Molecular Epidemiology of House Dust Mites In

MOLECULAR EPIDEMIOLOGY OF HOUSE DUST MITES IN

POTHWAR, PAKISTAN

RUBABA SHAFIQUE

10-arid-1986

Department of Zoology/Biology Faculty of Sciences Pir Mehr Ali Shah Arid Agriculture University Rawalpindi Pakistan 2018

MOLECULAR EPIDEMIOLOGY OF HOUSE DUST MITES IN

POTHWAR, PAKISTAN

RUBABA SHAFIQUE

(10-arid-1986)

A thesis submitted in partial fulfillment of

the requirements for the degree of

Doctor of Philosophy

Zoology

Department of Zoology/Biology Faculty of Sciences Pir Mehr Ali Shah Arid Agriculture University Rawalpindi Pakistan 2018

CERTIFICATION

I hereby undertake that this research is an original and no part of this thesis fall under plagiarism. If found otherwise, at any stage, I will be responsible for the consequences.

Name: Rubaba Shafique Signature: ______Registration No: 10-arid-1986 Date: ______

Certified that, the contents and form of thesis entitled “Molecular

Epidemiology of House Dust Mites in Pothwar, Pakistan” submitted by Ms.

Rubaba Shafique have been found satisfactory for the requirement of degree.

Supervisor: ______(Dr. Shamim Akhter)

Co-Supervisor: ______(Dr. Muhammad Ismail)

Member: ______(Prof. Dr. Mazhar Qayyum)

Member: ______(Dr. Farhana Riaz Ch.)

Member: ______(Prof. Dr. Azra Khanum)

Chairman: ______

Dean: ______

Director Advanced Studies: ______

Dedicated to my beloved mother and my sweet family who stood by me throughout my PhD

iii

CONTENTS

Page List of Tables vii List of Figures viii List of Abbreviations ix List of Publications and Presentations xii Acknowledgments xiii ABSTRACT xv 1 INTRODUCTION 1 2 REVIEW OF LITERATURE 10 2.1 HYPERSENSITIVITY 10 2.2 ALLERGY (TYPE I HYPERSENSITIVITY) 11 2.3 EPIDEMIOLOGY OF ALLERGIC DISEASES 13

2.3.1 Physiology of Allergic Response 13 2.4 EPIDEMIOLOGY OF HDM ALLERGIES 18

2.5 HDM ASSOCIATED ALLERGY DISEASES 20 2.5.1 Asthma 21

2.5.2 Allergic Rhinitis 22

2.5.3 Atopic Dermatitis 23 2.5.4 Allergic Conjunctivitis 24 2.5.5 Anaphylaxis 25 2.5.6 Gastrointestinal Allergy 27 2.6 MORPHOLOGY OF PYROGLYPHIDS 27 2.6.1 The Mite Body 28 2.6.2 Water Balance 32 2.6.3 Life Cycle 33 2.6.4 Differential Anatomy of D. farinae and D. pteronyssinus 36 2.7 IMPORTANCE OF MOLECULAR CHARACTERIZATION 37 2.8 ENVIRONMENTAL FACTORS EFFECTING MITE 39

POPULATION 2.9 GEOGRAPHICAL DISTRIBUTION OF HDM 40 2.10 HDM ALLERGENS 47 2.10.1 The Peptidases 48 2.10.2 The Glycosidases 52

2.10.3 The Transferases 54 2.10.4 The Lipid-binding Proteins 55 2.10.5 The Muscle Proteins 59 2.10.6 Proteins of the Cytoskeleton 61 2.10.7 Other Allergens 63 2.11 POLYMORPHISM IN HDM ALLERGENS 65 3 MATERIALS AND METHODS 69 3.1 EPIDEMIOLOGICAL STATUS OF HDM ALLERGIES 69 3.1.1 Data Collection 69 3.1.2 Skin Prick Test (SPT) 69 3.2 SPECIES DIVERSITY OF HDM 69 3.2.1 Study Site 70 3.2.2 Study Design 70 3.2.3 Calculation of Sample size 70 3.2.4 Sampling Protocol 76 3.2.5 Isolation of HDM in the Dust Sample 76 3.2.6 Morphological Characterization 78 3.2.7 Molecular Characterization 78 3.2.7.1 DNA extraction from single mites 78 3.2.7.2 PCR for RFLP 79 3.2.7.3 Gel electrophoresis 80 3.3 MOLECULAR CHARACTERIZATION OF HDM ALLERGENS 80 3.3.1 Quantification of Group 1 Allergens in the Environment 80 3.3.2 ELISA for Der p 1 and Der f 1 levels 82 3.3.3 Polymorphism in Group 1 Allergens 82 3.3.4 HDM Samples 82 3.3.5 Amplification by Nested PCR 83 3.3.6 Sequencing and Analysis 83 4 RESULTS AND DISCUSSION 86 4.1 EPIDEMIOLOGICAL STATUS OF HDM ALLERGIES 86 4.2 IDENTIFICATION AND PREVALENCE OF HDM 93 4.2.1 Species Diversity 93 4.2.2 Comparison of Mite Counts between Random and Patient houses 100 4.2.3 Seasonal Variation 103

4.3 MOLECULAR CHARACTERIZATION OF HDM ALLERGENS 103 4.3.1 Group 1 Allergen Levels 103 4.3.2 Group 1 Allergen Polymorphism 108 4.3.2.1 Der f1 gene polymorphism 114 4.3.2.2 Der p1 gene polymorphism 114 4.3.2.3 Polypeptide analysis 120 4.4 CONCLUSION 130 SUMMARY 133 LITERATURE CITED 137 APPENDICES 212

List of Tables

Table No. Page 3.1 Sampling Sites 72 3.2 Overall sampling strategy 75 3.3 Expected product size and fragment length of mite species 81 3.4 Primers used in nested PCR 84 4.1 Year wise percent sensitization to HDM allergens, pollens and food 87 allergens 4.2 Pairwise comparison of sensitivity to HDM, Pollen and food 89 allergens 4.3 Gender bias in allergen sensitization. 90 4.4 Mite counts based on morphological examination 98 4.5 Pairwise comparison of mean mite counts 99 4.6 Mean mite counts from random vs. patients’ houses 101 4.7 Seasonal variation in pyroglyphid mites 104 4.8 Der f 1 and Der p1 allergen levels in dust from selected samples 105 4.9 Seasonal variation in Der p1 and Der f 1 levels in dust samples 110 4.10 Exons, introns, and sequence polymorphism in the group 1 115 allergen-encoding gene in two house dust mite species 4.11 Geographical polymorphism in the Der p 1 allergen 121 4.12 Percent Identity Matrix of Aligned Group1 Allergens 123 4.13 Comparison of conserved amino acid residues involved in 4C1mAb 127 and Ca+ binding epitopes in aligned group 1 allergens

vii

List of Figures

Figure No. Page 1.1 Phylogram showing recent classification of HDM 4 2.1 Relationship between hypersensitivity and immune response to 12 disease

2.2 Steps of allergic immune response 14 2.3 Segmentation of pyroglyphid body 29 2.4 Life cycle of HDM 35 3.1 Map of sampling sites (Pothwar) 71 3.2 Online sampling tool used to calculate the number of households 74 per cluster in the study area 3.3 Alteration/modification in the vacuum cleaner pipe for the 77 collection of dust samples 4.1 Year wise percent sensitization to HDM allergens, pollens and 88 food allergens 4.2 Gender bias in allergen sensitization 91 4.3 Comparative anatomy of pyroglyphid mites 94 4.4 Morphologically identified HDM species 95 4.5 ITS2 gene amplification 96 4.6 Restriction fragments of ITS 2 rDNA from D. farinae and D. 97 pteronyssinus 4.7 Mean mite counts from random vs. patients’ houses 102 4.8 Fluctuations in D. farinae count around the year 106 4.9 Fluctuations in D. pteronyssinus count around the year 107 4.10 Correlation between mite counts and allergen levels 109 4.11 Seasonal variations in Der p1 and Der f1 levels 111 4.12 Amplification of Der f 1 gene by nested PCR 112 4.13 Amplification of Der p1 gene by nested PCR 113 4.14 Gene map of Group 1 allergen 117 4.15 Alignment of group 1 allergens of selected mite species 118 4.16 I-TASSER result showing tertiary structure predictions for RS33 119 and RS31 4.17 Maximum likelihood tree of the group 1 allergen protein of 124 acariform mites 4.18 Alignment map of cysteine proteases from selected mite species 125

viii

List of Abbreviations

A. siro Acarus siro AC Allergic conjunctivitis AD Atopic dermatitis AE Atopic eczema AKC Atopic keratoconjunctivitis APCs Antigen presenting cells AR Allergic rhinitis B cells B lymphocytes B. tropicalis Blomia tropicalis CD4 Cluster of differentiation 4 CEA Critical equilibrium activity CEH Critical equilibrium humidity CLC Contact lens conjunctivitis COX 1 or CO1 Cytochrome c oxidase 1 D Aspartic acid D. farinae Dermatophagoides farinae D. microcerus Dermatophagoides microcerus D. pteronyssinus Dermatophagoides pteronyssinus D. siboney Dermatophagoides siboney DC Dendritic cells E Glutamic acid E. maynei Euroglyphus maynei EC number Enzyme Commission number ECP Eosinophilic cationic protein FcεR High affinity IgE receptor G Glycine G. domesticus Glycyphagus domesticus H. domicola Hirstia domicola HDM House dust mites I Isoleucine

IFN-γ Interferon gamma IgE Immunoglobin E IgG Immunoglobin G IgM Immunoglobin M IL-13 Interleukin-13 IL-4 Interleukin-4 I-TASSER Iterative Threading ASSEmbly Refinement ITS Internally transcribed spacer region L Leucine L. destructor Lepidoglyphus destructor LOD Limit of detection M. intermedius Malayoglyphus intermedius mAb monoclonal antibodies MBP Major basic protein MHC II Major histocompatibility complex II OD Optical density P. ovis Psoroptes ovis PAC Persistent or perennial allergic conjunctivitis PM Peritrophic membrane PPIase Peptidylprolyl cis-trans isomerase Q Glutamine R Arginine RH Relative humidity RT-PCR Reverse transcriptase-polymerase chain reaction S Serine S. scabiei Sarcoptes scabiei SAC Seasonal allergic conjunctivitis Serpins Serine protease inhibitors SPT Skin prick test T Threonine T. putrescentiae Tyrophagus putrescentiae TBE Tris-Borate-EDTA T-cells T-lymphocytes

TCR T-cell receptors Th0 Naïve T-helper cells Th1 T-helper cells 1 Th2 T-helper cells 2 TPI Triosephosphate isomerases VKC Vernal keratoconjunctivitis W Tryptophan WAO World Allergy Organization Y Tyrosine

List of Publications and Presentations

International peer-reviewed publications

 Shafique et al., 2014. Group 1 Allergen Genes in Two Species of House Dust Mites, Dermatophagoides farinae and D. pteronyssinus (Acari: Pyroglyphidae): Direct Sequencing, Characterization and Polymorphism. PLOS ONE. 9(12): e114636. doi:10.1371/journal.pone.0114636. USA.

 Shafique et al., 2012. Group 10 allergens (Tropomyosin) from House Dust Mites may be a cause of covariation of sensitization to allergens from other invertebrates. Journal of Allergy and Rhinology, USA.

GenBank

 Shafique et al., 2014. Dermatophagoides farinae isolate RS17 cysteine proteinase-1 preproenzyme gene, partial cds GenBank: KJ542065.1 http://www.ncbi.nlm.nih.gov/nuccore/KJ542065

 Shafique et al., 2014. Dermatophagoides pteronyssinus isolate RS12 cysteine proteinase-1 preproenzyme gene, partial cds GenBank: KJ542087.1 http://www.ncbi.nlm.nih.gov/nuccore/KJ542087

xii

Acknowledgments

In the name of Allah, the Most Gracious and the Most Merciful All praise to Allah, who blessed me with strength and guided me through all obstacles and difficulties faced in completion of this dissertation.

I wish to express my sincere thanks to Dr. Shamim Akhter, Chairperson,

Department of Zoology and Biology, whose continuous support and suggestions were always helpful in academic matters during my PhD. I am also grateful to Prof.

Dr. Mazhar Qayyum for his generous support throughout my PhD. I wish to acknowledge Dr. Ismail, my co-supervisor for his extended research support at

Institute of Biomedical and Genetic Engineering (IBGE), Islamabad.

I would like to express my sincere and heart felt appreciation to Dr. Pavel

Klimov, my supervisor at Department of Ecology and Evolutionary Biology,

University of Michigan, USA, for his supervision, constructive comments and suggestions throughout the experimental and investigation work that, has contributed to the success of this research. Not forgotten, my appreciation to Dr. Barry M.

Oconnor (Associate Curator, Department of Ecology and Evolutionary Biology,

University of Michigan, USA) for his hospitality and support during my stay at the

University of Michigan.

I extend my special thanks to IRSIP-Team, Higher Education Commission,

Pakistan, for their timely funding and support which helped me gain unmatched research experience at the University of Michigan. I am also thankful to Pakistan

Science Foundation, Islamabad for funding this work under project number

xiii

PSF/Res/C-IBGE/Med (318).

I wish to acknowledge esteemed members of faculty, with special mention of Prof. Dr. Azra Khanam (member supervisory committee) for positive critique of my work and Dr. Afsar Mian for the faith he has always shown in my abilities.

Sincere thanks to all my friends and family (specially my husband) who stood by me during times of stress and despair. Their emotional support was the drive behind the accomplishment of this degree. I extend my deepest gratitude, to those who indirectly contributed in this research i.e. my Lab fellows Qaiser, Ammarah,

Noureen and everyone else, their kindness means a lot to me.

And last but not the least all those who helped me in the collection of house dust samples and made this humongous task possible.

Thank you all very much.

Rubaba Hamid Shafique

xiv

ABSTRACT

Association between sensitivity to house dust mite (HDM) allergens and allergic disorders is well known. Modern housing, genetic traits and environmental pollution are the major causes of increased prevalence of HDM allergy. The aim of this study was to estimate the epidemiological status of HDM allergy in Pothwar region. Samples of house dust were investigated to identify the prevalent HDM species in the house environment and their allergen levels. Molecular characterization of group 1 allergens and their polymorphism in prevalent HDM species was also undertaken. The present study found, that, an estimated 81.74% of patients were sensitized to HDM allergens (Der p1 and Der f1), 87% patients were poly-sensitized, wherein patients showing sensitization to pollen and food allergens were 53% and 38% respectively. Percentage of HDM sensitization was highly significant compared to the other two allergy groups (p=0.002357). A significant gender bias was observed, with percentage of male patients (56.11%) greater than female patients (43.89%). Results revealed D. farinae and D. pteronyssinus as the predominant acrofauna. Out of total examined mites, 60.89% were identified as D. farinae, followed by D. pteronyssinus (29%). Besides these two species of allergy causing family of Pyroglyphids, 11% mites were non-allergenic i.e. Cheyletidae and

Oribatidae. Comparison of mite counts from randomly selected houses and patients’ houses showed analogous counts of D. farinae and D. pteronyssinus. 87.35% random houses and 87.11% patients’ houses showed positive mite infestation. Mean D. farinae counts/gram of dust, in random samples were 235.36±7.93 (mean ± SEM) compared to 274.74±10.78 from patients’ homes. Similarly, mean D. pteronyssinus counts from random houses compared to patients’ houses were 115.04±4.57 and

124.58±5.76 respectively. Seasonal variation in mite counts was significant, with highest mite counts observed during monsoon season when % RH and ambient air temperatures are most suitable for mite proliferation.

Allergen levels in 81.2% dust samples tested for Der f 1 were above 0.5ng/ml

Limit of detection (LOD), where 57.6% dust samples had more than10µg/g dust allergen load. Conversely 69.4% of samples above were above LOD for Der p 1 and

20% had Der p 1 allergen levels greater than10µg/g dust. Mean Der f 1

(12.03±0.86µg/g) burden was significantly higher (p<0.0001) than mean Der p1

(6.06±0.73 µg/g). A moderate correlation (R2=0.6) between mite counts and their allergen levels was observed. Both Der f 1 and Der p 1 allergen levels were significantly high (p<0.0001) during monsoon and autumn compared to the remaining seasons of the year.

Study of group 1 allergen polymorphism revealed two novel introns at nucleotide position (nt pos) 87 and 291 in both species, and the absence of intron 3 in Der p 1. Thirteen silent and one novel non-synonymous mutation: Tryptophan

(W197) to Arginine (R197) were detected in D. farinae. Two haplotypes of Der f 1 gene were identified, haplotype 1 (63%) was more frequent than haplotype 2 (18%).

In Der p 1, a silent mutation at nt (aa) position 1011(149) and four non-synonymous mutations at positions 589(50), 935(124), 971(136) and 1268(215) were observed.

These mutations were reported from many other geographic regions, suggesting that polymorphism in Der p 1 gene is panmictic.

As an outcome of this research, a better awareness (with relevant data) about

xvi

the epidemiological status of House Dust Mite (HDM) allergy in Pothwar region has been established. Presence of Pyroglyphid mite species (D. farinae and D. pteronyssinus only) and the absence of other species from the family Pyroglyphidae are reported for the first time. The extent of polymorphism in both genes was substantially lower than that reported previously (0.10-0.16% vs 0.31-0.49%), indicating the need for careful evaluation of potential polymerase errors in studies utilizing RT-PCR.

xvii

Chapter 1

INTRODUCTION

The Greek word Allergy means, “Altered reactivity” (Lipkowitz and

Navarra, 2001). This term was used for the first time by an Austrian pediatrician

(Clemens P. Pirquet) to describe both beneficial and harmful hypersensitivity of the immune system, caused by foreign substances. Today, allergy refers to acquired potential of developing immunologically mediated adverse reactions to otherwise harmless substances (allergens), which may induce tolerance in normal people

(Johansson et al., 2001).

House dust has been identified among the major sources of allergens (allergy causing agents), for the past eighty years (Kern, 1921). Later, it was revealed, that, pyroglyphid mites belonging to genus Dermatophagoides, populating the house dust, are the main causative agents responsible for triggering allergy (Voorhorst et al.,

1963; Voorhorst et al., 1967). Several species of pyroglyphid mites, have since been identified as allergen source in houses (Platts-Mills, 1992). Although the term “house dust mite” (HDM) or “Domestic mites” was originally used for pyroglyphid mites, later, other non-pyroglyphid mites were also included in this description (Platts-

Mills, 1992). High levels of dust mites (by the tens of millions) are often associated with the bedroom, especially, bedding, the carpets, furniture and mattresses (Yan et al., 2016). They feed on detritus in human habitats, including shed human skin flakes, thriving in the stable indoor environment (Valero and Serrano, 2004). Their allergens are known to elicit symptoms of asthma and allergies in genetically predisposed individuals all over the world (Leung et al., 2002; Ohshima et al., 2002;

Wong et al., 2002). There is a strong association between, allergic disorders such as

asthma, perennial rhinitis and atopic dermatitis and sensitivity to HDM allergens

(Platts-Mills and Chapman, -1987). Epidemiological -studies -demonstrate -that -10-

30% -of- the population in regions infested by dust mites suffers from HDM allergy diseases (Platts-Mills et al., 1997; Beasley et al., 2003).

These miniature organisms belong to Phylum Arthropoda (Latreille, 1829) and are classified in sub-class Acari and Order Astigmata (Colloff, 1998). They have currently been classified in Super-order Acariformes, one of the two major divisions of the sub-class Acari. They may be parasitic (family Psoroptidae), or free-living saprophytes (family Pyroglyphidae; Klimov and Oconnor, 2008). Complete outline of their taxonomic classification is given below:

Phylum Arthropoda

Subphylum Chelicerata

Class Arachnida

Subclass Acari

Superorder Acariformes

Order Astigmata

Sub Order Psoroptidia

Superfamily Analgoidea

Family Pyroglyphidae

Genus Dermatophagoides

As the name shows, mites of order Astigmata “lacking stigmata” –openings found on exoskeleton, having a respiratory function. With a size not exceeding

1200µm, these mites inhabit a wide range of highly diverse environments exhibiting free-living or parasitic mode of life. Bodies (idiosoma) of astigmatids are weekly

sclerotized often forming shields or plates. Size, shape and patterns of striations on these shields are important in classification. There are hair like setae, present on the idiosoma, varying in number and pattern of distribution. In taxonomy, these numbers and patterns have been frequently used for classification (chaetotaxy). A claw-like empodium and a membranous ambulacrum is often noticed on the leg (Zhang and

Kato, 2003).

The Order Astigmata includes 45,000 mite species (Nathanson, 1969; Walter and Proctor, 2013), 627 genera and 70 families (Walter and Proctor, 2013), but only

13 mite species have been reported worldwide in domiciliary dust (Arlian and Platts-

Mills, 2001; Arlian et al., 2002). According to recent classification (Klimov and

OConnor, 2013), order Astigmata is classified into four super-families. Mites belonging to super-families Glycyphagoidea and Acaroidea have been preferably named as “storage mites”; these include families Chortoglyphidae, Echimyopodidae,

Glycyphagidae and Acaridae respectively (Figure 1.1). The third superfamily,

“Pterolichoidea” is a group of “non-allergenic mites” genera. Analgoidea, is the largest superfamily of Astigmata, which contains families of non-allergenic feather and fur mites, as well as families Pyroglyphidae (Allergenic HDM), Psoroptidae and

Sarcoptidae (Klimov and Oconnor, 2008). Common house dust mites, belong to five families of order Astigmata: Chortoglyphidae, Echimyopodidae, Glycyphagidae,

Acaridae and Pyroglyphidae (Mahesh et al., 2005; Kuljanac, 2006; Klimov and

Oconnor, 2008; Heikal, 2015).

Today, 47 species of 20 genera from the family Pyroglyphidae are associated with birds, mammals or house dust and stored products (Mumcuoglu, 1976; Fain and

Atyeo, 1990; Colloff et al., 2009; Solarz, 2011). Six species of family Pyroglyphidae

Figure 1.1: Phylogram showing recent classification of HDM; adapted from Klimov and Oconnor (2008).

including Dermatophagoides farinae (D. farinae), Dermatophagoides pteronyssinus

(D. pteronyssinus), Dermatophagoides microcerus (D. microcerus), Euroglyphus maynei (E. maynei), Malayoglyphus intermedius (M. intermedius), and Hirstia domicola (H. domicola), have been repeatedly reported in domiciliary dust throughout the world (Fain and Atyeo, 1990; Colloff, 1998). While D. microcerus

(closely related to D. farinae) is more frequent in Europe (Lovik et al., 1998), another species: D. siboney is limited to Cuba. In temperate region, three species, D. farinae,

D. pteronyssinus and E. maynei (family Pyroglyphidae) have been reported frequently (Arlian et al., 2002; Shin et al., 2005). However, D. pteronyssinus and D. farinae, are most abundant in terms of numbers and bear significance due to their clinical importance (Cui et al., 2006). In subtropical and tropical areas, Blomia tropicalis (B. tropicalis) of family Glycyphagidae and D. pteronyssinus are the most frequent species (Thomas et al., 2004).

Dust mites are distributed worldwide, but their prevalence and relative abundance of different species varies from one region to another (Arlian and Platts-

Mills, 2001). As stated previously, HDM belonging to the family Pyroglyphidae, such as D. pteronyssinus and D. farinae are often found in areas with high humidity

(Arlian, 1989; Arlian, 1992; Arlian et al., 1992; Arlian et al., 1998a; 1998b; Arlian et al., 1999a; 1999b). In tropical and subtropical regions, B. tropicalis a member of the family Glycyphagidae, is one of the most predominant mite species (Arruda et al., 1997a). Its clinical importance in tropical Singapore is well documented (Chew et al., 1996; Altschul et al., 1997), where one in five school children have a diagnosed asthma (Goh et al., 1996).

Our knowledge about dust mite allergens has increased over the past two

decades. Today, it is known, that, mite bodies and faeces are source of many allergens (Tovey et al., 1981; Arlian et al., 1987). Mite faecal matter contains active gut enzymes, that have been associated to allergic reactions. Among other mite allergens are enzymes associated with molting, mite saliva released into the environment while feeding, supracoxal gland secretions associated with mite water balance and body fluid proteins released from dead mite bodies (Mahakittikun et al.,

2001). Muscle proteins like tropomyosin and paramyosin are also added to house dust from deteriorating dead mites (Arlian and Platts-Mills, 2001; Shafique et al.,

2012). At least 23 allergens from D. pteronyssinus, D. farinae and other mite species are well studied (Calderón et al., 2015) and many more have been reported in the

Allergome database. Allergens have been grouped, based on their localization in mite body and biochemical characteristics.

Groups 1, 3, 6, 9 are proteases associated with digestive enzymes; Groups 2,

13 (fatty acid-binding proteins), 5, 7, 21, 22 (fat binding proteins) and 14

(vitellogenin/apolipophorin-like) together make a large family of lipid associated proteins; Groups 4 and 8 are sugar associated; Groups 10, 11 are tropomyosin and paramyosin (muscle associated); Groups 15, 18 are chitinase related; Groups 16, 17 and 24 are gelsolin and EF hand motif family of calcium binding cytoskeletal proteins. Group 19 is associated with an anti-microbial peptide and Group 20 is related to mite arginine kinase.

More than 90% of HDM allergy patients, show sensitivity to Group 1 and 2 allergens from house dust mites (Platts-Mills et al., 1997). Regional variants of these two allergen groups have also been reported that might have significant implications in HDM associated atopy (Thomas et al., 2007; Weghofer et al., 2008; Jeong et al.,

2012).

Search for answers to the increasing prevalence of HDM allergy, is of high priority and there have been speculations about the causes of this rising trend.

Increased allergen exposure, as a result of modern housing and lifestyles has been associated with an increase in allergy symptoms in atopic children (Peat et al., 1994).

In Pakistan, out of more than 160 million, an estimated 23 million people are suffering from asthma. Similarly, the prevalence of individuals diagnosed of various kinds of allergies is approximately 34 million and there is a steady rise of a 5 per cent per year (Rana, 2006). Globally changing lifestyles, genetic traits, environmental pollution, urbanization and presence of dust attracting substances in houses such as indoor plants, carpets, curtains etc. are the chief sources of allergy

(Crane et al., 2002). According to estimates, 50 per cent of children with allergic diseases suffer from bronchial asthma, due to house dust mite allergens. Dust mites are one of the leading causes of bronchial asthma in school children (Rana, 2006).

A study on the patients of allergic rhinitis, conducted by Ullah et al., (2005) in Rawalpindi, reported that 72.6% patients visiting a local hospital showed sensitivity to house dust, while 64% of allergic rhinitis patients were sensitive to

HDM allergen extracts. Fifty percent (50%) patients (among 702 individuals) were skin prick test (SPT) positive to house dust extract (Katelaris et al., 2007). In

Islamabad, 87.5% individuals visiting allergy clinic were SPT positive against aeroallergens, where the highest number (44.6%) of patients showed HDM sensitization (Abbas et al., 2012). Despite these reports, no work has been carried out to establish species diversity of HDM in Pakistan. Diversity of acrofauna, in the neighboring geographical regions, is well known. There are reports of D.

pteronyssinus dominating house dust from many cities in India (Maurya et al., 1983;

Modak et al., 1992; Saha et al., 1994) along with other mite species including D. farinae, E. maynei and B. tropicalis (Dar and Gupta, 1979). In Iran, humid areas have abundant D. pteronyssinus (Amoli and Cunnington, 1977; Sepasgosarian and

Mumcuoglu, 1979) and cities situated inland with a considerably drier climate are infested with D. farinae (Fereidouni et al., 2013). In China, a predominance of D. pteronyssinus has been reported (Wang and Wen, 1997). Many allergen groups like group 1, 2 and 3 show polymorphism within and among different species of mites.

There is evidence of geographical variants in HDM allergen groups (Thomas et al.,

2004). Research strongly advocates the existence of cross reactivity between allergens of the same group and with allergens from other sources e.g. food, plants, fungi and bacteria (Shafique et al., 2012).

This study was designed to investigate species diversity of HDM, based on their morphological and molecular characterization. It further aimed to determine the levels of major HDM allergens in household dust. Sequencing of group 1 allergen genes from HDM species was done to study the extent of polymorphism. It was hypothesized here, that, HDM species identified in this study may show genetic and allergen polymorphism. The aim of this research was, to undertake the molecular characterization of HDM allergens, that may help to understand mechanism of pathogenesis, development of locally produced diagnostic tools and potential vaccines for HDM allergies.

The study site was Pothwar region, that is located on the world map at 32o 10 to 34o 9 N latitude and 71o 10 to 73o 55 E longitude. Climatically, it can be divided into two subzones, semi-arid southern region and Barani (Rainfed) northern region.

The mean temperature in summers is recorded at 38.5o C, while in winters it falls to

0-1o C. Summers include monsoon (rainy season), that spans from early July to

September. During this period, there is a high relative humidity (70%) and warm temperature inside the houses which is an ideal environment for HDM.

The study design had the following key objectives:

 To study the epidemiological status of HDM allergies in Pothwar region.

 To study species diversity by morphological and molecular

characterization of HDM in Pothwar region.

 Molecular characterization of HDM allergens found in the randomly

collected dust samples from houses in Pothwar region.

Chapter 2

REVIEW OF LITERATURE

Immune system, protects the body against potentially life threatening

infectious microorganisms, foreign harmful substances and abnormal cancerous

cells. When harmful or foreign substances are introduced in the body, a series of

events is triggered in the immune system, which is a carefully coordinated and

controlled interaction of immune cells, with the ultimate goal, to eliminate the

foreign substance through pathogen-specific mechanisms. Immunity can broadly be

classified, into two groups, the innate and the adaptive immunity. The innate immune

response is mediated by phagocytic cells and is non-specific, whereas, the adaptive

immune response is featured by its specificity and memory. The specificity of

adaptive immune system helps to differentiate ‘self’ and ‘non-self’ antigens using

major histocompatibility complex (MHC) molecules as markers and subsequently

remove harmful substances from the body (Sorci et al., 2013). Similarly, the memory

of adaptive immune response of the host will help to recognize the antigens, that it

had earlier encountered, thus, the body rapidly responds to the repeated challenge

with analogous foreign substances. Allergy is a disorder of adaptive immunity that

leads to the over -reaction of immune response or “hypersensitivity” (Daniels et al.,

1996; Cookson, 1999; Moffatt and Cookson, 1999; Lonjou et al., 2000).

2.1 HYPERSENSITIVITY

Hypersensitivity refers to the excessive reaction of the immune system that

requires pre-sensitization of the host and re-exposure to similar antigens. Coombs

and Gell (1975) classified hypersensitivity into four types (Type I to Type IV

hypersensitivity) depending on the involved mechanisms and time it takes for the

reaction to occur. Type I hypersensitivity is the immediate hypersensitivity mediated by IgE- antibodies. - Type- II hypersensitivity is the cytotoxic hypersensitivity and may affect many organs and tissues. The reaction is primarily mediated by IgM or

IgG antibodies. Type III hypersensitivity or the immune complex hypersensitivity, may be general or may involve individual organs. Type IV hypersensitivity is delayed hypersensitivity, that involves a cell-mediated response. Recently, Type V hypersensitivity has been included in Gell-Coombs classification. This type of hypersensitivity involves the innate immune response (Rajan, 2003).

2.2 ALLERGY (TYPE I HYPERSENSITIVITY)

The term allergy, is derived from Greek words “allos” meaning altered and

“ergia” meaning reactivity (Lipkowitz and Navarra, 2001). This term was used for the first time, by Austrian pediatrician Clemens P. Pirquet (1874-1929), for both beneficial and harmful hypersensitivity of the immune system caused by dust, pollen and certain foods (Rocken et al., 2004). Today, allergy refers to an acquired potential of developing, immunologically mediated adverse reactions to normally harmless substances (allergens) which may induce tolerance in normal people (AAAAI,

2000).

Type I hypersensitivity, refers to immunological reactions, that trigger most atopic and allergic disorders. Although the two expressions “atopy” and “allergy” are used as synonyms, but they are scientifically different. The term “atopy” is derived from the Greek atopos, meaning “out of place” (Kay, 2000; Vallance et al.,

2006). It is an individual’s inherent predisposition, to produce IgE antibodies when exposed to low quantities of allergens (protein), resulting in the development of symptoms i.e asthma, inflammation of conjunctiva, rhinitis or dermatitis (Figure 2.1;

Figure 2.1: Relationship between hypersensitivity and immune response (left) to disease (right). Dotted line: Link between atopy and Ig-E mediated diseases caused by allergen exposure (modified from Johansson et al., 2001).

Johansson et al., 2001). On the other hand, allergy is said to have occurred, when the immune system responds in an exaggerated manner, to a foreign antigen through

IgE-independent or dependent pathways. In short, it can be stated that atopic reactions are always allergic but all allergies may not be atopic (Delves, 2014).

2.3 EPIDEMIOLOGY OF ALLERGIC DISEASES

Increasing prevalence in atopic allergies, has been emphasized by several multicenter studies around the world (Leuenberger et al., 1998; Leonardi et al., 2002;

Asher et al., 2006; Zock et al., 2006). It is estimated, that, if the frequency of allergy diseases continues, at the same pace, they may increase up to 50% by 2020. Today,

10–30% of the global population is suffering from various allergic diseases and their prevalence is increasing annually (Casolaro et al., 1996; Walker and Zuany-Amorim,

2001; Bant and Kruszewski, 2008). Approximately 150 million people are estimated to be suffering from allergic asthma, with a death toll reaching up to 180,000 every year (Sly, 1999). Such high counts exert huge burden on the economy of a country, for example, in the USA, estimated $12.7 billion is spent annually, on treatment of asthma patients (Weiss and Sullivan, 2001).

2.3.1 Physiology of Allergic Response

The physiological mechanisms, resulting in allergy development in some individuals while not in others, are not well understood. It is also unknown, why some people get hay fever and others develop asthma or both (Lipkowitz and

Navarra, 2001). Foreign antigens (allergens), enter the body through, respiratory mucosa, gastrointestinal mucosa and skin. Figure 2.2 illustrates, that, the allergic immune response is initiated by committed or activated antigen presenting cells

Figure 2.2: Steps of allergic immune response; adapted from Corry and Kheradmand

(1999).

(APCs) like dendritic cells, macrophages and B lymphocytes

(http://biowiki.ucdavis.edu). These cells have the ability, to chemically breakdown an antigen into short peptides and present them on the surface of the cell associated with the major histocompatibility complex (MHC II) molecules (Corry and

Kheradmand, 1999). In the meantime, dendritic cells migrate to the lymphoid organ to interact with naïve CD4+ T-cells (Figure 2.2).

After interacting with the antigen-MHC II complex through specific T-cell receptors (TCR), Naïve CD4+ T-cells (Th0) are activated with the help of other co- stimulatory molecules, to secrete regulatory cytokines that determine the polarization of T helper responses (Lambrecht et al., 2000). In vitro cultures of T (naïve or memory) cells have demonstrated that activated dendritic cells primarily induce Th2 cytokines rather than Th1 (Bellinghausen et al., 2000; De Wit et al., 2000). IL-4 and

IL-13 cytokines secreted by Th2 cells in response to activated dendritic cells, promote production of antigen specific IgE antibodies in B cells (Finkelman et al.,

1988; Pene et al., 1988; Punnonen et al., 1993; Emson et al., 1998). IgE antibodies circulate around the body and bind to high-affinity receptors (FcεR1) and low- affinity receptors (FcεR2) on mast cells, eosinophils, macrophages and platelets

(Roitt et al., 1998) (Figure 2.2).

Re-exposure to the same allergen, induces cross-linking of specific IgE on mast cells (Kadam et al., 2016), leading to mast cell degranulation activated through

FcεR1 receptor and the secretion of mediators such as tryptase, histamine, prostaglandins, heparin and leukotrienes etc. (Kinet, 1999). These mediators, cause vasodilatation, smooth muscle contraction and increase capillary permeability in the tissues leading to inflammation. The symptoms of immediate hypersensitivity

reactions, appear within minutes and include watery eyes, runny nose, coughing, sneezing, sinus congestion and constricted airways in the respiratory tract, cramping, diarrhea and vomiting in the gastrointestinal tract, erythema and urticaria on the skin

(Corry and Kheradmand, 1999).

Mast cells stimulated by antigen cross-linked to IgE-FcεRI complexes, induce synthesis of another group of mediators, leading to prolonged symptoms

(late-phase response). Activation of eosinophils releases pre-synthesized mediators like leukotrienes, major basic protein (MBP), eosinophilic cationic protein (ECP), and prostaglandins to enhance inflammation and prolong epithelial damage. The late phase reaction occurs 2-24 hours after allergen exposure, and is caused by the proliferation of activated Th2 cells, releasing pro-inflammatory cytokines, that enhance eosinophil recruitment (Dombrowicz and Capron, 2001). In a non-allergic individual, allergens are recognized and taken up by the APCs. The processed allergen fragment is then presented to the Th0 cells, stimulating the proliferation of mainly Th1 subtype of cells. The production of IFN-γ by the Th1 cells (Ebner et al.,

1994; Till et al., 1997), stimulates the production of allergen specific IgG (subtypes

IgG1 and IgG4) (Kemeny et al., 1989). The production of IFN-γ, also prevents IL-4 activity, which results in the inhibition of IgE production (Pene et al., 1988).

IgE is the class of immunoglobulin, that has protective antibody activity, against foreign antigens (parasitic). It can cause inappropriate inflammatory reactions, against innocuous environmental proteins such as HDM allergen, dust and pollen (Vallance et al., 2006). IgE antibodies play an important role in type I hypersensitivity reaction. It is the least abundant antibody class in serum. Sera IgEs from normal ("non- atopic") individuals are about 150ng/ml, much lower than IgGs

(about 10mg/ml). IgE levels in sera from atopic individuals can increase up to 10- fold of the normal level. Cross-linking of allergens to IgE-FcεR1 complex, results in mast cell degranulation, production of inflammation mediators and initiation of inflammatory response. It also intensifies the expression of CD40-ligand (CD40-L),

IL-4, and IL-13, leading to the activation of B cells. B cells further induce IgE synthesis under the stimulation of IL-4 and IL-13 forming a positive feedback loop which maintains high levels of the local IgE and enhance the inflammation reactions

(Pawankar et al., 1997).

Allergens are agents that act as the triggering factors of allergy. To solve the allergy problem, it is essential to understand allergens, which are mostly soluble proteins and often have proteolytic enzyme activity, in their native form (Janeway et al., 2001). An allergen displays two properties: the ability to induce IgE response and a clinical response in a sensitized person upon re-exposure to the same allergen

(Akdis et al., 2006). Allergen should contain B cell epitopes, that interact with IgE antibody and form a complex (Janeway et al., 2001). It should have specific IgE- binding activity in a minimum of 5 patients, or >5% of the individuals tested in atopic population (King et al., 1994).

According to allergen nomenclature standardized by the Alche et al., 2012

(Alche et al., 2012), the allergen name includes the first 3 letters of the genus, the first letter of the species and an Arabic numeral to indicate the chronological order of purification. Allergens from different species, that share same biochemical properties are considered as one allergen group (King et al., 1994). Allergens sharing more than 67% amino acid sequence identity and having similar biological functions are designated as isoallergens. Isoallergen (isoforms), may have multiple forms of

closely similar amino acid sequences, resulting from genetic polymorphism and are called “variants” (King et al., 1994).

There is no unified theory, to explain why some proteins are allergenic while others are not. More than 2000 allergens, commonly derived from pollen, fungi, mites, endothelial tissues and dander from pets, venom from insects and foods such as egg, milk, fruits, nuts and fish have been reported (Boulet et al., 1997; Burge and

Rogers, 2000; Kerkhof et al., 2003). Several studies implicate HDM allergens, to be the major cause of IgE mediated allergic diseases i.e. Asthma (Arlian et al., 1992;

Miraglia Del Giudice et al., 2002; Thomas et al., 2002) rhinoallergosis (Thomas et al., 2004), atopic dermatitis/ eczema (Mahesh et al., 2005), conjunctivitis (Leonardi et al., 2012).

2.4 EPIDEMIOLOGY OF HDM ALLERGIES

Although dust mites are deemed harmless to most individuals, they may be a cause of concern in atopic people such as asthmatics. Their faecal pellets, containing potent gut proteases (Jeong et al., 2010), dead bodies containing muscle proteins and exoskeleton etc. are found in house dust and can be strongly allergenic (Tovey et al.,

1981). HDM allergens not only activate the innate immunity in humans, but also contribute to persisting HDM-associated allergy symptoms (Jacquet, 2011).

Many allergens like group 1, 3, 6 and 9 are proteases (digestive enzymes) and are excreted in high concentrations in mite faecal pellets as active enzymes (Colloff,

1992). They are reportedly more heat stable than other proteases in dust mite proteome (Randall et al., 2017). These faecal pellets can be inhaled as they become airborne during vacuum cleaning of carpets, making beds and other mechanical

disturbances in the houses (Colloff, 1992).

Approximately 20% of people around the world, are not only sensitized to

HDM allergens, but also show allergy symptoms on exposure. High frequency (27.9-

68.8%) of HDM allergen sensitization occurs in atopic dermatitis patients (Min et al., 1987; Kang et al., 1991; Cho et al., 1998; Yim et al., 2001; Kim et al., 2003;

Shin et al., 2010), similarly in allergic rhinitis and asthma patients, sensitivity ranges between 40-60% (Ahu and Kim, 1983; Kang et al., 1984; Cho et al., 1985; Rhee and

Oh, 1985). Degree of allergen exposure is determined by the number of mites and concentration of their allergens in domiciliary dust (Solarz, 1998). HDM distribution varies in number and allergen concentration in different seasons and at different locations (Arlian et al., 2002). Factors like ventilation, house age, location, habits and number of inhabitants affect indoor environment of houses like temperature and indoor relative humidity. These factors have been associated to mite counts in house dust (Arlian et al., 2002; Kuljanac, 2006). Moreover, high temperatures (above

700F/200C), and indoor air pollution such as tobacco smoke or car fumes may also add to the differences (Arlian et al., 2002).

People exposed to, more than 2 µg Der p 1 and/or Der f 1 per gram of dust

(equivalent to 100 mites/gram of dust) during early childhood are at risk for sensitization to mites (Lau et al., 1989; Arruda et al., 1991), whereas, exposure to more than 10 µg Der p 1 per gram of dust (approximately 500 mites/gram of dust) is a risk factor for development of asthma in genetically predisposed individuals

(Sporik et al., 1990).

However, some reports suggest that mite exposure, lower than the designated

"threshold" levels may also be associated to sensitization in some atopic individuals

(Warner et al., 1996; Huss et al., 2001).

2.5 HDM ASSOCIATED ALLERGY DISEASES

Different pathophysiological conditions (Cross et al., 1998) including asthma, rhinitis, conjunctivitis, dermatitis (Eczema), food allergy, stinging insect reaction, drug sensitivity and anaphylaxis are associated with allergies.

The tendency to have atopic disease, is most likely a multiple gene inheritance (Stafforini et al., 1999; Mayor, 2002), but the increase in prevalence of atopic allergies over the past few decades reflects more on environmental changes

(von Mutius et al., 1994; von Mutius, 2000). These changes have resulted in increased exposure to allergens, both outdoor and indoor. A correlation between the modernization in communities and increase in atopic diseases has been demonstrated

(Taylor, 1995). Like mold spores, grass, weed and tree pollens are the major outdoor allergens (Kurup et al., 2000; Bush and Portnoy, 2001), house dust mites, cockroaches, animal dander, paints, tobacco smoke, volatile organic compounds and dust are the primary indoor allergens, whose levels have increased with changing lifestyles of societies. Increased indoor humidity, may have increased the incidence of symptomatic asthma, allergic rhinitis and atopic dermatitis (Kilpeläinen et al.,

2001).

Although, there is limited research, based on association between socioeconomic status and allergic diseases, one study reported a significantly higher number of unemployed individuals suffering from allergic bronchitis compared to the employed ones (Kogevinas et al., 1998). Many studies report a high risk of atopic allergies in males (de Marco et al., 2000; Chen et al., 2002; Calvo et al., 2005;

Assarehzadegan et al., 2013; Yap et al., 2014), however, data of an international, cross-sectional, population-based survey, collected in 16 countries from 1991 to

1993 observed an age-related reversal of prevalence of asthma in males and females resulting in an increase in asthma incidence in women and decrease in men during puberty (de Marco et al., 2000).

A brief overview of allergic disorders associated with HDM is give below:

2.5.1 Asthma

Asthma is a common chronic respiratory disorder effecting the population globally (Braun-Fahrländer et al., 2004; Galassi et al., 2006). Asthma has been defined as, reversible obstruction of airway due to bronchial hyperactivity, associated with inflammation of the airway (Currie et al., 2005). Asthma attacks may be mild or severe, resulting in a combination of symptoms like coughing, shortness of breath, chest pain and wheezing (Moorman et al., 2007), depending on varying susceptibility of people to different provoking agents (Wenzel, 2006). The condition, may be broadly classified into allergic and non-allergic asthma. Although, asthma is treatable, its prevalence has increased markedly over the past 3-4 decades (Asher et al., 2006; Anderson et al., 2007). It has become, a leading cause of morbidity and mortality in the United States (Moorman et al., 2007). Asthma, is one of the major healthcare burdens, on economy and at the same time results in loss of productivity at schools and at work (Weiss et al., 1992). It is, the most common chronic childhood disease in modernized societies. It is generally accepted, that, there are two forms of asthma; allergic (extrinsic) and non-allergic (intrinsic) and it would be important to clearly distinguish between them, in relation to the management of this disease.

Allergens play a dual role in most patients, firstly in provoking wheezing and also in

the development of this disease (von Mutius et al., 1998). Atopy, is the most significant factor for the development of asthma, increasing the risk to 10–20 times as compared to non-atopic factors (Hopkin, 2002). Environmental determinants, such as, HDM, grass pollens, cockroach, and animal dander have a pivotal role in the progression of atopic asthma (Aderele, 1979; von Mutius et al., 1994; Holt et al.,

1997; Nicolai, 1997; Shirakawa et al., 1997; Yemaneberhan et al., 1997; von Mutius et al., 1998; Rosenberg et al., 1999; Rumchev et al., 2004). A study reported, that,

30% of adult asthmatic patients showed atopic sensitization and 18% were sensitized to HDM (Sunyer et al., 2004). Recently, Der p 1 allergen exposure in homes was found positively associated with atopic asthmatic children (Yan et al., 2016).

2.5.2 Allergic Rhinitis

Allergic rhinitis (AR), is another IgE mediated immunologic response, resulting in the inflammation of respiratory airways. AR (due to allergy) and vasomotor rhinitis (over activity of nerves in the nasal tissue), are the two known types of rhinitis (Scoppa, 1985). AR occurs, when, a person with sensitized immune system is exposed to indoor and outdoor allergens. It may be seasonal (a condition commonly referred to as hay fever) or perennial (Kaliner et al., 1987; Kay, 2000).

While seasonal AR, is caused by pollen allergens, the perennial rhinitis or “Perennial

Allergic Rhinitis” is caused by allergen from animal dander, HDM and fungal spores.

This condition, is identified by symptoms, like sneezing, itching, nasal obstruction and rhinorrhea. Although, AR seems to be an inconsequential disease, it has been a major health issue in more than 600 million individuals worldwide (Asher et al.,

2006; Ait-Khaled et al., 2007; Bousquet et al., 2007). It is, among the leading causes of morbidity and costs to health services in the UK (McCormick et al., 1995;

Scadding, 1997; Prescott-Clarke and Primatesta, 1998). Up to 5% of the general

population, in western countries (Fleming and Crombie, 1987; Sibbald et al., 1990;

Beasley, 1998) and 10-25% of the world population is affected by perennial AR and its prevalence is increasing (Asher et al., 2006; Sehra et al., 2008). Seasonal and perennial AR are affecting 40 to 50 million people, in the United States (Nayak,

2003). It is three time more common than asthma (Togias, 2003), and is one of the risk factors for the development of asthma (Settipane et al., 1994; Guerra et al.,

2002).

2.5.3 Atopic Dermatitis

The term “Dermatitis”, also described as eczema, is a common skin disorder, found in elderly people. It can be classified into several types on the basis of its etiology, including Atopic dermatitis (AD), asteatotic dermatitis, seborrheic and contact dermatitis.

Atopic dermatitis (AD) or Atopic Eczema (AE), is a degenerating chronic inflammatory skin disorder. Its pathogenesis is characterized by IgE-mediated allergy and skin barrier defects (Flohr et al., 2004; Galassi et al., 2006; Werfel,

2009). It was added to the group of atopic disorders in 1930s, due to its association with allergic asthma and atopic AR (Spergel and Paller, 2003). According to one study, 2.4% individuals of diagnosed eczema were atopic (Harrop et al., 2007). The symptoms of AD include chronic dry skin, itching and age-specific morphology and distribution of skin lesions. It is a hereditary skin disorder, that may affect individuals in families with history of other allergy diseases like asthma and hay fever. Studies emphasize the role of HDM allergens in the development of AD (Teplitsky et al.,

2008; Fuiano and Incorvaia, 2012). D. farinae extract, induced AD-like symptoms in mice (Yamada et al., 2017). AD/AE prevalence has increased 2-3 times in the

developed countries. Studies suggest, that, the rural population is less vulnerable to the AD indicating the significance of urban lifestyle in the development of this disease (Bieber, 2008). Prevalence of eczema varies globally, showing increased trends in Australia, New Zealand and Western Europe, but a decline in South-East

Asia, Eastern Europe and the Mediterranean (Asher et al., 2006).

Papular urticaria (nettle-rash), is an itchy eruption, leading to the appearance of non-pigmented papules. A possible role of HDM allergens, in the manifestation of urticaria was reported. Houses of children with urticarial had high mite densities, whereas in control group children houses, mite counts were not significant (Alexander, 1972). Similarly, in another case study (of three people with urticaria), a positive association of exposure to HDM with the disease was established (Dixit, 1973).

2.5.4 Allergic Conjunctivitis

It is an atopic condition of the conjunctiva (a thin transparent tissue that covers the eye ball and the inside of eyelids), which leads to perpetual itching, redness, impaired vision and dryness of the eye. Persistent Allergic Conjunctivitis

(AC), may lead to the development of chronic infection of eyelid margin, chronic fibrosis of conjunctiva, tear abnormality, eczema of the eyelids and vascularization with progressive scarring of the cornea (Katelaris, 2003). AC, is an IgE-mediated disorder, caused by airborne allergens, such as HDM, grass and tree pollens, molds, and animal dander (Kari and Saari, 2010), which may be present year-round or may show seasonal variation, depending on the environmental conditions of a region

(Leonardi et al., 2012), thus affecting more than one billion people globally

(Pawankar et al., 2013). It is usually accompanied by AR, thus the term allergic

rhinoconjunctivitis may be coined (Nging Tan et al., 2005; Qiao et al., 2008).

Recently, in a murine model (BALB/c), HDM extract developed AC like symptoms, with increased IgE levels (Lee et al., 2016).

2.5.5 Anaphylaxis

Anaphylaxis, is a term used to describe serious and rapid systemic hypersensitivity reactions, usually involving more than one part of the body, which under severe conditions may cause death (Johansson et al., 2004; Sampson et al.,

2006; Simons, 2010; Simons et al., 2011). Since most of the death cases due to anaphylaxis go undiagnosed, therefore, the true rate of occurrence is unknown.

However, according to a careful estimate, the prevalence of anaphylaxis is estimated at 0.05–2% (Lieberman et al., 2006; Simons et al., 2011). The occurrence varies by gender, age, socio-economic status and geography. The incidence of anaphylaxis, caused by, food and drugs has increased with time. Food (Sampson, 1998), drugs

(Lang et al., 1993), latex (Yassin et al., 1994) and bee or wasp sting (Golden, 2000), are some of the common causes of Anaphylaxis. Exercise may sometimes speed up such reactions (exercise–induced anaphylaxis), therefore some people may experience anaphylaxis while exercising, after eating any food or specific food. This is called “exercise–induced food–dependent anaphylaxis”, and individuals with a family or personal history of atopy are considered to be at a higher risk of this condition (Sampson, 2003). Systemic anaphylaxis may lead to death due to the release of vasoactive mediators resulting in vasodilation and smooth muscle contraction which causes a rapid loss of blood pressure, angioedema and acute bronchoconstriction (Sampson, 1998; Ellis and Day, 2003).

Edston and van Hage-Hamsten (2003) reported, that, a farmer of 47 years

age, suffering with HDM allergy was found dead due to anaphylactic shock. High levels of serum D. farinae and D. pteronyssinus specific IgE were found in his blood along with elevated HDM allergens’ levels in his bed. Oral mite anaphylaxis, is a new syndrome characterized by severe allergic symptoms (mediated by IgE, IgG and immune complexes), that may occur abruptly after consuming diet made from mite- contaminated wheat flour. It is more common, in tropical environments and is known as “the pancake syndrome”, since it is triggered by eating pancakes, made from mite contaminated flour. It is thought, that, some thermo-resistant allergens are involved in its pathogenesis, which is not destroyed by cooking. This potentially lethal allergic condition, has been reported from, many countries but has frequently remained undiagnosed (Erben et al., 1993; Sanchez-Borges et al., 1997; Sánchez-Borges et al.,

2001; Dutau, 2002; Sánchez-Borges et al., 2005; Wen et al., 2005). Early diagnosis may reduce the risk of death, in allergic patients, through the employment of simple prophylactic measures (Sánchez-Borges et al., 2005). Another variation of this syndrome: dust mite ingestion–associated exercise-induced anaphylaxis, can occur, during physical exercise (Sánchez-Borges et al., 2013). A role of anaphylaxis, in

Sudden Infant Death Syndrome (SIDS), caused by mite allergens, was suggested by

Mulvey (1972). He observed anaphylactic-type reactions among many patients, who were accidentally given, high doses of mite allergen preparations, during immunotherapy. A correlation, between SIDS deaths and mite allergens was also reported, in Western Australia (Turner et al., 1975). High mite densities, were observed in homes (Mulvey, 1972) and nursery bedding (Ingham and Ingham, 1976) of SIDS patients. Increased serum β-tryptase levels, were found, in babies who died with SIDS, as compared to, children who expired from non-anaphylactic reasons

(Buckley et al., 2001). Despite previous studies, one report concluded that there was no significant role of mite-mediated anaphylaxis in SIDS (Hagan et al., 1998).

2.5.6 Gastrointestinal Allergy

Ingestion of mites from Pyroglyphidae family, may cause gastrointestinal allergic disorders (Scala, 1995). A case study, described HDM sensitized 5-year-old girl, suffering from persistent vomiting, without any respiratory symptoms. She was exposed to high HDM levels in her bedroom and her symptoms disappeared, soon after allergen avoidance (Scala, 1995).

2.6 MORPHOLOGY OF PYROGLYPHIDS

The term “HDM”, conventionally includes, acarids of family Pyroglyphidae

(Ho and Nadchatram, 1985; Mariana et al., 2000; Arlian et al., 2003; Mariana et al.,

2000), that are found in house dust, their fossils dating back 28 million years.

Evidence suggests, that, most of the Pyroglyphids were nest dwellers, associated with bird species of family Passeriformes, which preferred building nests near human communities (Fain and Atyeo, 1990; Klimov and Oconnor, 2008). These mites, migrated from nests, to colonize human dwellings, by evolving a shift to feeding on dead skin scales, resulting in development of tolerance to low humidity, as compared to other mite species. They successfully attained water, by metabolizing additional lipids in their diet. Bird nests and human houses have common pattern of moisture distribution, which is generally dry, with patches of moist areas containing sufficient food that can be inhabited by mites (Colloff, 2009).

Dust mites, are rectangular bodied chelicerate micro-arthropods, measuring

0.4 millimeter (400 µm) in length and 0.25–0.32 millimeter (250–320 µm) in width.

A typical house dust mite adult is eight-legged, creamy white in color and has weakly sclerotized striated cuticle (Colloff and Spieksma, 1992; Colloff, 1998; Colloff,

2009).

2.6.1 The Mite Body

Generalized structure of mite body comprises of two parts, the anterior part called the gnathosoma (false head) consisting of mouthparts located on the head

(capitulum), whereas, the posterior whole body is called the idiosoma (Figure 2.3).

Gnathosoma includes, a ventral hypostome, ending anterolaterally into a pair of segmented pedipalps and a dorsal pair of chelate-dentate chelicerae used for grasping, handling and breaking food (Arlian, 1989).

Idiosoma, is a single unsegmented soma that can be divided into two regions; propodosoma and hysterosoma. It is typically oval in shape, having round anterior and posterior margins but parallel sides. The body surface is covered with cuticle that shows variable degree of sclerotization. In some subfamilies or genera where it is completely sclerotized, no true striations are observed (O'Connor, 1982; Wolley,

1988; Solarz, 2011), whereas in others like Pyroglyphidae the cuticle is soft and striated, which reduces dehydration by creating a moisture barrier between the body and the environment (Colloff, 2009).

Propodosoma, is the anterior most part of idiosoma, comprising leg pair I and

II, separated by a sejugal suture (Figure 2.3). Hysterosoma is the posterior region of mite body. It is further divided into metapodosoma (the region of III and IV pairs of legs) and opisthosoma (the body section behind IV pair of legs). A term podosoma

(propodosoma+ metapodosoma) has also been coined, to describe the leg-bearing portion of idiosoma in mites (Figure 2.3). Mites may possess four pairs (adults and nymphs) or three pairs (larvae) of segmented legs. Each leg is formed of six segments, starting nearest to the body is coxa, followed by trochanter, femur, genu, tibia and tarsus. The coxa is fused to the ventral surface of astigmatid’s body forming

Figure 2.3: Segmentation of Pyroglyphid body (Ventral)

an epimeron. The remaining five segments are freely moveable. The first movable segment is the triangular trochanter. which is usually the shortest segment. The last segment called the tarsus displays a number of apical structures which may be claws or suckers and a centrally placed pulvillus. These structures are used for walking and clinging on to surfaces (Figure 2.3).

The body and legs of mites, have many hair-like structures, called “setae”, which have a sensory function and are of taxonomic importance. “Solenidia”, are hollow, blunt tipped structures, found on the distal segments of the legs and the pedipalps (Colloff, 2009).

Like other arthropods, mites show sexual dimorphism. Anatomy of genitalia is an important source of taxonomic identification keys. Externally, the female genitalia have a ventrally situated vulva, between the III and IV pairs of legs. This structure is involved in oviparity. The anteriolateral lips of vulva attach to a crescent shaped sclerite called “epigynium”. The shape of vulva and epigynium is used for morphological characterization of pyroglyphids. A second genital opening of the female’s body, the bursa copulatrix, is found at the posterior end, counterpoised from the terminal-end of the anal-slit. This is a copulatory structure, leading to spermatheca or the receptaculum (sperm store). The morphology of these structures also contributes to identification of females of different mite species (Colloff, 2009).

In male pyroglyphids, two external genital structures are visible. The first one, is a sclerotized penis, which is found ventrally, at the level of fourth leg pair. A pair of anal suckers, is the second sexual feature, found in the males of family

Pyroglyphidae and Acaridae. They are used, to position a female mite, during

copulation. These copulatory suckers, are missing in some species of family

Pyroglyphidae and Glycyphagoidae (Colloff, 2009).

The body wall of pyroglyphid mites, is formed by an epithelium and cuticle

(non-cellular substance secreted by epithelial cells). The cuticle is folded into ridges and plates, forming an exoskeleton called “exocuticle”. This three-layered barrier, forms insulation and protects the internal living tissues of mites. In the dermatophagoid mites, striations over the idiosoma are important contributors to systematics for identification of species. A waxy substance called “extracuticulin” is continuously secreted, resulting in the formation of a layer, that is referred to as the

“epicuticle”, covering the sclerotized areas of the mite body (Colloff, 2009).

The supra-coxal sclerite (plate), is found at the apex of the groove (dorsally) flanked, by the gnathosoma and the leg I coxa. It bears an opening of a pair of supracoxal glands (Grandjean, 1937). Each gland consists of eight cells, that function in pairs and produce secretions containing proteins, sodium and potassium chloride

(Colloff, 2009), that are involved in water balance (Wharton and Furumizo, 1977;

Wharton and Richards, 1978; Colloff, 2009). After death, these proteins are released, as the body of mites disintegrates and may be among the major sources of HDM allergens (Wharton and Furumizo, 1977; Colloff, 2009; Edrees, 2014).

The body cavity is filled with blood or hemolymph, which bathes the internal organs. The hemolymph in mites, is not well studied, but it is known, that, it comprises of a variable number of nucleated blood cells (haemocytes), suspended in a fluid called “plasma”, or found in tissues including muscle, salivary glands, and digestive tract etc. This fluid moves in the body, under the currents produced by the

movement of muscles and gut. It transports nutrients and hormones, but its role in immunity has not been described. It also accumulates body wastes and provides a hydrostatic support to the exoskeleton (Colloff, 2009). The digestive tract or gut of

D. farinae, comprises of a mouth, pharynx, oesophagus, foregut, midgut and a hindgut that ends at the anus. Most parts of the gut are lined by cuticle, while digestion and absorption occurs in mid gut where the cells form microvilli (Brody et al., 1972). Water resorption and compaction of faecal pallet, takes place in the hind gut (Colloff, 2009). A broad range of digestive enzymes are found in the domestic mites, many of these enzymes are passed in the faecal pellet (Tovey et al., 1981), or released from decaying mite bodies as allergens. These include, proteolytic enzymes

(trypsin, chymotrypsin, serine and protease and collagenase) and amylase from salivary glands (Arlian et al., 2003).

2.6.2 Water Balance

The ability, to maintain a water balance in their bodies, is the key factor, that has enabled domestic mites, to survive in fluctuating conditions of temperature and humidity like the human dwellings, where other arthropods will not survive. HDM have evolved methods, of avoiding water loss and developed ways of obtaining water from the environment. A ratio between, water uptake and water loss is referred to as critical equilibrium activity (CEA) or critical equilibrium humidity (CEH), which is related to percent relative humidity (RH), where water loss is balanced by water gain.

Value of CEA or CEH varies in different mite species and in some species, it is influenced by temperature (Edney, 1977). For example, in A. siro, CEA is almost fixed at 71% (Wharton, 1963; Knülle and Wharton, 1964), while in D. farinae, it is strongly dependent on temperature fluctuations (Arlian and Veselica, 1981a; 1981b).

Factors influencing the rate of water loss in mites, include body size, oviposition in females, cuticular transpiration and other physiological processes, like egestion, excretion and osmoregulation. Mites have learnt to reduce water loss, by alteration in behavior under dry conditions. They tend to crowd together and shutdown feeding and defaecation, which results in conserving water in their bodies.

Mechanisms of water gain include, consumption of hydrated food, production of water through lipid hydrolysis and uptake of water, from air across cuticle (passive process) and via the supracoxal gland (active process). These glands form an active water pump, which has the ability to gain water out of air, with less humidity. It produces a secretion of hygroscopic salts, including variable ratios of potassium chloride (KCl) and sodium chloride (NaCl). This secretion. flows into the podocephalic canal, which runs parallel to the edge of the supracoxal sclerite, on the dorsal side of the palp, reaching the mouth (Wharton, 1985; Colloff, 2009). When the RH declines below CEA, the salts precipitate, forming a plug, that prevents further dehydration (Wharton et al., 1979). This results in accumulation of salts, in mite body, thus reducing feeding and movement (Arlian, 1977). The difference in ratio of these salts in HDM species, results in difference of CEA. Studies carried out on population dynamics of HDM species, have concluded, that, D. farinae are better adapted for survival in longer periods of desiccation, compared to E. maynei and D. pteronyssinus (Arlian et al., 1998b; Colloff, 2009).

2.6.3 Life Cycle

Pyroglyphids are poikilothermic or ectothermic organisms, therefore, life cycle of these mites is influenced by the ambient temperature of the habitat. A typical HDM, has five stages, that include, the egg, larva, protonymph, tritonymph and adult

(Arlian et al., 1990; Arlian and Dippold, 1996). Each stage is anatomically identified,

due to their distinctive features (Arlian, 1989a). The larva has three pairs of legs and do not have genital papillae or reproductive structures. Ventral and genital setae are absent, but, some dorsal and lateral body setae are present. The protonymph has four pairs of legs (octapodal). They have two ventral genital papillae. The anal, dorsal and lateral setae are present. Tritonymphs are also octapodal and have two pairs of genital papillae, located between the fourth coxae. They have middle and anterior genital setae, along with anal, dorsal and lateral setae. The adults are larger in size, compared to the nymphs and possess a genital opening (Walzl, 1992). Each developing life stage, has a short non-feeding phase (quiescent phase) and a feeding phase where the mites are active. In the quiescent or pharate phase the mite metamorphose to the next stage. It is also a phase, that is dormant and may be prolonged during unfavorable conditions (Arlian et al., 1998a; Arlian et al., 1999a;

1999b). In some mite species, e.g. B. tropicalis, the life cycle has seven distinct stages (Figure 2.4) including egg (5.7±0.8 days), larva (4.2±3.0 days), pharate protonymph (1.7±0.8 days), protonymph (3.1±1.9 days), pharate tritonymph

(1.2±0.4 days), tritonymph (3.8±2.1 days), and pharate adult (1.8±0.5 days; Mariana and Ho, 1996).

Mites reproduce exclusively by sexual reproduction. During copulation, that may occur for a period of 48 hours, male mites attach to the adult or tritonymph females, by anal suckers, orientating in opposite directions (Hart, 1998). Sperms are transferred into the opening of bursa copulatrix (receptaculum seminis) of the female, after which, the adult females start laying eggs at a rate of 1-3 per day.

At optimum temperature of 23oC and RH of 75%, D. farinae and D. pteronyssinus take 35.6+ 4.4 and 34+ 5.9 days to complete their life cycles (Arlian

Figure 2.4: Life cycle of HDM

et al., 1990; Arlian and Dippold, 1996). Under optimum culture conditions, a D. farinae female can live for 100 days and reproduce for 34 days (Arlian and Dippold,

1996), whereas, D. pteronyssinus female, at an average, lives for 31 days and has a reproductivity period of 26.2 days (Arlian et al., 1990). Studies show, that, the egg laying rate may vary with environmental conditions (Walzl, 1988). In D. farinae, the egg laying period may last for 31.3 days at the rate of 0 to 5 eggs per day (Arlian and

Dippold, 1996) while D. pteronyssinus may lay 0 to 8 eggs per day for up to 23.3 days (Arlian et al., 1990).

Allergenicity of mite cultures, was found to show a strong relationship, with the stages of mite life cycle. It was low during the early stages and reached a maximum level during exponential growth, and eventually declined in the death phase (Eraso et al., 1997). Mite allergen levels in extracts, prepared during the exponential growth phase, were higher than extracts from other phases of growth

(Eraso et al., 1998).

2.6.4 Differential Anatomy of D. pteronyssinus and D. farinae.

D. farinae is among the larger mite species, the male mite has an average length of 290μm. D. farinae males are either homeomorphic or heteromorphic. In homeomorphic males epimera I is free and first pair of legs is of normal length.

Conversely, the heteromorphic males have epimera I fused into a V or Y shape and enlarged pair of leg I. The dorsal shield (hysteronotal shield), is square shaped and does not extend to the IV coxae. The average length of female is 360μm.

Propodonotal shield, is 1.4 times longer than its width. The dorsal body surface, is covered with transverse cuticular striations. The anterior genital apodeme or epigynium is crescent-shaped and is only slightly arched. The bursa copulatrix, is

ventrally placed on the side of the anus, with a strongly sclerotized funnel shaped receptaculum seminis or seminal receptacle (Fain, 1965; Fain, 1966; Arlian, 1989).

Recently, a third heteromorphic was also reported (Solarz et al., 2016).

Members of D. pteronyssinus species, are usually smaller than D. farinae.

The average length of the males is 275 µm. The third pair of legs, is slightly larger than the first two pair of legs. The dorsal shield, extends from the posterior end of the body to the genitalia and is longer than wide. A pair of adanal suckers, is present posteriorly on the ventral side of the body, measuring 12 μm in diameter. The males are homeomorphic, with free epimera I. The average length of female’s body is 300

µm, with longitudinal cuticular striations on the dorsal cuticle (Colloff, 2009). The epigynium, is more arched than in D. farinae females. Bursa copulatrix has ductus bursae, with uniform thickness, that ends in a receptaculum seminis. The base of the receptaculum seminis, is flower shaped in ventral view (U shaped in cross section) with 10-13 lobed sclerite (Fain, 1965; Fain, 1966; Arlian, 1989).

2.7 IMPORTANCE OF MOLECULAR CHARACTERIZATION

Currently, HDM are identified on their morphological and developmental characteristics. Some mite species are taxonomically and morphologically very similar in the adult stage, therefore, it is difficult to identify them with precision

(Colloff and Stewart, 1997). Molecular characterization is becoming increasingly important, for identification (genomic barcoding) of both plants and animals.

Genomic targets for potential barcodes, include, mitochondrial cytochrome c oxidase

(COX1) (Wheeler, 2005), various single copy nuclear genes, ITS1, ITS2 and 5.8S rRNA (Chen et al., 2010). Studies on these genes, indicate some limitations in there

use as potential markers, for example, COX1 and 5.8S rRNA show very low variability, while others like ITS1 rRNA and nuclear, single copy genes are difficult to amplify (Chen et al., 2010) Use of DNA markers, for the identification of mites is becoming increasingly important (Navajas and Fenton, 2000), because, it offers independence from the study of stages of life cycle or a live specimen for analysis.

A correct identification protocol, using molecular characterization of mite species can reduce time requirement and errors in contrast to morphological identification, making it more efficient, with greater objectivity, in the results (de Mendonça et al.,

2011). Mitochondrial genome of arthropods, contains some highly conserved regions like 12S rRNA (Roehrdanz, 1993). This region has recently been used, in the study of systematic biology of four domestic mite families Pyroglyphidae, Glycyphagidae,

Acaridae, and Echimyopodidae (Miyamoto et al., 1990; Carranza et al., 2002;

Dawood et al., 2002; Skerratt et al., 2002; van der Kuyl et al., 2002; Suarez-Martinez et al., 2005), but its use is limited, because of many highly conserved regions in the sequence. The nuclear ribosomal DNA region (rDNA), has been successfully used for the identification of eukaryotes (Schoch et al., 2012). It consists of a cluster of three conserved ribosomal subunits (18S rDNA, 5.8S rDNA and 28S rDNA), linked by the two internal transcribed spacers, ITS1 and ITS2. Amplification of rDNA is preferred, because there are more than 100 copies of this cluster in a genome. These conserved ribosomal subunits are valuable in distinguishing between taxonomic groups, while variation in ITS1 and ITS2 regions help in molecular characterization of species (Hillis and Dixon, 1991; Gotoh et al., 1998; Essig et al., 1999; Navajas et al., 1999; Navajas and Fenton, 2000; Navajas et al., 2001; Knapp et al., 2003; Ben-

David et al., 2007; de Rojas et al., 2007; Wei et al., 2011) and phylogenetic study

(Cruickshank, 2002). Polymerase chain reaction-restriction fragment length polymorphism (PCR–RFLP) of ITS1 and ITS2, has effectively been used for

taxonomic characterization of mites (Osakabe et al., 2002), ticks (Poucher et al.,

1999) and insect species (Toma et al., 2000; Kampen et al., 2003). ITS2 sequence, has now been recognized as a suitable tool in the characterization of astigmatid species (Webster et al., 2004; Noge et al., 2005; Yang et al., 2011). Wong et al

(2011) recently employed PCR–RFLP of ITS2 using six to eight restriction enzymes for the identification of six major mite species.

2.8 ENVIRONMENTAL FACTORS EFFECTING MITE POPULATION

Although, it is very difficult to accurately estimate the total number of mites in houses, but, their population can be predicted on the basis of environmental factors including availability of nutrients and fluctuations in relative humidity and temperature. Optimum conditions for D. farinae and D. pteronyssinus culture include 20-250C temperature and 75% relative humidity (Arlian et al., 1998a;

1998b). Mites feed on animal dander and human skin flakes, and are therefore found in places such as beds, sofas, couches, furniture, carpets and upholstery. Dense mite populations have been reported in bedroom carpets, living room carpets and couches

(van Bronswijk, 1981; Fain and Atyeo, 1990; Solarz and Solarz, 1996; Mehl, 1998;

Arlian and Platts-Mills, 2001; Solarz, 2001a, 2001b; Arlian et al., 2002b; Solarz and

Senczuk, 2003; Solarz, 2004; Solarz et al., 2007; Colloff, 2009; Solarz, 2010).

It is estimated, that, mites have approximately 75% water by weight (Arlian,

1992), where most of the water is acquired from the ambient air (Arlian, 1977), thus ambient relative humidity is vital for survival of mites in any habitat. Studies show, that, critical RH for the endurance of mite population is between 55 to 75% (Arlian,

1975). Under unfavorable conditions, when the environmental RH is low, the mites reduce their rate of metabolism, by adjusting various processes, e.g. a reduction in

food intake is observed and the mites are said to be in a quiescent phase (Arlian,

1975, 1977). Similarly, they become reproductively inactive during dry conditions, remain dormant for long periods and regain activity only with the return of favorable conditions (Arlian et al., 1983). Studies show, that, D. farinae are able to sustain and proliferate better under daily fluctuations of RH as compare to D. pteronyssinus

(Arlian et al., 1999a, 1999b). When RH falls below 50% critical value, a massive decline in mite populations occurs (Arlian et al., 1999b; Arlian et al., 2001). A fast rate of population growth in D. pteronyssinus was observed at RH above 60% (Arlian et al., 1998a; Crowther et al., 2006; Thomas, 2010).

Variation in temperature also strongly influences the life cycles of D. farinae and D. pteronyssinus. The optimum temperature for mite growth and proliferation is approximately 23oC (Arlian et al., 1990; Arlian and Dippold, 1996). At high temperature, mite populations grow fast, but much higher temperature lowers the fertility rate of mites (Arlian et al., 1990). Mites’ population decreases when air temperature is raised to 40oC (Chang et al., 1998). Arlian et al., (1990), observed that, D. pteronyssinus takes 123 days to complete its life cycle at 16oC, whereas, the cycle is completed in only 15 days at 35oC. Life cycle of D. farinae is more sensitive to extreme temperatures, reproducing only within a narrow range of temperatures.

Their fecundity was observed to be almost zero at 16oC and at 35oC (Arlian and

Dippold, 1996).

2.9 GEOGRAPHICAL DISTRIBUTION OF HDM

Mites show variation in their distribution around the world. D. pteronyssinus and D. farinae are among the most prevalent species found globally. D. pteronyssinus is mostly found in coastal areas, where the climate is humid, whereas

D. farinae more often occurs in dry areas or high-altitude regions with low humidity and higher temperatures (Dusbabek, 1974). Similarly, in temperate regions mite densities fluctuate with seasons, higher mite counts are observed in summers when indoor humidity is high, while a massive fall in mite population occurs in winters, because of their desiccation under low RH, but they never perish completely (Arlian et al., 1982; Arlian et al., 1983).

Earlier it was thought, that, D. farinae was the most abundant mite species, in the United States and D. pteronyssinus in Europe, hence, they were commonly named, American house dust mites and European house dust mites respectively

(Munir et al., 1995; Mullen and OConnor, 2002). Nevertheless, today a wide distribution of both species has been well established globally, co-inhabiting in most homes, where, one species may be more abundant than the other, depending on regional climate (Thomas, 2010). Houses found in tropical and subtropical regions, are abundantly infested with D. pteronyssinus and B. tropicalis. Studies from the

United States show, that, different houses in the same region, may have variable species dominance (Arlian et al., 1992).

Various geographic regions of North America, have a predominance of D. farinae in low humidity areas like Ohio (Arlian et al., 1982), New York (Chew et al., 2009), Baltimore, Massachussets (Huss et al., 2001), Cincinnati (Arlian et al.,

1992; Rose et al., 1996), Detroit (Abramson et al., 2006) and Toronto (Huss et al.,

2001), whereas, both D. farinae and D. pteronyssinus were equally frequent in humid regions, such as, Vancouver (Murray and Zuk, 1979; Chan-Yeung et al., 1995), Los

Angles (Arlian et al., 1992; Rose et al., 1996) and Texas. In some cities, only one species was found, e.g. D. farinae in Greenville and Delray Beach and D.

pteronyssinus from San Diego (Thomas et al., 2010; Arlian et al., 1992) and the surrounding regions of Honolulu (Nadchatram et al., 1981; Massey et al., 1988). D. farinae was also found to be the dominant species in Williamsburg, Virginia

(Lassiter and Fashing, 1990) and Columbus (Larson et al., 1969; Yoshikawa and

Bennett, 1979) USA.

E. maynei and B. tropicalis, are among the other reported allergy causing mite species from North America (Nadchatram et al., 1981; Arlian et al., 1982;

Fernández-Caldas et al., 1990; Arlian et al., 1992; Nelson and Fernandez-Caldas,

1995; Barnes et al., 1997; Hannaway and Roundy, 1997; Montealegre et al., 1997;

Demite and Feres, 2007; Chew et al., 2009). Mites have also been reported from other countries of North America. In Barbados (Pearson and Cunnington, 1973) and

Milwaukee (Klein et al., 1986) mite counts were very low and D. farinae was dominant. Another study reported a higher D. pteronyssinus count in Barbados

(Barnes et al., 1997). In Martinique, a bias for D. pteronyssinus counts was reported

(Marin et al., 2006), whereas, in La Chorrera; Panama, non-pyroglyphid mite species were predominant (Miranda et al., 2002).

D. pteronyssinus is the most dominant species, found in most parts of Central and South America (Charlet et al., 1977; Charlet et al., 1978; Hurtado and Parini,

1987; Soto‐Quiros et al., 1998; Binotti et al., 2001; Calvo et al., 2005); Chile

(Franjola and Rosinelli, 1999; Calvo et al., 2005), Santiago (Wickens et al., 2004), regions of Sao Paulo (Arruda et al., 1991; Demite and Feres, 2007), Salvador

(Medeiros Jr et al., 2002), Paramaribo (van Bronswijk, 1972) and Belo Horizonte

(Rosa and Flechtmann, 1979) in Brazil (Binotti et al., 2001; de Oliveira et al., 2003;

Terra et al., 2004), Venezuela (Hurtado and Parini, 1987), Colombia (Charlet et al.,

1977; Fernandez-Caldas et al., 1993; Sánchez-Medina et al., 1996), Croatia (Blythe,

1976; Macan et al., 2003), Cuba (Cuervo et al., 1983), Ecuador (Valdivieso et al.,

2006), Alexandria (Sadaka et al., 2000) and Puerto Rico (Montealegre et al., 1997), were also found to have rich D. pteronyssinus fauna. Some parts of Central and South

America have a mixed HDM populous, where, both D. pteronyssinus and D. farinae are equally abundant. These include, Argentina (Neffen et al., 1996), Quito in

Ecuador (Valdivieso et al., 2006) and Mexico (Servin and Tejas, 1991; Thomas et al., 2010). A drier region of Colombia; La Calera (Valdivieso et al., 2006) and

Croatia (Macan et al., 2003), reportedly, had a higher frequency of D. farinae in the houses. Other species like, D. siboney, E. maynei and B. tropicalis have also been reported in some parts of South and Central America (Charlet et al., 1977; Charlet et al., 1978; Cuervo et al., 1983; Hurtado and Parini, 1987; Soto‐Quiros et al., 1998;

Franjola and Rosinelli, 1999; Croce et al., 2000; Binotti et al., 2001; de Oliveira et al., 2003; Calvo et al., 2005; Monterroza et al., 2006). In Alexandria (Rezk et al.,

1996), San Jose; Costa Rica (Vargas and Mairena, 1991) and Peru low mite counts were found (Caceres and Fain, 1978; Caceres and Fain, 1979; Croce et al., 2000).

Both D. farinae and D. pteronyssinus are extensively distributed in all

European countries, though, some places are infested exclusively by D. pteronyssinus and others by D. farinae. Recently, Zock et al., (2006) suggested, that, the occurrence of D. farinae in Europe, is much higher than, reported earlier. The researchers also observed, a higher decline in the D. pteronyssinus population, in low temperatures during winter season, compared to D. farinae. E. maynei is another common mite species in Europe (Stenius and Cunnington, 1972; Blythe et al., 1974;

Mumcuoglu, 1976; 1977; Colloff, 1987b; 1987a; Munir et al., 1993; Alvarez et al.,

1996; Bigliocchi et al., 1996; Hirsch et al., 1998; Julge et al., 1998; Mehl, 1998;

Solarz, 1998; Warner et al., 1999; Moscato et al., 2000; Racewicz, 2001).

Houses in London (Zock et al., 2006), Cardiff (Rao et al., 1975), Oxford and its suburbs (Hart and Whitehead, 1990), Glasgow (Sesay and Dobson, 1972; Colloff,

1987a, 1987b) and Birmingham (Blythe, 1974; 1976), have higher frequency of D. pteronyssinus (Larson et al., 1969; Blythe et al., 1974; Yoshikawa and Bennett,

1979; Colloff, 1987a, 1987b; Lassiter and Fashing, 1990; Zock et al., 2006). Other

European countries, where D. pteronyssinus are more abundant, include Norway

(Mehl, 1998), Finland (Stenius and Cunnington, 1972), Estonia (Julge et al., 1998),

Italy (Noferi et al., 1974; Bigliocchi et al., 1996), 25 localities in Czech Republic

(Samsinák et al., 1972), Slovak Republic (Makovcová et al., 1982) and Spain (Portus and Gomez, 1976; Alvarez et al., 1996; Boquete et al., 2006). Conversely Poland

(Solarz, 1998; Racewicz, 2001), Verona (Zock et al., 2006), some cities of Italy

(Noferi et al., 1974; Bigliocchi and Maroli, 1995; Moscato et al., 2000; Zock et al.,

2006; Marraccini et al., 2004), France (Zock et al., 2006) and Switzerland (Zock et al., 2006) have D. farinae as the predominant species. Many inland regions of

Europe, have reports of very low mite counts, with D. pteronyssinus dominating the house dust. Among these are Bulgaria, Silistra (Todorov, 1979), France (Percebois et al., 1972; Araujo-Fontaine et al., 1973; Vervloet et al., 1982), Hungary (Halmai,

1984), Sardinia in Italy (Ottoboni et al., 1983), Spain (Alvarez et al., 1996; Boquete et al., 2006), Moscow in Russia (Zheltikova et al., 1994), Germany (Karg, 1973),

Iceland (Hallas et al., 2004), some parts of Czech Republic (Vobrázková et al.,

1986), Denmark (Korsgaard, 1979), Finland (Stenius and Cunnington, 1972) and

Netherlands (van Bronswijk and Sinha, 1971; Cornere, 1972; van Bronswijk, 1973;

Blythe, 1976; Racewicz, 2001). Some European countries are infested equally with both HDM species, like Sweden (Munir et al., 1993; Warner et al., 1999), Denmark

(Stenius and Cunnington, 1972; Mehl, 1998), French Alps (Vervloet et al., 1982;

Pauli et al., 1993), Netherlands (Tempels-Pavlica et al., 2004; Zock et al., 2006)

Belgium (Lind, 1986; Zock et al., 2006) Czech Republic (Dusbabek, 1974, 1979)

Finland (Stenius and Cunnington, 1972), Italy (Blythe, 1976), Turkey (Blythe, 1976;

Kalpaklioglu et al., 1997), Poland (Horák, 1987; Solarz, 1998) United Kingdom

(Blythe, 1976) and Germany (Dusbabek, 1974; Hirsch et al., 1998; Lau et al., 2001;

Zock et al., 2006). Mumcuoglu (1976; 1977), reported a high frequency of E. maynei, along with D. pteronyssinus in Switzerland. There are few studies reporting higher

D. farinae counts in Europe. Some places like Naples (Noferi et al., 1974; Blythe,

1976) and Rome (Bigliocchi et al., 1996) in Italy, and some cities of Czech Republic

(Samsinák et al., 1972) have a bias for D. farinae. Houses in Netherlands (Horák,

1987), 33 localities in Czech Republic (Samsinák et al., 1978) and London, S. Wales

(Maunsell et al., 1968) have very low mite infestation.

In Africa D. pteronyssinus and D. farinae are the most common species. In central highlands of Africa low HDM counts are reported, here, D. pteronyssinus heavily populates houses with better insulation (Sinclair et al., 2010). These include

Nairobi; Kenya (Blythe, 1976), Lagos; Nigeria (Hunponu-Wusu and Somorin,

1978), Zambia (Buchanan and Jones, 1974), Mauritius (Guerin et al., 1992), Ghana

(Addo-Yobo et al., 2001) and most of South Africa (Potter et al., 1996). Countries in North Africa like Algeria have very low mite counts (Louadi and Robaux, 1992)

In Egypt both species are equally abundant (Morsy et al., 1995; Yassin and Rifaat,

1997).

In Riyadh, Saudi Arabia, D. farinae is the dominant species (Al-Frayh et al.,

1997), while, in Jeddah, high D. pteronyssinus allergen levels compared to D. farinae

were reported (Al-Rabia, 2016), whereas, in Taif city, allergens from both species were found equally abundant (Tayeb, 2017). There are reports of low mite counts from many cities of Iran. The humid areas have abundant D. pteronyssinus (Amoli and Cunnington, 1977; Sepasgosarian and Mumcuoglu, 1979), whereas regions inland, that are considerably drier, are infested with D. farinae (Fereidouni et al.,

2013). Palestine (Feldman-Muhsam et al., 1985; Mumcuoglu et al., 1994;

Kalpaklioglu et al., 1997; El Sharif et al., 2004) and most regions of Israel (Kivity et al., 1993; Mumcuoglu et al., 1999), also have D. pteronyssinus as the major infestation, but in Nir Dawid, Israel (Feldman-Muhsam et al., 1985), both D. farinae and D. pteronyssinus are equally abundant.

In South Asia, Indian cities, Calcutta (Saha et al., 1994), Pahalgam and

Srinagar (Modak et al., 1992) and Jammu (Maurya et al., 1983), are rich in HDM fauna with D. pteronyssinus dominating the populous. Other mite species, reported in India include D. farinae, E. maynei and B. tropicalis (Dar and Gupta, 1979).

In the Southeast and Northeast Asian countries, a predominance of D. pteronyssinus has been established. Many researchers from China (Wang and Wen,

1997), Hong Kong (Gabriel et al., 1982), Japan (Miyamoto et al., 1970; Oshima,

1970; Suto et al., 1992; 1993; Takaoka et al., 1977; Ishii et al., 1979; Takaoka and

Okada, 1984; Toma et al., 1993), Malaysia (Mariana and Ho, 1996), Cameron

Highlands (Ho and Nadchatram, 1985), Thailand (Blythe, 1976; Malainual et al.,

1995), Singapore (Chew et al., 1999) and Taiwan (Sun and Lue, 2000), have reported a high prevalence of D. pteronyssinus, while Nagoya, Japan (Miyamoto et al., 1970;

Oshima, 1970; Suto et al., 1992) and some South Korean cities, have a bias for D. farinae (Paik et al., 1992; Ree et al., 1997). Some cities like Kuala Lumpur, Malaysia

(Rueda, 1985), Rangoon, Burma (Htut et al., 1991), Kwangju and Seoul, South

Korea (Ree et al., 1997), had very low mite counts. E. maynei and B. tropicalis were reported, in dust from houses in Taiwan (Miyamoto et al., 1970; Oshima, 1970).

Melbourne in Australia (Blythe, 1976), Papua New Guinea (Anderson and

Cunnington, 1974) and New Zealand (Wickens et al., 1997), are richly infested with

D. pteronyssinus. Low mite counts, with D. pteronyssinus dominance, were reported from most parts of Australia (Green et al., 1986; Tovey et al., 2000). Belmont region in Western Australia had a higher D. farinae count (Green et al., 1986), due to drier conditions around the year. In Bunbury and Perth, both D. farinae and D. pteronyssinus were equally abundant (Colloff et al., 1991).

2.10 HDM ALLERGENS

Applied molecular biology techniques have uncovered, over 20 proteins, from mite species, that can induce allergic response (allergens), in atopic individuals.

Amino acid sequences, of most of these allergens, are available in the database. They could be aligned with the help of Basic local alignment tool (BLAST). Their homologies, shared structural and functional domains and conserved amino acid sequences, can be determined with the help of available bioinformatics tools

(Altschul et al., 1997; Marchler-Bauer and Bryant, 2004). Peptide statistics programs and online servers have helped to discover similarities, in primary and secondary protein structure, as well as prediction of their tertiary structures and accumulate comparative data on these proteins (Colloff, 2009). Based on physicochemical properties and functions, allergens from house dust mites D. farinae and D. pteronyssinus (Acari: Pyroglyphidae), have been classified into 33 and 24 groups respectively (Allergome, 2017). Other mite species whose allergens have been

studied, include, E. maynei, B. tropicalis, L. destructor etc. Der p 1, was the first major allergen to be isolated and characterized in 1980, by two groups of independently working researchers (Chapman and Platts-Mills, 1980; Stewart and

Turner, 1980), followed by the discovery of Der f 1 in 1982 (Dandeu et al., 1982).

Der p 1 was the first allergen to be cloned using molecular biology tool (Chua, 1988).

Mite allergens have different biological functions. The relationship between their biological functions and IgE-binding activities is still not clear. Based on their generalized functions, mite allergen groups are broadly classified into 6 families: the peptidases, the glycosidases, the transferases, small alpha (α)-helical proteins, muscle proteins and the lipid-binding proteins. The remaining allergens, are proteins of unclassified families (Colloff, 2009). Mite allergen families have been discussed in further details below.

2.10.1 The Peptidases

Allergen groups (1, 3, 6 and 9) included in the family of peptidases are proteolytic enzymes with Enzyme Commission number (EC number) 3.4. These proteins are localized in the gut, secreted as digestive enzymes. The proteins are synthesized with a signal peptide and a pro-enzyme (in active form). Proteolytic activation may occur outside the cell, or inside cell organelles, like storage vacuoles or vesicles (Rawlings and Barrett, 1994). They are considered to be major allergens, due to their predominance in mite faecal pallets as active enzymes. Experimental evidence suggests, that, enzymatic activity of these proteins, may contribute significantly in increasing their allergenic properties (Hewitt et al., 1995; Reed and

Kita, 2004). Being peptidases, they may proteolytically trigger inflammation or may boost the activity of mast cell enzymes like tryptase and elastase in allergic

inflammatory reactions (Colloff, 2009; Dumez et al., 2014). Group 1 allergens, are cysteine proteases, possessing C1 domains (papain-like protease family) (Stewart et al., 1991; Rawlings and Barrett, 1994) whereas groups 3, 6, and 9 are serine proteases

(chymotrypsin family S1), showing trypsin, chymotrypsin, and collagenase activities respectively (Yasueda et al., 1986; Stewart et al., 1992; King et al., 1996). They have a high percentage of amino acids tryptophan, tyrosine and isoleucine. These peptidases contain, at least six conserved cysteine residues. Secondary structure prediction shows, short regions of α-helices and beta (β) strands in the molecules, whereas, 53-60% of the protein molecule displays random coiling (Dumez et al.,

2014).

The group 1 allergens, are 25 kDa polymorphic proteins, showing homology to mammalian cathepsin and the plant actinidin and papain enzymes. Approximately,

70% of mite allergy patients, show reactivity to group 1 allergens. They are found in most HDM species like D. pteronyssinus, D. farinae, D. microceras, D. siboney, E. maynei and B. tropicalis (Stewart and Turner, 1980; Mora et al., 2003). They are also reported in the Psoroptes cuniculi (P. cuniculi), P. ovis (Lee et al., 2002) and

Sarcoptes scabiei (S. scabiei) (Holt et al., 2004). The allergens are localized in the lining of gastrointestinal tract, released into environment from dead mites and faecal palettes (Tovey and Baldo, 1990). It is speculated, that, these allergens are not present in Acarus, Tyrophagus, Glycyphagus and Lepidoglyphus species.

Group 1 allergens in pyroglyphid mites (Dermatophagoides spp. and E. maynei), are made up of a signal peptide (18/19 residues), followed by a pro-peptide

(79/80 residues) and mature protein of 222–223 residues (Kent et al., 1992). They are among the major allergens from D. pteronyssinus and D. farinae, showing 50%

IgE binding frequency (Thomas et al., 2002). Although Der p 1 and Der f 1 are monomeric proteins and exhibit structural similarities, Der p 1 contains a magnesium binding site (Meno et al., 2005; De Halleux et al., 2006; Chruszcz et al., 2009), that is lacking in Der f 1 (Chruszcz et al., 2009). Der p 1 is a highly transcribed protein, accounting 50% of total proteases in D. pteronyssinus (Randall et al., 2017).

Efficiency of Der p 1 as a diagnostic tool for D. pteronyssinus sensitization is well recognized (Yang et al., 2016).

Within group sequence identity in pyroglyphid group 1 allergens is 78%

(highest in this group). Pso o 1, show 58% calculated identity and a potential glycosylation site similar to pyroglyphid group 1 allergen. A high level of homology among various group 1 allergens, is found in the active site region and the cysteine residues. Only five polymorphisms are known in Der f 1, compared to 23 variants in

Der p 1 (Thomas et al., 2007). While a single gene for Der p 1 is found in D. pteronyssinus genome, in scabies mite S. scabiei, multiple genes code for Sar s 1 allergen (Holt et al., 2004).

Allergens of group 3 are serine protease (trypsin-like) having a predicted molecular weight (MW) ranging between 23-25 kDa. They can be sighted on SDS

PAGE gel at 30 kDa MW. They are reported in D. pteronyssinus, D. farinae, D. siboney, S. scabiei, E. maynei, L. destructor, B. tropicalis and G. domesticus. The polypeptide consists of a signal peptide (15–20 residues), pro-enzyme (9–26 residues) and a mature protein (219–232 residues). Polymorphism reports in group

3 allergens show alleles in Der p 3 (Smith and Thomas, 1996a; 1996b). Like group

1 allergen, group 3 allergen in S. scabiei has a multi-gene family (Holt et al., 2003).

IgE binding frequency of this allergen group ranges between 40-100% with a mean

value of 67%, therefore they are among the major HDM allergens (Colloff, 2009).

Allergens included in group 6 are serine proteases with chymotrypsin activity, having average molecular weight of 25 kDa (Yasueda et al., 1993). They have been isolated from D. farinae, D. pteronyssinus and B. tropicalis. Only 31-65% patients with mite allergies show reactivity to allergens from group 6 (Yasueda et al., 1993). The mature protein molecule is 230-231 residues long and lacks any N- glycosylation sites. A 16-17 residues signal peptide and 32-34 residues pro-enzyme occurs at the start of the molecule. Der f 6 and Der p 6 show 75% similarity, sharing

35-37% identity to group 3 allergens and 27-30% sequence identity to group 9

(Colloff, 2009).

Group 9 allergens are collagenases having an estimated MW 23.8-24.5 kDa

(identified on SDS-PAGE gel at 27-30 kDa) with 16 residues signal peptide, a 9 residues pro-enzyme region and 219 residues mature protein. They have been characterized from D. pteronyssinus, D. farinae and also B. tropicalis. The enzyme has not been characterized in E. maynei, despite collagenase activity reports from this species (Stewart et al., 1994). These proteins show 92% Ig E binding in patients’ sera. There is 70% and 61% sequence identity with Der p 3 and Der f 3 respectively.

There is limited cross-reactivity between Der p 9 and Der p 3 (Colloff, 2009).

The full-length Der f 9 cDNA (831 bp), revealed a single open reading frame.

Computer assisted translation showed a 19aa signal peptide and 257 aa mature protein with approximately 28 kDa calculated MW. There are 14 phosphorylation sites in the peptide. Predicted secondary structure gave one α-helix in the molecule

(Cui et al., 2017).

2.10.2 The Glycosidases

Allergens in this family are enzymes that belong to class EC 3.2.1. Groups 4

(α-amylase), 12, 15, 18 and 23 (chitinases) are included in this family. Groups 4, 15 and 18 are relatively larger proteins, comprising of 437 to 555 amino acid residues, whereas, group 12 and 23 are smaller proteins, having 146 and 90 amino acid residues respectively. Predicted secondary structure includes, two N terminal α- helices along with six β-strands, that fold into an 8-barrel tertiary structure (Colloff,

2009). Group 4 are among those highly conserved proteins that have been used in systematics to estimate evolutionary distance between animal species (Lake et al.,

1991). A BLAST search of groups 12 and 23 revealed homologies to Peritrophin A like chitin-binding domain, found in many insects. This domain shows resistance to proteases in the arthropod midgut and is identified as its major structural property. It helps to bind peritrophic membrane (PM) proteins to chitin fibrils, thus, initiating the formation of peritrophic envelope (Wang et al., 2004).

The group 4 allergens (Lake et al., 1991) have 55-57 kDa derived MW. They were characterized from common dust mite species including D. pteronyssinus, D. farinae, E. maynei and B. tropicalis (Lake et al., 1991), and many other storage mite species (Stewart et al., 1991). Like many other enzymes, the allergen molecule consists of a 22-25 residue signal, and 496 residue mature peptide sequence. Der p 4 shows 94% identity to Eur m 4, and 55-60% identity with other insect α-amylases.

They show a low (38%) mean IgE binding frequency, where children sera are even lesser reactive to Der p 4, compared to adult sera (Lake et al., 1991). Among group

12 allergens, Lep d 12 (AY293744) and Blo t 12 (Puerta et al., 1996) have only been characterized. Their molecular weight is 14 kDa, and mature peptide composition

(123-125 residues) shows similarity with the chitinases of groups 15 and 18.

Group 15 allergens were reported from D. pteronyssinus (O'Neil et al., 2006) and D. farinae (McCall et al., 2001). Der f 15 has a MW: 63.2 kDa (98/109 kDa on

SDS PAGE), and 555 amino acid (aa) residues. The molecule shows rich O- glycosylation with 50% carbohydrate residues (McCall et al., 2001). Der f 15 and

Der p 15 show sequence identity of 90%. Sera from mite sensitized individuals give

70% IgE binding with this allergen (O'Neil et al., 2006). Group 18 allergens have been reported from D. farinae, D. pteronyssinus and B. tropicalis. Mature Der f 18 has a MW of 50 kDa (Weber et al., 2003). The molecule includes a signal sequence

(25 aa), and a mature protein of 437 aa (Colloff, 2009). It belongs to the family 18 chitinases, and demonstrates a weak chitin-binding activity (Resch et al., 2016). Der f 18 shows IgE binding frequency of 54% in D. farinae sensitized patients’ sera. Der p 18 shows a high sequence homology (O'Neil et al., 2006) and partial cross reactivity with Der f 18 (Resch et al., 2016).

Recently a new 14 kDa allergen, “Der p 23” containing a peritrophin-like protein domain (PF01607), was added to mite chitinases. The protein has a length of

90 aa with a 21 aa signal peptide residue. A 74% IgE binding frequency was observed in D. pteronyssinus allergic patients. Antibody levels in these patients’ sera, were analogous to Der p 1 and Der p 2 (Weghofer et al., 2013). Der p 23 is the least expressed among the major D. pteronyssinus allergens, the RNA content for Der p

23 was 30 time less than Der p 1 (Mueller et al., 2016). Role of Der p 23 in asthma exacerbation has also been established (Ono et al., 2010). This allergen was detected in faeces, signifying its localization in the gut (Weghofer et al., 2013). Group 23 allergen has also been reported in D. farinae (Uniprot number: A0A088SAW7).

With a molecular weight of 11 kDa and 91 aa residues the protein, shows 77% sequence homology to Der p 23 (Wu and Liu, 2014).

2.10.3 The Transferases

Transferases are a class of enzymes that belong to EC number 2. They catalyze reactions where a group, for example, a phosphate group or a Sulphur containing group, from one compound (donor) is transferred to another compound

(acceptor). Allergen of groups 8 (glutathione S-transferase) and 20 (arginine kinase) are included in this family. Both groups in this family have fairly uniform amino acid composition. Tertiary structure of glutathione S-transferase and arginine kinase, shows folded globular molecules, making two domains. A surface cleft separates the two domains in the molecules.

The group 8 allergens or glutathione S-transferases (EC 2.5.1.18), have an average molecular weight of 26 kDa. Native Der p 8 (nDer p 8), shows 65-96% IgE reactivity (O'Neil et al., 2006). These allergens have been reported from D. pteronyssinus (O'Neill et al., 1994; Dougall et al., 2005), Psoroptes ovis (P. ovis;

Lee et al., 2005), S. scabiei (Dougall et al., 2005), G. domesticus, L. destructor and

B. tropicalis (Chew et al., 2001). Der p 8 has at least eight isoforms, which may imply, that, the protein is translated from multi-gene family (Huang et al., 2006).

Recombinant Der p 8 expressed independently by O’Neill et al., (2006) and Huang et al., (2006), gave 40% sera binding and 84% IgE reactivity respectively. Blattella germanica allergen (Bla g 5), is also a glutathione S-transferase enzyme (Arruda et al., 1997b), and shows high cross-reactivity with Der p 8 (Huang et al., 2006).

D. farinae arginine kinase (Der f 20; ABU97470) was reported in 2007 (Bi et al., 2007). Smith et al., (2008) reported a similar 356 aa residue protein

(ACD50950), with arginine kinase activity in the GenBank. These phosphorous- group transferring enzymes, or arginine kinases, catalyze the arginine metabolism in

the urea cycle: A similar protein “Der p 20” was identified from D pteronyssinus, having a molecular weight of 40 kDa. It showed 84% identity to Der f 20

(A0A088SAW4), and 87% identity to arginine kinases from Aleuroglyphus ovatus

(A. ovatus), commonly named as brown legged grain mite (Tan and Chew, 2007), and the house itch mite Glycyphagus domesticus (G. domesticus) (Yap and Chew,

2007). It shares 77-78% aa sequence homology with arginine kinases from many insects and crustaceans.

2.10.4 The Lipid-binding Proteins

This family includes groups 2, 13 (fatty acid-binding proteins), 5, 7, 21, 22

(fat binding proteins) and 14 (vitellogenin/apolipophorin-like). They are structural proteins and do not show any enzymatic activities, their biochemical functions are still not well understood.

Group 2 allergens are non-glycosylated polymorphic proteins, having 14 kDa molecular weight, producing allergic response in most of the mite sensitized individuals. These lipid binding proteins have been identified in majority of dust mite species like D. farinae, D. pteronyssinus, D. siboney, E. maynei, Tyrophagus putrescentiae (T. putrescentiae), G. domesticus, L. destructor, B. tropicalis, P. ovis,

A. ovatus and Suidasia medanensis (S. medanensis). Group 2 allergen proteins are well conserved, each having a signal peptide (16-17 residues) and 125-129 residues mature protein (Yuuki et al., 1991). They show Ig E binding in a large number of atopic individuals. The Der p 2 and Der f 2 tertiary structure consists of, 10 β-strands and an α-helix folded into a characteristic immunoglobulin like structure (Mueller et al., 1998; Derewenda et al., 2002; Ichikawa et al., 2005; Johannessen et al., 2005).

These are lipid binding proteins having a classic ML (MD2 related-lipid recognition)

domain, identified in the secretions of male reproductive system. This lead to the assumption that they may only be found in the males of mite species, involved in transport of cholesterol, metabolism and lipid recognition (Thomas and Chua, 1995).

This hypothesis has not received much support, because, high levels (comparable to group 1 allergen proteins) of Der f 2 and Der p 2 have been reported in house dust, that are not possible if these proteins were only localized in male reproductive tract

(Colloff, 2009). Group 2 allergens have an average IgE binding frequency of 80%

(Calderón et al., 2015). Studies show that recombinant group 2 allergens have IgE binding frequencies as high as native allergens e.g. 82-100% IgE binding frequency was reported in rDer p2 (Chua et al., 1990; Shen et al., 1993; Shen et al., 1996; Tsai et al., 1998; Weghofer et al., 2005), which was as high as nDer p 2 which gave 93-

100% IgE response (Yasueda et al., 1993; King et al., 1996). Similarly, both nGly d

2 and rGly d 2 gave 94% IgE binding frequency (Gafvelin et al., 2001).

Group 13 allergens belong to lipocalin family of proteins that bind small hydrophobic molecules involved in various cellular physiological functions. They show fairly high identity to retinoic acid binding proteins of arthropods belonging to classes crustacea and insecta (Mansfield et al., 1998). Tertiary structure of allergen proteins from group 13, resembles fatty acid binding protein (FABP) found in human brain (Balendiran et al., 2000). These allergens have been identified from D. farinae,

G. domesticus, B. tropicalis, L. destructor, Acarus siro (A. siro) and T. putrescentiae.

Having an average mass of 15-17 kDa, group 13 proteins lack any conserved cysteine residues, signal or propeptide sequences, and glycosylation sites (Aca s 13 and Tyr p 13 being the exceptions). Despite a high degree of sequence homology (58-82% identities), they display only 10-23% IgE binding activity. The tertiary structure of

Der f 13 shows similarity with group 2 allergen structure with 2 α-helices and a barrel

formed with 9 anti-parallel β-strands. A tenth β-strand is found at the N-terminal end of the protein.

Group 5 allergens are identified in many mite species including D. pteronyssinus, D. farinae, B. tropicalis, L. destructor and G. domesticus. These allergens have been described as highly charged midgut structural protein.

(Weghofer et al., 2008). Although the function of group 5 proteins is not well understood, evidence suggests that Der p 5 increases the synthesis of IL-6 and IL-8

(Kauffman et al., 2006). Among this group, Der p 5 is the first completely sequenced allergen (Tovey et al., 1989). Results of Der f 5 BLAST gave 45-80% sequence similarity, to other allergen from group 5, and 30-40% homology, with group 21 allergens. The monomers have molecular weight of 12.5-14.2 kDa, Gly d 5 being an exception, is much heavier (26-27 kDa), and shows only 34% identity with Der f 5

(Colloff, 2009), and even lesser with Lep d 5 and Blo t 5 (Eriksson et al., 2001). Der p 5 comprises of a 20-36 residue leader sequence, and 112-113 aa residues mature protein (O’Neill et al., 2006). Predicted tertiary structures of monomeric Der p 5 and

Blo t 5, display three α-helices, which form a coiled-coil (Khemili et al., 2012). Der p 5 forms a kinked N-terminal helix, that helps the polypeptide to dimerize creating a large hydrophobic cavity, which may be the lipid binding site in these proteins

(Santos da Silva et al., 2017. Der f 5 also gave a similar predicted structure, while other group 5 allergens, like Sui m 5, Lep d 5 and Blo t 5 did not present any tendency to dimerize (Naik et al., 2008). Reports show that only 50% of mite allergic individuals give IgE response to Der p 5 (Tovey et al., 1989), whereas, in the tropical regions, where B. tropicalis is more abundant, Blo t 5 is the predominant allergen, showing Ig-E binding frequency of 70-92% (Arruda et al., 1997b).

Group 7 allergens have also been discovered from the same species as group

5. Der p 7 (22 kDa protein), is an allergen that shows immune response in about 50%

HDM allergy patients. Its primary structure depicts a 17 aa residue signal peptide, and 196-200 aa residue mature protein (Shen et al., 1995). The biochemical function has not been defined, but it is well known, that they are lipid binding structural proteins. An N-glycosylation site, is a common feature of all group 7 allergens, although differences in position of these sites do exist (Shen et al., 1995). There are

7 extended α-helices, disjointed by short coils, and 3 small β-strands can be seen in their predicted secondary structure. IgE-binding frequency to Der p 7 and Der f 7 was 37-50% and 46% respectively (Shen et al., 1993; Shen et al., 1995; Shen et al.,

1996). In rLep d 7 the frequency was 67% (Eriksson et al., 2001). Online BLAST of

Der f 7 revealed 86% identity with Der p 7, whereas, only 23-29% sequence similarity was observed with other mite species.

Group 21 allergen is only reported from D. farinae, D. pteronyssinus and B. tropicalis. Relatively high sequence identity exists between these allergens and some of the allergens from group 5 (Gao et al., 2007) and group 2. Blo t 21 is 129 aa residues in length, and shows 39% identity to Blo t 5. This protein is translated from a single-copy gene, with α-helical structure. Der p 21 was recently identified in the gut epithelial cells of D. pteronyssinus (Weghofer et al., 2008; Pulsawat et al., 2014). rDer p 21 are monomeric 14.6 kDa helical polypeptides that show dimerization in solution, a behavior similar to Der p 5 (Weghofer et al., 2008; Pulsawat et al., 2014).

It also shows sequence homology with Der p 5, but its allergenicity is unknown

(Khemili et al., 2012). In one study, 60-95% of asthma and rhinitis patients were skin-prick test positive to Blo t 21. Despite close homology with Blo t 5, no cross reactivity between these two allergens has been observed (Weghofer et al., 2008).

Group 21 allergen has only been reported in D. farinae (Chew and Gao, 2006; Wu et al., 2016). With a molecular weight of 16 kDa and 136 aa residues, the allergen shows above 30% identity with many group 5 allergens. rDer f 21 showed cross reactivity to rDer f 5 (Wu et al., 2016). Although, the biological function of this allergen has not been studied, it is thought to be a lipid binding protein. IgE binding frequency for this allergen is unknown (Khemili et al., 2012).

Group 14 allergens are vitellogenin (carotenoid lipoproteins) found in egg yolk of invertebrates and vertebrates. These large molecules (200-700 kDa) have many glycosylation and phosphorylation sites that bind with metals, vitamins and lipids. These proteins are reportedly expressed in the liver or associated organs (Chen et al., 1997; Tsang et al., 2003) and transported through hemolymph to their localization sites in the cuticle, oesophagus, gut, ovaries and internal organs

(Fujikawa et al., 1996). These allergens present a substantially high homology to several vitellogenins from prawns and shrimps (Phiriyangkul and Utarabhand,

2006). Group 14 allergens were identified from D. pteronyssinus, D. farinae, E. maynei, B. tropicalis, P. ovis and S. scabiei. These apolipophorins, are homologues of vitellogenins and have an average molecular weight ranging from 190-206 kDa

(Mattsson, 1999). Complete Der p 14 (Epton et al., 2001) and Eur m 14 (Epton et al., 1999) have a length of 1662 and 1668 aa respectively. Native Der f 14 gave 70%

IgE-binding frequency which was reduced to 30-39% in recombinant Der f 14

(Fujikawa et al., 1996).

2.10.5 The Muscle Proteins

Muscle proteins tropomyosin (group 10) and paramyosin (group 11) are included in this family. These proteins have high frequencies of glutamine, arginine,

glutamate and methionine while cysteine and proline occur in fairly low frequencies.

They have a typical dimeric coiled-coil tertiary structure, completely made of long strand-like -helices (Yi et al., 2002). Tropomyosins are muscle binding proteins, that cover the actin active sites during resting phase of muscle. They are regarded as pan- allergens, due to their highly conserved structure (Shafique et al., 2012). There are reports of cross reactivity among these allergens from dust mites, crustaceans, molluscs and insects (Jeong et al., 2006).

Tropomyosins (group 10 allergens), have been identified in D. farinae, D. pteronyssinus, G. domesticus, L. destructor, P. ovis and T. putrescentiae. Like arginine kinases (group 20), a high percent homology of mite group 10 proteins, exists with crustacean and insect tropomyosins. With signal peptide (15 aa residue) and mature protein (285 aa residue), group 10 allergens from B. tropicalis and D. pteronyssinus, have a calculated MW of 33 kDa, appearing at 37 kDa band on SDS-

PAGE. Sequence identity among HDM tropomyosins, is higher than 75%. nDer f 10 shows IgE binding frequency of 81%, making it one of the major HDM allergens, however recombinant group 10 allergens show much lower IgE binding frequency

(Saarne et al., 2003).

Allergens of group 11 are paramyosins, second most common group of muscle proteins, identified from D. farinae, D. pteronyssinus, P. ovis, S. scabiei and

B. tropicalis. In 1998, a 2.1kbps long cDNA was cloned and sequenced, that was coding for a polypeptide of 711 aa residues. Sequence analysis confirmed this protein to be mite paramyosin. Skin prick test and immunoblot assay showed moderate allergenic activity with 62% and 50% IgE binding respectively (Tsai et al., 1998).

Another 692 aa partial fragment of paramyosin, in D. farinae with MW 81 kDa was

cloned and expressed by Tsai et al. in 2000. They are much larger than tropomyosins and show IgE binding frequency of 42-80% (Lee et al., 2004). Der f 11 shows a sequence identity of 34-60% with paramyosins from various sources. Sera obtained from a panel of skin prick test positive asthmatic children and adults were tested with rDer f 11 using immunodot assays. 75-77.6% and 70.8% serum IgE reactivity was reported in children and adult sera respectively, whereas 87.5% IgE binding frequency was described to native Der f 11 in immunodot assay. Like tropomyosins, paramyosins are highly conserved, cross-reactive and their recombinant forms give significantly lower IgE binding frequency than to the native form (Teo et al., 2006).

Immunodot assay of rDer p 11 with different allergic patients’ sera, gave reactivity ranging from 41.7% to 66.7%. In non-atopic patients, suffering from urticaria the reactivity was 18.8%, while only 8% reactivity was observed in normal individuals

(Lee et al., 2004).

2.10.6 Proteins of the Cytoskeleton

The EF hand motif is a helix-loop-helix structural domain, found in calcium- binding proteins superfamily (Gifford et al., 2007; Denessiouk et al., 2014). Allergen groups 16, 17 and 24 are proteins associated with cytoskeletal microfilaments, that have calcium binding domains, which display typical EF-hand motifs. Der f 16 is the only reported and characterized allergen in this group (Calderón et al., 2015). It is a gelsolin-like actin-binding protein, with a molecular weight of 53 kDa (Kawamoto et al., 2002a). These proteins can cap actin filaments and are involved in gel-to-sol transformations in cells (Silacci et al., 2004). The amino acid composition of Der f

16, shows some identity to other α-helical allergen groups, like group 5, 7 and 21.

The length of this allergen is, 480 aa, with 4 repeated gelsolin like segmental structures (Kawamoto et al., 2002a). A 55 kDa, rDer f 16 was expressed by Zhou et

al., (2012), having a length similar to the native allergen protein (480 aa residues).

The predicted secondary structure revealed, 35.21% α-helix, 20.83% extended strand and remaining 43.96% random coiling. There were 4 gelsolin domains in the molecule. Studies on IgE binding frequency of purified Der f 16, show 47% binding to allergy patients’ sera (Kawamoto et al., 2002a). Group 17 allergen (previously named as Mag 50), has only been reported in D. farinae. This is a calcium-binding protein homologue, with a MW of 30 or 53 kDa (Tategaki et al., 2000), with a helix- loop-helix (EF-hand) motif in the molecule (Kawamoto et al., 2002b). Der f 17 binds

IgE in 35% of sera from mite-allergic patients (Tategaki et al., 2000).

Group 24 allergens are among higher molecular weight (90 kDa) proteins and have only been found in D. farinae and T. putrescentiae. Der f 24 protein (GenBank accession number KC305498), was cloned having a length of 885 aa. Identified as an α-actinin, it contains a calmodulin-like domain with two EF-hand motifs at the C- terminus. The allergen gave IgE binding frequency of 85.4%. Similarly, a positive skin prick test was found in 80% D. farinae allergy patients (An et al., 2013). Tyr p

24 (D2DGW3) on the other hand, is a much smaller protein with a molecular weight of 17.6 kDa. Recombinant Tyr p 24, has been identified as troponin C that shares

62.7-85.5% homology with troponin C from various arthropods. Approximately,

11% individuals were found with sensitivity (IgE binding frequency) to rTyr p 24

(Jeong et al., 2010).

Chan et al., (2013) have described, another protein of 14 kDa MW and 118aa length as Der f 24 (Uniprot accession number M9RZ95). This protein is homologous to Ubiquinol-cytochrome c oxidoreductase (Complex III; EC 1.10.2.2) which is a mitochondrial protein that plays an important role in electron transfer (Calderón et

al., 2015). No further information is known about this protein. Recently, a similar,

14 kDa MW protein from D. pteronyssinus has also been reported, as Der p 24

(Uniprot accession number A0A0K2GUJ4), which has proven allergenic characteristics (Luo et al., 2016).

2.10.7 Other Allergens

Some other allergens reported from HDM, with little known biological functions, structure and allergenicity. These include Blo t 19 and Der f 25 to Der f

33. These proteins have been reported in the database but the information about them is not fully elucidated.

Blo t 19 is a small 7 kDa peptide with a possible antimicrobial activity in the gut and a week IgE binding (10%) frequency (Thomas et al., 2002; Calderón et al.,

2015). An antibacterial function has been proposed for Blo t 19, based on 76% homology with Ascaris suum antibacterial factor (ASABF), from a nematode (Pillai et al., 2003).

Der f 25 (34 kDa) and Der f 29 (18 kDa) are isomerases. Der f 25 (L7UZA7), is 247 aa residue protein, that shows homology to triosephosphate isomerases (TPI).

TPI is an enzyme (EC 5.3.1.1), that catalyzes the reversible isomerization of dihydroxyacetone phosphate to D-glyceraldehyde 3-phosphate (Alber et al., 1981;

Harris et al., 1998). This enzyme is present in all organisms, and in some fish, midges, crustaceans, and various plants, TPIs have been identified as allergens

(Sander et al., 2001; Chen et al., 2005; Hoppe et al., 2006; Pastor et al., 2008; Sudha et al., 2008; Nakamura et al., 2009; Bauermeister et al., 2011).

Der f 26 is a 43 kDa transcription (translation) elongation factor 2. The isolated protein was 429 aa residues in length (An et al., 2013). No reports on its allergenicity are available. Der f 27 is a Trypsin inhibitor (Sander et al., 2001; An et al., 2013), having 48 kDa MW and 427 aa length (Liu et al., 2014a). It belongs to

Serpins (serine protease inhibitors) family of proteins, having the ability to inhibit proteases. Positive SPT was only observed in 9 out of 26 individuals, but in vitro IgE binding was 100% (Liu et al., 2014a). rDer f 27 successfully established allergic asthma in mice (Lin et al., 2016a). Der f 28 (L7V065) is a heat shock protein with a

MW of 70 kDa and 659 aa length. A study on its allergenicity reported 68% IgE binding frequency and 70% positive SPT to recombinant Der f 28 (An et al., 2013).

A novel allergen from D. farina has been reported called Der f 29, resembling pan-allergen family of profilin proteins from other plant and animal sources. The full rDer f 29 gene (AIO08866.1), is 393 bp long, encoding 130 aa peptide chain. SPT results revealed, that, 21% of the total allergy patients, showed sensitization to rDer f 29 (Jiang et al., 2015). Previously, another protein of 164 aa length, where residue

4-162 was identified as Der f 29 (Mal f 6) belonging to cyclophilin-rotamases family

(EC 5.2.1.8). This protein, showed 85% allergenicity in HDM sensitized individuals and 70% positive SPT to rDer f 29 (Chew et al., 2003). A new variant (rDer f 29b) of the same length has recently reported, which gave approximately 24% SPT positive response in allergy patient (Lin et al., 2016b).

Der f 30 (GenBank-AGC56219.1), is a 16 kDa oxidoreductase. The reported length of this allergen is 171 aa (An et al., 2013), where amino acid 23-153 is a ferritin-like domain with a MW of 20.7 kDa (Epton et al., 2002). Allergy response was found in 26 of 41 HDM allergic subjects (An et al., 2013). A 15 kDa allergen

from D. farinae, was reported as Der f 31. With a length of 148 aa, its predicted structure suggests a possible role as actin depolymerizing factor (ADF) and belong to cofilin family of actin-binding proteins (Yang et al., 2014). Allergenicity of this allergen is not known.

Der f 32 is a secreted inorganic pyrophosphatase, that has a molecular weight of 35 kDa and is 296 aa long. The active site is predicted between residues 48-230

(Yang et al., 2014). There are conflicting reports on its allergenicity, where only 8 out of 52 HDM allergic subjects gave a positive SPT to rDer f 32, 100% (5 of 5) immunoblotting and ELISA results were obtained (Yang et al., 2014). Der f 33 was identified as novel allergen in D. farinae (Wang et al., 2016), it is 52 kDa α-tubulin having 461 aa residues. 40% HDM allergic patients’ sera gave a positive SPT with

Der f 33 where as 100% IgE binding as observed in immunoblotting assays (Liu et al., 2014b).

2.11 POLYMORPHISMS IN HDM ALLERGENS

Polymorphism describes the amino acid sequence diversity of a specific allergen, obtained from a variety of sources such as plants (Rafnar et al., 1991; Ong et al., 1993; Suphioglu and Singh, 1995; Ferreira et al., 1996) mammals and also house dust mites (Griffith et al., 1992). Diversity may occur in allergens from multigene families (most of the plant allergens), or as allelic variation in single gene proteins (Smith et al., 2001a; 2001b).

Earlier reports described, local variants of group 1 allergens from different geographical regions in Thailand, Korea, China, Australia, and the UK (Dreborg and

Einarsson, 1992; Kent et al., 1992; Chua et al., 1993; Nishiyama et al., 1993; Chua

et al., 1996; Olsson et al., 1998; Piboonpocanun et al., 2006; van Ree, 2007; Cui et al., 2008a; Jeong et al., 2012). Variation data reports come from predicted amino acid sequences, based on either amplification from genomic DNA (Kent et al., 1992;

Smith et al., 2001a) or, more frequently, cDNA libraries obtained through reverse transcriptase-PCR (RT-PCR) and subsequent cloning (Chua et al., 1993; Smith et al., 2001a; 2001b; Piboonpocanun et al., 2006; Jeong et al., 2012). Because reverse transcriptase is not proof reading (Bebenek and Kunkel, 1993), it is not surprising that a higher number of mutations were reported in the latter studies.

Amino acid sequence variations can influence IgE binding reactivity of allergens (Park et al., 2002). Single amino acid mutations can alter inflammatory cytokine production of T cells specific for Der p 1 (Thomas et al., 1997; Hales et al.,

2002). It is possible, that, these mutations influence the inherent allergenicity of particular variants and contribute to differential IgE binding frequency by increasing diversity of epitopes (Thomas, 2010).

Der f 1 and Der p 1 share 81% amino acid sequence identity (Chapman et al.,

1987; Lind et al., 1988; Heymann et al., 1989), due to which, cross reactivity exists among these two allergens (Chapman et al., 1987; Lind et al., 1988; Heymann et al.,

1989). Despite their cross reactivity and relatively high percent homology, monoclonal antibodies (mAbs) produced against Der p 1 and Der f 1 are species specific (Chapman et al., 1987; Heymann et al., 1989). This contradictory behavior may be attributed to the position of IgE binding epitopes in allergen molecules.

Epitope residues, that are present in high homology regions of the allergen, explain cross reactivity between Der f 1 and Der p 1 allergens, while the part of the IgE binding epitope found in variable regions may result in species specificity. An

example of the first case, is 4C1 anti Der f 1 mAb (Chapman et al., 1987), which binds to a cross reactive (conserved) epitope on both Der f 1 and Der p 1. This set of amino acids includes Glutamic acid (E)14, Aspartic acid (D)16, Arginine (R)18,

Serine (S)19, Arginine (R)21, Glycine (G)156, Arginine (R)157, Isoleucine (I)159,

Threonine (T)181, Glutamine (Q)182, Tyrosine (Y)186, Aspartic acid (D)199,

Tyrosine (Y)202 and Tyrosine (Y)204. The second part of this epitope, is a calcium

(Ca+) binding residue on the allergen molecule comprising four amino acids:

Aspartic acid (D)57, Leucine (L)58, Glutamic acid (E)60 and Glutamic acid (E)92

(Chruszcz et al., 2012). Analysis of these aa residues may help to predict cross reactivity in allergens from different mite species. As mutations in some IgE binding epitopes may affect both cross-reactivity and specificity of monoclonal antibodies, allergen diversity both among and within species should be taken into consideration for development of appropriate allergen extracts. This accentuates the need for accurate identification and characterization of representative variants in any given geographic locality. Regional amino acid sequence polymorphism and the extent of this polymorphism are poorly studied, and such data are not available for many countries, including the USA and Pakistan (Shafique et al., 2014).

A high degree of polymorphism has also been reported in group 2 allergens, where many Der f 2 variants were characterized (Trudinger et al., 1991; Thomas et al., 1992; Smith et al., 2001a). Yuuki T et al., (1997) identified four Der f 2 genomic sequences in D. farinae obtained from Japan. Amino acid sequences of proteins detected in mite extracts, corresponded to the cloned Der f 2 variants (Nishiyama et al., 1994). Similarly, polymorphism in Der p 2 was found as two distinct alleles that differed by four amino acids (Chua et al., 1996; Smith et al., 2001a; 2001b). IgE binding and T cell proliferation of recombinant protein isoforms of the four reported

variants was studied. It was reported, that, Der p 2.0101 which is the most frequent isoform in the environment, gave a lower IgE binding level, but the highest level of induction of T cell (Hales et al., 2002). Previously, Smith and colleagues had established a comparable skin prick test reactivity and IgE binding of the four Der p

2 variants (Smith et al., 2001a). Group 2 polymorphism has also been observed in

Lep d 2 (Schmidt et al., 1995; Eriksson et al., 2001) and Eur m (Smith et al., 2001a), where 2 isoforms in each protein have been reported. Three variants of group 3 allergens from D. pteronyssinus (Smith and Thomas, 1996a) and D. farinae

(Nishiyama et al., 1995; Smith and Thomas, 1996b) were isolated. Variation in group

5 allergens was studied in D. pteronyssinus, where only 1 aa change was identified out of 5 cDNA clones (Lin et al., 1994). Data on polymorphism in other allergen groups is limited. Asturias et al., (1998) reported 2 variants of Der p 10 cDNA sequences, with 2 aa residue difference (Thomas et al., 2002).

Chapter 3

MATERIALS AND METHODS

3.1 EPIDEMIOLOGICAL STATUS OF HDM ALLERGIES

In order to establish the prevalence of HDM allergy, a cross sectional study

was designed.

3.1.1 Data Collection

Data of allergy patients from three Centers, was obtained from 2010 to 2013.

The Centers included, Allergy and Asthma Centre Islamabad, Allergy Center-

National Institute of Health (AC-NIH), Islamabad and Shifa International Hospital,

Islamabad. Patient history was recorded in a specially designed questionnaire

(Appendix-I).

3.1.2 Skin Prick Test (SPT)

Allergen extracts for SPT were purchased from Hollister-Steir (Spokane, WA).

12 allergens including pollens and food (Glycerinated 1:20w/v), mold (Glycerinated

1:10w/v), D. farinae and D. pteronyssinus (10,000AU/ml) were used. Volar aspect

of forearm, 2-3 cm from the wrist of the patient, was cleaned with ethanol and

marked for individual allergens. The distance between skin marks was at least 2cm

to avoid false positives. Allergen solution was placed beside each mark and the skin

was pricked with a sterile lancet. Excess allergen solution was dabbed off. After 20-

30 minutes appearance of a flare (red inflammation/wheel) was noticed and its size

was measured. Wheel size ≥ 3mm was considered as positive (Konstantinou et al.,

2009; Heinzerling et al., 2013).

3.2 SPECIES DIVERSITY OF HDM

Morphological and molecular characterization was used to study diversity and prevalence of HDM species.

3.2.1 Study site

Pothwar is situated at Lat./Long: 32 º 10′ to 34 º 9′ N /71 º 10′ to 73 º 55′ E, having an elevation of 446 meter, it is a semi-arid rain fed region with humid subtropical (dry winter, hot summer) climate. Its weather is categorized into five seasons, which are: spring (March-April), summer (May-June), rainy monsoon

(July-September), autumn (late September-early November) and winter (Late

November-February) (Shaheen et al., 2008; Cheema et al., 2013). Humidity of the region reaches a maximum of 75%, in July-September during monsoon with an average temperature ranging between 30°C-40°C (www.myweather2.com). The region is divided into five districts (Figure 3.1), that were further grouped into smaller units for cluster sampling (Table 3.1).

3.2.2 Study Design

For identification of HDM fauna and estimation of species prevalence in randomly selected houses and in patients’ houses, a cross sectional study was designed. The study was proceeded into a longitudinal design, to appraise any seasonal variations in mite counts. Dust samples from selected houses were obtained once every month for a period of two years, starting from May 2011 and ending in

April 2013.

3.2.3 Calculation of Sample Size

Sampling region was divided into 31 clusters, based on the age of houses and life style diversity. All houses, included in sampling, were constructed with concrete,

Figure 3.1: Map of sampling sites (Pothwar).

Table 3.1: Sampling sites.

Rawalpindi (7) Islamabad (10) Attock (6) Chakwal (4) Jhelum (4) Old City Rawalpindi Rawal Town Attock Chakwal Jhelum Satellite Town Margala Town Fateh Jang Choa Saidan Shah Dina Housing societies E-7 Hasanabdal Kalar Kahar PD Khan Chaklala F-6 & F-7 Hazro Talagang Sohawa Westridge F-8 Jand Clusters-31 Wah & Taxila F-10 & F-11 Pindigheb Gujar khan I-9 & I-10 G-6, G-7 & G-8 G-9, G-10 & G-11 I8 & H-8

having more or less similar indoor environment. Size of samples (number of households) for each cluster, was calculated with the help of an online sampling tool

(Figure 3.2 & Table 3.2) with the help of the following formula:

Where

N = Final sample size for each cluster (number of households) n* = n + 5% precision factor (Random sample size taking into account percent response)

NRR = Non-Response Rate (0.05)

The size of random sample (n) used in the above method was determined taking into account the estimated population of the study site (Gorstein et al., 2007).

The formula used was:

Where: n = random sample size t = confidence level at 95% (standard value of 1.96) p = Estimate of the expected proportion d = Desired level of absolute precision (d)

DEFF = Estimated design effect (DEFF)

Figure 3.2: Online sampling tool used to calculate the number of households per cluster in the study area (micronutrient, 2011

74 75

Table 3.2: Overall sampling strategy.

Sample size from Each District No. of Urban Districts of Pothwar No. of town/clusters Cross Sectional Study Longitudinal Study Households (14 Samples/Cluster) (Random Selection) Rawalpindi 7 409167 98 Islamabad 10 66279 140 Attock 6 56000 84 50/Season Chakwal 4 26667 56 Jhelum 4 53000 56 Total 31 611112 434

3.2.4 Sampling Protocol

Dust samples were obtained once a month, from mattresses of beds and couches in the selected houses. A portable vacuum cleaner with a modified metal attachment, was used for collecting dust (Figure 3.3). According to the protocol, 1m2 surface area at each sampling site was vacuumed for 1 min (Dautartiene, 2001). Dust from the filter was transferred into a 2x3 inches zip-lock plastic bag. Collected dust samples were brought to the laboratory and kept at 4°C to prevent mite proliferation.

3.2.5 Isolation of HDM in the dust sample

Sodium chloride suspension technique (Arlian et al., 1983; Terra et al., 2004;

Colloff, 2009; Henszel et al., 2010) was optimized, for HDM isolation from household dust. 50 mg dust was passed through a 1.5 mm wire mesh to remove all fiber, wooden splinters and large particles. The dust was passed through another sieve (0.3 mm), the fraction obtained on the sieve was used for mite extraction, while the finer sieved dust was stored at -20°C for allergen extraction. The whole fraction on sieve, was suspended in saturated sodium chloride solution (1% dust: brine ratio), stirred with a magnetic stirrer for 1 hour and left overnight for flotation of mites.

On the next day, a few drops of dilute detergent solution (1 ml detergent in

15 ml water), were added to the beaker the contents were stirred again and left for suspension for an hour. The supernatant was filtered, through Whatman (Grade 1 cellulose) filter paper placed in glass Buchner funnels. Filter paper was placed on a petri dish under a dissecting stereo-microscope, the mites on the filter paper were counted and collected with a fine mounted needle into separate Eppendorf tubes and stored at –20°C in 70% ethanol, later transferred to 96 percent ethanol. The number of mites found in a single sample (5 mg), was extrapolated to mites per gram of dust.

Figure 3.3: Alteration/modification in the vacuum cleaner pipe for the collection of dust samples.

the amount of dust collected in a single sample, varied from 10–500 mg.

3.2.6 Morphological Characterization

A single mite was kept on a watch glass, with a drop of Nesbitt's clearing agent for 24 hours. Then the specimen was transferred to a clean microscope slide and mounted in Hoyer’s medium. A round coverslip was placed on the slide.

Specimens were stored in oven, at 40-45°C, for 2-7 days and after drying, a ring of a waterproofing paint for sealing the coverslip was applied to the surface (Krantz,

1978; Faraji and Bakker, 2008). Mite species were identified at x40, using taxonomic identification key (Fain et al., 1990; Colloff, 2009).

3.2.7 Molecular Characterization

Polymerase chain reaction-restriction fragment length polymorphism (PCR–

RFLP) of ITS2, was used to identify and distinguish between various mite species

(Wong et al., 2011; Beroiz et al., 2014). Digestion was done with Hinf 1 and Taq 1 restriction enzymes.

3.2.7.1 DNA extraction from single mites

DNA extraction was carried out with QIAamp DNA Micro Kit (Qiagen,

GmbH). A mite was picked with a mounting needle and placed with a drop of lysis buffer (buffer ATL; Qiagen, GmbH) in a cavity glass slide. The body of mite was teased in buffer, to break the chitinous exoskeleton. Then broken/ punctured mite was picked and placed in 1.5 ml microcentrifuge tube and 180 µl buffer ATL was added. The remaining procedure was carried out as described by the manufacturers.

The tube was allowed to equilibrate to room temperature (15–25°C), hen 20 µl of proteinase K was added and mixed by pulse-vortexing for 15 sec. The tube was then

incubated at 56°C overnight, until the sample was completely lysed. Next day 200

µl buffer AL was added and mixed by pulse-vortexing for 15 sec. Precipitation of

DNA was done by adding 200 µl of ethanol to the lysate (96–100%) and pulse vortexing for 15 sec. After 5 min incubation, the tube was centrifuged briefly and the lysate was transferred to MinElute column (in a 2 ml collection tube) without wetting the rim. The tube was centrifuged at 6000 x g (8000 rpm), for 1 min. The column was placed on a clean 2 ml collection tube, and the flow-through was discarded.

Washing was done by adding 500 µl buffer AW1 and centrifuging at 6000 x g (8000 rpm) for 1 min. Then, the column was placed on another clean collection tube and

500 µl buffer AW2 was added and centrifuged at 6000 x g (8000 rpm) for 1 min.

The column was placed in a clean 2 ml collection tube, while the flow-through in the previous tube was discarded. The membrane was dried, by centrifuging at full speed

(20,000x g; 14,000 rpm), ensuring that all ethanol in the membrane has been removed. The column was placed on a clean autoclaved 1.5ml microcentrifuge tube and elution was done with 20 µl double deionized water, that was applied to the center of the membrane. The lid was closed and contents were incubated at room temperature (15–25°C) for 1 min. Then, the column was centrifuged at full speed

(20,000 x g; 14,000 rpm), for 1 min to collect extracted DNA, in microcentrifuge tube. All extracted DNA samples were labelled and stored in freezer at -20°C till further process.

3.2.7.2 PCR for RFLP

ITS2 Primers for mites were designed as described (Noge et al., 2005). The

5’ to 3’ sequence of forward and reverse primers is give below:

ITS2 forward primer: CGACTTTCGAACGCATATTGC ITS2 reverse primer: GCTTAAATTCAGGGGGTAATCTCG

The final volume of reaction was 50µl. Master mix consisted of 25 µl of Taq master mix (Qiagen, Germany), 0.25 µl of ITS2 forward primer (100 µM), 0.25 µl of ITS2 reverse primer (100 µM) and 23.5 µl of ultra-pure water. The DNA template was substituted with sterile ultra-pure water for the negative control. Thermocycler conditions for PCR were 94°C for 2 min, followed by 35 cycles (denaturation at

94°C for 30 sec, annealing at 56°C for 30 sec and extension at 72°C for 50 sec), finally 72°C for 3 min (Wong et al., 2011). 8 µl each of PCR products were digested individually with restriction enzymes Hin f I (10 U) and Taq I (20 U). The total volumes of mixtures were made up to 20 µl each. Hinf I was incubated overnight at

37°C whereas Taq I incubation was done at 65°C. Expected sizes of PCR products and restriction fragments are given in table 3.3. All products obtained were of the expected size (Wong et al., 2011).

3.2.7.3 Gel electrophoresis

The restriction digests were resolved by electrophoresis, using 3% agarose gel containing ethidium bromide (10 µl/100 ml dissolved gel). TBE (Tris-Borate-

EDTA) was used as buffer. The gel was run at 200V for 30 min. Bands were visualized in a UV transilluminator.

3.3 MOLECULAR CHARACTERIZATION OF HDM ALLERGENS

3.3.1 Quantification of Group 1 Allergens in the Environment

100mg sieved dust was agitated in 2 ml of 0.125 M ammonium bicarbonate

(pH 8.0), kept overnight at 4°C. On the next day, the supernatant was filtered through

0.45 µm acetate filter polypropylene syringe and stored at -20°C (Sidenius et al.,

2002; Spertini et al., 2010; Prester et al., 2007).

Table 3.3: Expected product size and fragment length of mite species.

Species Name Expected product size Restriction fragments size

Hinf I Taq I D. pteronyssinus 320 320 280

D. farinae 330 180 and 110 150 and 140

3.3.2 ELISA for Der p 1 and Der f 1 Levels

Der p 1 and Der f 1 allergen levels in allergen extracts were quantified with the help of ELISA kits (CITEQ). The working range of the kits was 1-15 ng/ml and the limit of detection (LOD) was 0.5 ng/ml. The standard curve was constructed using OD (450 nm) values of standard dilutions (R2 value for the curve was greater than 0.9 and OD of blank was less than 0.75, as described by the manufacturer).

3.3.3 Polymorphism in Group 1 Allergens

To study polymorphism in group 1 allergens genes and predicted amino acid sequences, full length genes of Der p 1 and Der f 1 allergens from mite specimens were amplified for the first time using direct sequencing technique, while previously only cDNA sequences were available in the database. Polymorphism in Der p 1 and

Der f 1 was studied and compared with sequences from USA specimens. Intra specific and inter specific polymorphism in group 1 allergen genes was studied.

Complete Der p 1 and Der f 1 genes with introns and exons were reported to

GenBank. After computer assisted translation and prediction of amino acid residues, analysis of predicted protein and comparison with other homologous proteins

(cysteine proteases) retrieved from National Centre for Biotechnology Information

(NCBI) was also carried out.

3.3.4 HDM Samples

Sampling, isolation and DNA extraction techniques have already been described in the previous section. Specimens of D. farinae from the USA were obtained from a laboratory culture maintained at the University of Michigan,

Museum of Zoology (started from specimens collected locally 42.27°N 83.73°W in

2005). Specimens of D. pteronyssinus originated from cultures in Greer

Laboratories, North Carolina, USA. Exact collection localities are available as

GenBank metadata deposited along with our sequences.

3.3.5 Amplification by Nested PCR

Der p 1 and Der f 1 genes were amplified by nested PCR. For each species, two sets of species-specific primers were designed in Primer3 to amplify almost the entire coding region of the gene (Rozen and Skaletsky, 1998). For uniform sequencing, T3 and SP6 tails were added to the forward inner and reverse inner primers respectively (Table 3.4). PCR was performed in 20 µl volume with

Platinum® Taq DNA polymerase (Invitrogen, USA). The master mix for initial PCR contained 2.0 µl of PCR buffer, 1.4 µl MgSO4 (50 mM) and dNTPs (10 mM each),

0.8 µl of primers (10 µM of each forward and reverse), 0.12 µl of Platinum Taq polymerase (1.5 U) and 0.6-1 µl of DNA template (depending on DNA concentration in the sample), the total volume was made up to 20 µl with distilled water. The thermocycler protocol was as follows: 94°C, 2 min; [94°C, 30 sec; 48°C, 35 sec;

72°C, 2 min] × 35 cycles; 72°C for 7 min. PCR products were kept at 4°C until the second PCR was performed. For the second PCR (inner primers) the master mix was modified with a reduced quantity of Taq polymerase 0.08 µl (1.0 U) and 0.6 µl of

PCR products from the first PCR. The thermocycler protocol was set as above, except for the annealing step (50°C for 38 sec), the extension step (1.50 min), and the total number of cycles-38. PCR products were run on 1.5% agarose gel, bands were excised under UV light, and DNA was purified with a QIAquick gel extraction kit (Qiagen) (Shafique et al., 2014).

3.3.6. Sequencing and Analysis

Sequencing was done with an Applied Biosystems 3730 XL DNA sequencer

Table 3.4: Primers used in nested PCR.

Primer Name Primer Sequence (5’ to 3’) D. farinae_Der1_P_121F AAAATTCATCAAAAATGAAATTCG D. farinae_Der1_P_1436R CTCGCAAGAGTAGTTGTTTTTATTTTG D.pteronyssinus_Der1_P_108F CTCTCTAAAATCTAAAATCCATCC D.pteronyssinus_Der1_P_1509R AATTTAATTTTTGTGAATG D. farinae_Der1_P.Ch_133F_T3 ATTAACCCTCACTAAAGGGAATGAAATTCGTTTTGGCCATTG D. farinae_Der1_P.Ch_1430R_SP6 ATTTAGGTGACACTATAGCGCAAGAGTAGTTGTTTTTATTTTGA D.pteronyssinus_Der1_P_Ch.115F_T3 ATTAACCCTCACTAAAGGGAAAAATCTAAAATCCATCCAACATGA D.pteronyssinus_Der1_P_Ch.1458R_SP6 ATTTAGGTGACACTATAGTTTTAAATAAATTAGTGACAATCA P – outer primer; P.Ch. – inner primer; F – forward; R – reverse; T3 – has T3 tail (underlined); SP6 – has SP6 tail (underlined)

at the University of Michigan sequencing core. Sequences were analyzed in

Sequencher ver. 5.0. Due to primer overlap partial sequences (22 nt missing for Der f 1 and 4 nt missing for Der p 1) at the 5' end were obtained. The sequences were submitted to GenBank having accession numbers KJ542064 through KJ542097.

However, for analysis it was assumed that the sequences are complete and using

GenBank data (AB034946 for Der f 1 and U11695.1 for Der p 1) for the short missing 5' ends. Thus, position 1 of the alignment was the start codon of allergen gene. Intron identification and translation into polypeptide was done in Mesquite ver.

2.75. After computer-assisted translation, preproenzyme sequences (full length peptides) were obtained. Three regions on the peptides were identified: signal or leader peptide (pre), inactive enzyme (proenzyme) and mature enzyme. In amino acid sequences, the starting position was set to the 1st amino acid of the mature peptide, whereas the signal peptides and proenzyme regions were given negative coordinates (Dilworth et al., 1991). Homologous group 1 allergen DNA and protein sequences were retrieved from NCBI, Expressed Sequence Tags (EST), and protein databases using blastn and blastp. Resulting sequences, Euroglyphus maynei

(AAC82351), P. ovis (CAK32515), S. scabiei (AAS93667), A. siro (ABU50820), B. tropicalis (AAQ24541) and T. putrescentiae (ABM53753), were aligned with D. farinae (KJ542065) and D. pteronyssinus (KJ542087). Alignment was done in

Clustal Omega. Signal peptide prediction of all selected cysteine proteases was done in SignalP ver4.1 (Petersen et al., 2011).

Chapter 4

RESULTS AND DISCUSSION

4.1 EPIDEMIOLOGICAL STATUS OF HDM ALLERGIES

Out of a total of 2087 allergy patients 1706 (81%) were SPT positive for

HDM allergens, while 1094 (53%) patients were SPT positive to various kinds of pollens, and only 812 (38%) showed reactivity to food allergens (Table 4.1 & Figure

4.1). Year wise percent sensitization to HDM, pollen and food allergens did not vary significantly. All patients were symptomatic and had been diagnosed by doctor with atopic allergies like asthma, allergic rhinitis, conjunctivitis and eczema. Eighty seven percent (87%) patients were poly-sensitized (showed reactivity to more than one allergen). Two-way ANOVA revealed that percentage of patients who were SPT positive to HDM allergens was significantly higher than percent sensitization to both pollen and food allergens (p=0.002357). Pairwise comparison of the three catagories also showed that percent HDM senstization in allergy patients was highly significant, compared to percent pollen senstization (p<0.001), and percent food senstization

(p<0.0001) (Table 4.2).

In this work, a gender bias in allergen sensitization data was observed. The percentage of male patients showing positive skin reactions to all allergens and to

HDM allergens was 56.11% and 56.83% respectively (Mean=56.6%), whereas, in female patients 43.89% were SPT positive to all allergens and 42.10% to HDM allergens with 43% mean value (Table 4.3 & Figure 4.2).

Previous reports from different parts of the world, show that 45% to 85% of atopic allergy and asthmatic patients were SPT positive to HDM allergens (Colloff,

Table 4.1: Year wise percent sensitization to HDM allergens, pollens and food allergens.

Percent sensitization Year (n) HDM(n) Pollen(n) Food(n) 2010(260) 74(192) 61(158) 28(73) 2011(695) 83(576) 60(417) 30(208) 2012(701) 86(602) 44(308) 47(329) 2013(431) 78(336) 49(211) 47(202) Mean%(n) 81(1706) 53(1094) 38(812) n=total number of patients, numbers in parenthesis show actual number of SPT positive

Figure 4.1: Year wise percent sensitization to HDM allergens, pollens and food allergens.

Table 4.2: Pairwise comparison of senstivity to HDM, Pollen and food allergens.

Comparison Mean Diff. Summary 95% CI of diff % HDM senstization vs 26.75 <0.001 10.37 to 43.13 % Pollen senstization % HDM senstization vs 42.25 <0.0001 25.87 to 58.63 % Food senstization % Pollen senstization vs 15.5 ns -0.8849 to 31.88 % Food senstization Data analyzed with Tukey’s Multiple Comparison Test. ns: not significant

Table 4.3: Gender bias in allergen sensitization.

Total Number n (%age) Positive SPT p value (n) Females Males All allergens 2087 916 (43.89) 1171(56.11) <0.01*

HDM allergens 1706 741(42.10) 965 (56.83) <0.01*

*p value calculated F-critical one-tailed

Figure 4.2: Gender bias in allergen sensitization

1992; De Vries et al., 2005; Assarehzadegan et al., 2013).

A previous study from Rawalpindi, reported that 72.6% allergic rhinitis patients showed sensitivity to house dust, while 64% of allergic rhinitis patients were sensitive to purified HDM allergen extracts (Ullah et al., 2005). Out of a total of 702 individuals from Islamabad, 50% patients were SPT positive to house dust extract

(Katelaris et al., 2007). In Islamabad 87.5% individuals visiting allergy clinic were

SPT positive against aeroallergens, wherein the highest number (44.6%) of patients showed HDM sensitization (Abbas et al., 2012). Prevalence of HDM sensitized allergic rhinitis patients in a study from Lahore was 50.9% (Jalil and Bajwa, 2014).

Conforming to outcomes in present study, Jalil and Bajwa (2014) also reported a bias in male to female patients’ ratio (2.6:1) wherein the male to female patient ratio in

HDM sensitized group was even higher (3.4:1).

A gender bias to male allergy patients has been reported in many other studies, from Chile (Calvo et al., 2005); Philippines (Yap et al., 2014) and Iran

(Assarehzadegan et al., 2013). A possible role of testosterone and the other androgens in allergy has been postulated, but it remains less defined and actual data from human studies are lacking (Chen et al., 2008). According to some researchers, the male disadvantage for respiratory allergies disappears at the age of puberty

(Skobeloff et al., 1992; Venn et al., 1998) and females older than 20 years were at a higher relative risk of developing asthma (Redline and Gold, 1994; de Marco et al.,

2000).

Results in this research, show that 87% patients showed sensitivity to multiple allergens. Similar data has been reported earlier in an Iranian study where,

a significantly high sensitivity (91%) to multiple allergens was observed, compared to only 8.9% patients showing sensitivity to one allergen (Nabavizadeh et al., 2012).

In another work, 84% poly-sensitized patients were reported using SPT

(Assarehzadegan et al., 2013).

4.2 IDENTIFICATION AND PREVALENCE OF HDM

4.2.1 Species Diversity

A total of 9211 mites were examined under the dissection microscope. They were morphologically identified with the help of available identification keys (Fain et al., 1990) (Figure 4.3). Twenty (20) whole adult mites were selected for preparation of permanent slides (Figure 4.4). Remaining mites were individually placed, in labelled microcentrifuge tubes. After single mite DNA extraction, 75 single mites’ DNA samples were randomly selected for PCR of ITS-2 gene.

Amplification percentage of gene was 90% (68 out of 75). All products appeared on gel at expected product size, either for, D. farinae or D. pteronyssinus (Figure 4.5).

Digests of both Hinf 1 and Taq 1, confirmed the morphologically identified D. farinae and D. pteronyssinus (Figure 4.6). No unexpected bands of PCR products or restriction fragments were observed, concluding that, D. farinae or D. pteronyssinus are the only two pyroglyphid species inhabiting houses in the Pothwar region.

Out of 9211 mites examined, 8246 were allergy causing mites from family

Pyroglyphidae. D. farinae was the most prevalent species, with 60.89% abundance, they were followed by D. pteronyssinus showing 29% infestation. Besides family

Pyroglyphidae, mites of other families, including Cheyletidae and Orbitidae were also sighted (Table 4.4). Their frequency in the total mite counts was only 11%.

Tukey’s multiple comparison test revealed D. farinae counts to be significantly higher (p<0.0001) than all other mite species (Table 4.5).

Figure 4.3: Comparative anatomy of pyroglyphid mites. Female: (A) D. farinae, (B)

D. pteronyssinus and male: (C) D. farinae, (D) D. pteronyssinus

Figure 4.4: Morphologically identified HDM species.

A) D. farinae female (ventral), a: epimera (aposoma) I, b: epigynium, c: vulva, d: bursa copulatrix. B) D. farinae male (ventral), a: epimera (aposoma) I, b: hysteronotal shield, c: penis, d: adanal suckers C) D. pteronyssinus female (ventral) a: Epimera (aposoma) I, b: epigynium, c: vulva, d: bursa copulatrix D) D. pteronyssinus male (ventral) a: Epimera (aposoma) I, b: hysteronotal shield, c: penis, d: adanal suckers

Figure 4.5: ITS2 gene amplification; Lane 1: DNA marker, Lane 2-5: D. farinae

(330bp), Lane 6-8: D. pteronyssinus (320bp).

Figure 4.6: Restriction fragments of ITS 2 rDNA from D. farinae and D. pteronyssinus

(A) Hinf1 digests; Lane 1: DNA marker, Lane 2, 3, 4, 5, 7 and 8: D. farinae 180 and 110, Lane 6 and 9: D. pteronyssinus (320bp)

(B) Taq1 digests; Lane M: DNA marker, Lane 1: negative control, Lane 2, 3, 5, 7, 8, 10, 12 and 14: D. farinae fragments 150bp and 140bp, Lane 4, 6, 9, 11 and 13: D. pteronyssinus 280bp

Table 4.4: Mite counts based on morphological examination.

Mite species Pothwar Districts Pyroglyphids Other Acari Total Acari D. farina D. pteronyssinus Rawalpindi 1304 601 253 2156 Islamabad 2476 1198 296 3967 Attock 808 354 188 1349 Chakwal 339 112 117 569 Jhelum 678 376 116 1170 Total specimens 9211

Table 4.5: Pairwise comparison of mean mite counts.

Pairs compared Random Houses (n=419) Mean Diff. Significance 95% CI of diff

D. farinae vs 120.3 <0.0001 102.5 to 138.2 D. pteronyssinus

D. farinae vs 201.5 <0.0001 183.7 to 219.4 other acari

D. pteronyssinus vs 81.21 <0.0001 63.36 to 99.07 other acari

Tukey’s Multiple Comparisons Test; n= number of

100

4.2.2 Comparison of Mite Counts between Random and Patient Houses

Dust samples from four hundred and nineteen (419) randomly selected houses were examined, along with fifty-nine (59) samples obtained from HDM allergy patients visiting clinics. D. farinae and D. pteronyssinus were isolated from

87.35% and 87.11% dust samples respectively. D. farinae counts in random samples ranged between 0–666/g of dust, with 235.36±7.93 (mean ± SEM) compared to 75-

441 mites/g of dust (274.74±10.78) taken from patients’ homes. Similarly, mean D. pteronyssinus counts from random houses were 115.04±4.57, ranging between 0-435 mites/g dust and 124.58±5.76 from patients’ houses ranging from 38-265 mites/g dust. Mean total acari counts were greater from patients’ homes (423.05±12.63) compared to random houses (384.24±11.33). Although, Wilcoxon matched pair-test results showed no significant difference (p=0.27) between mite species counts in random and patients’ houses, however it was discerned, that, 100 percent of the dust samples from patients’ dwellings were infested with pyroglyphid mites (Table 4.6,

Figure.4.7).

D. pteronyssinus and D. farinae are equally abundant and a great diversity of acrofauna has been reported (Solarz, 1998; Boquete et al., 2006). There are reports of D. pteronyssinus dominating house dust from many cities in India (Maurya et al.,

1983; Modak et al., 1992; Saha et al., 1994), along with other HDM species like D. farinae, E. maynei and B. tropicalis (Dar and Gupta, 1979). In Iran, humid areas have abundant D. pteronyssinus (Sepasgosarian and Mumcuoglu, 1979). Cities situated inland, with a considerably drier climate, are extensively infested with D. farinae

(Fereidouni et al., 2013). In China, a predominance of D. pteronyssinus has been reported (Wang and Wen, 1997).

101

Table 4.6: Mean mite counts from random vs. patients’ houses

Random Houses (n=419) Patient Houses (n=59) Mite Species Samples Positive Samples Positive Con./gm of dust Con./gm of dust for mites for mites Mean ± SEM (range) Mean ± SEM (range) Number (%) Number (%) D. farina 366 (87.35) 235.36±7.93(0-666) 59(100) 274.74±10.78(75-441)

D. pteronyssinus 365(87.11) 115.04±4.57(0-435) 59(100) 124. 58±5.76(38-265)

Other acari 381(90.93) 33.83±1.38(0-99) 56(95) 37.3±3.5(0-99)

Total acari 366(87.35) 384.24±11.33(0-1007) 59(100) 436±11(190-602) Wilcoxon matched pair test p=0.27 (not significant)

102

Figure 4.7: Mean mite counts from random vs. patients’ houses

103

4.2.3 Seasonal Variation

In Pothwar region, mite counts were found to fluctuate around the year. Mean counts of both D. farinae and D. pteronyssinus, were significantly higher in monsoon

(July-September) i.e. 273.1±37.69 and 127.5±12.41 respectively. Their counts remained fairly low, means never exceeding 18.71±5.19 at any other time of the year

(Table 4.7).

Comparison of two-year D. farinae and D. pteronyssinus counts with average environmental temperatures and % RH showed, that, highest mean mite counts coincided with average environmental temperature between 37-40°C and %RH 70-

75. This was the rainy monsoon season in the Pothwar region (Figure 4.8 & 4.9).

Previously a clear association of increase in relative indoor humidity with increase in mite counts has been established (Korsgaard, 1998; Sinclair et al., 2010).

4.3 MOLECULAR CHARACTERIZATION OF HDM ALLERGENS

4.3.1 Group 1 Allergen Levels

Hundred (100) dust samples were randomly selected for allergen extraction.

Out of these 100 samples, 67 allergen extracts were tested with ELISA to determine

Der f 1 and Der p 1 levels. Allergen levels in 59 (81.2%) dust samples tested for Der f 1 were above 0.5 ng/ml (LOD). 5 out of 59 (8.5%) dust samples were below sensitization threshold of 2 µg/g dust, while 34 (57.6%) had more than 10 µg/g dust allergen load, described as a risk factor for developing asthma (Table 4.8).

Conversely, Der p 1 assay results demonstrated 50 (69.4%) samples above

LOD, 4 out of 50 (8%) samples were with Der p 1 levels below the sensitization threshold, and 10 out of 50 (20%) had Der p 1 allergen levels above 10 µg/g dust.

104

Table 4.7: Seasonal variation in pyroglyphid mites.

D. farinae counts D. pteronyssinus counts Season Mean ± SEM p value Mean ± SEM p value

Summer 18.71±5.19 ns 1.44±1.25 ns

Monsoon 273.1±37.69 < 0.0001 127.5±12.41 < 0.0001

Autumn 9.194±1.77 ns 0.295±0.19 ns

Winter 18.15±2.44 ns 0.185±0.08 ns

Spring 9.755±0.21 ns 0.15±0.08 ns ns: not significant

105

Table 4.8: Der f 1 and Der p 1 allergen levels in dust from selected samples.

Der f 1 Der p 1 p Samples above LOD n (%) 59(81.2) 50(69.4) allergen level <2µg/g n (%) 5(8.5) 4(8) 2-10µg/g n (%) 20(33.9) 36(72) >10µg/g n (%) 34(57.6) 10(20) Mean ± SEM 12.03±0.86 6.06±0.73 <0.0001* Standard Deviation 5.94 4.99 Sample Variance 35.32 24.94 0.242 ns Range 0.21-29.79 0-16.59 LOD: 0.5ng/ml, lower limit of detection of ELISA, (*): highly significant, ns: not significant.

106

Figure 4.8: Fluctuations in D. farinae count around the year.

107

Figure 4.9: Fluctuations in D. pteronyssinus count around the year.

108

Mean Der f 1 (12.03±0.86 µg/g) burden was significantly higher (p <0.0001) than mean Der p 1 (6.06±0.73 µg/g) levels. Linear regression was applied to determine a correlation between D. farinae and D. pteronyssinus counts and their allergen levels. A moderate relationship (R2=0.5) was observed between D. farinae and Der f 1 allergen, while the value of R2 calculated for D. pteronyssinus and their allergen Der p 1 was 0.6 (Figure 4.10).

All samples (100%) collected during the rainy monsoon and autumn carried

Der f 1 and Der p 1 allergen load above the LOD (0.5 ng/ml). Der f 1 allergen levels displayed seasonal fluctuations. Mean Der f 1 levels in dust samples obtained during monsoon and autumn seasons were 15.96 µg/g and 7.59 µg/g respectively (Table

4.9). These levels were highly significant (p<0.0001), compared to the remaining seasons of the year (Table 4.9, Figure 4.11). Similarly, mean Der p 1 levels during monsoon and autumn were significantly high with 10.88±0.77 µg/g and 4.31±0.55

µg/g respectively, compared to the other seasons of the year (Table 4.9, Figure 4.11).

In regions, like Quito; Ecuador where the level of humidity remained high, throughout the year, Der p 1 levels were significantly high (Valdivieso et al., 2010).

Whereas, in Zagreb; Croatia with a less humid environment, Der f 1 allergen levels ranged between 0.1-31.2 μg/g in house dust and Der p 1 allergen ranged between

0.1-12.5 μg/g (Prester et al., 2007). Seasonal variations in HDM allergens have been reported in many studies (de Andrade et al., 1995; Wahn et al., 1997; Hirsch et al.,

1998; Macan et al., 2003).

4.3.2 Group 1 Allergen Polymorphism

Der f 1 and Der p 1 genes were amplified using nested PCR (Figure 4.12 &

4.13). Sequences were analyzed to study the polymorphism in both genes.

109

Figure 4.10: Correlation between mite counts and allergen levels: (A) Der f 1 (B)

Der p 1.

110

Table 4.9: Seasonal variation in Der p 1 and Der f 1 levels in dust samples.

Der f 1 Der p 1 Monsoon Autumn Winter Spring Summer Monsoon Autumn Winter Spring Summer

(Jul-Sept) (Sept-Nov) (Nov-Feb) (Mar-Apr) (May-Jun) (Jul-Sept) (Sept-Nov) (Nov-Feb) (Mar-Apr) (May-Jun)

n 15 15 12 10 15 15 15 12 10 15

N (%) > LOD 15(100) 15(100) 10(83) 9(90) 10(67) 15(100) 15(100) 7(58) 7(70) 6(40)

Range 9.03-30 0.26-12.66 0.1-10.06 0-10.14 0-8.86 7.88-16.6 0.49-7.57 0-6.86 0-4.2 0-3.2

Mean ± SEM 15.96±1.49 7.59±1.08 3.63±1.18 3.19±1.22 2.95±0.81 10.88±0.77 4.31±0.55 1.84±0.84 2.02±0.60 0.87±0.34

p value <0.0001 <0.0001 ns ns ns <0.0001 <0.001 ns ns ns n=No. of samples, N= number of samples above LOD, LOD: 0.5ng/ml, lower limit of detection; all means expressed as µg/g of dust, SEM: standard error mean; CI: confidence interval of difference; p was determined at 95% confidence level; p significant when value < 0.05, ns: not significant.

111

Figure 4.11: Seasonal variations in Der p 1 and Der f 1 levels.

112

Figure 4.12: Der f 1 gene PCR products. A): no amplification in Lane 3, 12, 13, 17,

B): no amplification in Lane 1, 6, 11, 12, 16, 21 and week bands in 5, 8 and 17.

113

Figure 4.13: Der p 1 gene PCR products.

114

4.3.2.1 Der f 1 gene polymorphism

Twenty-two (22) Der f 1 gene sequences, including six from the USA, were analyzed. The length of the gene (from start to stop codon), including six exons and five introns, was 1278 base pairs (bp). Of the five introns we detected, two (intron1 and 2, at mRNA nucleotide positions “nt. pos” 87 and 291, respectively) were not reported previously (Table 4.10 & Figure 4.14). Seven mutations were observed in non-translated regions (introns) of the gene (Table 4.10).

All D. farinae sequences show 99-100% homology, with 2 distinct haplotypes

(H1, H2, Appendix-2: S1). Haplotype 1 (e.g. RS17 and RS20) was the more frequent

(63.5%, 14/22), followed by haplotype 2 (18%, 4/22, e.g., RS27 and RS30) and heterozygous variants (18%, 4/22, e. g., RS26 and RS40). Der f 1 sequences of all

USA specimens (e.g., RS03), were identical to the H1 sequence from the Pakistan

HDM population (Appendix-2: S1). Mutations were observed at 14 different positions along the whole length of the sequenced gene, where seven mutations were in the introns (non-translated region). Mutations (substitutions) in the exons were at nt pos 600, 794, 978, 9926, 1014, 1207 and 1211. Table 4.10 shows the corresponding amino acid positions and translated amino acid at each substitution site. Of these, all but one mutation were silent. The single non-silent mutation was observed in variant RS31 (KJ542072), where amino acid tryptophan (W) was substituted by arginine (R) at nt(aa) pos 1211(197) (Table 4.10). This novel mutation occurred in the active site of the mature enzyme (Figure 4.15). Secondary and tertiary protein structure prediction indicated slight difference between these two variants, whereas, no predicted function difference was observed (Figure 4.16).

4.3.2.2 Der p1 gene polymorphism

115

Table 4.10: Exons, introns, and sequence polymorphism in the group 1 allergen-encoding gene in two house dust mite species.

(Continued)

116

Table 4.10. Continued.

PK: Pakistan; USA: United States of America; (1): not reported in previous studies;(2): Novel silent (synonymous) mutation;(3): Novel non silent (non- synonymous) mutation. GenBank accession numbers for the sequences resulted from our study are given in parentheses.

Figure 4.14: Gene map of group 1 allergens. A: Der f 1 and B: Der p 1 allergens amplified by nested PCR. UTR: un-translated regions;

(numbers): nucleotide position for introns. The blank region with dashed outlines at exon 1 indicates partial 5’end of genes.

117

118

Figure 4.15: Alignment of group 1 allergens of selected mite species. Active site

(yellow), amino acid residues making 4C1 binding epitope (pink) and calcium binding epitope (green); "*": identical, ":": conserved and ".": semi-conserved sites.

119

Figure 4.16: I-TASSER result showing tertiary structure predictions for (A) RS33 and (B) RS31 (Zhang, 2008; Roy et al., 2010; Roy et al., 2012).

120

Twelve (12) Der p 1 gene sequences were obtained, including four from the

USA. The length of the gene (from start to stop codon), including five exons and four introns was 1248-1250 bp, owing to a variable poly-T region in intron1

(Appendix-2: S2). The key difference between Der p 1 and Der f 1 genes is the absence of intron 3 (length: 58 nt) in the Der p 1 gene (Figure 4.14). Although intron

3 was known for Der f 1, no such data existed for Der p 1. Four mutations were observed in non-translated regions (introns) (Table 4.10).

D. pteronyssinus samples obtained from USA and Pakistan displayed polymorphism at five nucleotide positions in the coding regions (exons). Deduced amino acid sequences showed four non-synonymous substitutions at positions [nt

(aa)]: 589 (50), 935(124), 971(136), 1268(215) and a synonymous mutation at

1011(149) (Table 4.10).

In contrast to D. farinae, all the sequences of Der p 1 were unique, differing by 1-2 amino acid residues, but no distinct haplotypes were observed (Appendix-2:

S2). Comparison of these results and data from previous studies showed that mutations in Der p 1 aa pos (Y->H)50, (V->A)124, (T->S)136 and (Q->E/K/G)215 were most frequently reported (Table 4.11). Nearly 20 other mutations that were sporadically observed in Der p 1 previously (Dreborg and Einarsson, 1992; Kent et al., 1992b; Chua et al., 1993; Nishiyama et al., 1993; Chua et al., 1996; Olsson et al., 1998; Piboonpocanun et al., 2006; van Ree, 2007; Cui et al., 2008a; Jeong et al.,

2012) were not found in this study.

4.3.2.2 Polypeptide analysis

The percent identity tree of group 1 allergens shows close similarity of

121

Table 4.11: Geographical polymorphism in the Der p 1 allergen.

Locality and DNA Other sporadic Most frequently reported mutation sites Reference template Y50 V124 T136 Q215 mutation sites Pakistan genomic - V/A S E None This study USA genomic Y/H A - - None This study UK genomic - A S N.R. None Kent et al., 1992 Sydney genomic - V/A S/T E None Smith et al., 2001a; 2001b Melbourne cDNA H/Y V/A S/T E/Q 1 Chua et al., 1993 Perth cDNA - V/A S E/K 6 Smith et al., 2001 Bangkok cDNA H/Y A/V S E/G 9 Piboonpocanun et al., 2006 Korea cDNA Y/H V/A S E 20 Jeong et al., 2012 Superscript on amino acid symbol indicates the position in polypeptide (N.R.: not reported; “a.a/a.a”: higher frequency/lower frequency reported; “-”: no mutation

122

pyroglyphid dust mites (D. farinae, E. maynei and D. pteronyssinus) with the psoroptid mange mite, P. ovis (Psoroptidae); whereas large phylogenetic distances were found between the pyroglyphid mites and species from the storage mite families

Echimyopodidae (B. tropicalis) and Acaridae (A. siro and T. putrescentiae) (Table

4.12 & Figure 4.17). A closer evolutionary relationship of E. maynei with D. pteronyssinus was observed in the tree whereas D. farinae and D. pteronyssinus were more distantly placed (Figure 4.17).

The total length of the translated Der f 1 polypeptide was 321 amino acids.

This included the signal peptide (with the C-terminus at pos -81), the proenzyme part

(80 amino acids, pos -80 to -1), and the mature enzyme (223 amino acids, pos 1 to

223). Coordinates for Der p 1 were similar, except for the mature enzyme, which had a single deletion at aa pos 9, therefore, its length was 222 amino acids (Figure 4.18).

The cleavage sites for signal peptides predicted for all cysteine proteases in this study were between aa pos -80 and -81.

The length of signal peptides in Der f 1, Der p 1, Eur m 1, Pso o 1 and Blo t

1 was 18 amino acids, whereas Sar s 1, Aca s 1 and Try p 1 were 24, 15 and 17 amino acids long, respectively. Identification of proenzyme regions was based on the length of the signal peptide and mature enzyme (Figure 4.18). No insertions or deletions were found in the Eur m 1 protein, whereas, in Pso o 1 there was an insertion between aa pos -40 and -41 in the proenzyme region. In Sar s 1, Aca s 1, Blo t 1 and Tyr p 1,

6 to 7 insertions and 1 to 5 deletions were observed (Figure 4.18).

Forty-four identical amino acid residues were observed in the alignment. The active sites were well conserved: the first region (pos 29-40, length 11 aa) has 80%

123

Table 4.12: Percent identity matrix of aligned group 1 allergens.

Der f 1 Der p 1 Eur m 1 Pso o 1 Sar s 1 Aca s 1 Blo t 1 Tyr p 1

Der f 1 100.00 ------Der p 1 83.01 100.00 ------Eur m 1 86.58 84.59 100.00 - - - - - Pso o 1 64.86 62.58 64.49 100.00 - - - - Sar s 1 44.98 44.90 44.30 43.85 100.00 - - - Aca s 1 35.67 33.00 35.29 35.95 27.30 100.00 - - Blo t 1 35.41 34.19 37.38 33.87 30.97 42.37 100.00 - Tyr p 1 32.01 29.97 30.65 30.00 27.42 39.38 38.23 100.00

124

Figure 4.17: Maximum likelihood tree of the group 1 allergen protein of acariform mites (inferred in RAxML ver. 7.5.5).

Figure 4.18: Alignment map of cysteine proteases from selected mite species. D. pteronyssinus (Der p 1: present study, and U11695.1 for Der p 1 to complete our partial signal peptide sequence), E. maynei (Eur m 1:AAC82352.), Psoroptes ovis (Pso o 1: Q1EIQ3.1), S. scabiei (Sar s 1: AAS93667.1), A. siro (Acr s: ABU50820.1), B. tropicalis (Blo t 1: AAQ24541.1) and T. putrescentiae (Tyr p 1: ABM53753.1). Numbers inside triangles indicate the number of amino acids (aa). The "No data" box indicates missing 5’ ends.). AB034946 sequence was used to complete our partial Der f 1 signal peptide sequence.

125

126

mean similarity; the second (pos 170-180, length 11) 72%, and the third (pos 186-

205, length 20) 79% mean identity (Figure 4.15). Amino acid residues making the

4C1 mAb binding epitope for Der f 1 were aligned with cysteine proteases of other mite species. Analysis revealed its high identity with Eur m 1 (100 %), Der p 1

(85.7%) and Pso o 1 (78.87%), varying from 2 to 3 amino acid residues, whereas, the Ca+ ion binding region demonstrated a 100% identity (Table 4.13 & Figure 4.15).

Group 1 allergens of HDM are medically important, since they show high

IgE binding frequencies and are commonly used in, diagnostic tests (i.e. SPT) and immunotherapeutic management of HDM allergy patients. Polymorphism in group

1 allergens in different geographical regions has been of great concern, because it may affect the efficacy of allergy tests and treatment of the allergic disease. GenBank data available to date, are mostly based on cDNA libraries, produced by amplifying

mRNA using RT-PCR with subsequent cloning of PCR products. Unfortunately, these studies made little effort to distinguish between potential polymerase errors (as reverse transcriptase is non-proofreading) and actual sequence polymorphism. In this study, we employed direct gene amplification and sequencing of the two most important -HDM -species, with the aim -to reduce artifacts, that may be introduced by the non-proofreading reverse transcriptase. This technique is also less labor intensive, so results can be obtained faster in future studies.

Der f 1 allergen polymorphism observed in the present study shows two haplotypes. Haplotype 1 from the USA and Pakistan exactly matches with partial mRNA variants from Korea (n:12) China (n:13) and the UK (n:18). In contrast, haplotype 2 detected in Pakistan specimens showed 100% similarity with variants reported from Thailand (n:9) and China (Cui et al., 2008a).

127

Table 4.13: Comparison of conserved amino acid residues involved in 4C1mAb and Ca+ binding epitopes in aligned group 1 allergens

4C1 binding epitope Ca+ Binding

Amino Identity Identity acid E14 D16 R18 S19 R21 G156 R157 I159 T181 Q182 Y186 D199 Y202 Y204 score D57 L58 E60 E92 score Position (%) (%) Der f 1 ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ 100 ✓ ✓ ✓ ✓ 100

Der p 1 ✓ ✓ ✓ Q ✓ ✓ ✓ ✓ A ✓ ✓ ✓ ✓ ✓ 85.71 ✓ ✓ ✓ ✓ 100

Eur m 1 ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ 100 ✓ ✓ ✓ ✓ 100

Pso o 1 ✓ ✓ ✓ A G ✓ ✓ ✓ K ✓ ✓ ✓ ✓ ✓ 78.57 ✓ ✓ ✓ ✓ 100

Sar s 1 ✓ ✓ ✓ K G ✓ K V K Y V ✓ ✓ ✓ 50 G ✓ ✓ S 50

Aca s 1 T ✓ ✓ - S ✓ G ✓ E N ✓ E ✓ K 50 R ✓ K ✓ 50

Blo t 1 N ✓ ✓ Q A S G L ✓ V ✓ N ✓ ✓ 42.86 E ✓ ✓ ✓ 75

Tyr p 1 S ✓ ✓ N I N G M D S ✓ E ✓ R 28.57 H ✓ R D 25 A high percent identity score (>50) was observed in Der p 1, Eur m 1, Pso o 1 compared to Der f 1, indicating possibility of cross-reactivity among these allergens

128

Almost all mutations (13), observed in our study were silent substitutions, however, there was one novel non-silent mutation (tryptophan to arginine) at aa pos

197. This mutation lies within the active region of the mature protein (Stamatakis et al., 2005; Lanfear et al., 2012). Tryptophan (W) is an aromatic amino acid, with a large side chain pointing into the core between α helices of the polypeptide. Its side chain makes many hydrophobic interactions. The amino acid arginine (R) is polar, positively charged and can only make a few of these interactions, thus, potentially destabilizing the active site domain (Bonifácio et al., 2002). Although no significant change in structure and function was predicted, there still is a need to investigate the effect of this mutation on the properties of this peptide. This mutation might alter the enzyme activity of cysteine protease, but since it does not lie in the IgE binding epitope residue, therefore, it may not affect the allergenic properties, immune response, and cross-reactivity of the protein. Further investigations may help to confirm this hypothesis.

In Der p 1, sporadic substitutions of amino acids have been reported previously (Dreborg and Einarsson, 1992; Kent et al., 1992; Chua et al., 1993;

Nishiyama et al., 1993; Chua et al., 1996; Olsson et al., 1998; Piboonpocanun et al.,

2006; van Ree, 2007; Cui et al., 2008a; Cui et al., 2008b; Jeong et al., 2012).

However, at least some of them may actually represent artifacts, introduced by polymerase errors. For example, only single occurrence of an amino acid substitution was reported at several aa positions: 19 (L->M), 21(P->T), 44 (D->E), 125(S->N),

129 (K->E) and 138 (M->I) (Smith et al., 2001b; Piboonpocanun et al., 2006).

Immune response to polymorphic peptides with these substitutions was either reduced or absent, whereas polymorphic peptides with more frequent substitutions at aa pos 50 (Y->H), 124 (V->A), 136 (T->S) and 215(Q->E/K/G) were able to

129

induce a T cell response, indicating their role in differential inflammatory cytokine production of T cells (Smith et al., 2001b). Additional, albeit indirect evidence for the presence of potential RT-PCR artifacts, in published sequences is the substantial difference in percentages of mutations per sequenced nucleotide for GenBank cDNA data versus our data: 0.3071 vs 0.1614 for D. farinae and 0.4866 vs 0.0948 for D. pteronyssinus. These two lines of evidence support our argument, that some clones reported in the literature may be artifacts of RT-PCR.

Chua and colleagues reported six variants of Der p 1 from Australia using

RT-PCR, including five non-synonymous (aa pos 50, 81, 124, 136 and 215) and one synonymous mutation aa pos 149. Results of our study coincide with five of these reported substitutions (Chua et al., 1993). This probably indicates the panmictic nature of D. pteronyssinus populations. Mutations at aa pos 50(Y->H) and 124 (V-

>A) are the most frequent substitutions and have been shown to strongly affect the

T cell response in humans and mouse (Chua et al., 1993; Smith et al., 2001b; Jeong et al., 2012). It is now recognized that amino acids Y50, V124, T136 and Q215 are common in Der p 1 and Der f 1 at these sites. The effect of these amino acid substitutions needs to be studied in the future for the development of species-specific monoclonal antibodies.

The predicted Der f 1 allergen sequence in our study, shows a high percent homology with Eur m 1 (85.58%), suggesting a closer phylogenetic relationship to

Der f 1, although D. farinae and D. pteronyssinus are currently taxonomically classified in the same genus. However, recent molecular phylogenetic studies, based on different genes also support the close relationship of D. farinae and E. maynei

(Klimov and OConnor, 2013). The ordered distances of group 1 allergen protein,

130

agree with the phylogenetic distances of these taxa inferred using five independent genes (Klimov and OConnor, 2013).

Similarly, there was 100% homology in the second active site residue (aa pos

186-205), IgE-binding epitopes and in the Ca+ binding epitopes of Der f 1 and Eur m

1. This is supported, by earlier reports of a greater homology between these two mite allergens and evidence of cross reactivity between them (Betts and Russell, 2007;

Chruszcz et al., 2012). Der p 1 epitopes were also highly conserved (86%), where only serine (S19) was replaced by glutamine (Q). This may be the cause of cross reactivity reported earlier between Der f 1, Der p 1 and Eur m 1 (Cui et al., 2008b).

Pso o 1 allergen also shows a 100% conservation of the Ca+ binding epitope residue,

79% 4C1 mAb epitope homology and 69% complete protein identity score. This explains the cross-antigenicity between allergens of house dust mites and other parasitic psoroptidians (Arlian, 1991). On the other hand, the complete absence of any cross reactivity between Der p 1 and Blo t 1 (Thomas et al., 2004) is supported by the large phylogenetic distance between group 1 allergens of pyroglyphid and echimyopodid mites (Blomia).

4.4 CONCLUSION As an outcome of this research, a better awareness (with relevant data) about the epidemiological status of House Dust Mite (HDM) allergy in Pothwar region has been established. The status of HDM, pollen and food allergy was explored and it was deduced, that, HDM allergy is significantly higher compared to pollen and food allergies in the study region. Since more patients visiting the allergy clinics were males, gender skewness was observed in all types of allergies indicating a probable role of sex hormones in developing type I hypersensitivity.

131

Presence of pyroglyphid mite species (D. farinae and D. pteronyssinus only) and the absence of other species from the family Pyroglyphidae are reported for the first time. Sixty one percent (61%) of mites were D. farinae (most prevalent) followed by 29% D. pteronyssinus. Among other Acariformes mites found, were, predatory Cheyletidae and detritivores Orbitidsae. These are not usually associated to allergic disorders, hence, out of the scope of present study. Acrofauna in the

Pothwar region were characterized and quantified for the first time. It has helped shed light on this very significant, but ignored cause of allergy in our population.

Use of molecular characterization of species, that are closely related and morphologically very similar, is a new contemporary approach, that reduces chances of error in identification and ensures correct taxonomic placement of species. It was concluded from this work, that due to extreme climate conditions in the Pothwar, mite counts show seasonal variation, with highest peaks observed during monsoon

(July-Sept), when average temperature and percent relative humidity (%RH) is maximum.

It was also concluded here, that exposure to mite allergens is not associated to an individual’s home environment, since there was no significant difference in

HDM allergen levels, between random houses and patient houses. This emphasizes a need to further investigate the role of genetic predisposition in allergen sensitization.

Study of group 1 allergen polymorphism indicated, that, very little polymorphism occurs in the group 1 allergen gene of D. farinae, where all but one mutation were silent and do not affect the primary structure of this protein. The discovery of a novel TrpArg mutation in the active site of the enzyme is the most

132

exciting finding of present work. Further experiments are required to estimate the frequency of this novel Der f 1 allele. In this study, a substantial amino-acid variation is present in D. pteronyssinus, but the number of variants is far fewer than reported earlier. In order to eliminate RT-PCR artifacts as a probable cause of these variations, it is suggested that, direct sequencing technique should be utilized in the study of genetic polymorphism. Polymorphism in Der f 1 gene did show some geographic distribution patterns: haplotype 1 is more common and widely distributed as compared to haplotype 2. Der p 1 gene polymorphism is panmictic and does not show any geographically localized variants. Analysis of group 1 allergen proteins from different mite species confirms a close evolutionary relationship between pyroglyphids and parasitic psoroptid mange mites.

SUMMARY

Allergy refers to acquired potential of developing immunologically mediated adverse reactions to normally harmless substances (allergens). Pyroglyphid mites belonging to the genus Dermatophagoides, present in the house dust, have been identified among the major sources of allergens. Although several species of pyroglyphid mites are associated with house dust, D. farinae and D. pteronyssinus have been reported frequently. Millions of these tiny creatures (300-400 µm in width) are associated with a variety of habitats in human dwellings affecting the health of 10-30% population in a region. Association between sensitization to house dust mite allergens and allergic diseases such as asthma, perennial rhinitis and atopic dermatitis is well known. A large number of mite body proteins have been implicated as allergens in dust from the houses. Increased allergen exposure as a result of modern housing, genetic traits and environmental pollution are the major causes of increased prevalence of HDM allergy. Recent studies from Rawalpindi and

Islamabad have reported high prevalence of HDM sensitization in allergy patients.

The present study also found, that, an estimated 81.74% of allergy patients showed sensitivity to HDM allergens. In this work, a gender bias to allergen sensitization

(56.11% males) was also observed, but any association of allergy predisposition to sex hormones still remains to be elucidated.

Despite reports of allergen sensitization, no efforts had been made to characterize HDM populations of houses. Commercially available battery of allergens used for SPT includes group 1 allergens (Der p 1 and Der f 1), owing to high IgE binding frequency of these allergens. Similarly, Der p 1 and Der f 1 ELISA kits are frequently used by researchers to estimate HDM exposure of a population.

133

134

This research work was therefore based on these rationales, with the aim to unveil the HDM-fauna populating -domiciliary dust in Pothwar region. Results of endeavors made in the present study, revealed two “allergy causing” pyroglyphid species namely: D. farinae and D. pteronyssinus dwelling houses in the study region.

Taxonomic identification was duly supported by PCR-RFLP of ITS2 gene. D. farinae are known to survive better in extreme climate conditions especially dry periods, therefore it was not surprising that this species was the most abundant among the acrofauna characterized from dust samples. Seasonal variations in acrofauna counts were supported by fluctuating Der f 1 and Der p 1 allergen levels in house dust extracts. Monsoon season during which, % RH and ambient air temperatures are most suitable for the proliferation of HDM species, was the time of the year when the human population is exposed to alarmingly high allergen levels.

Although in this work significantly high HDM counts and their allergen levels were found in the monsoon season, association of incidence of HDM allergy during this season needs to be studied.

Since group 1 allergens are of importance in diagnostic procedures and HDM allergy treatment strategies, they have been extensively studied around the world.

These cysteine proteases are single gene products, and there are reports of geographical polymorphism in these genes. Der f 1 and Der p 1 allergen genes were therefore amplified using direct PCR method. This protocol was unique, as it reduced possibility of error due to RT-PCR, where reverse transcriptase enzyme is used to make cDNA copies from mRNA. Furthermore, with direct sequencing, the complete

Der f 1 and Der p 1 allergen genes were reported for the first time.

Der f 1 gene, including six exons and five introns (with two novel introns),

135

was 1278 base pairs (bp) long. The gene showed two haplotypes i.e. H1 and H2. It was observed that H1 was more frequent in D. farinae specimens from Pakistan and

USA. Fourteen (14) mutations in Der f 1 gene were identified, where 13 were silent and 1 was a novel non-silent mutation, where amino acid tryptophan (W) was substituted by arginine (R). This novel mutation occurred in the active site of the mature enzyme. There is a need to further investigate the effect of this mutation on allergenicity of Der f 1 allergen.

Similarly, Der p 1 gene sequence included five exons and four introns, having a length 1248-1250 bp, owing to a variable poly-T region in intron 1. Three (3) out of 5 introns were not known previously. Polymorphism at five nucleotide positions in the coding regions (exons) was observed. Deduced amino acid sequences showed four non-synonymous substitutions and a synonymous mutation. Mutations at aa pos

50, 124, 136 and 215 have been frequently reported previously.

The predicted Der f 1 allergen sequence, showed a high percent homology with Eur m 1 supporting earlier hypothesis of a closer phylogenetic relationship, between D. farinae and E. maynei. On the other hand, a low homology between Der p 1 and Blo t 1 supports the earlier postulated large phylogenetic distance between pyroglyphid and echimyopodid mites (Blomia). The detailed analysis of group 1 protein alignments, may be helpful in predicting possibility of cross reactivity among homologous allergens and understanding incidents of co-sensitization observed in

HDM allergy patients.

Hence, it is concluded that, HDM allergy is a significant problem faced by the inhabitants of Pothwar, Pakistan. The present study helps in understanding HDM

136

allergy in a meaningful manner, it has further provided a direction towards better management and control of this allergy. It has shed light on a new concept of dispersal of HDM. Genetic mutations shared by HDM in the US and Pakistan show the tendency of intercontinental dispersal. After examining genetic variation in the group 1 allergen gene from samples of D. farinae and D. pteronyssinus, collected in the US and Pakistan, it is suggested that, HDM populations may be connected through migration across continents with some detectible geographic differences.

LITERATURE CITED

AAAAI (American Academy of Allergy, Asthma, and Immunology). 2000.

Corrected abstracts: 56th annual meeting. J. Allergy Clin. Immunol., 105 (3):

593-648.

Abbas, S., C. H. Katelaris, A. B. Singh, S. M. Raza, M. A. Khan, M. Rashid, M.

Abbas and M. Ismail. 2012. World allergy organization study on aerobiology

for creating first pollen and mold calendar with clinical significance in

Islamabad, Pakistan; a project of World Allergy Organization and Pakistan

Allergy, Asthma & Clinical Immunology centre of Islamabad. World Allergy

Organ. J., 5 (9): 103-110.

Abramson, S. L., A. Turner-Henson, L. Anderson, M. P. Hemstreet, L. K.

Bartholomew, C. L. M. Joseph, S. Tang, S. Tyrrell, N. M. Clark and D.

Ownby. 2006. Allergens in school settings: results of environmental

assessments in 3 city school systems. J. Sch. Health, 76 (6): 246-249.

Addo-Yobo, E. O., A. Custovic, S. C. Taggart, M. Craven, B. Bonnie and A.

Woodcock. 2001. Risk factors for asthma in urban Ghana. J. Allergy Clin.

Immunol., 108 (3): 363-368.

Aderele, W. 1979. Bronchial asthma in Nigerian children. Arch. Dis. Child., 54 (6):

448-452.

Ahu, S. and H. Kim. 1983. The allergen skin test and the effect of specific

desensitising vaccination therapy in allergic rhinitis and bronchial asthma.

Allergy, 3: 159-167.

Ait-Khaled, N., J. Odhiambo, N. Pearce, K. S. Adjoh, I. A. Maesano, B. Benhabyles,

Z. Bouhayad, E. Bahati, L. Camara, C. Catteau, A. El Sony, F. O. Esamai, I.

E. Hypolite, K. Melaku, O. A. Musa, L. Nganga, B. O. Onadeko, O. Saad,

137

138

M. Jerray, J. M. Kayembe, N. B. Koffi, F. Khaldi, C. Kuaban, K. Voyi, J.

M'Boussa, -O. Sow, O. Tidjani and H. J. Zar. 2007. - Prevalence of symptoms

of asthma, -rhinitis and eczema in 13- to 14-year-old children in Africa: the

international study of asthma and allergies in childhood Phase III. Allergy,

62 (3): 247-258.

Akdis, C. A., M. Akdis, T. Bieber, C. Bindslev‐Jensen, M. Boguniewicz, P.

Eigenmann, Q. Hamid, A. Kapp, D. Y. Leung and J. Lipozencic. 2006.

Diagnosis and treatment of atopic dermatitis in children and adults: European

Academy of Allergology and Clinical Immunology/American Academy of

Allergy, Asthma and Immunology/PRACTALL Consensus Report. Allergy,

61 (8): 969-987.

Al-Frayh, A. S., S. M. Hasnain, M. O. Gad-El-Rab, B. Schwartz, K. Al-Mobairek

and S. T. Al-Sedairy. 1997. House dust mite allergens in Saudi Arabia:

Regional variations and immune response. Ann. Saudi. Med., 17 (2): 156-

160.

Al-Rabia, M. W. 2016. Prevalence and severity of sensitization reaction to food and

inhalant allergens among allergic patients from Jeddah city: Saudi Arabia.

Int. J. Community Med. Public Health, 3(10): 2908-2915.

Alber, T., D.W. Banner, A.C. Bloomer, G.A. Petsko, D. Phillips, P.S. Rivers and

I.A. Wilson. 1981. On the three-dimensional structure and catalytic

mechanism of triose phosphate isomerase. Philos. Trans. R. Soc. London

Biol., 293 (1063): 159-171.

Alexander, J.O.D. 1972. Mites and skin diseases. Jpn. J. Clin. Med., 79: 14-19.

Allergome. 2017. Allergome, the plateform for allergen knowldge. Retrieved June

20, 2017, from http://www.allergome.org/script/search_step2.php.

Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller and D.

139

J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of

protein database search programs. Nucleic Acids Res., 25 (17): 3389-3402.

Alvarez, M., J. Olaguibel, S. Acero, S. Quirce, B. Garcia, T. Carrillo, C. Cortes and

A. Tabar. 1996. Indoor allergens and dwelling characteristics in two cities in

Spain. J. Investig. Allergol. Clin. Immunol., 7 (6): 572-577.

Amoli, K. and A. M. Cunnington. 1977. House dust mites in Iran. Clin. Allergy, 7

(1): 93-101.

An, S., L. Chen, C. Long, X. Liu, X. Xu, X. Lu, M. Rong, Z. Liu and R. Lai. 2013a.

Dermatophagoides farinae allergens diversity identification by proteomics.

Mol. Cell. Proteomics, 12 (7): 1818-1828.

An, S., C. Shen, X. Liu, L. Chen, X. Xu, M. Rong, Z. Liu and R. Lai. 2013b. Alpha-

actinin is a new type of house dust mite allergen. PLoS One, 8 (12): e81377.

Anderson, H. R. and A. M. Cunnington. 1974. House dust mites in the highlands of

Papu New Guinea. P. N. G. Med. J., 17 (3): 304-308.

Anderson, H. R., R. Gupta, D. P. Strachan and E. S. Limb. 2007. 50 years of asthma:

UK trends from 1955 to 2004. Thorax, 62 (1): 85-90.

Araujo-Fontaine, A., M. Wagner and M. Kremer. 1973. Study of house-dust mites

in Alsace. Relations to habitat conditions. C.R. Séances Soc. Biol. Fil., 167

(2): 371-378.

Arlian, L. G. 1975. Water exchange and effect of water vapour activity on metabolic

rate in the dust mite, Dermatophagoides. J. Insect Physiol., 21 (8): 1439-

1442.

Arlian, L. G. 1977. Humidity as a factor regulating feeding and water balance of the

house dust mites Dermatophagoides farinae and D. pteronyssinus (Acari:

Pyroglyphidae). J. Med. Entomol., 14 (4): 484-488.

Arlian, L. G. 1989. Biology and ecology of house dust mites, Dermatophagoides

140

spp. and Euroglyphus spp. Immunol. Allergy Clin. North Am., 9 (2): 339-

356.

Arlian, L. G. 1991. House-dust-mite allergens: a review. Exp. Appl. Acarol., 10 (3-

4): 167-186.

Arlian, L. G. 1992. Water balance and humidity requirements of house dust mites.

Exp. Appl. Acarol., 16 (1-2): 15-35.

Arlian, L. G. and M. M. Veselica. 1981 a. Effect of temperature on the equilibrium

body water mass in the mite Dermatophagoides farinae. Physiol. Zool., 54

(4): 393-399.

Arlian, L. G. and M. M. Veselica. 1981 b. Reevaluation of the humidity requirements

of the house dust mite Dermatophagoides farinae (Acari: Pyroglyphidae). J.

Med. Entomol., 18 (4): 351-352.

Arlian, L. G., I. L. Bernstein and J. S. Gallagher. 1982. The prevalence of house dust

mites, Dermatophagoides spp, and associated environmental conditions in

homes in Ohio. J. Allergy Clin. Immunol., 69 (6): 527-532.

Arlian, L. G., P. J. Woodford, I. L. Bernstein and J. S. Gallagher. 1983. Seasonal

population structure of house dust mites, Dermatophagoides spp. (acari:

Pyroglyphidae). J. Med. Entomol., 20 (1): 99-102.

Arlian, L. G., I. Bernstein, D. Geis, D. Vyszenski-Moher, J. Gallagher and B. Martin.

1987. Investigations of culture medium-free house dust mites: III. Antigens

and allergens of body and fecal extract of Dermatophagoides farinae. J.

Allergy Clin. Immunol., 79 (3): 457-466.

Arlian, L. G., C. M. Rapp and S. G. Ahmed. 1990. Development of

Dermatophagoides pteronyssinus (Acari: Pyroglyphidae). J. Med. Entomol.,

27 (6): 1035-1040.

Arlian, L. G., D. Bernstein, I. L. Bernstein, S. Friedman, A. Grant, P. Lieberman, M.

141

Lopez, J. Metzger, T. Platts-Mills and M. Schatz. 1992. Prevalence of dust

mites in the homes of people with asthma living in eight different geographic

areas of the United States. J. Allergy Clin. Immunol., 90 (3 Pt 1): 292-300.

Arlian, L. G. and J. S. Dippold. 1996. Development and fecundity of

Dermatophagoides farinae (Acari: Pyroglyphidae). J. Med. Entomol., 33 (2):

257-260

Arlian, L. G., P. D. Confer, C. M. Rapp, D. L. Vyszenski-Moher and J. C. Chang.

1998a. Population dynamics of the house dust mites Dermatophagoides

farinae, D. pteronyssinus, and Euroglyphus maynei (Acari: Pyroglyphidae)

at specific relative humidities. J. Med. Entomol., 35 (1): 46-53.

Arlian, L. G., J. S. Neal and S. W. Bacon. 1998b. Survival, fecundity, and

development of Dermatophagoides farinae (Acari: Pyroglyphidae) at

fluctuating relative humidity. J. Med. Entomol., 35 (6): 962-966.

Arlian, L. G., J. S. Neal and D. L. Vyszenski-Moher. 1999a. Fluctuating hydrating

and dehydrating relative humidities effects on the life cycle of

Dermatophagoides farinae (Acari: Pyroglyphidae). J. Med. Entomol., 36 (4):

457-461.

Arlian, L. G., J. S. Neal and D. L. Vyszenski-Moher. 1999b. Reducing relative

humidity to control the house dust mite Dermatophagoides farinae. J.

Allergy Clin. Immunol., 104 (4 Pt 1): 852-856.

Arlian, L. G. and T. A. Platts-Mills. 2001. The biology of dust mites and the

remediation of mite allergens in allergic disease. J. Allergy Clin. Immunol.,

107 (3 S): S406-413.

Arlian, L. G., J. S. Neal, M. S. Morgan, D. L. Vyszenski-Moher, C. M. Rapp and A.

K. Alexander. 2001. Reducing relative humidity is a practical way to control

dust mites and their allergens in homes in temperate climates. J. Allergy Clin.

142

Immunol.,107 (1): 99-104.

Arlian, L. G., M. Morgan and J. Neal. 2002. Dust mite allergens: Ecology and

distribution. Curr. Allergy Asthma Rep., 2 (5): 401-411.

Arlian, L. G., D. L. Vyszenski-Moher and M. S. Morgan. 2003. Mite and mite

allergen removal during machine washing of laundry. J. Allergy Clin.

Immunol., 111 (6): 1269-1273.

Arruda, L. K., M. C. Rizzo, M. D. Chapman, E. Fernandez-Caldas, D. Baggio, T. A.

Platts-Mills and C. K. Naspitz. 1991. Exposure and sensitization to dust mite

allergens among asthmatic children in São Paulo, Brazil. Clin. Exp. Allergy.,

21 (4): 433-439.

Arruda, L. K., L. D. Vailes, T. A. Platts-Mills, E. Fernandez-Caldas, F. Montealegre,

K. L. Lin, K. Y. Chua, M. C. Rizzo, C. K. Naspitz and M. D. Chapman.

1997a. Sensitization to Blomia tropicalis in patients with asthma and

identification of allergen Blo t 5. Am. J. Respir. Crit. Care Med., 155 (1):

343-350.

Arruda, L. K., L. D. Vailes, T. A. Platts-Mills, M. L. Hayden and M. D. Chapman.

1997b. Induction of IgE antibody responses by glutathione S-transferase

from the German cockroach (Blattella germanica). J. Biol. Chem., 272 (33):

20907-20912.

Asher, M. I., S. Montefort, B. Björkstén, C. K. W. Lai, D. P. Strachan, S. K. Weiland,

H. Williams and I. P. T. S. Group. 2006. Worldwide time trends in the

prevalence of symptoms of asthma, allergic rhinoconjunctivitis, and eczema

in childhood: ISAAC Phases One and Three repeat multicountry cross-

sectional surveys. Lancet, 368 (9537): 733-743.

Assarehzadegan, M. A., A. Shakurnia and A. Amini. 2013. The most common

aeroallergens in a tropical region in Southwestern Iran. World Allergy Organ.

143

J., 6 (1): 7.

Asturias, J. A., M. C. Arilla, N. Gómez-Bayón, A. Martínez, J. Martínez and R.

Palacios. 1998. Sequencing and high level expression in Escherichia coli of

the tropomyosin allergen (Der p 10) from Dermatophagoides pteronyssinus.

Biochim. Biophys. Acta., 1397 (1): 27-30.

Balendiran, G. K., F. Schnutgen, G. Scapin, T. Borchers, N. Xhong, K. Lim, R.

Godbout, F. Spener and J. C. Sacchettini. 2000. Crystal structure and

thermodynamic analysis of human brain fatty acid-binding protein. J. Biol.

Chem., 275 (35): 27045-27054.

Bant, A. and J. Kruszewski. 2008. Increased sensitization prevalence to common

inhalant and food allergens in young adult Polish males. Ann. Agric. Environ.

Med., 15 (1): 21-27.

Barnes, K. C., E. Fernández-Caldas, W. L. Trudeau, D. E. Milne and R. J. Brenner.

1997. Spetial and temporal distribution of house dust mite

(Astigmata:Pyroglyphidae) allergens Der p 1 and Der f 1 in Barbadian homes.

J. Med. Entomol., 34 (2): 212-218.

Bauermeister, K., A. Wangorsch, L. P. Garoffo, A. Reuter, A. Conti, S. L. Taylor, J.

Lidholm, A. M. Dewitt, E. Enrique, S. Vieths, T. Holzhauser, B. Ballmer-

Weber and G. Reese. 2011. Generation of a comprehensive panel of

crustacean allergens from the North Sea Shrimp Crangon crangon. Mol.

Immunol., 48 (15-16): 1983-1992.

Beasley, R. 1998. Worldwide variation in prevalence of symptoms of asthma,

allergic rhinoconjunctivitis, and atopic eczema: ISAAC. Lancet, 351 (9111):

1225-1232.

Beasley, R., P. Ellwood and I. Asher. 2003. International patterns of the prevalence

of pediatric asthma: the ISAAC program. Pediatr. Clin. North Am., 50 (3):

144

539-553.

Bebenek, K., and T. A. Kunkel. 1993. The fidelity of retroviral reverse transcriptases.

In: A. M. Skalka & S. P. Goff (eds.), Reverse transcriptase. Cold Spring

Harbor Laboratory Press, New York, p. 85-102.

Bellinghausen, I., U. Brand, J. Knop and J. Saloga. 2000. Comparison of allergen-

stimulated dendritic cells from atopic and nonatopic donors dissecting their

effect on autologous naive and memory T helper cells of such donors. J.

Allergy Clin. Immunol., 105 (5): 988-996.

Ben-David, T., S. Melamed, U. Gerson and S. Morin. 2007. ITS2 sequences as

barcodes for identifying and analyzing spider mites (Acari: Tetranychidae).

Exp. Appl. Acarol., 41 (3): 169-181.

Beroiz, B., F. Couso-Ferrer, F. Ortego, M. Chamorro, C. Arteaga, M. Lombardero,

P. Castañera and P. Hernandez-Crespo. 2014. Mite species identification in

the production of allergenic extracts for clinical use and in environmental

samples by ribosomal DNA amplification. Med. Vet. Entomol., 28 (3): 287-

296.

Betts, M. J. and R. B. Russell. 2007. Amino-Acid Properties and Consequences of

Substitutions. In: M. R. Barnes, (ed.), Bioinformatics for Geneticists: A

Boinformatics Primer for the Analysis of Genetic Data. 2nd ed., John Wiley

& Sons Ltd., England, p. 311-342.

Bi, X. Z., S. T. Ong and F. T. Chew. 2007. Identification, cloning, and expression of

the arginine kinase, a putative pan-allergen from house dust mite, via

expressed sequence tagging, peptide mass fingerprinting and tandem mass

spectrometry. Retrieved May 17, 2015, from UniProt:

http://www.uniprot.org/uniprot/A7XZJ2.

Bieber, T. 2008. Atopic Dermatitis. New Engl. J. Med., 358 (14): 1483-1494.

145

Bigliocchi, F., L. Frusteri, M. P. Carrieri and M. Maroli. 1996. Distribution and

density of house dust mites Dermatophagoides spp. (Acarina:Pyroglypidae)

in the mattresses of two areas of Rome, Italy. Parassitologia, 38 (3): 543-546.

Bigliocchi, F. and M. Maroli. 1995. Distribution and abundance of house-dust mites

(Acarina: Pyroglycphidae) in Rome, Italy. Aerobiologia, 11 (1): 35-40.

Binotti, R. S., J. R. Muniz, I. A. Paschoal, A. P. do Prado and C. H. Oliveira. 2001.

House dust mites in Brazil-an annotated bibliography. Mem. Inst. Oswaldo

Cruz., 96 (8): 1177-1184.

Blythe, M. 1976. Some aspects of the ecological study of the house dust mites. Br.

J. Dis. Chest, 70 (1): 3-31.

Blythe, M., J. Williams and J. M. Smith. 1974. Distribution of pyroglyphid mites in

Birmingham with particular reference to Euroglyphus maynei. Clin. Exp.

Allergy, 4 (1): 25-33.

Bonifácio, M. J., M. Archer, M. L. Rodrigues, P. M. Matias, D. A. Learmonth, M.

A. Carrondo and P. Soares-Da-Silva. 2002. Kinetics and crystal structure of

Catechol-O-Methyltransferase complex with co-substrate and a novel

inhibitor with potential therapeutic application. Mol. Pharmacol., 62 (4): 795-

805.

Boquete, M., V. Iraola, E. Fernández-Caldas, L. Arenas Villaroel, F. J. Carballada,

C. González de la Cuesta, M. R. López-Rico, R. Núñez Orjales, G. A. Parra,

M. T. Soto-Mera, S. Varela and C. Vidal. 2006. House dust mite species and

allergen levels in Galicia, Spain: a cross-sectional, multicenter, comparative

study. J. Investig. Allergol. Clin. Immunol., 16 (3): 169-176.

Boulet, L. P., H. Turcotte, C. Laprise, C. Lavertu, P. M. Bedard, A. Lavoie and J.

Hebert. 1997. Comparative degree and type of sensitization to common

indoor and outdoor allergens in subjects with allergic rhinitis and/or asthma.

146

Clin. Exp. Allergy, 27 (1): 52-59.

Bousquet, J., R. Dahl and N. Khaltaev. 2007. Global alliance against chronic

respiratory diseases. Allergy, 62 (3): 216-223.

Braun-Fahrlander, C., M. Gassner, L. Grize, K. Takken-Sahli, U. Neu, T. Stricker,

H. S. Varonier, B. Wuthrich and F. H. Sennhauser. 2004. No further increase

in asthma, hay fever and atopic sensitisation in adolescents living in

Switzerland. Eur. Respir. J., 23 (3): 407-413.

Brody, A. R., J. C. McGrath and G. Wharton. 1972. Dermatophagoides farinae: the

digestive system. J. N. Y. Entomol. Soc. 80 (3): 152-177.

Buchanan, D. and I. Jones. 1974. Mites and house dust mite allergy in bronchial

asthma in Northern Zambia. Postgrad. Med. J., 50 (589): 680-682.

Buckley, M., S. Variend and A. Walls. 2001. Elevated serum concentrations of β‐

tryptase, but not α‐tryptase, in Sudden Infant Death Syndrome (SIDS). An

investigation of anaphylactic mechanisms. Clin. Exp. Allergy, 31 (11): 1696-

1704.

Burge, H. A. and C. A. Rogers. 2000. Outdoor allergens. Environ. Health Perspect.,

108 (4): 653-659.

Bush, R. K. and J. M. Portnoy. 2001. The role and abatement of fungal allergens in

allergic diseases. J. Allergy Clin. Immunol., 107 (3): S430-S440.

Caceres, I. and A. Fain. 1978. Notes sur la faune acarologique des poussières de

maisons du Perou. Bulletin et Annales de la Societe royale d’entomolgie de

Belgique, 114: 301-303.

Caceres, I. and A. Fain. 1979. Notes sur la faune acarologique des poussières de

maisons du Perou. Proc. IV International Congress of Acarology, 1974.,

Budapest., pp. 259-261.

Calderón, M. A., A. Linneberg, J. Kleine-Tebbe, F. De Blay, D. H. F. de Rojas, J. C.

147

Virchow and P. Demoly. 2014. Respiratory allergy caused by house dust

mites: What do we really know? J. Allergy Clin. Immunol. 136 (1):38-48.

Calvo, M., E. Fernández-Caldas, P. Arellano, F. Marín, J. Carnés and A.

Hormaechea. 2005. Mite allergen exposure, sensitisation and clinical

symptoms in Valdivia, Chile. J. Investig. Allergol. Clin. Immunol., 15 (3):

189-196.

Carranza, S., E. Arnold, J. Mateo and P. Geniez. 2002. Relationships and evolution

of the North African geckos, Geckonia and Tarentola (Reptilia: Gekkonidae),

based on mitochondrial and nuclear DNA sequences. Mol. Phylogen. Evol.,

23 (2): 244-256.

Casolaro, V., S. N. Georas, Z. Song and S. J. Ono. 1996. Biology and genetics of

atopic disease. Curr. Opin. Immunol., 8 (6): 796-803.

Chan-Yeung, M., A. Becker, J. Lam, H. Dimich-Ward, A. Ferguson, P. Warren, E.

Simons, I. Broder and J. Manfreda. 1995. House dust mite allergen levels in

two cities in Canada: effects of season, humidity, city and home

characteristics. Clin. Exp. Allergy, 25 (3): 240-246.

Chan, S. H., W. J. Leu, L. C. Hsu, H. S. Chang, T. L. Hwang, I. S. Chen, C.S. Chen

and J. H. Guh. 2013. Reevesioside F induces potent and efficient anti-

proliferative and apoptotic activities through Na⁺/K⁺-ATPase α3 subunit-

involved mitochondrial stress and amplification of caspase cascades.

Biochem. Pharmacol., 86 (11): 1564-1575.

Chang, J., L. G. Arlian, J. S. Dippold, C. M. Rapp and D. Vyszenski‐Moher. 1998.

Survival of the house dust mite, Dermatophagoides farinae, at high

temperatures (40–80° C). Indoor Air, 8 (1): 34-38.

Chapman, M. D., P. Heymann and T. Platts-Mills. 1987. Epitope mapping of two

major inhalant allergens, Der p I and Der f I, from mites of the genus

148

Dermatophagoides. J. Immunol., 139 (5): 1479-1484.

Chapman, M. D. and T. A. Platts-Mills. 1980. Purification and characterization of

the major allergen from Dermatophagoides pteronyssinus-antigen P1. J. of

Immunol., 125 (2): 587-592.

Charlet, L. D., M. S. Mulla and M. Sanchez-Medina. 1977. Domestic Acari of

Colombia: Abundance of the European house dust mite, Dermatophagoides

pteronyssinus (Acari: Pyroglyphidae), in homes in Bogota. J. Med. Entomol.,

13 (6): 709-712.

Charlet, L. D., M. S. Mulla and M. Sanchez-Medina. 1978. Domestic Acarina of

Colombia: occurrence and distribution of Acari in house dust. Acarologia.,

19 (2): 302-317.

Cheema, N. M., U. Farooq, G. Shabbir, M. K. N. Shah and M. Musa. 2013. Prospects

of castor bean cultivation in rainfed tract of Pakistan. Pak. J. Bot., 45 (1):

219-224.

Chen, J.-S., T. W. Sappington and A. S. Raikhel. 1997. Extensive sequence

conservation among insect, nematode, and vertebrate vitellogenins reveals

ancient common ancestry. J. Mol. Evol., 44 (4): 440-451.

Chen, S., H. Yao, J. Han, C. Liu, J. Song, L. Shi, Y. Zhu, X. Ma, T. Gao, X. Pang,

K. Luo, Y. Li, X. Li, X. Jia, Y. Lin and C. Leon. 2010. Validation of the ITS2

region as a novel DNA barcode for identifying medicinal plant species. PLoS

One, 5 (1): e8613.

Chen, W., M. Mempel, W. Schober, H. Behrendt and J. Ring. 2008. Gender

difference, sex hormones, and immediate type hypersensitivity reactions.

Allergy, 63 (11): 1418-1427.

Chen, Y., R. Dales, M. Tang and D. Krewski. 2002. Obesity may increase the

incidence of asthma in women but not in men: longitudinal observations from

149

the Canadian National Population Health Surveys. Am. J. Epidemiol., 155

(3): 191-197.

Chen, Y. H., M. F. Lee, J. L. Lan, C. S. Chen, H. L. Wang, G. Y. Hwang and C. H.

Wu. 2005. Hypersensitivity to Forcipomyia taiwana (biting midge): clinical

analysis and identification of major For t 1, For t 2 and For t 3 allergens.

Allergy, 60 (12): 1518-1523.

Chew, F., S. Ong, W. Wang, K. Kuay, B. Lee, L. Tsai and S. Lim. 2001. Preliminary

profile of the dust mite genomes: an expressed sequence tag (EST) analysis

of Dermatophagoides farinae and Blomia tropicalis genes. Proc. J. Allergy

Clin. Immunol., 107(2): S56.

Chew, F. T. and Y. F. Gao. 2006. Group 21 allergen, A8B8G7 - A8B8G7_DERFA.

Retrieved May 18, 2007, from UniProt:

http://www.uniprot.org/uniprot/A8B8G7.

Chew, F. T., D. Y. Goh and B. W. Lee. 1996. Effects of an acaricide on mite allergen

levels in the homes of asthmatic children. Acta paediatrica Japonica;

Overseas edition, 38 (5): 483-488.

Chew, F. T., S. T. Ong, S. H. Lim, L. C. Tsai and B. W. Lee. 2003. Identification

and cloning of Mal f 6 allergen homolog from Dermatophagoides farinae

expressed sequence tags. Retrieved May 18, 2015, from UniProt:

http://www.uniprot.org/uniprot/A1KXG2.

Chew, F. T., L. Zhang, T. M. Ho and B. W. Lee. 1999. House dust mite fauna of

tropical Singapore. Clin. Exp. Allergy, 29 (2): 201-206.

Chew, G. L., A. M. Reardon, J. C. Correa, M. Young, L. Acosta, R. Mellins, F. T.

Chew and M. S. Perzanowski. 2009. Mite sensitization among Latina women

in New York, where dust-mite allergen levels are typically low. Indoor Air,

19 (3): 193-197.

150

Cho, H., K. Lee, Y. Choi, D. Cho and N. Kim. 1985. Result of allergen skin tests in

type I hypersensitivity. Allergy, 5: 14-22.

Cho, H. J., H. J. Choi, D. K. Kim and K. H. Lee. 1998. Dermatophagoides farinae-

specific IgE and IgG4 antibodies in atopic dermatitis patients. Korean J.

Dermatol., 36 (1): 16-22.

Chruszcz, M., M. D. Chapman, L. D. Vailes, E. A. Stura, J. M. Saint-Remy, W.

Minor and A. Pomés. 2009. Crystal structures of mite allergens Der f 1 and

Der p 1 reveal differences in surface-exposed residues that may influence

antibody binding. J. Mol. Biol., 386 (2): 520-530.

Chruszcz, M., A. Pomés, J. Glesner, L. D. Vailes, T. Osinski, P. J. Porebski, K. A.

Majorek, P. W. Heymann, T. A. Platts-Mills and W. Minor. 2012. Molecular

determinants for antibody binding on group 1 house dust mite allergens. J.

Biol. Chem., 287 (10): 7388-7398.

Chua, K., C. Huang, H. Shen and W. Thomas. 1996a. Analysis of sequence

polymorphism of a major mite allergen, Der p 2. Clin. Exp. Allergy, 26 (7):

829-837.

Chua, K., P. Kehal and W. Thomas. 1993. Sequence polymorphisms of cDNA clones

encoding the mite allergen Der p I. Int. Arch. Allergy Immunol., 101 (4):

364-368.

Chua, K. Y. 1988. Sequence analysis of cDNA coding for a major house dust mite

allergen, Der p 1. Homology with cysteine proteases. J. Exp. Med., 167 (1):

175-182.

Chua, K. Y., R. J. Dilworth and W. R. Thomas. 1990. Expression of

Dermatophagoides pteronyssinus allergen, Der p II, in Escherichia coli and

the binding studies with human IgE. Int. Arch. Allergy Immunol., 91 (2):

124-129.

151

Chua, K. Y., C. H. Huang, H. D. Shen and W. R. Thomas. 1996. Analysis of

sequence polymorphism of a major mite allergen, Der p 2. Clin. Exp. Allergy,

26 (7): 829-837.

Colloff, M. J. 2009. Dust mites. Springer, Dordrecht, Netherlands: 8-310.

Colloff, M. J. 1987a. Mite fauna of dust from passenger trains in Glasgow.

Epidemiol. Infect., 98 (1): 127-130.

Colloff, M. J. 1987b. Mites from house dust in Glasgow. Med. Vet. Entomol., 1 (2):

163-168.

Colloff, M. J. 1992. Exposure to house dust mites in homes of people with atopic

dermatitis. Br. J. Dermatol., 127 (4): 322-327.

Colloff, M. J. 1998a. Distribution and abundance of dust mites within homes.

Allergy, 53 (48S): 24-27.

Colloff, M. J. 1998b. Taxonomy and identification of dust mites. Allergy, 53 (48S):

7-12.

Colloff, M. J. and F. T. Spieksma. 1992. Pictorial keys for the identification of

domestic mites. Clin. Exp. Allergy, 22 (9): 823-830.

Colloff, M. J., G. A. Stewart and P. J. Thompson. 1991. House dust acarofauna and

Der p I equivalent in Australia: the relative importance of Dermatophagoides

pteronyssinus and Euroglyphus maynei. Clin. Exp. Allergy, 21 (2): 225-230.

Colloff, M. J. and Stewart, G.A. 1997. House dust mites. In: Barnes, P., M. M.

Grunstein, A.R. Leff & A.J. Woolcock, (eds.), Asthma. Lippincott-Raven,

Philadelphia, p. 1089–1103.

Cookson, W. 1999. The alliance of genes and environment in asthma and allergy.

Nature, 402: 5-11.

Coombs, R. R. A. and P. G. H. Gell. 1975. Classification of allergic reactions

responsible for clinical hypersensitivity and disease. In: Gell, P. G. H., R. R.

152

A. Coombs & P. J. Lachmann, (eds.), Clinical Aspects of Immunology. 3rd

ed., Blackwell Scientific Publications, Oxford, London, p. 761-781.

Cornere, B. M. 1972. House dust mites: a national survey. N. Z. Med. J., 76 (485):

270-271.

Corry, D. B. and F. Kheradmand. 1999. Induction and regulation of the IgE response.

Nature, 402 (6760 S): B18-23.

Crane, J., K. Wickens, R. Beasley and P. Fitzharris. 2002. Asthma and allergy: a

worldwide problem of meanings and management? Allergy, 57 (8): 663-672.

Croce, M., E. Costa-Manso, D. Baggio and J. Croce. 2000. House dust mites in the

city of Lima, Peru. J. Investig. Allergol. Clin. Immunol., 10 (5): 286-288.

Cross, S., S. Buck and J. Hubbard. 1998. ABC of allergies: Allergy in general

practice. Br. Med. J. 316 (7144): 1584-1587.

Crowther, D., T. Wilkinson, P. Biddulph, T. Oreszczyn, S. Pretlove and I. Ridley.

2006. A simple model for predicting the effect of hygrothermal conditions on

populations of house dust mite Dermatophagoides pteronyssinus (Acari:

Pyroglyphidae). Exp. Appl. Acarol., 39 (2): 127-148.

Cruickshank, R. H. 2002. Molecular markers for the phylogenetics of mites and

ticks. Syst. Appl. Acarol., 7: 3-14.

Cuervo, N., F. Dusbabek, J. de la Cruz and R. Abreu. 1983. Acarids (Acarina:

Pyroglyphidae, Cheyletidae, Saproglyphidae and Glycyphagidae) of house

dust in Cuba. Rev. Cubana Med. Trop., 35 (1): 83-103.

Cui, Y. B., J. L. Peng, P. Zhou and M. Peng. 2008a. Sequence analysis and structure

prediction of the complete prepro-form group 1 allergen of adult

Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) from China. Int.

J. Acarol., 34 (1): 3-12.

Cui, Y., F. Teng, L. Yu, Y. Zhou, C. Zhang and L. Yang. 2017. Cloning, expression,

153

purification, characterization and IgE-binding in children with atopic asthma.

Pediatr. Pulmonol., 52: 282–292.

Cui, Y., P. Zhou, J. Peng, M. Peng, Y. Zhou, Y. Lin and L. Liu. 2008b. Cloning,

sequence analysis, and expression of cDNA coding for the major house dust

mite allergen, Der f 1, in Escherichia coli. Braz. J. Med. Biol. Res., 41 (5):

380-388.

Cui, Y. B., Y. Z. Ling, Y. Zhou, Z. W. Feng, Y. R. Xing and S. W. Zhang. 2006. An

effective indirect fluorescent antibody test for diagnosis of intestinal

acariasis. Southeast Asian J. Trop. Med. Public Health, 37 (3): 452-455.

Currie, G. P., T. C. Fardon and D. K. Lee. 2005. The role of measuring airway

hyperresponsiveness and inflammatory biomarkers in asthma. Ther. Clin.

Risk. Manag., 1 (2): 83.

Dandeu, J. P., J. Le Mao, M. Lux, J. Rabillon and B. David. 1982. Antigens and

allergens in Dermatophagoïdes farinae mite. II. Purification of AG f1, a

major allergen in Dermatophagoïdes farinae. Immunology, 46 (4): 679-687.

Daniels, S., S. Bhattacharrya, A. James, N. Leaves, A. Young, M. Hill, J. Faux, G.

Ryan, P. le Söuef and G. Lathrop. 1996. A genome-wide search for

quantitative trait loci underlying asthma. Nature, 383 (6597): 247-250.

Dar, N. and V. Gupta. 1979. Studies on the house dust mites of India and their role

in causation of bronchial asthma and allergic rhinitis-Part I. The mites.

Orient. Insects, 13 (3-4): 261-298.

Dautartiene, A. 2001. Seasonal changes in house dust mites. Ekologija (Vilnius), 2:

3-7.

Dawood, A., A. Channing and J. P. Bogart. 2002. A molecular phylogeny of the frog

genus Tomopterna in southern Africa: examining species boundaries with

mitochondrial 12S rRNA sequence data. Mol. Phylogen. Evol., 22 (3): 407-

154

413. de Andrade, A. D., D. Charpin, J. Birnbaum, A. Lanteaume, M. Chapman and D.

Vervloet. 1995. Indoor allergen levels in day nurseries. J. Allergy Clin.

Immunol., 95 (6): 1158-1163. de Boer, R., K. Kuller and O. Kahl. 1998. Water balance of Dermatophagoides

pteronyssinus (Acari: Pyroglyphidae) maintained by brief daily spells of

elevated air humidity. J. Med. Entomol., 35 (6): 905-910. de Halleux, S., E. Stura, L. VanderElst, V. Carlier, M. Jacquemin and J. M. Saint-

Remy. 2006. Three-dimensional structure and IgE-binding properties of

mature fully active Der p 1, a clinically relevant major allergen. J. Allergy

Clin. Immunol., 117 (3): 571-576. de Marco, R., F. Locatelli, J. Sunyer and P. Burney. 2000. Differences in incidence

of reported asthma related to age in men and women. Am. J. Respir. Crit.

Care Med., 162 (1): 68-74. de Mendonça, R. S., D. Navia, I. R. Diniz, P. Auger and M. Navajas. 2011. A critical

review on some closely related species of Tetranychus sensu stricto (Acari:

Tetranychidae) in the public DNA sequences databases. Exp. Appl. Acarol.,

55 (1): 1-23. de Oliveira, C. H., R. S. Binotti, J. R. O. Muniz, J. C. dos Santos, A. P. do Prado and

A. J. de Pinho. 2003. Comparison of house dust mites found on different

mattress surfaces. Ann. Allergy Asthma Immunol., 91 (6): 559-562. de Rojas, M., J. M. Úbeda, C. Cutillas, M. D. Mora, C. Ariza and D. Guevara. 2007.

Utility of ITS1–5.8 S–ITS2 and 16S mitochondrial DNA sequences for

species identification and phylogenetic inference within the Rhinonyssus

coniventris species complex (Acari: Rhinonyssidae). Parasitol. Res., 100 (5):

1041-1046.

155

de Vries, M., L. Van den Bemt, F. Van der Mooren, J. Muris and C. van Schayck.

2005. The prevalence of house dust mite (HDM) allergy and the use of HDM-

impermeable bed covers in a primary care population of patients with

persistent asthma in the Netherlands. Prim. Care Respir. J., 14 (4): 210-214. de Wit, D., Z. Amraoui, B. Vincart, O. Michel, A. Michils, L. Van Overvelt, F.

Willems and M. Goldman. 2000. Helper T-cell responses elicited by Der p

1–pulsed dendritic cells and recombinant IL-12 in atopic and healthy

subjects. J. Allergy Clin. Immunol., 105 (2): 346-352.

Delves, P. 2014. Allergic, autoimmune and other hypersensitivity disorders The

Merck Manual. Professional ed., Merck & Co. Inc., New Jersey, USA., (no

paging).

Demite, P. R. and R. J. F. Feres. 2007. Occurrence and fluctuation of mite

populations associated with rubber tree crop neighbor of fragments of

cerrado. Neotrop. Entomol., 36 (1): 117-127.

Denessiouk, K., S. Permyakov, A. Denesyuk, E. Permyakov and M. S. Johnson.

2014. Two structural motifs within canonical EF-hand calcium-binding

domains identify five different classes of calcium buffers and sensors. PloS

One, 9 (10): e109287.

Derewenda, U., J. Li, Z. Derewenda, Z. Dauter, G. A. Mueller, G. S. Rule and D. C.

Benjamin. 2002. The crystal structure of a major dust mite allergen Der p 2,

and its biological implications. J. Mol. Biol., 318 (1): 189-197.

Dilworth, R., K. Chua and W. Thomas. 1991. Sequence analysis of cDNA coding

for a major house dust mite allergen, Der f I. Clin. Exp. Allergy, 21 (1): 25-

32.

Dixit, I. P. 1973. Dust-mite urticaria. Practitioner, 210 (259): 664.

Dombrowicz, D. and M. Capron. 2001. Eosinophils, allergy and parasites. Curr.

156

Opin. Immunol., 13 (6): 716-720.

Dougall, A., D. C. Holt, K. Fischer, B. J. Currie, D. J. Kemp and S. F. Walton. 2005.

Identification and characterization of Sarcoptes scabiei and

Dermatophagoides pteronyssinus glutathione S-transferases: implication as

a potential major allergen in crusted scabies. Am. J. Trop. Med. Hyg., 73 (5):

977-984.

Dreborg, S. and R. Einarsson. 1992. The major allergen content of allergenic

preparations reflects their biological activity. Allergy, 47 (4): 418-423.

Dumez, M. E., J. Herman, V. Campizi, M. Galleni, A. Jacquet and A. Chevigné.

2014. Orchestration of an uncommon maturation cascade of the house dust

mite protease allergen quartet. Front. Immunol., 5: 138.

Dusbabek, F. 1974. Population structure and dynamics of the house dust mite

Dermatophagoides farinae (Acarina: Pyroglyphidae) in Czechoslovakia.

Folia Parasitol., 22 (3): 219-231.

Dusbabek, F. 1979. Dynamics and structure of mixed populations of

Dermatophagoides farinae and D. pteronyssinus. Rec. Adv. Acarology, 2:

173-177.

Dutau, G. 2002. House dust mites: new food allergens. Rev. Fr. Allergol., 42 (2):

171-177.

Ebner, C., H. Feldner, H. Ebner and D. Kraft. 1994. Sensitization to storage mites in

house dust mite (Dermatophagoides pteronyssinus) allergic patients.

Comparison of a rural and an urban population. Clin. Exp. Allergy, 24 (4):

347-352.

Edney, E. B. 1977. Water balance in land arthropods. Springer-Verlag, New York:

1-289.

Edrees, N. O. 2014. The impact of using pistacia lentiscus and raw boswellia

157

carteriiwidely spread at the popular level for incensing on minimizing HDM

population density. Life Sci. J., 11 (9): 644-655.

Edston, E. and M. van Hage-Hamsten. 2003. Death in anaphylaxis in a man with

house dust mite allergy. Int. J. Legal Med., 117 (5): 299-301.

El Sharif, N., J. Douwes, P. H. M. Hoet, G. Doekes and B. Nemery. 2004.

Concentrations of domestic mite and pet allergens and endotoxin in Palestine.

Allergy, 59 (6): 623-631.

Ellis, A. K. and J. H. Day. 2003. Diagnosis and management of anaphylaxis. Can.

Med. Assoc. J., 169 (4): 307-312.

Emson, C. L., S. E. Bell, A. Jones, W. Wisden and A. N. McKenzie. 1998.

Interleukin (IL)-4–independent induction of immunoglobulin (Ig) E, and

perturbation of T cell development in transgenic mice expressing IL-13. J.

Exp. Med., 188 (2): 399-404.

Epton, M. J., R. J. Dilworth, W. Smith, B. J. Hart and W. R. Thomas. 1999. High-

molecular-weight allergens of the house dust mite: an apolipophorin-like

cDNA has sequence identity with the major M-177 allergen and the IgE-

binding peptide fragments Mag1 and Mag3. Int. Arch. Allergy Immunol., 120

(3): 185-191.

Epton, M. J., R. J. Dilworth, W. Smith and W. R. Thomas. 2001. Sensitisation to the

lipid-binding apolipophorin allergen Der p 14 and the peptide Mag-1. Int.

Arch. Allergy Immunol., 124 (1-3): 57-60.

Epton, M. J., W. Smith, B. J. Hales, L. Hazell, P. J. Thompson and W. R. Thomas.

2002. Non-allergenic antigen in allergic sensitization: responses to the mite

ferritin heavy chain antigen by allergic and non-allergic subjects. Clin. Exp.

Allergy, 32 (9): 1341-1347.

Eraso, E., J. Martinez, P. Garcia-Ortega, A. Martinez, R. Palacios, R. Cisterna and J.

158

A. Guisantes. 1998. Influence of mite growth culture phases on the biological

standardization of allergenic extracts. J. Investig. Allergol. Clin. Immunol., 8

(4): 201-206.

Eraso, E., J. Martinez, A. Martinez, R. Palacios and J. A. Guisantes. 1997. Quality

parameters for the production of mite extracts. Allergol. Immunopathol.

(Madr), 25 (3): 113-117.

Erben, A. M., J. L. Rodriguez, J. McCullough and D. R. Ownby. 1993. Anaphylaxis

after ingestion of beignets contaminated with Dermatophagoides farinae. J.

Allergy Clin. Immunol., 92 (6): 846-849.

Eriksson, T. L., O. Rasool, S. Huecas, P. Whitley, R. Crameri, U. Appenzeller, G.

Gafvelin and M. van Hage-Hamsten. 2001. Cloning of three new allergens

from the dust mite Lepidoglyphus destructor using phage surface display

technology. Eur. J. Biochem., 268 (2): 287-294.

Essig, A., H. Rinder, R. Gothe and M. Zahler. 1999. Genetic differentiation of mites

of the genus Chorioptes (Acari: Psoroptidae). Exp. Appl. Acarol., 23 (4): 309-

318.

Evans, L. 1992. Application of pharmacological principles to benzodiazepine

therapy. Drug Alcohol Rev., 11 (4): 389-392.

Fain, A. 1965. Les acariens nidicoles et detriticoles de la famille Pyroglyphidae

Cunliffe. Rev. Zool. Bot. Afr., 72 (276): 1055-1067.

Fain, A. 1966. Further description of Dermatophagoides pteronyssinus (Trouessart,

1897). Importance of this arachnid in human pathology (Psoroptidae:

Sarcoptiformae). Acarologia, 8 (2): 302-327.

Fain, A. and W. Atyeo. 1990. A new pyroglyphid mite (Acari: Pyroglyphidae) from

a woodpecker (Picidae) in Thailand. Acarologia, 31 (1): 43-50.

Fain, A., B. Guerin and B. J. Hart. 1990. Mites and Allergic Disease. France:

159

Allerbio, Varennes-en-Argonne. France, p.190.

Faraji, F. and F. Bakker. 2008. A modified method for clearing, staining and

mounting plant-inhabiting mites. Eur. J. Entomol., 105: 793-795.

Feldman-Muhsam, B., Y. Mumcuoglu and T. Osterovich. 1985. A survey of house

dust mites (Acari: Pyroglyphidae and Cheyletidae) in Israel. J. Med.

Entomol., 22 (6): 663-669.

Fereidouni, M., F. Fereidouni, M. Hadian, M. Mazandarani and M. Ziaee. 2013.

Evaluation of the level of house dust mite allergens, Der p 1 and Der f 1 in

Iranian homes, a nationwide study. Allergol. Immunopathol. (Madr), 41 (6):

381-386.

Fernández-Caldas, E., R. W. Fox, G. A. Bucholtz, W. L. Trudeau, D. K. Ledford and

R. F. Lockey. 1990. House dust mite allergy in Florida. Mite survey in

households of mite-sensitive individuals in Tampa, Florida. Allergy Asthma

Proc., 263-267.

Fernandez-Caldas, E., L. Puerta, D. Mercado, R. Lockey and L. Caraballo. 1993.

Mite fauna, Der p I, Der f I and Blomia tropicalis allergen levels in a tropical

environment. Clin. Exp. Allergy, 23 (4): 292-297.

Ferreira, F., K. Hirtenlehner, A. Jilek, J. Godnik-Cvar, H. Breiteneder, R. Grimm, K.

Hoffmann-Sommergruber, O. Scheiner, D. Kraft, M. Breitenbach, H. J.

Rheinberger and C. Ebner. 1996. Dissection of immunoglobulin E and T

lymphocyte reactivity of isoforms of the major birch pollen allergen Bet v 1:

potential use of hypoallergenic isoforms for immunotherapy. J. Exp. Med.,

183 (2): 599-609.

Finkelman, F., I. Katona, J. Urban, J. Holmes, J. Ohara, A. Tung, J. Sample and W.

Paul. 1988. IL-4 is required to generate and sustain in vivo IgE responses. J.

Immunol., 141 (7): 2335-2341.

160

Fleming, D. and D. Crombie. 1987. Prevalence of asthma and hay fever in England

and Wales. Br. Med. J. (Clin. Res. Ed.), 294 (6567): 279-283.

Flohr, C., S. Johansson, C. F. Wahlgren and H. Williams. 2004. How atopic is atopic

dermatitis? J. Allergy Clin. Immunol., 114 (1): 150-158.

Franjola, R. and D. Rosinelli. 1999. Housedust mites in Punta Arenas city, Chile.

Bol. Chil. Parasitol., 54 (3-4): 82-88.

Fuiano, N. and C. Incorvaia. 2012. Dissecting the causes of atopic dermatitis in

children: less foods, more mites. Allergol. Int., 61 (2): 231-243.

Fujikawa, A., N. Ishimaru, A. Seto, H. Yamada, T. Aki, S. Shigeta, T. Wada, T. Jyo,

Y. Murooka, S. Oka and K. Ono. 1996. Cloning and characterization of a new

allergen, Mag 3, from the house dust mite, Dermatophagoides farinae: cross-

reactivity with high-molecular-weight allergen. Mol. Immunol., 33 (3): 311-

319.

Gabriel, M., A. M. Cunnington, W. G. Allan, C. A. Pickering and D. G. Wraith.

1982. Mite allergy in Hong Kong. Clin. Allergy, 12 (2): 157-171.

Gafvelin, G., E. Johansson, A. Lundin, A. M. Smith, M. D. Chapman, D. C.

Benjamin, U. Derewenda and M. van Hage-Hamsten. 2001. Cross-reactivity

studies of a new group 2 allergen from the dust mite Glycyphagus domesticus,

Gly d 2, and group 2 allergens from Dermatophagoides pteronyssinus,

Lepidoglyphus destructor, and Tyrophagus putrescentiae with recombinant

allergens. J. Allergy Clin. Immunol., 107 (3): 511-518.

Galassi, C., M. De Sario, A. Biggeri, L. Bisanti, E. Chellini, G. Ciccone, M. G.

Petronio, S. Piffer, P. Sestini and F. Rusconi. 2006. Changes in prevalence of

asthma and allergies among children and adolescents in Italy: 1994–2002.

Pediatrics, 117 (1): 34-42.

Gao, Z., C. H. Tseng, Z. Pei and M. J. Blaser. 2007. Molecular analysis of human

161

forearm superficial skin bacterial biota. Proc. Natl. Acad. Sci. USA., 104 (8):

2927-2932.

Gifford, J., M. Walsh and H. Vogel. 2007. Structures and metal-ion-binding

properties of the Ca2+-binding helix-loop-helix EF-hand motifs. Biochem.

J., 405: 199-221.

Goh, D. Y., F. T. Chew, S. C. Quek and B. W. Lee. 1996. Prevalence and severity

of asthma, rhinitis, and eczema in Singapore schoolchildren. Arch. Dis.

Child., 74 (2): 131-135.

Golden, D. B. 2000. Stinging insect vaccines: patient selection and administration of

Hymenoptera venom immunotherapy. Immunol. Allergy Clin. North Am., 20

(3): 553-570.

Gorstein, J., K. Sullivan, I. Parvanta and F. Begin. 2007. Indicators and methods for

cross-sectional surveys of vitamin and mineral status of populations. Atlanta

(GA): Micronutrient Initiative (Ottawa) and the Centers for Disease Control.

www.who.int/vmnis/toolkit/mcn-micronutrient-surveys.pdf.

Gotoh, T., J. Gutierrez and M. Navajas. 1998. Molecular comparison of the sibling

species Tetranychus pueraricola Ehara et Gotoh and T. urticae Koch (Acari:

Tetranychidae). Entomol. Sci., 1 (1): 55-57.

Grandjean, F. 1937. Otodectes cynotis (Hering) et les prétendues trachées des

Acaridiae. Bull. soc. zool. Fr., 62: 280-290.

Green, W. F., A. J. Woolcock, M. Stuckey, C. Sedgwick and S. R. Leeder. 1986.

House dust mites and skin tests in different Australian localities. Aust. N. Z.

J. Med., 16 (5): 639-643.

Griffith, I. J., S. Craig, J. Pollock, X. B. Yu, J. P. Morgenstern and B. L. Rogers.

1992. Expression and genomic structure of the genes encoding FdI, the major

allergen from the domestic cat. Gene, 113 (2): 263-268.

162

Guerin, B., D. A. Levy, J. Lemao, F. Leynadier, G. Baligadoo, A. Fain and J. Dry.

1992. The house dust mite Dermatophagoides pteronyssinus is the most

important allergen on the island of Mauritius. Clin. Exp. Allergy, 22 (5): 533-

539.

Guerra, S., D. L. Sherrill, F. D. Martinez and R. A. Barbee. 2002. Rhinitis as an

independent risk factor for adult-onset asthma. J. Allergy Clin. Immunol.,

109 (3): 419-425.

Hagan, L. L., D. W. Goetz, C. H. Revercomb and J. Garriott. 1998. Sudden infant

death syndrome: a search for allergen hypersensitivity. Ann. Allergy Asthma

Immunol., 80 (3): 227-231.

Hales, B. J., L. A. Hazell, W. Smith and W. R. Thomas. 2002. Genetic variation of

Der p 2 allergens: effects on T cell responses and immunoglobulin E binding.

Clin. Exp. Allergy, 32 (10): 1461-1467.

Hallas, T. E., D. Gislason, U. S. Björnsdottir, K. B. Jörundsdottir, C. Janson, C. M.

Luczynska and T. Gislason. 2004. Sensitization to house dust mites in

Reykjavik, Iceland, in the absence of domestic exposure to mites. Allergy, 59

(5): 515-519.

Halmai, Z. 1984. Changes in the composition of house-dust mite fauna in Hungary.

Parasitologia Hungarica, 17: 59-70.

Hannaway, P. J. and C. Roundy. 1997. Distribution of Dermatophagoides spp., D.

farinae and D. pteronyssinus, antigen in homes of patients with asthma in

eastern Massachusetts. Allergy Asthma Proc., 18 (3): 177-180.

Harris, T. K., R. N. Cole, F. I. Comer and A. S. Mildvan. 1998. Proton transfer in the

mechanism of triosephosphate isomerase. Biochemistry, 37 (47): 16828-

16838.

Harrop, J., S. Chinn, G. Verlato, M. Olivieri, D. Norbäck, M. Wjst, C. Janson, J. P.

163

Zock, B. Leynaert, D. Gislason, M. Ponzio, S. Villani, A. Carosso, C. Svanes,

J. Heinrich and D. Jarvis. 2007. Eczema, atopy and allergen exposure in

adults: a population-based study. Clin. Exp. Allergy, 37 (4): 526-535.

Hart, B. 1998. Life cycle and reproduction of house‐dust mites: environmental

factors influencing mite populations. Allergy, 53 (48S): 13-17.

Hart, B. and L. Whitehead. 1990. Ecology of house dust mites in Oxfordshire. Clin.

Exp. Allergy, 20 (2): 203-209.

Heinzerling, L., A. Mari, K. C. Bergmann, M. Bresciani, G. Burbach, U. Darsow, S.

Durham, W. Fokkens, M. Gjomarkaj and T. Haahtela. 2013. The skin prick

test-European standards. Clin. Transl. Allergy, 3 (1): 3.

Henszel, L., E. Kalisinska, D. Kosik-Bogacka and W. Kuzna-Grygiel. 2010. Mites

in dust samples collected from sleeping places in apartments. Pol. J. Environ.

Stud., 19 (4): 723-730.

Hewitt, C., A. P. Brown, B. Hart and D. I. Pritchard. 1995. A major house dust mite

allergen disrupts the immunoglobulin E network by selectively cleaving

CD23: innate protection by antiproteases. J. Exp. Med., 182 (5): 1537-1544.

Heymann, P. W., M. D. Chapman, R. C. Aalberse, J. W. Fox and T. A. Platts-Mills.

1989. Antigenic and structural analysis of group II allergens (Der f II and Der

p II) from house dust mites (Dermatophagoides spp). J. Allergy Clin.

Immunol., 83 (6): 1055-1067.

Hillis, D. M. and M. T. Dixon. 1991. Ribosomal DNA: molecular evolution and

phylogenetic inference. Q. Rev. Biol.: 411-453.

Hirsch, T., U. Range, K. Walther, B. Hederer, S. Lassig, G. Frey and W. Leupold.

1998. Prevalence and determinants of house dust mite allergen in East

German homes. Clin. Exp. Allergy, 28 (8): 956-964.

Ho, T. and M. Nadchatram. 1985. Distribution of Dermatophagoides pteronyssinus

164

(Astigmata: Pyroglyphidae) in Cameron Highlands, Malaysia. Trop.

Biomed., 2: 54-58.

Holt, D. C., K. Fischer, G. E. Allen, D. Wilson, P. Wilson, R. Slade, B. J. Currie, S.

F. Walton and D. J. Kemp. 2003. Mechanisms for a novel immune evasion

strategy in the scabies mite sarcoptes scabiei: a multigene family of

inactivated serine proteases. J. Invest. Dermatol., 121 (6): 1419-1424.

Holt, D. C., K. Fischer, S. J. Pizzutto, B. J. Currie, S. F. Walton and D. J. Kemp.

2004. A multigene family of inactivated cysteine proteases in Sarcoptes

scabiei. J. Invest. Dermatol., 123 (1): 240-241.

Holt, P. G., P. D. Sly and B. Bjorksten. 1997. Atopic versus infectious diseases in

childhood: a question of balance? Pediatr. Allergy Immunol., 8 (2): 53-58.

Hopkin, J. M. 2002. The rise of atopy and links to infection. Allergy, 57 (72S): 5-9.

Hoppe, S., H. Steinhart and A. Paschke. 2006. Identification of a 28 kDa lychee

allergen as a triose-phosphate isomerase. Food Agric. Immunol., 17 (1): 9-

19.

Horák, B. 1987. Preliminary study on the concentration and species composition of

bacteria, fungi and mites in samples of house dust from Silesia (Poland).

Allergol. Immunopathol. (Madr), 15 (3): 161-166.

Htut, T., D. W. Nyunt and S. Mitchell. 1991. A study of the mite fauna in the homes

of asthmatics with positive skin tests for Dermatophagoides pteronyssinus in

Burma. Int. J. Environ. Health Res., 1 (2): 117-122.

Huang, C., L. Liew, K. Mah, I. Kuo, B. Lee and K. Chua. 2006. Characterization of

glutathione S‐transferase from dust mite, Der p 8 and its immunoglobulin E

cross‐reactivity with cockroach glutathione S‐transferase. Clin. Exp. Allergy,

36 (3): 369-376.

Hunponu-Wusu, O. O. and A. O. Somorin. 1978. Epidemiological aspects of house

165

dust allergy in Nigeria. J. Dermatol., 5 (1): 27-32.

Hurtado, I. and M. Parini. 1987. House dust mites in Caracas, Venezuela. Ann.

Allergy, 59 (2): 128-130.

Huss, K., N. F. Adkinson, P. A. Eggleston, C. Dawson, M. L. Van Natta and R. G.

Hamilton. 2001. House dust mite and cockroach exposure are strong risk

factors for positive allergy skin test responses in the Childhood Asthma

Management Program. J. Allergy Clin. Immunol., 107 (1): 48-54.

Ichikawa, S., T. Takai, T. Inoue, T. Yuuki, Y. Okumura, K. Ogura, F. Inagaki and

H. Hatanaka. 2005. NMR study on the major mite allergen Der f 2: its refined

tertiary structure, epitopes for monoclonal antibodies and characteristics

shared by ML protein group members. J. Biochem., 137 (3): 255-263.

Ingham, P. E. and D. M. Ingham. 1976. House dust mites and infant-use sheepskins.

Med. J. Aust., 1 (10): 302-304.

Ishii, A., M. Takaoka, M. Ichinoe, Y. Kabasawa and T. Ouchi. 1979. Mite fauna and

fungal flora in house dust from homes of asthmatic children. Allergy, 34 (6):

379-387.

Jacquet, A. 2011. The role of the house dust mite-induced innate immunity in

development of allergic response. Int. Arch. Allergy Immunol., 155 (2): 95-

105.

Jalil, S. and R. A. Bajwa. 2014. Allergic rhinitis pattern of allergen sensitivity. Pak.

J. Med. Health Sci., 8 (4): 922-925.

Janeway, C. A., P. Travers, M. Walport and M. J. Shlomchik. 2001. Immunobiology:

The immune system in health and disease (5th ed.). New York: Garland

Science. http://www.ncbi.nlm.nih.gov/books/NBK10757/

Jeong, K., I. Y. Lee, T. S. Yong, J. H. Lee, E. J. Kim, J. S. Lee, C. S. Hong and J.

W. Park. 2012. Sequence polymorphisms of Der f 1, Der p 1, Der f 2 and Der

166

p 2 from Korean house dust mite isolates. Exp. Appl. Acarol., 58 (1): 35-42.

Jeong, K. Y., C. S. Hong and T. S. Yong. 2006. Allergenic tropomyosins and their

cross-reactivities. Protein Pept. Lett., 13 (8): 835-845.

Jeong, K. Y., C. Kim and T. S. Yong. 2010. Enzymatic activities of allergen extracts

from three species of dust mites and cockroaches commonly found in Korean

home. Korean J. Parasitol., 48 (2): 151-155.

Jiang, C., X. Fan, M. Li, P. Xing, X. Liu, Y. Wu, M. Zhang, P. Yang and Z. Liu.

2015. Characterization of Der f 29, a new allergen from Dermatophagoides

farinae. Am. J. Transl. Res., 7(7): 1303–1313.

Johannessen, B. R., L. K. Skov, J. S. Kastrup, O. Kristensen, C. Bolwig, J. N. Larsen,

M. Spangfort, K. Lund and M. Gajhede. 2005. Structure of the house dust

mite allergen Der f 2: implications for function and molecular basis of IgE

cross-reactivity. FEBS Lett., 579 (5): 1208-1212.

Johansson, S., T. Bieber, R. Dahl, P. S. Friedmann, B. Q. Lanier, R. F. Lockey, C.

Motala, J. A. O. Martell, T. A. Platts-Mills and J. Ring. 2004. Revised

nomenclature for allergy for global use: report of the nomenclature review

committee of the World Allergy Organization, October 2003. J. Allergy Clin.

Immunol., 113 (5): 832-836.

Johansson, S. G., J. O. Hourihane, J. Bousquet, C. Bruijnzeel-Koomen, S. Dreborg,

T. Haahtela, M. L. Kowalski, N. Mygind, J. Ring, P. van Cauwenberge, M.

van Hage-Hamsten and B. Wüthrich. 2001. A revised nomenclature for

allergy. An EAACI position statement from the EAACI nomenclature task

force. Allergy, 56 (9): 813-824.

Julge, K., A. K. Munir, M. Vasar and B. Björkstén. 1998. Indoor allergen levels and

other environmental risk factors for sensitization in Estonian homes. Allergy,

53 (4): 388-393.

167

Kaliner, M., P. A. Eggleston and K. P. Mathews. 1987. Rhinitis and asthma. Jama,

258 (20): 2851-2873.

Kalpaklioglu, A., M. Emekçi, A. Ferizli and Z. Misirligil. 2004. A survey of

acarofauna in Turkey: comparison of seven different geographic regions.

Allergy Asthma Proc., 25(3):185-90.

Kalpaklioglu, A., M. Emekçi, A. G. Ferizli and Z. Misirligil. 1997. House dust mite

fauna in Turkey. J. Investig. Allergol. Clin. Immunol., 7 (6): 578-582.

Kampen, H., A. Sternberg, J. Proft, S. Bastian, F. Schaffner, W. A. Maier and H. M.

Seitz. 2003. Polymerase chain reaction–based differentiation of the mosquito

sibling species Anopheles claviger ss and Anopheles petragnani (Diptera:

Culicidae). Am. J. Trop. Med. Hyg., 69 (2): 195-199.

Kang, S., B. Choi, H. Moon, K. Min and Y. Kim. 1984. The prevalence of immediate

skin reactions in patients with respiratory allergies. Allergy, 4: 49-56.

Kang, S. J., K. H. Kim and S. H. Kim. 1991. A study on type 1 allergy to house dust

mite in patients with atopic dermatitis. Korean J. Dermatol., 29 (3): 285-291.

Karg, W. 1973. House dust mites in the German Democratic Republic. Allerg.

Immunol., 19 (1): 81-85.

Kari, O. and K. M. Saari. 2010. Updates in the treatment of ocular allergies. J.

Asthma Allergy, 3: 149-158.

Katelaris, C. 2003. Ocular allergy: implications for the clinical immunologist. Ann.

Allergy Asthma Immunol., 90 (6): 23-27.

Katelaris, C., A. Mir, M. Raza, S. Abbas, A. Singh and M. Hasnain. 2007.

Aerobiology of Islamabad. [Abstract]. World Allergy Organ. J., S258-S259.

Kauffman, H. F., M. Tamm, J. A. B. Timmerman and P. Borger. 2006. House dust

mite major allergens Der p 1 and Der p 5 activate human airway-derived

epithelial cells by protease-dependent and protease-independent

168

mechanisms. Clin. Mol. Allergy, 4 (1): 1-8.

Kawamoto, S., T. Aki, M. Yamashita, A. Tategaki, T. Fujimura, S. Tsuboi, T.

Katsutani, O. Suzuki, S. Shigeta and Y. Murooka. 2002a. Toward elucidating

the full spectrum of mite allergens - state of the art. J. Biosci. Bioeng., 94 (4):

285-298.

Kawamoto, S., T. Suzuki, T. Aki, T. Katsutani, S. Tsuboi, S. Shigeta and K. Ono.

2002b. Der f 16: a novel gelsolin-related molecule identified as an allergen

from the house dust mite, Dermatophagoides farinae. FEBS Lett., 516 (1):

234-238.

Kay, A. B. 2000. Overview of allergy and allergic diseases: with a view to the future.

Br. Med. Bull., 56 (4): 843-864.

Kemeny, D. M., R. Urbanek, P. Ewan, S. McHugh, D. Richards, S. Patel and M. H.

Lessof. 1989. The subclass of IgG antibody in allergic disease: II. The IgG

subclass of antibodies produced following natural exposure to dust mite and

grass pollen in atopic and non-atopic individuals. Clin. Exp. Allergy, 19 (5):

545-549.

Kent, N. A., M. R. Hill, J. N. Keen, P. W. Holland and B. J. Hart. 1992. Molecular

characterisation of group I allergen Eur m I from house dust mite

Euroglyphus maynei. Int. Arch. Allergy Immunol., 99 (1): 150-152.

Kerkhof, M., D. Postma, J. Schouten and J. de Monchy. 2003. Allergic sensitization

to indoor and outdoor allergens and relevance to bronchial

hyperresponsiveness in younger and older subjects. Allergy, 58 (12): 1261-

1267.

Kern, R. 1921. Dust sensitization in bronchial asthma. Med. Clin. North Am., 5: 751-

758.

Khemili, S., J. M. Kwasigroch, T. Hamadouche and D. Gilis. 2012. Modelling and

169

bioinformatics analysis of the dimeric structure of house dust mite allergens

from families 5 and 21: Der f 5 could dimerize as Der p 5. J. Biomol. Struct.

Dyn., 29 (4): 663-675.

Kilpeläinen, M., E. Terho, H. Helenius and M. Koskenvuo. 2001. Home dampness,

current allergic diseases, and respiratory infections among young adults.

Thorax, 56 (6): 462-467.

Kim, S. S., H. D. Bang, K. H. Kim and K. J. Kim. 2003. Evaluation of Pharmacia

CAP system FEIA for house dust mites in patients with atopic dermatitis.

Korean J. Dermatol., 41 (11): 1455-1462.

Kinet, J. P. 1999. The high-affinity IgE receptor (FcεRI): from physiology to

pathology. Annu. Rev. Immunol., 17 (1): 931-972.

King, C., R. J. Simpson, R. L. Moritz, G. E. Reed, P. J. Thompson and G. A. Stewart.

1996. The isolation and characterization of a novel collagenolytic serine

protease allergen (Der p 9) from the dust mite Dermatophagoides

pteronyssinus. J. Allergy Clin. Immunol., 98 (4): 739-747.

King, T. P., D. Hoffman, H. Lowenstein, D. G. Marsh, T. A. Platts-Mills and W.

Thomas. 1994. Allergen nomenclature. WHO/IUIS Allergen Nomenclature

Subcommittee. Int. Arch. Allergy Immunol., 105 (3): 224-233.

Kivity, S., A. Solomon, R. Soferman, Y. Schwarz, K. Y. Mumcuoglu and M.

Topilsky. 1993. Mite asthma in childhood: a study of the relationship

between exposure to house dust mites and disease activity. J. Allergy Clin.

Immunol., 91 (4): 844-849.

Klein, B. S., M. F. Rogers, L. A. Patrican, M. C. White, W. Burgdorfer, W. L. Schell,

R. L. Kochel, N. J. Marchette, J. T. McPherson and D. B. Nelson. 1986.

Kawasaki syndrome: a controlled study of an outbreak in Wisconsin. Am. J.

Epidemiol., 124 (2): 306-316.

170

Klimov, P. B and B. M. O’Connor. 2013. Is permanent parasitism reversible?-critical

evidence from early evolution of house dust mites. Syst. Biol., 62 (3): 411-

423.

Klimov, P. B. and B. M. O’Connor. 2008. Origin and higher-level relationships of

psoroptidian mites (Acari: Astigmata: Psoroptidia): evidence from three

nuclear genes. Mol. Phylogen. Evol., 47 (3): 1135-1156.

Knapp, M., B. Wagener and M. Navajas. 2003. Molecular discrimination between

the spider mite Tetranychus evansi Baker & Pritchard, an important pest of

tomatoes in southern Africa, and the closely related species T. urticae Koch

(Acarina: Tetranychidae). Afr. Entomol., 11 (2): 300-304.

Knülle, W. and G. W. Wharton. 1964. Equilibrium humidities in arthropods and their

ecological significance. Proc. 1st Int. Cong. Acarol., Fort Collins, USA., pp.

299-306.

Kogevinas, M., J. Anto, A. Tobias, J. Alonso, J. Soriano, E. Almar, N. Muniozguren,

F. Payo, A. Pereira and J. Sunyer. 1998. Respiratory symptoms, lung function

and use of health services among unemployed young adults in Spain. Spanish

Group of the European Community Respiratory Health Survey. Eur. Respir.

J., 11 (6): 1363-1368.

Konstantinou, G. N., P. J. Bousquet, T. Zuberbier and N. G. Papadopoulos. 2009.

The longest wheal diameter is the optimal measurement for the evaluation of

skin prick tests. Int. Arch. Allergy Immunol., 151 (4): 343-345.

Korsgaard, J. 1979. Housedust mites (Pyroglyphidae, Acari) in Danish homes.

Ugeskr. Laeg., 141 (13): 888-892.

Korsgaard, J. 1998. Epidemiology of house-dust mites. Allergy, 53: 36-40.

Krantz, G. W. 1978. A Manual of Acarology. 2nd ed., Oregon State University Book

Stores, Corvallis. USA, p. 509.

171

Kuljanac, I. 2006. The role of Dermatophagoides pteronyssinus in atopic dermatitis.

Acta Dermatovenerol Croat., 14 (2): 86-89.

Kurup, V. P., H. D. Shen and B. Banerjee. 2000. Respiratory fungal allergy. Microb.

Infect., 2 (9): 1101-1110.

Lake, F. R., L. D. Ward, R. J. Simpson, P. J. Thompson and G. A. Stewart. 1991.

House dust mite-derived amylase: allergenicity and physicochemical

characterization. J. Allergy Clin. Immunol., 87 (6): 1035-1042.

Lambrecht, B. N., R. A. Pauwels and B. Fazekas De St Groth. 2000. Induction of

rapid T cell activation, division, and recirculation by intratracheal injection

of dendritic cells in a TCR transgenic model. J. Immunol., 164: 2937-2946.

Lanfear, R., B. Calcott, S. Y. Ho and S. Guindon. 2012. Partitionfinder: combined

selection of partitioning schemes and substitution models for phylogenetic

analyses. Mol. Biol. Evol., 29 (6): 1695-1701.

Lang, D. M., M. B. Alpern, P. F. Visintainer and S. T. Smith. 1993. Elevated risk of

anaphylactoid reaction from radiographic contrast media is associated with

both ß-blocker exposure and cardiovascular disorders. Arch. Intern. Med.,

153 (17): 2033-2040.

Larson, D. G., W. F. Mitchell and G. W. Wharton. 1969. Preliminary studies on

Dermatophagoides farinae Hughes, 1961 (Acari) and house dust allergy. J.

Med. Entomol., 6 (3): 295-299.

Lassiter, M. T. and N. J. Fashing. 1990. House dust mites in Williamsburg, Virginia.

Virginia Med. J., 117 (4): 152-157.

Latreille, P. 1829. Les Crustacés, les Arachnides et Insectes, distribués en familles

naturelles. In: G. Cuvier (ed.), Le Règne Animal Distribué d'après son

Organisation, pour Servir de Base à l'Histoire Naturelle des Animaux et

d'Introduction à l'Anatomie Comparée. 2nd ed., Deterville, Paris, p. 584.

172

Lau, S., G. Falkenhorst, A. Weber, I. Werthmann, P. Lind, P. Buettner-Goetz and U.

Wahn. 1989. High mite-allergen exposure increases the risk of sensitization

in atopic children and young adults. J. Allergy Clin. Immunol., 84 (5 Pt 1):

718-725.

Lau, S., G. Schulz, C. Sommerfeld and U. Wahn. 2001. Comparison of quantitative

ELISA and semiquantitative Dustscreen for determination of Der p 1, Der f

1, and Fel d 1 in domestic dust samples. Allergy, 56 (10): 993-995.

Lee, A., P. Sangsupawanich, S. Ma, T. Tan, L. Shek, D. Goh, B. Ho, H. van Bever

and B. Lee. 2005. Endotoxin levels in rural Thai and urban Singaporean

homes. Int. Arch. Allergy Immunol., 141 (4): 396-400.

Lee, A. J., J. Machell, A. H. M. Van Den Broek, A. J. Nisbet, H. R. P. Miller, R. E.

Isaac and J. F. Huntley. 2002. Identification of an antigen from the sheep scab

mite, Psoroptes ovis, homologous with house dust mite group I allergens.

Parasite Immunol., 24 (8): 413-422.

Lee, C. S., L. C. Tsai, P. L. Chao, C. Y. Lin, M. W. Hung, A. I. Chien, Y. T. Chiang

and S. H. Han. 2004. Protein sequence analysis of a novel 103-kDa

Dermatophagoides pteronyssinus mite allergen and prevalence of serum

immunoglobulin E reactivity to rDer p 11 in allergic adult patients. Clin. Exp.

Allergy, 34 (3): 354-362.

Lee, Y. J., S. J. Han, H. Lee, J. S. Kim and K. Y. Seo. 2016. Development of Allergic

Conjunctivitis Induced by House Dust Mite Extract From Dermatophagoides

pteronyssinus. Invest. Ophthalmol. Vis. Sci., 57(4):1773-1781.

Leonardi, A., E. Bogacka, J. L. Fauquert, M. L. Kowalski, A. Groblewska, M.

Jedrzejczak-Czechowicz, S. Doan, F. Marmouz, P. Demoly and L. Delgado.

2012. Ocular allergy: recognizing and diagnosing hypersensitivity disorders

of the ocular surface. Allergy, 67 (11): 1327-1337.

173

Leonardi, G. S., D. Houthuijs, B. Nikiforov, J. Volf, P. Rudnai, J. Zejda, E. Gurzau,

E. Fabianova, T. Fletcher and B. Brunekreef. 2002. Respiratory symptoms,

bronchitis and asthma in children of Central and Eastern Europe. Eur. Respir.

J., 20 (4): 890-898.

Leuenberger, P., N. Kunzli, U. Ackermann-Liebrich, C. Schindler, G. Bolognini, J.

P. Bongard, O. Brandli, C. Defila, G. Domenighetti, W. Karrer, R. Keller, T.

Medici, C. Monn, A. P. Perruchoud, M. Schoni, J. M. Tschopp, B. Villiger,

B. Wuthrich and J. P. Zellweger. 1998. [Swiss Study on air pollution and lung

diseases in adults (SAPALDIA)]. Schweiz Med. Wschr., 128 (5): 150-161.

Leung, T., C. W. K. Lam, I. H. S. Chan, A. M. Li, G. Ha, N. L. S. Tang and T. Fok.

2002. Inhalant allergens as risk factors for the development and severity of

mild-to-moderate asthma in Hong Kong Chinese children. J. Asthma, 39 (4):

323-330.

Lieberman, P., C. A. Camargo, Jr., K. Bohlke, H. Jick, R. L. Miller, A. Sheikh and

F. E. Simons. 2006. Epidemiology of anaphylaxis: findings of the American

College of Allergy, Asthma and Immunology Epidemiology of Anaphylaxis

Working Group. Ann. Allergy Asthma Immunol., 97 (5): 596-602.

Lin J., M. Li, Y. Liu, C. Jiang, Y. Wu, Y. Wang, A. Gao, Z. Liu, P. Yang and X. Liu.

2016a. Expression, purification and characterization of Der f 27, a new

allergen from Dermatophagoides farinae. Am. J. Transl. Res., 8(5): 2468–

2470.

Lin, J., H. Wang, Li, M., Liang, Z., Jiang, C., Wu, Y., L. Zhigang, Y. Pingchang and

X. Liu. 2016b. Characterization and analysis of a cDNA coding for the group

29b (Der f 29b) allergen of Dermatophagoides farinae. Am. J. Transl. Res.,

8(2): 568–577.

Lin, K. L., K. H. Hsieh, W. R. Thomas, B. L. Chiang and K. Y. Chua. 1994.

174

Characterization of Der p V allergen, cDNA analysis, and IgE-mediated

reactivity to the recombinant protein. J. Allergy Clin. Immunol., 94 (6 Pt 1):

989-996.

Lind, P. 1986. Enzyme-linked immunosorbent assay for determination of major

excrement allergens of house dust mite species D. pteronyssinus, D. farinae

and D. microceras. Allergy, 41 (6): 442-451.

Lind, P., O. Hansen and N. Horn. 1988. The binding of mouse hybridoma and human

IgE antibodies to the major fecal allergen, Der p I, of Dermatophagoides

pteronyssinus. Relative binding site location and species specificity studied

by solid-phase inhibition assays with radiolabeled antigen. J. Immunol., 140

(12): 4256-4262.

Lipkowitz, M. A. and T. Navarra. 2001. The Encyclopedia of Allergies. In: Facts on

File, History of allergy and immunology. 2nd ed. New York, p. 167.

Liu, X. Y., Z. G. Liu, P. C. Yang, Y. L. Wu, L. H. Liu and X. Chen. 2014a. Cloning,

expression, purification and immunological activity of genes from

Dermatophagoides farinae. Retrieved May 18, 2015, from GenBank:

http://www.ncbi.nlm.nih.gov/protein/AIO08851.1

Liu, Z. G., Y. P. C., K. M. Ji, X. Y. Liu, Y. L. Wu and H. Y. He. 2014b. Cloning,

expression, purification and immunological activity of genes from

Dermatophagoides farinae. Retrieved May 18, 2015, from UniProt:

http://www.uniprot.org/uniprot/A0A088SV41.

Lonjou, C., K. Barnes, H. Chen, W. O. Cookson, K. A. Deichmann, I. Hall, J. W.

Holloway, T. Laitinen, L. J. Palmer and M. Wjst. 2000. A first trial of

retrospective collaboration for positional cloning in complex inheritance:

assay of the cytokine region on chromosome 5 by the consortium on asthma

genetics (COAG). Proc. Natl. Acad. Sci. U.S.A., 97 (20): 10942-10947.

175

Louadi, K. and P. Robaux. 1992. Etude des populations d'acariens pulvicoles dans

l'Est Algérien selon les gradients climatiques propres à cette région.

Acarologia, 33 (2): 177-191.

Lovik, M., P. Gaarder and R. Mehl. 1998. The house-dust mite: its biology and role

in allergy. A synopsis. Allergy, 53 (48S): 121-135.

Luo, W., C. Qiu, Z. Cai and K. Ji. 2016. Cloning and expression of ubiquinol-

cytochrome c reductase binding protein-like protein from the house dust mite,

Dermatophagoides pteronyssinus Der p 24. Unpublished, available at

https://www.ncbi.nlm.nih.gov/protein/922664427.

Macan, J., B. Kanceljak, D. Plavec and S. Milković-Kraus. 2003. Differences in mite

fauna between the continental and Mediterranean climates of Croatia:

microscopy and Dustscreen test findings. Allergy, 58 (8): 780-783.

Mahakittikun, V., S. Wongkamchai, M. Ahamad and P. Vichyanond. 2001. Killing

mites with heat. Allergy, 56 (3): 262-262.

Mahesh, P. A., P. A. Kushalappa, A. D. Holla and P. K. Vedanthan. 2005. House

dust mite sensitivity is a factor in chronic urticaria. Indian. J. Dermatol.

Venereol. Leprol., 71 (2): 99-101.

Makovcová, S., K. Samsinák and E. Vobrázková. 1982. Biological aspects of mites

in house dust and their importance in house dust allergy. I. Fysiatr. Revmatol.

Vestn., 60 (2): 69-74.

Malainual, N., P. Vichyanond and P. Phan-Urai. 1995. House dust mite fauna in

Thailand. Clin. Exp. Allergy, 25 (6): 554-560.

Mansfield, S. G., S. Cammer, S. C. Alexander, D. P. Muehleisen, R. S. Gray, A.

Tropsha and W. E. Bollenbacher. 1998. Molecular cloning and

characterization of an invertebrate cellular retinoic acid binding protein. Proc.

Natl. Acad. Sci. U.S.A., 95 (12): 6825-6830.

176

Marchler-Bauer, A. and S. H. Bryant. 2004. CD-Search: protein domain annotations

on the fly. Nucleic Acids Res., 32 (2S): W327-W331.

Mariana, A., T. M. Ho and S. K. Heah. 1996. Life-cycle, longevity and fecundity of

Blomia tropicalis (Acari: Glycyphagidae) in a tropical laboratory. Braz. J.

Med. Biol. Res., 27 (2): 392-395.

Mariana, A., T. M. Ho, M. Sofian-Azirun and A. L. Wong. 2000. House dust mite

fauna in the Klang Valley, Malaysia. Braz. J. Med. Biol. Res., 31 (4): 712-

721.

Marin, S. L., V. Iraola, S. Merle and E. Fernández-Caldas. 2006. Étude de la faune

acarologique des matelas de l'île de la Martinique. Rev. Fr. Allergol., 46 (2):

62-67.

Marraccini, P., L. Farioli, A. Pagani, L. Rossi, D. Russignaga and S. Parmiani. 2004.

Indoor allergens in office. Evaluation of the work station. G. Ital. Med. Lav.

Ergon., 26 (2): 97-101.

Massey, D. G., R. T. Furumizo, G. Fournier-Massey, D. Kwock and S. T. Harris.

1988. House dust mites in university dormitories. Ann. Allergy, 61 (3): 229-

232.

Mattsson, J. G. B., K. and Näslund, K. 1999. Molecular cloning and expression of a

major antigen from Sarcopes scabiei. 17th Int. Conf. World Assoc. Advan.

Vete. Parasitol., pp. 15-19.

Maunsell, K., D. G. Wraith and A. M. Cunnington. 1968. Mites and house-dust

allergy in bronchial asthma. Lancet, 1 (7555): 1267-1270.

Maurya, K., Z. Jamil and B. Dev. 1983. Prevalence of astigmatid mites (Acarina) in

the domestic environment of north-eastern and northern India. Biol. Mem.,

8: 207-215.

Mayor, S. 2002. Researchers identify gene associated with airways remodelling in

177

asthma. Br. Med. J. 325: 123

McCall, C., S. Hunter, K. Stedman, E. Weber, A. Hillier, C. Bozic, B. Rivoire and

T. Olivry. 2001. Characterization and cloning of a major high molecular

weight house dust mite allergen (Der f 15) for dogs. Vet. Immunol.

Immunopathol., 78 (3-4): 231-247.

McCormick, A., D. Fleming and J. Charlton. 1995. Morbidity Statistics from General

Practice: Fourth National Study 1991-1992. London, United Kingdom: Her

Majesty's Stationery Office., (no paging).

Medeiros Jr, M., J. P. Figueiredo, M. C. Almeida, A. M. Atta, E. A. Taketomi, D.

Silva, S. A. Terra, W. W. Amorim, R. S. Pinho and M. I. Araujo. 2002.

Association between mite allergen (Der p 1, Der f 1, Blo t 5) levels and

microscopic identification of mites or skin prick test results in asthmatic

subjects. Int. Arch. Allergy Immunol., 129 (3): 237-241.

Mehl, R. 1998. Occurrence of mites in Norway and the rest of Scandinavia. Allergy,

53 (48S): 28-35.

Meno, K., P. B. Thorsted, H. Ipsen, O. Kristensen, J. N. Larsen, M. D. Spangfort, M.

Gajhede and K. Lund. 2005. The crystal structure of recombinant proDer p

1, a major house dust mite proteolytic allergen. J. Immunol., 175 (6): 3835-

3845.

Micronutrient. 2011. Retrieved May, 29, 2011, from

http://micronutrient.org/nutritiontool kit/ModuleFolders/5.Sampling/tools/Sample_for_single_cluster_survey__persons_

per_HH.htm

Min, T. H., C. K. Hong, B. I. Ro and C. Y. Chang. 1987. Allergen prick test reactivity

in the patients with uriticaria and atopic dermatitis. Korean J. Dermatol., 25

(5): 587-598.

178

Miraglia Del Giudice, M., M. Pedulla, G. Piacentini, C. Capristo, F. Brunese, F.

Decimo, N. Maiello and A. Capristo. 2002. Atopy and house dust mite

sensitization as risk factors for asthma in children. Allergy, 57 (2): 169-172.

Miranda, R. J., D. A. Quintero and A. Almanza. 2002. House dust mites from urban

and rural houses on the lowland Pacific slopes of Panama. Syst. Appl.

Acarol., 7: 23-30.

Miyamoto, M. M., F. Kraus and O. A. Ryder. 1990. Phylogeny and evolution of

antlered deer determined from mitochondrial DNA sequences. Proc. Natl.

Acad. Sci. U.S.A., 87 (16): 6127-6131.

Miyamoto, T., S. Oshima, A. Domae, K. Takahashi and M. Izeki. 1970. Allergenic

potency of different house dusts in relation to contained mites. Ann. Allergy,

28 (9): 405-412.

Modak, A., G. Saha and D. Choudhuri. 1992. High altitude house dust mite fauna of

Kashmir Valley, India. Ann. Entomol. (India), 10: 43-46.

Moffatt, M. F. and W. O. Cookson. 1999. Genetics of asthma and inflammation: the

status. Curr. Opin. Immunol., 11 (6): 606-609.

Montealegre, F., A. Sepulveda, M. Bayona, C. Quiñones and E. Fernández-Caldas.

1997. Identification of the domestic mite fauna of Puerto Rico. P. R. Health

Sci. J., 16 (2): 109-116.

Monterroza, S. R., I. Herrera, A. C. Martinez, J. M. Navarro, L. Arroyo, D. L. Meza

and P. B. Tuiran. 2006. Rodríguez rivera mendoza and asma alérgica, niveles

de IgE total y exposición a los acaros del polvo casero en el municipo de

Santiago de Tolú. Duazary (Revista de la Facultad de Ciencias de Salud,

Universidad de Magdalena, Colombia), 3: 10-17.

Moorman, J. E., R. A. Rudd, C. A. Johnson, M. King, P. Minor, C. Bailey, M. R.

Scalia and L. J. Akinbami. 2007. National surveillance for asthma--United

179

States, 1980-2004. Morbidity and mortality weekly report. Surveillance

Summaries (Washington, D.C.: 2002), 56 (8): 1-54.

Mora, C., I. Flores, F. Montealegre and A. Díaz. 2003. Cloning and expression of

Blo t 1, a novel allergen from the dust mite Blomia tropicalis, homologous to

cysteine proteases. Clin. Exp. Allergy, 33 (1): 28-34.

Morsy, T., A. el Said, M. Salama, M. Arafa, T. Younis, D. Ragheb and R. M. Abdel.

1995. Four species of house dust mites recovered from houses of patients

with allergic respiratory diseases. J. Egypt Soc. Parasitol., 25 (1): 195-206.

Moscato, G., L. Perfetti, E. Galdi, V. Pozzi and C. Minoia. 2000. Levels of house-

dust-mite allergen in homes of nonallergic people in Pavia, Italy. Allergy, 55

(9): 873-878.

Mueller, G. A., D. C. Benjamin and G. S. Rule. 1998. Tertiary structure of the major

house dust mite allergen Der p 2: sequential and structural homologies.

Biochemistry, 37 (37): 12707-12714.

Mueller, G. A., T. A. Randall, J. Glesner, L. C. Pedersen, L. Perera, L. L. Edwards,

E. F. DeRose, M. D. Chapman, R. E. London and A. Pomés. 2016.

Serological, genomic and structural analyses of the major mite allergen Der

p 23. Clin. Exp. Allergy, (46): 365–376.

Mullen, G. and B. OConnor. 2002. Mites (Acari). In: G. Mullen & L. A. Durden

(eds.), Med. Vet. Entomol. Elsevier Science, USA., p. 449-516.

Mulvey, P. M. 1972. Cot death survey: anaphylaxis and the house dust mite. Med. J.

Aust., 2 (22): 1240-1244.

Mumcuoglu, K. Y., Y. Abed, B. Armenios, S. Shaheen, J. Jacobs, S. Bar-Sela and

E. Richter. 1994. Asthma in Gaza refugee camp children and its relationship

with house dust mites. Ann. Allergy, 72 (2): 163-166.

Mumcuoglu, K. Y., Z. Gat, T. Horowitz, J. Miller, R. Bar-Tana, A. Ben-Zvi and Y.

180

Naparstek. 1999. Abundance of house dust mites in relation to climate in

contrasting agricultural settlements in Israel. Med. Vet. Entomol., 13 (3):

252-258.

Mumcuoglu, Y. 1976. House dust mites in Switzerland. I. Distribution and

taxonomy. J. Med. Entomol., 13 (3): 361-373.

Mumcuoglu, Y. 1977. House dust mites in Switzerland. III. Allergenic properties of

the mites. Acta Allergol., 32 (5): 333-349.

Munir, A. K., B. Björkstén, R. Einarsson, A. Ekstrand-Tobin, C. Möller, A. Warner

and N. I. Kjellman. 1995. Mite allergens in relation to home conditions and

sensitization of asthmatic children from three climatic regions. Allergy, 50

(1): 55-64.

Munir, A. K., R. Einarsson and S. K. Dreborg. 1993. Vacuum cleaning decreases the

levels of mite allergens in house dust. Pediatr. Allergy Immunol., 4 (3): 136-

143.

Murray, A. B. and P. Zuk. 1979. The seasonal variation in a population of house dust

mites in a North American city. J. Allergy Clin. Immunol., 64 (4): 266-269.

Nabavizadeh, S. Hesamedin, Al-Yasin, Sohila. 2012. Distribution of allergans

among allergic rhinitis patient living in Shiraz (Iran) region. Asia Pac.

Allergy, 2(2):93-100.

Nadchatram, M., G. Fournier, B. L. Gordon and D. G. Massey. 1981. House dust

mites in Hawaii. Ann. Allergy, 46 (4): 197-200.

Naik, M. T., C. F. Chang, I. C. Kuo, C. C. H. Kung, F. C. Yi, K. Y. Chua and T. H.

Huang. 2008. Roles of structure and structural dynamics in the antibody

recognition of the allergen proteins: an NMR study on Blomia tropicalis

major allergen. Structure, 16 (1): 125-136.

Nakamura, R., R. Satoh, Y. Nakajima, N. Kawasaki, T. Yamaguchi, J. I. Sawada, H.

181

Nagoya and R. Teshima. 2009. Comparative study of GH-transgenic and

non-transgenic amago salmon (Oncorhynchus masou ishikawae)

allergenicity and proteomic analysis of amago salmon allergens. Regul.

Toxicol. Pharmacol., 55 (3): 300-308.

Nathanson, M. E. 1969. Arthropods and allergy. J. Asthma Res., 7 (2): 55-63.

Navajas, M. and B. Fenton. 2000. The application of molecular markers in the study

of diversity in acarology: a review. Exp. Appl. Acarol., 24 (10-11): 751-774.

Navajas, M., J. Gutierrez, M. Williams and T. Gotoh. 2001. Synonymy between two

spider mite species, Tetranychus kanzawai and T. hydrangeae (Acari:

Tetranychidae), shown by ribosomal ITS2 sequences and cross-breeding

experiments. Bull. Entomol. Res., 91 (02): 117-123.

Navajas, M., J. Lagnel, G. Fauvel and G. De Moraes. 1999. Sequence variation of

ribosomal internal transcribed spacers (ITS) in commercially important

Phytoseiidae mites. Exp. Appl. Acarol., 23 (11): 851-859.

Nayak, A. S. 2003. The asthma and allergic rhinitis link. Allergy Asthma Proc., 24

(6): 395-402.

Neffen, H. E., E. Fernández-Caldas, N. Predolini, W. L. Trudeau, M. E. Sánchez-

Guerra and R. F. Lockey. 1996. Mite sensitivity and exposure in the city of

Santa Fe, Argentina. J. Investig. Allergol. Clin. Immunol., 6 (5): 278-282.

Nelson, H. S. and E. Fernandez-Caldas. 1995. Prevalence of house dust mites in the

Rocky Mountain states. Ann. Allergy Asthma Immunol. , 75 (4): 337-339.

Nging Tan, T., D. Li‐Chern Lim, B. Wah Lee and H. P. Van Bever. 2005. Prevalence

of allergy‐related symptoms in Singaporean children in the second year of

life. Pediatr. Allergy Immunol., 16 (2): 151-156.

Nicolai, T. 1997. Asthma prevalence: lessons from the reunification of Germany.

Clin. Asthma Rev., 1: 1-6.

182

Nishiyama, C., T. Yasuhara, T. Yuuki and Y. Okumura. 1995. Cloning and

expression in Escherichia coli of cDNA encoding house dust mite allergen

Der f 3, serine protease from Dermatophagoides farinae. FEBS Lett., 377

(1): 62-66.

Nishiyama, C., T. Yuuki, T. Takai, Y. Okumura and H. Okudaira. 1993.

Determination of Three Disulfide Bonds in a Major House Dust Mite

Allergen, Der f ll. Int. Arch. Allergy Immunol., 101 (2): 159-166.

Nishiyama, C., T. Yuuki, Y. Usui, N. Iwamoto, Y. Okumura and H. Okudaira. 1994.

Effects of amino acid variations in recombinant Der fII on its human IgE and

mouse IgG recognition. Int. Arch. Allergy Immunol., 105 (1): 62-69.

Noferi, A., W. Serino, G. Sacerdoti and M. Blythe. 1974. Survey on concentration

and type of house dust mites (HDM) in dusts of specifically sensitized people

in Naples. Preliminary data. Folia Allergol. Immunol. Clin., 21: 466-469.

Noge, K., N. Mori, C. Tanaka, R. Nishida, M. Tsuda and Y. Kuwahara. 2005.

Identification of astigmatid mites using the second internal transcribed spacer

(ITS2) region and its application for phylogenetic study. Exp. Appl. Acarol.,

35 (1-2): 29-46.

O'Connor, B. M. 1982. Acari: Astigmata Synopsis and classification of living

organisms. In: S. P. Parker, (ed.), McGraw-Hill, New York, p. 146-169.

O'Neil, S., T. Heinrich, B. Hales, L. Hazell, D. Holt, K. Fischer and W. Thomas.

2006. The chitinase allergens Der p 15 and Der p 18 from Dermatophagoides

pteronyssinus. Clin. Exp. Allergy, 36 (6): 831-839.

O'Neill, G. M., G. R. Donovan and B. A. Baldo. 1994. Sequence analyses of the

native form of a major house dust mite allergen and its nascent polypeptide.

Mol. Immunol., 31 (18): 1447-1448.

Ohshima, Y., A. Yamada, M. Hiraoka, K. Katamura, S. Ito, T. Hirao, H. Akutagawa,

183

N. Kondo, A. Morikawa and M. Mayumi. 2002. Early sensitization to house

dust mite is a major risk factor for subsequent development of bronchial

asthma in Japanese infants with atopic dermatitis: results of a 4-year followup

study. Ann. Allergy Asthma Immunol., 89 (3): 265-270.

Olsson, H. H. Van, Whitley, Johansson, Hoffman, Gafvelin and Schmidt. 1998.

Expression of two isoforms of Lep d 2, the major allergen of Lepidoglyphus

destructor, in both prokaryotic and eukaryotic systems. Clin. Exp. Allergy,

28 (8): 984-991.

Ong, E. K., I. J. Griffith, R. B. Knox and M. B. Singh. 1993. Cloning of a cDNA

encoding a group-V (group-IX) allergen isoform from rye-grass pollen that

demonstrates specific antigenic immunoreactivity. Gene, 134 (2): 235-240.

Ono, E., M. Taniguchi, N. Higashi, H. Mita, K. Kajiwara, H. Yamaguchi, S. Tatsuno,

Y. Fukutomi, H. Tanimoto, K. Sekiya, C. Oshikata, T. Tsuburai, N.

Tsurikisawa, M. Otomo, Y. Maeda, M. Hasegawa, E. Miyazaki, T.

Kumamoto and K. Akiyama. 2010. CD203c expression on human basophils

is associated with asthma exacerbation. J. Allergy Clin. Immunol., 125 (2):

483-489. e483.

Osakabe, M., T. Hirose and M. Satô. 2002. Discrimination of four Japanese

Tetranychus species (Acari: Tetranychidae) using PCR-RFLP of the inter-

transcribed spacer region of nuclear ribosomal DNA. Appl. Entomol. Zool.,

37 (3): 399-407.

Oshima, Y. 1970. Clinical effect of disodium cromoglycate in bronchial asthma--

nationwide statistics in Japan. Arerugi, 19 (11): 835-841.

Ottoboni, F., P. Falagiani, E. Lorenzini, G. Più, A. Carluccio and S. Centanni. 1983.

Domestic Acari in Sardinia. Boll. Ist. Sieroter. Milan., 62 (4): 362-369.

Paik, Y., M. Takaoka, H. Matsuoka and A. Ishii. 1992. Mite fauna and mite antigen

184

in house dust from houses in Seoul, Korea. Jap. J. Sanit. Zool., 43 (1): 29-35.

Park, J., K. Kim, H. Jin, C. Kim, D. Kang, S. Choi, T. S. Yong, S. Oh and C. S.

Hong. 2002. Der p 2 isoallergens have different allergenicity, and

quantification with 2‐site ELISA using monoclonal antibodies is influenced

by the isoallergens. Clin. Exp. Allergy, 32 (7): 1042-1047.

Pastor, C., J. Cuesta-Herranz, B. Cases, M. Pérez-Gordo, E. Figueredo, M. De las

Heras and F. Vivanco. 2008. Identification of major allergens in watermelon.

Int. Arch. Allergy Immunol., 149 (4): 291-298.

Pauli, G., E. Quoix, G. Hedelin, J. C. Bessot, M. Ott and A. Dietemann. 1993. Mite

allergen content in mattress dust of Dermatophagoides-allergic

asthmatics/rhinitics and matched controls. Clin. Exp. Allergy, 23 (7): 606-

611.

Pawankar, R., M. Okuda, H. Yssel, K. Okumura and C. Ra. 1997. Nasal mast cells

in perennial allergic rhinitics exhibit increased expression of the Fc

epsilonRI, CD40L, IL-4, and IL-13, and can induce IgE synthesis in B cells.

J. Clin. Invest., 99 (7): 1492.

Pawankar, R., M. Sanchez-Borges and S. Bonini. 2013. Allergic rhinitis, allergic

conjunctivitis, and rhinosinusitis. World Allergy Organization (WAO) White

Book on Allergy. World Allergy Organ., London, p. 27-33.

Pearson, R. S. and A. M. Cunnington. 1973. The importance of mites in house dust

sensitivity in Barbadian asthmatics. Clin. Allergy, 3 (3): 299-306.

Peat, J. K., R. H. van den Berg, W. F. Green, C. M. Mellis, S. R. Leeder and A. J.

Woolcock. 1994. Changing prevalence of asthma in Australian children. Br.

Med. J. (Clin. Res. Ed.), 308 (6944): 1591-1596.

Pene, J., F. Rousset, F. Brière, I. Chrétien, J. Y. Bonnefoy, H. Spits, T. Yokota, N.

Arai, K.-l. Arai and J. Banchereau. 1988. IgE production by normal human

185

lymphocytes is induced by interleukin 4 and suppressed by interferons

gamma and alpha and prostaglandin E2. Proc. Natl. Acad. Sci. U.S.A., 85

(18): 6880-6884.

Percebois, G., A. M. Gallois and P. Denvis. 1972. Mise en évidence de

Dermatophagoides pteronyssinus dans des poussières de matelas en

Lorraine. Ann. Med. Nancy., 11: 79-82.

Petersen, T. N., S. Brunak, G. von Heijne and H. Nielsen. 2011. SignalP 4.0:

discriminating signal peptides from transmembrane regions. Nat. Methods, 8

(10): 785-786.

Phiriyangkul, P. and P. Utarabhand. 2006. Molecular characterization of a cDNA

encoding vitellogenin in the banana shrimp, Penaeus (Litopenaeus)

merguiensis and sites of vitellogenin mRNA expression. Mol. Reprod. Dev.,

73 (4): 410-423.

Piboonpocanun, S., N. Malainual, O. Jirapongsananuruk, P. Vichyanond and W.

Thomas. 2006. Genetic polymorphisms of major house dust mite allergens.

Clin. Exp. Allergy, 36 (4): 510-516.

Pillai, A., S. Ueno, H. Zhang and Y. Kato. 2003. Induction of ASABF (Ascaris suum

antibacterial factor)-type antimicrobial peptides by bacterial injection: novel

members of ASABF in the nematode Ascaris suum. Biochem. J., 371 (Pt 3):

663-668.

Platts-Mills, T. A. 1992. Dust mite allergens and asthma: report of a second

international workshop. J. Allergy Clin. Immunol., 89 (5): 1046-1060.

Platts-Mills, T. A. and M. D. Chapman. 1987. Dust mites: immunology, allergic

disease, and environmental control. J. Allergy Clin. Immunol., 80 (6): 755-

775.

Platts-Mills, T. A., D. Vervloet, W. R. Thomas, R. C. Aalberse and M. D. Chapman.

186

1997. Indoor allergens and asthma: report of the third international workshop.

J. Allergy Clin. Immunol., 100 (6 Pt 1): S2-24.

Portus, M. and M. S. Gomez. 1976. Variaciones cuali y cuantitivos dela fauna de

acaros del polvo domestico en diversas localidades catalanas. Circ. Farm.,

253: 547-551.

Potter, P. C., G. Davis, A. Manjra and D. Luyt. 1996. House dust mite allergy in

Southern Africa--historical perspective and current status. Clin. Exp. Allergy,

26 (2): 132-137.

Poucher, K. L., H. J. Hutcheson, J. E. Keirans, L. A. Durden and W. C. Black IV.

1999. Molecular genetic key for the identification of 17 Ixodes species of the

United States (Acari: Ixodidae): a methods model. J. Parasitol., 623-629.

Prescott-Clarke, P. and P. Primatesta. 1998. Health survey for England: The health

of young people'95-'97. Methodology & Documentation. Her Majesty's

Stationery Office, (no paging).

Prester, L., I. Brčić Karačonji and J. Macan. 2007. Determination of mite allergen in

house dust using the enzyme immunoassay. Arh. Hig. Rada. Toksikol., 58

(4): 413-419.

Puerta L., Caraballo L., Fernandez-Caldas E., Avjioglu A., Marsh D.G., Lockey

R.F., Dao M.L. 1996. Nucleotide sequence analysis of a complementary

DNA coding for a Blomia tropicalis allergen. J. Allergy Clin. Immunol. 98

(5): 932-937.

Pulsawat, P., M. Theeraapisakkun, E. Nony, M. Le Mignon, K. Jain, A. Buaklin, J.

Wongpiyabovorn, K. Ruxrungtham and A. Jacquet. 2014. Characterization

of the house dust mite allergen Der p 21 produced in Pichia pastoris. Protein

Expr. Purif., 101: 8-13.

Punnonen, J., G. Aversa, B. G. Cocks, A. McKenzie, S. Menon, G. Zurawski, R. de

187

Waal Malefyt and J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-

independent IgG4 and IgE synthesis and CD23 expression by human B cells.

Proc. Natl. Acad. Sci. U.S.A., 90 (8): 3730-3734.

Qiao, T., Y. Hu and Z. Wang. 2008. Pediatric allergic conjunctivitis and allergic

rhinitis. J. Nan. Jing. Med. University, 22 (3): 183-187.

Racewicz, M. 2001. House dust mites (Acari: Pyroglyphidae) in the cities of Gdańsk

and Gdynia (Northern Poland). Ann. Agric. Environ. Med., 8 (1): 33-38.

Rafnar, T., I. J. Griffith, M. C. Kuo, J. F. Bond, B. L. Rogers and D. G. Klapper.

1991. Cloning of Amb a I (antigen E), the major allergen family of short

ragweed pollen. J. Biol. Chem., 266 (2): 1229-1236.

Rajan, T. V. 2003. The Gell-Coombs classification of hypersensitivity reactions: a

re-interpretation. Trends Immunol., 24 (7): 376-379.

Rana, A. N. 2006. Pakistan has 25 to 30 million allergy patients. The News

International, Pakistan. Retrieved from http://pdfsr.com/pdf/pakistan-has-25-

to-30-million-allergy-patients.

Randall, T. A., R. E. London, M. C. Fitzgerald and G. A. Mueller. 2017. Proteases

of Dermatophagoides pteronyssinus. Int. J. Mol. Sci., 18(6): e1204.

Rao, V. R., B. V. Dean, A. Seaton and D. A. Williams. 1975. A comparison of mite

populations in mattress dust from hospital and from private houses in Cardiff,

Wales. Clin. Allergy, 5 (2): 209-215.

Rawlings, N. D. and A. J. Barrett. 1994. Families of cysteine peptidases. In: A. J.

Barrett (ed.), Methods enzymol. (Proteolytic enzymes: serine and cysteine

peptidases). Academic Press, Liverpool, United Kingdom, p. 461-486.

Redline, S. and D. Gold. 1994. Challenges in interpreting gender differences in

asthma. Am. J. Respir. Crit. Care Med., 150 (5): 1219-1221.

Ree, H. I., S. H. Jeon, I. Y. Lee, C. S. Hong and D. K. Lee. 1997. Fauna and

188

geographical distribution of house dust mites in Korea. Korean J. Parasitol.,

35 (1): 9-17.

Reed, C. E. and H. Kita. 2004. The role of protease activation of inflammation in

allergic respiratory diseases. J. Allergy Clin. Immunol., 114 (5): 997-1008;

quiz 1009.

Resch, Y., K. Blatt, U. Malkus, C. Fercher, I. Swoboda, M. Focke-Tejkl, K. W. Chen,

S. Seiberler, I. Mittermann, C. Lupinek, A. Rodriguez-Dominguez, P.

Zieglmayer, R. Zieglmayer, W. Keller, V. Krzyzanek, P. Valent, R. Valenta

and S. Vrtala. 2016. Molecular, Structural and Immunological

Characterization of Der p 18, a Chitinase-Like House Dust Mite Allergen.

PLoS One, 11(8): e0160641.

Rezk, H., M. Abd-El-Hamid and M. Abd-El-Latif. 1996. House dust mites in

Alexandria region, Egypt. Alexandria J. Agri. Res., 41, 209–216.

Rhee, Y. and Y. Oh. 1985. Results of skin test, peripheral eosinophil count, total and

specific IgE in allergic patients in Chonbuk area. Allergy, 5: 147-155.

Rocken, M., G. Grevers and B. Walter. 2004. Color atlas of allergic diseases 1st ed.,

Georg Thieme Velag., Stuttgart, Germany, p. 2.

Roehrdanz, R. L. 1993. An improved primer for PCR amplification of mitochondrial

DNA in a variety of insect species. Insect Mol. Biol., 2 (2): 89-91.

Roitt, I. M., J. Brostoff and D. K. Male. 1998. Immunology. 5th ed., Gower Medical

Publishing Ltd. London, p. 83-89.

Rosa, A. and C. Flechtmann. 1979. Mites in house dust from Brazil. Int. J. Acarol.,

5 (3): 195-198.

Rose, G., L. Arlian, D. Bernstein, A. Grant, M. Lopez, J. Metzger, S. Wasserman

and T. A. Platts-Mills. 1996. Evaluation of household dust mite exposure and

levels of specific IgE and IgG antibodies in asthmatic patients enrolled in a

189

trial of immunotherapy. J. Allergy Clin. Immunol., 97 (5): 1071-1078.

Rosenberg, R., S. Vinker, H. Zakut, F. Kizner, S. Nakar and E. Kitai. 1999. An

unusually high prevalence of asthma in Ethiopian immigrants to Israel. Fam.

Med., 31 (4): 276-279.

Roy, A., A. Kucukural and Y. Zhang. 2010. I-TASSER: a unified platform for

automated protein structure and function prediction. Nat. Protocols, 5 (4):

725-738.

Roy, A., J. Yang and Y. Zhang. 2012. COFACTOR: an accurate comparative

algorithm for structure-based protein function annotation. Nucleic Acids

Res., 40 (Web Server issue): W471-W477.

Rozen, S. and H. Skaletsky. 1998. Primer3. Code available at http:\\ www-genome.

wi: mit. edu\ genome-software\ other\ primer3. html.

Rueda, L. M. 1985. House dust mites (Acari) in Malaysia. Philipp. Entomol., 6: 428-

434.

Rumchev, K., J. Spickett, M. Bulsara, M. Phillips and S. Stick. 2004. Association of

domestic exposure to volatile organic compounds with asthma in young

children. Thorax, 59 (9): 746-751.

Saarne, T., L. Kaiser, O. Rasool, S. Huecas, M. van Hage-Hamsten and G. Gafvelin.

2003. Cloning and characterisation of two IgE-binding proteins, homologous

to tropomyosin and alpha-tubulin, from the mite Lepidoglyphus destructor.

Int. Arch. Allergy Immunol., 130 (4): 258-265.

Sadaka, H. A., S. R. Allam, H. A. Rezk, S. Y. Abo-el-Nazar and A. Y. Shola. 2000.

Isolation of dust mites from houses of Egyptian allergic patients and

induction of experimental sensitivity by Dermatophagoides pteronyssinus. J.

Egypt Soc. Parasitol., 30 (1): 263-276.

Saha, G. K., A. Modak, N. Tandon and D. K. Choudry. 1994. Prevalence of house

190

dust mites Dermatophagoides spp. in homes of asthmatic patients of Calcutta.

Ann. Entomol., 12 (2): 13-17.

Sampson, H. 1998. Fatal food‐induced anaphylaxis. Allergy, 53 (46S): 125-130.

Sampson, H. A. 2003. Anaphylaxis and emergency treatment. Pediatrics, 111 (3S):

1601-1608.

Sampson, H. A., A. Munoz-Furlong, R. L. Campbell, N. F. Adkinson, Jr., S. A. Bock,

A. Branum, S. G. Brown, C. A. Camargo, Jr., R. Cydulka, S. J. Galli, J.

Gidudu, R. S. Gruchalla, A. D. Harlor, Jr., D. L. Hepner, L. M. Lewis, P. L.

Lieberman, D. D. Metcalfe, R. O'Connor, A. Muraro, A. Rudman, C. Schmitt,

D. Scherrer, F. E. Simons, S. Thomas, J. P. Wood and W. W. Decker. 2006.

Second symposium on the definition and management of anaphylaxis:

summary report--Second National Institute of Allergy and Infectious

Disease/Food Allergy and Anaphylaxis Network symposium. J. Allergy Clin.

Immunol., 117 (2): 391-397.

Samsinák, K., F. Dusbabek and E. Vobrázková. 1972. Note on the house dust mites

in Czechoslovakia. Folia Parasitol., 19 (4): 383-384.

Samsinák, K., E. Vobrázková and V. Spicák. 1978. Investigations on the fauna of

beds in flats, children's sanatoria and old-age homes. Folia Parasitol., 25 (2):

157-163.

Sanchez-Borges, M., A. Capriles-Hulett, E. Fernandez-Caldas, R. Suarez-Chacon,

F. Caballero, S. Castillo and E. Sotillo. 1997. Mite-contaminated foods as a

cause of anaphylaxis. J. Allergy Clin. Immunol., 99 (6 Pt 1): 738-743.

Sánchez-Borges, M., A. Capriles-Hulett, R. Suárez-Chacón and E. Fernández-

Caldas. 2001. Oral anaphylaxis from mite ingestion. J. Allergy Clin.

Immunol., 13 (1): 33-35.

Sánchez-Borges, M., R. S. Chacón, A. Capriles-Hulett, F. Caballero-Fonseca and E.

191

Fernández-Caldas. 2013. Anaphylaxis from ingestion of mites: pancake

anaphylaxis. J. Allergy Clin. Immunol., 131 (1): 31-35.

Sánchez-Borges, M., R. Suárez-Chacón, A. Capriles-Hulett and F. Caballero-

Fonseca. 2005. An update on oral anaphylaxis from mite ingestion. Ann.

Allergy Asthma Immunol., 94 (2): 216-221.

Sánchez-Medina, M., I. Zarante and J. A. C. IMMUNOL. 1996. Dust mites at high

altitude in a tropical climate. J. Allergy Clin. Immunol., 97 (5): 1167-1168.

Sander, I., A. Flagge, R. Merget, T. M. Halder, H. E. Meyer and X. Baur. 2001.

Identification of wheat flour allergens by means of 2-dimensional

immunoblotting. J. Allergy Clin. Immunol., 107 (5): 907-913.

Scadding, G. 1997. Could treating asthma help rhinitis? Clin. Exp. Allergy, 27 (12):

1387-1393.

Scala, G. 1995. House-dust mite ingestion can induce allergic intestinal syndrome.

Allergy, 50 (6): 517-519.

Schmidt, M., S. Olsson, I. van der Ploeg and M. van Hage-Hamsten. 1995. cDNA

analysis of the mite allergen Lep d 1 identifies two different isoallergens and

variants. FEBS Lett., 370 (1-2): 11-14.

Schoch, C. L., K. A. Seifert, S. Huhndorf, V. Robert, J. L. Spouge, C. A. Levesque,

W. Chen. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region

as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. U.S.A.,

109 (16): 6241-6246.

Scoppa, J. 1985. Vasomotor rhinitis. A review and management by intranasal

cryotherapy. Med. J. Aust., 143 (10): 448-450.

Sehra, S., F. M. B. Tuana, M. Holbreich, N. Mousdicas, R. S. Tepper, C. H. Chang,

J. B. Travers and M. H. Kaplan. 2008. Scratching the surface: towards

understanding the pathogenesis of atopic dermatitis. Crit. Rev. Immunol., 28

192

(1): 15-43.

Sepasgosarian, H. and Y. Mumcuoglu. 1979. Faunistische und ökologische studien

der hausstaubmilben in Iran. Int. J. Acarol., 5 (2): 131-138.

Servin, V. and R. Tejas. 1991. Presencia de Dermatophagoides en Baja California

Sur, Mexico. Southwest. Entomol., 16: 156-161.

Sesay, H. R. and R. M. Dobson. 1972. Studies on the mite fauna of house dust in

Scotland with special reference to that of bedding. Acarologia, 14 (3): 384-

392.

Settipane, R. J., G. W. Hagy and G. A. Settipane. 1994. Long-term risk factors for

developing asthma and allergic rhinitis: a 23-year follow-up study of college

students. Allergy Proc., 15 (1): 21-25.

Shafique, R. H., M. Inam, M. Ismail and F. R. Chaudhary. 2012. Group 10 allergens

(tropomyosins) from house-dust mites may cause covariation of sensitization

to allergens from other invertebrates. Allergy Rhinol. (Providence), 3 (2):

e74-90.

Shafique, R. H., P. B. Klimov, M. Inam, F. R. Chaudhary and B. M. Oconnor. 2014.

Group 1 allergen genes in two species of house dust mites,

Dermatophagoides farinae and D. pteronyssinus (Acari: Pyroglyphidae):

direct sequencing, characterization and polymorphism. PLoS One, 9 (12):

e114636.

Shaheen, A., M. Shafiq, M. A. Naeem and G. Jilani. 2008. Characterization of the

eroded lands of Fatehjang. Soil Environ., 27 (2): 208-214.

Shen, H. D., K. Y. Chua, K. L. Lin, K. H. Hsieh and W. R. Thomas. 1993. Molecular

cloning of a house dust mite allergen with common antibody binding

specificities with multiple components in mite extracts. Clin. Exp. Allergy,

23 (11): 934-940.

193

Shen, H. D., K. Y. Chua, W. L. Lin, H. L. Chen, K. H. Hsieh and W. R. Thomas.

1996. IgE and monoclonal antibody binding by the mite allergen Der p 7.

Clin. Exp. Allergy, 26 (3): 308-315.

Shen, H. D., K. Y. Chua, W. L. Lin, K. H. Hsieh and W. R. Thomas. 1995.

Characterization of the house dust mite allergen Der p 7 by monoclonal

antibodies. Clin. Exp. Allergy, 25 (5): 416-422.

Shin, J. W., J. H. Sue, T. W. Song, K. W. Kim, E. S. Kim, M. H. Sohn and K. E.

Kim. 2005. Atopy and house dust mite sensitization as risk factors for asthma

in children. Yonsei Med. J, 46 (5): 629-634.

Shin, J. W., S. P. Jin, J. H. Lee and S. Cho. 2010. Analysis of MAST-CLA Results

as a Diagnostic Tool in Allergic Skin Diseases. Ann. Dermatol., 22 (1): 35-

40.

Shirakawa, T., T. Enomoto, S. Shimazu and J. M. Hopkin. 1997. The inverse

association between tuberculin responses and atopic disorder. Science, 275

(5296): 77-79.

Sibbald, B., E. Rink and M. D'Souza. 1990. Is the prevalence of atopy increasing?

Br. J. Gen. Pract., 40 (337): 338-340.

Sidenius, K. E., T. E. Hallas, L. K. Poulsen and H. Mosbech. 2002. House dust mites

and their allergens in Danish mattresses - results from a population based

study. Ann. Agric. Environ. Med.: AAEM, 9 (1): 33-39.

Silacci, P., L. Mazzolai, C. Gauci, N. Stergiopulos, H. L. Yin and D. Hayoz. 2004.

Gelsolin superfamily proteins: key regulators of cellular functions. Cell. Mol.

Life Sci., 61 (19-20): 2614-2623.

Simons, F. E. 2010. World Allergy Organization survey on global availability of

essentials for the assessment and management of anaphylaxis by allergy-

immunology specialists in health care settings. Ann. Allergy Asthma

194

Immunol., 104 (5): 405-412.

Simons, F. E. R., L. R. F. Ardusso, M. B. Bilò, Y. M. El-Gamal, D. K. Ledford, J.

Ring, M. Sanchez-Borges, G. E. Senna, A. Sheikh, B. Y. Thong and O. for

the World Allergy. 2011. World Allergy Organization guidelines for the

assessment and management of anaphylaxis. The World Allergy Organ. J., 4

(2): 13-37.

Sinclair, W., L. Coetzee and G. Joubert. 2010. House-dust mite species in

Bloemfontein, South Africa. S. Afr. Med. J., 100 (3): 164-167.

Skerratt, L., N. Campbell, A. Murrell, S. Walton, D. Kemp and S. Barker. 2002. The

mitochondrial 12S gene is a suitable marker of populations of Sarcoptes

scabiei from wombats, dogs and humans in Australia. Parasitol. Res., 88 (4):

376-379.

Skobeloff, E. M., W. H. Spivey, S. S. S. Clair and J. M. Schoffstall. 1992. The

influence of age and sex on asthma admissions. Jama, 268 (24): 3437-3440.

Sly, R. M. 1999. Changing prevalence of allergic rhinitis and asthma. Ann. Allergy

Asthma Immunol. , 82 (3): 233-248.

Smith, A. M., D. C. Benjamin, N. Hozic, U. Derewenda, W. A. Smith, W. R.

Thomas, G. Gafvelin, M. van Hage-Hamsten and M. D. Chapman. 2001a.

The molecular basis of antigenic cross-reactivity between the group 2 mite

allergens. J. Allergy Clin. Immunol., 107 (6): 977-984.

Smith, W. A., B. J. Hales, A. G. Jarnicki and W. R. Thomas. 2001b. Allergens of

wild house dust mites: environmental Der p 1 and Der p 2 sequence

polymorphisms. J. Allergy Clin. Immunol., 107 (6): 985-992.

Smith, W. A., S. K. Khoo, K. L. Mills and W. R. Thomas. 2008. Molecular

characterization of Der p 20, a house dust mite arginine kinase allergen.

Retrieved May 17, 2015, from UniProt:

195

http://www.uniprot.org/uniprot/B2ZSY4

Smith, W. A. and W. R. Thomas. 1996a. Comparative analysis of the genes encoding

group 3 allergens from Dermatophagoides pteronyssinus and

Dermatophagoides farinae. Int. Arch. Allergy Immunol., 109 (2): 133-140.

Smith, W. A. and W. R. Thomas. 1996b. Sequence polymorphisms of the Der p 3

house dust mite allergen. Clin. Exp. Allergy, 26 (5): 571-579.

Solarz, K. 1998. The allergenic acarofauna of house dust from dwellings, hospitals,

libraries and institutes in Upper Silesia (Poland). Ann. Agric. Environ. Med.,

5: 73-86.

Solarz, K. 2001a. Pyroglyphidae (Acari: Astigmata) in Poland. Distribution, biology,

population ecology and epidemiology. Acta Zool. Cracov., 44 (4): 435-528.

Solarz, K. 2001b. Risk of exposure to house dust pyroglyphid mites in Poland. Ann.

Agric. Environ. Med., 8 (1): 11-24.

Solarz, K. 2004. Distribution and ecology of allergenic mites in Poland. Phytophaga,

14: 675-694.

Solarz, K. 2010. Temporal changes in the composition of house-dust-mite fauna in

Poland. Acta. Zool. Cracov. Ser-B: Invert., 53 (1-2): 39-64.

Solarz, K. 2011. House dust mites, other domestic mites and forensic medicine. In:

D. N. Vieira (ed.), Forensic medicine - from old problems to new challenges.

InTech. Rijeka, Croatia, p. 327-358.

Solarz, K. and L. Senczuk. 2003. Allergenic acarofauna of synanthropic outdoor

environments in a densely populated urban area in Katowice, Upper Silesia,

Poland. Int. J. Acarol., 29 (4): 403-420.

Solarz, K., L. Senczuk, H. Maniurka, E. Cichecka and M. Peszke. 2007.

Comparisons of the allergenic mite prevalence in dwellings and certain

outdoor environments of the Upper Silesia (southwest Poland). Int. J. Hyg.

196

Environ. Health, 210 (6): 715-724.

Solarz, K. and D. Solarz. 1996. The allergenic mites in coal-mine dust from coal

mines in Upper Silesia (Poland). Ann. Agric. Environ. Med., 3 (1): 49-55.

Solarz, K., P. Skubała, G. Wauthy and P. Szilman. 2016. Body Size Variability in

Different Forms of Heteromorphic Males in Populations of the House Dust

Mite Dermatophagoides farinae Hughes 1961 (Acari: Astigmata:

Pyroglyphidae). Ann. Zool. Fenn., 66 (2): 329-336.

Soto‐Quiros, M., I. Gutierrez, N. Calvo, C. Araya, J. Karlberg, L. Hanson and L.

Belin. 1998. Allergen sensitization of asthmatic and nonasthmatic

schoolchildren in Costa Rica. Allergy, 53 (12): 1141-1147.

Spergel, J. M. and A. S. Paller. 2003. Atopic dermatitis and the atopic march. J.

Allergy Clin. Immunol., 112 (6): S118-S127.

Spertini, F., M. Berney, F. Foradini and C. A. Roulet. 2010. Major mite allergen Der

f 1 concentration is reduced in buildings with improved energy performance.

Allergy, 65 (5): 623-629.

Sporik, R., S. T. Holgate, T. A. Platts-Mills and J. J. Cogswell. 1990. Exposure to

house-dust mite allergen (Der p I) and the development of asthma in

childhood. A prospective study. N. Engl. J. Med., 323 (8): 502-507.

Stafforini, D. M., T. Numao, A. Tsodikov, D. Vaitkus, T. Fukuda, N. Watanabe, N.

Fueki, T. M. McIntyre, G. A. Zimmerman and S. Makino. 1999. Deficiency

of platelet-activating factor acetylhydrolase is a severity factor for asthma. J.

Clin. Invest., 103 (7): 989-997.

Stamatakis, A., T. Ludwig and H. Meier. 2005. RAxML-III: a fast program for

maximum likelihood-based inference of large phylogenetic trees.

Bioinformatics, 21 (4): 456-463.

Stenius, B. and A. M. Cunnington. 1972. House dust mites and respiratory allergy:

197

a qualitative survey of species occurring in Finnish house dust. Scand. J.

Respir. Dis., 53 (6): 338-348.

Stewart, G. A., M. R. Kollinger, C. M. King and P. J. Thompson. 1994. A

comparative study of three serine proteases from Dermatophagoides

pteronyssinus and D. farinae. Allergy, 49 (7): 553-560.

Stewart, G. A., F. R. Lake and P. J. Thompson. 1991. Faecally derived hydrolytic

enzymes from Dermatophagoides pteronyssinus: physicochemical

characterisation of potential allergens. Int. Arch. Allergy Immunol., 95 (2-3):

248-256.

Stewart, G. A. and K. J. Turner. 1980. Physicochemical and immunochemical

characterization of the high molecular weight allergens from

Dermatophagoides pteronysisinus with particular reference to the tridacnin,

Con-A and S107 reactive components. Aust. J. Exp. Biol. Med. Sci., 58 (3):

275-288.

Stewart, G. A., L. D. Ward, R. J. Simpson and P. J. Thompson. 1992. The group III

allergen from the house dust mite Dermatophagoides pteronyssinus is a

trypsin-like enzyme. Immunology, 75 (1): 29-35.

Suarez-Martinez, E. B., F. Montealegre, J. M. Sierra-Montes and R. J. Herrera. 2005.

Molecular identification of pathogenic house dust mites using 12S rRNA

sequences. Electrophoresis, 26 (15): 2927-2934.

Sudha, V. T., N. Arora, S. N. Gaur, S. Pasha and B. P. Singh. 2008. Identification of

a serine protease as a major allergen (Per a 10) of Periplaneta americana.

Allergy, 63 (6): 768-776.

Sun, H. L. and K. H. Lue. 2000. Household distribution of house dust mite in central

Taiwan. J. Microbiol. Immunol. Infect., 33 (4): 233-236.

Sunyer, J., D. Jarvis, J. Pekkanen, S. Chinn, C. Janson, B. Leynaert, C. Luczynska,

198

R. Garcia-Esteban, P. Burney, J. M. Antó and G. European Community

Respiratory Health Survey Study Group. 2004. Geographic variations in the

effect of atopy on asthma in the European Community Respiratory Health

Study. J. Allergy Clin. Immunol., 114 (5): 1033-1039.

Suphioglu, C. and M. B. Singh. 1995. Cloning, sequencing and expression in

Escherichia coli of Pha a 1 and four isoforms of Pha a 5, the major allergens

of canary grass pollen. Clin. Exp. Allergy, 25 (9): 853-865.

Suto, C., I. Sakaki, H. Itoh and M. Mitibata. 1992. Studies on the ecology of house-

dust mites in wooden houses in Nagoya, with special reference to the

influence of room ratios on the prevalence of mites and allergy. Jap. J. Sanit.

Zool., 43 (3): 217-228.

Suto, C., I. Sakaki, H. Itoh and M. Mitibata. 1993. Influence of types of rooms and

flooring on the prevalence of house dust mites, Dermatophagoides farinae

and D. pteronyssinus (Acari: Pyroglyphidae), in houses in Nagoya, Japan.

Jap. J. Sanit. Zool., 44 (3): 247-255.

Takaoka, M. and S. Okada. 1984. Ecological studies on the house dust mites in

Saitama prefecture Japan. Seasonal occurrences of the pyroglyphid mites in

house dusts in 1981 to 1982. Jap. J. Sanit. Zool. 35 (2):129-137.

Takaoka, Y., R. J. White, R. B. Billiar and B. A. Little. 1977. Regional arterial blood

flow in the primate pituitary gland. Surg. Forum, 28: 464-466.

Tan, C. L. and F. T. Chew. 2007. Isolation and characterization of group 20 allergen

from Aleuroglyphus ovatus. Retrieved May 17, 2015, from UniProt:

http://www.uniprot.org/uniprot/A7XZH8

Tategaki, A., S. Kawamoto, T. Aki, T. Jyo, O. Suzuki, S. Shigeta and K. Ono. 2000.

Newly described house dust mite allergens. Allergy Clin. Immunol. Int. 1:74-

76.

199

Tayeb, M. M. S. 2017. Aeroallergens sensitization pattern at Taif city: Saudi. Int. J.

Community Med. Public Health, 3(4): 973-976.

Taylor, A. N. 1995. Environmental determinants of asthma. The Lancet, 345 (8945):

296-299.

Tempels-Pavlica, Z., A. J. Oosting, I. Terreehorst, R. G. van Wijk, C. A. F. M.

Bruijnzeel-Koomen, J. G. R. de Monchy and R. C. Aalberse. 2004.

Differential effect of mattress covers on the level of Der p 1 and Der f 1 in

dust. Clin. Exp. Allergy, 34 (9): 1444-1447.

Teo, A. S. M., J. D. A. Ramos, B. W. Lee, N. Cheong and K. Y. Chua. 2006.

Expression of the Blomia tropicalis paramyosin Blo t 11 and its

immunodominant peptide in insect cells. Biotechnol. Appl. Biochem., 45 (Pt

1): 13-21.

Teplitsky, V., K. Y. Mumcuoglu, I. Babai, I. Dalal, R. Cohen and A. Tanay. 2008.

House dust mites on skin, clothes, and bedding of atopic dermatitis patients.

Int. J. Dermatol., 47 (8): 790-795.

Terra, S., D. Silva, M. Sopolete, J. Mendes, S. Sung and E. Taketomi. 2004. Mite

allergen levels and acarologic analysis in house dust samples in Uberaba,

Brazil. J. Investig. Allergol. Clin. Immunol., 14 (3): 232-237.

Thomas, W., W. Smith, B. Hales and M. Carter. 1997. Functional effects of

polymorphisms of house dust mite allergens. Int. Arch. Allergy Immunol.,

113 (1-3): 96-98.

Thomas, W. R. 2010. Geography of house dust mite allergens. Asian Pac. J. Allergy

Immunol., 28 (4): 211-224.

Thomas, W. R. and K. Y. Chua. 1995. The major mite allergen Der p 2--a secretion

of the male mite reproductive tract? Clin. Exp. Allergy, 25 (7): 667-669.

Thomas, W. R., K. Y. Chua and W. A. Smith. 1992. Molecular polymorphisms of

200

house dust mite allergens. Exp. Appl. Acarol., 16 (1-2): 153-164.

Thomas, W. R., T. K. Heinrich, W. A. Smith and B. J. Hales. 2007. Pyroglyphid

house dust mite allergens. Protein Pept. Lett., 14 (10): 943-953.

Thomas, W. R., W. A. Smith and B. J. Hales. 2004. The allergenic specificities of

the house dust mite. Chang Gung Med. J., 27 (8): 563-569.

Thomas, W. R., W. A. Smith, B. J. Hales, K. L. Mills and R. M. O'Brien. 2002.

Characterization and immunobiology of house dust mite allergens. Int. Arch.

Allergy Immunol., 129 (1): 1-18.

Till, S., S. Durham, R. Dickason, D. Huston, J. Bungre, S. Walker, D. Robinson, A.

B. Kay and C. Corrigan. 1997. IL-13 production by allergen-stimulated T

cells is increased in allergic disease and associated with IL-5 but not IFN-

gamma expression. Immunology, 91 (1): 53-57.

Todorov, D. A. 1979. Mites of the family Pyroglyphidae (Sarcoptiformes) in house

dust and methods of their collection. [In Bulgarian, English summary]. Acta

Zool. Bulg., 13: 64-71.

Togias, A. 2003. Rhinitis and asthma: evidence for respiratory system integration. J.

Allergy Clin. Immunol., 111 (6): 1171-1183.

Toma, T., I. Miyagi, M. B. Crabtree and B. R. Miller. 2000. Identification of Culex

vishnui subgroup (Diptera: Culicidae) mosquitoes from the Ryukyu

Archipelago, Japan: development of a species-diagnostic polymerase chain

reaction assay based on sequence variation in ribosomal DNA spacers. J.

Med. Entomol., 37 (4): 554-558.

Toma, T., I. Miyagi, M. Kishimoto and T. Nagama. 1993. Fauna and seasonal

appearances of mites in house dusts collected from the residences including

asthmatic children in Okinawa Prefecture, Ryukyu Archipelago. Jap. J. Sanit.

Zool., 44 (3): 223-235.

201

Tovey, E. R. and B. A. Baldo. 1990. Localization of antigens and allergens in thin

sections of the house dust mite, Dermatophagoides pteronyssinus (Acari:

Pyroglyphidae). J. Med. Entomol., 27 (3): 368-376.

Tovey, E. R., M. D. Chapman and T. A. Platts-Mills. 1981. Mite faeces are a major

source of house dust allergens. Nature, 289 (5798): 592-593.

Tovey, E. R., M. C. Johnson, A. L. Roche, G. S. Cobon and B. A. Baldo. 1989.

Cloning and sequencing of a cDNA expressing a recombinant house dust

mite protein that binds human IgE and corresponds to an important low

molecular weight allergen. J. Exp. Med., 170 (4): 1457-1462.

Tovey, E. R., L. G. McDonald, J. K. Peat and G. B. Marks. 2000. Domestic Mite

Species and Der p 1 Allergen levels in nine locations in Australia. Allergy

Clin. Immunol. Int., 12 (5): 0226-0231.

Trudinger, M., K. Y. Chua and W. R. Thomas. 1991. cDNA encoding the major mite

allergen Der f II. Clin. Exp. Allergy, 21 (1): 33-37.

Tsai, J. J., H. H. Wu, H. D. Shen, E. L. Hsu and S. R. Wang. 1998. Sensitization to

Blomia tropicalis among asthmatic patients in Taiwan. Int. Arch. Allergy

Immunol., 115 (2): 144-149.

Tsai, L. C., P. L. Chao, M. W. Hung, Y. C. Sun, I. C. Kuo, K. Y. Chua and S. H.

Liaw. 2000. Protein sequence analysis and mapping of IgE and IgG epitopes

of an allergenic 98-kDa Dermatophagoides farinae paramyosin, Der f 11.

Allergy, 55 (2): 141-147.

Tsang, W. S., L. S. Quackenbush, B. K. C. Chow, S. H. K. Tiu, J. G. He and S. M.

Chan. 2003. Organization of the shrimp vitellogenin gene: evidence of

multiple genes and tissue specific expression by the ovary and

hepatopancreas. Gene, 303: 99-109.

Turner, K. J., B. A. Baldo and J. M. Hilton. 1975. IgE antibodies to

202

Dermatophagoides pteronyssinus (Housedust mite), Aspergillus fumigatus,

and beta-lactoglobulin in sudden infant death syndrome. Br. Med. J., 1

(5954): 357-360.

Ullah, S., S. A. Niazi and M. R. Akhter. 2005. Allergens in allergic rhinitis. Pak

Armed Force Med. J., 55 (2): 126-128.

Valdivieso, R., M. Estupiñañ and V. Iraola. 2010. Exposure to risky concentrations

of Dermatophagoides allergens in a high-altitude population (Quito, 2800 m

above sea level in the Andean Mountains). J. Investig. Allergol. Clin.

Immunol., 20 (4): 362-363.

Valdivieso, R., V. Iraola, M. Estupiñán and E. Fernández-Caldas. 2006. Sensitization

and exposure to house dust and storage mites in high-altitude areas of

ecuador. Ann. Allergy Asthma Immunol. , 97 (4): 532-538.

Valero, A. and C. Serrano. 2004. Are environmental controls effective for house-

dust-mite allergies? Arch. Bronconeumol. (Eng. Ed.), 40 (9): 389-391.

Vallance, G., C. McSharry, S. Wood and N. C. Thomson. 2006. House dust mite

control measures in the treatment of asthma. Ther. Clin. Risk. Manag., 2 (4):

347. van Bronswijk, J. 1981. House dust biology: for allergists, acarologists, and

mycologists. NIB Publishers. The Netherlands. van Bronswijk, J. E. 1973. Dermatophagoides pteronyssinus (Trouessary, 1897) in

mattress and floor dust in a temperate climate (Acari: Pyroglyphidae). J. Med.

Entomol., 10 (1): 63-70. van Bronswijk, J. E. and R. N. Sinha. 1971. Pyroglyphid mites (Acari) and house

dust allergy. J. Allergy, 47 (1): 31-52. van Bronswijk, J. E. M. H. 1972. Huis, Bed en Beestjes [House, Bed and Bugs]. Ned.

Tijdschr. Geneeskd., 116 (20): 825-831.

203

van der Kuyl, A. C., D. L. P. Ballasina, J. T. Dekker, J. Maas, R. E. Willemsen and

J. Goudsmit. 2002. Phylogenetic relationships among the species of the genus

Testudo (Testudines: Testudinidae) inferred from mitochondrial 12S rRNA

gene sequences. Mol. Phylogen. Evol., 22 (2): 174-183. van Ree, R. 2007. Indoor allergens: Relevance of major allergen measurements and

standardization. J. Allergy Clin. Immunol., 119 (2): 270-277.

Vargas, V. M. and A. H. Mairena. 1991. House dust mites from the metropolitan

area of San José, Costa Rica. Int. J. Acarol., 17: 141-144.

Venn, A., S. Lewis, M. Cooper, J. Hill and J. Britton. 1998. Questionnaire study of

effect of sex and age on the prevalence of wheeze and asthma in adolescence.

Br. Med. J., 316 (7149): 1945-1946.

Vervloet, D., A. Penaud, H. Razzouk, M. Senft, A. Arnaud, C. Boutin and J. Charpin.

1982. Altitude and house dust mites. J. Allergy Clin. Immunol., 69 (3): 290-

296.

Vobrázková, E., A. Kasiaková and K. Samsinák. 1986. Analysis of dust samples

from the clinical environment of children with eczemas. Angew. Parasitol.,

27 (1): 53-55. von Mutius, E. 2000. The burden of childhood asthma. Arch. Dis. Child., 82 (2s):

112-115. von Mutius, E., F. D. Martinez, C. Fritzsch, T. Nicolai, G. Roell and H.-H.

Thiemann. 1994. Prevalence of asthma and atopy in two areas of West and

East Germany. Am. J. Respir. Crit. Care Med., 149 (2): 358-364. von Mutius, E., S. K. Weiland, C. Fritzsch, H. Duhme and U. Keil. 1998. Increasing

prevalence of hay fever and atopy among children in Leipzig, East Germany.

The Lancet, 351 (9106): 862-866.

Voorhorst, R., M. Spieksma-Boezeman and F. T. Spieksma. 1963. Is a mite

204

(Dermatophagoides sp.) the producer of the house-dust allergen? Allerg.

Asthma, 10: 329-334.

Voorhorst, R. and F. Spieksma. 1967. Correspondence: of mites and men. J. Allergy,

40 (6): 357-358.

Voorhorst, R., F. T. M. Spieksma, H. Varekamp, M. J. Leupen and A. W. Lyklema.

1967. The house-dust mite (Dermatophagoides pteronyssinus) and the

allergens it produces. Identity with the house-dust allergen. J. Allergy, 39 (6):

325-339.

Wahn, U., S. Lau, R. Bergmann, M. Kulig, J. Forster, K. Bergmann, C. P. Bauer and

I. Guggenmoos-Holzmann. 1997. Indoor allergen exposure is a risk factor for

sensitization during the first three years of life. J. Allergy Clin. Immunol., 99

(6 Pt 1): 763-769.

Walker, C. and C. Zuany-Amorim. 2001. New trends in immunotherapy to prevent

atopic diseases. Trends Pharmacol. Sci., 22 (2): 84-90.

Walter, D. E. and H. C. Proctor. 2013. Mites: ecology, evolution & behaviour: Life

at a microscale. 2nd ed., Springer, New York, USA., p. 11-66.

Walzl, M. G. 1988. A scanning electron microscopic study of the embryonic

development of the house dust mite, Dermatophagoides farinae

(Pyroglyphidae, Actinotrichida) from blastula to the hatching of the larva.

Inst. Phys. Conf. Ser., 3 (93): 159-160.

Walzl, M. G. 1992. Ultrastructure of the reproductive system of the house dust mites

Dermatophagoides farinae and D. pteronyssinus (Acari, Pyroglyphidae) with

remarks on spermatogenesis and oogenesis. Exp. Appl. Acarol., 16 (1-2): 85-

116.

Wang, H. and T. Wen. 1997. Mite allergens Der p1 and Der f1 in bedding dust

determined by monoclonal antibodies in Shanghai. Syst. Appl. Acarol., 2:

205

135-140.

Wang, H., J. Lin, X. Liu, Z. Liang, P. Yang, P. Ran and Z. Liu. 2016. Identification

of α-tubulin, Der f 33, as a novel allergen from Dermatophagoides farinae.

Immunobiology. (8):911-917.

Wang, P., G. Li and R. R. Granados. 2004. Identification of two new peritrophic

membrane proteins from larval Trichoplusia ni: structural characteristics and

their functions in the protease rich insect gut. Insect Biochem. Mol. Biol., 34

(3): 215-227.

Warner, A., B. Bjbrksten, A. Munir, C. Möller, C. Schou and N. L. Kjellman. 1996.

Childhood asthma and exposure to indoor allergens: lowmite levels are

associated with sensitivity. Pediatr. Allergy Immunol., 7 (2): 61-67.

Warner, A., S. Boström, C. Möller and N. I. Kjellman. 1999. Mite fauna in the home

and sensitivity to house-dust and storage mites. Allergy, 54 (7): 681-690.

Weber, E., S. Hunter, K. Stedman, S. Dreitz, T. Olivry, A. Hillier and C. McCall.

2003. Identification, characterization, and cloning of a complementary DNA

encoding a 60-kd house dust mite allergen (Der f 18) for human beings and

dogs. J. Allergy Clin. Immunol., 112 (1): 79-86.

Webster, L. M., R. H. Thomas and G. P. McCormack. 2004. Molecular systematics

of Acarus siro s. lat., a complex of stored food pests. Mol. Phylogen. Evol.,

32 (3): 817-822.

Weghofer, M., Y. Dall'Antonia, M. Grote, A. Stöcklinger, M. Kneidinger, N. Balic,

M. T. Krauth, E. Fernández-Caldas, W. R. Thomas, M. van Hage, S. Vieths,

S. Spitzauer, F. Horak, D. I. Svergun, P. V. Konarev, P. Valent, J. Thalhamer,

W. Keller, R. Valenta and S. Vrtala. 2008. Characterization of Der p 21, a

new important allergen derived from the gut of house dust mites. Allergy, 63

(6): 758-767.

206

Weghofer, M., M. Grote, Y. Resch, A. Casset, M. Kneidinger, J. Kopec, W. R.

Thomas, E. Fernández-Caldas, M. Kabesch, R. Ferrara, A. Mari, A. Purohit,

G. Pauli, F. Horak, W. Keller, P. Valent, R. Valenta and S. Vrtala. 2013.

Identification of Der p 23, a peritrophin-like protein, as a new major

Dermatophagoides pteronyssinus allergen associated with the peritrophic

matrix of mite fecal pellets. J. Immunol., 190 (7): 3059-3067.

Weghofer, M., W. R. Thomas, G. Pittner, F. Horak, R. Valenta and S. Vrtala. 2005.

Comparison of purified Dermatophagoides pteronyssinus allergens and

extract by two-dimensional immunoblotting and quantitative

immunoglobulin E inhibitions. Clin. Exp. Allergy, 35 (10): 1384-1391.

Wei, D. D., M. L. Yuan, Z. Y. Wang, D. Wang, B. J. Wang, W. Dou and J. J. Wang.

2011. Sequence analysis of the ribosomal internal transcribed spacers region

in psocids (Psocoptera: Liposcelididae) for phylogenetic inference and

species discrimination. J. Econ. Entomol., 104 (5): 1720-1729.

Weiss, K. B., P. J. Gergen and T. A. Hodgson. 1992. An economic evaluation of

asthma in the United States. N. Engl. J. Med., 326 (13): 862-866.

Weiss, K. B. and S. D. Sullivan. 2001. The health economics of asthma and rhinitis.

I. Assessing the economic impact. J. Allergy Clin. Immunol., 107 (1): 3-8.

Wen, D. C., S. D. Shyur, C. M. Ho, Y. C. Chiang, L. H. Huang, M. T. Lin, H. C.

Yang and P. H. Liang. 2005. Systemic anaphylaxis after the ingestion of

pancake contaminated with the storage mite Blomia freemani. Ann. Allergy

Asthma Immunol. , 95 (6): 612-614.

Wenzel, S. E. 2006. Asthma: defining of the persistent adult phenotypes. Lancet, 368

(9537): 804-813.

Werfel, T. 2009. The role of leukocytes, keratinocytes, and allergen-specific IgE in

the development of atopic dermatitis. J. Invest. Dermatol., 129 (8): 1878-

207

1891.

Wharton, G., K. M. Duke and H. M. Epstein. 1979. Water and the physiology of

house dust mites. Rec. Adv. Acarol., 1: 325-335.

Wharton, G. and A. Richards. 1978. Water vapor exchange kinetics in insects and

acarines. Annu. Rev. Entomol., 23 (1): 309-328.

Wharton, G. W. 1963. Equilibrium humidity. In: J. A. Naegele (ed.), Advances in

Acarology. Cornell University Press, USA., p. 201-208.

Wharton, G. W. 1985. Water balance of insects. In: G. A. Kerkut & L. I. Gilbert

(eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology.

Pergamon Press, Oxford, UK., 565-603

Wharton, G. W. and R. T. Furumizo. 1977. Supra-coxal gland secretions as a source

of fresh water for Acaridei. Acarologia, 19 (1): 112-116.

Wheeler, Q. D. 2005. Losing the plot: DNA “barcodes” and taxonomy. Cladistics,

21 (4): 405-407.

Wickens, K., J. de Bruyne, M. Calvo, S. Choon-Kook, G. Jayaraj, C. K. W. Lai, J.

Lane, R. Maheshwari, J. Mallol, S. Nishima, G. Purdie, R. Siebers, T.

Sukumaran, M. Trakultivakorn and J. Crane. 2004. The determinants of dust

mite allergen and its relationship to the prevalence of symptoms of asthma in

the Asia-Pacific region. Pediatr. Allergy Immunol., 15 (1): 55-61.

Wickens, K., R. Siebers, I. Ellis, S. Lewis, G. Sawyer, S. Tohill, L. Stone, R. Kent,

J. Kennedy, T. Slater, A. Crothall, H. Trethowen, N. Pearce, P. Fitzharris and

J. Crane. 1997. Determinants of house dust mite allergen in homes in

Wellington, New Zealand. Clin. Exp. Allergy, 27 (9): 1077-1085.

Wolley, J. B. 1988. Phylogeny and classification of the Signiphoridae

(Hymenoptera: Chalcidoidea). Syst. Entomol., 13 (4): 465-501.

208

Wong, G. W. K., S. T. Li, D. S. C. Hui, T. F. Fok, N. S. Zhong, Y. Z. Chen and C.

K. W. Lai. 2002. Individual allergens as risk factors for asthma and bronchial

hyperresponsiveness in Chinese children. Eur. Respir. J., 19 (2): 288-293.

Wong, S. F., A. L. Chong, J. W. Mak, J. Tan, S. J. Ling and T. M. Ho. 2011.

Molecular identification of house dust mites and storage mites. Exp. Appl.

Acarol., 55 (2): 123-133.

Wu, Y., C. Jiang, M. Li, H. Yu, X. Xiao, X. Fan, L. Jianli, L. Xiaoyu, Z. Min, Y.

Pingchang and Z. Liu. 2016. Der f 21, a novel allergen from

Dermatophagoides farina. Am. J. Transl. Res., 8(1): 49-59.

Wu, Y. L. and Z. G. Liu. 2014. Cloning, expression, purification and immunological

activity of genes from Dermatophagoides farinae. Retrieved May 17, 2015,

from UniProt: http://www.uniprot.org/uniprot/A0A088SAW7 www.myweather2.com. from Weather2: http://www.myweather2.com/City-

Town/Pakistan/Rawalpindi/climate-profile.aspx.

Yamada Y., Y. Ueda, A. Nakamura, S. Kanayama, R. Tamura, K. Hashimoto, T.

Matsumoto and R. Ishii. 2017. Immediate-type allergic and protease-

mediated reactions are involved in scratching behaviour induced by topical

application of Dermatophagoides farinae extract in NC/Nga mice. Exp.

Dermatol., 00: 1-9.

Yan, D. C., F. F. Chung, S. J. Lin and G. H. Wan. 2016. The relationships among

Dermatophagoides pteronyssinus exposure, exhaled nitric oxide, and exhaled

breath condensate pH levels in atopic asthmatic children. Medicine, 95(39):

e4825.

Yang, B., J. Cai and X. Cheng. 2011. Identification of astigmatid mites using ITS2

and COI regions. Parasitol. Res., 108 (2): 497-503.

209

Yang, P. C., Z. G. Liu, Y. L. Wu, X. Y. Liu, M. Y. Zheng and R. J. Lai. 2014.

Cloning, expression, purification and immunological activity of genes from

Dermatophagoides farinae. Retrieved May 18, 2015, from UniProt:

http://www.uniprot.org/uniprot/A0A088SCP3.

Yang, X., G. Fan and J. Li. 2016. Diagnostic value of Der p 1 and Der p 2 specific

IgE in IgE sensitization. Ann. Allergy Asthma Immunol., 116(4): 295-301.

Yap, J., M. Ching, C. Cabanilla and J. Ramos. 2014. Multiple house dust mite

allergen-sensitization profiles in children with allergic asthma. J. Allergy

Ther., 5 (179): 2.

Yap, L. C. and F. T. Chew. 2007. Cloning of allergens from the storage mite

Glycyphagus domesticus. Retrieved May 17, 2015, from UniProt:

http://www.uniprot.org/uniprot/A7XZJ5.

Yassin, M. and M. Rifaat. 1997. Distribution and abundance of house dust mites,

Dermatophagoides spp., in different ecological localities in Esna City, Kena

Governorate, Egypt. J. Egypt Soc. Parasitol., 27 (2): 431-437.

Yassin, M. S., M. B. Lierl, T. J. Fischer, K. O'Brien, J. Cross and C. Steinmetz. 1994.

Latex allergy in hospital employees. Ann. Allergy, 72 (3): 245-249.

Yasueda, H., H. Mita, K. Akiyama, T. Shida, T. Ando, S. Sugiyama and H.

Yamakawa. 1993. Allergens from Dermatophagoides mites with

chymotryptic activity. Clin. Exp., 23 (5): 384-390.

Yasueda, H., H. Mita, Y. Yui and T. Shida. 1986. Isolation and characterization of

two allergens from Dermatophagoides farinae. Int. Arch. Allergy Immunol.,

81 (3): 214-223.

Yemaneberhan, H., Z. Bekele, A. Venn, S. Lewis, E. Parry and J. Britton. 1997.

Prevalence of wheeze and asthma and relation to atopy in urban and rural

Ethiopia. Lancet, 350 (9071): 85-90.

210

Yi, F. C., N. Cheong, L. P. Shek, P. C. L. Shek, D. Y. Wang, K. Y. Chua and B. W.

Lee. 2002. Identification of shared and unique immunoglobulin E epitopes of

the highly conserved tropomyosins in Blomia tropicalis and

Dermatophagoides pteronyssinus. Clin. Exp. Allergy, 32 (8): 1203-1210.

Yim, Y. S., C. W. Park and C. H. Lee. 2001. A comparative study of atopy patch test

using house dust mite antigens with skin prick test and specific serum IgE

level in atopic dermatitis. Korean J. Dermatol., 39 (10): 1072-1079.

Yoshikawa, M. and P. H. Bennett. 1979. Brief note house dust mites in Columbus,

Ohio. Ohio J. Sci., 79 (6): 280-282.

Yuuki, T., Y. Okumura, T. Ando, H. Yamakawa, M. Suko, M. Haida and H.

Okudaira. 1991. Cloning and expression of cDNA coding for the major house

dust mite allergen Der f II in Escherichia coli. Agric. Biol. Chem., 55 (5):

1233-1238.

Yuuki, T., Y. Okumura and H. Okudaira. 1997. Genomic organization and

polymorphisms of the major house dust mite allergen Der f 2. Int. Arch.

Allergy Immunol., 112 (1): 44-48.

Zhang, H. and Y. Kato. 2003. Common structural properties specifically found in

the CS-alpha beta-type antimicrobial peptides in nematodes and mollusks:

evidence for the same evolutionary origin? Dev. Comp. Immunol., 27 (6-7):

499-503.

Zhang, Y. 2008. I-TASSER server for protein 3D structure prediction. BMC.

Bioinformatics, 9: 40.

Zheltikova, T. M., I. G. Ovsyannikova, V. B. Gervazieva, T. A. Platts-Mills, M. D.

Chapman, A. D. Petrova-Nikitina and G. N. Stepanova. 1994. Comparative

detection of mite allergens in house dust of homes in Moscow by enzyme-

linked immunosorbent assay and acarologic analysis. Allergy, 49 (10): 816-

211

819.

Zhou, Y., J. X. Sun, Y.G. Wang, L. Yang, G. F. Ma, Y. B. Cui and X. H. Ji. 2012.

Cloning and expression of the group 16 allergen of Dermatophagoides

farinae. J. Pathogen Biol., 7: 011.

Zock, J. P., J. Heinrich, D. Jarvis, G. Verlato, D. Norbäck, E. Plana, J. Sunyer, S.

Chinn, M. Olivieri, A. Soon, S. Villani, M. Ponzio, A. Dahlman-Hoglund, C.

Svanes and C. Luczynska. 2006. Distribution and determinants of house dust

mite allergens in Europe: the European Community Respiratory Health

Survey II. J. Allergy Clin. Immunol., 118 (3): 682-690.

212

APPENDICES

Appendix-1

213

APPENDIX-2

Supllimentary Figures

S1: Selected sequences of the Der f 1 gene showing two distinct haplotypes: Haplotype1- rows 1, 2 and 3; haplotype2-rows 4 and 5; heterozygous - rows 6 and 7 (RS26 and RS40); and gb|Der-f1 gene (GenBank Accession number X65196).

214

S2: Selected Der p 1 gene sequences aligned in NCBI blastn. gb| Der-p1gene (GenBank accession number X65197.1).

215

APPENDIX-3

Publications

216

217

218

219

220

221

222

223

224

225