later for CHP-134 cells. Results represent the mean of three independent experiments ± standard error. P- values are derived from one sample t-test. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

3.2.6 Using an inducible MYCN expression system to test the selectivity of the inhibitory effect of ABCE1 knockdown in MYCN expressing neuroblastoma cells

Across the seven cell lines used to test the impact of ABCE1 knockdown on cell growth, molecular aberrations other than MYCN amplification exist that may explain the apparent link between MYCN amplification and the response to ABCE1 knockdown. Therefore, to further validate the particular requirement for ABCE1 by MYCN expressing neuroblastoma cells, an inducible MYCN expression system was utilised. The SHEP Tet21N neuroblastoma cells can be induced to express MYCN under the control of a doxycycline-responsive promoter. In this ‘Tet-off’ system, MYCN expression is suppressed with the addition of doxycycline (Figure 3.2.6A). ABCE1 knockdown and BrdU proliferation assays were performed in SHEP Tet21N cells after they were cultured for 3-13 days in the presence or absence of doxycycline. Consistent with previous findings that ABCE1 is up-regulated by MYCN, forced MYCN expression in the SH-EP Tet21N cells increased ABCE1 expression (Figure 3.2.6A, compare lanes 1 and 4). MYCN induction in these cells increased cell proliferation (Figure 3.2.6B, compare bars 1 to bar 4). Through ABCE1 suppression, this MYCN- induced increase in cell proliferation was restored to levels observed in SH-EP Tet21N cells without MYCN (comparing bars 2, 3 to 4; Figure 3.2.6B). In line with the observations made for the seven cell lines tested previously in this chapter, ABCE1 suppression only reduced the high proliferation rate in MYCN overexpressing SH-EP Tet21N cells (Figure 3.2.6B; bars 1-3). These results provide correlative evidence to suggest that ABCE1 suppression preferentially blocks the division of high MYCN expressing neuroblastoma cells.

Figure 3.2.6: Forced MYCN expression in the SH-EP Tet21N cells sensitises proliferation of the cells to ABCE1 knockdown. SH-EP Tet21N cells do not exhibit MYCN amplification but carry a ‘Tet-off’ MYCN expression construct that enables these cells to express MYCN in the absence of doxycycline. The cells were cultured for 3-13 days in the presence or absence of doxycycline during which the ABCE1 knockdown and BrdU proliferation assays were performed. (A) Western blot showing induction of MYCN in SH-EP Tet21N cells by removal of doxycycline and knockdown of ABCE1 in these cells. (B) BrdU incorporation assay performed upon MYCN induction and ABCE1 suppression in SH-EP Tet21N cells. Results represent a mean of 3 independent experiments ± standard error and p-values were derived from one sample t-test for (B) bars 1-4 and One way ANOVA for bars 4-6 of part (B). Dox – doxycycline; Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

3.2.7 ABCE1 knockdown does not induce apoptosis in neuroblastoma cells

To determine whether suppression of ABCE1 also affected cell viability, induction of cell death was assessed by monitoring cell surface presentation of Annexin V and intracellular staining of 7-AAD. Presence of Annexin V is a marker of early apoptosis while 7-AAD enters cells with compromised cell membrane and thus is a marker of late stage apoptosis. Results showed there was no increase in the proportion of Annexin V and/or 7-AAD positive cells upon knockdown (Appendix Figure 3). Therefore, ABCE1 suppression appears to act by blocking cell division rather than by induction of apoptosis.

3.2.8 ABCE1 knockdown impairs the migration of MYCN-amplified neuroblastoma cells

Children diagnosed with metastatic, late stage neuroblastoma have much poorer clinical outcome than those without metastatic spread [72]. Although metastasis cannot be fully modelled in vitro, certain stages of the process such as cell motility and invasion of extracellular matrix can be recreated using TranswellTM inserts. The three neuroblastoma cell lines that readily migrate under in vitro conditions, i.e. SK-N-BE(2), CHP-134 and SK-N-AS, were used to test the impact of ABCE1 knockdown on cell migration. For migration, the TranswellTM inserts were coated with collagen IV to enable neuroblastoma cells to adhere to and migrate through the pores of the TranswellTM membrane and a gradient of 0-10% FBS was used to induce migration. The number of migrated cells was expressed as a percentage of the total number of cells so that any reduction in migration was not exaggerated by the decrease in proliferation. The results showed that the motility of the MYCN-amplified cell lines, SK-N-BE(2) and CHP-134, was affected by ABCE1 suppression (Figures 3.2.7A-B), whereas the motility of the SK-N-AS was not (Figure 3.2.7C).

Figure 3.2.7: Impact of ABCE1 suppression on the migration of neuroblastoma cells. Graphs show migration index upon ABCE1 knockdown in (A) SK-N-BE(2), (B) CHP-134 and (C) SK-N-AS neuroblastoma cells. Cell migration was measured using Transwell inserts coated with Collagen IV on the underside of the Transwell inserts. Migration was induced using a 0-10% FBS gradient. Migration index refers to the number of migrated cells as a percentage of the total number of cells so that the results are not affected by changes in cell proliferation. Results (A-C) represent the mean of three independent experiments ± standard error. P-values were derived from One Way ANOVA with Dunnett’s multiple comparisons correction. Ctrl – non-targeting control siRNA; siRNA1 – ABCE1 specific siRNA sequence 1; siRNA2 – ABCE1 specific siRNA sequence 2.

3.2.9 ABCE1 suppression blocks the invasion of extracellular matrix by MYCN- amplified neuroblastoma cells

To model the invasion of extracellular matrix, SK-N-BE(2) cells were seeded onto MatrigelTM coated TranswellTM inserts and allowed to move along a 5-10% FBS gradient. The cells must invade through the MatrigelTM to reach the complete media. ABCE1 suppression caused a dramatic decrease in the invasiveness of the SK-N-BE(2) cells (Figure 3.2.8).

Figure 3.2.8: Invasion of extra-cellular matrix by SK-N-BE(2) cells was impaired upon ABCE1 suppression. Cells were seeded into Matrigel® and collagen IV coated Transwell inserts and invasion induced with a 2-10% FBS gradient and 2.5µg/ml of PDGF. Invasion index refers to the number of invaded cells as a percentage of the total number of cells so that the results are not affected by changes in cell proliferation. Results represent the mean of three independent experiments ± standard error. P-values are derived from One Way ANOVA with Dunnett’s multiple comparisons correction. Ctrl – non-targeting control siRNA; siRNA1 – ABCE1 specific siRNA sequence 1; siRNA2 – ABCE1 specific siRNA sequence 2.

3.2.10 Investigating the effect of combining ABCE1 suppression with standard-of- care chemotherapies

Besides cell growth, migration and invasion, another malignant phenotype of high-risk neuroblastomas is their resistance to chemotherapy. This is a significant problem as it leads to neuroblastoma relapse that in turn often leads to disease-related mortality. Determining which chemotherapeutic(s) can co-operate with the anti-oncogenic effects ABCE1 knockdown will shed light on the types of chemotherapies that can be given in combination with future pharmacological inhibitors of ABCE1. The frontline chemotherapeutics for neuroblastoma include cisplatin, doxorubicin, vincristine, cyclophosphamide, etoposide with topotecan used for relapsed disease.

To investigate the impact of ABCE1 knockdown on the sensitivity of MYCN-amplified neuroblastoma cells to these drugs, colony forming assays were set up for the SK-N- BE(2) neuroblastoma cells that were transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2) and assessed for chemotherapeutic response. Topotecan, etoposide and doxorubicin all exert their anti-oncogenic effects by interfering with the function of topoisomerases. Representative photographs of the colony forming assay plates showed that ABCE1 suppression alone caused a dramatic decrease in the number of colonies and the addition of topotecan or etoposide further reduced the number of colonies (Figure 3.2.9A-B). This effect was not observed with doxorubicin (Figure 3.2.9C). Dose response curves generated after analysis of the colony forming assay show that ABCE1 knockdown was able to potentiate topotecan and etoposide as represented by the left-shift in the curves (Figure 3.2.9. D-E). However, this shift in the dose-response curves was not observed following doxorubicin treatment (Figure 3.2.9F). When the half maximal inhibition concentrations (IC50s) were extrapolated from the dose-response curves, the ~50% reduction in the IC50s of topotecan and etoposide caused by ABCE1 knockdown reached statistical significance (P<0.0001 for topotecan and P=0.0074 for etoposide) but no significant changes were observed in the IC50 of doxorubicin (Figure 3.2.9G-I).

100

Figure 3.2.9: The impact of combining ABCE1 suppression with chemotherapeutics that induce topoisomerase-mediated DNA damage on the viability of MYCN-amplified neuroblastoma cells. (A-C) Representative photos of the colony forming plates showing how the addition of topotecan and etoposide further reduced the number of colonies compared to ABCE1 knockdown alone but the addition of doxorubicin had a similar effect on cells with or without ABCE1 expression. (D-F) Dose response curves show that ABCE1 knockdown increased the sensitivity of the cells to topotecan and etoposide but not doxorubicin. SK-N-BE(2) neuroblastoma cells were transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Percent viability was calculated for each siRNA individually. Within each siRNA treatment, the number of colonies formed by cells receiving drug treatment is calculated as a percentage of the number of colonies formed by cells receiving vehicle only to give

101 the percent viability. (G-I) Half maximal inhibitory concentrations (IC50s) extrapolated from the dose-response curves of the treatments show that ABCE1 suppression reduced the IC50s of topotecan and etoposide by >50%. Colony assays were set up at 24 hours post-transfection during which varying concentrations of topotecan (targets topoisomerase I), etoposide (targets topoisomerase II) or doxorubicin (induces topoisomerase II-mediated DNA damage) were added to the culture media. Results (A, D, F and I) each represent the mean of three independent experiments ± standard error. Results (E and H) represent the mean of four independent experiments ± standard error. P-values for (G, H and I) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction.

Cyclophosphamide, cisplatin and vincristine were also tested in combination with ABCE1 knockdown. When administered in vivo, cyclophosphamide is metabolised by the liver to release active metabolites that possess anti-oncogenic properties. Mafosfamide is one such active metabolite of cyclophosphamide that can be studied in vitro since it does not require metabolism by the liver to exert its anti-oncogenic effects. Photos of the colony forming assays show that when cells were treated with 2µM of mafosfamide, ABCE1 knockdown further reduced the number of colonies (Figure 3.2.10A). Suppression of ABCE1 sensitised SK-N-BE(2) neuroblastoma cells to mafosfamide, reducing the IC50 by ~75% (Figure 3.2.10A). The reduction in the IC50 of mafosfamide by ABCE1 knockdown reached statistical significance (P=0.0047; Figure 3.2.10C).

102

Figure 3.2.10: ABCE1 knockdown potentiates the anti-growth effects of mafosfamide against MYCN-amplified neuroblastoma cells. SK-N-BE(2) neuroblastoma cells were transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Colony assays were set up at 24 hours post-transfection during which varying concentrations of mafosfamide were added to the culture media. (A) Representative photos of the colony forming plates show how the addition of mafosfamide decreased the number of colonies further than ABCE1 knockdown alone. (B) Dose response curves show that ABCE1 knockdown increased the sensitivity of the cells to mafosfamide. Percent viability was calculated for each siRNA individually. Within each siRNA treatment, the number of colonies formed by cells receiving drug treatment is calculated as a percentage of the number of colonies formed by cells receiving vehicle only to give the percent viability. (C) The half maximal inhibitory concentrations (IC50s) were extrapolated from the dose-response curves of the treatments and ABCE1 knockdown significantly reduced the IC50 of mafosfamide. Results represent the mean of four independent experiments ± standard error. P-values for (C) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction.

103

Cisplatin also induces DNA adducts as well as crosslinks. However, treatment with cisplatin had similar effects on the number of colonies formed by SK-N-BE(2) cells with or without ABCE1 knockdown (Figure 3.2.11A). Dose-response curves show a small leftward shift in the curves representing the colony formation by cells with ABCE1 suppression (Figure 3.2.11B). Despite a small decrease in IC50 by 20-30%, no significant changes were observed between cells with or without ABCE1 knockdown (Figure 3.2.11C).

Vincristine targets the microtubules and prevents proper mitotic spindle formation which is needed for cell division. ABCE1 knockdown slightly increased the sensitivity of the SK-N-BE(2) neuroblastoma cells to vincristine, causing further decreases in the number of colonies than 0.25µM of vincristine treatment alone (Figure 3.2.12A). This result is reflected by the small leftward shift in the dose-response curves (Figure 3.2.12B). However, due to large variation between the experiments for siRNA2 treated cells, the reduction in IC50 was not statistically significant (P=0.1717; Figure 3.2.12C).

104

Figure 3.2.11: The impact of combining ABCE1 suppression with cisplatin on the viability of MYCN-amplified neuroblastoma cells. SK-N-BE(2) neuroblastoma cells were transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Colony assays were set up at 24 hours post-transfection during which varying concentrations of cisplatin were added to the culture media. (A) Representative photos of the colony forming plates show how the addition of cisplatin failed to reduce the number of colonies further than ABCE1 knockdown alone. (B) Dose response curves show that ABCE1 knockdown did not increase the sensitivity of the cells to cisplatin. Percent viability was calculated for each siRNA individually. Within each siRNA treatment, the number of colonies formed by cells receiving drug treatment is calculated as a percentage of the number of colonies formed by cells receiving vehicle only to give the percent viability. (C) The half maximal inhibitory concentrations (IC50s) were extrapolated from the dose-response curves of the treatments and ABCE1 knockdown did not significantly reduce the IC50 of cisplatin. Results represent the means of three independent experiments ± standard error. P-values for (C) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction.

105

Figure 3.2.12: The impact of combining ABCE1 suppression with the microtubule- targeting agent, vincristine, on the viability of MYCN-amplified neuroblastoma cells. SK-N-BE(2) neuroblastoma cells were transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Colony assays were set up at 24 hours post- transfection during which varying concentrations of vincristine were added to the culture media. (A) Representative photos of the colony forming plates showing how the addition of cisplatin did not further reduce the number of colonies more than ABCE1 knockdown alone. (B) Dose response curves show that ABCE1 suppression did not heighten the sensitivity of the cells to vincristine. Percent viability was calculated for each siRNA individually. Within each siRNA treatment, the number of colonies formed by cells receiving drug treatment is calculated as a percentage of the number of colonies formed by cells receiving vehicle only to give the percent viability. (C) The half maximal inhibitory concentrations (IC50s) extrapolated from the dose-response curves of the treatments show that ABCE1 knockdown did not lower the IC50 of vincristine. Results represent the mean of three independent experiments ± standard error. P-values for (C) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction.

106

3.2.11 High ABCE1 expression may support the progression of c-MYC expressing neuroblastomas

Analysis of clinical data in this study so far has revealed that high ABCE1 mRNA expression is prognostic of outcome irrespective of MYCN amplification status while in vitro experiments imply that ABCE1 suppression primarily affects MYCN-amplified neuroblastoma cell lines. A possible explanation for such discrepancy is that patients without MYCN amplification can exhibit c-MYC amplification or overexpression and given the functional similarities between c-MYC and MYCN, it is likely that high ABCE1 expression may confer poor outcome in this subset of patients. About 10% of neuroblastomas exhibit c-MYC overexpression [374]. Recently, elevated levels of c- MYC have been shown to play an as important role in neuroblastoma development and progression as MYCN amplification [375]. Furthermore, ABCE1 can also be up- regulated by c-MYC [299]. Therefore, the prognostic significance of ABCE1 was analysed in a cohort of neuroblastoma patients without MYCN amplification but exhibiting ‘high c-MYC’ expression. Patients were considered to exhibit ‘high c-MYC’ expression if their c-MYC mRNA level were ranked in the upper half or upper quartile of the cohort. In this group, elevated ABCE1 expression (dichotomised at the upper quartile level) was prognostic of poor outcome (Figure 3.2.13A, left panel, P=0.003; HR=1.968 with 95% CI of 1.256-3.085). Similar observations were made in patients with c-MYC mRNA in the upper quartile of the cohort (Figure 3.2.13A, right panel, P=0.047; HR=1.82 with 95% CI of 1.008-3.288). When expression of ABCE1 and c- MYC proteins were analysed in neuroblastoma tumour microarrays, tumours with c- MYC expression (with scores >0) expressed significantly higher levels of ABCE1 protein compared to tumours without c-MYC expression (score =0; Figure 3.2.13B). In NB69 neuroblastoma cells that exhibit high c-MYC protein expression without MYCN amplification, ABCE1 knockdown impaired cell proliferation to similar extent as in MYCN-amplified neuroblastoma cell lines (Figure 3.2.13C), in support of the notion that ABCE1 may contribute to the growth of c-MYC driven neuroblastoma cells.

107

Figure 3.2.13 ABCE1 is predictive of poor outcome in neuroblastoma patients with high c-MYC expression and lacking MYCN amplification. (A) Patients from Kocak et al (2013; [376]) without tumour MYCN amplification and expressing high levels of c- MYC (segregated at the median or upper quartile level) have worse event-free survival when ABCE1 expression is elevated compared to those with low levels of ABCE1. (B) ABCE1 protein expression across three neuroblastoma tumour microarrays (13_002, 14_001 and 14_002) obtained from the tumour bank at The Children’s Hospital at Westmead show that in patients without MYCN amplification ABCE1 protein level is higher in those with c-MYC expression (score >0). (C) Proliferation assay performed on the NB69 neuroblastoma cells, which exhibit high c-MYC expression but no MYCN amplification, show cells with ABCE1 suppression have significantly impaired

108 proliferation. (C) Results represent means of three independent experiments ± standard error. P-values for (A) are derived from Log-rank test. P value for (B) was derived from two-tailed t-test while for (C) p-values were derived from one sample t-test.

109

3.3 Discussion

Despite improvements in the treatment regimen for neuroblastoma, the five year survival rate of patients with MYCN-amplified neuroblastoma lies around 40% [3], necessitating the development of new, more effective methods of treating this disease. Inhibition of the MYCN transcription factor through its downstream target genes presents an attractive avenue of treating neuroblastoma. However, because MYCN drives the expression of a large number of genes that contribute to oncogenesis [237] [210, 211, 235, 239-241], an obvious question is whether targeting just one of these is enough to block the effects of MYCN-driven tumour progression. The results reported in this chapter highlight that targeting the MYCN-regulated gene, ABCE1, on its own can impair the malignant characteristics of neuroblastoma. In particular, the data showed that suppression of ABCE1 reduced the growth, migration and invasion of MYCN-amplified neuroblastoma cells whilst having minimal impact on the neuroblastoma or fibroblast cell lines that lack MYCN gene amplification. Furthermore, preliminary experiments indicate the anti-growth effects of ABCE1 suppression can be potentiated by three standard-of-care chemotherapeutics namely topotecan, etoposide and mafosfamide. Such results suggest that targeting ABCE1 represents a potentially valuable therapeutic approach in this childhood disease.

The MYC transcriptional program is critical in driving the development and progression of MYC driven cancers such as neuroblastoma [184]. A major component of this transcriptional program are RNAs and proteins involved in mRNA translation which, when up-regulated by MYC factors, contribute essential building blocks needed by cancer cells to support their perpetual growth [202, 242, 247, 266, 377]. The direct transcriptional up-regulation of ABCE1 by MYCN and c-MYC reported by previous studies suggest that ABCE1 is also a part of this transcriptional program [298, 299]. By showing that high ABCE1 expression is more frequently observed in neuroblastoma tumours or cell lines with MYCN amplification, the results of this chapter support the notion that ABCE1 may be a functional downstream target of MYC factors. Interestingly, although the phenotypic data obtained from cell lines support this relationship, no statistically significant differences in either ABCE1 protein or RNA expression between MYC expressing versus MYC non-expressing neuroblastoma cell lines. It is possible that elevated expression of ABCE1 across cell lines is an artefact of extended culture in vitro. Hence the data obtained from the primary samples in the

110 tumour microarrays showing that ABCE1 is significantly elevated in MYCN-amplified neuroblastoma tumours may be the most representative.

An earlier report linked ABCE1 expression with poor clinical outcome in a cohort of 250 neuroblastoma patients and this implied ABCE1 may be required for the progression of this disease [299]. By using RNA sequencing data from 498 neuroblastoma patients to confirm the correlation between high ABCE1 expression and reduced patient survival, the current study provided further support for the potential importance of ABCE1 in neuroblastoma tumour progression. The results of the multivariate analysis performed on this cohort suggest that despite MYCN being a driver of ABCE1 expression, the prognostic significance of ABCE1 is not limited to patients with MYCN amplification and highlight ABCE1 as an independent prognostic factor in neuroblastoma. These findings imply that ABCE1 may also be required for the progression of neuroblastomas without MYCN amplification. Therefore, subsequent in vitro experiments included MYCN-amplified neuroblastoma cell lines and cell lines without MYCN amplification to allow examination of the importance of ABCE1 in the biology of both subsets of neuroblastoma.

Despite the essential requirement for ABCE1 in protein synthesis demonstrated by findings across a diverse range of organisms from archaea to yeasts, data from this study showed that neuroblastoma cells without MYCN amplification were not dependent on ABCE1 for their proliferation [339, 340, 346, 351]. Interestingly, although ABCE1 is a downstream target of c-MYC and MYCN, the notion of ABCE1 playing a critical role specific to the biology of MYC-driven cancers has not been reported. The role of ABCE1 in the proliferation of cancer cells has been briefly explored in adult cancers. For example, ABCE1 knockdown can reduce the proliferation of cervical, breast, oesophageal and small cell lung cancer cells [339, 342-345]. In these studies, all of the cancer cell lines that show reduced malignant properties upon ABCE1 suppression express high levels of MYC. However, one limitation was that in each study, for each cancer type, only a single cell line was used to explore the effects of ABCE1 suppression. Given the molecular heterogeneity often seen in adult cancers, particularly breast cancer, it is unclear whether the response to ABCE1 would be consistently observed across different molecular subtypes of each adult cancer or if the effects would be limited to cells with c-MYC overexpression. The advantage of using the SH-EP Tet21N cells is that it allows the effect of ABCE1 knockdown to be studied in direct

111 comparison between cells with and without MYCN overexpression, minus the complications of different cell line backgrounds. Using this model, it was found that high-level expression of MYCN was associated with the sensitivity to ABCE1 knockdown. Also, in the present study, the survey of six different MYCN amplified neuroblastoma cell lines (three MYCN-amplified; three cell lines without MYCN amplification) and the finding that inhibition of proliferation caused by ABCE1 knockdown was consistently observed in but was limited to the MYCN-amplified cell lines further supported this conclusion. Interestingly, the SK-N-AS cells that lack MYCN amplification showed no reductions in cell growth or migration despite expressing similar levels of ABCE1 to the MYCN-amplified KELLY cells. Such data demonstrate that the response of neuroblastoma cells to ABCE1 knockdown is not affected by the level of ABCE1 expression. The presence of MYCN amplification appears to be the major dictator of response to ABCE1 knockdown. This result provides encouraging evidence that despite the ubiquitous expression of ABCE1, any detrimental impact on cell growth or migration may be limited to those with MYCN amplification or overexpression.

Since MYC factors up-regulate various genes that promote cell cycle progression, faster rates of cell division and short cell cycles may sensitise MYC-amplified cancer cells to any agent that disrupt cell proliferation [378]. However, in neuroblastoma, it is unlikely for faster rates of cell division alone to be responsible for impaired growth following ABCE1 knockdown in MYCN-amplified neuroblastoma cells. This is because as published in Lau et al 2015, the SH-EP cell line used in this current study exhibit a shorter doubling time of 1.28 days compared to the MYCN-amplified KELLY (2.62 days) and CHP134 (1.84 days) [378]. Therefore, other reasons for the difference in growth changes following ABCE1 suppression, such as the contribution of ABCE1 to a metabolic process critical for the growth of MYCN-amplified neuroblastoma cells, should be investigated in future studies.

Results of the TranswellTM migration assays in SK-N-AS cells without MYCN amplification imply that the migratory capacity of these neuroblastoma cells is not reliant on ABCE1. However, unlike the proliferation assays, only one cell line lacking MYCN amplification (SK-N-AS) was used for the TranswellTM migration assays. As cell lines without MYCN amplification other than SK-N-AS do not migrate efficiently in vitro, it was difficult to thoroughly investigate this concept. Another option might be to

112 test the impact of ABCE1 knockdown on the migration of cells bearing an inducible MYCN expression system, although this is technically difficult because the available expression system, SH-EP Tet21N cells (like the parental SH-EP cells), has limited migratory capacity in vitro and is weakly tumorigenic in vivo. Therefore, development of an inducible MYCN expression system in a highly migratory, neuroblastoma cell line without MYCN amplification such as the SK-N-AS cells would allow further testing of whether the anti-migratory effects of ABCE1 suppression are limited to cells with MYCN amplification. Regarding the TranswellTM invasion assay, the SK-N-AS cells, like the CHP-134 cells, do not readily invade or exhibit problems with adhesion to the extracellular matrix so only one cell line, the SK-N-BE(2), was used for the invasion assay. Thus, the only conclusion that can be drawn is that ABCE1 knockdown impairs invasion through extracellular matrix by the SK-N-BE(2) cells. No further deductions can be drawn regarding the necessity of MYCN overexpression to the reliance of the neuroblastoma cells upon high ABCE1 expression for efficient invasion.

The current evidence showing that ABCE1 knockdown impairs the malignant phenotype of neuroblastoma cells can be strengthened through a number of approaches. One method is by performing proliferation assays following ABCE1 suppression in a wider panel of cell lines including the MYCN-inducible cells such as the SH-EP Tet21N line. Creating ABCE1 knockout cell lines using CRISPR-Caspase 9 or shRNA specific to ABCE1 will provide an alternate method of ABCE1 suppression and enable the effects of long-term ABCE1 knockdown to be studied. To determine if the effects on malignant phenotype is solely caused by ABCE1 suppression, rather than off-target effects common to siRNA-based approaches, overexpression of ABCE1 can be performed in cells with ABCE1 suppression to determine whether the overexpression can reverse the effect of ABCE1 suppression and restore cell growth or migration. Silent mutations can be introduced to the overexpression construct to avoid suppression by siRNAs without affecting amino acid sequence of ABCE1. Conversely, point mutations can be introduced via site-directed-mutagenesis to determine which mutant of ABCE1 fails to rescue the effect of ABCE1 suppression. This experiment will help determine which region of ABCE1 (for example its ATPases or Fe-S cluster) is required to enhance the malignant phenotypes of neuroblastoma.

To provide further evidence showing that ABCE1 is specifically required for MYCN- driven malignant characteristics, ABCE1 can be suppressed in the SH-EP Tet21N cells

113 that lack MYCN expression. Then, once ABCE1 is suppressed, MYCN expression can be induced in these cells. If these cells cannot achieve the same level of growth rate as the MYCN-expressing cells with ABCE1 expression, then it can be concluded that MYCN relies on ABCE1 to increase the malignancy of neuroblastoma cells. Similarly, MYCN and ABCE1 can be co-overexpressed in mouse embryonic fibroblasts to see if MYCN requires ABCE1 for malignant transformation and immortalisation. A similar study has been performed to prove that ARID3B is vital to MYCN-driven malignant transformation [379]. These data may provide additional evidence that ABCE1 is required for malignant characteristics driven specifically by MYCN.

The ability for ABCE1 suppression to preferentially target cells with MYCN amplification is likely to stem from the molecular functions of ABCE1. The most widely published function of ABCE1 is its role in supporting global mRNA translation and protein synthesis [339, 340, 346, 353, 354, 357]. As a fundamental process required for the survival of all cells, protein synthesis has been considered as a pathway for which it would be difficult to obtain a safe therapeutic window. However, several recent studies have shown that targeting certain aspects of translation can block the growth of c-MYC-driven cancer cells and tumours without general toxicity. These cancers are sensitive to therapeutics that target translation because the heightened cell proliferation rates, characteristic of MYC-driven cancers, can only be maintained by efficient protein synthesis [246, 278]. Such reliance on heightened protein synthesis makes c-MYC hyperactive cancers particularly sensitive to any disruptors of translation [246, 270, 273, 274, 380]. The results of this chapter suggest that MYCN has a similar effect on cell biology because an elevated rate of cell proliferation was observed in SH-EP Tet21N cells with forced MYCN expression compared to cells lacking this molecular aberration. Similar to c-MYC, MYCN up-regulates an entire repertoire of genes that heighten protein synthesis and cell proliferation [202, 242, 247, 266, 377]. Therefore, it might be unexpected that the knockdown of a single translation factor could reverse the malignant phenotypes up-regulated by MYCN. However, the current work now shows that targeting ABCE1 alone is able to restore the proliferation back to a level close to baseline level. Based the published findings in c-MYC-driven cancers, elevated protein synthesis in MYCN-amplified neuroblastomas and their reliance on this process is one potential hypothesis that explains why these cells are so vulnerable to ABCE1 suppression. The experiments of chapter 4 will test this hypothesis.

114

Another possible mechanism by which translation factors can target cancers with specific molecular aberrations lies in their ability to alter the translation of specific mRNAs that encode proteins critical to progression of these cancers. This has been demonstrated in studies where therapeutic inhibition of translation initiation factors up- regulated by c-MYC, such as eIF4E, can selectively down-regulate the translation of oncogenes such as cyclin D1, VEGF and c-MYC that are critical to the growth and proliferation of cancer cells [256, 259, 289, 381]. Genes that control cancer cell migration and metastasis can also be regulated at the translational level. For example, inhibiting the function of eIF4E through mTOR alters the translation of proteins that are involved in epithelial to mesenchymal transition (EMT); leading to reduced invasiveness of prostate cancer cells [257]. Inhibiting eIF4E activity using ribavirin has been shown to block the production of MMP-3 and MMP-9, leading to reduced metastasis of breast cancer cells [382]. Suppressing eIF5A2 also alters the expression of EMT markers, resulting in impaired migration and invasion of extracellular matrix [383, 384]. If the reported role of ABCE1 in protein synthesis holds true in MYCN-amplified neuroblastomas, then limited capacities in protein turnover as a result of ABCE1 knockdown may reduce the production of proteins required for cell migration and invasion of ECM. This may cause the observed impairment in cell migration and tumour metastasis. This possibility will be examined in chapter 4.

The current study has also demonstrated that the growth of non-malignant MRC5 fibroblasts is unaffected by ABCE1 suppression. While these data are encouraging, it is not possible to draw conclusions about whether ABCE1 suppression affects other non- malignant tissues, based on this study. Previous studies that examined the impact of ABCE1 knockdown on non-malignant HEK293T cells show the anti-proliferative effects occurring at a later time point. For example, cell cycle arrest was observed in the HEK293T cells at six days after transfection with ABCE1 specific siRNAs as opposed to three days in MYCN-amplified neuroblastoma cells ([339]; [358]versus Figure 3.2.4A-C). A major caveat shared by our study and the ones performed on HEK293T cells is that the cells used do not accurately represent how non-malignant tissues respond to treatment in vivo. For example, the transformation of the HEK293T cells with the SV40 large T antigen causes the cells to exhibit rapid proliferation that is not usually observed with primary non-malignant cells in culture. The most accurate way to investigate whether ABCE1 is necessary for development and survival of non-malignant

115 tissue is by creating ABCE1 hemizygous mice with the TH-MYCN transgenic background. The TH-MYCN transgenic mice should develop neuroblastoma tumours. If ABCE1 hemizygosity gives viable offspring without neuroblastoma, we can conclude high expression of ABCE1 is required for initiation of neuroblastoma but not for normal development. A similar experiment was performed to demonstrate how mice with 50% of eIF4E expression can develop normally and that the expression of this protein is only needed for MYC and Ras-driven malignant transformation [278]. Alternatively, creating a conditional ABCE1 knockout in the TH-MYCN background enables the impact of ABCE1 knockout on viability or development various organs to be examined. Another method of testing the impact of ABCE1 suppression on non-malignant tissue is by using a biologically tolerable vehicle to deliver the ABCE1-specific siRNAs systemically to treat either tumour-bearing TH-MYCN transgenic mice or immunocompromised mice with neuroblastoma xenografts. The safety of targeting ABCE1 would be supported if no adverse effects were observed at a dose of the siRNAs that causes tumour delay. As a first step towards such studies, a proof-of-concept experiment to test the efficacy of nanoparticles complexed with ABCE1-specific siRNA will be described in chapter 5.

Despite the in vitro experiments showing the resistance of cell lines without MYCN amplification to ABCE1 knockdown, high ABCE1 expression is still correlated with poor outcome in patients without MYCN-amplified neuroblastoma tumours. One possible explanation for this discrepancy is that the cell lines lacking MYCN amplification that we have used express neither MYCN nor c-MYC; however, patients without MYCN amplification may display overexpression of c-MYC [375]. The high ABCE1 expression predicting poor clinical outcome in these ‘high-c-MYC’ patients is likely to account for the correlation between high ABCE1 expression and reduced survival of patients without MYCN amplification. The link between high ABCE1 expression and reduced survival of patients with high c-MYC expression suggests ABCE1 may contribute to the progression of these cancers. This is a likely possibility because c-MYC overexpression can drive neuroblastoma progression in a similar fashion to MYCN and shares many common transcriptional targets including ABCE1 [184, 298, 299, 385]. Following ABCE1 suppression, the significant decrease in proliferation of the NB69 neuroblastoma cells which lack MYCN amplification but express high levels of c-MYC suggest that ABCE1 does indeed support division of high c-MYC neuroblastoma cells. A role in c-MYC driven cancers potentially has broad

116 implications because half of all cancers display c-MYC overexpression. While previous studies did not investigate the importance of c-MYC in dictating sensitivity to ABCE1 knockdown, the reduction in malignant phenotypes of certain c-MYC expressing cancer cell lines upon ABCE1 knockdown raises the possibility that ABCE1 may play a part in the biology of these cancers.

Besides c-MYC overexpression, aberrations such as overexpression of MYCN or stabilisation of the MYCN protein can also lead to MYC hyperactivity, leading to tumours that exhibit characteristics similar to a MYCN-amplified tumour [202, 204, 208]. Therefore, it is possible for high ABCE1 expression to correlate with poor outcome in patients whose tumours display high MYC activity but do not possess MYCN amplification. Further analysis of the patient cohort by excluding those with high MYC activity will determine if the progression of neuroblastomas with low MYC activity is independent of ABCE1 expression.

Since the phenotypic assays have shown that targeting ABCE1 may possess some degree of therapeutic benefit for MYCN-amplified neuroblastomas, one of the remaining questions is whether targeting ABCE1 can heighten the efficacy of standard-of-care chemotherapeutics. When molecular based agents enter the clinic, they are often required to be administered in combination with standard-of-care chemotherapeutics as they typically exert limited clinical efficacy as single agents [144, 145, 150]. Therefore, it is important to identify which chemotherapeutic(s) could synergise with ABCE1- targeting agents. Furthermore, chemoresistance, which often leads to relapsed or refractory disease, is a major roadblock in the treatment of neuroblastoma [4, 72]. MYCN can directly or indirectly up-regulate a number of genes that contribute to drug resistance including the multi-drug transporter P-gp and MDM2, which destabilises p53 [175, 299]. Reduced levels of p53 and inactivating mutations in this gene can heighten the chemoresistance phenotype of cancers and much research has been focused on ways of re-sensitising these cancers cells to chemotherapy [368, 386-388]. SK-N-BE(2) is a MYCN-amplified, p53 mutant cell line and is highly resistant to conventional chemotherapeutics [368]. The results from the cytotoxic clonogenic assays performed on the SK-N-BE(2) cells in this chapter suggest that despite being highly chemoresistant, the sensitivity of these cells to etoposide, topotecan and mafosfamide can be significantly heightened by ABCE1 suppression. From a clinical perspective, the findings have significant implications as topotecan along with cyclophosphamide

117

(mafosfamide precursor) are therapeutics used for relapsed neuroblastomas that often respond poorly to chemotherapy. If ABCE1 targeted agents are developed, the results from this chapter imply they may offer therapeutic benefit for relapsed patients whose prognosis remain poor. Furthermore, when molecular target-based agents enter the clinic, they are often combined with topotecan and cyclophosphamide. The new analogue of camptothecin, irinotecan, is now being introduced into the clinic as a replacement of topotecan for relapsed neuroblastomas. The potentiation of topotecan by ABCE1 suppression suggests that investigation into the potentiation of irinotecan should also be considered.

The preliminary studies performed in this chapter have raised a number of questions that must be addressed before clinical relevance of the findings can be conclusively interpreted. Firstly, studies in additional MYCN-amplified neuroblastoma cell lines are needed to confirm if potentiation of these three chemotherapeutics by ABCE1 knockdown is a common phenomenon across many MYCN-amplified and/or p53 mutant neuroblastoma cell lines. Furthermore, since ABCE1 suppression did not affect the malignant phenotypes of cell lines without MYCN amplification, it would be interesting to test whether the addition of chemotherapeutics will sensitise these cells to the knockdown. Finding new methods of treating patients without MYCN amplification is also important because a majority of high-risk neuroblastoma patients (~55%) do not possess MYCN amplification and these patients can have poor clinical outcome [59]. It is also important to note that animal experiments will be required to confirm whether the ~2-fold decrease in the IC50s of topotecan, etoposide and mafosfamide (cyclophosphamide) can still be observed in vivo. Nonetheless, this set of experiments provides encouraging evidence that the anti-growth effects of etoposide, topotecan and mafosfamide against the SK-N-BE(2) neuroblastoma cells can be heightened with ABCE1 knockdown.

Since ABCE1 is a soluble protein without a lipophilic, drug transport domain, the potentiation of chemotherapeutics by ABCE1 knockdown is unlikely to be caused by reductions in drug efflux through ABCE1. However, since ABCE1 is believed to play a role in protein synthesis, its suppression may lead to down-regulation of drug transporters or enzymes that can break down or inactivate mafosfamide, topotecan and etoposide whilst having no effect on doxorubicin, vincristine and cisplatin (i.e. the agents that were not potentiated by ABCE1 suppression). For example, while the

118 literature has not shed light on possible mechanisms for potentiation of mafosfamide or etoposide, the potentiation of topotecan by ABCE1 knockdown is thought to be caused by the activation of RNaseL and subsequent JNK-dependent apoptosis [347]. One of the first known functions of ABCE1 was its ability to inhibit RNaseL, which is an enzyme that degrades ribosomal RNA to impair protein synthesis and induce JNK-mediated apoptosis [347, 359]. RNaseL is normally activated by type I interferons in response to viral infections [347, 359]. However, topoisomerase I inhibitors such as camptothecin and its analogues (e.g. topotecan) can also activate RNaseL activity [360]. The removal of the RNaseL inhibitor, i.e. ABCE1, maximises the effect of RNaseL activation and JNK-mediated apoptosis as demonstrated in c-MYC driven prostate cancers [360]. Results of this chapter supported such findings by showing that the potentiation of topotecan against a MYCN-amplified neuroblastoma cell line with ABCE1 suppression. While the colony forming assay is ideal for detecting small changes in cell growth, it does not indicate whether the combination of topotecan and ABCE1 knockdown is enhancing the apoptotic effects of topotecan or strengthening the anti-proliferative effects of the individual agents. Exploring the exact mechanisms of how ABCE1 suppression sensitises neuroblastoma cells to topotecan, etoposide and mafosfamide is worthy of future investigations. These investigations may include identifying the proteins that are responsible for the observed potentiation using RNA sequencing or mass spectrometry performed on neuroblastoma cells at various time points following ABCE1 suppression. Then, cell-based experiments may be conducted to test whether overexpression of these proteins following ABCE1 knockdown can restore resistance to topotecan, etoposide and mafosfamide.

Despite accumulating literature on the potential for exploiting control of mRNA translation for cancer therapy, the value of ABCE1 as a therapeutic target for cancer treatment has not been previously appreciated. The results of this chapter showed that suppression of ABCE1 selectively reduces the malignant phenotypes of MYCN- amplified neuroblastoma with minimal impact on cells that lack this genetic aberration, thus supporting the notion of ABCE1 as an attractive therapeutic target for neuroblastoma. The molecular function of ABCE1 as a translation factor has been explored in lower order organisms such as archaea, yeast and Drosophila, suggesting ABCE1 suppression may reduce malignant phenotypes of neuroblastoma cells by impairing translation. Examination of the impact of ABCE1 knockdown on translation

119 in neuroblastoma cells is necessary to fully explain the selectivity against MYCN- amplified neuroblastoma cells observed in this chapter. This is because the selectivity may arise in one of two ways. Firstly, it is possible that ABCE1 knockdown reduces translation efficiency in all cell lines but the proliferation and migration rates heightened by MYCN expression are more sensitive to disruptions in mRNA translation compared to the slower proliferation and migration rates of neuroblastoma cells without MYCN amplification. The other possibility is that being a MYC up-regulated gene, ABCE1 expression is only critical for heightened protein synthesis in MYCN-amplified neuroblastoma cells and this process is not affected by ABCE1 suppression in cells without aberrant MYCN. The mechanism by which ABCE1 suppression affects protein synthesis in neuroblastoma cells will be examined in the following chapter.

120

Chapter 4: Investigating the molecular mechanisms that underlie the pro- oncogenic functions of ABCE1

121

4.1: Introduction

One of the key discoveries that arose from chapter 3 was the ability of ABCE1 suppression to inhibit the malignant phenotypes of MYCN-amplified neuroblastoma cells without affecting that of neuroblastoma and fibroblast cell lines that lack MYCN amplification. Thus, the focus of this chapter is to investigate the molecular mechanisms that underlie the observed selectivity of ABCE1 suppression against MYCN-amplified neuroblastoma cells. To explore this possibility, the proposed molecular functions of ABCE1 and the importance of these functions in MYC-driven cancers must be understood.

The best described molecular function of ABCE1 and the most likely method by which ABCE1 can promote the malignant phenotype of cancer cells is through its role in protein synthesis. Using lysates from rabbit reticulocytes, archean and yeast cells, the ATP hydrolysis by ABCE1 has been shown to power the dissociation of the single ribosome into the large and small ribosome subunits in the process of ribosome recycling [346, 351, 354, 355]. This process enables free small and large ribosome subunits to bind to new transcripts and continue mRNA translation. Ribosome profiling experiments, which determine where ribosomes are located on an mRNA, show that loss of ABCE1 in yeast and chronic myeloid leukaemia cells causes accumulation of ribosomes at the 3’ untranslated region (3’-UTR) because the ribosomes cannot dissociate mRNA transcripts [353, 357]. By demonstrating that ABCE1 is required for ribosome dissociation or recycling, these studies confirm the previous findings discovered using cell-free systems. But besides promoting ribosome recycling, ABCE1 can also support protein synthesis through other means. For example, ABCE1 in yeast can also act as a translation termination factor by assisting in the recognition of stop codons [352]. Cryo-electron microscopy in yeast cells has shown that ABCE1 is required for the stabilisation of the translation pre-initiation complex and it also directly interacts with certain translation initiation factors, namely eIF2α and eIF5 in human cervical cancer cells [339, 340, 389, 390]. These studies suggest ABCE1 may be required for translation initiation. ABCE1 in yeast also plays a critical role in ribosome biogenesis. It does so by aiding the maturation of essential 18S rRNA and the export of ribosomal subunits out of the nucleus and into the cytoplasm [341]. Together the evidence in the literature indicates that ABCE1 can be involved in ribosome recycling and biogenesis, translation initiation and termination. The contribution of ABCE1 to so

122 many stages of protein synthesis implicates that any disruption to ABCE1 activity can greatly impair mRNA translation. The detrimental effects of ABCE1 suppression on protein synthesis has been observed across different species from thermophilic archaeans to eukaryotic yeasts and more complex mammalian cancer cells [332, 346, 351, 357]. Efficient protein synthesis is required for unlimited cancer cell growth and migration [246, 256, 280, 383, 384]. Thus, it is reasonable to propose that reduced protein synthesis accounts for the impairment of neuroblastoma cell growth and migration upon ABCE1 knockdown.

The essential nature of ABCE1 in protein synthesis would prompt one to believe that targeting ABCE1 could prove detrimental to all cells. However, the results of chapter 3 clearly demonstrated that this was not the case. While previous studies on ABCE1 do not explain why targeting this protein would be selective against MYCN-amplified neuroblastomas or MYC-driven cancers in general, studies performed on other translation factors can shed some light on this mystery. Selectivity against c-MYC- driven cancer cells has been observed with the c-MYC-regulated translation factor, eIF4E and ribosomal protein, RPL24 [251, 278]. In the Burkitt’s lymphoma mouse model, mice with RPL24 haploinsufficiency have normally growing non-malignant B- cells because these cells have low levels of protein synthesis that can be maintained with low RPL24 expression [246, 251]. However, because c-MYC driven lymphomas exhibit a higher rate of protein synthesis compared to non-malignant cells, they require full expression of RPL24 and cannot maintain such elevated protein synthesis with RPL24 haploinsufficiency, thus enabling the haploinsufficiency to significantly delay lymphoma growth [246]. Haploinsufficiency in eIF4E has a similar effect such that eIF4E exists in excess during normal development of mice and its expression only becomes rate limiting when murine cells are subjected to c-MYC or Ras driven malignant transformation [278]. It follows from these studies that high reliance of MYC-driven cancers on efficient mRNA translation makes these cancers more vulnerable to disruptors of translation than cells lacking MYC aberration. Ribosomal RNAs and proteins form a large component of the MYCN transcriptome [202, 266]. This implies that MYCN may also drive translation in neuroblastoma. Thus, it is possible that while the residual ABCE1 expression remaining after siRNA-mediated knockdown is enough to maintain low translation rates in cells without MYCN amplification, it cannot maintain heightened protein synthesis in MYCN-amplified cells,

123 thus resulting in the observed selectivity. The effect of MYCN overexpression on mRNA translation and the possible role of ABCE1 in protein synthesis in neuroblastoma will need to be tested to determine whether the greater dependence of MYCN-amplified neuroblastoma cells on mRNA translation is responsible for their sensitivity to ABCE1 knockdown.

Another reason why ABCE1 suppression would reduce the malignant phenotypes specifically in MYCN-amplified neuroblastoma cells is that cells without MYCN amplification may rely on other factors to compensate for the loss of ABCE1. Traditionally, the critical process of ribosome recycling has been attributed to ABCE1. However, recent publications suggest other factors such as PELO can power this process in the absence of ABCE1 [353, 357]. Examining the levels of PELO across a panel of neuroblastoma cell lines with or without MYCN amplification and testing whether PELO levels increase after ABCE1 knockdown in the cells without MYCN amplification will test this possibility.

Yet another mechanism by which translation factors can specifically target a particular subset of cancers is by down-regulating the translation of mRNAs encoding oncogenes, critical to the progression of those cancers. Inhibiting the activity of translation initiation factors, eIF4A, eIF4E and various subunits of eIF5 can down-regulate the translation of c-MYC, MDM2, NOTCH1, VEGF and Cyclin D1 that are needed to support MYC-driven tumour progression [186, 256, 280, 383, 384, 391]. ABCE1 is thought to directly interact with eIF5, eIF2α and eIF3. Toompuu et al 2016 found that in HEK293 cells, protein levels of histones 2B and 4, needed for DNA replication and cell proliferation, decreased after ABCE1 suppression [358]. This provides further evidence that ABCE1 may be required for the production of particular proteins that support the rapid growth rates of MYC-driven cancers. Dissecting how ABCE1 may affect mRNA translation to selectively block the growth of MYCN-amplified neuroblastoma is an aim of this chapter.

Targeting multiple facets of mRNA translation can produce synergistic anti-cancer effects. This has been demonstrated by the potentiation of CX-5461, an inhibitor of ribosome biogenesis with the mTORC1 inhibitor, everolimus against the MYC-driven B-cell lymphoma [271]. Active mTORC1 releases the translation initiation factor, eIF4E, from its inhibitory protein, 4EBP and this allows free eIF4E to heighten cap-

124 dependent translation [257]. Therefore, inhibition of mTORC1 by everolimus can block eIF4E-mediated translation and Devlin et al 2016 showed everolimus can synergise with inhibitors of ribosome biogenesis [271]. Several translation inhibitors have had promising effects in vivo but have either not progressed to clinical trials or have had modest anti-cancer effects in patients. This implies that finding methods of potentiating existing inhibitors of translation may be worthwhile for MYC-driven cancers such as neuroblastoma, particularly since MYCN-amplified neuroblastomas are highly likely to be dependent on efficient translation. If ABCE1 suppression has been found to impair protein synthesis in MYCN-amplified neuroblastomas and given that targeting multiple aspects of translation can produce synergistic effects, one remaining question is whether ABCE1 suppression can potentiate the efficacy of these translation inhibitors. Three attractive translation inhibitors that warrant further investigation include silvestrol, ribavirin and MK-2206. Each of these blocks a specific aspect of translation and there is room for improvement of each of their potencies.

The experiments of this chapter will examine the potential role of ABCE1 in protein synthesis in neuroblastoma cells with or without MYCN amplification. Given the extensive evidence implicating ABCE1 in mRNA translation, it is most likely for ABCE1 to support the malignant phenotypes of MYCN-amplified neuroblastoma through its contributions to this process. MYC-driven cancers such as neuroblastoma can be particularly vulnerable to translation impairment and this enables inhibitors of translation to have a safe therapeutic window. Therefore, the potential role of ABCE1 in translation may be especially interesting in the context of MYCN-driven neuroblastoma. If ABCE1 suppression is proven to impair translation, its ability to potentiate existing inhibitors of translation will also be tested.

125

Therefore, the aims of this chapter were to:

1. To investigate the impact of ABCE1 knockdown on the protein synthesis in MYCN-amplified neuroblastoma cells 2. To determine whether changes in protein synthesis can explain the selective effect of ABCE1 knockdown on the viability of MYCN-amplified neuroblastoma cells 3. To investigate the impact of translation inhibitors on neuroblastoma cell lines and whether the response to translation inhibitors can be potentiated by ABCE1 suppression

126

4.2 Results:

4.2.1 ABCE1 suppression reduces translation efficiency and rate of protein synthesis in MYCN-amplified SK-N-BE(2) neuroblastoma cells

To examine the impact of ABCE1 knockdown on the translation efficiency of MYCN- amplified SK-N-BE(2) neuroblastoma cells, polysome profiling was performed at 48 hours after transfection with control or ABCE1-specific siRNAs. This time point was chosen to ensure the molecular changes were not the consequence of phenotypic changes that occurred at 56-72 hours post-transfection. Time points earlier than 48 hours post-transfection were not chosen because 48 hours post-transfection was the first time point at which substantial ABCE1 knockdown could be observed (Figure 3.2.3). Polysome profiling is a technique that measures the relative amount of translationally active polysomes (multiple, active ribosomes translating a single strand of mRNA) and less active monosomes (80S ribosomes). It involves using ultracentrifugation through a sucrose gradient to separate the 40S and 60S ribosome subunits, 80S ribosomes and polysomes followed by collection of fractions throughout the gradient (Figure 4.2.1A). After the centrifugation, the fractions are analysed by UV detection, enabling the amount of ribosomal proteins in each sucrose fraction to be measured, which is represented graphically by a trace (Figure 4.2.1A). Traces showed that ABCE1 suppression by siRNA1 or siRNA 2 reduced the amount of polysomes and increased the amount of monosomes (Figure 4.2.1A and B). The polysome to monosome ratio is indicative of translational efficiency. ABCE1 suppression was found to significantly decrease this ratio in the SK-N-BE(2) cells (P=0.0044 for siRNA1; P=0.0199 for siRNA2; Figure 4.2.1C).

127

Figure 4.2.1: ABCE1 suppression reduces the translation efficiency of MYCN- amplified SK-N-BE(2) neuroblastoma cells. (A) Schematic of polysome profiling and traces from polysome profiling experiments showing that the amount of 80S monosomes increased while the amount of polysomes was decreased following transfection with ABCE1-specific siRNA1 and siRNA2 (coloured lines) compared to cells treated with control siRNA (black lines). (B) Western blots showing siRNA1 and siRNA2 suppress ABCE1 expression at 48 hours post-transfection, which was when the polysome profiling experiments were performed. (C) Translation efficiency, measured by the relative amount of polysomes and monosomes, was reduced with the knockdown of ABCE1 by siRNA1 and siRNA2. Results represent the means of three independent experiments ± standard error. P-values were derived from one sample t-test. Ctrl – non- targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

128

To investigate whether the impairment in translation efficiency reduces global protein synthesis, a method of measuring de novo protein synthesis was optimised for neuroblastoma cells. This method relies on the incorporation of the non-radioactive antibiotic, puromycin, into the C-terminus of polypeptides over a discrete timeframe to measure the rate of protein synthesis [392]. Puromycin incorporation assays were thus used to examine whether the reduction in translation efficiency led to a decrease in protein synthesis in MYCN-amplified neuroblastoma cells. At 48 hours after transfection with control or ABCE1-specific siRNAs (the time point at which reduction in translational efficiency was observed), protein synthesis did not change in the SK-N- BE(2) cells (Appendix Figure 4). However, protein synthesis was significantly reduced in these cells at 54 hours post-transfection (P=0.0001 for siRNA1; P=0.0048 for siRNA2; Figure 4.2.2A). When this assay was extended to other MYCN-amplified neuroblastoma cell lines, significant reductions in protein synthesis were also observed (KELLY P=0.0169 for siRNA1; P=0.0302 for siRNA2; CHP-134 P=0.0215 for siRNA1; P=0.0297 for siRNA2; Figure 4.2.2B and C). The level of reduction in protein synthesis after ABCE1 suppression was similar for the KELLY and SK-N-BE(2) cells but more modest reductions were observed in the CHP-134 cells (compare Figure 4.2.2A, B and C). This could be linked to the lower levels of MYCN expression in the CHP-134 cells compared to the SK-N-BE(2) and KELLY cells (see Figure 3.2.2). These results show that ABCE1 knockdown in the MYCN-amplified neuroblastoma cells reduced the rate of protein synthesis.

129

Figure 4.2.2: ABCE1 knockdown reduced protein synthesis in MYCN-amplified neuroblastoma cell lines. Western blots and densitometric analysis measuring the amount of puromycin incorporation in (A) SK-N-BE(2), (B) KELLY and (C) CHP-134 MYCN-amplified neuroblastoma cell lines. The amount of puromycin incorporated into polypeptides over 1 hour indicates the rate of protein synthesis. Cells were treated with control (Ctrl) or one of two ABCE1 specific siRNAs (siRNA1 and siRNA2). The amount of puromycin incorporation was determined by Western blots of cellular extracts using anti-puromycin antibody and normalised to levels of actin protein in the respective densitometric analysis. Results represent the means of three independent experiments ± standard error. P-values were derived from one sample t test. Ctrl – non- targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

130

4.2.2 ABCE1 knockdown does not impair translation in neuroblastoma and fibroblast cell lines that do not possess MYCN amplification

Given that ABCE1 affected the rate of mRNA translation, a universal process required by all cells, the question of why ABCE1 suppression largely affected the malignant phenotypes of only the MYCN-amplified neuroblastomas remained unanswered. Despite extensive evidence showing the essential role of ABCE1 in translation in lower order organisms, the evidence supporting this function of ABCE1 in human cancers is less comprehensive with the function observed only in two malignant cell lines [339, 357]. The extent to which mammalian cells of different molecular subtypes depend on ABCE1 to maintain translation is therefore unclear. Given that neither proliferation nor migration of neuroblastoma and fibroblast cells without MYCN amplification was impaired after ABCE1 suppression, it may be possible that ABCE1 is not required to maintain translation in these cells. To test this hypothesis, puromycin incorporation assays were performed. No decrease in protein synthesis was observed in the neuroblastoma or fibroblast cell lines without MYCN amplification following ABCE1 knockdown (Figure 4.2.3A-D). To examine the possibility of changes in protein synthesis occurring at different time points in cells lacking MYCN amplification, puromycin incorporation assay was also performed at 48 hours and 72 hours post- transfection in the SK-N-AS cells. This cell line was chosen because a subtle, although insignificant decrease in protein synthesis was observed at 54 hours following ABCE1 knockdown (Figure 4.2.3B), suggesting it may be the most sensitive of these cell lines. However, no changes in protein synthesis were observed at either time points (48 hours and 72 hours; Figure 4.2.3E and F). Together, these results demonstrated that ABCE1 suppression reduced protein synthesis in MYCN-amplified neuroblastoma cells without adversely impairing this process in cell lines that lack this molecular aberration.

131

Figure 4.2.3: ABCE1 knockdown did not reduce translation in the neuroblastoma and fibroblast cell lines lacking MYCN amplification. The rate of protein synthesis is measured by puromycin incorporation into polypeptides over 1 hour at 54 hours after transfection with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). (A- F) The amount of puromycin incorporation was measured with Western blots using anti- puromycin antibody and normalised to levels of actin protein in the respective densitometric analysis. ABCE1 knockdown did not reduce protein synthesis in (A) SH- EP, (B) SK-N-AS or (C) SK-N-F1 neuroblastoma cell lines and (D) MRC5 fibroblast cell line. (E-F) The assay was performed at additional time points for SK-N-AS cells. Results represent the means of three independent experiments ± standard error, except for (A) for which two independent experiments were performed and (D) for which one experiment was performed. P-values were derived from one sample t test. Ctrl – non- targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

132

4.2.3 ABCE1 suppression returns MYCN-driven protein synthesis to baseline levels

Another explanation as to why translation continues in cells lacking MYCN amplification after ABCE1 knockdown is that these cells may exhibit lower basal rates of translation that can be maintained with the residual ABCE1 present after knockdown. Forced expression of c-MYC has been shown to increase translation but this remains to be examined in MYCN-driven neuroblastoma [246]. Firstly, to directly test the impact of forced MYCN expression in neuroblastoma cells, Western blots for ABCE1 expression and puromycin incorporation assays were performed in the SH-EP Tet21N neuroblastoma cells with inducible MYCN expression. MYCN expression strongly enhanced ABCE1 expression from 3 days after removal of doxycycline (Figure 4.2.4). Then, at 6 days after removal of doxycycline and following the increase in ABCE1 expression, the rate of protein synthesis was heightened (Figure 4.2.4). Next, to examine the impact of ABCE1 suppression on this heightened translation, the cells were transfected with non-targeting control or ABCE1 specific siRNAs. Consistent with the results shown in the Figure 4.2.4, MYCN expression heightened protein synthesis (comparing control siRNA treated cells in lanes or bars 1 and 4; Figure 4.2.5). ABCE1 suppression returned the heightened protein synthesis down to a level similar to that observed in the MYCN non-expressing cells (lanes 1-3; Figure 4.2.5). In the SH-EP Tet21N cells without MYCN expression, ABCE1 suppression did not further reduce the rate of protein synthesis compared to the control siRNA treated cells (lanes 4-6; Figure 4.2.5).

133

Figure 4.2.4: ABCE1 expression and the rate of protein synthesis increase following MYCN expression in the SH-EP Tet21N cells. Western blots and respective densitometry were performed on cellular extracts collected from SH-EP Tet21N cells treated with or without doxycycline (dox) for the indicated time points.

134

Figure 4.2.5: ABCE1 knockdown reduces elevated protein synthesis caused by forced MYCN expression in the SH-EP Tet21N cells. SH-EP Tet21N cells were cultured with or without doxycycline for 3-12days before being transfected with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Puromycin incorporation was performed at 54 hours after transfection. (A) Western blot indicating that MYCN expression increased protein synthesis (comparing lane 1 with lane 4) but ABCE1 knockdown restored the protein synthesis to levels similar to MYCN non-expressing cells (compare lanes 2 and 3 with lanes 4-6). (B) Quantification of the Western blots by densitometric analysis. Results represent the mean of three independent experiments ± standard error. P-values comparing the difference between bars 1-3 in (B) were derived from one sample t-test with the theoretical mean set at 1 while for bars 4-6 the p-values were derived from one sample t-test with the theoretical mean set at 0.6049 which is the mean of puromycin incorporation in the cells without MYCN expression, transfected with control siRNA. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

135

4.2.4 MYCN-amplified neuroblastoma cell lines exhibit higher levels of baseline protein synthesis

Since the SH-EP Tet21N cell line was not derived from MYCN-amplified neuroblastoma tumours and the MYCN expression in these cells was artificially created, observations made in MYCN expressing SH-EP Tet21N cells may be inconsistent to those made in cell lines derived from MYCN driven neuroblastomas. Thus, to extend these findings into the parental cell lines derived from neuroblastomas, puromycin incorporation assays were performed on three MYCN-amplified (SK-N-BE(2), KELLY and CHP-134) and three neuroblastoma cell lines without MYCN amplification (SK-N- AS, SH-EP and SK-N-F1). Results showed that the three MYCN-amplified cell lines exhibited higher rates of protein synthesis (indicated by the elevated amount of puromycin incorporation) compared to the three cell lines without MYCN amplification; although, large variations were observed between the three independent runs (Figure 4.2.6A and B). The average rate of protein synthesis from the three MYCN-amplified cell lines was significantly higher compared to that of the three cell lines without MYCN amplification (Figure 4.2.6C). These results supported the findings made in the SH-EP Tet21N cells by showing that MYCN-amplified neuroblastoma cells exhibit higher baseline levels of protein synthesis compared to cell lines without MYCN amplification. The MYCN-amplified neuroblastoma cells with heightened protein synthesis may be particularly sensitive to disruptors of translation and hence more likely to be subject to disruption of malignant characteristics.

136

Figure 4.2.6: MYCN-amplified neuroblastoma cell lines exhibited higher levels of protein synthesis than neuroblastoma cell lines without MYCN amplification. Puromycin incorporation assay was performed across three MYCN-amplified neuroblastoma cell lines (SK-N-BE(2), KELLY, CHP-134) and three neuroblastoma cell lines without MYCN amplification (SK-N-AS, SH-EP, SK-N-F1) using the same cell seeding density and puromycin concentration. (A) Representative Western blot showing the amount of puromycin incorporation across the cell line panel over an hour. (B) Densitometric analysis of the Western blots where the amount of puromycin incorporation was adjusted to the loading control, actin. (C) Dot plot of the average amount of puromycin incorporated by the neuroblastoma cells with or without MYCN amplification over three independent runs. Results in (B) represent the means of three independent experiments ± standard error. P-value was derived from unpaired t-test.

137

4.2.5 Neuroblastoma cells lacking MYCN amplification do not up-regulate ribosome recycling factors to compensate for suppression of ABCE1

The hypothesis that cells lacking MYCN amplification might be able to compensate for ABCE1 suppression by expressing ribosome recycling factors other than ABCE1 was also considered. Although ABCE1 is the most well characterised ribosome recycling factor, other proteins have been identified to dissociate the ribosomes, particularly under conditions of stress including PELO, HBS1 and eRF1 [393, 394]. However, only PELO (also known as Pelota; DOM34), has been found to play an important role in the recycling of mammalian ribosomes, especially in the absence of ABCE1 [355, 357]. To test for up-regulation of PELO after ABCE1 knockdown, Western blots were performed on lysates from SK-N-AS, SH-EP and SK-N-F1 neuroblastoma cells between 54-72 hours post-transfection with control or ABCE1 specific siRNAs. This time point was chosen because by this time, ABCE1 suppression had already disrupted protein synthesis in the MYCN-amplified cell lines so any compensatory factors utilised by the cells without MYCN amplification should have been already up-regulated if they were to prevent changes in protein synthesis. Up-regulation of PELO was not observed in response to ABCE1 suppression in any of the cell lines without MYCN amplification tested in this study (Figure 4.2.7). To investigate the possibility that insensitivity of neuroblastoma cells without MYCN amplification to ABCE1 suppression was due to higher endogenous levels of rescue factors such as PELO, the protein expression of PELO was examined in a panel of neuroblastoma cell lines. On the contrary, the Western blots analysis revealed that cell lines without MYCN amplification express lower levels of PELO (P=0.0009; Figure 4.2.8). It is also important to note that PELO was expressed at the lowest level in the SH-EP and SK-N-AS cell lines that were consistently used in this study. Collectively, these data demonstrate that in neuroblastoma cells without MYCN amplification, PELO is not up-regulated in the absence of ABCE1 to maintain mRNA translation and is unlikely to act as a rescue factor upon ABCE1 knockdown in these cells.

138

Figure 4.2.7: ABCE1 knockdown did not increase in the expression of PELO, a potential compensatory ribosome recycling factor in neuroblastoma cells. Representative Western blots and respective densitometry indicating that the expression of PELO did not change in (A) SK-N-AS, (B) SH-EP and (C) SK-N-F1 cells after ABCE1 knockdown. Protein lysates for (A-C) were harvested at 54 hours post- transfection. (D) Western blots were performed at additional time points for SK-N-AS, showing no changes occur at either 48 hours or 72 hours. Western blots were representative of two independent experiments. Column graphs represent the means of two independent experiments ± standard error. P-values are derived from one sample t- test. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

139

Figure 4.2.8: Potential ‘rescue’ ribosome recycling factor, PELO was more abundantly expressed in MYCN-amplified neuroblastoma cell lines. (A) Representative Western blots and (B) respective densitometry indicating that the expression of PELO was significantly higher in MYCN-amplified neuroblastoma cell lines. Western blots and column graphs were representative of one experiment. P-values were derived from two-tailed t-test. Ctrl – non-targeting control siRNA; siRNA1– ABCE1 specific siRNA sequence 1; siRNA2– ABCE1 specific siRNA sequence 2.

140

4.2.6 ABCE1 suppression does not appear to alter the level of specific proteins

Translation factors can either influence translation in a global manner and/or decrease the translation of selected proteins. Puromycin incorporation experiments from section 4.2.1 showed ABCE1 suppression reduces global translation. However, translation and expression of certain oncoproteins that are critical to cancer progression might be translationally down-regulated before changes in global protein synthesis are detected [186, 257]. The selectivity of ABCE1 knockdown against MYCN-amplified neuroblastoma cells may suggest the knockdown is also affecting a molecular pathway particularly critical to MYCN-dependent neuroblastoma. Therefore, to find changes in the expression of specific proteins, tandem mass spectrometry (mass spectrometry) was performed using unlabelled, cellular extracts harvested from the SK-N-BE(2) neuroblastoma cells at 48 hours after transfection with control or ABCE1-specific siRNAs. By this time point, ABCE1 suppression has impaired translation efficiency (Figure 4.2.1) but has not caused changes in the rate of global protein synthesis as indicated by the puromycin incorporation assay (Appendix Figure 4). This analysis revealed that after ABCE1 suppression, the expression of only a small number of proteins was altered more than 2-fold, indicating the changes could be biologically relevant (Tables 4.2.1 and 4.2.2). However, with the exception of ABCE1 itself, only the expression of GABARAPL2 was significantly altered (reduced) by both ABCE1- specific siRNAs (for siRNA1 P=0.0232; Table 4.2.1; for siRNA2 P=0.0141; Table 4.2.2).

141

Table 4.2.1: Proteins altered by more than 2-fold after ABCE1 knockdown by siRNA1 Gene Protein names P Value Fold change ABCE1 ATP-binding cassette sub-family E member 1 0.0003 -2.4929 GABARAPL2 Gamma-aminobutyric acid receptor-associated 0.0232 -2.1964 protein-like 2 BLVRA Biliverdin reductase A 0.0039 -2.1439 CSTB Cystatin-B 0.0062 -2.0885 NUDT21 Cleavage and polyadenylation specificity factor 0.0156 -2.5935 subunit5 ZC3H13 Zinc finger CCCH domain-containing protein 13 0.0115 2.0454 PPIG Peptidyl-prolyl cis-trans isomerase G 0.0346 2.0772 CLTB Clathrin light chain B 0.0370 2.0163 Data analysed by Dr Chelsea Mayoh.

Table 4.2.2: Proteins altered by more than 2-fold after ABCE1 knockdown by siRNA2 Gene Protein names P Value Fold change ABCE1 ATP-binding cassette sub-family E member 1 0.0009 -2.1784 GABARAPL2 Gamma-aminobutyric acid receptor-associated 0.0141 -2.4078 protein-like 2 COX5A Cytochrome c oxidase subunit 5A, mitochondrial 0.0090 2.5908 MTCH2 Mitochondrial carrier homolog 2 0.0135 2.1989 TMED2 Transmembrane emp24 domain-containing protein 2 0.0135 2.2204 RHOA Transforming protein RhoA 0.0166 2.1998 UBE2D2 Ubiquitin-conjugating enzyme E2 D2 0.0186 2.0605 RBM3 RNA-binding protein 3 0.0281 3.5808 PSME2 Proteasome activator complex subunit 2 0.0336 2.0893 SEC23A Protein transport protein Sec23A 0.0466 2.3065 Data analysed by Dr Chelsea Mayoh.

142

Western blotting was conducted to verify altered levels of GABARAPL2 following ABCE1 suppression. However, after 3 independent experiments, consistent reduction in this protein was not evident (Figure 4.2.8). Thus, although the mass spectrometry showed that the level of GABARAPL2 was significantly altered more than 2-fold by both ABCE1-targeting siRNAs, ABCE1 suppression did not consistently reduce the expression of this protein. The mass spectrometry data indicated there were proteins other than GABARAPL2 that showed altered expression following ABCE1 knockdown. However, because the fold change of these proteins was <2-fold and even more subtle than the change observed in GABARAPL2, it is unlikely for ABCE1 knockdown to strongly decrease the expression of these proteins. Subsequently, since MYC proteins can be translationally regulated [256], MYCN expression was examined following ABCE1 knockdown. No decrease in MYCN protein was observed in response to ABCE1 knockdown (Appendix Figure 5). These Western blots, along with the tandem mass spectrometry experiment, did not provide evidence that ABCE1 suppression could change the expression of specific proteins.

Figure 4.2.9: ABCE1 knockdown failed to consistently alter the expression of GABARAPL2. (A) Western blots and (B) respective densitometric analysis (column graphs) were performed on extracts harvested from MYCN-amplified SK-N-BE(2) cells at 48 hours after transfection with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). P values were obtained from one sample t-test.

143

4.2.7 Inhibitors of translation are not highly selective against MYCN-amplified neuroblastoma cells

If the greater effect of inhibiting translation through ABCE1 suppression on the malignant phenotypes of MYCN-amplified neuroblastoma is linked to higher rates of protein synthesis in MYCN driven neuroblastomas, it might be expected that inhibitors of other stages of translation would exert similar selectivity against MYCN-amplified neuroblastomas. A number of translation inhibitors have been tested in pre-clinical studies on various adult cancers but the selective nature of their efficacy against MYCN driven neuroblastoma remains unknown. To test this possibility, dose-response colony forming assays were performed with small molecule inhibitors of eIF4A (silvestrol) and eEF6 (cycloheximide) across five neuroblastoma cell lines that exhibit good colony forming ability. The colony forming assay was chosen because the assay is highly sensitive and suitable for detecting small changes in viability over prolonged drug treatment. Silvestrol is thought to disrupt protein synthesis primarily by inhibiting the translation of specific oncogenes while cycloheximide blocks global protein synthesis. After treatment with silvestrol, all cell lines responded similarly with IC50s between 2- 4nM with no significant differences observed between the lines (P=0.5956; Figure 4.2.9A and B). Treatment with cycloheximide potently reduced the colony forming ability of all cell lines but no significant differences were observed between any of the cell lines with the exception of SK-N-BE(2) cells being more resistant to the inhibitor (P=0.3648; Figure 4.2.9C and D). These results indicate that the current, commonly used inhibitors of translation do not offer the same selectivity against MYCN-amplified neuroblastoma as observed with ABCE1 knockdown.

144

Figure 4.2.10: Inhibition of protein synthesis using translation inhibitors did not exert selectivity against MYCN-amplified neuroblastoma cell lines. Dose-response curves of colony forming assays for three neuroblastoma cell lines with MYCN amplification (SK-N-BE(2), CHP-134 and KELLY) and two without amplification (SK- N-AS and SH-EP). Dose response curves and corresponding IC50s of the different cell lines for (A-B) silvestrol and (C-D) cycloheximide demonstrated that MYCN-amplified neuroblastoma cell lines do not display higher sensitivity to these translation inhibitors. The percent viability is the number of colonies formed by cells receiving drug treatment expressed as a percentage of the number of colonies formed by cells receiving vehicle only. Results represent means of two independent experiments ± standard error. P-value is derived from One Way ANOVA with Dunnett’s multiple comparisons correction.

145

4.2.8 ABCE1 suppression modestly potentiates the efficacy of translation inhibitors

Previous studies have indicated that targeting multiple aspects of translation can produce synergistic effects [270, 271]. Furthermore, although ABCE1 knockdown significantly reduces protein synthesis, it does not fully inhibit the process. Therefore, to further impair translation efficiency and heighten the anti-growth effects of ABCE1 suppression, the impact of combining ABCE1 knockdown and other inhibitors of translation was investigated. To achieve this, colony forming assays were performed on SK-N-BE(2) neuroblastoma cells, with and without ABCE1 knockdown, treated with a dose range of silvestrol (eIF4A inhibitor), ribavirin (5’ cap mimetic) or MK-2206 (AKT inhibitor).

Rocaglates such as silvestrol that inhibit eIF4A have good in vivo potency against c- MYC driven solid tumours [256, 259, 395]. However, these inhibitors have not progressed to clinical trials. One possible reason may be that dose limiting toxicities prevent high doses from being administered into patients. Although in vivo studies have reported anti-cancer effects associated with these drugs, only low concentrations of ~1.5mg/kg are typically being administered in vivo [396, 397]. Any method of reducing their toxicity will enable higher doses to be administered. ABCE1 suppression reduced the number of colonies further than silvestrol treatment alone (Figure 4.2.10A). When the data was analysed, ABCE1 suppression by both siRNAs caused a small leftward shift in the dose response curves (Figure 4.2.10B). The IC50s extrapolated from these curves show that ABCE1 knockdown caused a significant 30-40% decrease in IC50 (P=0.0124; Figure 4.2.10C).

Ribavirin is a mimetic of eIF4E that prevents the binding of the translation factor to the 5’ cap, thus blocking eIF4E-mediated translation. Although it has progressed to clinical trials, its effects have been modest in AML patients and finding methods of potentiating its efficacy are worthwhile [282]. Results of this current study indicate that ABCE1 suppression may not potentiate the efficacy of ribavirin (Figure 4.2.11A-C). Dose response curves show that cells transfected with ABCE1-specific siRNA2 had a rightward shift in the curve, which indicates ABCE1 knockdown by this siRNA increases resistance of the cells to ribavirin (Figure 4.2.11B). Large variations were observed between independent experiments so no significant changes in IC50 were observed following ABCE1 suppression (Figure 4.2.11C).

146

Figure 4.2.11: ABCE1 suppression in MYCN-amplified neuroblastoma cells subtly potentiated the efficacy of the eIF4A inhibitor, silvestrol. (A) Representative photos of the plates from the colony forming assays. (B) Dose-response curves of SK-N-BE(2) cells treated with various concentrations of silvestrol in the presence or absence of ABCE1-targeting siRNAs (siRNA1 and siRNA2). (C) The half maximal inhibitory concentrations (IC50s) extrapolated from the dose-response curves of these treatments are represented graphically. Dose-response studies were conducted by performing colony forming assays in the SK-N-BE(2) cells, set up at 24 hours post-transfection with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Percent viability was calculated for each siRNA individually. The percent viability is the number of colonies formed by cells receiving drug treatment expressed as a percentage of the number of colonies formed by cells receiving vehicle only. The results represent means of three independent experiments ± standard error and P-values were generated using One Way ANOVA with Dunnett’s multiple comparisons correction.

147

Figure 4.2.12: ABCE1 suppression in MYCN-amplified neuroblastoma cells does not affect the efficacy of the eIF4E inhibitor, ribavirin. (A) Representative photos of the plates from the colony forming assays. (B) Dose-response curves of SK-N-BE(2) cells treated with various concentrations of ribavirin in the presence or absence of ABCE1-targeting siRNAs (siRNA1 and siRNA2). (C) The half maximal inhibitory concentrations (IC50s) extrapolated from the dose-response curves of these treatments are represented graphically. Dose-response studies were conducted by performing colony forming assays in the SK-N-BE(2) cells, set up at 24 hours post-transfection with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Percent viability was calculated for each siRNA individually. The percent viability is the number of colonies formed by cells receiving drug treatment expressed as a percentage of the number of colonies formed by cells receiving vehicle only. The results represent means of three independent experiments ± standard error and P-values were generated using One Way ANOVA with Dunnett’s multiple comparisons correction.

148

Besides direct inhibitors of translation, certain inhibitors of AKT, such as MK-2206, can block ribosome biogenesis [274]. However, in analogy to other inhibitors of the PI3K/AKT/mTOR pathway, MK-2206 exerted limited efficacy against paediatric malignancies such as neuroblastoma as found in a recent clinical trial [192]. Mechanistically, because ABCE1 suppression is thought to block ribosome recycling and thus reduces the number of active ribosomes, combining the suppression with an inhibitor of ribosome biogenesis such as MK-2206 may deplete the pool of active ribosomes further and produce more pronounced impairment of translation. MK-2206 being well-tolerated in neuroblastoma patients gives added clinical relevance to testing this combination [192]. A slight sensitisation was observed for MK-2206 (Figure 4.2.12A-C). However, due to large variations between the experiments, the 40-50% decrease in IC50 did not reach statistical significance (Figure 4.2.12C).

149

Figure 4.2.13: ABCE1 suppression in MYCN-amplified neuroblastoma cells does not affect the efficacy of the AKT inhibitor, MK-2206. (A) Representative photos of the plates from the colony forming assays. (B) Dose-response curves of SK-N-BE(2) cells treated with various concentrations of MK-2206 in the presence or absence of ABCE1-targeting siRNAs (siRNA1 and siRNA2). (C) The half maximal inhibitory concentrations (IC50s) extrapolated from the dose-response curves of these treatments are represented graphically. Dose-response studies were conducted by performing colony forming assays in the SK-N-BE(2) cells, set up at 24 hours post-transfection with control (Ctrl) or ABCE1 specific siRNAs (siRNA1 and siRNA2). Percent viability was calculated for each siRNA individually. The percent viability is the number of colonies formed by cells receiving drug treatment expressed as a percentage of the number of colonies formed by cells receiving vehicle only. The results represent means of three independent experiments ± standard error and P-values were generated using One Way ANOVA with Dunnett’s multiple comparisons correction.

150

4.3 Discussion:

The studies of chapter 3 showed that suppression ABCE1 impaired the growth and migration of MYCN-amplified neuroblastoma cells. In the present chapter, the molecular mechanisms that underlie the anti-oncogenic effects of ABCE1 suppression were investigated. The most well described molecular function of ABCE1 is its contribution to mRNA translation; with supporting evidence arising from studies performed in a variety of organisms from archaea to mammalian cells [346, 352-355, 394]. The results presented in this chapter demonstrate that ABCE1 is important in maintaining global mRNA translation in MYCN-amplified neuroblastoma cells. However, contrary to expectations, in cells lacking MYCN amplification, there was no apparent need for ABCE1 in maintaining protein synthesis. These findings provide an explanation for the selectivity of ABCE1 knockdown in inhibiting the growth and migration of MYCN- amplified neuroblastoma cells that was described in chapter 3.

Although the role of ABCE1 in mRNA translation has been reported, this study is the first to uncover the critical importance of ABCE1 in protein synthesis that is specifically driven by the MYCN transcription factor. The function of ABCE1 in mRNA translation has primarily been studied through the use of cellular extracts from yeasts, archaea or rabbit reticulocytes [346, 350, 351, 354, 355]. Two studies performed in yeast and haematopoietic cells later confirmed that ABCE1 plays a critical role in ribosome recycling within living cells [353, 357]. In HeLa cervical cancer cells, the absence of ABCE1 reduces global protein synthesis and cell growth [339, 358]. HeLa cells express low levels of c-MYC; however, the critical comparison for cells with and without MYC is lacking. This is because in every study regarding ABCE1 only one cancer cell line was tested and so it was impossible to delineate if the requirement for ABCE1 in protein synthesis differs between c-MYC expressing and c-MYC negative cancer cell lines. Furthermore, cervical cancers are not typically viewed as a ‘MYC-driven’ cancer type. To date, no other studies have examined the role of ABCE1 in cancer cell protein production. All previous work has led to the perception that ABCE1 is an ‘essential’ ribosome recycling factor and sufficiently important that its loss was predicted to completely block protein synthesis and the growth of all cells; irrespective of molecular subtype, organism, species and domains [332, 340, 346, 353]. However, the results of this current study demonstrated that in human cells, ABCE1 is likely to support protein synthesis mainly in MYC-driven or other cells with heightened protein production. By

151 showing that MYCN induction first increases the level of ABCE1 before protein synthesis is heightened, experiments performed in the SH-EP Tet21N cells imply that ABCE1 may be required for the enhancement of protein synthesis by MYCN. In future studies, the necessity of ABCE1 in supporting MYCN driven protein synthesis can studied in greater depths through several approaches. Firstly, ABCE1 can be suppressed with siRNAs prior to the induction of MYCN expression in the SH-EP Tet21N cells to determine whether protein synthesis can be heightened by MYCN in the absence of ABCE1. Alternatively, re-expression of wildtype and/or mutant forms of ABCE1 in MYCN-expressing SH-EP Tet21N cells with ABCE1 suppression will confirm the dependence of MYCN-driven protein synthesis on ABCE1 and pinpoint the region of ABCE1 required for this function. Results of the current study also suggest that protein synthesis in cell lines without MYCN overexpression or amplification can proceed in the face of reduced ABCE1 expression. This may explain why cells lacking MYCN amplification can sustain their normal rate of proliferation and migration following ABCE1 knockdown. Thus, in MYCN-amplified neuroblastoma cells, the requirement for ABCE1 in translation closely parallels its requirement for growth and migration.

The addiction of MYCN-driven neuroblastomas to heightened protein synthesis and their dependence on full expression of factors involved in translation are characteristics that bear striking resemblance to observations made for the Eμ-MYC model of Burkitt’s lymphoma. In experiments performed using this lymphoma model, haploinsufficiency in the ribosomal protein, RPL24, brings c-MYC driven protein synthesis and cell growth back down to levels similar to the wildtype B-lymphocytes [246]. Although published reports have not investigated the up-regulation of protein synthesis by MYCN in neuroblastoma, ribosomal proteins and RNAs are highly expressed in MYCN- amplified neuroblastomas which indicates MYCN-driven neuroblastomas may also be particularly reliant on elevated mRNA translation [202, 266]. This hypothesis is supported by the up-regulation of protein synthesis in MYCN-positive SH-EP Tet21N cells as demonstrated in the current study and together these studies illustrate MYCN as a potent driver of mRNA translation in neuroblastoma. In MYCN positive SH-EP Tet21N cells, the observation that ABCE1 suppression reduced protein synthesis down to levels comparable to MYCN-negative cells, suggests that up-regulation of protein synthesis by MYCN is dependent on ABCE1. MYCN negative SH-EP Tet21N cells exhibit slower rates of protein synthesis compared to MYCN positive cells that

152 presumably could be maintained with residual ABCE1 expression remaining after ABCE1 suppression. These observations made in the SH-EP Tet21N cells are more broadly applicable because when puromycin incorporation assay was performed on a panel of neuroblastoma cell lines, those derived from MYCN-amplified neuroblastoma tumours also showed heightened baseline rates of protein synthesis. The heightened protein synthesis may be a result of increased transcriptional output in MYCN-amplified neuroblastoma cell lines or the direct up-regulation of translational machinery by MYCN. Published evidence predominantly supports the latter explanation because MYC factors directly up-regulate a number of ribosomal proteins and translation factors such as eIF5A, eIF4E and eIF4A that can increase the number of ribosomes per strand of mRNA, as revealed by ribosome or polysome profiling experiments [247, 253, 256, 257, 264]. This means it is possible for MYCN to enhance translation even without increasing the amount of transcript. However, since MYC factors are responsible for transcribing a large proportion of the genome [202, 242], increases in protein synthesis may be amplified by increases in the amount of transcripts. To dissect which of these mechanisms are responsible for the enhanced protein synthesis in MYCN-amplified neuroblastomas, polysome or ribosome profiling can be performed on neuroblastoma cell lines with or without MYCN amplification. Since these techniques measure the number of ribosomes per strand of mRNA, any increases in polysomes would be supportive of a role for MYCN in up-regulating translation. The addiction of MYCN- driven neuroblastomas to elevated protein synthesis raises questions of whether other factors involved in translation such as RPL24 can be targeted to treat MYCN-amplified neuroblastoma and if ABCE1 would play a similar role in c-MYC driven cancers.

Besides supporting global mRNA translation, another mechanism by which translation factors can promote malignant phenotypes is by specifically up-regulating the translation of genes critical to cancer progression. This has been observed previously with a number of MYC-driven translation initiation factors. For example proteins required for cell cycling such as cyclin D1 and PRPS2 (pyrimidine biosynthesis), proteins involved in metastasis (e.g. vimentin) and pro-angiogenic proteins (e.g. VEGF) were shown to be translationally up-regulated by eIF4E [186, 251, 257, 280]. The question of whether ABCE1 can regulate the expression of specific proteins important for the progression of MYCN-amplified neuroblastoma was asked using a proteomic approach. Because the data from tandem mass spectrometry experiments and Western

153 blots performed in the SK-N-BE(2) cells showed no significant changes in levels of any protein after ABCE1 knockdown, the results did not support that changes in the level of specific proteins were responsible for the impaired cell proliferation or migration. This approach of identifying changes in the levels of sequence-specific protein synthesis had a number of limitations that could be addressed in future experiments. Firstly, the label- free approach used in this study measured the absolute quantity of proteins instead of measuring changes in newly synthesize proteins. Instead, this can be achieved by labelling newly synthesized proteins with a fluorescent amino acid analogue, isolating these proteins and then performing mass spectrometry to examine any changes only in the level of these labelled proteins [398]. If ABCE1 is thought to block the translation of all proteins, the faster degradation of short-lived proteins means that the levels of these proteins may decrease prior to changes in the level of many longer-lived housekeeping proteins such as actin. To test this hypothesis, label-free mass spectrometry can be used but would have to be performed at a later time point than at the 48 hours used in this study to allow sufficient time for protein turnover. One experiment that would provide definitive evidence to show whether ABCE1 suppression affects translation in a gene- specific manner is ribosome profiling. Ribosome profiling is an experiment that relies on RNA sequencing to measure the number of ribosome-protected regions on an mRNA transcript which is indicative of the translational activity of the mRNA [399]. Therefore, it allows one to determine whether ABCE1 suppression can reduce the translational efficiency of specific transcripts. Ribosome profiling experiments performed in chronic myeloid leukaemia and yeast cells have demonstrated that loss of ABCE1 does not alter gene specific translation [353, 357]. However, these studies do not rule out the possibility of ABCE1 affecting translation of specific transcripts in neuroblastoma because such ribosome profiling experiments have not been performed after ABCE1 suppression on MYC-dependent cells. Conducting such experiments will determine if ABCE1 knockdown can affect the transcription of specific mRNAs or if it contributes to translation in a global, non-gene specific manner in MYCN-driven neuroblastoma cells.

The possibility of other ribosome recycling factors compensating for the loss of ABCE1 has also been examined in this study. Over the years, a limited number of factors have been identified to have a role in ribosome recycling and these include HBS1 and PELO (DOM34 in yeast; [355, 357, 389, 393, 394]). While most of these studies were

154 performed in yeast or Drosophila, it appears that increased expression of DOM34 or PELO can compensate for the loss of ABCE1 and maintain ribosome recycling in mammalian cells [357]. In chronic myeloid leukaemia cells, PELO levels increased with the loss of ABCE1 and elevated PELO expression rescued stalled ribosomes caused by ABCE1 knockdown [357]. By contrast, the results presented in this study showed no increase in PELO expression following ABCE1 knockdown or higher endogenous levels of the recycling factor and therefore it is unlikely that PELO plays a critical role in supporting protein synthesis following suppression of ABCE1 in neuroblastoma cells. However, further confirmation of these findings could be provided by testing whether or not combined knockdown of PELO and ABCE1 would reduce the rate of protein synthesis in neuroblastoma cells without MYCN amplification. Interestingly, the higher PELO expression in the MYCN-amplified neuroblastoma cell lines raises the possibility that PELO may contribute to protein synthesis and aggressive phenotypes of these cells. Like ABCE1, the role of PELO in mRNA translation had not been studied in the MYC- driven cancer context. Investigating whether MYC factors drive PELO expression and examining the role of PELO in MYCN-driven neuroblastomas can potentially uncover a new therapeutic target.

Other possible mechanisms by which ABCE1 suppression may disrupt the malignant phenotypes of cells include disabling the biosynthesis of ribosomal RNAs (rRNAs). Certain rRNAs are transcriptionally activated by c-MYC, suggesting they may play a role in MYC-driven oncogenesis [244, 245]. This hypothesis has been supported by several studies. For example, inhibiting RNA polymerase I (RNA Pol I), leading to a reduction in mature rRNAs, can induce p53-dependent apoptosis in Eµ-MYC lymphoma cells and prolong lymphoma-free survival [271, 272]. Similar anti- tumorigenic effects were observed when RNA Pol I was inhibited in a high-MYC murine prostate cancer model [270]. Recently, deficiencies in rRNA biosynthesis have been shown to reduce the growth of MYCN-driven neuroblastoma tumours in a transgenic zebrafish model [267]. The contribution of ABCE1 to ribosome biosynthesis was demonstrated when repression of ABCE1 expression in yeast reduced the levels of mature 25S and 18S rRNAs that are critical components of ribosomes [341]. However, to date, this phenomenon has not been observed in mammalian cells. Furthermore, problems in ribosome biosynthesis often induce nucleolar stress and this leads to p53- mediated apoptosis [271-273], a phenotype not observed for CHP-134 cells, which have

155 wildtype p53 (see Chapter 3). Therefore, while a potential role of ABCE1 in ribosome biosynthesis remains unexamined in neuroblastoma, ABCE1 suppression may be reducing the malignant phenotypes of neuroblastoma by other means.

Although this study shows ABCE1 plays an important role in protein synthesis of MYCN-amplified neuroblastoma cells, the current set of experiments cannot fully distinguish the stage of translation in which ABCE1 is involved. Some reports of ABCE1 have demonstrated the factor to be associated with the initiation stages of translation [339, 340, 389, 400]. Other studies have shown that ABCE1 plays a more important role in providing energy needed for the dissociation of the ribosome subunits at the end of translation during stop codon recognition and ribosome recycling [346, 351, 355]. In the polysome profiling experiments of the current study, the reduction in the amount of polysomes and increase in the amount of monosomes is characteristic of disrupted translation initiation and this polysome is often observed when cells are treated with inhibitors of translation initiation [271]. However, treatment of the neuroblastoma cells with cycloheximide prior to polysome profiling, as part of the necessary methodologies, prevents changes in post-initiation stages of translation to be studied. Therefore, while the reduction in polysome to monosome ratio observed in the current experiments signifies that ABCE1 suppression can disrupt translation initiation, its possible roles in translation termination or ribosome recycling cannot be ruled out. To test whether ABCE1 is involved in ribosome recycling or translation termination in neuroblastoma cells, ribosome profiling should be utilised to examine where ribosomes sit on the transcripts after ABCE1 suppression. If ABCE1 is also involved in these later stages of translation, reduction in ABCE1 should cause an accumulation of ribosomes in the 3’ UTR as ribosomes cannot terminate at the stop codon and dissociate from the transcripts. This approach was used previously to investigate the potential involvement of ABCE1 in translation termination or ribosome recycling in yeast and chronic myeloid leukaemia cells [353, 357]. However, since translation termination, ribosome recycling and translation initiation are processes that occur one after another, it is likely that suppression of ABCE1 will disrupt all of these processes and it would be difficult to pinpoint exactly which process is directly affected by ABCE1. Therefore, whilst results of this chapter clearly indicate that ABCE1 suppression interferes with translation, further experiments are required to clarify which stage or stages of translation are disrupted by ABCE1 knockdown in neuroblastoma cells.

156

The reduction in malignant phenotypes in MYCN-amplified neuroblastoma cells following the suppression of a translation factor such as ABCE1 raises the question of whether current small molecule inhibitors of translation confer similar effects towards these cancer cells. Interestingly, the preliminary data provided by the clonogenic assays did not show MYCN-amplified neuroblastoma cells to be any more sensitive to eIF4A inhibition by silvestrol or eEF6 inhibition by cycloheximide compared to cell lines without MYCN amplification. This was not anticipated, in particular with silvestrol as it has been demonstrated to selectively reduce the expression of c-MYC [256, 289]. However, the impact of silvestrol on MYCN protein expression has not been examined so it is not clear yet whether expression of MYCN is under the same level of translational regulation. Furthermore, silvestrol reduces the expression of other oncoproteins such as BCL2, cyclin D1 and MDM2 that may indiscriminately inhibit the growth of all neuroblastoma cells [256]. Previous data in this study showed that a slower rate of protein synthesis in neuroblastoma cells without MYCN amplification is correlated with a lack of growth impairment following ABCE1 knockdown. If sensitivity to ABCE1 knockdown is determined by the rate of protein synthesis in neuroblastoma cells, then targeting other translation factors, in particular those that affect translation in a global manner such as cycloheximide (CHX), should offer similar selectivity towards the MYCN-amplified neuroblastoma cells. However, the results of this study imply this property of ABCE1 suppression is unlikely to be mimicked by the common inhibitors of translation tested in this study. One potential reason for this discrepancy is that small molecule inhibitors were used instead of siRNAs so the response of cells to inhibition of these translation factors could be subject to differential cellular uptake, differences in elimination of the inhibitors between cell lines and off- target effects of small molecule inhibitors. In the future, drug development efforts for ABCE1-targeted inhibitors should ideally include a cell-based screen on a panel of neuroblastoma cell lines without MYCN amplification as well as non-malignant cell lines. If the selectivity observed with ABCE1 suppression can be maintained in small molecule inhibitors against ABCE1, these inhibitors may offer a distinctive characteristic that sets them apart from existing inhibitors of translation.

The clonogenic assays involving the combination of ABCE1 suppression with small molecule inhibitors of translation revealed that targeting translation through different routes simultaneously can offer additive anti-cancer effects. Previous studies have

157 shown that the anti-tumorigenic effects of the ribosome biogenesis inhibitor, CX-5461, can be potentiated by PIM kinase inhibitors and mTORC1 inhibitors that indirectly block eIF4E-mediated translation [270, 271]. The eIF4A inhibitor silvestrol, the eIF4E inhibitor ribavirin and the AKT inhibitor MK-2206 were chosen for this study because each of these translation inhibitors is well-tolerated in animal models and in patients but have shown modest clinical efficacy against solid tumours. In particular, inhibitors of the PI3K-AKT-mTOR pathway such as MK-2206 have entered clinical trials for paediatric malignancies including neuroblastoma; however, the efficacy observed with these inhibitors when administered as single agents has been disappointing [192]. Thus, research is now focused on combination therapies that can potentiate the efficacy of these inhibitors.

MK-2206 can inhibit translation by impairing ribosome biogenesis [274]. Since loss of ABCE1 is thought to impair translation by reducing the number of active ribosomes, the inhibition of ribosome biogenesis by MK-2206 may further reduce the number of available ribosomes, thus giving the subtle potentiation observed in the current study. The ability for ABCE1 suppression to sensitise SK-N-BE(2) neuroblastoma cells to silvestrol (which inhibits cap-dependent gene translation) but not to ribavirin suggests that the anti-growth effects of ABCE1 suppression may be exaggerated by the down- regulation of proteins specifically regulated by eIF4A but not eIF4E. This is not unexpected because eIF4A can regulate a distinct subset of mRNAs that contain differently structured 5’ UTRs compared to the transcripts regulated by eIF4E [256, 401]. Combining ABCE1 suppression with other inhibitors of eIF4E and eIF4A and performing the clonogenic assays in other MYCN-amplified neuroblastoma cell lines will confirm whether ABCE1 knockdown sensitises MYCN-amplified neuroblastoma cells to inhibitors eIF4A but not to those that target eIF4E. Another method by which ABCE1 knockdown can cooperate with translation inhibitors is by reducing translation efficiency further than targeting a single aspect of translation. Earlier results of this chapter have shown that ABCE1 suppression reduces the translation efficiency and protein synthesis by ~40-50%. Although the results here have demonstrated that the anti-growth effects of ABCE1 knockdown can be heightened by translation inhibitors, the impact of the combinations on protein synthesis has not been tested. Examining whether the potentiation observed with targeting ABCE1 and other translation initiation factors is the result of further reductions in mRNA translation remains an interesting

158 biological question. Given that silvestrol and MK-2206 can be administered in vivo, testing whether systemic administration of these inhibitors can potentiate the effects of ABCE1 suppression in vivo will determine if the modest, in vitro potentiation can still be observed in a more biologically relevant model.

In conclusion, the results of this chapter provide insight into the underlying mechanism for the anti-oncogenic effects of ABCE1 suppression against MYCN-amplified neuroblastoma. This work builds on previous reports about the molecular functions of ABCE1 and has demonstrated the essential nature of ABCE1 in maintaining heightened mRNA translation and the selectivity for MYCN-amplified neuroblastoma cells. The higher basal rates of translation in MYCN expressing neuroblastoma cells means that protein synthesis in these cells is more sensitive to the suppression of ABCE1. The role of ABCE1 in MYCN-driven translation has broader implications than solely childhood cancer neuroblastoma because elevated protein synthesis is also an Achilles heel of c- MYC driven cancers [207, 251]. Potentially, targeting ABCE1 may have therapeutic benefits for c-MYC driven cancers and this notion warrants further investigation.

159

Chapter 5: Investigating the role of ABCE1 in neuroblastoma tumour biology

160

5.1 Introduction:

The role of ABCE1 has been extensively studied in molecular and cellular biology but its function in tumour biology remains a mystery. Previous reports demonstrated how ABCE1 is required for the growth, migration and invasion of extracellular matrix by lung, breast and cervical cancer cells [339, 342, 344, 345, 358] and results of previous chapters have uncovered a role for ABCE1 in protein synthesis and driving malignant phenotypes in MYCN-amplified neuroblastoma. This evidence together with the correlation between high ABCE1 expression and neuroblastoma disease progression in patients strongly implies that ABCE1 may fuel the progression of neuroblastoma tumours. Furthermore, MYCN-amplified neuroblastomas appear to be more reliant on the activity of ABCE1, giving rise to the possibility that targeting ABCE1 may offer a safe therapeutic window, further emphasizing the therapeutic potential of ABCE1. However, before designing therapeutics against ABCE1 can be considered, whether ABCE1 suppression can delay the progression of MYCN-amplified neuroblastoma tumours must be investigated. This is because in vitro cultures lack the pro-oncogenic factors in the tumour microenvironment such as regions of hypoxia, infiltration of stromal cells and endothelial cells that may dampen any tumour-suppressive functions of ABCE1 knockdown [402, 403]. Furthermore, cells cultured in vitro exhibit distinct gene expression profiles compared to tumour samples [404]. For these reasons, factors that are critical in cell biology may not contribute to tumour biology. Although the role of ABCE1 in tumour biology has not been directly studied, Ren et al, 2012 have hinted this possible role by showing that nodal metastases from lung carcinomas express higher levels of ABCE1 compared to the primary tumour [345]. This piece of evidence, together with the findings from the previous chapters of this thesis, strongly implies the need to investigate the role of ABCE1 in neuroblastoma tumour biology.

There are several representative animal models that can be used to examine the progression of neuroblastoma. The TH-MYCN transgenic murine model of neuroblastoma is highly representative of the human disease and this immunocompetent model offers the impact of tumour immunity on anti-cancer treatments to be investigated [184, 405]. However, genetic manipulation of the neuroblastoma cells in this model is not readily achievable as a knockdown of ABCE1 in human neuroblastoma cell lines. A more readily available method of investigating the role of ABCE1 in neuroblastoma tumour biology is through creation of tumorigenic

161 neuroblastoma cell lines with inducible or stable ABCE1 knockdown and then xenografting these lines into immunocompromised mice. The most commonly used animal models of neuroblastoma include subcutaneous or orthotopic metastatic xenografts of cultured neuroblastoma cell lines into immunocompromised mice. Subcutaneous xenografts of cultured cell lines have several advantages including easy genetic manipulation of the cells, easy implantation of the cells into mice (compared to surgery required for intra- or para-adrenal engraftments), high engraftment rate of most cell lines and ease and accuracy of tumour monitoring [406]. These xenograft models have been essential in the drug discovery process as indicated by the large number of studies that have used them to assess the efficacy of novel compounds and understand the biological roles of potential therapeutic targets [407, 408] [148, 152, 213, 228, 292, 409]. Despite the practicality of the subcutaneous xenografts, the tumours are formed in an unnatural environment in this model. Primary neuroblastomas typically form in the adrenal medulla and metastases often form in the bone, bone marrow, liver, lymph nodes and lungs [6, 8]. Orthotopic engraftment of neuroblastoma cell lines into the adrenal fat pad or systemic administration of these cell lines enable tumour formation in clinically relevant niches and this allows tumours to faithfully recapitulate the molecular characteristics of the patient’s neuroblastoma [405]. Orthotopic tumour measurements require bioluminescent imaging. The imaging process relies on the expression of luciferase by the tumour cells that enable the cells to bioluminesce when the mice are administered luciferin. Although this process is technically more challenging than measurements for subcutaneous xenografts, it is a relatively accurate method of monitoring tumour progression [405].

Neuroblastoma patient derived xenografts (PDXs) have been used for drug testing instead of xenografts of perpetually cultured cell lines [152, 410, 411]. PDXs are fragments of patient tumours that have been engrafted directly into immunocompromised mice or rats. Likewise, patient-derived cell lines are cells from patient tumours grown in directly in cell culture and representative of primary cells [23, 402]. Unlike established cell lines such as the SK-N-BE(2), patient cell lines have not been subjected to prolonged culture on plastic ware that is known to alter gene expression [404]. The major advantage of using patient-derived xenografts or cell lines is their close resemblance to disease in the patients. These models have been demonstrated to largely retain the molecular characteristics, gene expression profiles,

162

DNA methylation patterns and pattern of metastasis of the patient tumours from which they originated [402, 403], making them worthwhile models for in vivo validation of novel findings.

One of the breakthrough results from chapters 3 and 4 was the selectivity of ABCE1 knockdown against cells that harbour MYCN amplification or overexpression. This discovery suggests a possible therapeutic window associated with targeting ABCE1. A limitation of the animal models discussed so far is that ABCE1 can only be suppressed in the engrafted neuroblastoma cells and thus the possibility of a therapeutic window cannot be tested. Alternatively, systemic inhibition of ABCE1 activity could be achieved via three methods: i) administering an inhibitor of ABCE1, ii) creating conditional knockout of ABCE1 on the TH-MYCN mouse model or iii) administration of therapeutic nanoparticles complexed with ABCE1 specific siRNAs. Currently there are no small molecule inhibitors of ABCE1 available and to date no mouse models with ABCE1 gene deletion have been generated. However, recent advances allow delivery of siRNA via synthetic nanoparticles. Thus, the most feasible method of targeting ABCE1 systemically may be through the use of therapeutic nanoparticles complexed with ABCE1-specific siRNAs. Both of the ABCE1-specific siRNA sequences used in this thesis are predicted to target murine ABCE1 which means systemic delivery of nanoparticles complexed to these siRNAs can provide insight into the therapeutic window of targeting ABCE1. Since siRNA1 suppresses ABCE1 more strongly than siRNA2, it has been selected for in vivo testing. Over the years nanoparticles synthesized from a variety of materials have been developed and tested. One commonly used type is lipid-based nanoparticles such as ALN-VSP and Atu027. These nanoparticles exerted potent in vivo anti-cancer effects when they were complexed with siRNAs targeting oncoproteins such as VEGF [412]. However, when these nanoparticle-siRNA complexes were administered into adult cancer patients, despite being well tolerated most patients do not show disease regression or at best partial response [413, 414]. Furthermore, the lipid-based nanoparticles-siRNA complexes are not efficient at knocking down the target oncoproteins when administered to patients. More recently, poly[oligo(ethylene glycol) methyl ether methacrylate] or POEGMA nanoparticles have been developed for cancer therapy. The POEGMA shields the positive cationic charge of nanoparticles to reduce their toxicity and prevent the aggregation of negatively charged serum proteins on the nanoparticles [415, 416]. Due

163 to their molecular shape, these nanoparticles are known as star nanoparticles and proof of principle is evident in that they exert potent anti-growth effects upon pancreatic solid tumours when complexed with βIII tubulin-targeting siRNAs [415]. Biodistribution studies showed that star nanoparticles efficiently penetrate various organs and tumours [415]. These studies indicate that star nanoparticles are promising, emerging nanoparticles for cancer therapy. Therefore, determining whether they can suppress ABCE1 expression sufficiently to delay tumour growth is worthwhile. Since ABCE1- specific siRNAs have never been tested in vivo, a proof-of-concept experiment involving intratumoral delivery of the siRNA-nanoparticle complexes into subcutaneous neuroblastoma xenografts will be needed to validate whether the ABCE1-specific siRNA1 can suppress ABCE1 in vivo and delay tumour growth. If this experiment is successful, it would be followed with systemic administration of the siRNA- nanoparticle complexes to test whether targeting ABCE1 provides anti-tumorigenic effects without toxicity to normal tissues that accumulate nanoparticles.

The results from chapters 3 and 4 indicated that ABCE1 suppression can reduce the aggressive characteristics of MYCN-amplified neuroblastoma cells such as cell migration, invasion of extracellular matrix, cell proliferation and growth. The experiments of this current chapter will reveal the effects of ABCE1 suppression on tumour growth and metastasis in different neuroblastoma animal models. Whether or not ABCE1 can be therapeutically targeted through the use of star nanoparticles complexed to ABCE1-specific siRNAs will also be tested. Since the effect of ABCE1 suppression on tumour biology in vivo has never been reported, this set of experiments can potentially uncover a novel role for ABCE1. If targeting ABCE1 can impair tumour progression, the results of this chapter will provide solid support for the therapeutic potential of this protein and highlight the need to develop methods for targeting ABCE1 in a clinical setting.

164

Therefore, the aims of this chapter were to:

1. To create MYCN-amplified neuroblastoma cell lines with or without inducible ABCE1 suppression using the pTRIPZTM lentiviral system 2. To investigate the impact of inducible ABCE1 suppression on malignant phenotypes, including tumour growth and metastasis, of both cultured and patient-derived MYCN-amplified neuroblastoma cells and tumours 3. To explore the anti-growth effects of targeting ABCE1 in MYCN-amplified neuroblastoma tumours by using ABCE1-specific siRNAs complexed to star nanoparticles

165

5.2 Results:

5.2.1 Development of a cultured neuroblastoma cell line for examining the impact of inducible ABCE1 knockdown

The results from in vitro experiments of the previous chapters suggest that targeting ABCE1 can weaken the aggressive phenotypes of MYCN-amplified neuroblastoma cells. In order to extend these studies to a more biologically relevant system, development of a model for in vivo studies was necessary. Long term, inducible ABCE1 knockdown can be achieved by transducing cells with pTRIPZTM lentiviral plasmids carrying an ABCE1 specific shRNA sequence while pTRIPZTM lentiviral plasmids carrying non-targeting shRNAs served as controls. These plasmids carry a tetracycline inducible promoter ahead of the shRNA and a red fluorescent protein (RFP) reporter, resulting in their expression when cells are exposed to a tetracycline such as doxycycline. These plasmids were validated to be the correct constructs using a restriction enzyme digest that produced fragments of the expected sizes (7104bps, 4028bps and 2188bps) before production of the viruses by packaging cells and the subsequent transduction of the viruses into neuroblastoma cells (Figures 5.2.1A and see 2.2 Methods).

The MYCN-amplified SK-N-BE(2) TGL neuroblastoma cells are a useful model for in vivo studies as they carry a luciferase gene that enables bioluminescent detection of the tumour cells when mice are administered luciferin, thus allowing both tumour growth and metastasis to be tracked non-invasively. Thus, control and ABCE1 pTRIPZ lentiviruses were first transduced into these cells to create two cell lines – one carrying control, non-targeting shRNA; the other carrying the ABCE1-specific shRNA. Inducible knockdown of ABCE1 in both of these cell lines was tested by treatment with 0.5µg/ml of doxycycline. The ABCE1-specific shRNA effectively suppressed ABCE1 from 48- 144 hours post-transfection, with maximum knockdown achieved by 48 hours post- transfection (Figures 5.2.1B). Therefore, these cells were used for the subsequent in vitro and in vivo experiments.

166

Figure 5.2.1: Development of an inducible ABCE1 expression system. (A) pTRIPZTM lentiviral constructs carrying non-targeting, control (Ctrl) or ABCE1 specific shRNAs were validated through a restriction enzyme (Sal I) digest. Predicted band sizes are 7104bps, 4028bps and 2188bps. These lentiviruses were transduced into the MYCN- amplified SK-N-BE(2) TGL neuroblastoma cell line that, unlike the parental SK-N- BE(2) cells, were modified to express luciferase. (B) Western blots showing a time course of ABCE1 knockdown in SK-N-BE(2) TGL cells using ABCE1-specific shRNA. To induce the expression of the shRNAs, 0.5µg/ml of doxycycline was added once to the media at 24 hours after seeding and cells were collected at the specified time points to check ABCE1 expression.

167

5.2.2 Inducible ABCE1 suppression blocks the growth and migration of the cultured SK-N-BE(2) TGL cells

Since the sequence of the ABCE1-specific shRNA encoded in pTRIPZTM is distinct from siRNA1 and siRNA2, it was important to validate whether ABCE1 suppression by this shRNA exerted the same anti-growth and migratory effects on the SK-N-BE(2) TGL cells as the siRNA-mediated suppression. ABCE1 suppression by the ABCE1- specific shRNA significantly reduced both colony formation and cell motility by >50% (Figure 5.2.2A and B). The small decrease in ABCE1 expression in the cells carrying the ABCE1-specific shRNA without doxycycline induction (Figure 5.2.2A compare lane 1 and 3) was insufficient to cause changes in cell growth or movement compared to cells carrying Ctrl shRNA (Figure 5.2.2B and C). As such, these cell lines represent suitable systems for in vivo xenograft experiments.

Figure 5.2.2: Impact of inducible ABCE1 suppression on the colony forming ability and migration of MYCN-amplified neuroblastoma cell lines. (A) Inducible ABCE1 suppression in the SK-N-BE(2) TGL cells reduced both (B) colony formation and (C) cell migration. Cells were cultured with or without 0.5µg/ml of doxycycline for 48 hours before being seeded for colony forming and TranswellTM migration assays. Protein extracts for the representative Western blot in (A) were collected at 48 hours post-transfection. Results (B-C) represent the means of three independent experiments ± standard error. P-values were derived from one sample t-test.

168

5.2.3 Long-term ABCE1 knockdown delays the growth of neuroblastoma tumours and prolongs the survival of tumour bearing mice

The impact of ABCE1 suppression on tumour growth and progression was examined by subcutaneous engraftment of SK-N-BE(2) TGL cells carrying either Ctrl or ABCE1- specific shRNAs into dorsal flanks of Balb/c nude mice. Once the tumours reached 50mm3, mice were given food with or without doxycycline to regulate the expression of the shRNAs and thus knockdown of ABCE1. Inducing ABCE1 suppression after the initial tumour formation enables the impact upon tumour progression, rather tumour initiation, to be examined. The experimental design consisted of three control groups where the xenografted cells express ABCE1 and one treatment group where the cells undergo ABCE1 suppression.

The expression of the ABCE1-specific shRNA, which is designed to knockdown ABCE1 in the tumours, significantly extended the survival of mice in the treatment group (Figure 3.2.3A). The median survival of the treatment group (black line) was 30.7 days which is a 2-fold increase compared to median survival of the control group (red line; Figure 3.2.3A). This marked increase in survival is the result of a striking delay in tumour growth, as shown by all of the mice in the treatment group (Figure 3.2.3B).

Comparing the survival of mice in the control groups and examining the ABCE1 expression in the tumours prove that the observed in delay in tumour progression is indeed cause by ABCE1 knockdown in the treatment group. No changes were observed between the three control groups of mice with ABCE1 expression (Figure 5.2.3C). This indicates the addition of doxycycline to one of the control groups did not impact tumour growth and the tumour delay observed in the treatment group was only due to loss of ABCE1 (Figure 5.2.3C). Western blotting and respective densitometry performed on all tumours from the mice shows that the tumours of the treatment group had a small but significant decrease in ABCE1 expression that is likely to have caused the reduction in tumour growth (Figure 5.2.3D and E). Immunohistochemistry staining for the proliferation marker, Ki67, showed that tumours with ABCE1 suppression display fewer proliferating cells as indicated by the significant reduction in Ki67 staining (Figure 3.2.3F).

169

170

Figure 5.2.3: Effect of ABCE1 suppression on the growth of neuroblastoma tumours and the survival of tumour-bearing mice. MYCN-amplified SK-N-BE(2) TGL neuroblastoma cells were transduced with lentiviruses carrying either control or ABCE1-specific shRNAs and xenografted subcutaneously into Balb/c nu/nu (nude) mice. Doxycycline administered through food induced the expression of the shRNAs. When expressed, the ABCE1-specific shRNA should knock down ABCE1 expression. (A) Mice carrying the ABCE1-specific shRNAs in their tumour cells exhibited prolonged survival when they were placed on food containing doxycycline (ABCE1 knockdown; black line) compared to mice placed on control food (ABCE1 present; red line). (B) Growth curves of tumours show those with doxycycline-induced expression of ABCE1-specific shRNA had delayed tumour growth compared to tumours without the induction of ABCE1-specific shRNA. (C) Survival curves of control groups of mice carrying tumours without ABCE1 knockdown show that addition of doxycycline in the food (represented by blue line) causes no difference in survival. (D) Western blots were performed on lysates harvested from the tumours after the experiment and (E) densitometric analysis of the blots shows that ABCE1 expression was significantly reduced in the treatment group. N=10 per group for all groups. Endpoint is when the tumours ≥1000mm3. (F) Immunohistochemistry performed in tumours show that ABCE1 knockdown reduces expression of Ki67, indicating impaired cell proliferation. P-values for (A, B) were derived from Mantel Cox regression while p-values for (E) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction. P-value for (F) was deducted from two-tailed t-test. Red line – control group mice carrying ABCE1-specific shRNA in their tumours and fed control food; green line – control group mice carrying control, non-targeting shRNA in their tumours and fed control food; blue line – control group mice carrying control, non-targeting shRNA in their tumours and fed doxycycline food; black line – treatment group mice carrying ABCE1-specific shRNA in their tumours and fed food containing doxycycline.

171

5.2.4 Long-term ABCE1 knockdown reduces the development of neuroblastoma metastases

Cell migration and invasion of extracellular matrix are two in vitro approximations of metastatic ability that are impaired by the depletion of ABCE1. Therefore, to test the effect of ABCE1 knockdown on tumour metastasis, the SK-N-BE(2) TGL cells carrying either Ctrl or ABCE1-specific shRNAs were cultured in media for 9 days with or without doxycycline before being injected into the lateral tail veins of NOD/SCID mice. Metastases were detected through bioluminescence of the tumour cells following administration of D-luciferin to mice. In a clinical setting, the most common sites of metastasis for neuroblastoma include the liver, bone and bone marrow. Reflecting the clinical presentation of metastatic neuroblastoma, images of the mice taken by the IVIS SpectrumCT showed that mice of the control groups in this study had extensive metastases in the approximate locations of their liver, jaw and long bones at 4 weeks post-inoculation of neuroblastoma cells (Figure 5.2.4A and B). Analysis of these images showed that mice carrying cells with ABCE1 knockdown exhibited fewer and smaller metastases (as measured by the amount of bioluminescence from the neuroblastoma cells) compared to mice in the three groups with ABCE1 expression (Figure 5.2.4C). Examination at weekly intervals revealed less extensive metastases in mice with ABCE1 depletion in their tumours from as early as one week after inoculation of the neuroblastoma cells (Figure 5.2.4B) and this trend continued up to 4 weeks post- inoculation (Figures 5.2.4B-C). In similar fashion to the subcutaneous xenograft, the presence or absence of doxycycline itself did not affect the development of metastasis in the three groups of mice with normal ABCE1 expression (Figures 5.2.4B-C). Metastasis to the liver was confirmed via post-mortem examination (Figure5.2.4D). As expected, analysis of protein extracts prepared from liver metastases indicated marked reduction of ABCE1 expression in the tumours that had expression of the ABCE1-specific shRNA compared to the three control groups that did not (Figure 5.2.4E).

172

173

Figure 5.2.4: ABCE1 depletion significantly reduced the development of MYCN- amplified neuroblastoma metastases in the orthotopic xenograft model. ABCE1- specific or control (non-targeting) shRNAs were transduced into SK-N-BE(2) TGL MYCN-amplified neuroblastoma cells. These transduced cells were cultured in the presence or absence of 1ug/ml of doxycycline 9 days before being intravenously injected into the lateral tail veins of NOD/SCID mice that were placed on either control food or food containing doxycycline. Doxycycline induces the expression of the shRNAs. On a weekly basis, mice were administered luciferin that causes the luciferase expressing SK-N-BE(2) TGL cells to bioluminesce and this allows metastases to be tracked via the SpectrumCT In Vivo Imaging System. (A) Time course of metastatic development shows that throughout the 4 weeks following inoculation, mice carrying tumours with ABCE1-specific shRNA and receiving doxycycline food had lower tumour burden compared to those carrying tumours with ABCE1-specific shRNA on food without doxycycline. N=10; endpoint is at 7 weeks post inoculation. (B and C) Measurement of tumour burden at 4 weeks shows that mice of the treatment group had significantly less metastatic tumours than those of the three control groups. (D) Images of liver harvested from mice at 7 weeks post-inoculation showing the number of liver metastases in the mice of treatment group versus those in the control groups. (E) Western blots performed on a selection of tumours harvested from the experiment to examine whether the ABCE1-specific shRNA was successful in suppressing ABCE1 expression. (F) Densitometry of Western blots showing that tumours from the treatment group express significantly less ABCE1 than tumours randomly selected from the three control groups. Some mice in the treatment group with ABCE1 suppression failed to produce any tumours at the endpoint and so the level of ABCE1 suppression could not be examined in those mice. P-values for (B) were derived from One-way ANOVA with Dunnett’s multiple comparisons correction while p-value for (F) was derived from two- tailed t-test. Red line – control group mice carrying ABCE1-specific shRNA in their tumours and fed control food; black line – treatment group mice carrying ABCE1- specific shRNA in their tumours and fed food containing doxycycline.

174

5.2.5 Investigating the role of ABCE1 in a MYCN-amplified neuroblastoma patient-derived xenograft

While SK-N-BE(2) TGL neuroblastoma cells have advantageous features such as luciferase reporter expression and ease of transduction, this established cell line is not the most representative model of human neuroblastoma. To investigate the in vivo role of ABCE1 knockdown in a more representative model, low passage, patient-derived neuroblastoma cell lines were used. The COG-N-415, COG-N-440, COG-N-496 and COG-N-519 are all MYCN-amplified neuroblastoma cell lines and express similar levels of ABCE1 (Appendix Figure 6) [150]. Transfection of ABCE1-specific siRNAs did not reduce ABCE1 expression in COG-N-415 cells and many of the cells died after the transfection so the impact of ABCE1 knockdown on their proliferation could not be assessed (Appendix Figure 7A). The knockdown of ABCE1 was also not successful in the COG-N-440 cells and expectedly, no changes were observed in the BrdU incorporation proliferation assay (Appendix Figure 7B). ABCE1 was successfully knocked down by siRNA2 in the COG-N-496 cells and this strongly reduced cell proliferation but siRNA1 was less efficient in suppressing ABCE1 and modestly reduced cell proliferation (Appendix Figure 7C). Efficient ABCE1 suppression was achieved in the COG-N-519 cells as examined at two time-points following transfection (Figure 5.2.5A). This suppression of ABCE1 significantly reduced proliferation in these cells (P=0.0026; Figure 5.2.5B). For this reason, the COG-N-519 cells were chosen for subsequent in vivo experiments.

175

Figure 5.2.5: Transient ABCE1 knockdown in MYCN-amplified neuroblastoma patient-derived xenograft COG-N-519 cell line significantly reduced cell proliferation. (A) Representative Western blots showing ABCE1 suppression in the cells transfected with ABCE1-specific siRNAs (siRNA1 and siRNA2), harvested at 48 hours and 72 hours post-transfection. (B) BrdU proliferation assays performed on the COG-N-519 cells at 72 hours post-transfection showed that ABCE1 suppression reduced the rate of proliferation. Results in (B) represent means of three independent experiments ± standard error. P-values were derived from One-sample t-test.

To investigate the effect of ABCE1 knockdown on the growth of tumours formed by these cells, they were transduced by the pTRIPZTM lentiviral Ctrl or ABCE1-specific shRNAs in order to generate a system for long-term knockdown. When induced with 1µg/ml of doxycycline for 6 days, substantial knockdown by the ABCE1-specific shRNA was observed in these cells (Figure 5.2.6A) and the ABCE1 knockdown significantly reduced proliferation by more than 60% (Figure 5.2.6B; P=0.003).

176

Figure 5.2.6: ABCE1 knockdown by lentiviral shRNAs transduced into COG-N- 519 cells significantly reduced cell proliferation. COG-N-519 cells transduced with either control (non-targeting) or ABCE1-specific shRNA. ‘Induced’ indicates the cells were induced with 1ug/ml of doxycycline to stimulate the expression of the shRNA. (A) Representative Western blots showing that from 3 days after induction by doxycycline, ABCE1 was suppressed by the expression of the ABCE1-specific shRNA. (B) BrdU proliferation assays set up at 6 days after addition of doxycycline showed that long-term ABCE1 suppression reduced the proliferation of these patient-derived cells. Results in (B) represent means of three independent experiments ± standard error. P-values were derived from One-sample t-test.

177

COG-N-519 cells with Ctrl or ABCE1-specific shRNAs were subcutaneously xenografted into NOD/SCID Gamma (NSG) mice to examine the impact of ABCE1 knockdown on tumour progression in vivo. When the tumours reached 50mm3, the mice were given food with or without doxycycline to induce shRNA expression, and knockdown of ABCE1 in the treatment group. Expression of the ABCE1-specific shRNA was able to delay the growth of the COG-N-519 tumours (Figure 5.2.7A and B). Tumours in the three control groups of mice that did not have expression of the ABCE1-specific shRNA showed similar rates of progression, irrespective of the ingestion of doxycycline (Figure 5.2.7C). After the tumours reached 1000mm3, the mice were euthanized and Western blot analysis of the tumours showed that ABCE1 was successfully suppressed by the expression of the ABCE1-specific shRNA (Figure 5.2.7D and E). These results indicate that inducible ABCE1 suppression could be achieved in the COG-N-519 cells and such ABCE1 depletion delayed progression of these tumours.

178

Figure 5.2.7: ABCE1 suppression in COG-N-519 tumour xenografts significantly delays tumour progression. MYCN-amplified COG-N-519 patient-derived neuroblastoma cells were transduced with lentiviruses carrying either control or ABCE1-specific shRNAs and xenografted subcutaneously into NSG mice. Doxycycline administered through food induced the expression of the shRNAs. When expressed, the

179

ABCE1-specific shRNAs knocks down ABCE1 expression. (A) Mice carrying the ABCE1-specific shRNAs in their tumour cells exhibited prolonged survival when they were placed on food containing doxycycline (ABCE knockdown; black line) compared to mice placed on control food (ABCE1 present; red line). (B) Growth curves of tumours show mice in the group with ABCE1 knockdown (black lines) have delayed growth compared to those exhibiting ABCE1 expression (red lines). (C) Survival curves of mice in the control groups (xenografted with cells carrying either control or ABCE1- specific shRNAs) show that addition of doxycycline in the food causes no difference in survival. (D) Western blots and (E) densitometric analysis performed on the protein extracts from the tumours show induction of the ABCE1-specific shRNA in the treatment group significantly suppressed ABCE1 expression. N=10 per group. Endpoint is when the tumours reach 1000mm3. P-values for (A, B) were derived from Mantel Cox regression while p-values for (E) were derived from One way ANOVA with Dunnett’s multiple comparisons correction. Red line – control group mice carrying ABCE1- specific shRNA in their tumours and fed control food; green line – control group mice carrying control, non-targeting shRNA in their tumours and fed control food; blue line – control group mice carrying control, non-targeting shRNA in their tumours and fed doxycycline food; black line – treatment group mice carrying ABCE1-specific shRNA in their tumours and fed food containing doxycycline.

180

5.2.6 Suppression of ABCE1 expression through intra-tumoral injections of star nanoparticles complexed with ABCE1-specific siRNAs

The results of this chapter have indicated that the anti-cancer effects of ABCE1 suppression observed in neuroblastoma cell lines also extends to anti-tumour effects in vivo, supporting the idea that targeting ABCE1 may be a good therapeutic approach for MYCN-amplified neuroblastomas. A necessary next step in exploiting the therapeutic potential of ABCE1 is to develop clinically relevant methods of targeting ABCE1 in vivo. Since no pharmacological inhibitors of ABCE1 exist, an alternative, clinically relevant approach to target ABCE1 in vivo is through the use of star nanoparticle- mediated delivery of ABCE1-specific siRNAs into tumours. In a proof-of-concept study, mice with subcutaneous tumours formed from SK-N-BE(2) TGL neuroblastoma cells received a mix of 40μg of control (non-targeting) or ABCE1-specific siRNAs and 120μg of star nanoparticles twice a week (i.e. total of 4mg/kg of siRNA-nanoparticles mix was administered with each injection). Administration of the ABCE1-specific siRNAs extended the median survival from 10 days to 17.2 days (Figure 5.2.7A and B). This increase in median survival of 1.72 fold mimics what was observed in the earlier experiment where ABCE1 suppression was mediated by endogenous shRNAs albeit slightly weaker (compare with Figure 3.2.2A). However, one mouse receiving control siRNA reached the endpoint later than the mice receiving ABCE1 specific siRNA (Figure 5.2.7A and B). Having this single outlier meant that ABCE1 suppression produced no statistically significant delay in tumour growth (P=0.5892; Figure 5.2.7A). Somewhat surprisingly, Western blotting of extracts from tumours harvested at 24-72 hours after the last injection of nanoparticles failed to detect suppression of ABCE1 (Figure 5.2.7C and D).

181

Figure 5.2.8 The impact of administering ABCE1-specific siRNAs complexed with star nanoparticles on the growth of MYCN-amplified neuroblastoma tumours. 4mg/kg of ABCE1-specific siRNA (siRNA1) or control siRNA complexed with star nanoparticles were administered twice a week, intra-tumorally. (A) Kaplan-Meier growth curves showing a trend where tumour-bearing mice in the treatment group (black line) appear to have longer survival compared to mice in control group (red line; median survival of 10 days in the control versus 17.2 days in the treatment group). (B) Growth curves of tumours show most mice in the treatment group with ABCE1 knockdown (black lines) have delayed growth compared to those in control group (red

182 lines). (C) Western blots were performed on extracts prepared from tumours at the end of the experiment. * Extracts from tumours of mouse 2.1 served as loading control on the two blots. (D) Densitometric analysis of the blots shows that ABCE1 expression was not significantly reduced in the group receiving ABCE1-specific siRNA. P-values for (A, B) were derived from Mantel Cox regression while p-values for (D) were derived from two-tailed t-test.

183

5.3 Discussion

Although the role of ABCE1 in cancer cell biology and mRNA translation has been studied previously, the results in this chapter provide the first evidence of a critical role for ABCE1 in tumour biology. This set of experiments showed that ABCE1 knockdown by shRNA impaired the progression of tumours formed by cultured SK-N-BE(2) cells or by neuroblastoma patient-derived COG-N-519 cells. Successful genetic manipulation of patient-derived cell lines has not been reported. However, in this study, we show that ABCE1 suppression by both siRNAs and lentiviruses can be achieved in the MYCN- amplified human neuroblastoma PDX COG-N-519 cells. This chapter also explored the concept of targeting ABCE1 in vivo through administration of nanoparticles complexed with siRNAs. However, when star nanoparticles complexed with ABCE1-specific siRNAs were injected into tumours formed by SK-N-BE(2) TGL cells, the siRNAs delayed tumour progression although this failed to achieve statistical significance.

Exploring the role of ABCE1 in tumour biology is an important advance since the evidence of a role for ABCE1 in cell biology does not automatically translate to the behaviour of a tumour and its environment in a whole animal context. This is because factors such as tumour growth in a 3-dimensional structure and the presence of murine structures such as blood vessels and stromal cells can facilitate tumour growth and reduce the efficacy of anti-cancer interventions. The three animal models xenografted with cells with inducible ABCE1 suppression together provide definitive evidence for the first time that long-term suppression of ABCE1 expression can delay neuroblastoma tumour progression. The different pieces of evidence provided by each of the models, their advantages and the remaining questions from each experiment will be discussed.

The subcutaneous xenograft of the SK-N-BE(2) TGL cells provided the first evidence that suppression of ABCE1 in neuroblastoma cells can delay tumour progression, with a biologically significant increase in survival time of almost 2-fold observed upon ABCE1 suppression. The significant reduction in Ki67 staining observed in the tumours with ABCE1 suppression suggests that ABCE1 may contribute to tumour growth by supporting cell proliferation. This hypothesis is further supported by the data presented in chapter 3 that showed ABCE1 knockdown impairing cell proliferation in vitro. The subtle degree of ABCE1 knockdown apparent from the Western blots does not necessarily mean the shRNA had low efficiency in suppressing ABCE1 expression.

184

Since the transduced cells were maintained as a stable pool, it is likely that some cells had weaker ABCE1 suppression than other cells. It is conceivable that those cells might eventually out-compete slower growing cells with stronger degrees of ABCE1 knockdown. Thus, when Western blots were performed on tumours harvested at the end of the experiment, the final tumour may contain a significant proportion of cells with less efficient ABCE1 suppression. Harvesting tumours before the endpoint of tumour size ≥1000mm3 may have given better indication of the extent of the knockdown during the course of the experiment.

The tumour growth delay following ABCE1 knockdown in the patient-derived COG-N- 519 MYCN-amplified neuroblastoma cells is highly encouraging as it extends the in vivo observations to an additional highly clinically relevant model. The other advantage of this model is that the short culture of this cell line enables it to retain a similar molecular profile to that of the patient tumour from which it was derived [402, 403, 417]. However, even therapeutics with potency in animal models can sometimes fail to be efficacious in the clinic [145, 230]. One reason for this discrepancy is that xenografts formed from cell lines that have been cultured on plasticware for prolonged periods may not resemble a patient’s tumour [404]. Since isolates such as the COG-N-519 bear close resemblance to the patient’s tumour, observing efficacy with this model means there may be greater likelihood that targeting ABCE1 can delay neuroblastoma progression in patients. Interestingly, although the delay in tumour growth is significant between mice carrying tumours with and without ABCE1, the delay is subtle and there is overlap in the survival of mice in the two groups. One possible reason for this is the presence of greater mouse-to-mouse variations within each group such that several tumours of the control group have much slower growth compared to others. This variation is expected in a cohort of biologically independent samples, especially for newly patient-derived cell lines. It is also important to note that while ABCE1 knockdown is statistically significant, there are mice in the control group with lower levels of ABCE1 and this may reduce their natural tumour growth rates, causing the overlap in survival between the two groups of mice. Despite this overlap, the growth delay caused by ABCE1 knockdown is still statistically significant. Therefore, together with the subcutaneous xenograft of SK-N-BE(2) TGL cells, this model provides solid evidence that ABCE1 knockdown can delay the growth of MYCN-amplified neuroblastoma tumours.

185

The other major implication that arises from the COG-N-519 xenograft experiment is that it revealed a novel application for patient-derived cell lines. Traditionally, neuroblastoma PDXs or patient-derived cell lines have only used been used for testing different compounds in mice [152, 410, 411]. These cell lines have not been used for loss-of-function studies of genes. By showing that ABCE1 can be suppressed using standard transfection and transduction tools, the results of this experiment prove that suppression of gene products can be achieved in certain neuroblastoma patient-derived cell lines. As more patient-derived cell lines are created, the use of these cell lines may serve as an important model in the discovery of new drug targets.

The use of both subcutaneous and orthotopic xenografts shows that ABCE1 suppression can delay neuroblastoma progression irrespective of where the tumours are formed. The first in vivo experiment performed for this study was the subcutaneous xenograft of the SK-N-BE(2) TGL cells into Balb/c nude mice. The limitation with this model is that the subcutaneous environment can lack factors that represent the true tumour microenvironment of neuroblastoma [405]. The orthotopic model of metastatic neuroblastoma overcame some of these limitations. In this model, the disseminated neuroblastoma must exit the blood vessels form secondary tumours or metastasis in distal organs such as the liver, bone and bone marrow. Therefore, it enables one to study certain processes required for metastasis such as extravasation, invasion of healthy tissue and formation of secondary tumours. Formation of secondary tumours in the abdominal organs and bone or bone marrow enables the progression of neuroblastoma to be studied in an environment that more closely mimics the physiological niche [6, 8]. The observation that suppression of ABCE1 delayed progression of neuroblastoma in this model suggests that targeting ABCE1 may hamper the progression of secondary tumours. This is clinically important because mortalities from progression of secondary tumours or metastatic disease remain a major problem in the treatment of neuroblastoma [4, 72].

Since ABCE1 knockdown decreases tumour growth, it is difficult to conclusively determine whether the reduced tumour burden comes from impaired metastasis or delayed tumour growth. One piece of evidence to suggest ABCE1 may play a role in metastasis is that in samples from patients with lung and breast cancer, higher ABCE1 expression was detected in nodal metastasis than primary tumours [342]. The results of the TranswellTM migration and invasion assays from chapter 3 suggest that ABCE1

186 plays an integral part in neuroblastoma cell motility and invasion of extracellular matrix. Thus, it is possible for the reduction in tumour burden observed in the orthotopic xenograft model to be caused by impaired cell migration out of the vasculature and into distal organs. However, even if these processes are not disrupted by ABCE1 knockdown, a reduction in the number of metastases may still be observed because the knockdown impairs tumour growth so that macroscopic metastases may not form from neuroblastoma cells that have migrated into the distal organs. Therefore, the reduction in the formation of metastases caused by ABCE1 suppression is likely to be caused by a combination of slowed tumour growth and/or disrupted migration of neuroblastoma cells into distal organs.

While the current animal experiments cannot delineate whether ABCE1 affects tumour metastasis, re-designing these experiments or using other models can give insight into the possible role of ABCE1 in tumour metastasis. One such experiment would be to administer the SK-N-BE(2) TGL cells with or without ABCE1 suppression systemically as described for the orthotopic experiment in this study. Doxycycline would be removed when the tumour cells of the mice in the control groups have entered the distal organs. This enables ABCE1 to be suppressed only during the time when neuroblastoma cells in mice of control groups are metastasizing into distal organs. The tumour burden would be imaged using the bioluminescence of the SK-N-BE(2) TGL cells and this should be reflective of tumour metastasis. Another option is to cull the mice immediately after the neuroblastoma cells have invaded into the distal organs such as liver and bone marrow and then use the GFP expressed by the SK-N-BE(2) TGL cells to determine how many cells have entered those organs. For both of these experiments, optimisations would be needed to determine how long it takes for untreated SK-N-BE(2) TGL neuroblastoma cells (with ABCE1 expression) to invade into the different organs. The third option is to use an orthotopic xenograft where the SK-N-BE(2) TGL cells are engrafted in the adrenal fat pad of SCID-Beige mice [418, 419]. If doxycycline is only administered when the primary tumour reaches the size at which metastasis occurs and then removed following metastasis in the control group mice, then changes in the number of secondary tumours is largely determined by the changes in the metastasis. Again, this model will require optimisation to determine when the cells initially metastasize from the primary tumour and when the cells start growing in distal organs to form secondary tumours.

187

One limitation of these in vivo experiments is the engraftment of human neuroblastoma cells into immunocompromised mice and the likelihood that interactions between murine stromal and human cancer cells may differ from interactions between syngeneic systems of murine stromal and murine neuroblastoma cells. Furthermore, the absence of immune cells such as cytotoxic T cells, from the strain of immunocompromised mice used, can affect tumour biology and response to targeted therapies. One method to address this caveat would be to ablate ABCE1 expression, either through CRISPR-Cas9 induced knockout or nanoparticle delivery of siRNAs in a genetically modified mouse model of neuroblastoma such as the TH-MYCN transgenic mice.

Despite the observed growth delay, the eventual return of all SK-N-BE(2) tumours indicates that the knockdown is not capable of eliminating all traces of the disease. There are several possible reasons for this. The first possibility is that the knockdown is incomplete. Incomplete knockdown could present as low levels of knockdown in all cells and this residual level of ABCE1 could enable tumour growth, albeit slower than cells with full ABCE1 expression. Alternatively, incomplete ABCE1 knockdown in the cells expressing ABCE1-specific shRNA may also result from some cells having more efficient ABCE1 knockdown than others. Thus, the cells with better ABCE1 knockdown failed to form tumours but cells with relatively high levels of ABCE1 would progress to form the eventual tumour. This may explain why, when tumours were harvested at the endpoint of 1000mm3, the ABCE1 knockdown was less prominent than that observed in the orthotopic xenograft model, in which the tumours were harvested at a set time point rather than a set tumour size. Examining ABCE1 expression in single tumour cells by flow cytometry would determine the presence or absence of a population of cells with poor knockdown. The other possible reason for the relapse in mice with ABCE1 suppression is that ABCE1 knockdown in the SK-N-BE(2) cells may only slow tumour progression without exerting cytotoxic effects, as also evident in the tumour growth curves where none of the tumours displayed tumour regression. This possibility is supported by in vitro findings reported in chapter 3 where ABCE1 knockdown failed to increase the proportion of apoptotic SK-N-BE(2) cells. Therefore, although apoptosis can be induced by targeting other aspects of protein synthesis such as ribosome biogenesis [271], the effect of ABCE1 knockdown on these MYCN- amplified neuroblastoma may be purely cytostatic. This finding implies that combining ABCE1-targeting therapeutics alongside other agents such as the chemotherapeutics

188 found to potentiate with ABCE1 suppression in vitro (described in chapter 3), would be required in order to fully eliminate the tumour.

One of the questions remaining is whether targeting ABCE1 systemically can exert anti- tumorigenic effects without imposing adverse effects on non-malignant tissue. In the absence of small molecule inhibitors of ABCE1 or an ABCE1 knockout mouse model, the most feasible way answering of this question was to administer nanoparticles complexed with ABCE1-specific siRNAs. Nanoparticles complexed with siRNAs have been FDA approved and some have progressed to clinical trials [413, 414]. Star-shaped nanoparticles complexed with siRNAs have been shown to delay the progression of solid tumours [415] and thus were chosen to deliver the ABCE1-specific siRNAs in this study. Systemic administration of siRNA-nanoparticles against ABCE1 in an orthotopic neuroblastoma xenograft could also give insight into the existence of a therapeutic window for ABCE1 targeting. However, before this experiment can be accomplished, a proof-of-concept experiment demonstrating that the ABCE1-specific siRNA duplex 1 can knockdown ABCE1 in vivo had to be performed. Unfortunately, although a trend was observed towards delayed tumour growth in mice receiving ABCE1 siRNA nanoparticle complex, no significant differences were observed. Since the same SK-N- BE(2) TGL cell line was used in this experiment as for the experiments testing for the effects of shRNA-mediated ABCE1 knockdown, if there was substantial ABCE1 knockdown, a tumour delay should have been observed. The protein expression data obtained from tumours harvested at the endpoint suggest that ABCE1 suppression did not occur at any time point during the 3day interval between injections of the siRNA- nanoparticles, although additional samples harvested 72 hours after the final injection are required to draw a firm conclusion. Therefore, the lack of tumour growth delay observed in this experiment is most likely attributable to the minimal ABCE1 knockdown observed in the tumours.

Any of several technical challenges encountered with the nanoparticle approach may have contributed to the suboptimal efficacy of the ABCE1 siRNA-nanoparticle complexes. Firstly, in this experiment, the SK-N-BE(2) TGL cells engrafted more slowly than expected, taking six weeks, on average, as opposed to two weeks for typical engraftment of these cells. A consequence of late engraftment is that tumour biology may not be as representative as those tumours formed through typical engraftment. In addition, as a consequence, the older age of the mice at the time of engraftment was not

189 ideal for this experiment. Another potential factor is the choice of protocol, where the standard siRNA-nanoparticle administration protocol (40µg siRNA with 120µg of star nanoparticles given twice a week) was taken from previous studies examining different protein targets [415]. In previous studies, fluorescently-tagged siRNAs were used in pharmacokinetic and biodistribution studies to demonstrate that the siRNAs could reach and accumulate in solid tumours and that these levels were higher than organs such as the liver [415, 416]. However, suboptimal knockdown of ABCE1 could still occur due to the fact that ABCE1 is a relatively stable protein and that the SK-N-BE(2) line that express high levels of ABCE1. Thus, higher doses or more frequent administration of the siRNA-nanoparticles may be required. The bruising within the tumours caused by repeated intra-tumoral injections may have reduced uptake of siRNAs and consequently further reduced the knockdown efficiency. Despite these technical challenges, the observation of a trend for tumours administered with ABCE1-specific siRNAs to have slower tumour growth suggests that optimisation of the administration protocol to achieve maximal ABCE1 knockdown may be worthwhile.

Even though ABCE1 knockdown by siRNA-nanoparticles was not observed at the end of the experiment, efficient ABCE1 knockdown may have occurred before the endpoint, which may have led to the slight increase in the median survival by 7.2 days in the group treated with ABCE1-specific siRNAs. As postulated for the subcutaneous xenografts with inducible knockdown, it is possible that in this case too, the knockdown becomes undetectable as the growth of neuroblastoma cells with less efficient delivery of the nanoparticle supersedes the growth of siRNA-nanoparticle transfected cells, and so the tumour progresses towards endpoint. Performing Western blots on tumours harvested prior to the 1000mm3 endpoint would test this possibility.

In summary, the results of this chapter demonstrated for the first time that ABCE1 plays a critical role in malignant tumour progression. Such findings imply that targeting ABCE1 may offer therapeutic benefit for patients with MYCN-amplified neuroblastoma. The strong anti-proliferative effects associated with ABCE1 knockdown in the xenografted patient-derived COG-N-519 cells indicate that ABCE1 also plays a critical role driving the malignant phenotypes of a cell line that closely resembles the patient’s disease. These in vivo data imply that targeting ABCE1 has promising therapeutic potential and methods of therapeutically inhibiting its function should be explored. Despite the success of siRNA-nanoparticle complexes in suppressing the expression of

190 other oncogenic proteins, the siRNA-nanoparticle complexes tested in this study were not able to suppress ABCE1 expression and significantly delay the progression of MYCN-amplified neuroblastoma tumours. However, given the technical challenges encountered in this experiment and the encouraging trend showing slowed tumour progression in mice receiving ABCE1-specific siRNAs, methods of optimising ABCE1 knockdown should be investigated.

191

Chapter 6: Concluding remarks and future perspectives

192

Neuroblastoma patients whose tumours are characterised by MYCN gene amplification are among those with the worst clinical outcome [59, 63]. In many of these patients, the current chemotherapies do not prevent or cure their relapse and ultimately these patients succumb to the disease. Finding more effective therapeutics for patients with MYCN- amplified neuroblastoma has been a key focus in research over the past few decades [4, 72]. One class of therapeutics showing promising efficacy in preclinical studies of c- MYC driven cancers is that consisting of inhibitors of translation factors and ribosome biosynthesis. For example, targeting the activity of translation initiation factor, eIF4A, impairs the progression of multiple myeloma [259]. Targeting ribosome biogenesis through inhibition of RNA polymerase I has yielded similar results in c-MYC driven lymphomas and prostate cancers [270-273]. Several studies have implicated MYCN in up-regulating the expression of genes and proteins involved with translation [202, 266]. High expression of two translation factors have been linked to the growth of neuroblastoma cells and poorer clinical outcome [267, 268]. Whilst these published studies imply that targeting mRNA translation in MYCN-driven neuroblastomas may also be an effective method of treating this disease, the potential benefit of targeting mRNA translation in MYCN-driven neuroblastoma is not well understood. ABCE1 is an ATPase directly up-regulated by MYCN and c-MYC transcription factors [298, 299]. It plays a critical role in powering the dissociation of the ribosome into its constituent subunits to enable translation re-initiation and continued protein synthesis [346, 354, 355]. In neuroblastoma, high ABCE1 expression has been associated with poor clinical outcome [299]. However, despite its essential nature in protein synthesis, the role of ABCE1 and potential of targeting this molecule as a therapeutic strategy for neuroblastoma has not been reported and examining such role of ABCE1 became the focus of this thesis.

Investigating the biological role of ABCE1 in neuroblastoma was broken down into three broad aims in this thesis and these were i) determining the role of ABCE1 in the malignant phenotypes of neuroblastoma cells; ii) uncovering the molecular mechanism that underlie the pro-oncogenic functions of ABCE1; iii) investigating the role of ABCE1 in neuroblastoma tumours. The results of chapter three highlighted that ABCE1 suppression preferentially reduced the proliferation, colony forming ability, migration and invasiveness of MYCN-amplified or MYCN overexpressing neuroblastoma cells. No reduction in these malignant properties was observed in neuroblastoma or fibroblast

193 cells that lack MYCN amplification. The results also implied that ABCE1 knockdown potentiates the efficacy of three chemotherapeutics that are routinely used to treat neuroblastoma patients; namely topotecan, mafosphamide (an in vitro active derivative of cyclophosphamide) and etoposide. After demonstrating the importance of ABCE1 in supporting the malignant phenotypes of MYCN-amplified neuroblastoma cells, chapter four aimed to uncover the molecular functions of ABCE1 that enable it to enhance the aggressiveness of neuroblastoma. The results reported in this chapter showed that neuroblastoma cells with MYCN overexpression or amplification exhibited a heightened rate of protein synthesis. ABCE1 suppression in these cells dramatically reduced the activity of ribosomes and the rate of protein synthesis. Neuroblastoma or fibroblast cells without MYCN amplification appeared to maintain normal levels of protein synthesis even when ABCE1 was suppressed and this is consistent with their malignant phenotypes being unperturbed upon ABCE1 knockdown. Finally, the results of chapter five highlighted the biological relevance of ABCE1 in tumour progression. The delay in tumour progression caused by ABCE1 knockdown in two independent MYCN-amplified neuroblastoma xenografts demonstrates that ABCE1 knockdown can override the pro- oncogenic factors present in the tumour microenvironment and exert tumour- suppressive effects. Altogether the results of this thesis present ABCE1 as an attractive therapeutic target in neuroblastoma that warrants further investigation.

Contrary to previous conceptions of ABCE1 as an essential translation factor, the results of this thesis demonstrated that ABCE1 was only required for the malignant phenotype of MYCN overexpressing neuroblastoma cells. This contrasts to prior molecular-based studies using cell-free models, which demonstrated that ribosome recycling does not occur in the absence of ABCE1 [346]. While the addition of other potential ribosome recycling factors can dissociate ribosomes, they are not as efficient as ABCE1 [394]. In published literature, suppression of ABCE1 impaired mRNA translation in every model and reduced the malignant phenotype of every human cell line tested; from archaea to yeasts to mammalian cells [339, 340, 351, 353-355, 357]. For this reason, the ubiquitous ABCE1 has been thought to be critical for mRNA translation generally, without which cells cannot grow. Thus, the perceived essential nature of ABCE1 in protein synthesis had led to the presumption that targeting ABCE1 is likely to cause detrimental effects to non-malignant tissue as well as tumours, presenting a major challenge in exploiting ABCE1 as a therapeutic target for cancer therapy. Data presented in this thesis

194 demonstrated that human cells without MYCN amplification do not require full ABCE1 expression to maintain a level of protein synthesis with which they can survive. However, as observed for c-MYC driven cancers, the results of this thesis suggest that MYCN-amplified neuroblastoma cells also exhibit heightened protein synthesis. When this process is disrupted by siRNA-mediated ABCE1 suppression, the malignant characteristics of MYCN-amplified neuroblastoma cells and tumours are severely impaired. While the selectivity of ABCE1 knockdown against MYCN-amplified neuroblastoma cells appear contradictory to the essential nature of ABCE1 reported by previous findings, it is important to note that studies of ABCE1 in human cells have mostly been performed on c-MYC expressing cancer cell lines such as MCF7, K562, HeLa and Eca109 [339, 342, 343, 357, 358]. Therefore, these studies complement the results of this thesis by showing that ABCE1 suppression reduces malignant phenotype of MYC expressing cells. One caveat in each of these published studies is that only a single cell line for each cancer type was tested so the effect of ABCE1 suppression on cells with different levels of MYC expression has not been formally investigated. By investigating the role of ABCE1 in MYCN-amplified versus non-amplified neuroblastoma cells and non-malignant fibroblast cells, the results of this thesis suggest that targeting ABCE1 could offer a safe therapeutic window that may be exploited as a therapeutic strategy for MYCN-amplified neuroblastoma.

The ability for ABCE1 knockdown to selectively reduce translation in MYCN-amplified neuroblastomas warrants further investigation into the molecular functions of ABCE1. The polysome profiling assays described in this thesis cannot pinpoint which stage(s) of translation are affected by ABCE1 knockdown. Experiments that can shed light on this question include performing polysome profiling assays using cell-free protein lysates and adjusting the sucrose gradient to specifically examine the amount of 40S, 60S and 80S ribosomes as described in Barthelme et al (2011) and Pisarev et al (2010) [346, 354]. In these experiments, because the cellular extracts, unlike living cells, contain a finite amount of 80S ribosomes, the addition of human ABCE1 should dissociate all of these ribosomes into 40S and 60S subunits if the ABCE1 plays a role in ribosome recycling. It is important to note that this experiment should preferably be performed using lysates and ABCE1 from neuroblastoma cells in case there is discrepancy between the function of ABCE1 in neuroblastoma cells compared to ABCE1 derived from other mammalian cells. This may require optimisation because previous experiments in

195 mammalian systems have only been done using rabbit reticulocyte lysates [354]. To examine whether ABCE1 has a role in ribosome recycling within living cells, ribosome profiling should be performed on neuroblastoma cells with or without ABCE1 knockdown. Ribosome recycling involves isolating the ribosomes from protein extracts and performing RNase-mediated digestion regions of the mRNA not covered by the ribosomes before the fragments covered by the ribosomes are isolated and sequenced to determine where ribosomes are sitting on the mRNA. If ABCE1 knockdown reduces ribosome recycling and ribosomes can no longer dissociate and be released from the mRNA, there would be a build-up of ribosomes on the 3’ UTR of transcripts. This experiment has been successfully used to demonstrate the role of ABCE1 in ribosome recycling in mammalian (leukaemia) and yeast cells [353, 357]. In addition, performing co-immunoprecipitation experiments will determine the binding partners of ABCE1 and this may also give clues about the stages of translation in which it takes part. For example, the direct association of ABCE1 with translation initiation factors such as eIF2 and eIF5 implies it may be involved in translation initiation.

Mechanistically, other experiments worthy of future investigations should aim to determine whether ABCE1 suppression is reducing the translation of specific transcripts. The label-free mass spectrometry experiment performed in this study was aimed at answering this question and the results of this experiment did not support a role for ABCE1 in changing the translation of specific proteins. However, this study examined only the absolute quantity of proteins, rather than the expression of newly synthesized proteins and it did not measure changes in translation of specific mRNAs. For this reason, more in-depth experiments are needed to supplement the findings from the mass spectrometry experiments. Performing RNA sequencing on polysomes from the neuroblastoma cells with or without ABCE1 knockdown will determine if ABCE1 suppression is changing the translation of specific transcripts. For example, if mRNAs encoding oncoproteins are being translated less efficiently after ABCE1 suppression, then the amount of these mRNAs being associated with the polysomes should decrease whilst no changes should be observed in the mRNAs encoding housekeeping proteins such as actin. Besides performing RNA sequencing on the polysomes, another way of validating the findings from the mass spectrometry is by pre-labelling the proteins with an amino acid analogue before performing mass spectrometry. This method, described in Wang et al 2016, only measures the expression of newly synthesized proteins and

196 should be more sensitive at detecting changes in the expression of specific proteins [398]. These experiments should provide definitive evidence to support or disprove the role of ABCE1 in promoting the translation of specific oncogenes.

Although MYCN is known to up-regulate genes encoding translational machinery, the addiction of MYCN-amplified neuroblastoma cells to heightened protein synthesis has not been demonstrated until now. By performing puromycin incorporation assays on the SH-EP Tet21N cells and a variety of neuroblastoma cell lines with or without MYCN amplification, the experiments reported in this thesis have shown that MYCN heightens protein synthesis in the same way as c-MYC. The ability for ABCE1 suppression to reduce the MYCN-driven protein synthesis down to basal levels and the associated reduction in proliferation of the SH-EP Tet21N cells suggests that the malignant phenotypes of MYCN-driven neuroblastoma are fuelled by heightened protein synthesis. This newly discovered vulnerability of MYCN-amplified neuroblastoma cells to disruptors of protein synthesis indicates that translation inhibitors should be investigated as a therapeutic strategy for these neuroblastomas.

The common addiction to heightened protein synthesis shared by MYCN-driven neuroblastoma and c-MYC-driven adult cancers raises the question of targeting ABCE1 as a therapeutic strategy for c-MYC driven cancers. Inhibitors of global translation have been effective against a number of c-MYC driven adult cancers such as Burkitt’s lymphoma, multiple myeloma, T-cell acute lymphoblastic leukaemia, c-MYC driven prostate cancer, pancreatic cancer and melanoma [256, 259, 271, 273]. As mentioned previously, several studies reported that ABCE1 contributed to malignant phenotypes in cancer cell lines that express c-MYC [342, 343]; however, deeper investigations are required to determine whether c-MYC overexpression sensitises these cancer cells to ABCE1 suppression. Examining the link between high ABCE1 expression and clinical outcome across different adult cancers would be a suitable approach to start these investigations. These adult cancers should include those that are known to be c-MYC driven such as Burkitt’s lymphoma [248]. The cancers that show correlation of high ABCE1 expression to reduced patient survival should be examined further. For each of these cancers, ABCE1 suppression should be performed in a variety of cell lines with or without c-MYC amplification. If ABCE1 suppression preferentially reduces the malignant phenotypes and protein synthesis of the c-MYC overexpressing cell lines, then a cell line with inducible c-MYC expression, much like the SH-EP Tet21N

197 neuroblastoma cell line with inducible MYCN expression, should be created. ABCE1 suppression performed in these cancer cells with or without c-MYC overexpression will determine if high levels of c-MYC make these cells dependent on ABCE1 to fuel their protein synthesis, cell growth or malignant phenotype. Extending these findings into animal models either through xenografts of adult cancer cell lines with or without ABCE1 knockdown into immunocompromised mice or by knocking out ABCE1 in a cancer mouse model such as the Eμ-MYC lymphoma model will provide solid evidence supporting the role of ABCE1 in c-MYC driven cancers. Since c-MYC drives the progression of so many cancers, conducting these investigations could significantly broaden the implication and potential applications of future inhibitors against ABCE1.

While c-MYC is often associated with the progression of adult cancers, it is important to note that a subset of neuroblastomas can also overexpress c-MYC [184, 375]. c-MYC can drive the malignant transformation of neural crest cells into neuroblastoma [184]. This subset neuroblastomas accounts for ~10% of total cases and has a poor prognostic outcome, comparable to that of MYCN-amplified neuroblastomas [375]. For this reason, examining the dependence of these tumours on high ABCE1 expression by performing ABCE1 knockdown in c-MYC overexpressing neuroblastoma cells such as the NB69 line (see Figure 3.2.2) will determine if targeting ABCE1 can offer therapeutic benefit for patients with c-MYC-driven neuroblastomas. Interestingly, analysis of clinical data presented in this thesis suggested that ABCE1 is prognostic of poor clinical outcome in neuroblastomas lacking MYCN amplification while in vitro experiments do not support a role for ABCE1 in neuroblastoma cells lacking both MYCN and c-MYC expression. This implies that the correlation of high ABCE1 expression with poor outcome in neuroblastomas without MYCN amplification could stem from the prognostic significance of ABCE1 in the subset of patients that exhibit c-MYC overexpression in their tumours. Examining whether high ABCE1 expression is correlated to poor clinical outcome only in these patients will validate this idea and indicate whether targeting ABCE1 could be exploited as a therapeutic strategy for c-MYC driven neuroblastomas. To perform this type of analysis, it will be important to find a particular neuroblastoma patient cohort for which c-MYC expression level is known. Since detection of c-MYC overexpression is not routinely performed in the clinic for the diagnosis of neuroblastoma, finding a cohort with information about this aberration may be difficult. Analysing the level of c-MYC protein or mRNA expression in patient tumours through

198 tumour microarrays or standard microarrays respectively, can determine which patients exhibit aberrant c-MYC expression.

For the first time, solid support of a role of ABCE1 in tumour biology is now available. While the impact of ABCE1 knockdown on the growth and migration of adult cancer cells in vitro has been investigated in a few studies [339, 342, 343, 345], the impairment in tumorigenesis and cancer metastasis by targeting ABCE1 has not been previously investigated for any cancer. The xenograft experiments using long-established and patient-derived neuroblastoma cell lines performed in this study imply that the in vitro anti-oncogenic effects of ABCE1 knockdown could be observed in a clinically representative model. However, the conclusions drawn from the animal models used in this study do have caveats that should be addressed in future investigations. Firstly, interaction between the tumour and a functional immune system cannot be modelled by the engraftment of human cancer cells into immunocompromised mice. Secondly, the likely therapeutic window for ABCE1 suppression cannot be investigated through xenograft models because ABCE1 was only suppressed in the tumours and not throughout the non-malignant tissues of the mice. Both of these questions can be answered by developing a conditional knockout model of ABCE1 on the TH-MYCN murine background. This model not only enables the impact of ABCE1 suppression on the development of different types of normal tissues to be studied, but also the impact on neuroblastoma development and progression. The other benefit of developing a conditional knockout mouse model of ABCE1 on the TH-MYCN background is that it enables the effect of different dosages of ABCE1 on neuroblastoma and non-malignant tissues to be studied. Previous studies have demonstrated that haploinsufficiency of certain proteins involved in translation such as translation initiation factor eIF4E and ribosomal protein RPL24 is sufficient to stop MYC-driven cancer progression and malignant transformation without adverse effects on the development, and growth of normal tissues [246, 278]. These studies raise the question of whether 50% loss in ABCE1 expression, i.e. TH-MYCN mice with ABCE1 haploinsufficiency, can exert the same selective effects against MYCN-amplified neuroblastoma tumours. If ABCE1 haploinsufficiency can prevent or delay tumorigenesis without affecting the normal development of mice, then it may be possible for future inhibitors of ABCE1 to have a safe therapeutic that enables the inhibitors to impair neuroblastoma progression without posing toxicity to non-malignant tissue.

199

The potentiation of standard-of-care chemotherapies by ABCE1 knockdown highlights the substantial clinical relevance of targeting ABCE1. Two of the drugs potentiated by ABCE1 knockdown include mafosfamide (an activated metabolite of cyclophosphamide with in vitro anti-cancer effects) and topotecan that are commonly used to treat relapsed neuroblastomas. Therefore, future ABCE1-targeting agents may be of particular benefit for patients with relapsed or refractory neuroblastoma who do not respond well to the current chemotherapy regimen. Since the experiments performed in this study were conducted with just one cell line, extending the assays to additional neuroblastoma cell lines and importantly, animal models, will confirm the chemo-sensitisation effects of targeting ABCE1. Given that ABCE1 suppression delays neuroblastoma tumour growth without completely eradicating the tumour, finding other drug combinations that can heighten the anti-tumorigenic effects of ABCE1 and fully eliminate the tumour will be a worthwhile pursuit. These drugs should not be limited to chemotherapeutics and should be extended to existing small molecule inhibitors. Testing ABCE1 knockdown in a panel of neuroblastoma cells treated with a number of small molecule inhibitors will uncover which inhibitors can be potentiated by ABCE1 knockdown. Since many of the small molecule inhibitors entering the clinic show modest efficacy, the potentiation of these inhibitors by ABCE1 knockdown may present a novel approach to heighten their clinical efficacy. This type of drug screen is limited to gene products that have readily available inhibitors and many druggable proteins implicated in cancer progression do not yet have readily available inhibitors. Conducting a co-operative screen against an siRNA library will uncover any gene that can be silenced to potentiate the anti-growth effects of ABCE1 knockdown. Targeting these gene products along with ABCE1 may prolong the tumour-free survival of mice by comparison with targeting ABCE1 alone, and their discovery may also shed further light on the precise function of ABCE1.

Since the use of star nanoparticles complexed with ABCE1-specific siRNAs did not detectably knockdown ABCE1 or delay neuroblastoma tumour growth, optimising this method of siRNA delivery or finding new ways of targeting ABCE1 are required. There was a trend showing slower tumour growth in mice receiving ABCE1 siRNA so finding more efficient siRNA-to-nanoparticle ratios and the right frequency of intra-tumoral injections required to suppress ABCE1 expression in the tumours is still worthwhile. Other types of nanoparticles such as ALN-VSP and Atu027 have successfully delivered siRNAs into solid tumours, delayed tumour growth and are well tolerated in cancer

200 patients [412-414]. Thus, finding methods of suppressing ABCE1 through the use of siRNA should not be limited to star nanoparticles.

Another method of inhibiting the activity of ABCE1 is through the use of small molecule inhibitors that target regions of ABCE1 critical for its function. Like all ABC transporters, ABCE1 has two ATPases without which its functions in mRNA translation cannot occur [346]. The ATPases of ABC transporters can be readily inhibited by a variety of small molecule inhibitors [302, 304, 324, 325]. This implies finding methods of inhibiting the function of ABCE1 by small molecule inhibitors may generate clinically efficacious therapeutics for neuroblastoma. It has been demonstrated that the function of ABCE1 is largely dependent on its ATPases [346]. Performing an in silico screen on a library of existing and novel small molecules will reveal which molecules are likely to bind to and inhibit the function of the ATPases of ABCE1. These inhibitors should then be validated by testing their ability to block the ATPase activity of recombination wild-type ABCE1 protein using an ATP hydrolysis assay much like the process described in Barthelme et al, 2011 [346]. Microsomal stability assays will need to be performed to ensure they can be administered in vivo without rapid clearance by the liver. Then the inhibitors that are highly stable and can successfully impair the ATP hydrolysis of ABCE1 will need to be tested against a panel of cell lines derived from neuroblastoma, other cancers and non-malignant tissue to ensure they selectively inhibit the growth of malignant cell lines and preferably those with MYC hyperactivity. The ability of these selected inhibitors to delay tumour progression can be tested using neuroblastoma xenografts or the TH-MYCN neuroblastoma mouse model. Such screening can potentially identify small molecule inhibitors of ABCE1 with anti- tumorigenic effects against neuroblastoma.

In conclusion, the results of this thesis altogether have demonstrated that ABCE1 is a valuable new target worthy of further development for treatment of neuroblastoma. Since patients with MYCN-amplified neuroblastomas have particularly low survival rates and respond poorly to standard treatments, the pursuit of new approaches to treat these neuroblastomas should proceed with urgency. By showing that suppression of ABCE1 selectively reduces the rate of protein synthesis and the malignant characteristics of MYCN-amplified neuroblastoma cells and tumours, the data imply that targeting ABCE1 may delay the progression of these neuroblastomas without adverse toxicity. Given the high therapeutic potential of ABCE1, findings described in this

201 thesis indicate that developing therapeutic agents against ABCE1 should be a priority in the race to find more efficacious treatments for MYCN-amplified neuroblastomas.

202

Appendix

203

Table 1: Classification of neuroblastoma patients with high-risk disease

Risk INRG IDRFs in Age Histological category Grade of MYCN Genomic Ploidy group stage primary differentiation amplification profile tumour status High L1 Absent Any Neuroblastoma or Any + Any Any ganglioneuroblastoma nodular* High L2 Present ≥18 months Neuroblastoma or Poorly + Any Any ganglioneuroblastoma differentiated or nodular* undifferentiated High M Any 12-18 Any Any − Unfavourable genomic months profile and/or ploidy High M Any <18 months Any Any + Any Any High M Any ≥18 months Any Any Any Any Any High MS Any 12-18 Any Any − Unfavourable Any months High MS Any <18 months Any Any + Any Any * Tumours with a ganglioneuroblastoma nodular histology are those that have composite stroma rich and stroma regions as opposed to the more homogenous stroma-poor appearance characteristic of neuroblastoma histology. INRG – International Neuroblastoma Risk Group; IDRF – image defined risk factor. + indicates the presence of MYCN amplification while – indicates the absence of MYCN amplification.

204

205

Figures:

Figure 1: RT-qPCR showing ABCE1 expression is higher in certain MYC- expressing neuroblastoma cell lines (SK-N-BE(2) and NB69). Data obtained from Dr MoonSun Jung.

Figure 2: siRNA mediated knockdown of c-MYC in HEY epithelial ovarian cancer cells showed the band, observed between 50-75kDa, detected by the antibody was the c-MYC transcription factor. Lysate from HEY cells were obtained from Dr MoonSun Jung.

206

Figure 3: Loss of ABCE1 does not induce apoptosis as measured by the Annexin V staining in (A) SK-N-BE(2) and (B) CHP134 cells at 72 hours post-transfection with control or ABCE1 specific siRNAs. Results represent the mean of two independent experiments ± standard error. P-values were derived from One Way ANOVA with Dunnett’s multiple comparisons correction. Ctrl – non-targeting control siRNA; siRNA1 – ABCE1 specific siRNA sequence 1; siRNA2 – ABCE1 specific siRNA sequence 2.

Figure 4: At 48 hours post-transfection, ABCE1 knockdown did not decrease protein synthesis in the SK-N-BE(2) MYCN-amplified neuroblastoma cells. Ctrl – non-targeting control siRNA; siRNA1 – ABCE1 specific siRNA sequence 1; siRNA2 – ABCE1 specific siRNA sequence 2.

207

Figure 5: ABCE1 suppression by siRNA1 and siRNA2 did not reduce the expression of MYCN in the MYCN-amplified SK-N-BE(2) neuroblastoma cells at 48 hours or 72 hours post-transfection.

Figure 6: Expression of ABCE1 and MYCN across four neuroblastoma patient- derived cell lines. Western blots were performed on cell extracts harvested at log-phase of cell growth. (A) The four patient-derived cell lines had comparable ABCE1 expression. (A) All cell lines were MYCN-amplified and expressed MYCN with COG- N-415 and COG-N-519 being the strongest expressers. N=1.

208

Figure 7: The impact of siRNA-mediated suppression of ABCE1 on proliferation of neuroblastoma patient-derived cells. (A-C) Western blots was performed on cellular extracts harvested at 72 hours post-transfection with control (Ctrl) or one of two ABCE1 specific siRNAs (siRNA1 and siRNA2) in COG-N-496, COG-N-440 and COG-N-415 patient-derived neuroblastoma cell lines. (D) and (E) BrdU proliferation assays performed at 72 hours post-transfection in COG-N-440 and COG-N-496 cells respectively. *(A) the COG-N-415 cells had high amount of cell death following transfection so BrdU incorporation assays could not be performed on these cells. N=1.

209

References:

210

1. Park, J.R., R. Bagatell, W.B. London, et al., Children's Oncology Group's 2013 blueprint for research: neuroblastoma. Pediatric Blood & Cancer, 2013. 60(6): p. 985-93. 2. Gatta, G., L. Botta, S. Rossi, et al., Childhood cancer survival in Europe 1999-2007: results of EUROCARE-5--a population-based study. The Lancet Oncology, 2014. 15(1): p. 35-47. 3. Cohn, S.L., A.D. Pearson, W.B. London, et al., The International Neuroblastoma Risk Group (INRG) classification system: an INRG Task Force report. Journal of Clinical Oncology, 2009. 27(2): p. 289-97. 4. Maris, J.M., Recent advances in neuroblastoma. New England Journal of Medicine, 2010. 362(23): p. 2202-11. 5. Ng, A., G.M. Taylor and O.B. Eden, Secondary leukemia in a child with neuroblastoma while on oral etoposide: what is the cause? Pediatric Hematology and Oncology, 2000. 17(3): p. 273-9. 6. DuBois, S.G., Y. Kalika, J.N. Lukens, et al., Metastatic sites in stage IV and IVS neuroblastoma correlate with age, tumor biology, and survival. Journal of Pediatric Hematology/Oncology, 1999. 21(3): p. 181-9. 7. Vo, K.T., K.K. Matthay, J. Neuhaus, et al., Clinical, biologic, and prognostic differences on the basis of primary tumor site in neuroblastoma: a report from the international neuroblastoma risk group project. Journal of Clinical Oncology, 2014. 32(28): p. 3169- 76. 8. La Quaglia, M.P., B.H. Kushner, W. Su, et al., The impact of gross total resection on local control and survival in high-risk neuroblastoma. Journal of Pediatric Surgery, 2004. 39(3): p. 412-7; discussion 412-7. 9. Morandi, F., M.V. Corrias and V. Pistoia, Evaluation of bone marrow as a metastatic site of human neuroblastoma. Annals of the New York Academy of Sciences, 2015. 1335: p. 23-31. 10. Pollock, B.H., J.P. Krischer and T.J. Vietti, Interval between symptom onset and diagnosis of pediatric solid tumors. The Journal of Pediatrics, 1991. 119(5): p. 725-32. 11. He, W.G., Y. Yan, W. Tang, et al., Clinical and biological features of neuroblastic tumors: A comparison of neuroblastoma and ganglioneuroblastoma. Oncotarget, 2017. 8(23): p. 37730-37739. 12. Federico, S.M., S.L. Brady, A. Pappo, et al., The role of chest computed tomography (CT) as a surveillance tool in children with high-risk neuroblastoma. Pediatric Blood & Cancer, 2015. 62(6): p. 976-81. 13. Stone, A., D. Novetsky Friedman, S. Worgall, et al., Long-term Pulmonary Outcomes in Pediatric Survivors of High-risk Neuroblastoma. J Pediatr Hematol Oncol, 2017. 39(7): p. 547-554. 14. Knight, K.R., D.F. Kraemer and E.A. Neuwelt, Ototoxicity in children receiving platinum chemotherapy: underestimating a commonly occurring toxicity that may influence academic and social development. Journal of Clinical Oncology, 2005. 23(34): p. 8588- 96. 15. Garaventa, A., C. Gambini, G. Villavecchia, et al., Second malignancies in children with neuroblastoma after combined treatment with 131I-metaiodobenzylguanidine. Cancer, 2003. 97(5): p. 1332-8. 16. Ambros, P.F., I.M. Ambros, G.M. Brodeur, et al., International consensus for neuroblastoma molecular diagnostics: report from the International Neuroblastoma Risk Group (INRG) Biology Committee. British Journal of Cancer, 2009. 100(9): p. 1471- 82. 17. Brownell, A.L., Prognostic imaging of neuroblastoma. European Journal of Nuclear Medicine and Molecular Imaging, 2014. 41(6): p. 1043-5.

211

18. Zhao, L., J. Mu, P. Du, et al., Ultrasound-guided core needle biopsy in the diagnosis of neuroblastic tumors in children: a retrospective study on 83 cases. Pediatric Surgery International, 2017. 33(3): p. 347-353. 19. Flanagan, S.M., E. Rubesova, D. Jaramillo, et al., Fetal suprarenal masses--assessing the complementary role of magnetic resonance and ultrasound for diagnosis. Pediatric radiology, 2016. 46(2): p. 246-54. 20. Jaques, S., Jr., M.C. Tobes and J.C. Sisson, Sodium dependency of uptake of norepinephrine and m-iodobenzylguanidine into cultured human pheochromocytoma cells: evidence for uptake-one. Cancer Research, 1987. 47(15): p. 3920-8. 21. Sharp, S.E., B.L. Shulkin, M.J. Gelfand, et al., 123I-MIBG scintigraphy and 18F-FDG PET in neuroblastoma. Journal of Nuclear Medicine, 2009. 50(8): p. 1237-43. 22. Schmidt, M., T. Simon, B. Hero, et al., The prognostic impact of functional imaging with (123)I-mIBG in patients with stage 4 neuroblastoma >1 year of age on a high-risk treatment protocol: results of the German Neuroblastoma Trial NB97. European Journal of Cancer, 2008. 44(11): p. 1552-8. 23. Stewart, E., S.M. Federico, X. Chen, et al., Orthotopic patient-derived xenografts of paediatric solid tumours. Nature, 2017. advance online publication. 24. Kleis, M., H. Daldrup-Link, K. Matthay, et al., Diagnostic value of PET/CT for the staging and restaging of pediatric tumors. European Journal of Nuclear Medicine and Molecular Imaging, 2009. 36(1): p. 23-36. 25. Kembhavi, S.A., V. Rangarajan, S. Shah, et al., Prospective observational study on diagnostic accuracy of whole-body MRI in solid small round cell tumours. Clinical Radiology, 2014. 69(9): p. 900-8. 26. Taggart, D.R., M.M. Han, A. Quach, et al., Comparison of iodine-123 metaiodobenzylguanidine (MIBG) scan and [18F]fluorodeoxyglucose positron emission tomography to evaluate response after iodine-131 MIBG therapy for relapsed neuroblastoma. Journal of Clinical Oncology, 2009. 27(32): p. 5343-9. 27. Castel, V., P. Garcia-Miguel, A. Canete, et al., Prospective evaluation of the International Neuroblastoma Staging System (INSS) and the International Neuroblastoma Response Criteria (INRC) in a multicentre setting. European Journal of Cancer, 1999. 35(4): p. 606-11. 28. Brodeur, G.M., J. Pritchard, F. Berthold, et al., Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. Journal of Clinical Oncology, 1993. 11(8): p. 1466-77. 29. Smith, E.I., G.M. Haase, R.C. Seeger, et al., A surgical perspective on the current staging in neuroblastoma--the International Neuroblastoma Staging System proposal. Journal of Pediatric Surgery, 1989. 24(4): p. 386-90. 30. Ikeda, H., T. Iehara, Y. Tsuchida, et al., Experience with International Neuroblastoma Staging System and Pathology Classification. British Journal of Cancer, 2002. 86(7): p. 1110-6. 31. Schleiermacher, G., J. Michon, I. Huon, et al., Chromosomal CGH identifies patients with a higher risk of relapse in neuroblastoma without MYCN amplification. British Journal of Cancer, 2007. 97(2): p. 238-46. 32. Fischer, J., A. Pohl, R. Volland, et al., Complete surgical resection improves outcome in INRG high-risk patients with localized neuroblastoma older than 18 months. BMC Cancer, 2017. 17(1): p. 520. 33. Monclair, T., G.M. Brodeur, P.F. Ambros, et al., The International Neuroblastoma Risk Group (INRG) staging system: an INRG Task Force report. Journal of Clinical Oncology, 2009. 27(2): p. 298-303. 34. Monclair, T., V. Mosseri, G. Cecchetto, et al., Influence of image-defined risk factors on the outcome of patients with localised neuroblastoma. A report from the LNESG1

212

study of the European International Society of Paediatric Oncology Neuroblastoma Group. Pediatr Blood Cancer, 2015. 62(9): p. 1536-42. 35. Strenger, V., R. Kerbl, H.J. Dornbusch, et al., Diagnostic and prognostic impact of urinary catecholamines in neuroblastoma patients. Pediatric Blood & Cancer, 2007. 48(5): p. 504-9. 36. Franscini, L.C., M. Vazquez-Montes, T. Buclin, et al., Pediatric reference intervals for plasma free and total metanephrines established with a parametric approach: relevance to the diagnosis of neuroblastoma. Pediatric Blood & Cancer, 2015. 62(4): p. 587-93. 37. Cangemi, G., G. Reggiardo, S. Barco, et al., Prognostic value of ferritin, neuron-specific enolase, lactate dehydrogenase, and urinary and plasmatic catecholamine metabolites in children with neuroblastoma. Onco Targets and Therapy, 2012. 5: p. 417-23. 38. Massaron, S., E. Seregni, R. Luksch, et al., Neuron-specific enolase evaluation in patients with neuroblastoma. Tumour Biology, 1998. 19(4): p. 261-8. 39. Simon, T., B. Hero, D.H. Hunneman, et al., Tumour markers are poor predictors for relapse or progression in neuroblastoma. Eur J Cancer, 2003. 39(13): p. 1899-903. 40. Silber, J.H., A.E. Evans and M. Fridman, Models to predict outcome from childhood neuroblastoma: the role of serum ferritin and tumor histology. Cancer Research, 1991. 51(5): p. 1426-33. 41. Hann, H.W., A.E. Evans, S.E. Siegel, et al., Prognostic importance of serum ferritin in patients with Stages III and IV neuroblastoma: the Childrens Cancer Study Group experience. Cancer Research, 1985. 45(6): p. 2843-8. 42. Shimada, H., J. Chatten, W.A. Newton, Jr., et al., Histopathologic prognostic factors in neuroblastic tumors: definition of subtypes of ganglioneuroblastoma and an age-linked classification of neuroblastomas. Journal of the National Cancer Institute, 1984. 73(2): p. 405-16. 43. George, R.E., A.R. Perez-Atayde, X. Yao, et al., Tumor histology during induction therapy in patients with high-risk neuroblastoma. Pediatr Blood Cancer, 2012. 59(3): p. 506-10. 44. DuBois, S.G., R. Mody, A. Naranjo, et al., MIBG avidity correlates with clinical features, tumor biology, and outcomes in neuroblastoma: A report from the Children's Oncology Group. Pediatric Blood & Cancer, 2017. 64(11). 45. Shimada, H., I.M. Ambros, L.P. Dehner, et al., The International Neuroblastoma Pathology Classification (the Shimada system). Cancer, 1999. 86(2): p. 364-72. 46. Evans, A.E., G.J. D'Angio and J. Randolph, A proposed staging for children with neuroblastoma. Children's cancer study group A. Cancer, 1971. 27(2): p. 374-8. 47. Breslow, N. and B. McCann, Statistical estimation of prognosis for children with neuroblastoma. Cancer Research, 1971. 31(12): p. 2098-103. 48. London, W.B., R.P. Castleberry, K.K. Matthay, et al., Evidence for an age cutoff greater than 365 days for neuroblastoma risk group stratification in the Children's Oncology Group. Journal of Clinical Oncology, 2005. 23(27): p. 6459-65. 49. Schleiermacher, G., V. Mosseri, W.B. London, et al., Segmental chromosomal alterations have prognostic impact in neuroblastoma: a report from the INRG project. British Journal of Cancer, 2012. 107(8): p. 1418-22. 50. Look, A.T., F.A. Hayes, J.J. Shuster, et al., Clinical relevance of tumor cell ploidy and N- myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. Journal of Clinical Oncology, 1991. 9(4): p. 581-91. 51. Defferrari, R., K. Mazzocco, I.M. Ambros, et al., Influence of segmental chromosome abnormalities on survival in children over the age of 12 months with unresectable localised peripheral neuroblastic tumours without MYCN amplification. British Journal of Cancer, 2015. 112(2): p. 290-5.

213

52. Pinto, N., J.R. Mayfield, G. Raca, et al., Segmental Chromosomal Aberrations in Localized Neuroblastoma Can be Detected in Formalin-Fixed Paraffin-Embedded Tissue Samples and Are Associated With Recurrence. Pediatric Blood & Cancer, 2016. 63(6): p. 1019-23. 53. Berbegall, A.P., E. Villamon, I. Tadeo, et al., Neuroblastoma after childhood: prognostic relevance of segmental chromosome aberrations, ATRX protein status, and immune cell infiltration. Neoplasia, 2014. 16(6): p. 471-80. 54. Beltran, H., The N-myc Oncogene: Maximizing its Targets, Regulation, and Therapeutic Potential. Molecular Cancer Research, 2014. 12(6): p. 815-22. 55. Wang, Q., S. Diskin, E. Rappaport, et al., Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number. Cancer Research, 2006. 66(12): p. 6050-62. 56. Attiyeh, E.F., W.B. London, Y.P. Mosse, et al., Chromosome 1p and 11q deletions and outcome in neuroblastoma. New England Journal of Medicine, 2005. 353(21): p. 2243- 53. 57. Caren, H., H. Kryh, M. Nethander, et al., High-risk neuroblastoma tumors with 11q- deletion display a poor prognostic, chromosome instability phenotype with later onset. Proceedings of the National Academy of Sciences of the United States of America, 2010. 107(9): p. 4323-8. 58. Schwab, M., K. Alitalo, K.H. Klempnauer, et al., Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature, 1983. 305(5931): p. 245-8. 59. Brodeur, G.M., R.C. Seeger, M. Schwab, et al., Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science, 1984. 224(4653): p. 1121-4. 60. Wenzel, A., C. Cziepluch, U. Hamann, et al., The N-Myc oncoprotein is associated in vivo with the phosphoprotein Max(p20/22) in human neuroblastoma cells. The EMBO Journal, 1991. 10(12): p. 3703-12. 61. Knoepfler, P.S., P.F. Cheng and R.N. Eisenman, N-myc is essential during neurogenesis for the rapid expansion of progenitor cell populations and the inhibition of neuronal differentiation. Genes & Development, 2002. 16(20): p. 2699-712. 62. Gherardi, S., E. Valli, D. Erriquez, et al., MYCN-mediated transcriptional repression in neuroblastoma: the other side of the coin. Front Oncol, 2013. 3: p. 42. 63. Seeger, R.C., G.M. Brodeur, H. Sather, et al., Association of multiple copies of the N- myc oncogene with rapid progression of neuroblastomas. The New England Journal of Medicine, 1985. 313(18): p. 1111-6. 64. Mathew, P., M.B. Valentine, L.C. Bowman, et al., Detection of MYCN gene amplification in neuroblastoma by fluorescence in situ hybridization: a pediatric oncology group study. Neoplasia, 2001. 3(2): p. 105-9. 65. Frostad, B., T. Martinsson, E. Tani, et al., The use of fine-needle aspiration cytology in the molecular characterization of neuroblastoma in children. Cancer, 1999. 87(2): p. 60-8. 66. Mandelia, A., S. Agarwala, A. Sharma, et al., Assessment of fine needle aspiration cytology samples for molecular genetic analysis in neuroblastoma. Pediatric Surgery International, 2013. 29(11): p. 1131-8. 67. Frostad, B., E. Tani, P. Kogner, et al., The clinical use of fine needle aspiration cytology for diagnosis and management of children with neuroblastic tumours. European Journal of Cancer, 1998. 34(4): p. 529-36. 68. Yue, Z.X., C. Huang, C. Gao, et al., MYCN amplification predicts poor prognosis based on interphase fluorescence in situ hybridization analysis of bone marrow cells in bone marrow metastases of neuroblastoma. Cancer Cell International, 2017. 17: p. 43.

214

69. Raabe, E.H., M. Laudenslager, C. Winter, et al., Prevalence and functional consequence of PHOX2B mutations in neuroblastoma. Oncogene, 2008. 27(4): p. 469-76. 70. Reiff, T., K. Tsarovina, A. Majdazari, et al., Neuroblastoma phox2b variants stimulate proliferation and dedifferentiation of immature sympathetic neurons. The Journal of Neuroscience, 2010. 30(3): p. 905-15. 71. Naftali, O., S. Maman, T. Meshel, et al., PHOX2B is a suppressor of neuroblastoma metastasis. Oncotarget, 2016. 7(9): p. 10627-37. 72. Matthay, K.K., J.M. Maris, G. Schleiermacher, et al., Neuroblastoma. Nature Reviews Disease Primers, 2016. 2: p. 16078. 73. Perez, C.A., K.K. Matthay, J.B. Atkinson, et al., Biologic variables in the outcome of stages I and II neuroblastoma treated with surgery as primary therapy: a children's cancer group study. Journal of Clinical Oncology, 2000. 18(1): p. 18-26. 74. Modak, S., B.H. Kushner, M.P. LaQuaglia, et al., Management and outcome of stage 3 neuroblastoma. European Journal of Cancer, 2009. 45(1): p. 90-8. 75. Rubie, H., C. Coze, D. Plantaz, et al., Localised and unresectable neuroblastoma in infants: excellent outcome with low-dose primary chemotherapy. British Journal of Cancer, 2003. 89(9): p. 1605-9. 76. Irtan, S., H.J. Brisse, V. Minard-Colin, et al., Minimally invasive surgery of neuroblastic tumors in children: Indications depend on anatomical location and image-defined risk factors. Pediatric Blood & Cancer, 2015. 62(2): p. 257-261. 77. Simon, T., B. Haberle, B. Hero, et al., Role of surgery in the treatment of patients with stage 4 neuroblastoma age 18 months or older at diagnosis. Journal of Clinical Oncology, 2013. 31(6): p. 752-8. 78. Castel, V., J.A. Tovar, E. Costa, et al., The role of surgery in stage IV neuroblastoma. Journal of Pediatric Surgery, 2002. 37(11): p. 1574-8. 79. Mullassery, D., P. Farrelly and P.D. Losty, Does aggressive surgical resection improve survival in advanced stage 3 and 4 neuroblastoma? A systematic review and meta- analysis. Pediatric Hematology and Oncology, 2014. 31(8): p. 703-16. 80. Pinto, N.R., M.A. Applebaum, S.L. Volchenboum, et al., Advances in Risk Classification and Treatment Strategies for Neuroblastoma. Journal of Clinical Oncology, 2015. 33(27): p. 3008-17. 81. Frappaz, D., J. Michon, O. Hartmann, et al., Etoposide and carboplatin in neuroblastoma: a French Society of Pediatric Oncology phase II study. Journal of Clinical Oncology, 1992. 10(10): p. 1592-601. 82. Ladenstein, R., D. Valteau-Couanet, P. Brock, et al., Randomized Trial of prophylactic granulocyte colony-stimulating factor during rapid COJEC induction in pediatric patients with high-risk neuroblastoma: the European HR-NBL1/SIOPEN study. Journal of Clinical Oncology, 2010. 28(21): p. 3516-24. 83. George, R.E., S. Li, C. Medeiros-Nancarrow, et al., High-risk neuroblastoma treated with tandem autologous peripheral-blood stem cell-supported transplantation: long- term survival update. Journal of Clinical Oncology, 2006. 24(18): p. 2891-6. 84. Grimaldi, K.A., S.R. McAdam, R.L. Souhami, et al., DNA damage by anti-cancer agents resolved at the nucleotide level of a single copy gene: evidence for a novel binding site for cisplatin in cells. Nucleic Acids Research, 1994. 22(12): p. 2311-7. 85. Knox, R.J., F. Friedlos, D.A. Lydall, et al., Mechanism of cytotoxicity of anticancer platinum drugs: evidence that cis-diamminedichloroplatinum(II) and cis-diammine- (1,1-cyclobutanedicarboxylato)platinum(II) differ only in the kinetics of their interaction with DNA. Cancer Research, 1986. 46(4 Pt 2): p. 1972-9. 86. Moufarij, M.A., D.R. Phillips and C. Cullinane, Gemcitabine potentiates cisplatin cytotoxicity and inhibits repair of cisplatin-DNA damage in ovarian cancer cell lines. Molecular Pharmacology, 2003. 63(4): p. 862-9.

215

87. Gonzalez, V.M., M.A. Fuertes, C. Alonso, et al., Is cisplatin-induced cell death always produced by apoptosis? Molecular Pharmacology, 2001. 59(4): p. 657-63. 88. Wang, J.Y., G. Prorok and W.P. Vaughan, Cytotoxicity, DNA cross-linking, and DNA single-strand breaks induced by cyclophosphamide in a rat leukemia in vivo. Cancer Chemotherapy and Pharmacology, 1993. 31(5): p. 381-6. 89. Mazur, L., A. Augustynek, A. Deptala, et al., Effects of WR-2721 and cyclophosphamide on the cell cycle phase specificity of apoptosis in mouse bone marrow. Anti-cancer Drugs, 2002. 13(7): p. 751-8. 90. Ashour, M.E., R. Atteya and S.F. El-Khamisy, Topoisomerase-mediated chromosomal break repair: an emerging player in many games. Nature Reviews Cancer, 2015. 15: p. 137. 91. Tammaro, M., P. Barr, B. Ricci, et al., Replication-dependent and transcription- dependent mechanisms of DNA double-strand break induction by the topoisomerase 2-targeting drug etoposide. PLoS One, 2013. 8(11): p. e79202. 92. Wozniak, A.J. and W.E. Ross, DNA damage as a basis for 4'- demethylepipodophyllotoxin-9-(4,6-O-ethylidene-beta-D-glucopyranoside) (etoposide) cytotoxicity. Cancer Research, 1983. 43(1): p. 120-4. 93. Wassermann, K., J. Markovits, C. Jaxel, et al., Effects of morpholinyl doxorubicins, doxorubicin, and actinomycin D on mammalian DNA topoisomerases I and II. Molecular Pharmacology, 1990. 38(1): p. 38-45. 94. Tewey, K.M., T.C. Rowe, L. Yang, et al., Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science, 1984. 226(4673): p. 466-8. 95. Swift, L.P., A. Rephaeli, A. Nudelman, et al., Doxorubicin-DNA adducts induce a non- topoisomerase II-mediated form of cell death. Cancer Research, 2006. 66(9): p. 4863- 71. 96. Lobert, S., B. Vulevic and J.J. Correia, Interaction of vinca alkaloids with tubulin: a comparison of vinblastine, vincristine, and vinorelbine. Biochemistry, 1996. 35(21): p. 6806-14. 97. Jordan, M.A., D. Thrower and L. Wilson, Mechanism of inhibition of cell proliferation by Vinca alkaloids. Cancer Research, 1991. 51(8): p. 2212-22. 98. Kothari, A., W.N. Hittelman and T.C. Chambers, Cell Cycle-Dependent Mechanisms Underlie Vincristine-Induced Death of Primary Acute Lymphoblastic Leukemia Cells. Cancer Research, 2016. 76(12): p. 3553-61. 99. Singh, A., M.C. Zapata, Y.S. Choi, et al., GSI promotes vincristine-induced apoptosis by enhancing multi-polar spindle formation. Cell Cycle, 2014. 13(1): p. 157-66. 100. Berthold, F., J. Boos, S. Burdach, et al., Myeloablative megatherapy with autologous stem-cell rescue versus oral maintenance chemotherapy as consolidation treatment in patients with high-risk neuroblastoma: a randomised controlled trial. The Lancet Oncology, 2005. 6(9): p. 649-58. 101. Kreissman, S.G., R.C. Seeger, K.K. Matthay, et al., Purged versus non-purged peripheral blood stem-cell transplantation for high-risk neuroblastoma (COG A3973): a randomised phase 3 trial. The Lancet Oncology, 2013. 14(10): p. 999-1008. 102. Episkopou, H., S.A. Kyrtopoulos, P.P. Sfikakis, et al., Association between transcriptional activity, local chromatin structure, and the efficiencies of both subpathways of nucleotide excision repair of melphalan adducts. Cancer Research, 2009. 69(10): p. 4424-33. 103. Hansson, J., K. Berhane, V.M. Castro, et al., Sensitization of human melanoma cells to the cytotoxic effect of melphalan by the glutathione transferase inhibitor ethacrynic acid. Cancer Research, 1991. 51(1): p. 94-8.

216

104. French, S., S.G. DuBois, B. Horn, et al., 131I-MIBG followed by consolidation with busulfan, melphalan and autologous stem cell transplantation for refractory neuroblastoma. Pediatric Blood & Cancer, 2013. 60(5): p. 879-84. 105. Valdez, B.C., D. Murray, Y. Nieto, et al., Synergistic cytotoxicity of the DNA alkylating agent busulfan, nucleoside analogs and suberoylanilide hydroxamic acid in lymphoma cell lines. Leukemia & Lymphoma, 2012. 53(5): p. 973-81. 106. Iwamoto, T., Y. Hiraku, S. Oikawa, et al., DNA intrastrand cross-link at the 5'-GA-3' sequence formed by busulfan and its role in the cytotoxic effect. Cancer Science, 2004. 95(5): p. 454-8. 107. Dubois, S.G., E. Geier, V. Batra, et al., Evaluation of Norepinephrine Transporter Expression and Metaiodobenzylguanidine Avidity in Neuroblastoma: A Report from the Children's Oncology Group. International Journal of Molecular Imaging, 2012. 2012: p. 250834. 108. Haas-Kogan, D.A., P.S. Swift, M. Selch, et al., Impact of radiotherapy for high-risk neuroblastoma: a Children's Cancer Group study. International Journal of Radiation Oncology, Biology, Physics, 2003. 56(1): p. 28-39. 109. Miano, M., A. Garaventa, M.R. Pizzitola, et al., Megatherapy combining I(131) metaiodobenzylguanidine and high-dose chemotherapy with haematopoietic progenitor cell rescue for neuroblastoma. Bone Marrow Transplantation, 2001. 27(6): p. 571-4. 110. Yanik, G.A., J.G. Villablanca, J.M. Maris, et al., 131I-metaiodobenzylguanidine with intensive chemotherapy and autologous stem cell transplantation for high-risk neuroblastoma. A new approaches to neuroblastoma therapy (NANT) phase II study. Biology of Blood and Marrow Transplantation, 2015. 21(4): p. 673-81. 111. Gains, J.E., J.B. Bomanji, N.L. Fersht, et al., 177Lu-DOTATATE molecular radiotherapy for childhood neuroblastoma. Journal of Nuclear Medicine, 2011. 52(7): p. 1041-7. 112. Pearson, A.D., C.R. Pinkerton, I.J. Lewis, et al., High-dose rapid and standard induction chemotherapy for patients aged over 1 year with stage 4 neuroblastoma: a randomised trial. The Lancet Oncology, 2008. 9(3): p. 247-56. 113. Matthay, K.K., J.G. Villablanca, R.C. Seeger, et al., Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. Children's Cancer Group. New England Journal of Medicine, 1999. 341(16): p. 1165-73. 114. Philip, T., R. Ladenstein, J.M. Zucker, et al., Double megatherapy and autologous bone marrow transplantation for advanced neuroblastoma: the LMCE2 study. British Journal of Cancer, 1993. 67(1): p. 119-27. 115. Kletzel, M., H.M. Katzenstein, P.R. Haut, et al., Treatment of high-risk neuroblastoma with triple-tandem high-dose therapy and stem-cell rescue: results of the Chicago Pilot II Study. Journal of Clinical Oncology, 2002. 20(9): p. 2284-92. 116. Sidell, N., Retinoic acid-induced growth inhibition and morphologic differentiation of human neuroblastoma cells in vitro. Journal of the National Cancer Institute, 1982. 68(4): p. 589-96. 117. Khan, A.A., J.G. Villablanca, C.P. Reynolds, et al., Pharmacokinetic studies of 13-cis- retinoic acid in pediatric patients with neuroblastoma following bone marrow transplantation. Cancer Chemotherapeutics Pharmacology, 1996. 39(1-2): p. 34-41. 118. Cheung, N.K., I.Y. Cheung, B.H. Kushner, et al., Murine anti-GD2 monoclonal antibody 3F8 combined with granulocyte-macrophage colony-stimulating factor and 13-cis- retinoic acid in high-risk patients with stage 4 neuroblastoma in first remission. Journal of Clinical Oncology, 2012. 30(26): p. 3264-70.

217

119. Ring, E.K., J.M. Markert, G.Y. Gillespie, et al., Checkpoint Proteins in Pediatric Brain and Extracranial Solid Tumors: Opportunities for Immunotherapy. Clinical Cancer Research, 2017. 23(2): p. 342-350. 120. Suzuki, M., K.J. Curran and N.K. Cheung, Chimeric antigen receptors and bispecific antibodies to retarget T cells in pediatric oncology. Pediatric Blood & Cancer, 2015. 62(8): p. 1326-36. 121. Schulz, G., D.A. Cheresh, N.M. Varki, et al., Detection of ganglioside GD2 in tumor tissues and sera of neuroblastoma patients. Cancer Research, 1984. 44(12 Pt 1): p. 5914-20. 122. Mackall, C.L., M.S. Merchant and T.J. Fry, Immune-based therapies for childhood cancer. Nature Reviews. Clinical Oncology, 2014. 11(12): p. 693-703. 123. Mody, R., A. Naranjo, C. Van Ryn, et al., Irinotecan-temozolomide with temsirolimus or dinutuximab in children with refractory or relapsed neuroblastoma (COG ANBL1221): an open-label, randomised, phase 2 trial. Lancet Oncology, 2017. 18(7): p. 946-957. 124. Yu, A.L., A.L. Gilman, M.F. Ozkaynak, et al., Anti-GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. The New England Journal of Medicine, 2010. 363(14): p. 1324-34. 125. Dinutuximab approved for high-risk neuroblastoma. Cancer Discovery, 2015. 5(6): p. OF5. 126. Ploessl, C., A. Pan, K.T. Maples, et al., Dinutuximab: An Anti-GD2 Monoclonal Antibody for High-Risk Neuroblastoma. Annals of Pharmacotherapy, 2016. 50(5): p. 416-22. 127. Kushner, B.H., I.Y. Cheung, S. Modak, et al., Phase I trial of a bivalent gangliosides vaccine in combination with beta-glucan for high-risk neuroblastoma in second or later remission. Clinical Cancer Research, 2014. 20(5): p. 1375-82. 128. Bagatell, R., W.B. London, L.M. Wagner, et al., Phase II study of irinotecan and temozolomide in children with relapsed or refractory neuroblastoma: a Children's Oncology Group study. Journal of Clinical Oncology, 2011. 29(2): p. 208-13. 129. Di Giannatale, A., N. Dias-Gastellier, A. Devos, et al., Phase II study of temozolomide in combination with topotecan (TOTEM) in relapsed or refractory neuroblastoma: a European Innovative Therapies for Children with Cancer-SIOP-European Neuroblastoma study. European Journal of Cancer, 2014. 50(1): p. 170-7. 130. Subramanian, D., E. Kraut, A. Staubus, et al., Analysis of topoisomerase I/DNA complexes in patients administered topotecan. Cancer Research, 1995. 55(10): p. 2097-103. 131. Tanizawa, A., A. Fujimori, Y. Fujimori, et al., Comparison of topoisomerase I inhibition, DNA damage, and cytotoxicity of camptothecin derivatives presently in clinical trials. Journal of the National Cancer Institute, 1994. 86(11): p. 836-42. 132. Kushner, B.H., N.K. Cheung, M.P. LaQuaglia, et al., Survival from locally invasive or widespread neuroblastoma without cytotoxic therapy. Journal of Clinical Oncology, 1996. 14(2): p. 373-81. 133. Moreno, L., S.J. Vaidya, C.R. Pinkerton, et al., Long-term follow-up of children with high-risk neuroblastoma: the ENSG5 trial experience. Pediatric Blood & Cancer, 2013. 60(7): p. 1135-40. 134. Kushner, B.H., K. Kramer, M.P. LaQuaglia, et al., Reduction from seven to five cycles of intensive induction chemotherapy in children with high-risk neuroblastoma. Journal of Clinical Oncology, 2004. 22(24): p. 4888-92. 135. Holtta, P., S. Alaluusua, U.M. Saarinen-Pihkala, et al., Long-term adverse effects on dentition in children with poor-risk neuroblastoma treated with high-dose chemotherapy and autologous stem cell transplantation with or without total body irradiation. Bone Marrow Transplantation, 2002. 29(2): p. 121-7.

218

136. Sung, K.W., M.H. Son, S.H. Lee, et al., Tandem high-dose chemotherapy and autologous stem cell transplantation in patients with high-risk neuroblastoma: results of SMC NB-2004 study. Bone Marrow Transplantation, 2013. 48(1): p. 68-73. 137. Mosse, Y.P., M. Laudenslager, L. Longo, et al., Identification of ALK as a major familial neuroblastoma predisposition gene. Nature, 2008. 455(7215): p. 930-5. 138. Bresler, S.C., D.A. Weiser, P.J. Huwe, et al., ALK mutations confer differential oncogenic activation and sensitivity to ALK inhibition therapy in neuroblastoma. Cancer Cell, 2014. 26(5): p. 682-94. 139. Janoueix-Lerosey, I., D. Lequin, L. Brugieres, et al., Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma. Nature, 2008. 455(7215): p. 967-70. 140. Chen, Y., J. Takita, Y.L. Choi, et al., Oncogenic mutations of ALK kinase in neuroblastoma. Nature, 2008. 455(7215): p. 971-4. 141. George, R.E., T. Sanda, M. Hanna, et al., Activating mutations in ALK provide a therapeutic target in neuroblastoma. Nature, 2008. 455(7215): p. 975-8. 142. Kramer, M., D. Ribeiro, M. Arsenian-Henriksson, et al., Proliferation and Survival of Embryonic Sympathetic Neuroblasts by MYCN and Activated ALK Signaling. The Journal of Neuroscience 2016. 36(40): p. 10425-10439. 143. Ueda, T., Y. Nakata, N. Yamasaki, et al., ALK(R1275Q) perturbs extracellular matrix, enhances cell invasion and leads to the development of neuroblastoma in cooperation with MYCN. Oncogene, 2016. 35(34): p. 4447-58. 144. Tucker, E.R., L.S. Danielson, P. Innocenti, et al., Tackling Crizotinib Resistance: The Pathway from Drug Discovery to the Pediatric Clinic. Cancer Research, 2015. 75(14): p. 2770-4. 145. Mosse, Y.P., M.S. Lim, S.D. Voss, et al., Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: a Children's Oncology Group phase 1 consortium study. Lancet Oncology, 2013. 14(6): p. 472-80. 146. Gandhi, L. and P.A. Janne, Crizotinib for ALK-rearranged non-small cell lung cancer: a new targeted therapy for a new target. Clinical Cancer Research, 2012. 18(14): p. 3737- 42. 147. Wang, H.Q., E. Halilovic, X. Li, et al., Combined ALK and MDM2 inhibition increases antitumor activity and overcomes resistance in human ALK mutant neuroblastoma cell lines and xenograft models. Elife, 2017. 6. 148. Infarinato, N.R., J.H. Park, K. Krytska, et al., The ALK/ROS1 Inhibitor PF-06463922 Overcomes Primary Resistance to Crizotinib in ALK-Driven Neuroblastoma. Cancer Discovery, 2016. 6(1): p. 96-107. 149. McDermott, U., A.J. Iafrate, N.S. Gray, et al., Genomic alterations of anaplastic lymphoma kinase may sensitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Research, 2008. 68(9): p. 3389-95. 150. Krytska, K., H.T. Ryles, R. Sano, et al., Crizotinib Synergizes with Chemotherapy in Preclinical Models of Neuroblastoma. Clinical Cancer Research, 2016. 22(4): p. 948-60. 151. Tang, S.C., L.N. Nguyen, R.W. Sparidans, et al., Increased oral availability and brain accumulation of the ALK inhibitor crizotinib by coadministration of the P-glycoprotein (ABCB1) and breast cancer resistance protein (ABCG2) inhibitor elacridar. International Journal of Cancer, 2014. 134(6): p. 1484-94. 152. Wood, A.C., K. Krytska, H.T. Ryles, et al., Dual ALK and CDK4/6 Inhibition Demonstrates Synergy against Neuroblastoma. Clinical Cancer Research, 2017. 23(11): p. 2856-2868. 153. Moley, J.F., M.B. Brother, S.A. Wells, et al., Low frequency of ras gene mutations in neuroblastomas, pheochromocytomas, and medullary thyroid cancers. Cancer Research, 1991. 51(6): p. 1596-9.

219

154. Roberts, P.J. and C.J. Der, Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene, 2007. 26(22): p. 3291-310. 155. Yaari, S., J. Jacob-Hirsch, N. Amariglio, et al., Disruption of cooperation between Ras and MycN in human neuroblastoma cells promotes growth arrest. Clinical Cancer Research, 2005. 11(12): p. 4321-30. 156. Moller, M.B., P27 in cell cycle control and cancer. Leukemia & Lymphoma, 2000. 39(1- 2): p. 19-27. 157. Hua, Z., X. Gu, Y. Dong, et al., PI3K and MAPK pathways mediate the BDNF/TrkB- increased metastasis in neuroblastoma. Tumour Biology, 2016. 158. Kiessling, M.K., A. Curioni-Fontecedro, P. Samaras, et al., Targeting the mTOR Complex by Everolimus in NRAS Mutant Neuroblastoma. PLoS One, 2016. 11(1): p. e0147682. 159. Tanaka, T., M. Higashi, K. Kimura, et al., MEK inhibitors as a novel therapy for neuroblastoma: Their in vitro effects and predicting their efficacy. J Pediatr Surg, 2016. 51(12): p. 2074-2079. 160. Vujic, I., M. Sanlorenzo, C. Posch, et al., Metformin and trametinib have synergistic effects on cell viability and tumor growth in NRAS mutant cancer. Oncotarget, 2015. 6(2): p. 969-78. 161. Woodfield, S.E., L. Zhang, K.A. Scorsone, et al., Binimetinib inhibits MEK and is effective against neuroblastoma tumor cells with low NF1 expression. BMC Cancer, 2016. 16: p. 172. 162. Hart, L.S., J. Rader, P. Raman, et al., Preclinical Therapeutic Synergy of MEK1/2 and CDK4/6 Inhibition in Neuroblastoma. Clinical Cancer Research, 2017. 23(7): p. 1785- 1796. 163. Molenaar, J.J., M.E. Ebus, D. Geerts, et al., Inactivation of CDK2 is synthetically lethal to MYCN over-expressing cancer cells. Proceedings of the National Academy of Sciences of the United States of America, 2009. 106(31): p. 12968-73. 164. Dolman, M.E., E. Poon, M.E. Ebus, et al., Cyclin-Dependent Kinase Inhibitor AT7519 as a Potential Drug for MYCN-Dependent Neuroblastoma. Clinical Cancer Research, 2015. 21(22): p. 5100-9. 165. Chen, Z., Z. Wang, J.C. Pang, et al., Multiple CDK inhibitor dinaciclib suppresses neuroblastoma growth via inhibiting CDK2 and CDK9 activity. Scientific Reports, 2016. 6: p. 29090. 166. Sherr, C.J., D. Beach and G.I. Shapiro, Targeting CDK4 and CDK6: From Discovery to Therapy. Cancer Discovery, 2016. 6(4): p. 353-67. 167. Tweddle, D.A., A.J. Malcolm, N. Bown, et al., Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line. Cancer Research, 2001. 61(1): p. 8-13. 168. Carr-Wilkinson, J., K. O'Toole, K.M. Wood, et al., High Frequency of p53/MDM2/p14ARF Pathway Abnormalities in Relapsed Neuroblastoma. Clinical Cancer Research, 2010. 16(4): p. 1108-18. 169. Pflaum, J., S. Schlosser and M. Muller, p53 Family and Cellular Stress Responses in Cancer. Frontiers in Oncology, 2014. 4: p. 285. 170. McKenzie, P.P., S.M. Guichard, D.S. Middlemas, et al., Wild-type p53 can induce p21 and apoptosis in neuroblastoma cells but the DNA damage-induced G1 checkpoint function is attenuated. Clinical Cancer Research, 1999. 5(12): p. 4199-207. 171. Rihani, A., A. Van Goethem, M. Ongenaert, et al., Genome wide expression profiling of p53 regulated miRNAs in neuroblastoma. Scientific Reports, 2015. 5: p. 9027. 172. Chen, L., N. Iraci, S. Gherardi, et al., p53 is a direct transcriptional target of MYCN in neuroblastoma. Cancer Research, 2010. 70(4): p. 1377-88. 173. Di Micco, R., M. Fumagalli, A. Cicalese, et al., Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature, 2006. 444: p. 638.

220

174. Petroni, M., V. Veschi, A. Gulino, et al., Molecular mechanisms of MYCN-dependent apoptosis and the MDM2-p53 pathway: an Achille's heel to be exploited for the therapy of MYCN-amplified neuroblastoma. Frontiers in Oncology, 2012. 2: p. 141. 175. Slack, A., Z. Chen, R. Tonelli, et al., The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in neuroblastoma. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(3): p. 731-6. 176. He, J., L. Gu, H. Zhang, et al., Crosstalk between MYCN and MDM2-p53 signal pathways regulates tumor cell growth and apoptosis in neuroblastoma. Cell Cycle, 2011. 10(17): p. 2994-3002. 177. Patterson, D.M., D. Gao, D.N. Trahan, et al., Effect of MDM2 and vascular endothelial growth factor inhibition on tumor angiogenesis and metastasis in neuroblastoma. Angiogenesis, 2011. 14(3): p. 255-66. 178. Chen, L., R.F. Rousseau, S.A. Middleton, et al., Pre-clinical evaluation of the MDM2-p53 antagonist RG7388 alone and in combination with chemotherapy in neuroblastoma. Oncotarget, 2015. 6(12): p. 10207-21. 179. Opel, D., C. Poremba, T. Simon, et al., Activation of Akt predicts poor outcome in neuroblastoma. Cancer Research, 2007. 67(2): p. 735-45. 180. Dibble, C.C. and L.C. Cantley, Regulation of mTORC1 by PI3K signaling. Trends in Cell Biology, 2015. 25(9): p. 545-55. 181. Hahn-Windgassen, A., V. Nogueira, C.C. Chen, et al., Akt activates the mammalian target of rapamycin by regulating cellular ATP level and AMPK activity. The Journal of Biological Chemistry, 2005. 280(37): p. 32081-9. 182. Kang, J., P.G. Rychahou, T.A. Ishola, et al., N-myc is a novel regulator of PI3K-mediated VEGF expression in neuroblastoma. Oncogene, 2008. 27(28): p. 3999-4007. 183. Kenney, A.M., H.R. Widlund and D.H. Rowitch, Hedgehog and PI-3 kinase signaling converge on Nmyc1 to promote cell cycle progression in cerebellar neuronal precursors. Development, 2004. 131(1): p. 217-28. 184. Weiss, W.A., K. Aldape, G. Mohapatra, et al., Targeted expression of MYCN causes neuroblastoma in transgenic mice. The EMBO Journal, 1997. 16(11): p. 2985-95. 185. Howell, J.J., S.J. Ricoult, I. Ben-Sahra, et al., A growing role for mTOR in promoting anabolic metabolism. Biochemical Society Transactions, 2013. 41(4): p. 906-12. 186. Johnsen, J.I., L. Segerstrom, A. Orrego, et al., Inhibitors of mammalian target of rapamycin downregulate MYCN protein expression and inhibit neuroblastoma growth in vitro and in vivo. Oncogene, 2008. 27(20): p. 2910-22. 187. Castelletti, D., G. Fiaschetti, V. Di Dato, et al., The quassinoid derivative NBT-272 targets both the AKT and ERK signaling pathways in embryonal tumors. Molecular Cancer Therapeutics, 2010. 9(12): p. 3145-57. 188. Chesler, L., C. Schlieve, D.D. Goldenberg, et al., Inhibition of phosphatidylinositol 3- kinase destabilizes Mycn protein and blocks malignant progression in neuroblastoma. Cancer Research, 2006. 66(16): p. 8139-46. 189. Bender, A., D. Opel, I. Naumann, et al., PI3K inhibitors prime neuroblastoma cells for chemotherapy by shifting the balance towards pro-apoptotic Bcl-2 proteins and enhanced mitochondrial apoptosis. Oncogene, 2011. 30(4): p. 494-503. 190. Li, Z., S. Yan, N. Attayan, et al., Combination of an allosteric Akt Inhibitor MK-2206 with etoposide or rapamycin enhances the antitumor growth effect in neuroblastoma. Clinical Cancer Research, 2012. 18(13): p. 3603-15. 191. Zhang, H., J. Dou, Y. Yu, et al., mTOR ATP-competitive inhibitor INK128 inhibits neuroblastoma growth via blocking mTORC signaling. Apoptosis, 2015. 20(1): p. 50-62. 192. Fouladi, M., J.P. Perentesis, C.L. Phillips, et al., A phase I trial of MK-2206 in children with refractory malignancies: a Children's Oncology Group study. Pediatric Blood & Cancer, 2014. 61(7): p. 1246-51.

221

193. Becher, O.J., S.W. Gilheeney, Y. Khakoo, et al., A phase I study of perifosine with temsirolimus for recurrent pediatric solid tumors. Pediatric Blood & Cancer, 2017. 64(7). 194. Alaminos, M., J. Mora, N.K. Cheung, et al., Genome-wide analysis of gene expression associated with MYCN in human neuroblastoma. Cancer Research, 2003. 63(15): p. 4538-46. 195. Huang, M. and W.A. Weiss, Neuroblastoma and MYCN. Cold Spring Harb Perspect Med, 2013. 3(10): p. a014415. 196. Chan, H.S., B.L. Gallie, G. DeBoer, et al., MYCN protein expression as a predictor of neuroblastoma prognosis. Clinical Cancer Research, 1997. 3(10): p. 1699-706. 197. Bordow, S.B., M.D. Norris, P.S. Haber, et al., Prognostic significance of MYCN oncogene expression in childhood neuroblastoma. Journal of Clinical Oncology, 1998. 16(10): p. 3286-94. 198. Otto, T., S. Horn, M. Brockmann, et al., Stabilization of N-Myc is a critical function of Aurora A in human neuroblastoma. Cancer Cell, 2009. 15(1): p. 67-78. 199. Brockmann, M., E. Poon, T. Berry, et al., Small molecule inhibitors of aurora-a induce proteasomal degradation of N-myc in childhood neuroblastoma. Cancer Cell, 2013. 24(1): p. 75-89. 200. Barone, G., J. Anderson, A.D. Pearson, et al., New strategies in neuroblastoma: Therapeutic targeting of MYCN and ALK. Clinical Cancer Research, 2013. 19(21): p. 5814-21. 201. Muller, I., K. Larsson, A. Frenzel, et al., Targeting of the MYCN protein with small molecule c-MYC inhibitors. PLoS One, 2014. 9(5): p. e97285. 202. Fredlund, E., M. Ringner, J.M. Maris, et al., High Myc pathway activity and low stage of neuronal differentiation associate with poor outcome in neuroblastoma. Proceedings of the National Academy of Sciences of the United States of America 2008. 105(37): p. 14094-9. 203. Valentijn, L.J., J. Koster, F. Haneveld, et al., Functional MYCN signature predicts outcome of neuroblastoma irrespective of MYCN amplification. Proceedings of the National Academy of Sciences of the United States of America, 2012. 109(47): p. 19190-5. 204. Jung, M., A.J. Russell, B. Liu, et al., A Myc Activity Signature Predicts Poor Clinical Outcomes in Myc-Associated Cancers. Cancer Research, 2017. 77(4): p. 971-981. 205. Vita, M. and M. Henriksson, The Myc oncoprotein as a therapeutic target for human cancer. Seminars in Cancer Biology, 2006. 16(4): p. 318-30. 206. Dang, C.V., A. Le and P. Gao, MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clinical Cancer Research, 2009. 15(21): p. 6479-83. 207. van Riggelen, J., A. Yetil and D.W. Felsher, MYC as a regulator of ribosome biogenesis and protein synthesis. Nature Reviews Cancer, 2010. 10(4): p. 301-9. 208. Westermann, F., D. Muth, A. Benner, et al., Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas. Genome Biology, 2008. 9(10): p. R150. 209. Olsen, R.R., J.H. Otero, J. Garcia-Lopez, et al., MYCN induces neuroblastoma in primary neural crest cells. Oncogene, 2017. 36(35): p. 5075-5082. 210. Murphy, D.M., P.G. Buckley, K. Bryan, et al., Dissection of the oncogenic MYCN transcriptional network reveals a large set of clinically relevant cell cycle genes as drivers of neuroblastoma tumorigenesis. Molecular Carcinogenesis, 2011. 50(6): p. 403-11. 211. Bell, E., J. Lunec and D.A. Tweddle, Cell cycle regulation targets of MYCN identified by gene expression microarrays. Cell Cycle, 2007. 6(10): p. 1249-56.

222

212. Woo, C.W., F. Tan, H. Cassano, et al., Use of RNA interference to elucidate the effect of MYCN on cell cycle in neuroblastoma. Pediatric Blood & Cancer, 2008. 50(2): p. 208-12. 213. Huang, R., N.K. Cheung, J. Vider, et al., MYCN and MYC regulate tumor proliferation and tumorigenesis directly through BMI1 in human neuroblastomas. FASEB Journal, 2011. 25(12): p. 4138-49. 214. Fidler, I.J., The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited. Nature Reviews Cancer, 2003. 3: p. 453. 215. Tanaka, N. and M. Fukuzawa, MYCN downregulates integrin alpha1 to promote invasion of human neuroblastoma cells. International Journal of Oncology, 2008. 33(4): p. 815-21. 216. Fabian, J., D. Opitz, K. Althoff, et al., MYCN and HDAC5 transcriptionally repress CD9 to trigger invasion and metastasis in neuroblastoma. Oncotarget, 2016. 7(41): p. 66344- 66359. 217. Ambrosio, S., S. Amente, C.D. Sacca, et al., LSD1 mediates MYCN control of epithelial- mesenchymal transition through silencing of metastatic suppressor NDRG1 gene. Oncotarget, 2017. 8(3): p. 3854-3869. 218. Nair, S.K. and S.K. Burley, X-ray structures of Myc-Max and Mad-Max recognizing DNA. Molecular bases of regulation by proto-oncogenic transcription factors. Cell, 2003. 112(2): p. 193-205. 219. Jin, L., W. Wang and G. Fang, Targeting protein-protein interaction by small molecules. Annual Review of Pharmacology and Toxicology, 2014. 54: p. 435-56. 220. Yin, X., C. Giap, J.S. Lazo, et al., Low molecular weight inhibitors of Myc-Max interaction and function. Oncogene, 2003. 22(40): p. 6151-9. 221. Guo, J., R.A. Parise, E. Joseph, et al., Efficacy, pharmacokinetics, tisssue distribution, and metabolism of the Myc-Max disruptor, 10058-F4 [Z,E]-5-[4-ethylbenzylidine]-2- thioxothiazolidin-4-one, in mice. Cancer Chemotherapy and Pharmacology, 2009. 63(4): p. 615-25. 222. Puissant, A., S.M. Frumm, G. Alexe, et al., Targeting MYCN in neuroblastoma by BET bromodomain inhibition. Cancer Discovery, 2013. 3(3): p. 308-23. 223. Filippakopoulos, P., J. Qi, S. Picaud, et al., Selective inhibition of BET bromodomains. Nature, 2010. 468(7327): p. 1067-73. 224. Wyce, A., G. Ganji, K.N. Smitheman, et al., BET inhibition silences expression of MYCN and BCL2 and induces cytotoxicity in neuroblastoma tumor models. PLoS One, 2013. 8(8): p. e72967. 225. Henssen, A., K. Althoff, A. Odersky, et al., Targeting MYCN-Driven Transcription By BET- Bromodomain Inhibition. Clinical Cancer Research, 2016. 22(10): p. 2470-81. 226. Carter, D.R., J. Murray, B.B. Cheung, et al., Therapeutic targeting of the MYC signal by inhibition of histone chaperone FACT in neuroblastoma. Science Translational Medicine, 2015. 7(312): p. 312ra176. 227. Gasparian, A.V., C.A. Burkhart, A.A. Purmal, et al., Curaxins: anticancer compounds that simultaneously suppress NF-kappaB and activate p53 by targeting FACT. Science Translational Medicine, 2011. 3(95): p. 95ra74. 228. Gustafson, W.C., J.G. Meyerowitz, E.A. Nekritz, et al., Drugging MYCN through an allosteric transition in Aurora kinase A. Cancer Cell, 2014. 26(3): p. 414-427. 229. Bogen, D., J.S. Wei, D.O. Azorsa, et al., Aurora B kinase is a potent and selective target in MYCN-driven neuroblastoma. Oncotarget, 2015. 6(34): p. 35247-62. 230. Mosse, Y.P., E. Lipsitz, E. Fox, et al., Pediatric phase I trial and pharmacokinetic study of MLN8237, an investigational oral selective small-molecule inhibitor of Aurora kinase A: a Children's Oncology Group Phase I Consortium study. Clinical Cancer Research, 2012. 18(21): p. 6058-64.

223

231. DuBois, S.G., A. Marachelian, E. Fox, et al., Phase I Study of the Aurora A Kinase Inhibitor Alisertib in Combination With Irinotecan and Temozolomide for Patients With Relapsed or Refractory Neuroblastoma: A NANT (New Approaches to Neuroblastoma Therapy) Trial. Journal of Clinical Oncology, 2016. 34(12): p. 1368-75. 232. Hogarty, M.D., M.D. Norris, K. Davis, et al., ODC1 is a critical determinant of MYCN oncogenesis and a therapeutic target in neuroblastoma. Cancer Research, 2008. 68(23): p. 9735-45. 233. Qing, G., B. Li, A. Vu, et al., ATF4 regulates MYC-mediated neuroblastoma cell death upon glutamine deprivation. Cancer Cell, 2012. 22(5): p. 631-44. 234. Gan, L., R. Xiu, P. Ren, et al., Metabolic targeting of oncogene MYC by selective activation of the proton-coupled monocarboxylate family of transporters. Oncogene, 2016. 35(23): p. 3037-48. 235. Cliff, T.S., T. Wu, B.R. Boward, et al., MYC Controls Human Pluripotent Stem Cell Fate Decisions through Regulation of Metabolic Flux. Cell Stem Cell, 2017. 21(4): p. 502-516 e9. 236. Wise, D.R., R.J. DeBerardinis, A. Mancuso, et al., Myc regulates a transcriptional program that stimulates mitochondrial glutaminolysis and leads to glutamine addiction. Proceedings of the National Academy of Sciences of the United States of America, 2008. 105(48): p. 18782-7. 237. Xiao, D., P. Ren, H. Su, et al., Myc promotes glutaminolysis in human neuroblastoma through direct activation of glutaminase 2. Oncotarget, 2015. 6(38): p. 40655-66. 238. Hsieh, A.L., Z.E. Walton, B.J. Altman, et al., MYC and metabolism on the path to cancer. Seminars in Cell & Developmental Biology 2015. 43: p. 11-21. 239. Chen, Q.R., Y.K. Song, L.R. Yu, et al., Global genomic and proteomic analysis identifies biological pathways related to high-risk neuroblastoma. Journal of Proteome Research, 2010. 9(1): p. 373-82. 240. Carroll, P.A., D. Diolaiti, L. McFerrin, et al., Deregulated Myc requires MondoA/Mlx for metabolic reprogramming and tumorigenesis. Cancer Cell, 2015. 27(2): p. 271-85. 241. Zirath, H., A. Frenzel, G. Oliynyk, et al., MYC inhibition induces metabolic changes leading to accumulation of lipid droplets in tumor cells. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(25): p. 10258-63. 242. Ji, H., G. Wu, X. Zhan, et al., Cell-type independent MYC target genes reveal a primordial signature involved in biomass accumulation. PLoS One, 2011. 6(10): p. e26057. 243. Chan, J.C., K.M. Hannan, K. Riddell, et al., AKT promotes rRNA synthesis and cooperates with c-MYC to stimulate ribosome biogenesis in cancer. Science Signaling, 2011. 4(188): p. ra56. 244. Grandori, C., N. Gomez-Roman, Z.A. Felton-Edkins, et al., c-Myc binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I. Nature Cell Biology, 2005. 7(3): p. 311-8. 245. Arabi, A., S. Wu, K. Ridderstrale, et al., c-Myc associates with ribosomal DNA and activates RNA polymerase I transcription. Nature Cell Biology, 2005. 7(3): p. 303-10. 246. Barna, M., A. Pusic, O. Zollo, et al., Suppression of Myc oncogenic activity by ribosomal protein haploinsufficiency. Nature, 2008. 456(7224): p. 971-5. 247. Jones, R.M., J. Branda, K.A. Johnston, et al., An essential E box in the promoter of the gene encoding the mRNA cap-binding protein (eukaryotic initiation factor 4E) is a target for activation by c-myc. Molecular and Cellular Biology, 1996. 16(9): p. 4754-64. 248. Harris, A.W., C.A. Pinkert, M. Crawford, et al., The E mu-myc transgenic mouse. A model for high-incidence spontaneous lymphoma and leukemia of early B cells. The Journal of Experimental Medicine, 1988. 167(2): p. 353-71.

224

249. Iritani, B.M. and R.N. Eisenman, c-Myc enhances protein synthesis and cell size during B lymphocyte development. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(23): p. 13180-5. 250. Mateyak, M.K., A.J. Obaya, S. Adachi, et al., Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth & Differentiation, 1997. 8(10): p. 1039-48. 251. Cunningham, J.T., M.V. Moreno, A. Lodi, et al., Protein and nucleotide biosynthesis are coupled by a single rate-limiting enzyme, PRPS2, to drive cancer. Cell, 2014. 157(5): p. 1088-103. 252. Zhang, C., C. Yin, L. Wang, et al., HSPC111 governs breast cancer growth by regulating ribosomal biogenesis. Molecular Cancer Research, 2014. 12(4): p. 583-94. 253. Lin, C.J., R. Cencic, J.R. Mills, et al., c-Myc and eIF4F are components of a feedforward loop that links transcription and translation. Cancer Research, 2008. 68(13): p. 5326- 34. 254. Schmidt, E.V., The role of c-myc in regulation of translation initiation. Oncogene, 2004. 23(18): p. 3217-21. 255. Bhat, M., N. Robichaud, L. Hulea, et al., Targeting the translation machinery in cancer. Nature Reviews Drug Discovery, 2015. 14(4): p. 261-78. 256. Wolfe, A.L., K. Singh, Y. Zhong, et al., RNA G-quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature, 2014. 513(7516): p. 65-70. 257. Hsieh, A.C., Y. Liu, M.P. Edlind, et al., The translational landscape of mTOR signalling steers cancer initiation and metastasis. Nature, 2012. 485(7396): p. 55-61. 258. Pourdehnad, M., M.L. Truitt, I.N. Siddiqi, et al., Myc and mTOR converge on a common node in protein synthesis control that confers synthetic lethality in Myc-driven cancers. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(29): p. 11988-93. 259. Manier, S., D. Huynh, Y.J. Shen, et al., Inhibiting the oncogenic translation program is an effective therapeutic strategy in multiple myeloma. Science Translational Medicine, 2017. 9(389). 260. Miller-Fleming, L., V. Olin-Sandoval, K. Campbell, et al., Remaining Mysteries of Molecular Biology: The Role of Polyamines in the Cell. Journal of Molecular Biology, 2015. 427(21): p. 3389-406. 261. Saini, P., D.E. Eyler, R. Green, et al., Hypusine-containing protein eIF5A promotes translation elongation. Nature, 2009. 459(7243): p. 118-21. 262. Landau, G., Z. Bercovich, M.H. Park, et al., The role of polyamines in supporting growth of mammalian cells is mediated through their requirement for translation initiation and elongation. The Journal of Biological Chemistry, 2010. 285(17): p. 12474-81. 263. Nishimura, K., H. Okudaira, E. Ochiai, et al., Identification of proteins whose synthesis is preferentially enhanced by polyamines at the level of translation in mammalian cells. The International Journal of Biochemistry & Cell Biology, 2009. 41(11): p. 2251-61. 264. Coller, H.A., C. Grandori, P. Tamayo, et al., Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proceedings of the National Academy of Sciences of the United States of America, 2000. 97(7): p. 3260-5. 265. Fujimura, K., S. Choi, M. Wyse, et al., Eukaryotic Translation Initiation Factor 5A (EIF5A) Regulates Pancreatic Cancer Metastasis by Modulating RhoA and Rho-associated Kinase (ROCK) Protein Expression Levels. Journal of Biological Chemistry, 2015. 290(50): p. 29907-19. 266. Boon, K., H.N. Caron, R. van Asperen, et al., N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis and protein synthesis. The EMBO Journal, 2001. 20(6): p. 1383-93.

225

267. Tao, T., S.B. Sondalle, H. Shi, et al., The pre-rRNA processing factor DEF is rate limiting for the pathogenesis of MYCN-driven neuroblastoma. Oncogene, 2017. 36(27): p. 3852-3867. 268. Qu, H., L. Zheng, H. Song, et al., microRNA-558 facilitates the expression of hypoxia- inducible factor 2 alpha through binding to 5'-untranslated region in neuroblastoma. Oncotarget, 2016. 7(26): p. 40657-40673. 269. Delaidelli, A., G.L. Negri, A. Jan, et al., MYCN amplified neuroblastoma requires the mRNA translation regulator eEF2 kinase to adapt to nutrient deprivation. Cell Death Differentiation, 2017. 24(9): p. 1564-1576. 270. Rebello, R.J., E. Kusnadi, D.P. Cameron, et al., The Dual Inhibition of RNA Pol I Transcription and PIM Kinase as a New Therapeutic Approach to Treat Advanced Prostate Cancer. Clinical Cancer Research, 2016. 22(22): p. 5539-5552. 271. Devlin, J.R., K.M. Hannan, N. Hein, et al., Combination Therapy Targeting Ribosome Biogenesis and mRNA Translation Synergistically Extends Survival in MYC-Driven Lymphoma. Cancer Discovery, 2016. 6(1): p. 59-70. 272. Bywater, M.J., G. Poortinga, E. Sanij, et al., Inhibition of RNA polymerase I as a therapeutic strategy to promote cancer-specific activation of p53. Cancer Cell, 2012. 22(1): p. 51-65. 273. Drygin, D., A. Lin, J. Bliesath, et al., Targeting RNA polymerase I with an oral small molecule CX-5461 inhibits ribosomal RNA synthesis and solid tumor growth. Cancer Research, 2011. 71(4): p. 1418-30. 274. Devlin, J.R., K.M. Hannan, P.Y. Ng, et al., AKT signalling is required for ribosomal RNA synthesis and progression of Emu-Myc B-cell lymphoma in vivo. The FEBS journal, 2013. 280(21): p. 5307-16. 275. Kawashima, S.A., Z. Chen, Y. Aoi, et al., Potent, Reversible, and Specific Chemical Inhibitors of Eukaryotic Ribosome Biogenesis. Cell, 2016. 167(2): p. 512-524 e14. 276. Lazaris-Karatzas, A., K.S. Montine and N. Sonenberg, Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature, 1990. 345(6275): p. 544-7. 277. Villalonga, P., S. Fernandez de Mattos and A.J. Ridley, RhoE inhibits 4E-BP1 phosphorylation and eIF4E function impairing cap-dependent translation. Journal of Biological Chemistry, 2009. 284(51): p. 35287-96. 278. Truitt, M.L., C.S. Conn, Z. Shi, et al., Differential Requirements for eIF4E Dose in Normal Development and Cancer. Cell, 2015. 162(1): p. 59-71. 279. Kentsis, A., I. Topisirovic, B. Culjkovic, et al., Ribavirin suppresses eIF4E-mediated oncogenic transformation by physical mimicry of the 7-methyl guanosine mRNA cap. Proceedings of the National Academy of Sciences, 2004. 101(52): p. 18105-10. 280. Pettersson, F., C. Yau, M.C. Dobocan, et al., Ribavirin treatment effects on breast cancers overexpressing eIF4E, a biomarker with prognostic specificity for luminal B- type breast cancer. Clinical Cancer Research, 2011. 17(9): p. 2874-84. 281. Assouline, S., B. Culjkovic, E. Cocolakis, et al., Molecular targeting of the oncogene eIF4E in acute myeloid leukemia (AML): a proof-of-principle clinical trial with ribavirin. Blood, 2009. 114(2): p. 257-60. 282. Zahreddine, H.A., B. Culjkovic-Kraljacic, S. Assouline, et al., The sonic hedgehog factor GLI1 imparts drug resistance through inducible glucuronidation. Nature, 2014. 511(7507): p. 90-3. 283. Ko, S.Y., H. Guo, N. Barengo, et al., Inhibition of ovarian cancer growth by a tumor- targeting peptide that binds eukaryotic translation initiation factor 4E. Clinical Cancer Research, 2009. 15(13): p. 4336-47.

226

284. Moerke, N.J., H. Aktas, H. Chen, et al., Small-molecule inhibition of the interaction between the translation initiation factors eIF4E and eIF4G. Cell, 2007. 128(2): p. 257- 67. 285. Graff, J.R., B.W. Konicek, T.M. Vincent, et al., Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. Journal of Clinical Investigation, 2007. 117(9): p. 2638-48. 286. Grzmil, M. and B.A. Hemmings, Translation regulation as a therapeutic target in cancer. Cancer Research, 2012. 72(16): p. 3891-900. 287. Kumar, K., C.R. Chow, K. Ebine, et al., Differential Regulation of ZEB1 and EMT by MAPK-Interacting Protein Kinases (MNK) and eIF4E in Pancreatic Cancer. Molecular Cancer Research, 2016. 14(2): p. 216-27. 288. Callahan, K.P., M. Minhajuddin, C. Corbett, et al., Flavaglines target primitive leukemia cells and enhance anti-leukemia drug activity. Leukemia, 2014. 28(10): p. 1960-8. 289. Wiegering, A., F.W. Uthe, T. Jamieson, et al., Targeting Translation Initiation Bypasses Signaling Crosstalk Mechanisms That Maintain High MYC Levels in Colorectal Cancer. Cancer Discovery, 2015. 5(7): p. 768-781. 290. Malka-Mahieu, H., I. Girault, M. Rubington, et al., Synergistic effects of eIF4A and MEK inhibitors on proliferation of NRAS-mutant melanoma cell lines. Cell Cycle, 2016. 15(18): p. 2405-9. 291. Bordeleau, M.E., J. Matthews, J.M. Wojnar, et al., Stimulation of mammalian translation initiation factor eIF4A activity by a small molecule inhibitor of eukaryotic translation. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(30): p. 10460-5. 292. Evageliou, N.F., M. Haber, A. Vu, et al., Polyamine Antagonist Therapies Inhibit Neuroblastoma Initiation and Progression. Clinical Cancer Research, 2016. 22(17): p. 4391-404. 293. Rounbehler, R.J., W. Li, M.A. Hall, et al., Targeting ornithine decarboxylase impairs development of MYCN-amplified neuroblastoma. Cancer Research, 2009. 69(2): p. 547-53. 294. Gerner, E.W. and F.L. Meyskens, Jr., Polyamines and cancer: old molecules, new understanding. Nature Reviews. Cancer, 2004. 4(10): p. 781-92. 295. Hayes, C.S., A.C. Shicora, M.P. Keough, et al., Polyamine-blocking therapy reverses immunosuppression in the tumor microenvironment. Cancer Immunology Research, 2014. 2(3): p. 274-85. 296. Rosenwald, I.B., R. Kaspar, D. Rousseau, et al., Eukaryotic translation initiation factor 4E regulates expression of cyclin D1 at transcriptional and post-transcriptional levels. The Journal of Biological Chemistry 1995. 270(36): p. 21176-80. 297. Segerstrom, L., N. Baryawno, B. Sveinbjornsson, et al., Effects of small molecule inhibitors of PI3K/Akt/mTOR signaling on neuroblastoma growth in vitro and in vivo. International Journal of Cancer, 2011. 129(12): p. 2958-65. 298. Porro, A., N. Iraci, S. Soverini, et al., c-MYC oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34+ hematopoietic progenitor cells. Molecular Cancer Research, 2011. 9(8): p. 1054-66. 299. Porro, A., M. Haber, D. Diolaiti, et al., Direct and Coordinate Regulation of ATP-binding Cassette Transporter Genes by Myc Factors Generates Specific Transcription Signatures That Significantly Affect the Chemoresistance Phenotype of Cancer Cells. The Journal of Biological Chemistry, 2010. 285(25): p. 19532-19543. 300. Chen, Z., T. Shi, L. Zhang, et al., Mammalian drug efflux transporters of the ATP binding cassette (ABC) family in multidrug resistance: A review of the past decade. Cancer Lett, 2016. 370(1): p. 153-64.

227

301. Fletcher, J.I., M. Haber, M.J. Henderson, et al., ABC transporters in cancer: more than just drug efflux pumps. Nature reviews. Cancer, 2010. 10(2): p. 147-56. 302. Bark, H. and C.H. Choi, PSC833, cyclosporine analogue, downregulates MDR1 expression by activating JNK/c-Jun/AP-1 and suppressing NF-kappaB. Cancer Chemotherapy and Pharmacology, 2010. 65(6): p. 1131-6. 303. Lu, J.F., D. Pokharel and M. Bebawy, MRP1 and its role in anticancer drug resistance. Drug Metabolism Reviews, 2015. 47(4): p. 406-19. 304. Krech, T., E. Scheuerer, R. Geffers, et al., ABCB1/MDR1 contributes to the anticancer drug-resistant phenotype of IPH-926 human lobular breast cancer cells. Cancer Letters, 2012. 315(2): p. 153-60. 305. Vaidyanathan, A., L. Sawers, A.L. Gannon, et al., ABCB1 (MDR1) induction defines a common resistance mechanism in paclitaxel- and olaparib-resistant ovarian cancer cells. British Journal of Cancer, 2016. 115(4): p. 431-41. 306. Lombard, A.P., C. Liu, C.M. Armstrong, et al., ABCB1 Mediates Cabazitaxel-Docetaxel Cross-Resistance in Advanced Prostate Cancer. Molecular Cancer Therapeutics, 2017. 16(10): p. 2257-2266. 307. Durmus, S., R.W. Sparidans, E. Wagenaar, et al., Oral availability and brain penetration of the B-RAFV600E inhibitor vemurafenib can be enhanced by the P-GLYCOprotein (ABCB1) and breast cancer resistance protein (ABCG2) inhibitor elacridar. Molecular Pharmaceutics, 2012. 9(11): p. 3236-45. 308. Tang, S.C., L.N. Nguyen, R.W. Sparidans, et al., Increased oral availability and brain accumulation of the ALK inhibitor crizotinib by coadministration of the P-glycoprotein (ABCB1) and breast cancer resistance protein (ABCG2) inhibitor elacridar. Int J Cancer, 2014. 134(6): p. 1484-94. 309. Martin-Broto, J., A.M. Gutierrez, R.F. Ramos, et al., MRP1 overexpression determines poor prognosis in prospectively treated patients with localized high-risk soft tissue sarcoma of limbs and trunk wall: an ISG/GEIS study. Mol Cancer Ther, 2014. 13(1): p. 249-59. 310. Filipits, M., G. Pohl, M. Rudas, et al., Clinical role of multidrug resistance protein 1 expression in chemotherapy resistance in early-stage breast cancer: the Austrian Breast and Colorectal Cancer Study Group. Journal of Clinical Oncology, 2005. 23(6): p. 1161-8. 311. Bordow, S.B., M. Haber, J. Madafiglio, et al., Expression of the multidrug resistance- associated protein (MRP) gene correlates with amplification and overexpression of the N-myc oncogene in childhood neuroblastoma. Cancer Res, 1994. 54(19): p. 5036-40. 312. Manohar, C.F., J.A. Bray, H.R. Salwen, et al., MYCN-mediated regulation of the MRP1 promoter in human neuroblastoma. Oncogene, 2004. 23(3): p. 753-62. 313. De Antonellis, P., M. Carotenuto, J. Vandenbussche, et al., Early targets of miR-34a in neuroblastoma. Mol Cell Proteomics, 2014. 13(8): p. 2114-31. 314. Hu, J., J. Li, X. Yue, et al., Expression of the cancer stem cell markers ABCG2 and OCT-4 in right-sided colon cancer predicts recurrence and poor outcomes. Oncotarget, 2017. 8(17): p. 28463-28470. 315. Halon, A., V. Materna, P. Donizy, et al., MRP2 (ABCC2, cMOAT) expression in nuclear envelope of primary fallopian tube cancer cells is a new unfavorable prognostic factor. Arch Gynecol Obstet, 2013. 287(3): p. 563-70. 316. Henderson, M.J., M. Haber, A. Porro, et al., ABCC multidrug transporters in childhood neuroblastoma: clinical and biological effects independent of cytotoxic drug efflux. Journal of the National Cancer Institute, 2011. 103(16): p. 1236-51. 317. Murray, J., E. Valli, D.M.T. Yu, et al., Suppression of the ATP-binding cassette transporter ABCC4 impairs neuroblastoma tumour growth and sensitises to irinotecan in vivo. Eur J Cancer, 2017. 83: p. 132-141.

228

318. Wang, D. and R.N. Dubois, Eicosanoids and cancer. Nature Reviews Cancer, 2010. 10(3): p. 181-93. 319. Rask, K., Y. Zhu, W. Wang, et al., Ovarian epithelial cancer: a role for PGE2-synthesis and signalling in malignant transformation and progression. Molecular Cancer, 2006. 5: p. 62. 320. Reid, G., P. Wielinga, N. Zelcer, et al., The human multidrug resistance protein MRP4 functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal antiinflammatory drugs. Proceedings of the National Academy of Sciences of the United States of America, 2003. 100(16): p. 9244-9. 321. Rius, M., J. Hummel-Eisenbeiss and D. Keppler, ATP-dependent transport of leukotrienes B4 and C4 by the multidrug resistance protein ABCC4 (MRP4). Journal of Pharmacology and Experimental Therapeutics, 2008. 324(1): p. 86-94. 322. Marchan, R., C.L. Hammond and N. Ballatori, Multidrug resistance-associated protein 1 as a major mediator of basal and apoptotic glutathione release. Biochimica et Biophysica Acta, 2008. 1778(10): p. 2413-20. 323. Zamanian-Daryoush, M., D.J. Lindner, J.A. DiDonato, et al., Myeloid-specific genetic ablation of ATP-binding cassette transporter ABCA1 is protective against cancer. Oncotarget, 2017. 8(42): p. 71965-71980. 324. Kelly, R.J., D. Draper, C.C. Chen, et al., A pharmacodynamic study of docetaxel in combination with the P-glycoprotein antagonist tariquidar (XR9576) in patients with lung, ovarian, and cervical cancer. Clinical Cancer Research, 2011. 17(3): p. 569-80. 325. Kolitz, J.E., S.L. George, R.K. Dodge, et al., Dose escalation studies of cytarabine, daunorubicin, and etoposide with and without multidrug resistance modulation with PSC-833 in untreated adults with acute myeloid leukemia younger than 60 years: final induction results of Cancer and Leukemia Group B Study 9621. Journal of Clinical Oncology, 2004. 22(21): p. 4290-301. 326. Burkhart, C.A., F. Watt, J. Murray, et al., Small-molecule multidrug resistance- associated protein 1 inhibitor reversan increases the therapeutic index of chemotherapy in mouse models of neuroblastoma. Cancer Research, 2009. 69(16): p. 6573-80. 327. Cheung, L., C.L. Flemming, F. Watt, et al., High-throughput screening identifies Ceefourin 1 and Ceefourin 2 as highly selective inhibitors of multidrug resistance protein 4 (MRP4). Biochemical Pharmacology, 2014. 91(1): p. 97-108. 328. Kispal, G., K. Sipos, H. Lange, et al., Biogenesis of cytosolic ribosomes requires the essential iron-sulphur protein Rli1p and mitochondria. The EMBO Journal 2005. 24(3): p. 589-98. 329. Paytubi, S., X. Wang, Y.W. Lam, et al., ABC50 promotes translation initiation in mammalian cells. The Journal of Biological Chemistry, 2009. 284(36): p. 24061-73. 330. Decottignies, A. and A. Goffeau, Complete inventory of the yeast ABC proteins. Nature Genetics, 1997. 15(2): p. 137-45. 331. De Antonellis, P., M. Carotenuto, J. Vandenbussche, et al., Early targets of miR-34a in neuroblastoma. Molecular & Cellular Proteomics, 2014. 13(8): p. 2114-31. 332. Barthelme, D., U. Scheele, S. Dinkelaker, et al., Structural organization of essential iron- sulfur clusters in the evolutionarily highly conserved ATP-binding cassette protein ABCE1. The Journal of Biological Chemistry, 2007. 282(19): p. 14598-607. 333. Karcher, A., K. Buttner, B. Martens, et al., X-ray structure of RLI, an essential twin cassette ABC ATPase involved in ribosome biogenesis and HIV capsid assembly. Structure, 2005. 13(4): p. 649-59. 334. Tyzack, J.K., X. Wang, G.J. Belsham, et al., ABC50 interacts with eukaryotic initiation factor 2 and associates with the ribosome in an ATP-dependent manner. The Journal of Biological Chemistry, 2000. 275(44): p. 34131-9.

229

335. Paytubi, S., N.A. Morrice, J. Boudeau, et al., The N-terminal region of ABC50 interacts with eukaryotic initiation factor eIF2 and is a target for regulatory phosphorylation by CK2. The Biochemical Journal, 2008. 409(1): p. 223-31. 336. Stewart, J.D., J.L. Cowan, L.S. Perry, et al., ABC50 mutants modify translation start codon selection. The Biochemical Journal, 2015. 467(2): p. 217-29. 337. Yu, Y., Y. Zhang, Z. Zhu, et al., ABC50 modulates sensitivity of HL60 leukemic cells to endoplasmic reticulum (ER) stress-induced cell death. Biochemical Pharmacology, 2011. 81(4): p. 488-97. 338. Wilcox, S.M., H. Arora, L. Munro, et al., The role of the innate immune response regulatory gene ABCF1 in mammalian embryogenesis and development. PLoS One, 2017. 12(5): p. e0175918. 339. Chen, Z.Q., J. Dong, A. Ishimura, et al., The essential vertebrate ABCE1 protein interacts with eukaryotic initiation factors. The Journal of Biological Chemistry, 2006. 281(11): p. 7452-7. 340. Dong, J., R. Lai, K. Nielsen, et al., The essential ATP-binding cassette protein RLI1 functions in translation by promoting preinitiation complex assembly. The Journal of Biological Chemistry, 2004. 279(40): p. 42157-68. 341. Yarunin, A., V.G. Panse, E. Petfalski, et al., Functional link between ribosome formation and biogenesis of iron-sulfur proteins. The EMBO journal, 2005. 24(3): p. 580-8. 342. Huang, B., H. Zhou, X. Lang, et al., siRNAinduced ABCE1 silencing inhibits proliferation and invasion of breast cancer cells. Molecular Medicine Reports, 2014. 10(4): p. 1685- 90. 343. Huang, B., X. Gong, H. Zhou, et al., Depleting ABCE1 expression induces apoptosis and inhibits the ability of proliferation and migration of human esophageal carcinoma cells. International Journal of Clinical and Experimental Pathology, 2014. 7(2): p. 584-92. 344. Huang, B., Y. Gao, D. Tian, et al., A small interfering ABCE1-targeting RNA inhibits the proliferation and invasiveness of small cell lung cancer. International Journal of Molecular Medicine, 2010. 25(5): p. 687-93. 345. Ren, Y., Y. Li and D. Tian, Role of the ABCE1 gene in human lung adenocarcinoma. Oncology Reports, 2012. 27(4): p. 965-70. 346. Barthelme, D., S. Dinkelaker, S.V. Albers, et al., Ribosome recycling depends on a mechanistic link between the FeS cluster domain and a conformational switch of the twin-ATPase ABCE1. Proceedings of the National Academy of Sciences of the United States of America 2011. 108(8): p. 3228-33. 347. Bisbal, C., C. Martinand, M. Silhol, et al., Cloning and characterization of a RNAse L inhibitor. A new component of the interferon-regulated 2-5A pathway. The Journal of Biological Chemistry, 1995. 270(22): p. 13308-17. 348. Andreev, D.E., Patrick B F. O'Connor, G. Loughran, et al., Insights into the mechanisms of eukaryotic translation gained with ribosome profiling. Nucleic Acids Research, 2017. 45(2): p. 513-526. 349. Wilson, D.N., Ribosome-targeting antibiotics and mechanisms of bacterial resistance. Nature Reviews Microbiology, 2014. 12(1): p. 35-48. 350. Becker, T., S. Franckenberg, S. Wickles, et al., Structural basis of highly conserved ribosome recycling in eukaryotes and archaea. Nature, 2012. 482(7386): p. 501-6. 351. Shoemaker, C.J. and R. Green, Kinetic analysis reveals the ordered coupling of translation termination and ribosome recycling in yeast. Proceedings of the National Academy of Sciences of the United States of America 2011. 108(51): p. E1392-8. 352. Khoshnevis, S., T. Gross, C. Rotte, et al., The iron-sulphur protein RNase L inhibitor functions in translation termination. EMBO Reports, 2010. 11(3): p. 214-9. 353. Young, D.J., N.R. Guydosh, F. Zhang, et al., Rli1/ABCE1 Recycles Terminating Ribosomes and Controls Translation Reinitiation in 3'UTRs In Vivo. Cell, 2015. 162(4): p. 872-84.

230

354. Pisarev, A.V., M.A. Skabkin, V.P. Pisareva, et al., The role of ABCE1 in eukaryotic posttermination ribosomal recycling. Molecular Cell 2010. 37(2): p. 196-210. 355. Pisareva, V.P., M.A. Skabkin, C.U. Hellen, et al., Dissociation by Pelota, Hbs1 and ABCE1 of mammalian vacant 80S ribosomes and stalled elongation complexes. The EMBO Journal, 2011. 30(9): p. 1804-17. 356. Kiosze-Becker, K., A. Ori, M. Gerovac, et al., Structure of the ribosome post-recycling complex probed by chemical cross-linking and mass spectrometry. Nature Communications, 2016. 7: p. 13248. 357. Mills, E.W., J. Wangen, R. Green, et al., Dynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets. Cell Reports, 2016. 17(1): p. 1-10. 358. Toompuu, M., K. Karblane, P. Pata, et al., ABCE1 is essential for S phase progression in human cells. Cell Cycle, 2016. 15(9): p. 1234-47. 359. Li, G., Y. Xiang, K. Sabapathy, et al., An apoptotic signaling pathway in the interferon antiviral response mediated by RNase L and c-Jun NH2-terminal kinase. The Journal of Biological Chemistry, 2004. 279(2): p. 1123-31. 360. Malathi, K., J.M. Paranjape, R. Ganapathi, et al., HPC1/RNASEL mediates apoptosis of prostate cancer cells treated with 2',5'-oligoadenylates, topoisomerase I inhibitors, and tumor necrosis factor-related apoptosis-inducing ligand. Cancer Research, 2004. 64(24): p. 9144-51. 361. Zimmerman, C., K.C. Klein, P.K. Kiser, et al., Identification of a host protein essential for assembly of immature HIV-1 capsids. Nature, 2002. 415(6867): p. 88-92. 362. Lingappa, J.R., J.E. Dooher, M.A. Newman, et al., Basic residues in the nucleocapsid domain of Gag are required for interaction of HIV-1 gag with ABCE1 (HP68), a cellular protein important for HIV-1 capsid assembly. The Journal of Biological Chemistry, 2006. 281(7): p. 3773-84. 363. Lingappa, U.F., X. Wu, A. Macieik, et al., Host-rabies virus protein-protein interactions as druggable antiviral targets. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(10): p. E861-8. 364. Alhebshi, A., T.C. Sideri, S.L. Holland, et al., The essential iron-sulfur protein Rli1 is an important target accounting for inhibition of cell growth by reactive oxygen species. Molecular Biology of the Cell, 2012. 23(18): p. 3582-90. 365. Zhai, C., Y. Li, C. Mascarenhas, et al., The function of ORAOV1/LTO1, a gene that is overexpressed frequently in cancer: essential roles in the function and biogenesis of the ribosome. Oncogene, 2014. 33(4): p. 484-94. 366. Vieira, H.L., P.M. Alves and A. Vercelli, Modulation of neuronal stem cell differentiation by hypoxia and reactive oxygen species. Progress in Neurobiology, 2011. 93(3): p. 444- 55. 367. Chuang, J.I., T.Y. Chang and H.S. Liu, Glutathione depletion-induced apoptosis of Ha- ras-transformed NIH3T3 cells can be prevented by melatonin. Oncogene, 2003. 22(9): p. 1349-57. 368. Keshelava, N., J.J. Zuo, P. Chen, et al., Loss of p53 Function Confers High-Level Multidrug Resistance in Neuroblastoma Cell Lines. Cancer Research, 2001. 61(16): p. 6185-6193. 369. Nakamura, Y., T. Ozaki, H. Niizuma, et al., Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line. Biochem Biophys Res Commun, 2007. 354(4): p. 892-8. 370. Van Maerken, T., A. Rihani, D. Dreidax, et al., Functional Analysis of the p53 Pathway in Neuroblastoma Cells Using the Small-Molecule MDM2 Antagonist Nutlin-3. Molecular Cancer Therapeutics, 2011. 10(6): p. 983-993. 371. Hasan, M.K., A. Nafady, A. Takatori, et al., ALK is a MYCN target gene and regulates cell migration and invasion in neuroblastoma. Scientific Reports, 2013. 3: p. 3450.

231

372. Sakamoto, H., T. Tsukaguchi, S. Hiroshima, et al., CH5424802, a selective ALK inhibitor capable of blocking the resistant gatekeeper mutant. Cancer Cell, 2011. 19(5): p. 679- 90. 373. Park, J.R., R. Bagatell, W.B. London, et al., Children's Oncology Group's 2013 blueprint for research: neuroblastoma. Pediatr Blood Cancer, 2013. 60(6): p. 985-93. 374. Zimmerman, M.W., Y. Liu, S. He, et al., MYC Drives a Subset of High-Risk Pediatric Neuroblastomas and Is Activated through Mechanisms Including Enhancer Hijacking and Focal Enhancer Amplification. Cancer Discov, 2018. 8(3): p. 320-335. 375. Zimmerman, M.W., Y. Liu, S. He, et al., c-MYC drives a subset of high-risk pediatric neuroblastomas and is activated through mechanisms including enhancer hijacking and focal enhancer amplification. Cancer Discovery, 2017. 376. Kocak, H., S. Ackermann, B. Hero, et al., Hox-C9 activates the intrinsic pathway of apoptosis and is associated with spontaneous regression in neuroblastoma. Cell Death Dis, 2013. 4: p. e586. 377. Yeomans, A., S.M. Thirdborough, B. Valle-Argos, et al., Engagement of the B-cell receptor of chronic lymphocytic leukemia cells drives global and MYC-specific mRNA translation. Blood, 2016. 127(4): p. 449-57. 378. Lau, D.T., C.L. Flemming, S. Gherardi, et al., MYCN amplification confers enhanced folate dependence and methotrexate sensitivity in neuroblastoma. Oncotarget, 2015. 6(17): p. 15510-15523. 379. Kobayashi, K., T. Era, A. Takebe, et al., ARID3B induces malignant transformation of mouse embryonic fibroblasts and is strongly associated with malignant neuroblastoma. Cancer Res, 2006. 66(17): p. 8331-6. 380. Dai, M.S., H. Arnold, X.X. Sun, et al., Inhibition of c-Myc activity by ribosomal protein L11. The EMBO Journal 2007. 26(14): p. 3332-45. 381. Culjkovic-Kraljacic, B., T.M. Fernando, R. Marullo, et al., Combinatorial targeting of nuclear export and translation of RNA inhibits aggressive B-cell lymphomas. Blood, 2016. 127(7): p. 858-68. 382. Pettersson, F., S.V. Del Rincon, A. Emond, et al., Genetic and pharmacologic inhibition of eIF4E reduces breast cancer cell migration, invasion, and metastasis. Cancer Res, 2015. 75(6): p. 1102-12. 383. Zhu, W., M.Y. Cai, Z.T. Tong, et al., Overexpression of EIF5A2 promotes colorectal carcinoma cell aggressiveness by upregulating MTA1 through C-myc to induce epithelial-mesenchymaltransition. Gut, 2012. 61(4): p. 562-75. 384. Meng, Q.B., W.M. Kang, J.C. Yu, et al., Overexpression of eukaryotic translation initiation factor 5A2 (EIF5A2) correlates with cell aggressiveness and poor survival in gastric cancer. PLoS One, 2015. 10(3): p. e0119229. 385. Yang, X.H., F. Tang, J. Shin, et al., A c-Myc-regulated stem cell-like signature in high-risk neuroblastoma: A systematic discovery (Target neuroblastoma ESC-like signature). Sci Rep, 2017. 7(1): p. 41. 386. Ho, R., A. Eggert, T. Hishiki, et al., Resistance to chemotherapy mediated by TrkB in neuroblastomas. Cancer Res, 2002. 62(22): p. 6462-6. 387. Chesler, L., D.D. Goldenberg, R. Collins, et al., Chemotherapy-induced apoptosis in a transgenic model of neuroblastoma proceeds through p53 induction. Neoplasia, 2008. 10(11): p. 1268-74. 388. Xue, C., M. Haber, C. Flemming, et al., p53 determines multidrug sensitivity of childhood neuroblastoma. Cancer Res, 2007. 67(21): p. 10351-60. 389. Heuer, A., M. Gerovac, C. Schmidt, et al., Structure of the 40S-ABCE1 post-splitting complex in ribosome recycling and translation initiation. Nature structural & molecular biology, 2017. 24(5): p. 453-460.

232

390. Mancera-Martinez, E., J. Brito Querido, L.S. Valasek, et al., ABCE1: A special factor that orchestrates translation at the crossroad between recycling and initiation. RNA Biol, 2017. 14(10): p. 1279-1285. 391. Mamane, Y., E. Petroulakis, Y. Martineau, et al., Epigenetic activation of a subset of mRNAs by eIF4E explains its effects on cell proliferation. PLoS One, 2007. 2(2): p. e242. 392. Schmidt, E.K., G. Clavarino, M. Ceppi, et al., SUnSET, a nonradioactive method to monitor protein synthesis. Nat Methods, 2009. 6(4): p. 275-7. 393. Guydosh, N.R. and R. Green, Dom34 rescues ribosomes in 3' untranslated regions. Cell, 2014. 156(5): p. 950-62. 394. van den Elzen, A.M., A. Schuller, R. Green, et al., Dom34-Hbs1 mediated dissociation of inactive 80S ribosomes promotes restart of translation after stress. The EMBO journal, 2014. 33(3): p. 265-76. 395. Cencic, R., M. Carrier, A. Trnkus, et al., Synergistic effect of inhibiting translation initiation in combination with cytotoxic agents in acute myelogenous leukemia cells. Leukemia Research, 2010. 34(4): p. 535-541. 396. Patton, J.T., M.E. Lustberg, G. Lozanski, et al., The translation inhibitor silvestrol exhibits direct anti-tumor activity while preserving innate and adaptive immunity against EBV-driven lymphoproliferative disease. Oncotarget, 2015. 6(5): p. 2693-708. 397. Lucas, D.M., R.B. Edwards, G. Lozanski, et al., The novel plant-derived agent silvestrol has B-cell selective activity in chronic lymphocytic leukemia and acute lymphoblastic leukemia in vitro and in vivo. Blood, 2009. 113(19): p. 4656-66. 398. Wang, J., J. Zhang, Y.M. Lee, et al., Quantitative chemical proteomics profiling of de novo protein synthesis during starvation-mediated autophagy. Autophagy, 2016. 12(10): p. 1931-1944. 399. Ingolia, N.T., S. Ghaemmaghami, J.R. Newman, et al., Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science, 2009. 324(5924): p. 218-23. 400. Mancera-Martinez, E., J. Brito Querido, L.S. Valasek, et al., ABCE1: A special factor that orchestrates translation at the crossroad between recycling and initiation. RNA biology, 2017: p. 1-7. 401. Rubio, C.A., B. Weisburd, M. Holderfield, et al., Transcriptome-wide characterization of the eIF4A signature highlights plasticity in translation regulation. Genome Biology, 2014. 15(10): p. 476. 402. Braekeveldt, N., C. Wigerup, D. Gisselsson, et al., Neuroblastoma patient-derived orthotopic xenografts retain metastatic patterns and geno- and phenotypes of patient tumours. Int J Cancer, 2015. 136(5): p. E252-61. 403. Braekeveldt, N. and D. Bexell, Patient-derived xenografts as preclinical neuroblastoma models. Cell Tissue Res, 2017. 404. Gillet, J.-P., A.M. Calcagno, S. Varma, et al., Redefining the relevance of established cancer cell lines to the study of mechanisms of clinical anti-cancer drug resistance. Proceedings of the National Academy of Sciences of the United States of America, 2011. 108(46): p. 18708-18713. 405. Teitz, T., J.J. Stanke, S. Federico, et al., Preclinical models for neuroblastoma: establishing a baseline for treatment. PLoS One, 2011. 6(4): p. e19133. 406. Tomayko, M.M. and C.P. Reynolds, Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemother Pharmacol, 1989. 24(3): p. 148-54. 407. Zhang, L., P. Marrano, S. Kumar, et al., Nab-paclitaxel is an active drug in preclinical model of pediatric solid tumors. Clin Cancer Res, 2013. 19(21): p. 5972-83. 408. Li, Z., F. Tan, D.J. Liewehr, et al., In vitro and in vivo inhibition of neuroblastoma tumor cell growth by AKT inhibitor perifosine. Journal of the National Cancer Institute, 2010. 102(11): p. 758-70.

233

409. Evans, A.E., K.D. Kisselbach, D.J. Yamashiro, et al., Antitumor activity of CEP-751 (KT- 6587) on human neuroblastoma and medulloblastoma xenografts. Clin Cancer Res, 1999. 5(11): p. 3594-602. 410. Flahaut, M., N. Jauquier, N. Chevalier, et al., Aldehyde dehydrogenase activity plays a Key role in the aggressive phenotype of neuroblastoma. BMC Cancer, 2016. 16(1): p. 781. 411. Ham, J., C. Costa, R. Sano, et al., Exploitation of the Apoptosis-Primed State of MYCN- Amplified Neuroblastoma to Develop a Potent and Specific Targeted Therapy Combination. Cancer Cell, 2016. 29(2): p. 159-72. 412. Aleku, M., P. Schulz, O. Keil, et al., Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression. Cancer Research, 2008. 68(23): p. 9788-9798. 413. Schultheis, B., D. Strumberg, A. Santel, et al., First-in-human phase I study of the liposomal RNA interference therapeutic Atu027 in patients with advanced solid tumors. J Clin Oncol, 2014. 32(36): p. 4141-8. 414. Tabernero, J., G.I. Shapiro, P.M. LoRusso, et al., First-in-Humans Trial of an RNA Interference Therapeutic Targeting VEGF and KSP in Cancer Patients with Liver Involvement. Cancer Discovery, 2013. 415. Teo, J., J.A. McCarroll, C. Boyer, et al., A Rationally Optimized Nanoparticle System for the Delivery of RNA Interference Therapeutics into Pancreatic Tumors in Vivo. Biomacromolecules, 2016. 17(7): p. 2337-51. 416. Boyer, C., J. Teo, P. Phillips, et al., Effective delivery of siRNA into cancer cells and tumors using well-defined biodegradable cationic star polymers. Mol Pharm, 2013. 10(6): p. 2435-44. 417. Stewart, E., A. Shelat, C. Bradley, et al., Development and characterization of a human orthotopic neuroblastoma xenograft. Dev Biol, 2015. 407(2): p. 344-55. 418. Byrne, F.L., J.A. McCarroll and M. Kavallaris, Analyses of Tumor Burden In Vivo and Metastasis Ex Vivo Using Luciferase-Expressing Cancer Cells in an Orthotopic Mouse Model of Neuroblastoma. Methods Mol Biol, 2016. 1372: p. 61-77. 419. Byrne, F.L., L. Yang, P.A. Phillips, et al., RNAi-mediated stathmin suppression reduces lung metastasis in an orthotopic neuroblastoma mouse model. Oncogene, 2014. 33(7): p. 882-90.

234