Nucleosome Breathing and Remodeling Constrain CRISPR-Cas9 Function

R Stefan Isaaca,e, Fuguo Jiangb, Jennifer A Doudnac, Wendell A Limd*, Geeta J Narlikara*, Ricardo Almeidaf

* Corresponding authors: [email protected], [email protected] a Department of Biochemistry and Biophysics, University of California San Francisco, San Francisco, CA 94158, USA b Department of Molecular and Cell Biology, California Institute for Quantitative Biosciences, University of California, Berkeley, CA 94720, USA. c Department of Molecular and Cell Biology, Howard Hughes Medical Institute, California Institute for Quantitative Biosciences, Department of Chemistry, University of California, Berkeley, CA 94720, USA. Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA. Innovative Genomics Initiative, University of California, Berkeley, CA 94720, USA d Department of Cellular and Molecular Pharmacology, Howard Hughes Medical Institute, Center for Systems and Synthetic Biology, California Institute for Quantitative Biosciences, University of California San Francisco, San Francisco, CA 94158, USA e Tetrad Graduate Program, University of California San Francisco, San Francisco, CA 94158, USA f Department of Cellular and Molecular Pharmacology, Center for Systems and Synthetic Biology, California Institute for Quantitative Biosciences, University of California San Francisco, San Francisco, CA 94158, USA

Author contributions:

RSI: Conceived of and conducted the biochemistry experiments and data analysis, and helped write this report.

FJ: Generated reagents used in experiments, and edited this report.

JAD: Contributed ideas and reagents, and edited this report.

WAL: Co-supervised the work and helped write this report.

GJN: Co-supervised the work and helped write this report.

RA: Conceived of and conducted the work, generated reagents, and wrote this report.

1 Competing interests:

JAD: Co-founder of Caribou Biosciences; Editas Medicine; Intellia Therapeutics

WAL: Founder of Cell Design Labs, and member of its scientific advisory board

2 1 Abstract

2 The CRISPR-Cas9 bacterial surveillance system has become a versatile tool for genome editing and gene 3 regulation in eukaryotic cells, yet how CRISPR-Cas9 contends with the barriers presented by eukaryotic 4 chromatin is poorly understood. Here we investigate how the smallest unit of chromatin, a nucleosome, 5 constrains the activity of the CRISPR-Cas9 system. We find that nucleosomes assembled on native DNA 6 sequences are permissive to Cas9 action. However, the accessibility of nucleosomal DNA to Cas9 is 7 variable over several orders of magnitude depending on dynamic properties of the DNA sequence and 8 the distance of the PAM site from the nucleosome dyad. We further find that chromatin remodeling 9 enzymes stimulate Cas9 activity on nucleosomal templates. Our findings imply that the spontaneous 10 breathing of nucleosomal DNA together with the action of chromatin remodelers allows Cas9 to 11 effectively act on chromatin in vivo.

3 12 Introduction

13 The recent development of CRISPR (clustered regularly interspaced short palindromic repeats) systems, 14 particularly the type II CRISPR-Cas9 mechanism from Streptomyces pyogenes, as an artificial tool for 15 genome engineering, gene regulation, and live imaging is a remarkable achievement with profound 16 impact in a wide variety of research fields and applications [1]–[6]. Despite its successful adoption across 17 numerous eukaryotic organisms, relatively few details are known of the mechanism by which bacterial 18 CRISPR-Cas9 systems operate in eukaryotic cells [2], [7], [8].

19 CRISPR-Cas9 originated in bacteria, where genomic DNA generally consists of supercoiled circular 20 molecules associated with nucleoid-associated proteins [9]. In contrast, eukaryotic chromosomes are 21 linear, packaged with histone octamers into nucleosomes, and further organized into higher-order 22 structures [10]–[13]. The packaging of DNA into nucleosomes generally inhibits the binding of sequence 23 specific DNA binding factors. In the simplest model, nucleosomes would analogously inhibit Cas9 action. 24 Further, in eukaryotes ATP-dependent chromatin remodelers reposition, remove, or restructure 25 nucleosomes to regulate the access of DNA binding factors [14], [15]. It can therefore be imagined that 26 the action of remodelers also regulates the action of Cas9 on nucleosomes.

27 To quantitatively test the above models we performed biochemical studies to measure Cas9 activity on 28 nucleosomes assembled with native and artificial nucleosome positioning sequences. We find that the 29 combination of nucleosome breathing, by which DNA transiently disengages from the histone octamer, 30 and the action of chromatin remodeling enzymes allow Cas9 to act on nucleosomal DNA with rates 31 comparable to naked DNA. The results provide a biochemical explanation for the efficacy of Cas9 in 32 eukaryotic cells.

33 Results

34 Nucleosomes assembled on the 601 sequence inhibit Cas9 binding and cleavage of target DNA

35 To determine if a nucleosome inhibits the ability of Cas9 to scan, recognize, and cleave sgRNA-directed 36 DNA targets, we performed in vitro Cas9 cleavage assays using mononucleosomes (single nucleosomes 37 on short dsDNA molecules) reconstituted using the Widom 601 positioning sequence with 80 base pairs 38 of flanking DNA on both sides (referred to as 601 80/80 particles, Fig. 1A) [16]. The 601 sequence is an 39 artificially derived sequence with high affinity for the histone octamer and has proved a valuable tool for 40 assembling well positioning nucleosomes for biochemical studies. Using sgRNAs targeting the 41 nucleosomal dyad, entry/exit sites, and flanking DNA, we measured the rates of Cas9 cleavage with

4 42 naked 601 DNA and the 601 80/80 particles. Targeting the DNA flanking the nucleosome showed 43 cleavage rates comparable to those of naked DNA. Cleavage rates at entry/exit sites of the nucleosome 44 were much lower compared to naked DNA (~23-28x decrease cleavage rate vs. DNA alone) (Fig. 1B, C). 45 Targeting near the nucleosomal dyad resulted in further inhibition of cutting by Cas9 (~1000x decrease 46 vs. DNA alone) (Fig. 1C, D). Previous work has shown that nucleosomal DNA transiently disengages from 47 the histone octamer and reanneals, a process termed as DNA unpeeling. The equilibrium for DNA 48 unpeeling gets progressively more unfavorable the closer the DNA site gets to the dyad [17]–[19]. The 49 nucleosome-mediated inhibition of Cas9 activity is more pronounced near the dyad suggesting that Cas9 50 cleavage occurs on DNA that is transiently disengaged from the histone octamer. 51

52 Nucleosomes block the ability of Cas9 to cleave DNA, but it is unclear at which step of Cas9 activity this 53 occurs. Cas9 recognizes DNA target sites in a two-step process that begins with binding to the DNA 54 protospacer adjacent motif (PAM, in this case “NGG”) through its C-terminal PAM-interacting region, 55 followed by sequential melting of the DNA double strand and annealing of the sgRNA guide segment to 56 the unwound target DNA strand (Fig. 1 Supplement 1A) [20], [21]. Complete annealing of the 20-nt 57 guide RNA to the target DNA is required to drive a progressive conformational transformation that 58 authorizes Cas9 to simultaneously cleave both DNA strands [22], [23]. Given this order of events, it is 59 conceivable that nucleosomes can interfere with any of the steps preceding and including DNA cleavage. 60 To identify the point at which nucleosomes disrupt Cas9 function, we assessed binding of nuclease-dead 61 Cas9 (dCas9) to mononucleosomal particles by an electrophoretic mobility shift assay. We performed 62 dCas9 binding assays using 601 0/0 nucleosomal particles which are devoid of naked DNA overhangs. 63 Binding of dCas9 pre-loaded with core targeting sgRNA with 601 0/0 nucleosomes is undetectable 64 whereas binding to naked DNA control is still robust (Fig. 1 Supplement 1B). The presence of super shifts 65 in the gel migration pattern suggests that multiple dCas9 molecules are engaging the same DNA 66 substrate molecule. We investigated this further and determined that, in our binding assay, the highly 67 transient dCas9 binding to PAMs within target DNA is observable as super shifts, likely due to a 68 combination of a high number of PAMs on the target DNA (23 NGG PAMs present in 601 0/0 sequence) 69 and common caging effects of gel binding assays. The absence of a super shift binding pattern with 0/0 70 nucleosomes (Fig. 1 Supplement 1B, right) suggests that dCas9 cannot stably interact with PAMs located 71 on nucleosomes, in a manner consistent with a recently published study (Figure 1 Supplement 2D) [24].

72

5 73 Nucleosomes assembled on a native DNA sequence are permissive to Cas9 action

74 The artificial Widom 601 is an atypically strong nucleosome positioning sequence that shows ~ 100-fold 75 less breathing dynamics compared to physiological nucleosome positioning sequences, such as the 5S 76 rRNA gene [25], [26]. To determine how Cas9 contends with nucleosomes assembled on this 77 physiological positioning sequence, we performed cleavage experiments with nucleosomes assembled 78 from 5S rRNA gene sequences from Xenopus borealis (Fig. 2A). Cas9-mediated cleavage at sites near the 79 entry/exit of the nucleosome is substantially enhanced (700–fold) with 5S nucleosomes compared to 80 601 particles (Fig. 2B-D). In the context of 601, cutting at this site is 1000-fold slower than in naked DNA. 81 In contrast, with 5S nucleosomes, cutting at the comparable site is only 1.5-fold slower than in naked 82 DNA. However, Cas9 cleavage near the dyad is inhibited to a similar extent on both 5S and 601 83 nucleosomes, showing that the 5S-specific enhancement of Cas9 activity does not extend all the way to 84 the nucleosomal dyad. These results support our interpretation that nucleosomal DNA breathing 85 substantially enhances Cas9 binding to nucleosomes and demonstrate that nucleosomal DNA sequence, 86 through its influence on nucleosome stability, can regulate Cas9 activity over a large dynamic range. 87 88 Nucleosome Remodeling Enhances Cas9 Activity 89 We next investigated whether chromatin remodeling could enhance Cas9 activity towards chromatin 90 substrates. Nucleosome positioning in vivo is strongly dependent on ATP-dependent chromatin 91 remodelers, which are capable of loading, repositioning, and removing nucleosomes from the chromatin 92 fiber. To measure how chromatin remodelers can influence Cas9 activity, we performed experiments 93 where we pre-incubated 601 nucleosomes with remodeler enzymes prior to Cas9-mediated cleavage. 94 For our experiments with the human ISWI-family remodeler SNF2h, we used asymmetric nucleosomes 95 that possess flanking DNA only on the entry side (601 80/0 particles). When incubated with 601 80/0 96 particles, SNF2h promotes sliding of the nucleosome towards the center of the DNA molecule (Fig. 3A-B, 97 Fig. 3 Supplement 1) [27]–[29]. We then performed in vitro cleavage experiments where 80/0 particles, 98 pre-remodeled with SNF2h, were incubated with Cas9:sgRNA complex with its target site located within 99 the nucleosome exit region. Remodeling 80/0 nucleosomes by SNF2h resulted in a strong enhancement 100 of Cas9 cleavage to ~34%, showing that SNF2h slides the nucleosome enough to improve Cas9’s 101 accessibility to the target site and that Cas9 is now able to bind and cleave at a higher rate (Fig. 3A-D). 102 We also performed this experiment by simultaneously adding SNF2h and Cas9 and found a similar rate 103 enhancement (Fig. 3 Supplement 2).

6 104 While the ISWI remodeler SNF2h predominantly slides nucleosomes, remodelers from the SWI/SNF class 105 have multiple outcomes, which include generation of DNA loops and eviction of the histone octamer in 106 addition to nucleosome sliding [30]–[34]. To determine if the types of remodeled products generated 107 influence Cas9 activity, we performed similar experiments using 601 80/80 particles and the yeast 108 chromatin remodeler RSC. We find that RSC activity also dramatically enhances cleavage on 601 80/80 109 nucleosomes when Cas9 is targeted to the entry site, negating most of the inhibitory influence of the 110 nucleosome on Cas9 (Fig. 3E-F). These results demonstrate that two different classes of chromatin 111 remodeling enzymes can significantly enhance Cas9 access to DNA targets normally obscured by 112 nucleosomes. 113

114 Discussion

115 Here we demonstrate, using detailed biochemical studies with a variety of nucleosomal templates, that 116 (i) the intrinsic stability of the histone-DNA interactions, (ii) the location of the target site within the 117 nucleosomes (nucleosome positioning), and (iii) the action of chromatin remodeling enzymes play 118 critical roles in regulating the activity of S. pyogenes Cas9. Below we discuss the implications of our 119 results. 120 121 Nucleosomes have been shown to inhibit the action of DNA binding factors. Recent work using 122 nucleosomes assembled on the 601 sequence has led to the qualitatively similar conclusion that 123 nucleosomes are refractory for Cas9 action [24], [35]. The comparison here between Cas9 action on 601 124 nucleosomes vs. nucleosomes assembled on the native 5S sequence suggests a more refined model for 125 how nucleosomes regulate Cas9 action. We find that Cas9 sites near the entry/exit sites of 5S 126 nucleosomes are cleaved ~700-fold better than the corresponding sites within 601 nucleosomes. Given 127 that DNA breathing occurs at least 100-fold more in 5S nucleosomes than 601 nucleosomes we propose 128 that Cas9 gains access to nucleosomal DNA when the DNA is transiently unpeeled from the histone 129 octamer. This model also explains why sites closer to the entry/exit sites are cut more readily by Cas9 130 than sites near the dyad. This is because DNA unpeeling up to the dyad is substantially less favored (100- 131 fold) for both the 601 and 5S nucleosomes than DNA unpeeling near their respective entry/exit sites 132 [36]. 133

7 134 In vivo, as in vitro, the precise position of nucleosomes can greatly affect DNA factor binding. Chromatin 135 remodeling enzymes can move nucleosomes away or towards the factor binding sites to respectively 136 enhance or inhibit factor binding. We find that Cas9 activity can also benefit from chromatin remodeling 137 to access nucleosomal DNA, as evidenced by the strong enhancements of Cas9 cleavage resulting from 138 the action of the chromatin remodelers SNF2h and RSC. These two remodelers produce distinct 139 nucleosomal arrangements yet still substantially alleviate nucleosome-mediated occlusion of Cas9 140 activity.

141

142 In combination, our data lead to a comprehensive model that reconciles both biochemical evidence and 143 in vivo observations to explain how Cas9 is able to access nucleosomal DNA in live cells (Fig. 3I). In vivo, 144 the majority of nucleosomes are not located on strong positioning sequences, and therefore may be 145 permissive to Cas9 binding, especially at target sites that are readily accessible by DNA unpeeling. 146 Chromatin remodeling activities can further provide diverse mechanisms to potentiate Cas9 activity at 147 sites located close to the nucleosomal dyad or within more strongly positioned nucleosomes, which 148 would otherwise be refractory to Cas9 action. We hypothesize that the combination of spontaneous 149 DNA unpeeling and remodeling contributes to the widespread success of CRISPR-Cas9 in eukaryotic 150 cells. 151

152 Interestingly, most applications of CRISPR-Cas9 in vivo have focused on genome engineering of protein- 153 coding genes and other functional genomic elements associated with gene expression, which are 154 typically associated with high rates of nucleosome remodeling [14]. It is also conceivable that Cas9 can 155 temporarily gain access to less accessible regions of the genome during specific points of cell cycle (e.g. 156 DNA replication), leading to sufficient DNA cleavage events to promote NHEJ-mediated mutagenesis or 157 HDR-mediated DNA integration at appreciable rates. Recent studies on Cas9’s behavior by single 158 molecule imaging have also demonstrated that Cas9 favors more accessible euchromatin regions but is 159 not completely excluded from transcriptionally silent heterochromatin [37]. For other CRISPR 160 applications that require stable binding of nuclease-deficient dCas9 to DNA, such as transcriptional 161 regulation and live-cell imaging with fluorescent dCas9, even modest nucleosome phasing could have a 162 dramatic impact [38]–[41]. A recent study has described, for example, how the +1 nucleosome in RNA 163 pol II-transcribed genes is strongly positioned with phasing that dissipates gradually with each following 164 nucleosome. Several high resolution studies conducted in parallel to our work have established that the

8 165 +1 nucleosome and resulting nucleosome phasing at gene bodies can exert a strong influence on dCas9’s 166 DNA-binding ability for transcriptional regulation, but the effect is less striking on genome editing with 167 Cas9 [35], [42]. 168

169 Our observations suggest that sgRNA design strategies that avoid targeting near the dyad of strongly 170 phased nucleosomes are likely to be more successful than current methods. Large scale nucleosome 171 positioning or DNA accessibility maps are now readily available and can inform CRISPR sgRNA design in 172 order to avoid targeting regions of low accessibility [43]–[46]. Alternatively, whole cell chromatin de- 173 condensation or de-repression using chromatin factor drugs such as HDAC or DNA methyltransferase 174 inhibitors may be an alternative and attractive strategy for improving CRISPR-Cas9 activity towards 175 densely compact regions of chromatin [47], [48].

176 177

9 178 Methods

179 Cas9 and sgRNA preparation 180 Wild-type Streptococcus pyogenes Cas9 and catalytically-inactive Cas9 (dCas9) containing D10A and 181 H840A mutations were individually cloned into a custom pET-based expression vector encoding an N- 182 terminal 6xHis-tag followed by a small ubiquitin-related modifier (SUMO) fusion tag and a Ulp1 protease 183 cleavage site. Recombinant Cas9 variants were then expressed in Escherichia coli strain BL21 (DE3) 184 (Novagen) and further purified to homogeneity as previously described [21]. 185 186 Single guide RNAs (sgRNAs) were prepared by in vitro run-off transcription using recombinant His-tagged 187 T7 RNA polymerase and PCR product templates. Briefly, the DNA templates containing a T7 promoter, a 188 20-nt target DNA sequence (listed in Table 1) and an optimal 78-nt sgRNA scaffold were PCR amplified 189 using Phusion Polymerase (NEB) according to manufacturer’s protocol. The following PCR products were 190 used directly as DNA templates for in vitro RNA synthesis in 1x transcription buffer (30 mM Tris-HCl pH

-1 191 8.1, 20 mM MgCl2, 2 mM spermidine, 10 mM DTT, 0.1% Triton X-100, 5 mM each NTP, and 100 μg mL 192 T7 RNA polymerase). After incubation at 37°C for 4-8 h, the reactions were further treated with RNase- 193 free DNaseI (Promega) at 37°C for 30 min to remove the DNA templates. The synthesized sgRNAs were

194 purified by Ambion MEGAclear kit and eluted into DEPC-treated H2O for downstream experiments. 195 196 Table 1 – Spacer sequences for sgRNAs used in biochemistry experiments

Target sgRNA # Guide sequence PAM Figures where used strand 601_1 CGAGTTCATCCCTTATGTGA TGG Antisense Fig. 1D Fig. 1D, Fig. 2B-D, Fig. 2 601_2 (entry) AATTGAGCGGCCTCGGCACC GGG Sense Suppl. 1, Fig. 3E-H, Fig. 3 Suppl. 1D-E Fig. 1B-D, Fig. 1 Suppl. 601_3 (core) CCCCCGCGTTTTAACCGCCA AGG Antisense 1B-C, Fig. 2B-D, Fig. 2 Suppl. 1 601_4 GTATATATCTGACACGTGCC TGG Sense Fig. 1D 601_5 TCGCTGTTCAATACATGCAC AGG Sense Fig. 1D 601_6 GCGACCTTGCCGGTGCCAGT CGG Antisense Fig. 1D 5S_1 (entry) TCTGATCTCTGCAGCCAAGC AGG Sense Fig. 2B-E, Fig. 2 Suppl. 1 5S_2 (core) TATGGCCGTAGGCGAGCACA AGG Antisense Fig. 2B-E, Fig. 2 Suppl. 1 197 198 Nucleosome Reconstitution

10 199 Gradient salt dialysis was used to assemble mono-nucleosomes on DNA templates containing the 147 bp 200 long 601 or the 5S positioning sequence from X. borealis (listed in Table 2), and labeled with fluorescein 201 on the 5’ upstream end. Histones and histone octamers were prepared as previously described [49]. 202

203 Table 2 – Sequences for DNA molecules used for biochemical assays (Positioning sequence highlighted in 204 grey)

Name Sequence 601 80/80 CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCT ATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCAC CGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCA GGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCTTGCCGGTGCCAGTCGGAT AGTGTTCCGAGCTCCCACTCTAGAGGATCCCCGGGTACCGA 601 0/0 CTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCAC GTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAG ATATATACATCCTGT 601 80/0 CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCT ATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCAC CGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCA GGCACGTGTCAGATATATACATCCTGT 5S 0/0 GGCCCGACCCTGCTTGGCTGCAGAGATCAGACGATATCGGGCACTTTCAGGGTGGTATGGCCGTA GGCGAGCACAAGGCTGACTTTTCCTCCCCTTGTGCTGCCTTCTGGGGGGGGCCCAGCCGGATCCCC GGGCGAGCTCGAATT 205 206 207 Cas9 Cleavage Assays 208 Cleavage assays were conducted as previously described with the following modifications [50]. 209 Cas9:sgRNA complexes were reconstituted by incubating Cas9 and sgRNA for 10 minutes at 37°C. 210 Reactions contained 5 nM fluorescein labeled DNA or nucleosomes and 100 nM Cas9:sgRNA. In 211 combined cleavage and remodeling experiments, 25 nM SNF2h or 3 nM RSC was first incubated with 5 212 nM naked DNA or nucleosomes for 45 minutes at 37°C [31]. Cleavage assays were carried out in reaction

213 buffer (20 mM Tris-HCl pH 7.5, 70 mM KCl, 5 mM MgCl2, 5% Glycerol, and 1 mM DTT) at 25°C. For SNF2h 214 and RSC remodeling experiments, 0.2 mM ATP was also added. For RSC remodeling experiments, 1 mM

215 MgCl2 was used. Time points were quenched using stop buffer (20 mM Tris-HCl pH 7.5, 70 mM EDTA, 2% 216 SDS, 20% glycerol, and 0.2 mg/mL xylene cyanol and bromophenol blue). Proteins were digested with 3 217 mg/mL of Proteinase K and incubated at 50°C for 20 minutes. Samples were resolved on 1x TBE, 10% 218 Polyacrylamide gels for 4 hours at 140V before visualizing using a Typhoon scanner (GE Healthcare) and 219 quantifying with ImageJ [51]. For band quantification, background intensity was first subtracted after

11 220 averaging the intensity of three areas. For cleavage gels, fraction uncleaved was determined by 221 measuring the intensity of the uncleaved band compared to the total intensity for the lane. Similarly, 222 fraction unbound was determined by measuring the intensity of the unbound band compared to the 223 total intensity for the lane. 224 All experiments were performed in triplicate. Experiment variability is presented as the standard error of 225 the mean, calculated by the standard deviation divided by the square root of N. 226 227 Propagation of error for Rates of Cleavage on Nucleosomes to Rates of Cleavage on DNA was calculated 228 as follows: 229 � ��� ! ��� ! ����� = !"#$%&'&(! !"#$%&'&(%' + !"# �!"# �!"#$%&'&(%' �!"# 230 231 232 Data were fit on Graphpad Prism using a standard one phase decay model:

(!!") � = �! − ������� � + �������

233 where Y is the fraction of uncleaved DNA, Y0 is the value of Y at time = 0, k is the observed rate constant 234 (min-1) and t is time (min). 235 236 Native Gel Mobility Shift Assays 237 dCas9 and a 2x molar ratio of sgRNA were incubated for 10 min at 37°C. Various concentrations of 238 dCas9:sgRNA complex were incubated with 20 nM naked DNA or nucleosomes in binding buffer (20 mM

239 Tris-HCl pH 7.5, 100 mM KCl, 5 mM MgCl2, 5% Glycerol, 1 mM DTT, and 0.02% NP-40). Samples were 240 incubated at room temperature for 1 hour before being run on native 0.5X TBE 6% polyacrylamide gels, 241 visualized on a Typhoon scanner, and quantified using ImageJ. Fraction unbound was measured as the 242 intensity of all unbound species divided by the total intensity. Fraction unbound was then converted to 243 fraction bound: �������� ����� = 1 − �������� �������

244 ,and binding curves were fit with:

[!"#!:!"#$%]! 245 �������� ����� = ! ! ( !"#!:!"#$% !!!/!)

12

Acknowledgments

We would like to thank members of the Narlikar Lab, especially Nathan Gamarra, Coral Zhou, and Stephanie Johnson for providing reagents and assistance and members of the Lim lab, especially Scott Coyle, Levi Rupp, Amir Mitchell and Russell Gordley for assistance and helpful discussions during the planning and preparation of this manuscript.

References

[1] K. S. Makarova, Y. I. Wolf, O. S. Alkhnbashi, F. Costa, S. A. Shah, S. J. Saunders, R. Barrangou, S. J. J. Brouns, E. Charpentier, D. H. Haft, P. Horvath, S. Moineau, F. J. M. Mojica, R. M. Terns, M. P. Terns, M. F. White, A. F. Yakunin, R. A. Garrett, J. van der Oost, R. Backofen, and E. V. Koonin, “An updated evolutionary classification of CRISPR-Cas systems,” Nat. Rev. Microbiol., vol. 13, no. 11, pp. 722–736, Nov. 2015. [2] J. A. Doudna and E. Charpentier, “The new frontier of genome engineering with CRISPR-Cas9,” Science, vol. 346, no. 6213, p. 1258096, Nov. 2014. [3] L. Cong, F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. a Marraffini, and F. Zhang, “Multiplex Genome Engineering Using CRISPR/Cas Systems.,” Science, vol. 819, Jan. 2013. [4] M. Jinek, K. Chylinski, I. Fonfara, M. Hauer, J. A. Doudna, and E. Charpentier, “A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity.,” Science, Jun. 2012. [5] M. Jinek, A. East, A. Cheng, S. Lin, E. Ma, and J. Doudna, “RNA-programmed genome editing in human cells.,” eLife, vol. 2, p. e00471, Jan. 2013. [6] P. Mali, L. Yang, K. M. Esvelt, J. Aach, M. Guell, J. E. Dicarlo, J. E. Norville, and G. M. Church, “RNA- Guided Human Genome Engineering via Cas9.,” Science, vol. 823, Jan. 2013. [7] M. Ghorbal, M. Gorman, C. R. Macpherson, R. M. Martins, A. Scherf, and J.-J. Lopez-Rubio, “Genome editing in the human malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system,” Nat. Biotechnol., vol. 32, no. 8, pp. 819–821, Aug. 2014. [8] V. K. Vyas, M. I. Barrasa, and G. R. Fink, “A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families,” Sci. Adv., vol. 1, no. 3, p. e1500248, Apr. 2015. [9] A. Travers and G. Muskhelishvili, “Bacterial chromatin,” Curr. Opin. Genet. Dev., vol. 15, no. 5, pp. 507–514, Oct. 2005. [10] K. Luger, A. W. Mäder, R. K. Richmond, D. F. Sargent, and T. J. Richmond, “Crystal structure of the nucleosome core particle at 2.8 Å resolution,” Nature, vol. 389, no. 6648, pp. 251–260, Sep. 1997. [11] A. L. Olins and D. E. Olins, “Spheroid chromatin units (v bodies),” Science, vol. 183, no. 4122, pp. 330–332, Jan. 1974. [12] C. L. F. Woodcock, J. P. Safer, and J. E. Stanchfield, “Structural repeating units in chromatin: I. Evidence for their general occurrence,” Exp. Cell Res., vol. 97, no. 1, pp. 101–110, Jan. 1976. [13] J. R. Dixon, S. Selvaraj, F. Yue, A. Kim, Y. Li, Y. Shen, M. Hu, J. S. Liu, and B. Ren, “Topological domains in mammalian genomes identified by analysis of chromatin interactions,” Nature, vol. 485, no. 7398, pp. 376–380, May 2012. [14] C. R. Clapier and B. R. Cairns, “The Biology of Chromatin Remodeling Complexes,” Annu. Rev. Biochem., vol. 78, no. 1, pp. 273–304, 2009. [15] G. J. Narlikar, R. Sundaramoorthy, and T. Owen-Hughes, “Mechanisms and Functions of ATP- Dependent Chromatin-Remodeling Enzymes,” Cell, vol. 154, no. 3, pp. 490–503, Jan. 2013.

13 [16] P. T. Lowary and J. Widom, “New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning1,” J. Mol. Biol., vol. 276, no. 1, pp. 19–42, Feb. 1998. [17] K. J. Polach and J. Widom, “Mechanism of Protein Access to Specific DNA Sequences in Chromatin: A Dynamic Equilibrium Model for Gene Regulation,” J. Mol. Biol., vol. 254, no. 2, pp. 130–149, Nov. 1995. [18] G. Li and J. Widom, “Nucleosomes facilitate their own invasion,” Nat. Struct. Mol. Biol., vol. 11, no. 8, pp. 763–769, Aug. 2004. [19] K. Luger, M. L. Dechassa, and D. J. Tremethick, “New insights into nucleosome and chromatin structure: an ordered state or a disordered affair?,” Nat. Rev. Mol. Cell Biol., vol. 13, no. 7, pp. 436–447, Jul. 2012. [20] S. H. Sternberg, S. Redding, M. Jinek, E. C. Greene, and J. A. Doudna, “DNA interrogation by the CRISPR RNA-guided endonuclease Cas9,” Nature, vol. 507, no. 7490, pp. 62–67, Mar. 2014. [21] F. Jiang, K. Zhou, L. Ma, S. Gressel, and J. A. Doudna, “A Cas9–guide RNA complex preorganized for target DNA recognition,” Science, vol. 348, no. 6242, pp. 1477–1481, Jun. 2015. [22] S. H. Sternberg, B. LaFrance, M. Kaplan, and J. A. Doudna, “Conformational control of DNA target cleavage by CRISPR–Cas9,” Nature, vol. 527, no. 7576, pp. 110–113, Nov. 2015. [23] E. A. Josephs, D. D. Kocak, C. J. Fitzgibbon, J. McMenemy, C. A. Gersbach, and P. E. Marszalek, “Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage,” Nucleic Acids Res., p. gkv892, Sep. 2015. [24] J. M. Hinz, M. F. Laughery, and J. J. Wyrick, “Nucleosomes Inhibit Cas9 Endonuclease Activity in vitro,” Biochemistry (Mosc.), Nov. 2015. [25] J. D. Anderson, A. Thåström, and J. Widom, “Spontaneous Access of Proteins to Buried Nucleosomal DNA Target Sites Occurs via a Mechanism That Is Distinct from Nucleosome Translocation,” Mol. Cell. Biol., vol. 22, no. 20, pp. 7147–7157, Oct. 2002. [26] P. D. Partensky and G. J. Narlikar, “Chromatin Remodelers Act Globally Sequence Positions Nucleosomes Locally,” J. Mol. Biol., vol. 391, no. 1, p. 12, Aug. 2009. [27] G. Längst, E. J. Bonte, D. F. V. Corona, and P. B. Becker, “Nucleosome Movement by CHRAC and ISWI without Disruption or trans-Displacement of the Histone Octamer,” Cell, vol. 97, no. 7, pp. 843–852, Jun. 1999. [28] X. He, H.-Y. Fan, G. J. Narlikar, and R. E. Kingston, “Human ACF1 Alters the Remodeling Strategy of SNF2h,” J. Biol. Chem., vol. 281, no. 39, pp. 28636–28647, Sep. 2006. [29] J. G. Yang, T. S. Madrid, E. Sevastopoulos, and G. J. Narlikar, “The chromatin-remodeling enzyme ACF is an ATP-dependent DNA length sensor that regulates nucleosome spacing,” Nat. Struct. Mol. Biol., vol. 13, no. 12, pp. 1078–1083, Dec. 2006. [30] C. E. Rowe and G. J. Narlikar, “The ATP-Dependent Remodeler RSC Transfers Histone Dimers and Octamers through the Rapid Formation of an Unstable Encounter Intermediate,” Biochemistry (Mosc.), vol. 49, no. 45, pp. 9882–9890, Nov. 2010. [31] G. J. Narlikar, M. L. Phelan, and R. E. Kingston, “Generation and Interconversion of Multiple Distinct Nucleosomal States as a Mechanism for Catalyzing Chromatin Fluidity,” Mol. Cell, vol. 8, no. 6, pp. 1219–1230, Dec. 2001. [32] Y. Lorch, B. R. Cairns, M. Zhang, and R. D. Kornberg, “Activated RSC–Nucleosome Complex and Persistently Altered Form of the Nucleosome,” Cell, vol. 94, no. 1, pp. 29–34, Jul. 1998. [33] G. Schnitzler, S. Sif, and R. E. Kingston, “Human SWI/SNF Interconverts a Nucleosome between Its Base State and a Stable Remodeled State,” Cell, vol. 94, no. 1, pp. 17–27, Jul. 1998. [34] C. R. Clapier and B. R. Cairns, “The Biology of Chromatin Remodeling Complexes,” Annu. Rev. Biochem., vol. 78, no. 1, pp. 273–304, 2009.

14 [35] M. A. Horlbeck, L. B. Witkowsky, B. Guglielmi, J. M. Replogle, L. A. Gilbert, J. E. Villalta, S. E. Torigoe, R. Tijan, and J. S. Weissman, “Nucleosomes impede Cas9 access to DNA in vivo and in vitro,” eLife, vol. 5, p. e12677, Mar. 2016. [36] J. D. Anderson and J. Widom, “Sequence and position-dependence of the equilibrium accessibility of nucleosomal DNA target sites1,” J. Mol. Biol., vol. 296, no. 4, pp. 979–987, Mar. 2000. [37] S. C. Knight, L. Xie, W. Deng, B. Guglielmi, L. B. Witkowsky, L. Bosanac, E. T. Zhang, M. E. Beheiry, J.- B. Masson, M. Dahan, Z. Liu, J. A. Doudna, and R. Tjian, “Dynamics of CRISPR-Cas9 genome interrogation in living cells,” Science, vol. 350, no. 6262, pp. 823–826, Nov. 2015. [38] L. a Gilbert, M. H. Larson, L. Morsut, Z. Liu, G. a Brar, S. E. Torres, N. Stern-Ginossar, O. Brandman, E. H. Whitehead, J. a Doudna, W. a Lim, J. S. Weissman, and L. S. Qi, “CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.,” Cell, vol. 154, no. 2, pp. 442–51, Jul. 2013. [39] P. Mali, J. Aach, P. B. Stranges, K. M. Esvelt, M. Moosburner, S. Kosuri, L. Yang, and G. M. Church, “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering.,” Nat. Biotechnol., no. August, Aug. 2013. [40] B. Chen, L. A. Gilbert, B. A. Cimini, J. Schnitzbauer, W. Zhang, G.-W. Li, J. Park, E. H. Blackburn, J. S. Weissman, L. S. Qi, and B. Huang, “Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System,” Cell, vol. 155, no. 7, pp. 1479–1491, Dec. 2013. [41] H. Ma, A. Naseri, P. Reyes-Gutierrez, S. A. Wolfe, S. Zhang, and T. Pederson, “Multicolor CRISPR labeling of chromosomal loci in human cells,” Proc. Natl. Acad. Sci., vol. 112, no. 10, pp. 3002– 3007, Mar. 2015. [42] J. D. Smith, S. Suresh, U. Schlecht, M. Wu, O. Wagih, G. Peltz, R. W. Davis, L. M. Steinmetz, L. Parts, and R. P. St.Onge, “Quantitative CRISPR interference screens in yeast identify chemical-genetic interactions and new rules for guide RNA design,” Genome Biol., vol. 17, p. 45, 2016. [43] C. Jiang and B. F. Pugh, “Nucleosome positioning and gene regulation: advances through genomics,” Nat. Rev. Genet., vol. 10, no. 3, pp. 161–172, Mar. 2009. [44] R. E. Thurman, E. Rynes, R. Humbert, J. Vierstra, M. T. Maurano, E. Haugen, N. C. Sheffield, A. B. Stergachis, H. Wang, B. Vernot, K. Garg, S. John, R. Sandstrom, D. Bates, L. Boatman, T. K. Canfield, M. Diegel, D. Dunn, A. K. Ebersol, T. Frum, E. Giste, A. K. Johnson, E. M. Johnson, T. Kutyavin, B. Lajoie, B.-K. Lee, K. Lee, D. London, D. Lotakis, S. Neph, F. Neri, E. D. Nguyen, H. Qu, A. P. Reynolds, V. Roach, A. Safi, M. E. Sanchez, A. Sanyal, A. Shafer, J. M. Simon, L. Song, S. Vong, M. Weaver, Y. Yan, Z. Zhang, Z. Zhang, B. Lenhard, M. Tewari, M. O. Dorschner, R. S. Hansen, P. A. Navas, G. Stamatoyannopoulos, V. R. Iyer, J. D. Lieb, S. R. Sunyaev, J. M. Akey, P. J. Sabo, R. Kaul, T. S. Furey, J. Dekker, G. E. Crawford, and J. A. Stamatoyannopoulos, “The accessible chromatin landscape of the human genome,” Nature, vol. 489, no. 7414, pp. 75–82, Sep. 2012. [45] Y. Wu, W. Zhang, and J. Jiang, “Genome-Wide Nucleosome Positioning Is Orchestrated by Genomic Regions Associated with DNase I Hypersensitivity in Rice,” PLoS Genet, vol. 10, no. 5, p. e1004378, May 2014. [46] T.-H. S. Hsieh, A. Weiner, B. Lajoie, J. Dekker, N. Friedman, and O. J. Rando, “Mapping Nucleosome Resolution Chromosome Folding in Yeast by Micro-C,” Cell, vol. 162, no. 1, pp. 108–119, Jul. 2015. [47] T. Haaf, “The effects of 5-azacytidine and 5-azadeoxycytidine on chromosome structure and function: Implications for methylation-associated cellular processes,” Pharmacol. Ther., vol. 65, no. 1, pp. 19–46, 1995. [48] K. F. Tóth, T. A. Knoch, M. Wachsmuth, M. Frank-Stöhr, M. Stöhr, C. P. Bacher, G. Müller, and K. Rippe, “Trichostatin A-induced histone acetylation causes decondensation of interphase chromatin,” J. Cell Sci., vol. 117, no. 18, pp. 4277–4287, Aug. 2004. [49] K. Luger, T. J. Rechsteiner, and T. J. Richmond, “Preparation of nucleosome core particle from recombinant histones,” vol. 304, B.-M. in Enzymology, Ed. Academic Press, 1999, pp. 3–19.

15 [50] C. Anders and M. Jinek, “Chapter One - In Vitro Enzymology of Cas9,” in Methods in Enzymology, vol. 546, J. A. D. and E. J. Sontheimer, Ed. Academic Press, 2014, pp. 1–20. [51] C. A. Schneider, W. S. Rasband, and K. W. Eliceiri, “NIH Image to ImageJ: 25 years of image analysis,” Nat. Methods, vol. 9, no. 7, pp. 671–675, Jul. 2012.

16 Figure 1: Cas9 DNA nuclease activity is hindered by nucleosomes

(A) Schematic of sgRNAs designed against the assembled 601 80/80 nucleosome substrates targeting the flanking regions, entry/exit sites, and near the nucleosomal dyad. (B) Cleavage assay comparing Cas9 cleavage on 80/80 DNA and 80/80 nucleosomes when loaded with sgRNA #3. (C) Kinetics of cleavage with sgRNA #3. (D) Comparison of the relative rates of cleavage on nucleosomes to DNA at various positions along the 80/80 nucleosome construct. The position reported is the site of cleavage by Cas9. Represented values are mean ± SEM from three replicates.

Figure 1 Supplement 1: Nucleosome positioning blocks Cas9 from binding PAM sites on DNA

(A) Schematic illustrating the stepwise mechanism of Cas9 binding to DNA targets and subsequent nucleolytic cleavage. (B) Gel shift assay comparing dCas9 binding to 0/0 DNA and nucleosomes while loaded with sgRNA #3 targeting the nucleosome dyad. Band shift pattern appears as discrete lower band (dCas9 bound to sgRNA-specified target, arrowhead) and higher, super shift bands (additional dCas9 PAM-only binding events). (C) Quantification of (B). Represented values are mean ± SEM from three replicates.

Figure 2: Higher nucleosomal breathing dynamics enhance Cas9 cleavage

(A) Schematic illustrating nucleosome breathing and how it can enable Cas9 binding to a target in the nucleosome. (B) Cleavage assay comparing Cas9 cleavage of 601 and 5S 0/0 nucleosomes when loaded with sgRNAs targeting comparable positions at core and entry sites. (C) Quantification of (B). (D) Cas9 cleavage rates on 601 and 5S nucleosomes when targeted to core and entry sites. Values were normalized against naked DNA control rates. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 2 Supplement 1.

Figure 2 Supplement 1: Cas9 cleavage assay with 601 and 5S 0/0 nucleosomes

Representative gel images of Cas9 cleavage experiments with 601 (left) and 5S (right) 0/0 particles using sgRNAs targeting entry (top) or core (bottom) sites, including DNA control experiments. Samples were resolved on 12% (entry) or 8% (core) polyacrylamide gels. Cleavage with sgRNAs targeting the entry site on both 5S and 601 substrates generates a short cleavage product (13 bp) which partially denatures and runs as two bands (single and double stranded) on 12% polyacrylamide gels.

Figure 3: Chromatin remodeling improves Cas9 cleavage of nucleosomal substrates

(A) Schematic of Cas9 cleavage assay with remodeling. Cas9 is presented with 601 nucleosomes either untreated or previously remodeled with SNF2h or RSC remodelers. (B) Assay comparing cleavage on untreated and remodeled 80/0 nucleosomes when Cas9 is targeted to exit site (depicted in green). These asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (C) Quantification of (B). (D) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the

17 presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~35% of the naked DNA cleavage rate. (E) Assay comparing Cas9-mediated cleavage at entry site of 80/80 symmetric 601 nucleosomes, either untreated or previously treated with RSC remodeler. RSC can destabilize nucleosome structure and reposition nucleosomes towards the DNA ends. (F) Quantification of (E) (G) Comparison of the rates of cleavage of nucleosomes normalized to DNA control with and without the action of RSC chromatin remodeler. Mean enhancement rates of Cas9 activity by chromatin remodeling are shown. (H) Cleavage rates of 80/80 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of RSC. Cas9 cleavage is substantially enhanced by RSC, attaining ~63% of the naked DNA cleavage rate. Represented values are mean ± SEM from three replicates. Additional gel panels shown in Figure 3 Supplement 1. (I) Model of Cas9 activity in vivo in eukaryotes. Left, stable and strongly positioned nucleosomes impede Cas9 activity (downward arrows). However, nucleosomes in vivo are generally more dynamic (breathing), allowing Cas9 opportunities to target underlying DNA (center). Cas9 accessibility to nucleosomal DNA can be further enhanced by the activity of chromatin remodelers that destabilize and/or reposition nucleosomes (right).

Figure 3 Supplement 1: Cas9 cleavage assays with SNF2h and RSC chromatin remodelers

(A) Representative gel images of Cas9 cleavage experiments with 601 80/0 asymmetric particles and SNF2h chromatin remodeler, including DNA control experiments. Cas9 was loaded with sgRNA targeting the exit site of the nucleosome. SNF2h re-centers asymmetric nucleosomes such as 80/0 (Figure 3 Supplement 3), exposing the Cas9 target site. (B) Quantification of (A). (C) Representative gel images of Cas9 cleavage experiments with 601 80/80 symmetric nucleosomes and RSC chromatin remodeler, including DNA control experiments. Cas9 was targeted to the entry site of the nucleosome. RSC destabilizes nucleosomal structure and repositions nucleosomes to the ends of the DNA molecule. (D) Quantification of (C). Represented values are mean ± SEM from three replicates.

Figure 3 Supplement 2: Simultaneous chromatin remodeling and Cas9 cleavage of nucleosomal substrates

(A) Assay comparing Cas9 cleavage of 601 80/0 nucleosomes simultaneously with chromatin remodeling by SNF2h. The 601 80/0 asymmetric nucleosomes are recentered by SNF2h, exposing the exit target site to Cas9 (B) Quantification of (A). (C) Cleavage rates of 80/0 nucleosomes by Cas9 relative to naked DNA, in the presence or absence of SNF2h. SNF2h improves Cas9 cleavage to ~40% of the naked DNA cleavage rate, similarly to sequential remodeling and cleavage assays shown in Fig. 3A-D. Results shown for single experiment performed.

Figure 3 Supplement 3: SNF2h and RSC remodel nucleosomes prior to Cas9 cleavage

Gel-shift nucleosome remodeling assay comparing positioned and SNF2h-remodeled 80/0 nucleosomes (left) or RSC-remodeled 80/80 nucleosomes (right). Migration pattern for all three forms (centered, end- positioned nucleosomes and free DNA) is illustrated (center). Remodeling reactions were carried out 1 hour before being quenched and run on a 5% Acrylamide 0.5x TBE gel. SNF2h remodels 80/0 end-

18 positioned nucleosomes in a range of nucleosome positions biased towards the center of the DNA molecule, whereas RSC has the opposite bias of repositioned centered nucleosomes towards the ends of the DNA molecule. Images shown for single experiments performed, as previously described [29], [30].

Source Data

Figure 1 Source Data 1-3

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNAs #2 and #6.

Figure 1 Source Data 4-5

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #5.

Figure 1 Source Data 6-7

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #1.

Figure 1 Source Data 8-9

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #3.

Figure 1 Source Data 10-11

Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #4.

Figure 1 Source Data 12

Quantification of Figure 1 Cas9 cleavage gels.

Figure 1 Supplement 1 Source Data 1-3

Replicate gels of dCas9 binding to 0/0 601 DNA and nucleosomes with sgRNA #3.

Figure 1 Supplement 1 Source Data 4

Quantification of Figure 1 Supplement 1 gel shifts.

Figure 2 Source Data 1-2

Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA Core.

Figure 2 Source Data 3-4

Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA Entry.

Figure 2 Source Data 5-6

Replicate gels of cleavage of 0/0 601 DNA and nucleosomes with sgRNA entry.

Figure 2 Source Data 7-8

Quantification of Figure 2 Cas9 cleavage gels.

19 Figure 3 Source Data 1-3

Replicate gels of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without prior remodeling by Snf2h.

Figure 3 Source Data 4

Quantification of Cas9 cleavage gels from Figure 3 source data 1-3.

Figure 3 Source Data 5-7

Replicate gels of cleavage of 80/80 DNA and nucleosomes using sgRNA 601_2 with or without prior remodeling by RSC.

Figure 3 Source Data 8

Quantification of Cas9 cleavage gels from Figure 3 source data 5-7.

Figure 3 Supplement 2 Source Data 1

Gel of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without simultaneous remodeling by Snf2h.

Figure 3 Supplement 3 Source Data 1

Test remodeling gel of 80/0 nucleosomes with Snf2h.

Figure 3 Supplement 3 Source Data 2

Test remodeling gel of 80/80 nucleosomes with RSC.

20 Figure 1

A. B. Cas9 core 80 bp601 80 bp 312 bp dyad

Cas9 cleavage assay (sgRNA #3 - core)

80/80 DNA 80/80 Nucleosomes Time 0 0.25 0.5 1 3 10 30 60 120 0 0.25 0.5 1 3 10 30 60 120 (min) 136

80 bp601 nucleosome 80 bp 312 bp uncut target 2 dyad 45 sites cut exit downstream upstream entry core linker site site linker

C. D. target 136 Cas9 cleavage kinetics (#3 - core) sites 601 nucleosome 1.0 2 dyad 45 0.8 Nucleosomes 1.5 0.6 1.0 0.4

0.2 DNA 0.5 Fraction uncleaved Fraction 0.0 0.0 0 20406080100120 (nucleosomes/DNA) Relative cleavage rate Time (min) 050 100 150 200 350 300 Position (bp) Figure 2

A. C. Cas9 cleavage kinetics (entry) Cas9

601 0/0 Nucleosomes 5S 0/0 Nucleosomes 1.0 1.0 0.8 Nucleosomes 0.8 Cas9 target Cas9 target 0.6 0.6 Nucleosomes occluded exposed 0.4 DNA 0.4 0.2 0.2 DNA nucleosome 0.0 0.0 breathing Uncleaved Fraction 0 50 100 050100 Time (min) Time (min) B. 0/0 nucleosomes and sgRNA target sites Cas9 cleavage kinetics (core) core core 601 0/0 Nucleosomes 5S 0/0 Nucleosomes 601 5S 147 bp 1.0 1.0 entry entry 0.8 0.8 Nucleosomes Nucleosomes Cas9 cleavage (entry) 0.6 0.6 0.4 0.4 601 0/0 Nucleosomes 5S 0/0 Nucleosomes 0.2 0.2 DNA DNA Time Uncleaved Fraction 0.0 0.0 0 0.25 0.5 1 3 10 30 60 120 0 0.25 0.5 1 3 10 30 60 120 (min) 050100050100 Time (min) Time (min) uncut uncut D. cut cut Relative cleavage rates

 rate w/ naked DNA Cas9 cleavage (core) 

601 0/0 Nucleosomes 5S 0/0 Nucleosomes  Time 0 0.25 0.5 1 3 10 30 60 120 0 0.25 0.5 1 3 10 30 60 120 (min) 

uncut uncut 

cut  cut Relative Cleavage Rate (Nuclueosomes/DNA) 601 5S 601 5S entry entry core core Figure 3

A. B. C. D. Relative cleavage 601 80/0 Nucleosomes asymmetric Cas9 cleavage kinetics - 601 80/0 rates nucleosome rate w/ naked DNA 80 bp 601 232 bp 1.0 1.0 1XFOHRVRPHV dyad exit 0.8 0.8 Time 0.6 0.6 Cas9 0 0.25 0.5 1 3 10 30 60 120 (min) 1XF61)K SNF2h 0.4 0.4 Cas9 0.2 0.2

Fraction Uncleaved '1$61)K Cas9 0.0 0.0 Relative Rate (Nuc/DNA) + SNF2h 020406080100120 Cas9 Cas9 re-centered Time (min) + SNF2h nucleosome

E. F. 601 80/80 Nucleosomes G. H. Relative cleavage stable Cas9 cleavage kinetics - 601 80/0 rates nucleosome 80 bp601 80 bp 312 bp entry dyad rate w/ naked DNA 1.0 1.0 Time Nucleosomes 0 0.25 0.5 1 3 10 30 60 120 (min) 0.8 0.8 uncut Cas9 0.6 0.6 RSC Cas9 cut 0.4 Nuc. + RSC 0.4 0.2 0.2 uncut Fraction Uncleaved DNA + RSC Cas9 0.0 0.0 cut + RSC 0 20406080100120 Relative Rate (Nuc/DNA) Cas9 Cas9 destabilized Time (min) + RSC nucleosome I. Cas9

stable breathing remodeling