Structure-Function Studies of the Human Arylamine KAcetyltransferases
Geoffrey Howard Goodfellow
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Pharmacology University of Toronto
@Copyright by Geoffrey Howard Goodfellow 2001 Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395. rue Wellington Otîawa ON KI A ON4 Ottawa ON KIA ON4 Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant a la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or seU reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de rnicrofiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette Uièse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimes reproduced without the author's ou autrement reproduits sans son permission. autorisation. I Structure-Function Studies of the Human Arylamine N-Acetyltransferases Ph.D. 2001 Geoffrey H. Goodfellow Department of Pharmacology University of Toronto
The human arylamine N-acetyltransferases NATl and NAT2 are cytosolic enzymes that catalyze the acetyl coenzyme A-dependent N-and O-acetylation of primary arylarnine and hydrazine xenobiotics and their hydroxylamine rnetabolites. Despite the high degree of amino acid sequence identity between the 290 amino acid human drug rnetabolizing NATl and NAT2 isozymes (81 %), they exhibit marked differences in their patterns of kinetic selectivity. Amino acid residues 125 and 127 are located in a highly conserved region (aa 107-148) that has been demonstrated to impart NAT kinetic selectivity (Dupret et al., 1994). Residue 125 is an important determinant of NAT2-type substrate selectivity since the replacement of the NATl phe12' residue with the complementary NAT2 residue generated a 220-fold decrease in the Kmvalue for the NAT2-selective substrate SMZ (Goodfellow et ai., 2000). A detailed mutagenesis strategy together with a panel of acceptor amine substrates were used to assess whether the size or hydrogen bonding capabilities of position 125 impart NAT2-type substrate selectivity. Results of the kinetic analyses indicate that increases in the amino .. II acid side-chain volume at position 125 were directly associated with decreases in
NAT2-type kinetic selectivity. AlternativeIy, modifications at position 127 investigated the proposed role of a charge interaction between the positively charged guanidinium group of Arg'" and the negatively charged para-carboxylate group of the NATI- selective substrates in mediating NATI-type substrate specificity. Overall, these studies demonstrated that a positive charge was a necessary element for the high substrate affinity of these NAT1 proteins for the NAT1-selective substrates. Al1 of the NAT1 mutants, except RlZ7+D and RlZ7-tE, had cofactor binding characteristics that were comparable to wild-type NAT1 . iii
I would like to thank my supervisor Dr. Denis Grant for his valuable guidance throughout my graduate studies. In particular, I am very grateful for the support and encouragement to present my research at national and international meetings. I also appreciate the opportunity to develop the skills required to become an inaependent scientist. i would Iike to acknowledge the advice and laughs that 1 have shared with al1 the present and past members of the Grant and Harper labs (Drs. N!cki Hughes, Andrea Gaedigk, Susan Janezic, and Kim Sugamori, and Hillary Chen, Nathan Manning, Rajesh Khanna, Kristi Durette, Marina Tychopolous, Subha Indrarajah, Sharon Wong, Hanan Abramovici, Julie Green, Marg Miller, and Yanping Wang). In particular, I would tike to thank N!cki for both her mentorship and friendship over the years (in spite of her fondness for stale coffee). Many thanks to Kim and Hillary for making life, inside and outside of the lab, a lot more fun. One of the most enjoyable aspects of rny graduate studies has been the great friendships that I have made. ! would like to thank Frank Lee, Drs. Tim Beischlag, Kurt Droll, Adriano Marcese, Mayank Patel, and Judy Wong, and Mei Mei Wang. Certainly some of my fondest mernories were spent with you guys at the pub discussing science and many other topics.
I wish to thank Anne's parents (Ted and Zofia) for their many words of encouragement and support (and Sunday night dinners). Many thanks to Jennifer, Peter, and Jessie for giving me the opportunity to teII lots of "my niece.. .." stories and always being there to listen or Say the right thing. Mom and Dad, 1 cannot express how grateful I am for ail the love and support you have given me during my studies. Mom your 'joi de vivre' is incredible - you continue to amaze and inspire me. Finally, I wish to thank Anne for her patience and iaughter, I cannot imagine how I may have fared this last year without you. Looking forward to out- future, with now just one of us in school. ABSTRACT ...... i ... ACKNOWLEDG EMENTS ...... -III TABLE OF CONTENTS ...... iv ... LIST OF TABLES ...... VIII LIST OF FIGURES...... ix .. ABBREVIATIONS ...... XII
1 Introduction...... 1 11 Xenobiotic biotransformation - an overview ...... 1 1 3.1 Drug metabolizing enzymes ...... 1-1.1 -1 Unique features ...... 1.2 Human arylamine IWacetyltransferases...... m...... 1.2.1 The NAT genes and proteins ...... 1.2.2 NAT expression ...... 1 O 1.2.3 Reactions catalyzed by NATs ...... 1 1 1.2.4 NAT reaction mechanism...... 16 1.2.5 Endogenous rote of NAT1? ...... 19 1.2.6 Human acetylation polymorphism ...... 21 1.2.6.1 Allelic variation at the NAT2 gene locus ...... 24 1.2.6.2 Variant alleles at the NAT1 gene locus ...... 26 1.2.6.3 Functional consequences of allelic variants ...... 27 1.4 Structure-f unction studies ...... 31 1.4.1 Protein structure ...... 32 1.4.1.1 Protein structure prediction rnethods ...... 33 1.4.1 -2 Th ree-dimensional structural information ...... -36 1.4.2 Techniques utilized to investigate protein function ...... 37 1 .4.2.1 Chimeras ...... 37 1.4.2.2 Site-directed mutagenesis ...... 40 1. 5 Structure-function studies of NAT enzymes ...... 44 1.5.1 Structurally related acceptor substrates...... 44 1.5.2 Mechanistic studies ...... -46 1.5.2.1 Chemical modification of NAT proteins ...... 46 1.5.2.2 Active-site inactivatorslinhibitors ...... -48 v 1-5.3 Molecular techniques used to explore NAT structure-function relationships.49 1.5.3.1 Structural characterization studies ...... 49 153.2 NATI/NAT2 chimeras ...... 50 153.3 Site-directed NAT mutants ...... 54 1.6 Rationale and objectives for this study ...... 63 2 Materials and Methods...... 64 2.1 Materials ...... 64 2.2 Methods ...... 68 2.2.1 Standard Methods ...... 68 2.2.1 -1 Bacterial growth conditions ...... -68 2.2.1.2 Isolation of plasrnid DNA ...... 68 2.2.1.3 Polymerase chah reaction (PCR) amplification ...... 70 2.2.1 -4 Restriction endonuclease digestion and DNA fragment isolation ...... 73 2.2.1 -5 DNA sequencing ...... 74 2.2.1.6 NAT enzyme activity...... 76 2.2.1 .6.1 Preparation of the E. coli NAT tysate ...... 76 2.2.1 .6.2 Incubation of lysate with CoASAc and acceptor amines ...... 77 2.2.1.6.3 HPLC quantification of NAT activity ...... 78 2.2.2 Specific protocols ...... -81 2.2.2.1 Construction of NAT1-FI 25 and NAT1-RI 27 mutants ...... 81 2.2.2.2 NAT Stability ...... 83 2.2.2.3 Chernical denaturation studies ...... 85 2.2.2.4 pH activity profiles ...... 85 2.2.2.5 Western blotting procedures ...... -86 2.2.2.6 Purification of GST-NAT fusion proteins ...... 88 2.2.2.6.1 Preparation of E. coji lysate ...... -88 2.2.2.6.2 Glutathione Sepharose 48 affinity chromatography ...... 88 3 Results ...... 90 3.1 Purification of recombinant NATs ...... 90 3.1.1 Verification of nucleotide sequence of GST-NAT1 and GST-NAT2 ...... 91 3.1 -2 Affinity purification ...... 91 3.1.3 NAT Standard Curves ...... 95 3.2 Mutant NAT1 proteins ...... 98 3.2.1 Verification of nucleotide sequences of NAT1-FI 25 and NAT1-RI 27 mutant constructs ...... 98 3.2.2 Expression and immunodetection of recombinant mutant NAT1 proteins .. 101 vi 3.2.3 Kinetic analyses of mutant NAT1 proteins ...... 1 07 3.2.3.1 NAT1-F125s ...... 109 3.2.3.1 .1 Substrate affinities ...... 109 3.2.3.1 -2 Molecular activities ...... 16 3.2.3.1.3 Specificity constants ...... 18 3.2.3.2 NAT1-R127s ...... 120 3.2.3.2.1 Substrate affinities ...... 125 3.2.3.2.2 Molecular activities ...... 128 3.2.3.2.3 Specificity constants ...... 130 3.2.3.2.4 pH activity profiles ...... 132 3.2.4 Stabilities of wild-type and mutant NAT proteins ...... 135 3.2.5 Chemical denaturation studies ...... 138 3.2.6 Cofactor binding ...... 139 4 . Discussion...... m...... m.m...s.....m.I...ms...m...... a...... m...... mm...... 150 4.1 Kinetic parameters of the modified human NAT1 proteins ...... 154 4.1 .1 NAT1-FI 25 Mutants ...... 57 4.1.2 NAT1-RI 27 Mutants ...... 162 4.2 Cofactor binding of wild-type NATs and mutant NAT proteins ...... 170 4.3 Relationship between protein expression, stability, IC,,, and molecular activities for the mutant NAT1 proteins ...... 173 4.4 Summary ...... 175 4.5 Future Studies ...... 176 Appendix 1: HPLC profiles of acetylated standards...... 180 Appendix 2: GST-NAT Expression and Purification ...... 185 A2.1 GST-NAT fusion proteins...m...... 186 A2.1.1 Optimization of expression conditions ...... 186 Appendix 3: Crystal Screen of Human NAT1 ...... m...... rn..194 A3.1 Introduction .....m...... 195 A3.2 Materials and Methods ...... 195 A3.2.1 Materials ...... -195 A322 Methods...... 195 A3.2.2.1 Preparation of Sample ...... 195 A3.2.2.2 Hanging Drop Method ...... 195
viii LISTOF TABLES Table 1: Kinetic selectivity of human NAT proteins...... 9 Table 2: Coding region mutations in human NAT2 that have functional consequences ...... 28 Table 3: Coding region mutations in human NAT1 that have functional consequences ...... 30 Table 4: Kinetic parameters for wild-type and triple mutant NAT proteins...... 59 Table 5: Oligonucleotide primers used for mutagenesis of amino acids 125 and 127 ...... 71 Table 6: Oligonucleotide primers used for sequencing ...... 75 Table 7: HPLC conditions for the optimum separation of each NAT acceptor substrate and acetylated product ...... 79 Table 8: Summary of immunoquantitation of recombinant wild-type and mutant NATs ...... 108 Table 9: Summary of Km values for wild-type and mutant NATl-FI 25 proteins ...... 112 Table 10: Summary of molecular activities for wild-type and mutant NAT1-FI 25 proteins ...... 117 Table 11 : Michaelis-Menten kinetic parameters for wild-type NAT1 and mutant NAT1-RI 27 proteins ...... 123 Table 12: Summary of Kmvalues for wild-type and mutant NATl -RI 27 proteins ...... 126 Table 13: Surnrnary of molecular activities for wild-type and mutant NATl -RI 27 proteins ...... 129 Table 14: In vitro stabilities of wild-type and mutant NAT proteins...... 137 Table 15: Chernical denaturation of wild-type and mutant NAT proteins ...... 140 Table 16: Michaelis-Menten apparent kinetic parameters of NAT proteins for CoASAc ...... 14-4 Table 17: Michaelis-Menten true kinetic parameters for NAT proteins ...... 149 Table 18: Enzyme kinetic parameters for wild-type NAT proteins from several species ...... 164 Table 19: Crystal ScreenTMsolutions ...... 196 Table 20: Crystal S~reen2~~solutions ...... 197 Table 21 : Summary of crystal screen strategies ...... 199 Table 22: Summary of dynamic iight scattering anaiysis of purified NATl protein...... 200 Figure 1: Amino acid sequence identities between the human NAT1 and NAT2 proteins...... 8 Figure 2: Reactions catalysed by NAT...... 13 Figure 3: Potential pathways of aromatic amine detoxification and metabolic .. activation ...... 14 Figure 4: The parallel-line reciprocal plots of ping-pong kinetics...... 18 Figure 5: Proposed role of human NAT1 in folate rnetabolism...... 20 Figure 6: Structures of some representative NAT1-selective and NAT2-selective substrates for hurnan aryiamine N-acetyltransferases...... 23 Figure 7: Commun types of chimeric enzymes created from two homologous parents A and B...... 39 Figure 8: Chemical structures of NAT1-selective substrates and cysteine Selective reagent ...... 47 Figure 9a) : Th ree-dimensional structure of Salmonella typhimurium NAT Figure 9b): Amino acids conserved in mammalian and non-mamrnalian NATs ...... 51 Figure 10: Active site of Salmonella typhimurium NAT...... -52 Figure 11 : Panel of NATVNAT2 chimeric proteins...... 53 Figure 12: Ratios of VmaJKmfor SM2 to those for PAS in wild-type and chirneric NAT proteins...... 55 Figure 13: A highly conserved 25 amino acid segment within the centrai region of the human NAT1 and NAT2 proteins ...... 58 Figure 14: Substrate specificities of wild-type and mutant NAT proteins...... 61 Figure 15: Ratio of V,,/K, for SM2 to those for PAS in wild-type and mutant NAT1 proteins...... 62 Figure 16: Schematic representation of prokaryotic expression vectors (a) pKEN2 and (b) pGEX...... 66 Figure 17: Construction of pNATl expression vector containing the protein coding regions of the NAT1 gene ...... 72 Figure 18: Design of NAT1 mutants...... 82 Figure 19: Isolation of NAT1 Bbv //Sa/ 1 DNA fragment ...... 84 Figure 20: Partial nucleotide sequences of GST-NAT1 and GST-NAT2 fusion proteins...... 92 Figure 21 : Characterization of purified recombinant NAT1 protein...... 94 Figure 22: Development of standard curve for quantitation of NAT1 mutants ...... 96 Figure 23: Relationship between purified NAT1 and NAT2...... 99 Figure 24: lmmunoquantitation of NAT2 molecules ...... 100 X Figure 25: Partial nucleotide sequences of wild-type NAT1 and mutant NAT1- FI25 coding regions...... 102 Figure 26: Partial nucleotide sequences of wild-type NATl and mutant NAT1- RI27 coding regions...... 103 Figure 27: SDS-PAGE and immunoblot analysis of wild-type and mutant NAT1- FI25 proteins...... 104 Figure 28: SDS-PAGE and imrnunoblot analysis of wild-type and mutant NATI- R127proteins ...... 106 Figure 29: Amino acid side-chahs of (a) mutant NAT1-FI 25 proteins and (b) mutant NAT1-RI 27 proteins...... 1 10 Figure 30: Chemical structures of substrates used in the kinetic characterization of NAT1-FI 25 mutant proteins...... 11 1 Figure 31: Substrate specificities of wild-type NAT and mutant NAT1-FI 25 proteins for NAT1-selective substrates PAS and PABA...... 1 14 Figure 32: Substrate specificities of mutant NAT1-FI 25 proteins for sulfonarnide substrates ...... 115 Figure 33: Specificity constants of wild-type NAT and mutant NAT1-FI 25 proteins...... 119 Figure 34: Chemical structures of substrates used in the kinetic characterization of NAT1-RI 27 mutant proteins ...... 122 Figure 35: Substrate specificities of wild-type NAT and mutant NATI-RI27 proteins for NAT1-selective substrates PAS and NAT2-selective substrate SM2...... 124 Figure 36: Specificity constants of wild-type NAT1 and mutant NAT1-RI 27 proteins...... 131 Figure 37: Effect of pH on molecular activity of wild-type NAT and mutant NAT1-RI 27 proteins...... 134 Figure 38: Effect of pH on the specificity constants of wild-type NAT and mutant NAT1-RI 27 proteins...... 136 Figure 39: Double-reciprocal p!ots of I/velocity againçt I/[substrate] for (a) wild- type NAT1, (b) wild-type NAT2, and (c) NAT1-F125S...... 142 Figure 40: Double-reciprocal plots of l/velocity against l/[substrate] for (a) NAT1- FI25Y, (b) NAT1-RI 27E. and (c) NAT1-RI 27K...... 143 Figure 41 : Substrate specificities of wild-type and mutant NAT proteins for cofactor CoASAc...... 145 Figure 42: Determination of true kinetic parameters for recombinant NAT proteins...... 147 Figure 43: Arnino acid sequence alignments of hurnan NATl and S. typhimurium NAT proteins...... Figure 44: Structural mode1 of human NAT1 (aa 29-131) ...... Figure 45: Structural mode1 of human NAT1 active site ...... Figure 46: Effect of amino acid side-chain volume at position 125 on NAT kinetic selectivity ...... Figure 47: Catalytic core of wild-type and mutant NAT1-FI25 proteins ...... Figure 48: Atomic distances in the active site of the hurnan NATl homology mode1...... Figure 49: Effect of para-substituent on substrate affinity for select NAT1-RI 27 mutants...... Figure 50: NAT1 active site loop hydrogen bond network (aa 122-130) ...... Figure 51 : HPLC profiles of acetylated standards for (a) SMUAc.SMZ, (b) SM W Ac-SMR, and (c) SDZIAc-SDZ...... Figure 52: HPLC profiles of acetylatrd standards for (a) SPY/Ac-SPY, (b) PABN Ac-PABA, and (c) pCNAc-pCA...... Figure 53: HPLC profiles of acetylated standards for (a) SAAm/Ac-SAAm, (b) PAA P/Ac-PAAP, and (c) pABIAc-p-AB ...... Figure 54: HPLC profiles of acetylated standards for (a) PAWAc-PAS, (b) TOU Ac-TOL, (c) AN UAc-AN L, and (d) gAPIAc-pA P ...... Figure 55: Effect of growth conditions on NAT activity of GST-NAT1 fusion proteins...... Figure 56: Effect of growth conditions on NAT activity of GST-NAT2 fusion proteins ...... Figure 57: GST-NAT1 expression patterns ...... Figure 58: GST-NAT2 expression patterns ...... Figure 59: GST-NAT1 protein stability ...... 3D-PSSM - three-dimensional position-specific scoring matrix AA - arachidonic acid AAF - acetylaminofluorene AA-NAT - arylalkylam ine N-acetyltransferase AcCoA - see CoASAc AcN - acetonitrile AcNAT - acetyl-enzyme intemiediate AcPABA - acetylated PABA AcpABG - acetylated gaminobenzoylglutamate AcSMZ - acetylated SMZ ADR - adverse drug reaction AF - arninofluorene AFB - aflatoxin BI AMP - adenosine monophosphate ANL - aniline AP-1 - activator protein 1 ATP - adenosine triphospate BL21 - E. coli expression strain (F-omPThsdSgal) BLAST - basic local alignment search tool BSA - bovine serum albumin cDNA - complementary DNA CDNB - 1-chlore-2,4-dinitrobenzene CDTA - trans-l,2-diarninocyclohexane-N,N,N',N'-tetraacetic acid C/EBPa - CCAAT/enhancer binding protein alpha CHO - chinese hamster ovary CI,, - intrinsic clearance, ratio of Vmax to Km CoASAc - acetyl coenzyme A CoASH - deacetylated cofactor CoASAc COCH, - acetyl group COQ- - carboxylate group CPT 1 - carnitine palmitoyltransferase 1 CYP - cytochrome P450 DAC - arylacetamide deacetylase dATP - deoxyadenosine-5'4riphosphate dCTP - deoxycytidine-5'-triphosphate xiii ddH,O - double distilled water DEPC - diethylpyrocarbonate dGTP - deoxyguanosine-5'-triphosphate DLS - dynamic light scattering DMBA - dirnethylaminobenzyaldehyde DMSO - dimethylsulfoxide DNA - deoxyribonucleic acid Dop - dopamine dNTPs - deoxynucleoside triphosphates dsDNA - double stranded DNA DSM - discrete state-space models DTT - dithiothreitoi dTTP - deoxythymidine-5'-triphosphate ECPCR - expression cassette PCR ECL - enhanced cherniluminescence EDTA - ethylenediaminetetracetic acid FAD - flavin adenine dinucleotide FMN - flavin mononucleotide Glu-P-2 - 2-amidodipyrido [1,2-a:3'2'd]irnidazole GnHCl - guanidine hydrochloride GSH - glutathione (y-Glu-Cys-Gly) GST - glutathione S-transferase GTP - guanosine triphospate HCI - hydrochloric acid HCIO, - perchloric acid HPLC - high performance liquid chromatography HRE - hormone response element IC, - median inhibitory concentration IPTG - isopropyl P-D-thiogalactopyranoside kt- catalytic rate constant KCI - potassium chloride Km- Michaelis constant LB - Luria-Bertani MAP - multiple antigenic peptide Mes - 2-(4-morpholinyl) ethanesulfonic acid MgCI, - magnesium chloride Mops - [3-(N-morphdino)-propanesulfonic acid], pH 7.0 xiv mRNA - rnessenger RNA NaCI - sodium chloride NaCIO, - sodium perchlorate NADH - nicotinamide adenine dinucleotide (reduced) NADPH - nicotinamide adenine dinucleotide phosphate (reduced) Nal - sodium iodide NAT - acetyl CoA:arylamine N-acetyltransferase NaOH - sodium hydroxide NEM - N-ethylmaleimide NH,Ac - ammonium acetate NMR - nuclear magnetic resonance NPS@ - Network Protein Sequence Analysis OD - optical density P450 - cytochrome P450 PA - procainamide p-AAP - p-aminoacetophenone p-AB - paminobenzylamine PABA - paminobenzoic acid pABG - paminobenzoylgIutamate PAGE - polyacrylamide gel electrophoresis p-AP - p-aminophenol PAPS - 3'-phosphoadenosine-5'-phosphosulfate PAS - paminosaiicylic acid PaXAT - xeno biotic acetyltransferase f rom Psuedomonas aeruginosa PBS - phosphate-buffered saline p-CA - p-chloroaniline PCR - polymerase chain reaction PDB - protein data bank PEG - polyethylene glycol PG - phenylglyoxal PHD - Profile based neural network prediction p-NP - p-nitrophenol PSA - Protein Structure Analysis PSI BLAST - Position Specific lterated - BLAST PSI PRED - Position Specific lterated Prediction p-TOL - ptoluidine RBS - ribosomal binding site RSV - respiratory syncytial virus RNA - ribonucleic acid RNasel - ribonuclease SCOP - structural ctassification of proteins SDS - sodium dodecyl sulfate SDZ - sulfadiazine SMR - sulfarnerazine SM2 - sulfamethazine SPY - sulfapyridine SRS - substrate recognition site SNAT - Salmonella fyphimurium NAT ssDNA - single stranded DNA SULTs - sulfotransferases t,, t,, - time required for enzyme activity to be reduced to 50% T - absolute temperature TAE - Tridacetic acid/EDTA buffer TEA - triethylamine TE8 - Tris-EDTA pH 8.0 TED - triethanoIamine/EDTA/DTT TEDK - triethanolamine/EDTA/DTT/KCl pH 7.0 TNT - TrislNaCVTween 20 TrEMBL - translations of European Moiecular Biology Laboratory Nucleotide Sequence Database TSE - translational spacer element UDP - uridine 5'-phosphate UGT - gfucuronosyltransferase v - enzyme velocity V,,, - maximal velocity YAC - yeast artificial chromosome YT - yeast tryptone XA90 - E. coli expression strain (F'lacP1) 1 introduction 1.1 Xenobiotic biotransformation - an overview
The concentration of a xenobiotic (a term encompassing both drugs and other foreign chernicals) at its local site of action is strongly influenced by processes that include absorption, distribution, cellular binding, biotransformation, and excretion (Benet et al., 1990). Since all of these processes require that the drug molecule transverse cellular membranes, these compounds are relativeiy iipophilic in nature. However, the same chemical features that enhance the entry of drug molecules into an organism also impair their eiimination from the body. Thus, the overall fate of rnost xenobiotics in the body is primarily dependent on enzyme-catalyzed reactions that increase water solubility and thus enhance excretion (Caldwell, 1988). The characteristic feature that defines the majority of these reactions is that the drug-metabolizing enzymes generate metabolites that are more polar and will not be reabsorbed in the renal and biliary tubules (Alvares and Pratt, 1990). The accompanying consequences of such metabolic conversions include increases, decreases, altered target selectivity, or no change in drug efficacy (or chemical toxicity) (Caldwell, 1988).
The liver is one of the primary sites of drug biotransformation and functions as an anatornical defense for the body frorn drugs absorbed by the small intestine (Arias et al.,
1988). The concerted actions of hepatic and gastrointestinal drug metabolizing enzymes can in some cases prevent high concentrations of the xenobiotic from ever reaching the systemic circulation (also called the first-pass effect). Efforts to elucidate the rnechanisms of organ-specific toxicity and the metabolism of endogenous substrates has led to the identification of xenobiotic-rnetabolizing enzymes in many extrahepatic tissues (Wolf, 1984; Wolf et al., 1985) such as the lung, kidney, bladder, skin, and brain (Connelly and Bridges, 1980; Kapitulnik and Strobel, 1999). The chernical reactions of xenobiotic biotransforrnation (also cornmonly terrned drug metabolism) have historically been classified as phase I or phase II reactions
(Alvares and Pratt, 1990). The phase 1 enzymes participate in functionalization reactions that introduce or release masked chernical moieties (usuaIIy -OH groups) that enhance the substrate's polarity and attractiveness for subsequent phase II conjugation reactions (Caldwell, 1978). Phase 1 reactions include hydrolysis, oxidation, and reduction (Benet et al., 1990). The most dominant and widely studied phase 1 enzyme family is the cytochromes P450 (also referred to as the 'rnonooxygenases' or 'rnixed- function oxidases'), which cataiyze the oxidative metabolism of the rnajority of known xenobiotics as well as many endogenous substrates (Glue and Clernent, 1999). The
P450s are heme proteins located in the srnooth endoplasmic reticulurn of mammalian cells (the rnicrosornal fraction), and in the reduced (ferrous) form react with carbon monoxide to form a complex that has an absorption peak at 450 nm (Alvares and Pratt,
1990). The liver microsornal drug-oxidizing system, which consists of NADPH- cytochrome-P450 reductase, NADH b,-reductase, and the terminal oxidase cytochrorne
P450, utilizes NADPH and NADH as reductants along with rnolecular oxygen (hence the term 'mixed-function') to add a hydroxyl group to a xenobiotic (Ziegler, 1988). Since only one atom of oxygen is incorporated into the substrate with the other oxygen atorn reduced to form water during the oxidation of a single molecule of substrate, these enzymes are also referred to as 'rnonooxygenases' (Alvares and Pratt, 1990).
Phase II reactions of drug metabolisrn involve the conjugation of an endogenous substrate such as glucuronic acid, sulfuric acid, or acetic acid to the parent drug or the phase 1 metabolite (Jakoby, 1988). Early studies in the field of xenobiotic metabolism were primarily concerned with oxidative reactions and viewed conjugation as an inevitable process (Caldwell, 1978). However, detailed studies subsequently showed that the importance of these conjugation reactions are reflected in the cellular cost to utilize these endogenous substrates and that these donor substrates also often
enhanced the rate of elimination of the drug by increasing water-solubility (Jakoby,
1988). Some phase 1 metabolites are acceptor substrates for multiple conjugating
enzymes, and it is still not clear in many instances what factors determine the precise
route of metabolism.
Some enzymes involved in drug biotransformation can also metabolize
endogenous compounds (e.g. steroid-hydroxylating and fatty acid-hydroxylating cytochromes P450), whereas for many others the endogenous substrates, if any exist,
rernain unknown (e-g. arylamine N-acetyltransferase). Although enzyme function was
initially classified using these types of observations, more recent efforts have been
made to move towards a classification based on commonality of evolutionary origin
according to sequence homology (Testa et al., 1981; Jenner et al., 1983). Why or how
did animals acquire these drug-metabolizing enzymes long before they were ever
exposed to these compounds? The cytochrome P450 superfarnily offers an excellent
opportunity to explore this question. The ancestral prokaryotic CYP gene is estimated to have emerged as early as 3500 million years ago (mya) when the atmosphere was
prirnarily carbon dioxide and nitrogen (Nelson et al., 1993). Roughly 2000 mya, levels
of atmospheric oxygen began to rise and these enzymes started utilizing oxygen (Lewis
et al., 1998). However, it was not until after the evolution of the terrestrial biota during
the Devonian period 400 mya (Lewis et a/., 1998) that the diversity of the P450
superfamily originated, presumably as a direct result of the warfare between plants and
animals (Schuler, 1996). The dietary origin of terrestrial animals was a significant
selection pressure that further expanded the range of substrates that these enzymes
could accommodate (Gonzalez and Nebert, 1990).
There is a multitude of non-genetic factors that may affect the manner in which a
chernical compound is metabolized by an individual, including environmental chernical -3- exposures, age, gender, diet, and pathology (Caldwell, 1988). For instance, polycyclic aromatic hydrocarbons, polychlorinated biphenyls, alkylbenzenes, pesticides, and herbicides are a diverse group of xenobiotics that share the cornmonalty of eliciting an increase in gene expression by a process called enzyme induction (Caldwell, 1988). In general, the activity of drug-metabolizing enzymes is lowest at birth, increases to maximum levels within weeks post parturn, and then declines in an age-dependent manner (Alvares and Pratt. 1990). The rat is the only species in which clear differences are observed in drug metabolism between males and females (Caldwell, 1988). A variety of foodstuffs such as cruciferous vegetables, charcoal grilled food, grapefruit juice, psoralens, and alcohol are capable of modulating the level or activities of drug- metabolizing enzymes (Glue and Clement, 1999). In addition, obesity has been dernonstrated to elicit isozyme-selective effects on cytochrorne P450 enzyme activities
(Kotlyar and Carson, 1999). Furthemore, a reduction in metabolic capacity is observed for individuals with liver disease that may be attributed to a decrease in the amount of enzyme or cofactor (Tanaka, 1998).
1.1 .1 Drug metabolizing enzymes
1.1.1.1 Unique features
Organisms display two key adaptations with in their farn ilies of drug metabolizing enzymes that have provided themselves the capability to biotransform virtually any chemical compound to which they are exposed. The two distinct features of enzymes involved in drug metabolism are enzyme multiplicity and broad substrate specificity.
Many of the enzymes responsible for the biotransformation of xenobiotics, such as glutathione S-transferases (Eaton and Bammler, 1999; Strange et al., 2000), sulfotransferases (Coughtrie et al., 1998), UDP-glucuronyltransferases (Meech and
Mackenzie, 1997), methyltransferases (Weinshilboum et al., 1999), flavin-containing rnonooxygenases (Ziegler, 1990; Hines et al., 1994), and arylarnine N- -4- acetyltransferases (Grant et al., 1997; Hein, 2000),have multiple isofoms. However, the most extreme example is that of the cytochromes P450. The versatility of this biological catalyst is unrnatched with 17 farnilies of human CYP genes (of which at least
II are expressed in the liver (Crespi and Miller, 1999)) and greater than 1000 cytochrome P450 sequences identified among al1 species (Nelson, 1999). The diverse classes of organic substrates that are oxidized by these enzymes include a vast number of natural and synthetic xenobiotics and physiological steroids and lipids. It has been estimated that the potential number of substrates for the cytochromes P450 could exceed one million (Coon, 1998).
Drug rnetabolizing enzymes appear at times to have the best of both worlds; many exhibit a wide and often overlapping pattern of substrate selectivity, yet others maintain a rigid positional and stereochernical specificity for physiological chernical mediators. The cytochrome P450 families 1-3 are primarily responsible for the bulk of xenobiotic metabolism performed by this superfamily, whereas the other 14 farnilies utilize steroids or steroid precursors as their substrates (Nelson, 1999). One of the primary determinants for the remarkable versatility of the cytochrome P450 isozymes may be the multiple distinct species of activated oxygen (nucleophilic peroxo-iron, nucleophilic or electrophilic hydroperoxo-iron, and electrophilic oxenoid iron) that are observed in P450 active sites (Vaz et al., 1996; Vaz et al., 1998). CYP3A4 is a relevant exarnple of a P450 that displays these characteristics, since it has "specificity" for a remarkably diverse range of substrates including both xenobiotics and physiological compounds (Li et al., 1995). This cytochrome P450 is the rnost abundant P450 enzyme in the liver (- 30% of total P450) and is susceptible to modulation by both environmental factors and drug therapy (Waxman, 1999). The active site of CYP3A4 is accommodating to numerous substrates and has the capacity to catalyze a variety of enzymatic reactions such as: N-oxidation (acetaminophen), C-oxidation (aflatoxin B,), N-dealkylation (terfenndine), G-hydroxylation (testosterone), and N-demethylation
(tamoxifen) (Li et al., 1995).
1.2 Human arylamine Nacetyltransferases
1-2.1 The NAT genes and proteins
The arylamine N-acetyltransferases catalyze phase II xenobiotic
biotransformation reactions by incorporating several of the characteristics described in the previous section. The human NAT genes, NATI, NAT2, and NATP, are located on chromosome 8 (pter-qll) (Blum et al., 1990) and have been more precisely mapped to the short arm in the region 8~21.3-23.1for both NATgenes (Hickman et al., 1994) and
8p22 for NAT2 (Franke et al., 1994). Interestingly, the NAT2 gene mapped to a single
band on the short arrn of chromosome 8 (Franke et al., 1994) in a region frequently
deleted in bladder cancer patients (Knowles et al., 1993). A detailed mapping study
using YAC clones containing the human NAT genes and microsatellite markers
revealed that the NATl and NAT2 genes are between 170 to 360 kb apart, while only
140 kb separates NAT2 and NATP (Matas et ai., 1997). The NAT genes are intronless
with a single open reading frame of 870 bp. The coding and noncoding regions of
NAT1 are contained in a single exon, whereas a 5'-noncoding exon of NAT2 is 8 kb
upstream from its coding and 3'-noncoding regions (Ebisawa and Deguchi, 1991). On the other hand, the NATP gene is considered to be a pseudogene due to the presence
of at least 8 mutations that introduce temination signais and presumably lead to a loss
of protein function.
The 290 amino acid cytosolic human NATl and NAT2 proteins are products of the NATl and NA T2 genes, respectively (Blum et al, 1990). The molecular masses of the NAT1 and NAT2 proteins are calculated to be 33,898 daltons and 33,542 daltons, respectively, from their deduced amino acid sequences (Blum et al., 1990). Similar immunochemical characteristics of the native human NATs and those expressed in prokaryotic and eukaryotic recombinant systems suggest that these proteins do not undergo any posttranslational modifications (Blum et al., 1990; Dupret and Grant,
1992). The isoelectric point for human NAT2 is 4.8-4.9, but is still unknown for NATl
(Grant and Meyer, 1993). The liver of human rapid acetylators has been estimated to contain leveis of NAT2 protein that account for less than 0.01% of total soluble intracellular hepatocyte protein (Grant and Meyer, 1993).
NAT1 and NAT2 share 81% amino acid sequence identity, and of their 55 amino acid differences, only 28 (10%) are nonconserved (Figure 1) (Blum et al., 1990).
Despite the high degree of amino acid sequence identity between human NAT1 and
NAT2, these proteins exhibit distinct kinetic setectivities (Grant et al., 1991). This observation has provided a key foundation for the investigations into the structure- function relationships of the human NAT proteins described in this thesis. NATl and
NAT2 possess a high degree of selectivity for the acceptor amine substrates PAS and
SMZ, respectively (Table 1). This haç enabled investigators to employ these substrates as kinetic probes to monitor the catalytic behavior of both the wild-type (Grant et al.,
1991) and modified NAT proteins (Dupret et al., 1994; Goodfellow et aL, 2000).
TABLE1 Kinetic selectivity of human NA T proteins
These recombinant NAT proteins were heterologously expressed in E. coli (Dupret et al., 1994) 1-2.2 NAT expression
A thorough understanding of the factors that control the expression and regulation at both the protein and gene level are complementary to the type of structure- function investigations that are central to this thesis. In general, the NAT1 enzymic activity is ubiquitous, whereas NAT2 activity is more restricted to Iiver and gut. The diverse range of human tissues in which NAT1 activity has been observed include: bladder (Janezic, 1998), red blood cells (Drayer et a/., 1974; Ward et al., 1992) leukocytes (Cribb et al., 1Wl), colon (Ilett et al., 1994), placenta (Derewlany et al.,
1994), mammary gland cytosol (Sadrieh et al., 1996), pancreas (Anderson et al., 1997), intestine (Hickman et al., 1998), pineal gland (Heim et al., 1991), and skin (Kawakubo and Ohkido, 1998). Furthermore, there is immunochemical evidence that this NAT1 activity can be attributed to NATl protein located in tissues such as bladder epithelial tissue (Stanley et al., 1996) and bladder cytosol (Janezic, 1998). Recent research efforts have explored the cellular expression patterns of the human NATs by the deterrnination of their mRNA levels within select tissues (Debiec-Rychter et al., 1999;
Windrnill et al., 2000). Interestingly, one study has reported that the expression of human NAT2 was not liver and gut-specific, but in fact displayed a widespread tissue distribution akin to NATl (Windmill et al., 2000). It is likely that differences in the translational control of the NAT mRNA transcripts play a roie in the observed differential tissue distribution of the human NATs.
The NATl transcript is encoded in a single exon with a minimum promoter sequence, containing an AP-1 like binding site, residing 97 to 116 bases upstream of the open reading frame (Minchin, 1998). This region also contains a binding site for the protooncogene c-Fos that may have implications on cellular homeostasis. At the protein level, there is evidence that prolonged exposure to NAT1-selective substrates can directly down-regulate NATl enzymic activity and NATl protein levels in cultured -1 0- cells (Butcher et ai-, 2000). In addition, the mouse Nat2 gene, which shows the highest sequence similarity with human NATI, has a hormone response element (HRE) in its 5' flanking sequence (Estrada-Rodgers et al., 1998a) that appears to be androgen responsive in the kidneys of male mice (Estrada et al., 2000). On the other hand, liver specific transcriptional response elements, such as C/EBPc( and DPB, have been identified at numerous sites upstream of the human NAT2 gene (DMG, unpublished observations).
Homogenates of the pineal gland are capable of acetylating arylalkylamine substrates such as serotonin (Klein et al., 1981) and arylamine substrates such as phenetidine and aniline (Voisin et al., 1984). Although human NATl is present in the pineal gland, kinetic analyses of the expressed protein products revealed that it is not responsible for the acetylation of serotonin (Heim et al., 1991). A distinct enzyme, arylalkylamine Kacetyltransferase (AA-NAT, EC 2.3.1.87), catalyzes the rate limiting step of serotonin+ N-acetykerotonin in the production of melatonin. The amino acid sequence identity between human NATl and AA-NAT is relatively low (-8%), however protein function is often more conserved than the Iinear amino acid sequence. Despite the similarity in the substrates acetylated by these proteins, marked differences in their patterns of regulation were observed in immortalized retinal cells (Gaudet et al., 1993).
Moreover, there is a remarkable robustness in the increase of AA-NAT gene transcription and acetylation activity during the night that is not observed for the NAT genes and gene products (Borjigin et al., 1595).
1.2.3 Reactions catalyzed by NATs
Although NATs are best known for their ability to N-acetylate primary aromatic amines, they are in fact capable of conjugating acetate to a variety of potential acceptor substrates. The following reactions have been demonstrated or proposed to be catalysed by NAT from human or other mammalian sources (Figure 2): 1) N-acetylation -1 1- of primary aromatic amines; 2) N-acetylation of primary aromatic hydrazines; 3) N-
acetylation of primary heterocyclic amines; 4) N-acetylation of hydroxylamines; 5) N-
acetylation of acetoxy esters; 6) O-acetylation of hydroxylamines; 7) Oacetylation of
arylhydroxamic acids; and 8) intramolecular N, Gacyltransfer of arylhydroxamic acids
(Hein, 1988). All but the last of these reactions requires donation of acetate from the
essential cofactor CoASAc in a two-step reaction (see Section 1-24). Another common
feature for these reactions is that acetate is transferred to a nitrogen or oxygen atom
directly attached to a homo- or heterocyclic aromatic ring or separatea from it by no
more than one intervening nitrogen atom. Indeed, aliphatic and arylalkylamines are very
poor substrates for NAT-mediated acetylation (Namboodiri et al., 1987; Gaudet et al.,
1991).
The ability of NAT enzymes to transfer acetate to either nitrogen or oxygen atoms
in the vicinity of aromatic nngs is important from a toxicological perspective, especially in the context of arylamine-induced cancers. It is now generally accepted that arylamine
carcinogens, such as benzidine, P-naphthylamine, 2-aminofluorene and 4-
aminobiphenyl, are not toxic by themselves and require 'metabolic activation' by drug-
metabolizing enzymes to form reactive DNA- and protein-binding metabolites to fulfill their carcinogenic potential (Miller and Miller, 1981; Shields and Harris, 1991) and lead to cellular cytotoxicity, respectively (Hein, 1988) (Figure 3). The ultimate fate of a given
arylamine is complex and dependent on the relative tissue levels of each enzyme
involved in the pathway (each being subject to its own genetic variability) and the competing catalytic specificities of these enzymes for a common substrate. 1) N-acetylation of primary aromatic amines
2) N-acetylation of primary aromatic hydrazines
3) N-acetylation of primary heterocyclic amines
4) N-acetylation of hydroxylamines
5) N-acetylation of acetoxy esters OAc -Ri-\)- \H
6) Oacetylation of hydroxylamines
7) Oacetylation of arylhydroxamic acids
8) intramolecular N,O-acyltransfer of arylhydroxamic acids.
/OH / OAC \AC 'H
Figure 2: Reactions catalyzed by NAT. The numbers on the left represent each of the eight reactions listed in section 1.2.3. Heterocyclic amines (shown in reaction 3) can also undergo reactions 4 through 8. Ac represents an acetyl functional group and has the chernical structure of (-COCH3). ARYLAMINE
NAT ,H Ar- N 0 DAC 'AC 0 O-Gluc ST/ I I ~r-rd
1 UDPGT / / 1
,O-AC Ar- N
Ar- N Ar- N
1 ARYLAMINE NAT N-ACETYLTRANSFERASE 2 ARYLACETAMIDE 3 N-GLUCURONIDE OAT GACETYLTRANSFERASE 4 N-SULFATE 5 HYDROXYLAMINE N,O-AT N,OACYLTRANSFERASE 6 ARYLHYDROXAMIC AClD 7 DGLUCURONYLHYDROXAMIC ACID DAC DEACETYLASE 8 GLUCURONYLOXY ESTER 9 N-HYDROXY-N-GLUCURONIDE CYP1A2 CYTOCHROME P4501A2 10 SULFHYDROXYLAMINE 11 ACETOXY ESTER PHs PROSTAGLANDIN H SYNTHASE 12 ACETOXY ACETAMIDE 13 WACETYL SULFONYLOXY ESTER UDPGT GLUCURONOSYLTRANSFERASE 14 ARYLNITRENIUM ION ST SULFOTRANSFERASE (NAT = OAT = N,O-AT)
Figure 3: Potential pathways of aromatic amine detoxification and metabolic activation. For abbreviations not listed in the legend above, Ar represents aryl, Ac represents an acetyl group (-COCH,), Giuc represents a glucuronate moiety, and SO,H represents a sulfate group. N-acetylation, sulfation, and glucuronidation fomi relatively stable and unreactive
N-acetates, N-sulfates, and N-glucuronides, respectively, and together compete for the substrate to prevent the hydroxylation step. However, the competing critical step in this process of rnetabolic activation is the N-oxidation of the arylamine or arylarnide, mediated by cytochrome P450 1A2 (Guengerich, 1992) or prostaglandin H synthase
(Eling and Curtis, 1992), to produce the more reactive hydroxylamines and arylhydroxamic acids, respectively. In turn, the subsequent acetylation reactions (N- acetylation, O-acetylation, and N,O-acetyltransfer) generate the highly reactive acetoxy and N-acetyl-acetoxy esters. Sulfotransferases and UGTs can also rnetabolize the hydroxylarnines or hydroxamic acids into sulfate or glucuronide esters (Orzechowski et al., 1994; Chou et al., 1995)- It is these compounds, the various esters described above, that are regarded as the ultimate carcinogen and can spontaneously decompose into electrophilic protein- or DNA-binding nitreniurn ions (Boteju and Hanna, 1994)
(Figure 3). Another important component in this complex scheme is the microsomal enzyme arylacetamide deacetylase (DAC) (Probst et al., 1994) which cornpetes in the reverse direction with NAT catalyzed reactions. The balance between DAC and the
NATs is thus another important consideration in the prediction of the arylamine carcinogenic potential.
Only 'NAT' has been used in this description above and no specific details about the individual ability of each NAT isozyrne (NAT1 and NAT2) to rnetabolize homo- and heterocyclic arylamine carcinogens has been considered. Thus, it is important to state that both hurnan NAT1 and NAT2 have been shown to catalyze the N-acetylation of carcinogenic arylarnines (Minchin et al., 1992; Hein et al., 1993b), the O-acetylation of their hydroxylamine metabolites (Minchin et al., 1992; Hein et al., 1993b) and, to a lirnited extent, the intramolecular N,Oacetyltransfer (Hein et al., 1993b). However, in humans the ability to N-acetylate heterocyclic arylamines is at best only a minor pathway in the elimination of these compounds (Hein et al., 1993b; Wild et al., 1995). In fact, 2-aminodipyrido [1 ,2-a:3'Z1d]imidazole (Glu-P-2) (Hein et al., 1993b) and batracylin
(Stevens et al., 1999) are two examples of a select few heterocyclic arylamines that are acetylated to any significant degree. This suggests that in the context of the metabolic pathway of arylamine carcinogens, heterocyclic aromatic amines must first be activated by CYPI A2 to ultimately produce mutagenic acetoxy ester breakdown products (Wild et ai,, 1995).
1.2.4 NAT reaction mechanism
Except for intramolecular N, Oacetyltransfer (Figure 2),acetylation is thought to proceed via a two-step, substituted-enzyme (so-called 'ping-pong', 'Bi-Bi') kinetic mechanism (Weber and Cohen, 1967). A ping-pong reaction mechanism involves an enzyme oscillating between two or more stable forms in which a product is released before another substrate is added, while the term 'Bi-Bi' refers to a two-substrate and two-product reaction (Cleland, 1963). With regard to NAT, the overail catalytic process involves the two distinct substrates and two separate reactions shown below:
NAT + COASAC - AC-NAT + COASH (1)
Ac-NAT + Ar-NH2 - Ar-NHAc + NAT (2)
In the first reaction (l},an acetyl group (-COCH3, abbreviated as Ac) is covalently transferred from the donor substrate, CoASAc, to the active site of the NAT enzyme, to produce an activated acetyl-enzyme intemediate (AcNAT). In the second reaction (2), the acetate is then covalently transferred from thê enzyme to the nitrogen or oxygen atom of an acceptor substrate (shown above for transfer to the nitrogen atorn of an aromatic amine) to produce the ultimate acetylated product and regenewte the acetate- free enzyme (NAT) which is then ready to participate in another catalytic cycle.
A characteristic of an enzyme exhibiting ping-pong kinetics is that families of parallel Iines are obtained from Lineweaver-Burk plots (I/velocity versus l/[substrate]) when the concentration of substrate A is varied at different fixed concentrations of substrate B (Fersht, 1985) (Figure 4). The ping-pong nature of the acetylation reaction has been well documented in numerous studies (Weber and Cohen, 1968; Steinberg et al., 1971; Kilbane et al., 1991) including those from our own laboratory (Goodfellow et al., 2000).
The determination of M ichaelis-Menten kinetic parameters for enzymes displaying ping-pong kinetics is dependent on the concentration of one of the substrates being held constant, and values thus obtained are referred to as 'apparent' vatues.
Determination of the 'true' maximal velocity (V,,J and Michaelis constant (Km;an experirnental approximation of substrate affinity) requires that each of the two subsfrates be fixed in turn while the other is varied. These primary kinetic data are then used in series of Iinear transformations to calculate the 'true' kinetic constants (Cornish-Bowden and Wharton, 1988) or alternatively nonlinear regression is used to analyze the primary data with respect to the other substrate. On the other hand, multiple nonlinear regression is able to analyze the primary kinetic data in a single step with the following equafion (Cornish-Bowden and Wharton, 1988):
v = V_blKma + Kmb + ab where v = rate of formation of the N-acetylated product; V,, = maximal velocity; a = concentration of CoASAc; b = concentration of acceptor amine; Km = Michaelis constant for CoASAc; and Km= Michaelis constant for the acceptor amine for NAT catalysed reactions. In practice, physiologically relevant kinetic parameters for NAT enzymes Figure 4: The characteristic parallel-Iine reciprocal plots of ping-pong kineticç. As the concentration of the second substrate (B) in the reaction sequence is increased, Vmax (Vordinate intercept) increases along with the Km (-l/abscissa intercept) for the first substrate. Catalytic efficiency (VmaxlKm), the reciprocal of the siope remains constant- Abbreviations used are: v represents the enzyme velocity, [SI the substrate concentration of the first substrate; and [BI the substrate concentration of the second substrate.
(from Fersht, 1985) may be obtained experimentally by maintaining the concentration of CoASAc at a constant level (usually 100 PM) using assays that ernploy an auxiliary substrate/enzyme pair (such as acetyl-DL-carnitinekamitineacetyltransferase) as a CoASAc-regenerating system (Andres et ab, 1985). A concentration of 100 pM CoASAc is similar to the estimated physiological concentration of this compound in Iiver cytoplasm (Siess et al.,
1976). Under such conditions of fixed cofactor supply, enzyme kinetic parameters may then be derived by non-linear regression of enzyme activity data (or linear regression of transforrned data) generated by measuring enzyme velocity (v) at varying acceptor substrate [SI levels, using the standard Michaelis-Menten kinetic equation:
v = v,, ISY(K, + [SI)
1-2.5 Endogenous role of NAT1?
Although there is some evidence that the arylamine N-acetyltransferases play a role in human embryonic development by catalyzing a key step in folic acid metabolism
(Figure 5), the definitive experiments have yet to be performed. ln microbrial folate catabolism the sulfonamides competitively antagonize the incorporation of an essential cofactor, PABA, to prevent the formation of dihydropteroate (Anand, 1996). Thus,
PABA and the sulfonamides are chernical compounds that participate in the catalytic reactions for both NAT1 and dihydropteroate synthase. Studies have demonstrated that human NAT1 expressed in marnmalian (Minchin, 1995) or bacterial (Ward et al., 1995) cells is capable of acetylating the folic acid catabolite p-arninobenzoylglutamate (pABG).
Furthermore, during pregnancy there is a concomitant increase in folic acid catabolism and excretion of the N-acetylated pABG (AcpABG) metabolite (Geoghegan et al., 1995).
These results together may provide an explanation for the clinical observations that the intake of sufficient amounts of folate provides protection against the occurrence of neural tube defects (Group, 1991). sulfonamides Y DHP folate dihydropteroatee-6-
dihydrofolate
tetrahydrofolate formate
1O-formyl tetrahydrofolate
5,10-methylene pimëq tetrahydrofolate
5-formyl tetrahydrofolate
Figure 5: Proposed role of human NAT1 in folate metabolism. Mammalian species require folate in their diet, whereas microorganisms cannot utilize exogenous folate and must synthesize tetrahydrofolate. Sulfonamides are cornpetitive inhibitors of the incorporation of PABA by dihydropteroate synthase. pABG and AcpABG represent p- aminobenzoylglutamate and its acetylated metabolite, respectively, and DHP represents 7,8-dihydro-6-hydroxymethylpterin-pyrophosphate. Human NAT1 enzyrnic activity car? be detected starting in the first trimester for both fetal iiver (Meisel et al., 1986; Pacifici et al., 1986) and placenta1 tissue (Smelt et al., 2000). The gene encoding the mouse isozyme NAT2, the murine homologue of human NAT1, is present prior to neurulation (Payton et al., 1999) and its protein products have been localized to developing neuronal tissue by immunochemical staining (Stanley et al., 1998). Subsequent studies in hurnans have shown that NAT1 is also expressed before the onset of neurulation and that indeed the variation in NAT1 activity may be a risk factor for neural tube defects (Smelt et al., 2000).
Polyrnorphisms in drug metabolizing enzymes have yet to be directly Iinked to any serious developrnental or physiological defects (Gonzalez, 1998). Thus, hurnans rnay have evolved such that we only require these enzymes to combat foreign chemicals. From studies in our lab, we have identified individuals that have markedly reduced NAT2 activity and lack NAT1 function, yet appear normal (Janezic, 1998). In addition, mammals such as canids (Trepanier et al., 1997) and the suncus murinus
(Nakura et al., 1995) completely lack the genes encoding for arylamine N- acetyltransferase. Are NATs simply not required for the normal developmental process or is another similar enzyme compensating for the lack of NAT function? More definitive answers about the physiological roles of drug metabolizing enzymes can be addressed through the use of gene-knockout technology (Gonzalez, 1998). Studies of this nature are currently in progress in severai labs and will shortly shed much light on this intriguing area of NAT research.
1.2.6 Human acetylation polymorphism
Many genetic variants of drug-metabolizing enzymes exhibit monogenic traits that yield at least two distinct phenotypes and since the frequency of the rarest is greater than 1% in a tested population, these variants are thus referred to as polymorphic in nature (Vogel and Motulsky, 1979). The variable acetylation of select acceptor amine substrates by the human arylamine N-acetyltransferases is one of most well studied and characterized polymorphisms of drug metabolism. It has been almost
50 years since a marked interindividual variation in the elimination of the antituberculosis agent isoniazid was first reported (Bonicke and Reif, 1953). Prior to the identification of the molecular defect for the acetylation polymorphism, it was apparent that two distinct classes of substrates existed. The first class, referred to as the
'polymorphic' substrates, displayed patterns of elimination that correlated with the isoniazid acetylator phenotype. Some examples of these su bstrates include sulfamethazine and several other sulfonamides such as procainamide and hydralazine
(Figure 6). AIthough each of these substrates could potentially be used as metabolic probes to determine the isoniazid acetylator phenotype, the innocuous compound caffeine is now routinely used for acetylator phenotyping (Grant et al., 1984). On the other hand, there are also those substrates such as p-aminosalicylic acid (PAS) and p-aminobenzoic acid (PABA) (Figure 6), the so-called 'monomorphic' substrates that are highly acetylated in vivo and in vitro independent of the isoniazid acetylator phenotype.
It was first proposed in 1965 by Jenne that: 1) there are two distinct acetylating enzymes; and 2) the acetylation polymorphism results from differing amounts of one of these enzymes. However, further definitive evidence was not provided for at least twenty-five more years until rnolecular and biochernical approaches demonstrated that the NAT2 gene tocus is the site of the acetylation polymorphism (Blum et al., 1990;
Ohsako and Deguchi, 1990; Grant et al., 1991). In addition, the cytosols of human livers frorn phenotypically slow acetylators exhibit marked reductions in the amount of immunoreactive NAT2 protein (Blum et al., 1990; Grant et aL, 1990). On the other hand, the protein product of the NAT1 gene, NATI, migrates differently from NAT2 on 1 sulfamethazine (SMZ) NH2 z p-aminobenzoic acid -%/"y1 NH (PABA) hydralazine N
procainamide (PA) paminosalicylic acid 8 (PAS)
ccpolymorphic"substrates "monomorphic" substrates NA T2-selective NA TI-seledive
Figure 6: Structures of some representative NAT1-selective and NAT2-selective substrates for human arylamine N- acetyltransferases. SDS-PAGE gels and displays a kinetic selectivity for the 'monomorphic' substrates PAS and PABA that is independent of the acetylator phenotype (Grant et al., 1991).
1.2.6.1 Allelic variation at the NAT2 gene locus
To date, 27 variant NAT2 alleles have been identified in human populations (Hein et al., 2000). It has been estimated inat the variant NAT2*5 A, B, C, *A, and *7B alleles account for greater than 99% of the slow acetylator phenotypes in Caucasian populations (Meyer and Zanger, 1997). lnterethnic differences do exist for NAT2 allele frequencies, with Caucasian populations having a high incidence of the NAT2*5 allele, whereas it is quite rare in Orientals (Grant et ai., 1997; Meyer and Zanger, 1997). Thus the marked differences in the incidence of the slow acetylator phenotype between
Caucasians (40-70%) and Orientals (10-30%) is primarily a result of the higher frequency of lle'l4+~hr mutation of the variant NAT2 5 protein in the former groups
(Grant et al., 1997; Meyer and Zanger, 1997). The ~r~'~+~lnsubstitution of NAT2 14 is relatively common in African-Americans and Native Africans, but rarely observed in
Caucasian populations (Grant et al., 1997; Meyer and Zanger, 1997). Studies in Our lab have also identified an ethnic group, the Inuit, that have the highest reported frequency
(0.789) of rapid NAT2 acetylator alleles (Chen, 1996). The continuous discovery of novel NAT2 variants is increasing the potential for misclassifications of phenotype predictions from an individual's genotype (Hein, 2000). However, others contend that it is only necessary to determine the 'phase' of mutations that rnay potentially be ambiguous and only report those that lead to altered catalytic activity (Delornenie et al.,
1996).
Several groups have demonstrated that the reduction in the in vivo elimination of
'polymorphic' drugs such as isoniazid and sulfamethazine correlates with the presence of select NAT2 allelic variants (Deguchi et al., 1990; Ohsako and Deguchi, 1990; Blum et al., 1991; Hickman and Sim, 1991; Vatsis et al., 1991). Most of the variant NAT2
proteins that are associated with functional decreases in acetylation activity
concomitantly exhibit decreased levels of immunoreactive NAT protein in human liver
cytosol (Grant et al., 1990). However, wild-type and variant NAT proteins exhibit simiiar
levels of immunoreactive NAT protein in prokaryotic expression systems, suggesting
that the machinery required to remove inactive NAT proteins is presumably more
efficient in eukaryotic systems. Moreover, a recent study involving the expression of
hurnan NAT2 variants in yeast has provided evidence that alternative mechanisms may
exist for the development of the slow acetylator phenotype (Leff et al., 1999).
One of the consequences of allelic variation at the NAT2 gene locus is that select
individuals may be predisposed to the onset of various cancers or disease. A host of
contributing factors such as the target tissue, carcinogenic exposure, and other
competing metabolizing enzymes also play an important role in the etiology of the
cancer (reviewed recently in (Taningher et al., 1999; Hein et al., 2000)). Numerous
studies have investigated the association of slow and rapid NAT2 acetylators with
cancers found in colorectal, bladder, lung, and pharyngeal tissue. For instance, some
investigators have reported an association between the rapid acetylator phenotype and
colon cancer (Lang et al., 1986; Gil and Lechner, 19981, whereas others have not
(Probst-Hensch et al., 1995; Hubbard et al., 1997). One of the consequences of
exposure to aromatic amines, either in the workplace or through cigarette smoking, is
bladder cancer (Evans, 1989). The roie of the acetylation polymorphism as a risk factor for bladder cancer was assessed for al1 reports in the literature and a common odds
ratio weighted for sample size, but not stratified for smoking, age, sex, and occupation, was 1.3 (Brockmoller et al., 1998). Overall, this suggests that perhaps exposure is the
key factor and that NAT2 acetylator status may only modestly alter the risk for bladder cancer. However, given the prevalence of slow acetylators in the population the attributable risk is high.
1.2.6.2 Variant alleles at the NAT7 gene locus
Monomorphic substrates, such as PAS and PABA, are highly acetylated in vivo and in vitro, yet their distributions do not correlate with the isoniazid acetylator phenotypes (Grant et al., 1991 ). This independent expression pattern of NATl activity has also been demonstrated to exhibit a marked interindividual variation in the rates of formation of the acetylated NATl -selective substrates (Cribb et al., 1991 ; Grant et al.,
1991; Ward et al., 1992; Weber and Vatsis, 1993). A bimodal distribution of the acetylated metabolite of the innocuous metabolic probe drug PAS was observed in 130 healthy subjects (Grant et ai-, 1992b). Subsequent studies have examined both in vivo and in vitro indices of NAT1 function with PAS and also observed a highly variable pattern of acetylation (Hughes et al., 1998). Others have reported sirnilar findings with a bimodal distribution of peripheral blood mononuclear cell NATI activity in 85 individuals
(Butcher et al., 1998).
The widespread tissue distribution of human NAT1 (Windmilt et al., 2000) together with the polymorphic nature of this protein suggest that it Iikely plays a critical role in the local activation of arylarnine carcinogens and thus the etiology of various cancers. For exampte, an association between the NATI*IO allele and colorectal cancer has been reported, with an increased risk for individuals who also possess the
NAT2 rapid acetylator phenotype (Bell et al., 1995b). However, two studies contradict this finding and report no association between the NAT1 *IO allele and colorectal cancer
(Probst-Hensch et al., 1996; Lin et al*, 1998). There are two confounding variables that may explain these discrepancies: NATI *IO and NA TZ*4 are Iinked (Smelt et al., 1 998;
Henning et al., 1999) and the novel NA T1*14A allele was not detected with conventional NATI*IO genotyping assays (Butcher et al., 1998). On the other hand, some studies have also suggested that the NATI*IO allelic variant is associated with the elevated NAT1 activity in bladder and colon tissue (Bell et al., 1995a) and increased carcinogenic-DNA adduct bindirig in urinary bladder tissue (Badawi et al., 1995).
However, others (Butcher et al., 1998; Hughes et al., 1998) have not yet been able to confim that these mutations in the po!yadenylation signal (T'O"A and c'~A)lead to any increases in NAT1 functional activity.
1.2.6.3 Functional consequences of allelic variants
Point mutations generating polymorphic enzyme variants that modify a select drug biotransformation reaction may alter the disposition or fate of a drug and subdivide human populations into so-called 'extensive-rnetabolizer' and 'poor-metabolizer' groups-
For exarnple, the CYP2C19 (mephenytoin) and CYP2C9 polyrnorphisms are two well- known genetic polymorphisms in which point mutations lead to altered protein function by distinct mechanisms. A single G 4 A nucieotide substitution in exon 5 of the
CYP2C19 gene elirninates a splice site and yields a truncated non-functional protein
(De Morais et al., 1994), whereas the single amino acid substitutions of A~~'~-+C~S
(CYP2C9 2) and 11e~~~+~eu(CYP2C9 3) generate variant CYP2C9 proteins with altered function (Stubbins et al., 1996).
In the context of the site-directed mutagenesis studies to be described in this thesis, the variant NAT proteins can be viewed as 'naturally occurring site-directed mutants'. Each of the variant NAT2 proteins contain one to five nucleotide substitutions in the coding region at positions 191, 282, 341, 481, 590, 803, and 857. The mutations are eithe: silent or lead to amino acid changes that result in a range of effects on enzyme integrity and catalytic activity (Table 2). The 11e"~+~hramino acid mutation TABLE2 Coding region mutations in human NA T2 that have functional consequences Blue text represents those mutations that lead to a decrease in protein stability, whereas red text represents a mutation that imparts a decrease in acetylation activity. position basechange acid change
Arg64+ GIn silent Ile114+Thr Glu145+Pro silent ArgIg7-+GIn silent Ly~~~~-+Arg Ly~~~*--+Thr Gly 286 --+Glu imparts a decrease in maximal velocity that is not associated with significant alterations in enzyme stability or substrate affinity (Grant et aL, 1994; Hein et al., 1994; Hickman et al., 1995) (Table 2). Alternatively, marked reductions in enzyme stability with no impairment of substrate aff inity were obsewed for those NAT2 variants containing an
~r~'~~+Gln,GI$~~+GIU, or A~CJ~~+GI~amino acid substitution (Grant et al., 1997)
(Table 2). In fact, the Argl"+~ln and mutations even impart increaçes in substrate affinity for the NAT2-selective substrate SM2 (Grant et al., 1997). In addition, phenotype-genotype correlation studies revealed that an individual possessing two
NAT243 alleles (silent CZa2Tsubstitution s) exhibited a slow acetylator phenotype, whereas those individuais with *55 alleles had higher rates of acetylation than those with *6A alleles (Meyer and Zanger, 1997)D. Although in general these results agree with in vitro data, caution must be exercised when attempting to extrapolate enzyme activities from a non-native environment sucR as bacteria1 expression systems.
On the other hand, unlike the variant NAT2 alleles, many nucleotide substitutions have been reported outside of the protein coding regions of the NAT1 gene locus, with twenty-four variant NAT1 alleles identified tco date (Hein et al., 2000). However, there are also numerous single amino acid substitutions that indeed lead to alterations in
NATl function (Table 3). The Arg"+STOP (Lin et ai., 1998), Arg6'%Trp (Butcher et ai.,
1998), Argla7+STOP (Hughes et al., 1998), Argla7-+Gln(Hughes et al., 1998), and
Aspzs1-tValmutations produce decreases in acetylation activity. For exarnple, a su bject in a Toronto population possessing the NiATl 14 and NATl 15 variants displayed defective NATl function upon administration of the metabolic probe drug PAS (Hughes et al., 1998). Recombinant expression an d kinetic characterization of these variant
NAT1 proteins in E. coli demonstrated that the variant NATl 14 protein exhibited a 15- TABLE3 Coding region mutations in hurnan NA Tl tha t have functional consequences Red text represents those mutations that impart a decrease in catalytic function, wheras green text represents elevated NAT1 function. position basechange name amino acid change C+T NAT1:;:19 Arg33+STOP C+T NAT1#:17 Arg "+Trp T-C NATl *20 silent G+A NAT1$1 1 Va~'~~+lle G-A NAT1911 silent C+T NATlsl5 Arg 187+STOP G-A NAT1*14 Arg187+GIn A+G NAT1*:21 Met 205 +Val T+G NAT1*11 Ser2I4+Ala A+T NAT1G!2 ~sp*~~+~al T+C NAT1 *23 silent
G --> A NATl:i:24 GIU*~~--) LYS A--->G MAT1;!:25 Ile 263 -+Val fold increase in K~~~~and a 4-fold decrease in maximal velocity, whereas the tnincated
NATl 15 protein had no detectable enzymic activity, as expected (Table 3) (Hughes et al., 1998). In addition, single point mutations in the NATl coding region of NATl 21
(MetzosVal),NAT1 24 (Gluz6'Lys), and NATl 25 (1 le263Val)are associated with elevated
NAT1 catalytic function. All together, these NATl and NAT2 variants clearly dernonstrate that single amino acid substitutions in the NAT proteins can have profound impact on enzymic catalytic function. In summary, the variant NAT proteins provide examples of site-directed mutant proteins generated by nature.
1.4 Structure-function studies
Genetic manipulations, such as site-directed mutagenesis and chimera construction rnethodologies, that directly alter the linear amino acid sequences of proteins have provided invaluable information towards our understanding of protein structure and function. In light of the recent explosion in the field of structural biology and the remarkable advances in the areas of structural genomics (in particular the assignment of three-dimensional structures to a linear amino acid sequence), detailed three-dimensional information now exists for many proteins. This type of data provides a framework both to guide future studies and to allow a critical analysis of previous findings in the literature. In the context of drug metabolizing enzymes, one of the ultimate goals is to define the active sites and identify the individual amino acids that irnpart substrate affinity and catalytic activity. Thus, this type of knowledge will allow predictions of whether a given compound, such as a drug or foreign chemical, will be rnetabolized by a particular enzyme and perhaps then even provide estimates of the carcinogenic potential of such compounds. It is the linear amino acid sequence of a protein that ultimately defines the three dimensional architecture that it will assume (Anfinsen, 1973). Exons can encode
discrete structural and functional units or even an entire domain. For example, there are genes that contain exons encoding a membrane anchoring or insertion unit, whereas the central exon of the myoglobin gene encodes the heme-binding domain of this protein. The rearrangement of exons encoding unique functional units during evolution to generate novel proteins has been referred to as 'exon shuffling' (Gilbert et
a/., 1997).
On the other hand, residues that lie far apart in the Iinear amino acid sequence and originate in unique functional units or domains often govern the characteristics of the active-site environment. The tertiary folding of these proteins brings these catalytic residues in close proximity and allows them to participate in the functionality of the protein. Detailed structural information available for those proteins in the databank suggests that most proteins incorporate both of these themes to varying extents to define their substrate specificity characteristics.
1.4.1 Protein structure
It has been well documented that the primary amino acid sequence contains al1 of the information required for a protein to fold into its fully functional form (Anfinsan,
1973). Firstly, it is important to point out some of the key characteristic features that govern the native structure of a protein. Protein engineering studies such as those involving Rop (Munson et al., 1996) have demonstrated that the packing of the hydrophobic core is essential for protein structure and stabiiity. This process is driven by the protein's "desire" to minimize their free energy expenditure and results in a placement of the hydrophobic residues in the interior and the hydrophilic residues on the exterior of the protein (Kauzmann, 1959). The primary opposing forces arise from the presence of a hydrophilic pocket or region in the interior of the protein that contains
the residues involved in the catalytic function of the protein. Electrostatic interactions,
hydrogen-bonds, and Van der Waals interactions are three additional forces that are
involved in the strüctural stabilization of proteins. Predorninantly, a protein must be
completely folded to be biologically active. However, it should be noted that recent
evidence does suggest that the biological function of certain proteins is a direct
consequence of their unfolded or partially unfolded state (Wright and Dyson, 1999).
Enzyme kinetic studies by themselves are rather informative, but when in concert
with structural information the details of a kinetic rnechanism can be finely dissected
and understood. However, there still exists today a considerable range in the amount
and detail of secondary and tertiary structural information currently available among
proteins. A plethora of algorithms are capable of predicting secondary or tertiary
structure from a linear amino acid sequence. A few exarnples have been outlined below to highlight some of the rnost salient points with respect to structure-function studies.
On the other hand, the interpretation of a protein's functionality in three-dimensional
space is still the ultirnate goal for al1 structure-function studies- Since the rnerits of
providing a structural framework for kinetic analyses are intuitive. then an overall picture
of the rnethodologies utilized to assess protein structure must be presented.
1.4.1.1 Protein structure prediction rnethods
Predictions of protein secondary structure were pioneered by Chou and Fasrnan
more than 25 years ago (Chou and Fasman, 1974) and are now determined more
accurately and reliably than any other feature of protein structure. The rapid expansion
of the protein databases in the last few years has enabled researchers in this field to
make significant progress in their prediction accuracy. Presently, the two main strategies involve: 1) the evolution of protein families from sequence and structural databases; and 2) the physical principles of protein folding from structural databases.
The four publicly accessible secondary structure prediction methods used in the studies described in this thesis were: 1) Protein Structure Analysis server (PSA)'; 2) Network
Protein Sequence Analysis (NPSQ)2; 3) PSIPred3; and 4) Predict Protein4. lnvestigators should establish their own consensus prediction for their protein since each algorithm is quite distinct. For example, the two-layered feed-forward neural network (PHD) used by Predict Protein is one of the most adept methods available with a prediction accuracy greater than 70% (Rost and Sander, 1993). In fact, a recent modification of the PHD algorithm (PSIPRED) that incorporates output generated by
PSI-BLAST (Position Specific lterated - BLAST) (Altschul et al., 1997) has achieved the highest accuracy to date (77%) (Jones, 1999). Altematively, the probablistic Discrete
State-space Models (DSMs) of the PSA server foms the basis for an analysis algorithm with input from a complementary filtering and smoothing algorithm (Stultz et al., 1993).
One of the main benefits of the NPS@ server is that multiple secondary structure prediction algorithrns (eight) are used to generate a consensus secondary structure
(Combet et al., 2000).
Direct structural information is lacking for 99% of the approximately 200,000 proteins that possess unique amino acid sequences (Moult, 1999). Although a considerable number of these proteins are related to at least one known protein structure, it has been estimated that some proteins will possess novel folds (Chothia,
1992). Thus the construction of ab initio models will be the sole option to handle these
' Protein Structure Analysis server (PSA) (http://bmerc-www.bu.edu/psalindex.html) Network Protein Sequence Analysis (NPSB ) (http://pbil.ibcp.fr/ cgi-bidnpsa-automat.pl? page=npsa-seccons. html) PSlPred (http://globin. bio.warwick.ac.uk~psipred/) Predict Protein (http://cubic.bioc.columbia. edu/predictprotein/) novel folds. The ability of these techniques to predict three-dimensional models may have markedly improved in the last few years, but considerable work remains to be done before even low resolution (-54 structures can be generated. Future developments of this field of study will provide insight into the energy expenditures involved in protein structure and folding. On the other hand, the onset of large-scale structural genomics projects to crystallize 10,000 - 100,000 proteins will potentially create a database that has a representative structure for each protein sequence family
(Sali, 1998). However, ab initio methods will still be required to mode1 the differences between these structures.
The three-dimensional structure of a protein is much more highly conserved than the linear amino acid sequence. In fact, new structures that are deposited in the PDB will often contain folds that have been previously observed, yet these proteins that share common folds will have limited amino acid sequence identity. The central theme of fold recognition methodologies is to identify and find folds that are compatible with a submitted amino acid sequence. lronically, these approaches revisit one of the long- sta~dingmysteries in biochemistry, protein folding, and looks at it from a counter point- of-view (Honig, 1999). lnstead of predicting how an amino acid sequence will fold, these algorithms are designed to identify which folds best fit a particular sequence. In general, these methods utilize advanced sequence comparison methods (PSI-BLAST and Hidden Markov models); predicted secondary structure strings compared to known folds; threading (compatibility of an amino acid sequence with a known three- dimensional structure); and human expert knowledge. One of the potential drawbacks of these methods is that they cannot predict novel folds. 1-4.1.2 Three-dimensional structural Iinforrnation
Structure deterrnination provides invalusableinsight into the structure-function
relationship of a protein and offers detailed fundamental knowledge about the protein
itself. For instance, the identification of the active-site residues cm confirm the
predicted catalytic mechanism or even provide direct evidence for an unpredicted novel functional attribute of a protein. In addition, this information can also predict residues that may make important electrostatic interactioi ns or hydrogen bonds that contribute to
protein structure.
There were alrnost 14,000 entries in the Protein Data Bank (Berrnan et ai., 2000)
as of November 21, 2000, with approximately 5 entries being deposited per day. The
ovewhelming majority of these structures (- S2% (Berman et al., 2000)) have been
detemined by the X-ray diffraction of crystals using synchrotron radiation. On the other
hand, nuclear magnetic resonance (NMR) spe-ctroscopy involves proteins that are in
solution or noncrystalline states (Wuthrich, 1989) and steady rnethodoiogical
improvernents have led to an increase in their relative contributions to the PDB (Kay,
1998). These two methods acquire their detailed structural information using differing time scales that complement each other; x-ray crrystallography is static, whereas NMR is dynamic.
Three-dimensional structural coordinates can be utilized to guide the strategic systematic identification of select residues fosr mutagenesis (Peitsch, 1996). The functional consequences of the proposed mutations can be visualized and predicted using modeling software programs such as SWISS-PDGViewer and then assessed by functional analyses and direct structural studies. Similar approaches have been utilized to engineer enzymes to possess optimal catallytic efficiency and stability or altered substrate selectivity (Bott and Boefens, 1999). In addition, the structural coordinates of a protein can be used as a ternplate to buitd a de novo structure of a homologous protein. Although a rough homology model can be simply achieved by copying related regions from the template, the challenge in this field is to generate an accurate model. The final accuracy is dictated by the significant contributions of several factors: alignrnent of target and ternplate residues, orientation of side chains, building of loop regions, and final refinement of the rnodel.
1-4.2 Techniques utilized to investigate protein function
The most significant characteristics of protein structure determination and its' impact on structure-function studies have been highlighted above. We now shift the focus to discuss techniques that allow us to examine the functionaf attributes of proteins. Structure-function relationships can be explored using the powerful and insightful methodologies of protein chimera construction (Armstrong, 1990) and site- directed mutagenesis (Plapp, 1995). These techniques fom the experimental basis for this thesis.
1A.2.l Chimeras
Chimeric proteins provide a rnodular approach in the study of a protein's structure-function relationships. Protein chirneras are generated by the exchange of
Iinear amino acid segments between similar or unrelated proteins with distinct catalytic specificities. The goal of chimeric protein methodologies is to assess the relative contribution of a linear amino acid segment towards a particular functionai characteristic of the protein (Armstrong, 1990). This type of approach can provide valuable insight into the primary structural features of a protein or confirm predictions from the solved or hornology modeled structure.
In general, there exist three types of protein chimeras: 1) bipartite (amino terminus from one protein plus carboxy terminus from another protein); 2) rnultipartite (intemal sequence is from another protein); and 3) fusion (two proteins are grafted together) (Figure 7). This methodology is rnost efficient for proteins that exhibit a high
degree of nucleotide sequence identity and thus share common restriction
endonuclease cleavage sites. However, the polymerase chain reaction (PCR) does
provide the opportunity to create chirneric proteins between distinct unrelated proteins
such as the fusion of rat CYP2C11 to an NADPH-P450 reductase domain (Helvig and
Capdevila, 2000). Alternatively, non-specific techniques such as the DNA shuffling of the human Mu class glutathione transferases (Hansson et al., 1999a) and the random chimeragenesis of rat and human P450c17 (Moore and Blakely, 1994) can also be used to delineate the functional attributes of a protein.
Chimeric bipartite or multipartite genes are often emptoyed as an initial probe of
a protein's structure-function relationships prior to detailed site-specific mutagenesis.
These types of studies, undertaken with or without detailed structural information, focus
on mapping the linear arnino acid determinants of substrate affinity, catalytic activity,
and other characteristics (Armstrong, 1990). Since the human NAT proteins that are
central to this thesis are enzymes, then a few examples of chimeric enzymes that
highlight both the breadth of studies and type of data generated are outlined below.
Chimeric protein methodologies are used to map linear arnino acid regions to
assess what characteristics modulate and define the kinetic selectivity of a protein. For
example, the substrate selectivity of liver camitine palmitoyltransferase I (L-CPT 1) was
shown to be dependent on the intramolecular associations between its transmembrane
helices and the C and N-termini, whereas muscle-CPT I was relatively insensitive
(Jackson et al., 2000). This study provides an example of how the functionality of
discrete modules can impart distinct kinetic selectivities. Parents
cut with restriction endonucleases, mix, and religate
Chimeras
bipartite tripartite fusion
Expression Vector (p lasmid)
Transform the construct into an expression host and perform kinetic analysis of the recombinant proteins
Figure 7: Common types of chimeric enzymes created from two homologous parents A and B. A and B represent the protein coding regions of the genes encoding the enzymes A and B, respectively (adapted from Armstrong, 1990). A concerted change of several arnino acids is required to alter substrate
selectivity in some instances. One of the advantages of chimeric protein strategies is that the exchange of linear amino acid segments conserves the local secondary
structure. For example, the site-specific substitutions of five amino acids in the
electrophile binding site of humar: (h) GST Ml-1 were unable to convert its specificity
characteristics to resemble those of hGST M2-2. However, the linear region containing these five amino acids was swapped between these GST proteins and characterization of these protein chimeras clearly showed that these residues were involved in the specificity of hGST M2-2 (Hansson et al., 1999b).
Fusion proteins are an alternative to the bipartite and multipartite chimeras described above. One of the advantages of fusion proteins is that one can potentially generate a self-sufficient functional unit that can perform as a robust catalyst. Fcr example, the fusion of the major rat liver P450 2C isoform (CYP 2C11) with an NADPH-
P450 reductase domain significantly enhanced the overall metabolism of arachidonic acid (AA) to generate multiple eicosanoid metabolites (Helvig and Capdevila, 2000).
The identification of the intermediates and products of the AA cascade should greatly enhance the understanding of the factors that control hypertension. In addition, fusion proteins are also a very important tool in the food, beer, and pharmaceutical industries.
The linkage of sequential steps in a catalytic process can decrease total reaction time, which increases both efficiency and output and hence leads to an overall reduction in cost.
1.4.2.2 Site-directed mutagenesis
The ability to manipulate DNA in a strategic manner has become a cornerstone to the fields of genetics and biochemistry. Site-directed mutagenesis is a powerful and informative DNA modification technique that can be used to probe a protein's structural features and identify the relative contributions of specific individual amino acids. The development of the first mutagenic strategies is beyond the scope of this section. In general, the earty methodologies relied on techniques that avoided the wild-type sequence (Kramer et al., 1984; Kunkel, 1985; Taylor et al., 1985), whereas in this thesis we have used PCR to directly introduce mutations into the amplified mutagenic fragments.
Site-directed mutagenesis is an invaluable tool that is utilized in al1 areas of biological sciences ranging from enzyme-substrate interactions (Chakraborty et al.,
1999) to protein folding (Cordes et al., 1999). Amino acid substitutions may have no effect, generate a decrease in function, or even impart a noveI functionality to a protein.
Since NAT is a drug metabolizing enzyme, some examples of rnutagenesis experiments for the cytochrornes P450 and the sulfotransferases wili be provided to illustrate some of the salient points observed from these types of studies.
1)Cytochromes P450: Work from Negishi's lab provide some of the ctassic examples of how site-directed mutagenesis influenced cytochrome P450 research over the last ten years. Mouse P450 2A4 and 2A5 differ by only 11 amino acids, yet they have distinct su bstrate selectivity for 3-ketone steroids (e.g. testosterone) and coumarin,
respectively. In 1989 Lindberg and Negishi first demonstrated that a single amino acid substitution (PheZog+Leu) could significantly alter the substrate specificity of a P450 enzyme and impart a novel enzymic activity. This engineered P450 2A5 protein exhibited a 100-fold increase in testosterone l5a-hydroxylase activity with no alteration in its native coumarin hydroxylase activity (Lindberg and Negishi, 1989). Subsequent site-directed mutagenesis studies identified four consewed positions (1 17, 209, 365, and 481) in P450 famiiy 2 that are key deteminants of steroid hydroxylase activities in mammalian P450s (Negishi et al., 1 996). The four critical mouse residues in P450 2A4/2A5 are located in the putative substrate recognition sites (S RS) of P450 subfamily
2 (Gotoh, 1992) and alignments with the solved crystal structures of bacterial P450s suggest that their location is in the substrate-heme pocket (Negishi et al., 1996). These studies highlight the concept that a few select residues can dictate the individual specificity of the cytochrome P450s and have provided insight into one of the mechanisrns that the P450s have evolved to display such catalytic diversity.
The distinct substrate specificities between highly sirnilar cytochrome P450 proteins can also have significant toxicological implications. For example, cytochrome
P450 3A4 and 3A5 share greater than 85% amino acid sequence identity, yet are markedly different in their regioselective patterns of aflatoxin B, (AFBI) metabolism
(Gillarn et al., 1995). P450 3A4 converts AFB1 to a Sa-hydroxylated metabolite that is eliminated, whereas P450 3A5 cannot perfo rrn the Sa-hydroxylation reaction and metabolizes AFBI to the genotoxic exo-8,9-oxide. The residues that differ between
P450 CYP3A4 and CYP3A5 in the SRSs were exchanged and two critical mutations
(N206S and L210F) were identified in the SRS-2 domain of 3A4 that were capable of irnparting the 3A5 phenotype (Wang et al., 1998). This exarnple describes the exquisite balance that exists between the detoxification and activation pathways of a compound.
2)Sulfotransferases:
Site-directed sulfotransferase (SULT) mutants have been used to identify the amino acid residues involved in cofactor and acceptor substrate binding. The mutation of the conserved residues in the SULT P-loop nucleotide binding motif of guinea pig estrogen sulfotransferases (gpEST) (Komatsu et al., 1994) and flavonal sulfotransferases (Marsolais and Varin, 1995) resulted in an elimination of the binding of the cofactor 3'-phosphoadenosine-5'-phosphosulfate(PAPS). Subsequent mutagenesis studies have demonstrated that the KSGTT sequence in the conserved N-terminal motif, the RKG sequence in the consewed C-teminal motif, and the individual Arg130 and Se? residues are also deteminants of PAPS binding (Kakuta etal., 1997).
The phenolic SULTIA subfamily offers an excellent parallel model to the structure-function studies of the human NATs. The rnembers of this subfamily
(SULTIAI, SULTIA2, and SULTlA3) have greater than 90% arnir no acid sequence identity, yet display distinct substrate selectivity. Dopamine (Dmp) is a SULTlA3 selective substrate (Km = 9.7 PM), whereas p-nitrophenol (pNP3 is considered a
SULTI A1 selective substrate (Km = 0.6 vM) (Veronese et a/., 19943 A single amino acid substitution (A1a146+GI~)in SULTl Al decreased substrate affinity for p-NP by more than 2700-fold such that it was now comparable to SULTIA3 aBrix et al., 1999a;
Brix et al,, 1999b). However, the results also suggested that a coordinated change of multiple amino acids would be necessary to acquire the substrate binding characteristics of SULTlA3 for dopamine (Brix et a/., 1999a). Alternativeiy, the complementary mutation in SULTIA3 (Gl~'~~-+Ala)caused a marked increase in affinity for p-NP (-200-fold), but only a modest 8-fold decrease in dopamine affinity (Mx et al.,
1999a). Interestingly, select SULT1A3 mutants had alterations in momoamine substrate specificity, predicted by a homology model of SULTIA3 (Brix et? al., 1999a) and confimed by SULTlA3 direct structural information (Bidwell et al., 1999), that appeared to be dependent on a charge interaction between the acidic functional group of and the amino group substituent of dopamine. Nevertheless, it is unclear why the mutations involving residue 146 appear to have their most profound effect on the Km values for the substrates with uncharged para-substituents (e.g. p-NP), but not dopamine. 1.5 Structure-f unction studies of NAT enzymes
1.5.1 Structurally related acceptor substrates
Molecular cloning studies have dernonstrated the existence of two distinct and independently regulated isozymes of arylamine N-acetyltransferase from a variety of species (reviewed in (Hein et al., 2000)). However, prior to these findings the limited structure-activity studieç in this field had focused on how substituents on the acetyl donors or acceptors altered the relative rates of N-acetylation by NATs purified from the
Iivers of pigeons (Jacobson, 1961; Riddle and Jencks, 1971; Andres et al., 1983) and homozygous rapid acetylator rabbits (Andres et al., 1987).
Jacobsen (1 961) was one of the firsis to investigate which chemical features of the NAT substrates were important determinants for N-acetylation. The contribution of the acetyl donor's para-substituent to the electron withdrawing effect influenced the carboniurn characteristics of the carbonyl group and hence the rate of N-acetylation.
Conversely, the electronegativity of the para-substituent of the acceptor substrate was inversely retated to the nucleophilic character of its amine and thus modulated how readily the acetyl group moiety was accepted. Overall, the results of this study suggested that perhaps an acid-base catalyst was involved in the acetyiation reaction.
Riddle and Jencks (1971) set out to obtain detaiIed evidence describing the kinetic mechanism of the arylamine N-acetyltransferases. Identical Vmaxvalues were observed for five different substituted anilines using fixed concentrations of the acetyl donor p-nitroacetanilide. This suggested that the formation of the covalent acetyl- enzyme intermediate was the rate-determining step in N-acetylation. Polar substituents that altered the charge distribution of the transition state were reflected in the modified rates of N-acetylation. The observed variation in the sensitivity of the reaction mechanism to the nucleophilic or leaving group basicity further suggested the involvement of general acid-base catalysts in the transition state. Direct evidence for incubating [2-3H] acetyl-CoA with pigeon liver NAT examined the existence of the covalent acetyl-enzyme intermediate in the absence of an acceptor amine substrate
(Andres et ai., 1983). A radiolabelled peak corresponding to the acetyl-enzyme intermediate was isolated and oxidation with cold performic acid indicated that the acetyl moiety was bound as a thioester to a NAT cysteine residue.
Purified NAT from rapid acetylator rabbits exhibited a rate-limiting formation of the acetyt-enzyme intermediate for strongly basic amines (Andres et al., 1987). This
NAT was characterized for the first time with the physiological donor acetyl-CoA and a panel of aniline derivatives differing in hydrophobicity, size, charge, position, and number of substituents. A rnethyl group was the only ortho-position substituent in this series of aniline derivatives that was accommodated and perrnitted the acetylation reaction to proceed. All the aniline derivatives with varying substituents at the meta- andfor para-positions were N-acetylated. Typically, arylamines with charged substituents had a lower rate of catalysis than did those with uncharged substituents in the same location. This is presumably due to unfavorable interactions between the charged residues of the substrate and those of active-site amino acids that prevent efficient enzyme-substrate interactions. Since each of these studies described above involved the purification of NAT from liver tissue, they are not able to clearly differentiate or attribute the observed effects on the kinetic parameters as being due to either NAT1 or NAT2. Presumably, however, the rabbit enzyme that was purified for theçe studies was the more abundant and therrnally stable NAT2. 1.5.2 Mechanistic studies
1.5.2.1 Chernical modification of NAT proteins
NAT isolated from rabbit blood, referred to as 'extrahepatic' NAT, was completely and irreversibly inhibited by pchloromercuribenzoate, whereas 'hepatic' NAT was only inhibited by roughly 10% (Dnimmond et al., 1980). These authors attributed the difference in p-chlorornercuribenzoate sensitivity of the two enzyme preparations to tissue specific post-translational modifications. In light of our current knowledge of the existence of both NATl and NAT2 in mamrnalian species, the actual mechanism is likely due to the fact that p-chloromercuribenzoate is a more potent inhibitor of NATl than of NAT2, and NATl is the only acetyltransferase expressed in blood while both
NATl and NAT2 are expressed in liver. Indeed, the structure of this inhibitor closely resembles known NAT1-seledive substrates (Figure 8). Furthermore, since p chloromercuribenzoate has a preference for thiol groups, this study provided the first direct evidence that indeed a cysteine residue was potentially involved in the catalytic mechanism (see Section 1-2.3).
lmprovements in the purification of arylamine acetyltransferases from rapid acetylator rabbits (Andres et al., 1987) enabled more detailed studies of the NAT active- site. The covalent inhibitor iodoacetic acid and bromoacetanilide abolished N- acetylation activity in purified cytosolic liver NAT from rapid acetylator rabbits (Andres ef al., 1988). This provided compelling evidence for the requirement of a sulfhydryl group in the NAT reaction rnechanism and suggested that a single cysteine residue was involved in the transfer of acetate from CoASAc to the acceptor amine (Andres et al.,
1988). During the development of isozyme-selective inhibitors for exploration of the active-site topologies of the NATs, further details about the mechanisms of substrate binding and catalysis for the hamster NAT proteins were revealed using group-seleciive COO-
paminobenzoic acid (PABA)
COO-
p-chloromercuribenzoate
paminosalicylic acid (PAS)
"monomorphic" substrates NA TI-seledive
Figure 8: Chernical structures of NAT1-selective substrates and cysteine selective reagent. modifying reagents (Cheon and Hanna, 1992). Two forms of hamster NAT (NAT1 and
NAT2) were purified and each was exposed to a cysteine (N-ethylmafeimide, NEM), arginine (phenylglyoxal, PG), or histidine (diethylpyrocarbonate, DEPC) selective inhibitor. Each of these three reagents caused alterations to enzyme catalysis or structure that led to the inactivation of both NAT1 and NAT2 proteins. CoASAc prevented the NEM inhibition of both NATl and NAT2 and the PG inhibition in only
NAT1, but not the DEPC inhibition of either NAT1 or NAT2. This pattern of protection exhibited by CoASAc suggested that a cysteine residue was in the active site and that an essentiai NAT2 Arg residue was stilI accessible after CoASAc binding. Cheon and
Hanna (1 992) discounted the possibility that it is simply subtle differences in the tertiary structures of NATl and NAT2 that allow PG to inhibit only NAT2 in the presence of
CoASAc. Since this type of study is unable to definitively show which residue was rnodified, it is difficult to speculate further until detailed structural information is available for the hamster NAT proteins.
1-5.2.2 Active-site inactivators/inhibitors
Suicide inhibition is a process by which an enzyme converts a substrate into a reactive inhibitor that in turn immediately inactivates the catalytic activity of the enzyme.
Studies of this nature have focused on chemistry based approaches to dissect the catalytic mechanism of the arylamine N-acetyltransferases. In general, N- aryl hydroxamic acids function as suicide inactivators and undergo NAT-mediated N,O- transacetylation to ultirnately form electrophilic arylnitrenium ions. Prior to the molecular cloning of the NATs, suicide inactivation studies using N-ary[hydroxamic acids were an effective approach to selectively inactivate individual NAT isozymes and explore the relationships between the different reactions catalyzed by the acetyltransferases (Wick and Hanna, 1990). The addition of cofactor or substrate has a protective effect when incubated with
N-OH-acetylarninofluorene (MF) and hamster NATs, thus satisfying the criteria for a mechanism-based inactivation process (Sticha et al., 1998). Hamster (Hanna et al.,
1982; Smith and Hanna, 1986) and rat (Wick et al., 1988; Wick and Hanna, 1990) NAT1 are irreversibly inhibited with the mechanism-based inactivator N-OH-AAF. On the other hand, there is no evidence that N-OH-AAF or any other arylhydroxamic acids are mechanism-based inactivators of NAT2 (Smith and Hanna, 1986). This result was subsequently confirmed by in vitro metaboiism studies that demonstrated that N,O- acetylation in hamsters (Ozawa et al., 1990) and hurnans (Hein et al., 1993b) is predominantly mediated by NATI. This result is even more interesting given that 2-AF is an excellent substrate for both NAT7 and NAT2 (Grant et al., 1991).
15.3 Molecular techniques used to explore NAT structure-function relationships
1-5.3.1 Structural characterization studies
The merits of possessing accurate three-dimensional structural information for structure-function studies have been expfained in detail in section 1.4.1 -2. Although it has been 10 years since the human NATgenes were cloned and characterizeci by Blum et al. (1990), no detailed structural information is yet available for the hurnan NATs.
Due to difficulties in expressing large amounts of human NATs in bacteria, other iabs have focused on developing purification schemes for hamster (Sticha et al., 1997) and
Salmonella typhimurium NATs (Sinclair et al., 1998). Sufficient amounts of purified NAT proteins were obtained with these expression systems to set-up small-scale crystallization screens and grow hamster NAT (Hanna et al., 1998) and S. typhimurium
NAT (Sinclair et al., 1998) crystals.
The experimental crystallization conditions for S. typhimurium NAT were the starting point for the subsequent determination of the crystal structure at 2.8 A resolution (Sinclair et al., 2000). The solved structure of S. typhrimurium NAT has a 248 kDa asyrnmetric unit that consists of two tetrameric assemblies of a 31 kDa protein.
The protein can be roughly divided into three domains: a helical bundle, a P-barrel, and an cc@-'lid' (Figure 9). The activesite cleft is formed by the interface between domains
II and III and the interdomain helix separating them. One wf the rnost interesting findings from the elucidation of this structure was the presence of a catalytic triad consisting of three residues (Cys6', H~S'~', AS^'^^) that ars conserved arnong NATs from
S. typhimurium to humans (Figure 9b). This provided compelling evidence for an alternative mechanism that did not support the previous model Sn which an Arg residue was proposed to be the base catalyst in the NAT catalytic mechanism (Watanabe et al.,
1992). This catalytic triad of the cysteine protease superfamily forms a structural motif that is conserved in factor Xlll transglutaminase, deubiquitinase, and cysteine proteases of the papain family (Figure 10). The common feature of each member in this cysteine protease superfamily (according to SCOP classification) is that they function as sulfur nucleophiles towards amide bonds. Since the human NATs and S. typhimurium NAT share at least 30% amino acid sequence identity, this structure shouId provide a template to develop a homology model for human NAT1 and greatly aid the future structural characterization studies of the hurnan NATs.
1-5.3.2 NAT1/NAT2 chirneras
Homologous regions were exchanged between the two h urnan NAT enzymes to localize linear amino acid segments that were associated with or imparted substrate specificity and protein stability characteristics (Dupret et al., 199*4). The gain or loss of kinetic characteristics was monitored using the NAT1- and NAT2-selective probe drugs
PAS and SMZ, respectively. A panel of NATI/NAT2 chirneric proteins was constructed
(Figure Il) and kinetic analyses of the bacterial recombinant chianeric proteins revealed Hurnan NAT1 R C l-f D F R Y HumanNAT2 R C H D S S S
Rabbit NAT2 R C H D F R Y Hamster NAT1 R C H D Y G Y Hamster NAT2 R C H D F R L Mouse NAT1 R C H D Y G Y MouseNAT2 R C H D F R Y MouseNAT3 R C H D F F C Rat NAT1 R C H D Y S Y Rat NAT2 R C H D F R Y S. typhimurium NAT R C H D F R Y
Figure 9: (a) Three-dimensional structure of Salmonel/a typhimurium NAT. POV-RayTM generated figure of a Swiss-PdbViewer (ribbon diagram) representation of the 3D structure of SNAT (aal to 273; pdb entry le2t). Catalytic triad (Cys69,His'07,Asp1") and Phel25 residues are shown. 'I3-sheets are in orange, 'a-helices' are in green, 'loops' are in magenta. (b) Amino acids conserved in mammalian and non-mammalian NATs. Numbers at the top 01 each colurnn represent the amino acid position in the respective NAT proteins. The eukaryotic NATs have Arg and Cys residues at positions 64 and 68, respectively, whereas the homologous positions in prokaryotes (SNAT) are 65 and 69. Figure 10: Active site of Salmonella typhimurium NAT. POV-Ra TM generated Swiss- PdbViewer (ribbon diagram) representation of the 3D structure of SNAT &al to 273; pdb entry le2t). The location of the catalytic triad (Cys69,His107,Asp'22) and Phel25 residues in the active site environment are shown. '/j-slieetç' are in orange, 'ci-helices' are in green, and 'loops' are in magenta, Figure 11 : Panel of NATllNAT2 Chimeric Proteins. Open boxes represent areas originating from NAT1, and shaded boxes from NAT2. Vertical dashed lines show the location of the active site cysteine (Cysss) involved in the acetyi transfer reaction, and the numbers in parentheses identify the linear amino acid segments derived frorn NAT1 (lefi coiumn) and NAT2 (right column) (from Dupret et al., 1994) that regions distinct from the active site made significant contributions to both substrate affinity and enzymic velocity (Figure 12).
In terms of protein stability, the carboxy terminus of NAT2 (amino acids 21 1-250) appeared to make a significant contribution to the greater stability that the NAT2 proteins displayed with respect to the NATl proteins (Dupret et al., 1994). For the analysis of the enzyme kinetic constants, the intrinsic clearance (Cl,,; the ratio of VmaXto
Km), a relative measure of the specificity constant (k=/K,), of each chimera was determined for the selective substrates PAS and SMZ. The ratio of the Vma/Kmfor SMZ to that of PAS for each chimera divided this panel of NAT chirneric proteins into those which exhibited NAT1-type (Figure 12, left) or NAT2-type (Figure 12, right) behavior. A central region (amino acid residues 112-210) in NATl and NAT2, distinct from the active-site cysB8 residue, was associated with NAT1- and NAT2-type behavior, respectively (Dupret et al., 1994).
1.5.3.3 Site-directed NAT mutants
Each of the three highly conserved cysteine residues (cysU, ~~ç~~,G~s~~~)in human NAT2 was mutated to glycine to determine if any of these residues were involved in mediating the N-acetylation reaction (Dupret and Grant, 1992). cys6* was identified as the cysteine residue directly involved in the NAT reaction and essential for enzymatic catalysis, since only the ~~s~~-1~l~mutant displayed a complete abolition of catalytic function. Subsequent studies further demonstrated that a single C~S%AI~ mutation in human NATl produced a mutant protein devoid of acetylation activity
(Delomenie et al., 1997). Independently, Watanabe et al. (1992) demonstrated that the cys6' residue of S. typhimurium N-hydroxylarylarnine O-acetyltransferase was responsible for mediating CoASAc binding. the only Figure 12: Ratios of V,,,/K, for SMZ to those for PAS in wild-type and chimeric NAT proteins (from Dupret et al., 1994). conserved cysteine residue between the Oacetyltransferase of S. typhimurium and N- acetyltransferases of h igher organisms (Figure 9b) resides within a highly conserved region.
Phenylglyoxal inhibition studies suggested that an arginine residue rnay be required for both NAT1 and NAT2 activity (Cheon and Hanna, 1992) which agreed with its proposed role as a base catalyst in the NAT catalytic mechanism (Watanabe et al.,
1992). Although the pKa for the guanidinium group is higher (-12.5) than one rnay expect for a side-chain that must be capable of being protonated and deprotonated, the local environment can modify pKa values. An arginine residue located proximal to the active site cysteine is highly conserved from the O-acetyltransferase of S. typhimurium
(~r~'~)to the NATs of higher organisms (A~cJ~~)(Figure 9b). In addition, the Argg residue in the human NATs is also conserved among mammalian and bacterial NATs. The role of the ~r~~~ and ~r~~ residues as putative base catalysts were examined by mutagenesis to Ala, Met, Gln, and Lys residues in both human NAT1 and NAT2
(Delornenie et al., 1997). Each of the singly rnodified NAT1 and NAT2 proteins had marked decreases in their levels of acetylating activity and significant reductions in their intrinsic stabilities as compared to the wild-type NAT proteins, yet no alterations in Km values were observed. These resufts are comparable to what is observed for the naturally occurring NAT2 14 variant, which has an substitution, when it iç expressed in E. coli (Table 2) (Grant et al., 1994; Hein et a!., 1994). Interestingly, the
Arg+Lys mutants, the only mutant NAT proteins for which there was a conservation of positive charge, consistently exhibited the highest enzymic activities and intrinsic stabilities. However, the conservative Arg+Lys substitutions for both Arg residues simuitaneously (R9tVR64K) in NAT1 and NAT2 revealed that these arnino acids seemed to make their most important contributions to the conformational stability of the NAT proteins. Independently, it has also been demonstrated that the-mutation of the
~r~~~residue in S. typhimurium Oacetyltrançferase results in a loss of activity that can be attributed to a decrease in stability (Watanabe et aL, 1992). These results and the direct structural information from S. typhimurium NAT together provide evidence that
ArgM does not play a role in proton abstraction, but is involved in protein structure likely via the formation of a salt-bridge-
These studies described so far have explored the role of residues that participate in the NAT catalytic mechanism. On the other hand, mutagenesis has also been employed to identify amino acid residues that are involved in suostrate binding.
Chimera production methodologies identified a central region (amino acids 1 12-210) from NATl and NAT2 that imparts NATt-type (Figure 12, Mt) and NAT2-type characteristics (Figure 12, right), respectively (Dupret et al., 1994). Further examination of this central region revealed that there was a highly conserved 25 amino acid segment in which the sequences of NATl and NAT2 differed at only amino acid positions 125,
127, and 129 (Figure 13). A NATl protein (referred to as the 'NAT1 triple mutant') with
NAT2 Ser residues at each of these three positions; and a corresponding NAT2 protein
(the 'NAT2 triple mutant') with the NATl Phel", Arg12', and Tyr12' residues were created.
Subsequent kinetic analyses with the selective substrates PAS and SMZ revealed that these three amino acids were important determinants of NAT acceptor substrate selectivity (Table 4) (Goodfellow el ai., 2000). The presence of the three NAT2 Ser residues in the NAT1-triple mutant produced an almost 60-fold decrease in PAS substrate affinity and more than a 2600-fold decrease in the PAS specificity constant.
In addition, the NAT1 residues imparted about a 60-fold decrease in SMZ substrate I DGRNY QMWQPLELI I DGRNY QMWQPLELI I I I I I I I I 115 117 119 121 123 125 127 129 amino acid
Figure 13: A highly conserved 25 amino acid segment within the central region of the human NATl and NAT2 proteins. Open boxdepicts the NATgene as a representation of the NATl and NAT2 genes to dernonstrate the location of selected restriction endonuclease sites common to NATl and NAT2, darkly shaded boxes represent the wild-type NATl and NAT2 proteins, dark solid vertical lines represent the three amino acid differences between NAT1 and NAT2 in this highly conserved region flanked by the restriction sites Pst I and Bbv I at the NAT gene level, lightly shaded boxes enclose the three amino acids which differ at positions 125, 127, and 129 between NAT1 (Phe125,Arg127,Tyr129) and NAT2 (Ser1*5,Ser127,Ser1*9). Kinetic parameters for wild-type and triple mutant NA Tproteins
The triple mutant NAT proteinç were generated using the Pst I and Bbv I restriction endonuclease sites shown in Figure 17. The NATI-triple mutant (FSIRSNS) has PheI2'Ser (FS), ~rg'~'Ser(RS), and Tyr129Ser(YS) mutations, whereas the NAT2-triple mutant has SerlzsPhe (SF), Serl"Arg (SR), and Ser129Tyr(SY) mutations. These recombinant NAT proteins were heterologously expressed in E. coli (from Goodfellow et al., 2000). affinity and a 39-fold decrease in the SM2 catalytic specificity for the NAT2 triple mutant. On the other hand, the introduction of these amino acids was also capable of imparting novel kinetic characteristics for the respective mutant NAT proteins
(Goodfellow et al., 2000). For example, the NAT2-triple mutant and NAT1-triple mutant had 763-fold and 2-fold increases, respectively, in their PAS and SMZ specificity constants (Table 4).
In order to gain a fuller understanding of the individual contributions that these three amino acid residues play in the determination of NAT acceptor substrate specificity, we exchanged these amino acids individually and in pairs between NAT1 and NAT2 and kinetically characterized the expressed protein producls. A single arnino acid substitution of the Phe residue at position 125 in human NAT1 had a drastic effect on kinetic selectivity. The Phe'25+Ser substitution of the NAT1-FI 25s mutant produced only a four-fold increase in K'*'~, yet displayed a greater than 200-fold decrease in
K'~',. In fact, this mutant protein had a KSMzmvalue of 20 pM that was 5-fold leçç than even that of wild-type NAT2 (Figure 14) (Goodfellow et al., 2000). On the other hand, al1 mutant NAT1 proteins containing an Arg'27+Ser substitution displayed significant increases in their KPAs, values (Figure 14) (Goodfellow et al., 2000). The marked alterations in kinetic behavior for these NAT1 mutant proteins were further dernonstrated in their intrinsic clearance values (Figure 15). The NATI-F125S and
NAT1-R127S mutant proteins each exhibited more than a 38,000-fold Increase in
NAT2-type behavior (Goodfellow et al., 2000). Some of the remarkable effects that were observed for these single point mutations were the foundation for the studies described in this thesis. I wiid-type NAT2 wild-type NAT1 1 PAS 1 NAT1-FI 25s -Q- NATl -RI 27s
(b) wild-type NAT2 wild-type NATl NAT1-FI 25s NAT1-RI 27s NATl-Y 129s NAT1-FI 25S/Rl27S NATl-FI 25Sff129S NAT1-RI 27SNl 29s NAT1-FI 25S/Rl27S/Yl29S O 200 400 600 800 1000 Km (PM) Figure 14: Substrate specif icities of wild-type and mutant NAT proteins. Kinetic analyses- were performed usin6 -the (a) NAT1-selective substrate PAS and (b) the NAT2-selective substrate SM2 (from Goodfellow et al., 2000). NATl variants NAT1-FI 25S/R127SN129S
NAT1-RI 27SN129S
NATl-F125SN129S
NAT1-FI 25S/R127S
NATl-Y1 29s
NAT1-RI 27s
NAT1-FI 25s
wild-type NAT1
NAT2 variants NAT2-SI 2SF/Sl27WSl29Y
NAT2-S 127 FUS1 29Y
NAT2-SI 25F/S129Y
NAT2-SI 25 F/S 127R
NAT2-S1 29Y
NAT2-S1 27R
NAT2-SI 25F.
wild-type NAT2
-4 -3 -2 -1 O 1 2 3 log [(ClintSMZ)/(Clint PAS)]
Figure 15: Ratio of V,,dK, for SM2 to those for PAS in wild-type and mutant NAT proteins (from Goodfellow et al., 2000). 1.6 Rationale and objectives for this study
The overall goal of the studies described in this thesis is to identify and characterize the amino acid residues in the NAT proteins that make significant contributions to the determination of NAT kinetic selectivity. Alterations at position 125 in human NAT1 produced rnarked increases in NAT2-type behavior, whereas modifications of residue 127 led to a decreased aff inity for the NAT1-selective substrate
PAS (Goodfellow et al., 2000). The marked differences in the structural and chemical nature of the side chains at positions 125 and 127 between NATl and NAT2 is Iikely an integral factor in the observed kinetic characteristics of these mutant NATl p roteins.
The phenyl ring of the NAT1-Phe1" residue is much larger and lacks the hydroxyl group of the corresponding NAT2-Ser12' residue. Thus, we propose that the hydroxyl functional group and/or size of the amino acid side-chah at position 125 plays a significant role in the determination of NAT2-type kinetic behavior. The guanidinium group of NAT1-Arg12' is positively charged and we hypothesize that the positive charge at amino acid position 127 is a requirement for NATI-type kinetic selectivity. The contributions of amino acid positions 125 and 127 in human NAT1 towards enzyme kinetic parameters and indices of protein stability in the context of structural information were assessed by site-directed mutagenesis and panels of acceptor amine substrates. 2 Materials and Methods
2.1 Materials
The arylamine acceptor substrates sulfamethazine (SMZ), sulfamerazine (SMR), sulfadiazine (SDZ), sulfapyridine (SPY), paminobenzoic acid (PABA), p-aminosalicylic acid (PAS), pchloroaniline (p-CA), paminophenol (p-AP), p-toluidine (p-TOL), p aminobenzylamine (p-AB), p-aminoacetophenone (p-AAP), aniline (ANL), the acetyl donor CoASAc, and the reagents of the cofactor regenerating system (acetyl-DL- carnitine and carnitine acetyltransferase (EC 2.3.1.7)) were purchased from Sigma
(Mississauga, ON). Synthesis and purification of AcSMZ was performed by Dr. D.M.
Grant as previously outlined by du Souich et al., (1979). The acetylated metabolites of
SMR, SDZ and SPY were a generoüs gift from Dr. R. McClleIand (Department of
Chemistry, University of Toronto). Standards of the acetylated products for the remaining acceptor amine substrates were generated using wild-type recombinant
NAT1 bacterial lysate as the enzymatic catalyst.
High performance Iiquid chromatography (HPLC) mobile phases contained the following reagents: triethylamine from Sigma, glacial acetic acid, acetonitrile and methanol (HPLC grade) from Fisher Scientific (Nepean, ON), sodium perchlorate from
BDH, and 70% perchloric acid from Caledon Laboratories (Georgetown, ON). HPLC was performed using an Shimadzu automated isocratic system (Shirnadzu Scientific
Instruments Inc., Columbia, MD) that consisted of: a LPI-66 System Controller, a SIL-
6% auto injecter, a LC600 pump, and a SPD-GA UV detector. The software program
ClassVPTMChromatography Data System version 4.2 (Scientific Software Inc., San
Ramon, CA) controlled this system through Windows 95TM on an IBM compatible pentium cornputer. The bacterial expression vector pKEN2 (Figure 16a), a tac promoter-based expression phagemid bearing the bla gene for selection by ampicillin resistance, and the E. coli host strain XA90 (FrlacP') were kindly provided by Dr. G.L. Verdine,
Department of Chemistry, Harvard University, Cambridge MA. A copy of the T7 RNA polymerase gene is integrated into the chromosomal DNA of the BL21 (DE3) bacterial hast cells and is under the control of the lacUV5 promoter. XA90 and BL21 (DE3) bacterial celis were grown in Luria-Bertani (LB) medium containing ampicillin (100 pg/ml). LB medium consists of: 10 g of bacto-tryptone, 5 g of bacto-yeast extract and
10 g of NaCl per 1 I of deionized water. GST Gene Fusion Vector pGEX-4T-2 (Figure
17b) from Amersham Pharmacia Biotech (Baie d'Urfé, QU) has tac-promoter based inducible high-level expression with a concomitant overproduction of the lac repressor protein. XA90 bacterial cells expressing recombinant GST-NAT fusion proteins were grown in 2XYT medium containing ampicillin (1 00 pg/ml). YT medium consists of: 16 g of tryptone, 10 g of yeast extract and 5 g of NaCl per 1 I of deionized water with pH adjusted to 7.0 by NaOH. Recombinant protein expression for al1 pKEN2- and pGEX-
4T-derived constructs was directed by the inducing agent l PTG (isopropyl P-D- thiogalactopyranoside) obtained frorn Gibco BRL Products (Burlington, ON).
Recombinant GST-NAT protein purification schemes utilized the chromatography medium Glutathione Sepharose 4B from Amersham Pharrnacia Biotech.
The NAT1-specific rabbit antiserum #4769 and NAT rabbit antiserum #5231 were generated in our lab using a NAT1 14-mer (corresponding to amino acids 182-195) conjugated to the multiple antigenic peptide (MAP) (Posnett et al., 1988) and gel solubilized recombinant NAT2 protein, respectively, by R. Grewal. The HybondTM-C super nitrocellulose, secondary antibody donkey anti-rabbit IgG horseradish peroxidase, and HyperfilrnTMECLTM were from Amersham Pharmacia Biotech and were also used to Figure 16: Schematic representation of prokaryotic expression vectors (a) pKEN2 and (b) pGEX. Open arrows indicate the relative location of some important features of these expression vectors. The Eco RI and Sa1 1 sites in the multiple cloning sites were used for the directional cloning of the NAT1 and NAT2 expression cassettes. detect the immunoreactive NAT proteins in Western blotting procedures. Chernical
denaturation studies were performed using guanidine hydrochlonde from Sigma.
Mutant NATgene constructs were generated and characterized using molecuiar
cloning techniques that utilized the following restriction enzymes: Sa1 1, Bbv 1, BsfB 1,
Aat II, Hpa I and Nco 1 obtained from New England Biolabs (Mississauga, ON) and Eco
RI, Bgl II, Kpn 1, Nde 1, Barn HI and Bst El1 from Arnersham Pharmacia Biotech. The
100 Base-Pair Ladder, bacteriophage lambda DNA used to generate DNA size markers,
and T4 DNA ligase were purchased from Amersharn Pharmacia Biotech.
The oligonucleotides used for site-directed mutagenesis and sequencing were
synthesized by Keystone Labs (Camarillo, CA) and GSD (Toronto, ON), respectively.
Amplitaq DNA polymerase, PCR buffers, and dNTP's used in the PCR amplification of plasmid DNA were from Perkin Elmer (Applied Biosysterns Canada Inc., Mississauga,
ON). PCR amplifications were carried out in a Perkin Elmer DNA Thermal Cycler 480.
The dsDNA templates used for sequencing were prepared using the Amersham
Pharmacia Biotech FlexiPrep Kit that utilizes a glass matrix, SephaglasTMFP, to selectively bind DNA. Sequencing reactions were performed using a T7 SequencingTM
Kit from Amersham Pharmacia Biotech and were loaded ont0 a Base AceO Vertical
Seq uencing Apparatus (Stratagene, La Jolla, GA). The radioisotope ([cx-~~S]dATPuS) was purchased from Amersham Pharmacia Biotech. Al1 other chernicals were of analytical grade and were obtained from local suppliers. 2.2 Methods
2.2.1 Standard Methods
2.2.1 -1 Bacterial growth conditions
Ovemight bacterial cultures were grown in Luria-Bertani medium containing 100 pg/ml ampicillin (Le-arnp) for either the isolation of plasrnid dsDNA or to restart culture growth for protein expression. In both cases, isolated colonies of bacteria harboring plasmids encoding for ampicillin resistance were grown on LB-amp agar plates and then used to inoculate a small volume (-3 ml) of LB-amp liquid culture. Cultures were grown overnight at 37" C in a shaking incubator at 250 rpm.
Recombinant NAT proteins used for the NAT enzyme assays were expressed according to an established protocol (Dupret and Grant, 1992) as follows: an aliquot (50 to 150 pi) from a fresh overnight bacterial culture was used to inoculate five ml of LB- amp in a 14 ml polypropylene tube. Cultures were grown in a 37" C shaking incubator at 280 rpm until the OD,,, was approximately 0.5, induced with IPTG at a final concentration of 1 mM, and grown for a further 3 hrs. The phagemid pKEN2 (Figure
17a) directed the expression of the recombinant human NAT proteins through derepression of the tac-promoter following induction with IPTG. Only minimal levels of expression were obsewed in the absence of the inducing agent IPTG (data not shown).
This demonstrated the tight level of repression on the tac-promoter due to the overproduction of the lac-repressor protein by the host bacterial strain XA90 (F'lacP1).
2.2.1.2 isolation of plasmid DNA
The small-scale isolation of plasmid dsDNA from bacterial cultures (referred to as a miniprep) was accomplished by either the alkaline lysis rnethod (Sambrook et al.,
1989) or a modification of this protocol that included further purification steps (a
FlexiPrep Kit). A 1 ml aliquot of a fresh overnight bacterial culture was centrifuged at 12,000xg for 30 sec at room temperature to pellet the cells. The supernatant was
removed, the pellet was spun for another 10 sec. and the remaining supernatant was aspirated. One-hundred pl of an ice cold solution of 50 mM glucose, 25 mM Tris-HCI,
10 mM EDTA, 0.4 mg/ml RNasel pH 8.0 was added to the pellet and it was
resuspended by vortexing. Bacterial cells were lysed and the proteins and chromosomal DNA denatured by adding 200 pl of a 0.2 N NaOH and 1% SDS solution followed by inverting the mixture - five tirnes and storing on ice for 5 min. Proteins, chromosornal DNA, and cellular debris were precipitated with 150 pl of 3M potassium acetate. The mixture was then spun at 18,320xg for 5 min at 4" C and the supematant was removed and transferred to a new tube. The DHSabacterial strain used in Our molecular cloning procedures does not require the phenol/chloroform (1:l) step to isolate high quality dsDNA for subsequent molecular techniques. Two volumes (900 pl) of 100% ethanol were added, the mixture was inverted, and then left to stand at room temperature for 2 min to precipitate the DNA. The precipitate was pelleted by spinning at 18,320xg for 5 min at 4" C, the supematant was removed, the pellet was rinsed with
1 ml of 70% ethanol, and then spun at 18,320xg for another 5 min at 4" C. The supernatant was removed by aspiration, the pellet was air dried for 10 min, and then resuspended in 50 pl of 10 mM Tris-HCI, 1 mM EDTA, pH 8.0 (TE8).
For preparation of double-stranded sequencing templates, the following additional steps to plasmid preparatioris were included. DNA was precipitated with 1 volume of isopropanol instead of 2 volumes of ethanol, and air-dried DNA pellets were resuspended in 150 pl of SephaglassTM FP slurry (Phanacia). The slurry was centrifuged briefly, the supernatant was discarded, and the Sephaglass pellet was washed once with 200 pl of 20 mM Tris-HCI, 2 mM CDTA, 200 mM NaCI, pH 7.5, and once with 300 pl of 70% ethanol. The pellet was air-dried for 10 min and the DNA was eluted by resuspending the pellet in 50 p1 of TE8. After 5 min at roorn temperature, the -69- mixture was centrifuged and the supernatant containing the eluted DNA was collected.
It was important to ensure that the eluted DNA contained no slurry material that could
potentially interfere with subsequent procedures.
2.2.1 -3 Polymerase chain reaction (PCR) amplification
PCR amplification of DNA was used to synthesize expression cassettes for NATl
expression vectors (Dupret and Grant, 1992) and to introduce single point mutations at
amino acid positions 125 or 127 in human NAT1 by PCR-mediated site-directed
mutagenesis. The oligonucleotide prirners used in each of these strategies are listed in
Table 5. Subcloned human genomic DNA fragments containing the NATl coding
region (Blum et al., 1990) were used as templates for the amplification of NAT1
expression cassettes (Dupret and Grant, 1992) following the expression cassette
polymerase chain reaction (ECPCR) method described by MacFerrin et al., (1990). The
resulting expression vector, pNATI, served as the template in subsequent PCR-
mediated site-directed mutagenesis experirnents (Figure 17). For PCR-mediated site-
directed mutagenesis, reactions (50 pl) contained 5 pl of 10x buffer (100 mM Tris (pH
8.3), 500 mM KGI, 0.1 % gelatin, 15 mM MgCl,), 4 pl of dNTPs (1 -25 mM of each
deoxynucleotide (dATP, dCTP, dGTP, dTTP), 1 pl of a 20 PM stock of the 5' primer
NIPC5, 1 pl of a 20 PM 3' mutagenic primer, 0.25 pl (2U) of AmpliTaq DNA polyrnerase,
and 37.45 pl of H,O. Reactions were started with the addition of 1 pl (10 ng) of the
pNATl plasmid ternplate. Amplifications were pzrformed in a Perkin Elmer DNA
Thermal Cycler 480 under the following conditions: denaturation, 30 sec at 94" C; annealing, 30 sec at 45O C; extension, 45 sec at 72" C for a total of 30 cycles, followed by a final extension at 72O C for 7 min. A 1 pl aliquot of the reaction was loaded onto a TABLE5 Oiigonucleotide pUïmers used for mutagenesis of amino acids 125 and 727
Boldface and Iarger font identify the location of start and stop codons, and italics represent the nucleotides recognîzed by the restriction enzymes noted. The amino acids encoded by the mutagenic primers at positions 125 and 1 27 are underlined and labeled, and location of each oligonucleotide in the NAT1 is indicated relative to the ATG start codon (tl). The 5' primer used for ECPCR of the original NAT1 expression cassette is identical to that used for PCR-mediated site-directed mutagenesis. The ECPCR primers N1PC5 and N1PC3 denote the 5' and 3' NAT1-specific primers, respectively, that were used to amplify the NAT1 expression cassette (Dupret and Grant, 1992).
ECPCR primers +1 i-28 NIPC5 5'-CGCG CGAATCAGGAGGAAllTCATATGGACATTGAAGCATAlTCTGAAAGAA-3' Eco RI (s tart) +873 +847 N1PC3 5'-GCGCATATGTCGA CTAAATAGTAAAAAATCTATCACCATG-3' Sa['[ (stop) 3' mutagenic m ri mers
+419 t368 5'-CCAGAAATTAATTCTAGAG GCTGCCACATCTGGTAGGATCTCCAGACCCAG-3' (8bv 1) (~erl25) +420 +368 5'-CAGAAATTAAACTCCAGAGGCTGCCACATCTGGTATGAGCGTCCAGCCCCAG-3' (Bbv l) la' 25) 5'-CAGAAAlTMCTCCAGAG GCTGCCACATCTGGTATGAGCGTCCAGTCCCAG-3' (Bbv 1) ~hrl*~) 5'-CAGAAATTAPiCTCCAGAGGCTGCCACATCTGGTATGAGCGTCCAACCCCAG-3' (Bbv 1) (va1'25) 5'-CAGAAATTWCTCCAGAGGCTGCCACATCTGGTATGAGCGTCCATACCCAG-3' (Bbv 1) CTY r1 25) +420 +368 5'-CAGAAAlTMCTCCAGAG GCTGCCACATCTGGTATGAGTCTCCAAACCCAG-3' (Bbv 1) (&pl27) 5'-CAGAAATTAACTCCAGAG GCTGCCACATCTGGTATGACTCTCCAAACCCAG-3' (Bbv 1) (GIIJ'27) 5'-CAGAAATTAAACTCCAGAGGCTGCCACATCTGGTATGACTITCCAAACCCAG-3' (Bbv 1) (LYS lZ7) 5'-CAGAAATAACTCCAGAGGCTGCCACATCTGGTATGACATCCAAACCCAG-3' (Bbv 1) et'^^) 5'-CAGAAATTAAACTCCAGAGGCTGCCACATCTGGTATGAGTTTCCAAACCCAG-3' (Bbv 1) (~snl27) 5'-CAGAAATTAACTCCAGAG GCTGCCACATCTGGTATG ATTGTCCAAACCCAG-3' (Bbv 1) (~ln~~') +419 +368 5'-CCAGAAATTAATCTAGAG GCTGCCACATCTGGTAGGAGCTTCCAAACCCAG-3' (Bbv 1) (serl z7)
-71 - NAT1*4 gene Eco RI 3' - primer r'3-==kF ECPCR 5' - primer
Eco RI Sa1 I Eco RI/Sa/ l digest 1wild-type NAT1 1
Eco RI/Sa/ l 1 digest Eco RI Sa1 I
( wild-type NAT1 1
Figure 17: Construction of pNATl expression vector containing the protein coding regions of the NATl gene. ECPCR, the expression cassette polymerase chain reaction (MacFerrin et al., 1990), was used to generaie the NATl Eco RllSal I cassettes from human genomic DNA. These cassettes were digested with Eco RI and Sa1 I that enabled the directional cloning of these DNA fragments into the multiple cloning site (MCS) of the expression phagernid pKEN2. 1% TAE-agarose gel and positive amplification was verified by agarose gel electrophoresis, with visualization by ethidium bromide staining.
2.2.1.4 Restriction endonuclease digestion and DNA fragment isolation
Each restriction endonuclease was used under conditions producing optimal activity at a selected salt concentration. Amounts of enzymes used were generally equivalent to two units of enzyme activity per pg of DNA to be digested, where one unit of activity is defined as the amount of enzyme required to digest 1 pg of bacteriophage lambda DNA in one hour under optimal conditions. For example, a typical 50 pl restriction endonuclease digest for preparative isolation of DNA fragments contained -5 pg of miniprep DNA and 10-15 units of one or more restriction endonucleases in the appropriate reaction buffer. Mixtures were incubated at 37" C for - 2 hrs and a 1 pl aliquot was run on a 1% TAE-agarose gel to ensure completeness of digestion. The appropriate digested fragments that were visualized by ethidium bromide staining under
UV radiation were excised and placed in 1.5 ml microcentrifuge tubes. DNA was recovered from gel slices using a QlAEX DNA purification kit (Qiagen) as follows: 300 pl of solubilization buffer (3 M Nal, 4 M NaCIO,, 10 mM Tris-HCI (pH 7.0), and 10 mM sodium thiosulfite) and 7.5 pl of the QlAEX particle slurry were added to the gel slice and the tube was placed in a 50" C heating block for 10 min with occasional mixing.
The mixture was centrifuged at 12,000xg for 30 sec at room temperature and the supernatant was aspirated. The pellet was washed twice with 500 pl of 8 M NaCIO,, 1O mM Tris-HCI, pH 7.0, twice with 70% ethanol, 100 rnM NaCI, 10 rnM Tris-HCI, pH 7.5, and the washed pellet was then air dried for at least 10 min. The pellet was resuspended in 20 pl of TE8 for 5 min to elute the bound DNA. The mixture was then spun at 12,000xg for 30 sec at room temperature and the supernatant was removed and kept. 2.2.1 -5 DNA sequencing
Double-stranded DNA (dsDNA) sequencing templates were isolated with the
FlexiPrep Kit as described above. Roughly 1.5 - 2 pg of plasmid dsDNA in 16 pl of TE8
was denatured to single-stranded DNA with 4 pl of 2 M NaOH at room temperature for
10 min. ssDNA was then precipitated by the addition of 6.7 pl of 7.5 M ammonium
acetate (NH,Ac) and 60 pl of 100% ethanol for one hsur to overnight at -20" C or for -
10 min at -80" C. The precipitated DNA was pelleted by centrifugation at 18,320xg for
20 min at 4" C. The supernatant was removed, the pellet washed with 100 pl of ice-cold
70% ethanol, spun for a further 3 min and the supernatant removed again. This pellet
was dried in a 37" C heating block for 5 min and resuspended in 4 pl of ddH,O.
The oligonucleotide primers used for DNA sequencing to verify the nucleotide
sequence of the mutant constructs are listed in Table 6. A 2 pl aliquot of one of
sequencing primers listed in Table 6 and 1 pl of annealing buffer (1 M Tris-HCI (pH 7.5),
5 mM DTT, 100 pg BSA/ml and 5% glycerol) were added to the denatured DNA ternplates and the mixture was incubated at 37" C for 20 min. The annealed templates
cooled to room temperature in approximately 5 min and were ready for the sequencing
reactions.
A master mix was made that contained 0.5 pl of ddH,O, 3 pl of Labeling Mix A
(1.375 pM each of dCTP, dGTP, and dTTP and 333.5 mM NaCI), (3n/enzyme activity of
T7 DNA polymerase) pl of T7 DNA polymerase, (2n - pl of T7) pl of the enzyme dilution
buffer (20 mM Tris-HCI (pH 7.5), 5 mM DTT, 100 pg BSA/ml, and 5% glycerol), and 0.5
pl of [35S]dATPfor two sets of reactions with n equal to the number of pairs of reactions to be perforrned. A 3 pl aliquot of this master rnix was added to the annealed template and primer to initiate the labeling reactions. T7 DNA polymerase catalyzed the extension of the primer and incorporation of a radiolabelled deoxynucleotide TABLE6 Oligonucieotide primers used for sequencing
The upstream location of the pKEN2 binding primers, tac and Ti', are indicated relative to the downstream start codon- The position of the other NAT1 specific oligonucleotides are indicated relative to the ATG start codon (+I). The downstream location of pKEN2-rev is indicated relative to the TAG stop codon (4373)-The position of the GST primers is given with respect to the pGEX-4T2 vector. Primers used for sequencing were diluted from stock solutions to working concentrations of 20 pM (- 150 ng/pI).
tac
T7
pKEN2-rev
1-535
NAT
112-228
1/24 OOrev
PGEX-5'
pGEX-3' [cx-"S]d~~PcxSfor 5 min at 37" C. The labeling reaction was then aliquoted (2.3
@/tube) into four separate pre-warmed tubes which each contained a different reaction- terminating dideoxynucleotide along with non-limiting concentrations of al1 four deoxynucleotides. These mixtures were incubated for 5 min and then stopped with 2.5 pl of the Stop Solution (0.3% each Bromophenol Blue and Xylene Cyanol FF, 10 mM
EDTA (pH 7.5), and 97.5% deionized formamide). The chain terrninated reaction products were loaded (1.5-2.5 pi) in four adjacent lanes ont0 0.4 mm 6% acrylamide gels and run on a Base Ace@ Vertical Sequencing Apparatus. Gels were dried for one hour and exposed to X-ray film ovemight at room temperature.
2.2.1.6 NAT enzyme activity
2.2.1 -6.1 Preparation of the E. coli NAT lysate
After 3 hours of IPTG induced protein expression, the cultures were removed from the incubator and centrifuged at 2050xg for IO min at 4' C in a swinging bucket rotor. The supernatant was poured off and the tube inverted to dry for 1-2 min. The pellet was then resuspended with 1/3 to 1/5 the volume of the original culture in ice cold
TEDK buffer (10 mM triethanolarnine-HCl, 1 mM EDTA, 1 mM DlT, and 50 mM KCI, pH
7.0) using a pipette and transferred to a 1.5 ml microcentrifuge tube.
The resuspended bacterial cells were lysed by sonication in a ice-water bath using a Vibra CellTM3 mm Stepped Micro-Tip (Sonics and Materials Inc. (Danbuiy, CN)) at power output 4 for two x 15 sec bursts with 10 sec breaks between sonications. This was usually sufficient to clear the suspension and release the soluble NAT protein from the bacterial cells. The sonicated solution was then spun at 18,320xg for 5 min at 4" C to pellet cellular debris. The supernatant (the NAT lysate) was removed and transferred to a new tube.
The lysate was either used immediately for NAT enzyme assays and Western irnrnunoblot analysis or was flash frozen with liquid nitrogen and stored at -80" C. Wild- -76- type NAT1 experiences a significant drop in activity after a single freeze thaw cycle, whereas the wild-type NAT2 protein can withstand the rigors of a number of freeze thaw cycles without a significant loss in activity (data not shown). For ail of the kinetic analyses in this study each individual lysate was analyzed on the same day that it was prepared.
2.2.1 -6.2 Incubation of lysate with CoASAc and acceptor amines
Pilot studies were performed to determine both the appropriate dilution factors for each bacterial lysate and the optimum range of arylamine acceptor substrate concentrations. Lysates were diluted in TEDK containing bovine serum albumin (1 mg/rnl) to enhance protein stability. Dilution of bacterial lysates was performed to ensure that no greater than 10-15% substrate conversion occurred during the incubation of the enzyme, to avoid significant deviation from linearity of product formation throughout the incubations. The desired range in substrate concentrations spanned roughly 1O-foid below to 1O-fold above the Kmfor each individual recombinant
NAT protein and acceptor amine substrate. Substrates were diluted in 25% DMSO and the overall range in the concentrations used in this study was: 2.5 to 20,000 FM for
PAS, 5 to 2000 pM for SMZ (Iimited by substrate solubility), 10 to 10,000 pM for SMR,
50 to 10,000 pM for SDZ, 100 to 2000 pM for SPY (Iimited by substrate solubility), 10 to
8000 pM for PABA, 50 to 2000 PM for CoASAc, 20 to 3000 pM for p-CA, 5 to 1000 FM for p-AP, 5 to 1000 pM for p-TOL, 5 to 2500 pM for ANL, 0.5 to 500 FM for p-AAP and
100 to 25,000 FM for p-AB.
The NAT enzyme assay used a cofactor regenerating system (Andres et aï.,
1985) to maintain the CoASAc concentration at a value (100 FM) close to physiological levels (Siess et al., 1976). The system consisted of 5.4 mg of acetyl-DL-camitineand
1U of carnitine acetyltransferase (EC 2.3.1 -7)per ml of NAT assay buffer (250 mM triethanolamine-HC 5 mM EDTA, 5 mM DlT, pH 7.5). Incubations (final volume 100 -77- pl) contained 10 pl of the acceptor amine substrate, 20 pl of 500 FM CoASAc (dissolved in water), 20 pl of CoASAc regenerating system and 50 pl of appropriately diluted Iysate
(added to start reactioms). Tubes were gently mixed and incubated at 37O C for 10 min.
Reactions were stopaped with 10 pl of 15% HCIO, and tubes were centrifuged at
12,000~9for 3 min im a table top microcentrifuge to pellet the precipitated protein.
TEDK was substituted for the NAT lysate in blanks run with each independent assay.
Additional blanks substituted water for CoASAc to verify the cofactor dependence of the reactions. Blanks of cofactor, regenerating system, and substrate concentrations used in the kinetic assays were aiso incfuded to ensure that the observed acetylated product peaks were a direct cmnsequence of the enzymatic reaction.
2.2.1 -6.3;HPLC quantification of NAT activity
High performamce liquid chromatography (HPLC) was used to quantify the acetylated products of ail the acceptor substrates (Grant et ai., 1989). An aliquot (50 pl) of supernatant from each stopped reaction was directly injected ont0 a reverse phase
Cl8 Beckman Ultraspl here@ column (4.6 mm x 15 cm) at a flow rate of 2 ml/min. The
UV absorbance, buffer composition and retention times for each substrate and its acetylated product are surnmarized in Table 7. Briefly, an UV abçorbance of 210 nm was selected to detect peaks for the acetylated products of p-CA; 250 nm for p-TOL, p-
AP and ANL; 254 nm -for SMZ,SMR, SDZ, SPY, PABA, SAAm, p-AAP and p-AB; and
270 nm for PAS. Modeest variations in the percentage compositions of the mobile phase
(20 mM NaCIO,, pH 2.5 1 acetonitrile; 9U:lO, w/w) were capable of resolving the substrate and acetylated product peaks fcr many of the acceptor amine substrates (SMZ, SMR, SDZ, SPY, PABA, pCA, p-AAP, pAB, and ANL) used in this study. ln addition, a mobile phase of 890 g dH,O, 10 ml glacial acetic acid, 0.5 ml TEA
(triethylamine), and 60 g acetonitrile was used for the clear separation of PAS and Ac-
PAS peaks. On the other hand, the substrate and product peaks of p-TOL and p-AP were resolved with mobile phases that ranged from 10-20% MeOH: 90-80% dH,O w/w.
Retention times for each acceptor substrate and the acetylated product were roughly
1.5 to 3.0 min and 3.5 to 6.5 min, respectively, and are summarized in Table 7. HPLC profiles of the acetylated standards for each acceptor amine substrate are found in
Appendix 1.
Samples were quantified by comparison cf peak height to known quantities of external standards for the acetylated metabolites of the acceptor substrates. External standards were available for SMZ, SMR, SDZ, SPY, PABA, p-AP and ANL. However, since the acetylated products are not cornmercially available for the other substrates and are technically difficult to synthesize, calibration standards were produced enzymatically in measurable quantities frorn the acceptor substrate using NATl as a catalyst. Two separate scaled-up reaction mixtures were prepared; each of which contained the acceptor substrate at a fixed final concentration of 100 PM. Mixture 1 contained no recombinant NATl enzyme, while mixture 2 contained enzyme at a level that would convert roughly 50% of substrate to acetylated product during the course of the reaction. The exact quantity of acetylated product formed in mixture 2 was then assigned a value equal to the amount of substrate lost from mixture 2. The latter could be calculated by comparison with the substrate peak height in mixture 1 where no conversion occurred. Aliquots of mixture 2 were then frozen and used for HPLC calibration in subsequent analyses.
The software package Class-VPTM was used to analyze experimental chromatograms against calibrated standards. These generated data could be used in -80- the estimation of apparent Michaelis constants (Km) and maximal velocities (V,,J by non-linear regression of the standard Michaelis-Menten kinetic equation (v = Vma-[S]/K,
+ [SI))using the Marquardt algorithm from the curve-fitting software program Ultrafit
(Biosoft, Ferguson MO). All of the kinetic parameters were detemined in at least three independent experirnents. The amount of bacterial lysate protein was quantified using a dye-binding method (Bradford, 1976) with bovine serum albumin generated standard curves.
2.2.2 Specific protocols
2.2.2.1 Construction of NAT1-FI 25 and NAT1-RI27 mutants
PCR-mediated site-directed mutagenesis methods were employed to introduce single point mutations at amino acid positions 125 and 127 (Figure 18). The expression vector pNATI, containing the 870 bp wild-type NATl coding region (Dupret and Grant,
1992), was used as the template for the amplification of a mutagenic lnsert DNA fragment (Kadowaki et al., 1989; Vallette et al., 1989) corresponding to nucleotides 1-
408 of NAT1. PCR conditions have been described previously in section 2.2.1 -3.
Amplification required the NAT1-specific primer NIPCS, encoding an Eco RI restriction endonuclease site, and a 3' mutagenic primer, containing a Bbv l site, (Table 5) for directional cloning utilized in subsequent molecular procedures. The PCR amplified products were digested with Eco RI and Bbv 1, run on 1%TAE gels, and the resulting bands were cut out and gel purified to isolate the DNA. Gel purification was performed as described in section 2.2.1.4.
The remaining component for the generation of the full length mutant NAT1 vectors was the isolation of the NATl Bbv IlSal I fragments (nucleotides 409-870) from NAT7 (870 bp) Eco RI mutation ECORI NCOI Bbv 1 Sa/ 1 primers Y PCR amplification I I I 1 of NAT1 O 200 400 600 800 Eco RI Bbv I , J I I I t 1 NAT1 *1 Bbv t Nco I I digest 1 Eco RI + Bbv I I
digest I Eco RI I Bbv I Eco RI Nco I Nco I JBbv I Bbv I
', NATl mutant '\, 1 ligate into expression : phagemid pKEN2
Figure 18: Design of NAT1 mutants. This figure demonstrates the protocol for the construction of a NATl mutant. Open boxes represent areas derived from NATI, star identifies the NAT1 amino acid that has been mutated, black vertical lines identify the restriction sites of the specified restriction enzyme, and the dashed line traces the path of the amino acid mutated by PCR mediated site-directed mutagenesis from the primer to the expression construct. the wild-type NAT1 protein coding regions (Figure 18). The expression cassette
containing the coding regions of wild-type NAT1 was isolated from pNATl by Eco RIISal
1 double digest (Figure 19) and gel purified. The addition of Nco 1, which cuts the 408
bp Eco RIIBbv I segment at position 140 (Figure 18), to the Bbv I digest of the Eco
RIISal 1 expression cassettes simplified the isolation of the Bbv l/Sal I DNA fragments
(nucleotides 409-870). The products of the Bbv VNco I digest were separated on a
1.4% TAE-agarose gel and the 462 bp Bbv IISal I DNA segment (Figure 19) was
excised and gel purified. This wild-type Bbv IISal I DNA fragment (409-870 bp) and the
PCR generated Eco RIIBbv I mutagenic fragment (1-408 bp) were ligated and
subcloned into the Eco RIISaI 1 cut phagemid pKEN2 (Figure 18). The modified NAT
vectors were then transfomied into the E coli strain DHSa.
Mutant constructs were sequenced to verify the presence of desired mutations
'and to ensure that no new mutations had been introduced during PCR amplification.
Constructs with the desired mutation were transformed into the bacterial expression
strain XA90 for su bsequent kinetic analyses of the recombinant proteins.
2.2.2.2 NAT Stability
The bacterial NAT lysates were prepared as described previously in section
2.2.1.6.1. An aliquot of the NAT lysate was removed, prior to the onset of lysate
incubation at 37" C, and diluted appropriately for the determination of enzyme activity
using the NAT enzyme assay (section 2.2.1 -6.3) and HPLC techniques to separate
substrates and acetylated products (section 2.2.1 -6.4). Upon incubation of ihe lysate at
37" C, aliquots of the lysate were removed at specified time points, diluted in TEDK-
BSA (if necessary), assayed for NAT activity, and the amount of acetylated product was
quantified by HPLC. The stability of the recombinant NAT proteins was defined as the + Bbv l + Nco I
NAT1-Bbv IISal I r-* gel purification NATl-ECO RIINco I NAT1-NCO IIBbv I ligations
Flgure 19: Isolation of NAT1-Bbv VSal I DNA fragment. (a) Eco RIISal I digest of pNATI. Digest (80 pl + 8 pl IOxSB) was run on 1% TAE-agarose gel. The bottom band, the NATl Eco RIISal I cassette, was excised, gel-purified, and further digested with the restriction enzymes Bbv I and Nco 1. (b) Bbv VNcc I digest of the wild-type NATl Eco RI/Sal I cassette. Digest (40 pl + 4 pl 1OxSB) was run on 1.4% TAE-agarose gel. The top band, representative of the 463 bp Bbv IISal I fragment, was excised, gel-purified and used in subsequent ligation reactions. M represents the 100 Base-Pair ladder. estimated time (t,,) at which 50% of the enzyme activity was lost foltowing lysate incubation at 37" C.
2.2.2-3 Chemical denaturation studies
Bacterial NAT lysates were prepared as outlined above in section 2.2.1 -6.1 . For each recombinant NAT protein, a single acceptor substrate concentration was selected that approximated the respective Km values for the acceptor amine substrates. NAT enzyme activity was determined at a single acceptor substrate concentration in the presence of increasing concentrations of guanidine hydrochloride (GnHCI) from 10 to
1600 mM. NAT assay reactions consisted of: 15 pl of 1 mM CoASAc (dissolved in water), 30 pl of the CoASAc regenerating system, 15 pl of the acceptor amine substrate, and 40 pl of 3.75~guanidine hydrochloride (dissolved in water). The enzymatic reaction was started with 50 pl of bacterial lysate, the mixture was incubated at 37" C for 10 min, and stopped with 15 pl of 15% perchloric acid. The effect of GnHCI on enzyme activity was calculated as the difference in activity between parallel reactions with and without GnHCI. These data were plotted with respect to the GnHCl concentration and the IC, values were deterrnined by regression analysis of the linear portion of the graphs.
2.2.2.4 pH activity profiles
Kinetic constants for the pH optima experiments were determined using the acceptor amine substrate PAS for the wild-type and mutant NAT1 proteins and SMZ for wild-type NAT2. NAT lysates were prepared as described in section 2.2.1 -6.1, except that instead the bacterial cells were resuspended in various buffers ranging in pH from
5.63 to 9.60. The buffers used in these experiments included: 0.05 M MedNaOH, pH
5.63, 6.03, 6.87; 0.05 M Mops/NaOH, pH 7.28; 0.05 M triethanolamine-HCI, pH 7.66; and 0.05 M glycine/NaOH, pH 7.60, 8.1, 8.27, 9.60. The pH of each buffer was recorded after the addition of 1 mM DTT final and an incubation at 37O C for 10 min to -85- mimic assay conditions. NAT enzyme activity was assayed (section 2.2.1 -6.2) and quantitated by HPLC (section 2.2.1 -6.3) as outlined previously. Michaelis-Menten kinetic constants were determined for the recombinant NAT proteins at each of the specified pH values.
2.2.2.5 Western blotting procedures
Aliquots of the E. coli NAT lysates, prepared as described above (section
2.2.j-6.1), were mixed with an equal volume of 2xSDS-polyacrylamide gel electrophoresis sample buffer (1% SDS, 20% glycerol, 62.5 mM Tris (pH 6.8),2%
P-mercaptoethanol and 0.01% bromophenol blue), boiled for 3-5 min and either used immediately or stored at -20" C. Equivaient amounts of recombinant NAT1 protein (5 or
10 pg) were ioaded per lane and the bacterial lysate proteins were separated on 12%
SDS-polyacrylamide gels by the method of Laemmli (1970) using a Mighty Small II
SE250 gel apparatus (Hoeffer). The High Molecular Weight marker [(Rabbit Muscle
Myosin (205,000 Da), E. colip-galactosidase (116,000 Da), Rabbit Muscle
Phosphorylase b (97,400 Da), Bovine Albumin (66,000 Da), Egg Albumin (45,000 Da), and Bovine Erythrocyte Carbonic Anhydrase (29,000 Da)] from Sigma was run on each gel. In addition, a known amount of purified NAT1 (100 ng) was run on each gel to quantitate the amount of NAT in each sample for calculation of their molecular activities
(kat).The gels were electrophoretically transferred to nitrocelIulose membranes and then stained with Ponceau S to verify the transfer efficiency and to identify the location of the molecular weight markers.
The membranes were blocked overnight to prevent non-specific protein binding with milk-TNT (10 mM Tris-HCI (pH 8.0), 150 mM NaCI, 0.2% w/v Tween 20, 0.01 % w/v thimersol, and 4% wlv skim milk powder) by gentle rocking at room temperature. The
NAT1-specific primary antibody (#4769) is a polyclonal rabbit antiserum raised against a human NAT1-MAP peptide conjugate. A 1/5000 dilution of the primary antibody was -86- added to each membrane for 3 hr, the blots were then washed 6x5 min with IxTNT, incubated next with a horseradish peroxidase labeled donkey anti-rabbit IgG secondary antibody (1/20,000-1/50,000 dilution) for one hour and washed with lxTNT as before.
The membranes were incubated in a solution containing 4 ml each of the two enhanced cherniluminescence (ECL) reagents (ECL reagent 1 and reagent 2 from Amersham
Pharmacia Biotech) for 1 min and exposed to HyperfiImTM-ECL for 1 to 10 min to visualize the product.
Since antiserum #4769 does not detect NAT2 proteins and Our antiserum #5231, generated from a solubilized gel slice of recombinant NAT2, recognizes bacterial proteins of comparable size to the NATs, modifications were required to visualize immunoreactive recombinant human NAT2 proteins. 10-20 pg of recombinant NAT2 protein was separated on a 15% SDS-polyacrylamide gel by the Laemmli method
(Laernmli, 1970) using a Vertical Gel EIectrophoresis Systern Model VI 6-2 with 12.5 cm x 20 cm gIass plates (Bethesda Research Laboratories Life Technologies, Inc.
(Gaithersberg, MD)). An aliquot of the Gibco Prestained Molecular Weight Standards
(Insulin (crand pchain) (2,930 Da), Bovine Trypsin lnhibitor (5,670 Da), Lysozyme
(14,820 Da), B-Lactoglobulin (20,190 Da), Carbonic anhydrase (29,310 Da) and
Ovalbumin (44,670 Da)) was run on each gel. A known amount (500 ng) of purified recombinant NAT1 protein was also run on each gel to permit the determination of the molecular activities for the wild-type recombinant NAT2 proteins. Electrophoretic transfer (0.8 mAmp/cm2), Ponceau S staining, and blocking of the membrane overnight was done as for NAT1 proteins. Membranes were incubated for 3 hr with a 1/4000 dilution of antiserum #5231 and the remaining procedures were similar to those used for the NAT1 proteins. 2.2.2.6 Purification of GST-NAT fusion proteins
2.2.2.6.1 Preparation of E. coli lysate
E. coli expressing the GST-NAT1 or GST-NAT2 fusion proteins were grown in
2XYT media at 280 rpm in a room temperature incubator, induced with 1.O mM IPTG at
OD,= 0.4 - 0.5, and incubated for a further 18 hours. Cultures were centrifuged at
7,500xg for 10 min at 4" C and the pellet was resuspended with 1/24th the volume of the original culture in TEDK. The cells were then divided into two aliquotç and each was sonicated for 20 min at power output 3 with the pulser duty cycle set at 50%.
Cellular debris was pelleted by centrifugation at 28.000xg for 5 min at 4O C. The supernatant was then removed and kept, whereas the pellet was resuspended in 5 ml
TEDK and also kept for subsequent analysis.
2.2.2.6.2 Glutathione Sepharose 4B affinity chromatography
Pharrnacia suggests that a bed volume of 50 pl glutathione slurry is sufficient for a typical 100 ml bacterial culture. Titration experiments for GST-NAT1 suggested that our expression levels necessitated the use of larger volumes of the glutathione slurry.
The following formula was used: volume of 50% glutathione slurry = 2 x [total amount of lysate/300 mg/ml]. On the other hand, the GST-NAT2 expression levels were not as high as those for GST-NAT1 and thus amounts of glutathione slurry used were similar to those suggested by Pharmacia. The lysate and 50% slurry were incubated at 4" C for 2 hr on a rocking platform. The beads were pelleted by centrifugaticn at 1000xg for
5 min at 4" C and the unbound proteins and medium (the supernatant) were removed and labeled as the 'load' fraction. IxPBS was used to resuspend the beads, the mixture was then centrifuged at 1000xg for 5 min at 4O C and the supernatant removed and kept as 'washl'. This was repeated twice ('wash2'. 'wash3'), after which 50 pl thrornbin protease + 950 pl 1XPBS was added to the beads and the mixture was incubated overnight at 4" C on a rocking platform. The next rnorning the mixture was spun at -88- 1000xg for 5 min at 4" C to pellet the beads and the supernatant containing the cleaved protein was removed. Beads were resuspended in IxPBS, spun at 10,000xg for 5 min at 4" C, and the supernatant removed with a final suspension of the beads with 2XSDS-
PAGE loading buffer in one-half the volume of 1xPBS. 3 Results
3.1 Purification of recombinant NATs
An important objective of the studies described herein involved the purification of
recombinant NATs for detailed structural analysis and the determination of enzymic
molecular activities. During the ten years since the human NATgenes were cloned by
Blum et al. (1990) a nurnber of groups, including us, have explored the structure- function relationships of the arylamine N-acetyltransferases. However, the
interpretation of these studies has always lacked accurate three-dimensional structural information. Furthermore, the structural consequences of the mutations found in the
NAT allelic variants are unknown and detailed structural information may provide essential clues towards an understanding into the association of select NAT variants with certain cancers. The first insight into the structure of the human NAT proteins is now possible from the recently solved crystal structure of the bacterial homologue
SNAT (Sinclair et al., 2000).
Our lab and others have designed and set up a variety of recombinant NAT expression systems to investigate the functional characteristics of the NATs and to purify these proteins on a large-scale. Human NAT1 and NAT2 were first expressed as recombinant proteins in COS-1 cells (Blum et al., 1990) and CHO cells (Ohsako and
Deçuchi, 1990). The substrate kinetic profiles of these recombinant NATs were comparable to the native human NAT proteins from liver cytosol (Blum et al., 1990;
Ohsako and Deguchi, 1990). This suggested that no additional components, other than the acceptor substrate and cofactor CoASAc, were required for the acetylation reaction.
We were the first to express recombinant human NATs in a prokaryotic expression system using the E. colistrain XA90 (Dupret and Grant, 1992). Acetyltransferases have now been expressed in bacteria as fusion proteins with GST (human NAT1) (Sinclair and Sim, 1997) and dihydrofolate reductase (hamster NAT2) (Sticha et al., 1997) or with small tags such as the FLAG-peptide (hamster NATl and NAT2) (Wagner et al., 1996) and hexahistidine (S. fyphimurium N,O-AT) (Sinclair et a/., 1998). In our study, a number of different expression systems were explored until we demonstrated that the
GST gene fusion system could produce purification scale amounts of recombinant
NATs (- more than 10 mg of purified protein per litre of bacterial culture). Some of the other prokaryotic and eukaryotic systerns that we have used include: the T7-promoter based high-level expression vector PET-Sa, amino- and carboxy terminal hexahistidine tags, baculovirus, and the yeast Pichia pastoris.
3.1 -1 Verification of nucleotide sequence of GST-NAT1 and GST-NAT2
The coding sequences of the wild-type NATl and NAT2 genes were isolated from the expression vectors pNATl and pNAT2, respectively, and independently subcloned into pGEX-4T-2 vectors by Dr. D. M. Grant using similar methods as outlined in section 2.2.2.1. Sequencing across the 5' Eco RI and 3' Sa1 I cloning sites was perforrned to ensure that no mutations had been introduced during the cloning procedures. The commercially available pGEX 5' (binds to nucleotides 869-891 of the pGEX-4T-2 vector) and 3' (binds to 1042-1020) sequencing primers from Pharrnacia were used (Table 6). The linker region of the GST-NAT fusion proieins between GST and the NATs, including the protease recognition site and the Eco RI cloning site, were sequenced with pGEX 5' and found to contain no mutations (Figure 20a, c). The integrity of the 3' Sal I cloning site and the stop codons for each GST-NAT fusion protein were confirmed by sequencing with 3' pGEX (Figure 20b, d).
3.1.2 Affinity purification
Early studies exploring the characteristics of aromatic amine acetylation revealed that liver cytosols exhibited maximum NAT activity in the presence of sulfhydryl Figure 20: Partial nucleotide sequences of GST-NAT1 and GST-NAT2 fusion proteins. Expression constructs were sequenced across 5' and 3' cloning sites to ensure no errors had occured during the cloning procedure. Larger bold font represents the start and stop codons in the 5' and 3' sequences, respectively. Larger italics represenls the restriction endonuclease recognition sites for Eco RI and Sa1 1. Order of lanes in each blot is A, C, G, T from left to right. compounds such as DTT and cation chelators like EDTA (Jacobson, 1961). Thus,
subsequent purifications of NAT proteins from the livers of rabbits (Andres et a/., 1987)
and hamsters (Hein et al., 1985) utilized buffers containing 2 mM DTT, 1 mM EDTA,
and 20 mM Tris-HCI, pH 7.5 to optimize enzyme stability and activity. In our lab, we
have substituted 1O mM triethanolamine-HSI for Tris-HCI because it: 1) is a better buffer
at pH 7.0-7.5 (pKa = 7-7); 2) does not affect protein assays unlike Tris; and 3) has a
lower ApKaAT than Tris.
The optimization of the growth conditions and purification schernes (described in
detail in Appendix 2) allowed the undettaking of preparative or large-scale purification
studies (Figure 21a). Cleavage of the bound fusion protein using thrombin protease in
TEDK buffer yielded a relatively pure sample with only a single distinct band detected
by Coomassie staining (for even up to 50 pg of this sample) (Figure 21 b). Two faint
bands, roughly 66 kDa in size, did not increase in intensity as the total amount of protein
loaded increased and thus were presumably artifacts (Figure 21 b). The eluted sample,
purified recombinant NATI, was assayed for functional activity and shown to have a
KPAS, (1 3 PM) that is comparable to the native NAT1 protein (Figure 21c). We now
possessed experirnenta1 evidence that we had successfully purified a functional NAT1
protein. We then perforrned a series of unsuccessful crystal screens that are described
in more detail in Appendix 3.
A similar battery of experirnents was performed to optimize both the expression
and purification of the GST-NAT2 fusion protein. Numerous attempts to purify
recombinant human NAT2 had little success, which may be attributed to a number of factors. Most importantiy, the expression of GST-NAT2 was predominantly in the
insoluble fraction for al1 experimental conditions (data not shown). In addition, the
glutathione sepharose 48 beads appeared to display low binding specificity for the Figure 21: Characterization of purified recombinant NATl protein. (a) GST-NAT1 was purified frorn 600 ml of bacterial culture and 20 pg aliquots from purification scheme were separated on 12% SDS-PAGE gels and visualized by Coomassie stain. (b) Purity of cleaved recombinant NATl examined by separating increasing amounts of purified NAT1 on 12% SE-PAGE gels with visualization by Coomassie stain. (c) Michaelis-Menten kinetic curve of purified recombinant NAT1 . NAT activities determined as outlined in Methods 2.2.1.6.2. M represents the molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P-Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "SI represents the supernatant, "P the pellet, "L" the load fraction, " WINthe first wash, " W2' the second wash, " W3' the third wash, "E' the elute fraction, "B' the beads, "open arrouil' the GST protein, "closed arrod' the NATl protein, and "cir~le'~the GST-NAT fusion protein. -94- GST-NAT2 gene fusion protein. In fact, Coomassie staining revealed that the thrornbin cleaved NAT2 protein sample contained two additional bands of approximately 66 kDa
(data not shown).
3.1 -3 NAT Standard Cumes
Experimental determination of the kinetic parameters and bacterial growth conditions for kinetic assays have been outlined previously in section 2.2.1.6. The
Michaelis-Menten kinetic constant V,,,, measured in units of number of nmoIes of acetylated product formed per min per mg of bacterial lysate, was previously reported in
Our iab. Since recombinant NAT expression in our in vitro system constitutes only a small percentage (-2-5 %) of total cellular protein, variations in NAT expression were not previously considered in the calculations of enzymic activity. The goal of the experiments outlined in this section was to develop a rnethod that couId accurately determine the number of molecules of NAT in each bacterial lysate. Molecular activity was thus defined as the number of molecules of product formed per molecule of NAT per sec ( s").
Purification of the recombinant human NATs has been described above in section 3.1.2. Aliquots of purified NAT1 (25-200 ng) were run on 12% SDS-PAGE gels, transferred to nitrocellulose, and probed with Our NATI-selective antiserum #4769
(Figure 22a). UMAX Vistascan software (Fremont, CA) was used to scan the immunoblot and the image was then analyzed on a Mac G3 computer using the public domain NIH Image program (developed at US. National Institutes of Health and available from the lntemet website at http://rsb.info.nih.gov/nih-image/) to determine the corresponding pixel values of NAT1 from each lane on the blot. Pixel values are linear in scale with respect to transmission (Tl T=IO-~~),however the negative log of these pixel values will not yield Optical Density (OD). The relationship of OD to T is not a Amount of NAT1 Protein (ng)
Figure 22: Development of standard curve for quantitation of NAT1 mutants. (a) Known amounts of purified recombinant NAT1 were separated on 12% SDS-PAGE gels, transferred to nitrocellulose. probed with NAT antiserum #4769 (primary antibody) and horseradish peroxidase labeled donkey anti-rabbit IgG (secondary antibody) and visualized by colour reaction with hydrogen peroxide and lurninol. M represents the rnolecular weight markers and are: Rabbit Muscle Myosin (205 kDa). E. coli P-Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Alburnin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic An hydrase (29 kDa). (b) lrnmunobiot was scanned using Umax VistaScan (Fremont, CA, USA), pixel values were then calculated with the software program NIH Image 1.62 and plotted with respect to the amount of purified NAT1 protein. Data points fit to various equations until best fit achieved. Equation of the line for these data points is the fourth order polynomial: y = 25.788 - 0.869~+ 0.0341 X' - 0.000266~3+ 6.41 E-07x4. simple Iinear relationship and requires at least greater than a second order polynomial
(Rasband and Bright, 1995). Thus, the known concentrations of purified NAT1 and their
respective pixel values were fit to exponential, Rodbard, and third and fourth order polynomial equations. A fourth order polynomial equation resulted in the best fit (Figure
22b) and was thus selected to calibrate the NIH lmage software. We then employed this standard curve to quantitate the molecules of NATl in each recombinant bacterial lysate used in our kinetic characterization studies.
An example will now be described in detail to demonstrate how the molecular activities were determined for a recombinant NAT1 protein. An immunoreactive NAT band from a Western blot was assigned a pixel value of 88.34 by the calibrated NIH lmage software. The standard curve in Figure 22b converts this pixel value to an amount of NAT1 protein ( 149.37 x 2.047(internaI standard correction factor) = 305.76 ng). Since only 10 pg of the bacterial lysate is utilized during the imrnunobIot analysis, then the amount of NATl in 10 pg is equal to 3.27E-05 mghg (= 0.01 mg /305.76 ng).
The experimentaj maximal velocity (192-92 nmoles/min/mg) of the recombinant NAT protein expressed in this bacterial lysate is multiphed by 3.27E-05 mghg to give 6.31 E-
03 nmoles/min/ng of NAT1. Two additional steps are required to convert these units to reflect molecules of acetylated product and catalytic centres. Firstly, multiplication by
((33,898 g/rnole)*(l mole/6.02E23 rnolecules)*(l E9 ng/l g)) generates a value of
3.55E-13 nmoles/molecule of NAT1/min. Then, the molecules of acetylated product formed are deterrnined with the further multiplication by ((1 mole/l E9 nmoles)*(6.02E23 molecules/ 1 mole)) which yields a molecular activity of 213.88 molecules of product~moleculeof NATl/min or 3.55 s-'.
Since we lacked a NAT antiserum specific for human NAT2, we proposed an indirect strategy to determine the amount of NAT2 in recombinant bacterial lysates.
-97- Initially, we had to determine a ratio between the 'purified' NAT1 and NAT2 samples that would give equivalent amounts of NAT protein. Known amounts of NAT2 were separated by SDS-PAGE. visualized by Coomassie stain (Figure 23a), and then used to create a standard curve (Figure 23b). Since 3.8 pg of NATl has a pixel value of
192.26, which corresponds to 12.2 pg of NAT2 from the standard curve (Figure 23b), then 3.2-fold more (12.2 pg/3.8 pg) NAT2 should be used to obtain equal amounts of
NATl and NAT2,
The antiserum #5231 recognizes both NAT proteins; thus it was important to assess the relative sensitivity towards the respective NAT proteins. Antiserum #5231 was demonstrated to have a 2.1 85-fold greater sensitivity for NAT2 when used to probe equal amounts of the NAT proteins (Figure 24a). A standard cuwe (4th order polynomial) was generated using known amounts of purified NAT1 (100-500 ng) and antiserum #5231(Figure 24b). The determination of the molecular activities is as described above for the recombinant NATl proteins, except that the absolute values were multiplied by an additional factor of 2.017 (sensitivity of antiserurn #5231 plus differences in rnolecular weight between NATl and NAT2).
3.2 Mutant NAT1 proteins
3.2.1 Verification of nucleotide sequences of NAT1-FI 25 and NAT1-RI 27
mutant constructs
Our mutant NATl proteins were generated by PCR-mediated site-directed mutagenesis without the aid of a mutagenesis kit. We used oligonucleotide primers, that encoded 1 to 3 bp mismatches with the target sequence, to introduce mutations into the amplified DNA product (Kadowaki et a/., 1989; Vallette et al., 1989). A convenient Bbv I restriction endonuclease site proximal to the rnutated site and the
-98- Figure 23: Relationship between purified NATl and NAT2. Ca) Known amounts of purified recombinant NATl and NAT2 were separated on 12% SDS-PAGE gels and visualized by Coomassie stain. M represents the molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P-Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (917.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). (b) Bands representative of NAT2 protein were scanned with Umax Vistascan (Fremont, CA, USA), pixel va..lues were then calculated with the software program NIH Image 1.62 and pl; otted with respect to the amount of purified NAT2 protein. Data points used fit to various equations until best fit achieved. Equation of the line for these data points iç the fourth order polynomial: y=153.6 - 0.543~+ 0.805~2-- 0.0523~3 + 0.000971~4. 3.8 pg NAT1 band was scanned, the pixel value calculated (shown by hatched line) and then converted to a value of 12.2 pgof NAT2 using the standard curve . "Arrod' represents NAT protein. 200 111111111 irialiiiilalli III I
Amount of NAT1 (ng) Figure 24: lmmunoquantitation of NAT2 molecules. (a) Purified NAT proteins were separated on 12% SDS-PAGE gels, transferred to nitrocellulose, probed with NAT antiserum #523 1 (primary antibody) and horseradish peroxidase labeled donkey anti-rabbit IgG (secondary antibody) and visualized by colour reaction with hydrogen peroxide and luminol. NAT immunoreactive bands were scanned with Umax VistaScan (Fremont, CA. USA) and pixel values were calculated with the software program NIH Image 1.62. Comparison of the pixel values for the respective NAT proteins revealed the sensitivity of antiserurn #5231 for NATl and NAT2. M represents the molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P-Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "NI" represents NATl and "NZ'represents NAT2. (b) NAT2 standard curve. Pixel values of immunoreactive NATl protein detected with NAT antiserum #5231 were plotted with respect to the amount of purified NATl protein. Equation which best fit experimental data was selected and is: y = 31.51 8 + 0.585~- 0.00079~2+ 8.44E- 07x3 - 7.37E-10x4. need to make no more than three nucleotide mismatches precluded the requirement to employ inverse PCR (Hemsley et al., 1989) and overlap extension (Ho et al., 1989) methodologies, respectively.
The entire mutant NATI-FI25 and NAT1-R1 27 protein coding regions were sequenced to confirm the presence of the desired mutation and ensure that no unwanted mutations had been introduced. In addition, we also sequenced upstream of the start ATG through the AGGAGG E. coli ribosome binding site and NT rich translational spacer elements (MacFerrin et al., 1990) and across the Eco RI cloning site. Previous studies in our lab have demonstrated that mutations in this region have no functional consequences but dramatically decrease recombinant protein expression levels (data not shown). Nucleotide sequences spanning the mutated region are shown for each of the NAT1-FI 25 mutants (Figure 25) and NAT1-RI 27 mutants (Figure 26).
3.2.2 Expression and immunodetection of recombinant mutant NAT1 proteins
Recombinant NAT expression was a direct result of the derepression of the tac- promoter in the phagemid vector pKEN2 by the inducing agent IPTG. SDS-PAGE samples were prepared for each bacterial lysate that had been analyzed in enzymic kinetic assays, pH profile activity assays, in vitro stability experiments, and chernical denaturation studies. The bacterial lysates of the wild-type and mutant NAT proteins were separated by SDS-PAGE, transferred to nitrocellulose immunoblots, and probed with NAT antisera. Details of the NAT antisera used in this study have been presented earlier.
SDS-PAGE analysis of the mutant NAT1-FI25 proteins and the wild-type NATs are shown in Figure 27. The NAT1 internal standard, 100 ng of purified recombinant
NATI, was included with each blot to address issues of day to day experimental variation. The marked separation between the NAT2 internal standard (500 ng of G wild-type \ T NAT1 \ c \ G \ T
Figure 25: Partial nucleotide sequences of wild-type NAT1 and mutant NAT1-FI 25 coding regions. Larger bold font highlights the arnino acid mutated in these studies. This amino acid at position 125 is labeled as either the wild-type Phel25 or mutant Ala125, Ser125, Thr125, Valiz5, and Tyr125 residue. Nucleotide sequences for amino acid position 125 are also shown for each mutant. Open circles represent mutated nucleotides that produce amino acid substitutions. Order of lanes in each blot is A,C,G,T from left to nght. wild-type ' G NAT1 \ T \ C \ G
Figure 26: Partial nucleotide sequences of wild-type NAT1 and mutant NATI-RI27 coding ragions. Larger bold font highlights the amino acid mutated in these studies. This amino acid at position 127 is labeled as either the wild-type Ar9127 or mutant Asp127, GIu127, Lys127, MeW, Asni27 , Gln127, and Seri27 residue. Nucleotide sequences for amino acid position 127 are also shown for each mutant. Open circles represent mutated nucleotides that produce amino acid substitutions. Order of lanes in each blot is A,C,G,T from left to right. Figure 27: SDS-PAGE and immunobtot analysis of wild-type and mutant NAT1 -FI 25 proteins. 10 pg of lysates were separated on 12% (a,b) and 15% (c) SDS-PAGE gels, transferred to nitrocellulose, probed with NAT antisera #4769 (a,b) and #5231 (c) primary antibodies and horseradish peroxidase labeled don key anti-rabbit IgG (secondary antibody), and visualized by colour reaction with hydrogen peroxide and Iuminol. A4 represents the molecular weight markers and are: Rabbil Muscle Myosin (205 kDa), E. coli PGalactosidase (1 16 kDa), Rabbil Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Alburnin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "IS represents the interna1 standard, "S' the supernatant, "P' the pellet, "NI" the wild-type NAT1 protein, and "N2' the wild-type NAT2 protein. 100 ng and 500 ng of IS was used for gels (a,b) and (c), respectively. Arrow indicates location of immunoreactive NAT2 protein. 10 pg of vector control pKEN2/XASO was used. NATI) and the NAT2 samples rnay be attributed to differences in electrophoretic
mobility of the human NATs (Grant et al., 1991; Dupret and Grant, 1992). However, the
additional ten amino acids of the post thrombin cleavage purified NAT1 presumably also
contributes to the differing migration patterns. Antibody specificity was assessed by the
inclusion of a bacterial lysate sample of XA90 cells harboring the vector pKEN2 alone
(without a protein coding insert). NAT antiserum #4769 did not recognize any E. coli
XA90 proteins (Figure 27a,b), whereas antiserum #5231 detected a single band,
smaller in size than that expected for wild-type NAT2, in the vector control lane and the
soluble and insoluble fractions of wild-type NAT2 (Figure 27~).
The soluble expression of mutants FA and FS were comparable to that of wild-
type NATl (Figure 27a). On the other hand, mutant FT (Figure 27a) had a modest
decrease in the amount of soluble immunoreactive NATl protein, whereas FV and FY
(Figure 27b) exhibited significantly greater levels of soluble recombinant NAT1 protein.
The recombinant protein expression of wild-type NAT1 and al1 of the NAT1-FI25
mutants, except FT, displayed an equal compartmentalization of recombinant protein
expression in the soluble and insoluble fractions. Altematively, only FT and wild-type
NAT2 had a rnarked increase in the amount of immunoreactive protein in the pellet
fraction.
RD, RE, and RK displayed decreased levels of soluble imrnunoreactive NATl
protein that were approximately 50% of wild-type NATl (Figure 28a). Since these
mutants had a concomitant increase in expression in the insoluble fraction, there was
no decrease in overall expression efficiency, but a shift in the pattern of expression from the soluble to insoluble compartment. Interestingly, the only mutants with significant
decreases in soluble NAT expression were those that exhibited charged functional
groups (positive or negative) at position 127 (Figure 28a). The other NAT1 mutant Figure 28: SDS-PAGE and immunoblot analysis of wild-type and mutant NAT1-RI27 proteins. 10 pg of lysates were separated on 12% SDS-PAGE gels, transferred to nitrocellulose, probed with NAT antiserum #4769 (primary antibody) and horseradish peroxidase labeled donkey anti-rabbit IgG (secondaty antibody), and visualized by colour reaction with hydrogen peroxide and luminol. M represents the molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P-Galactosidase (11 6 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "1s' represents the interna1 standard, "S' the supernatant, "P' the pellet and "NI" the wild-type NAT1 protein. 100 ng of IS and 10 pg of vector control pKEN2/XA9O were used. proteins, RM, RN, RQ, and RS, exhibited levels of soluble immunoreactive NAT comparable to those displayed by wild-type NATl (Figure 28b). In addition, the RM and
RN mutants had similar expression levels for the soluble and insoluble fractions, whereas there was slightly greater proportion of recombinant NAT1 protein expression in the insoluble fraction for RQ and RS.
Overall, greater than 400 recombinant NAT samples were assayed to determine the amount of NAT in each bacterial lysate (Table 8). The individual levels of NATl protein for the wild-type and mutant NAT proteins ranged 10-fold from roughly 40-400 ng. The mean value of NAT1 protein expressed by the NATI-FI25 mutants (174+24 ng) was comparable to that of wild-type NATl (176+,10) and roughly 15% greater than that of the NAT1-RI 27 mutants (148t5O ng).
3.2.3 Kinetic analyses of mutant NAT1 proteins
Estimates of Km and V,,, were calculated by non-linear regression of untransformed data using curve-fitting software. The enzymatic velocity of these mutant
NATs was expressed as nmoles of acetylated product formed per min per mg of bacterial lysate. The molecular activities (k,,J were calculated from the maximal velocities (Vm,J and are reported in s-' (section 3.1.3).
Analyses of these mutant NAT1 proteins to dissect the proposed roles of residues 125 and 127 in NAT kinetic selectivity have generated a wealth of kinetic data.
For completeness the details of the kinetic parameters have been organized into individual subsections for each set of NAT1 mutants. A thorough individual analysis of each of the Km, kt,and kaJK, parameters for the NAT1-FI 25 and NAT1-RI 27 mutants has provided a more complete understanding of how these data strongly support the TABLE8 Summary of immunoquantitation of recombinant wild-type and mutant NA TS
Bacterial lysates for each kinetic assay were separated on 12% SDS-PAGE gels (NAT2:15% SDS-PAGE gels), transferred to nitrocellulose, probed with NAT antisera #4769 or #523l(primary antibodies)and horseradish peroxidase labeled donkey anti-rabbit IgG (secondary antibody) and visualized by colour reaction with hydrogen peroxide and luminol. lmrnunoblots were scanried, pixel value of NAT bands deterrnined using NIH Image 1.62 and converted to 'ng' with standard curves.
NAT total # of range in Mean ISE Protein samples protein (ng) mg) proposed model. Tables and figures have been employed to clarify and highlight the salient points from afl of these kinetic data.
3.2.3.1 NAT1-FI 2%
Modifications at position 125 were perforrned to determine whether it was the size of the amino acid side chah or hydrogen bonding capabilities that were the critical determinants of kinetic selectivity for NAT2-selective substrates. To properly address our hypothesis a series of NAT1 -FI 25 mutant proteins were constructed in which the wild-type NAT1 Phe125residue was mutated to Ala, Ser, Thr, Val, and Tyr (Figure 29a).
The molecular volume of the amino acid side-chains increased from Ala to Tyr in order to explore how size altered NAT2 kinetic selectivity. Alternatively, the H-bonding of the side-chain at position 125 was addressed by using similar amino acids that differed only by the presence or absence of a hydroxyl group. For example, Val and Thr are isoteric with a methyl group and hydroxyl group, respectively, attached to the P-carbon atom of the side-chah On the other hand, although Tyr and the wild-type Phe residue share the common feature of a phenyl ring, the Tyr functional moiety has an additional para- hydroxyl group. We used PAS or PABA and SM2 as highly effective NAT1-selective and NAT2-selective probes, respectively, in the functional analyses of recombinant NAT proteins (Grant et al., 1991). In addition, we also included a series of sulfonamide substrates in Our panel of substrates (Figure 30). In general, the size of the NAT1- selective substrates complement some of the structural differences between NAT1 and
NATZ, since the NAT1-selective substrates (e.g. PAS) are generally smaller than the
NAT2-selective substrates (e.g. SMZ).
3.2.3.1.1 Substrate affinities
The Km values of the mutant NATI-Fi25 and wild-type NAT proteins for this panel of substrates are summarized in Table 9. Some of the most remarkable effects sulfamethazine H2N(I> \ / so2-NH <=F\N / CH3
sulfamerazine
sulfadiazine
sulfapyridine
paminobenzoic acid
paminosalicylic acid
Figure 30: Chemical structures of substrates used in the kinetic characteriration of NAT1-FI25 mutant proteins. on Kmobserved to date for NAT site-directed mutants are recorded in this table. The Km values spanned an extraordinary range for both the individual substrates and the NAT proteins themselves. For example, the KPABAmvalues differed by greater th~an1660-fold for the wild-type and mutant NATs, whereas, for instance, wild-type NATl exhibited more than a 430-fold range in Kmvalues.
The KPAS, of the NAT1-FI25 mutants (FA, FS. FT, FV and FY) and wild-type
NATl were almost identical to their respective K~*'*, values (Table 9). In fact, al1 of the
NAT1-FI25 mutants exhibited KPAsmandKPABAm values that were no more than 4-fold greater than wild-type NATl (Figure 31). This suggested that although tihe chernical nature of the amino acid side-chains at position 125 differed dramatically for this series of mutants, there was still only a negligible effect on NAT1-selective substtrate binding characteristics. Alternatively, the KPASmand KPABAmvaluesof wild-type NAT2 were 500- fold and 2380-fold greater, respectively, than wild-type NAT1 (Figure 31).
Some unique characteristics were revealed when the NAT1-FI25 mutants and wild-type NATs were characterized with the four sulfonarnide substrates. The FA and
FS proteins displayed KSMZ, values that were almost 300-fold lower than thmse exhibited by wild-type NATl and more than 5-fold lower than those of wild-type NAT2 (Table 9).
Furthermore, the KSMZmvalues of FA (18 FM) and FS (19 PM) were also less than those they displayed for both NAT1-seledive substrates. An apparent relationship was readily observed for the Kmvalues of the three mutants with the smallest side-chain volumes at position 125 (FA. FS, and FT). Increases in substrate size from smallest to largest
(SPY+SDZ+SMR+SMZ) were associated with concomitant decreases in the Km values for FA (Figure 32a), FS (Figure 32b), and FT (Figure 32c). On the other hand, the mutant FV had comparable Kmvalues for each of the four sulfonarnide substrates
(Table 9). wild-type NAT1 PAS
NAT1-F125Y
NAT1-F125V
wild-type NAT2 wild-type NAT1 PABA I NAT1-Fl25Y
NP$1 -FI 2SV
NAT1-FI 25T
NAT1-FI 255
Figure 31 : Substrate specificities of wild-type NAT and mutant NAT1- FI25 proteins for NAT1-selective substrates PAS and PABA. Kinetic analyses were performed using the NAT1-selective substrates (a) PAS and (b) PABA. Enzyme activities wsre determined from bacterial lysates as determined in Methods 2.2.1.6.3. Results are mean .c standard error for al least three independent experiments. SMR
SMZ NAT1-FI 25A
1 1 1 1 1 1
SDZ
SMR
SM2 NAT1-FI 255
SMR
SMZ
Figure 32: Substrate specif icities of mutant NAT1-FI 25 proteins for sulfonamide su bstrates. Kinetic analyses were performed using the sulfonamide acceptor substrates SMZ, SMR, SDZ, and SPY for mutants (a) FA (b) FS and (c) FT. Enzyme activities were determined from bacterial lysates as described in Methods 2.2.1.6.3. Results are mean 1 standard error for at least three independent experiments The Kmvalues for wild-type NATl and PI were comparable for al1 the substrates used in this study (Table 9). Both of these NATl proteins had K~~~,values that were at least 430-fold greater than their KSMZmvalues. Thus, the kinetic data for these two NATl proteins suggest that the presence of a phenyl ring at position 125 strongly infiuenced the affinities of these NAT proteins for SMZ and the other sulfonamide substrates. Not surprisingly, wild-type NAT2 had its lowest Kmvalue for the NAT2-selective substrate
SMZ (Table 9). Results of the kinetic analyses of recombinant human NAT2 with the substrates SMR and SDZ revealed that the methyl groups impart favourable enzyme- substrate interactions between the NAT2 proteins and the acceptor substrate.
However, the KSPYmvalue of NAT2 (455 PM) is almost 9-fold lower than its KSDZmvalue of
3980 pM (Table 9). Since both SDZ and SPY lack rnethyl group substituents, the ring nitrogens must also somehow play a role in determining NAT2 enzyme-substrate interactions.
Overall, this relationship between size and acceptor su bstrate affinity was further evident upon cornparison of al1 the Kmvalues for an individual substrate. For example, the mutant FA displayed the lowest Kmvalues for each of the substrates SMZ, SMR, and SDZ, whereas FY had the largest amino acid side-chain and the highest Kmvalues for each of the sulfonamide substrates (Table 9).
3.2.3.1 -2 Molecular activities
The molecular activities or kcatvalues for the wild-type NATs and NAT1-FI 25 mutant proteins are summarized in Table 10. The PAS and PABA molecular activities of wild-type NATl and FY were significantly greater than those they exhibited for the sulfonamide substrates. Since the high rnolecular activities of wild-type NATl and FY appeared to be restricted to the srnaller NAT1-selective substrates, these results suggested that the size of the amino acid side-chain also played an important role in
-1 16- TABLE10 Summary of rnolecuiar activities for wild-type and mutant NAT1-FI25 proteins
The enzyme activity of bacterial Iysates containing expressed recombinant NAT proteins was determined as described in Methods 2.2.1.6.3. Apparent kCBtvalues (rnean Istandard error) are in s''. Results shown below are for at least three independent experiments. 'The low affinity of wild-type NAT2 for PABA did not allow an accurate determination of bai.
Protein SMZ SMR SDZ SPY PABA PAS
wild-type NAT1 wild-type NAT2 modulati~gthe rate of the N-acetylation of NAT1-seledive substrates. Interestingly, the
PAS and PABA rnolecular activities of wild-type NAT1 and FY generally decreased in parallel with the successive reductions in the molecular volume of the side-chain at position 125 (Table 10).
The FV mutant protein exhibited the highest molecular activity for each of the four sulfonarnide substrates, whereas wild-type NAT2 displayed the smallest km, values for each substrate except PABA. lnterestingly the NATl proteins uniformty exhibited a low SPY molecular activity (either their lowest or next to lowest value), yet wild-type
NAT2 displayed its highest mo!ecular activity for this substrate (Table 1 0).
3.2.3.1 -3 Specificity constants
Since we are capable of determining the molecular activities (k,,,) for recombinant NAT pr~teins,catalytic efficiencies were assessed by calculating the specificity constants (=k,,JK,). Only the NAT1 proteins with amino acid side-chain volumes greater than or equal to 93 A (FT, FV, FY, and wild-type NAT1) exhibited their highest specificity constants for both NAT1-selective substrates PAS and PABA. The catalytic efficiencies of wild-type NATl and FY for PAS and PABA were more than four orders of magnitude greater than any of the values that they exhibited for the sulfonamide substrates (Figure 33). On the other hand, the FA, FS, FT, and FV mutants had specificity constants that did not differ more than 100-fold arnong al1 the substrates. However, the specificity constants for these four mutants (FA, FS, FT, FV) appeared to roughly decrease concomitantly with sulfonamide size (Figure 33).
The catalytic efficiency of these NAT proteins ranged from relatively good to excellent with km/K, ratios of 220 M-'s -' (FY;SMZ) to 2.7E7 M%' (wild-type
NAT1 ;PABA). In fact, the catalytic efficiency of wild-type NATl for PABA is only 1O-fold below the upper limit for kinetic perfection (1 08-1 0' M%") displayed by enzymes such wt NATl 1 .wt NAT2
I 1 1 I I 1 SMZ SMR SDZ SPY PAS PABA wild-type NAT1
NATl-FI 25Y
NAT1-FI 25V
NAT1-FI 25T
NAT1-FI 25s
NAT1-FI 25A wild-type NAT2
Figure 33: Specificity constants of wild-type NAT and mutant NAT10 FI25 proteins. (a) Kinetic analyses were performed using the acceptor substrates SMZ, SMR, SDZ, SPY, PABA and PAS as descnbed in Methods 2.2.1 -6.3. K,,./& values (mean I standard error) are for at least three independent experiments. (b) Ratios of specificity constants of SM2 to fhose for PAS. as acetylcholinesterase and carbonic anhydrase (Stryer, 1988). Perhaps this is not that surprising , since investigators can readily observe NAT1-specific acetylation from
human liver samples, but have great difficulty in detecting immunoreactive NAT protein
(Grant et a/., 1991). Thus, the low levels of NAT1 protein appear to be cornplemented by a robust catalytic activity.
The ratio of specificity constants for SM2 to those for PAS can be used to characterize the kinetic selectivity of a mutant NAT protein. A low value is indicative of a kinetic identity akin to that of wild-type NATI, whereas a high value is representaiive of a protein exhibiting NAT2-type charaeteristics. The FA and FS mutants exhibited values proximal to unity, which suggested that these proteins were exhibiting equal kinetic selectivity for PAS and SMZ (Figure 33b). The ratios for FT and FV were still
3000-fold and 600-fold lower, respectively, than wild-type NAT1 such that they display some characteristics from both NAT1 and NAT2 (Figure 33b). On the other hand, the mutant FY was comparable to that of wild-type NAT1 with kinetic selectivity for NAT1- type substrates (Figure 33b). This figure clearly demonstrates that site-directed mutagenesis could be used in the human NAT proteins to engineer novel kinetic selectivities for a distinct class of substrates.
3.2.3.2 NAT1-RI 27s
Previous studies in our laboratory suggested that amino acid position 127 is an important determinant of NAT1-type substrate specificity (Goodfellow et al., 2000). It was pioposed in this present study that the positively charged side-chain of residue 127 was interacting with the negatively charged para-carboxylate group of the NAT1 - selective substrate PAS. We used site-directed mutagenesis to investigate whether a charge interaction was indeed one of the key factors in the high PAS affinity of wild-type
NAT1. The wild-type Argl2' residue was mutated to the only other positively charged residue Lys, the negatively charged residues Glu and Asp and their uncharged amine derivatives Gln and Asn, respectively, and the long hydrophobic side-chain of Met and
Ser (the NAT2 residue at position 127) (Figure 29b). A panel of aniline derivatives was selected that differed with respect to the nature of their para-substituents and overall cornplernented the amino acid substitutions (Figure 34). The functional groups at the para-position in this series of aniline derivatives included those that had negative and positive charges, carbonyl groups, hydroxyl groups, and methyl groups.
The mutant NAT1-RI 27 and wild-type NAT proteins were expressed as bacterial recombinant proteins, the lysates were assayed for enzymic activity, and their PAS and
SM2 kinetic parameters are surnmarized in Table 11. We employed these probe substrates to assess the effect of these mutations on NAT kinetic behavior and aid in the selection of candidate mutants for further characterization studies. RK, the only mutant with a positive charge at position 127, had the lowest KPASmvalue (25 pM) of al1 the NAT1-RI 27 mutants that was only 3-fold greater than wild-type NAT1 (Figure 35a).
Interestingly, the RK mutant also had the most marked decrease in KSMZmof 23-fold
(Figure 35b). On the other hand, RM and RQ exhibited the greatest increases in KPASm values of 175-fold and 165-fold, respectively. Nonetheless, RQ maintained a KSMZm value that was still comparable to wild-type NAT1. RE, the acidic derivative of RQ, had almost identical KPAS, and KSMzmvalues of 744 pM and 805 PM, respectively. One of the common features of the three mutants (RD, RN, RS) not selected for further characterization studies was their equal selectivity for PAS and SMZ. Unlike the equally high affinities displayed by some of the FI25 mutants, these mutant NATs had relatively moderate to low affinities. This brief description was intended to highlight the justification for selecting the mutant RE, RK, RM, and RQ proteins along with wild-type paminobenzylamine
paminobenzoic acid
paminoacetophenone
ptoluidine
paminophenol
aniline
Figure 34: Chernical structures of substrates used in the kinetic characterization of NAT1-RI27 mutant proteins. TABLE11 Michaelis-Menfen kinetic parameters for wild-type NA TI and mutant NA TI-R127proteins The enzyme activity of bacterial lysates containing expressed recombinant NAT proteins was determined as described in Methods 2.2.1.6.3 for the acceptor amine substrates PAS and SMZ. Apparent Km values (mean t standard error) are in pM and apparent ktvalues (mean t standard error) in s", and the specificity constant (IQJK,) is in M-'s-'. Results shown below are from at least three independent experiments.
PAS
NAT1-R1 27D
NAT1-R1 27E
NAT1-RI 27K
NAT1-RI 27M
NAT1-RI 27N
NAT1-R1 27Q
NAT1-R1 27s
wild-type NAT1
wild-type NAT2 (a) wild-type NATl I PAS NAT1-R 127s
NAT1-R 127Q
NAT1-RI 27N
NAT1-RlZ'M
NAT1-RI 27K
NAT1-RI 27E
NAT1-RI 270
(4 wild-type NATl
Figure 35: Substrate specificities of wild-type NATl and mutanl NAT1-RI 27 proteins for NAT1-selective substrate PAS and NAT2- selective substrate SMZ. Kinetic analyses were performed using the (a) NATI-selective substrate PAS and (b) the NAT2-selective substrate SMZ. Enzyme activities were detennined from bacterial lysates as described in Methods 2.2.1.6.3. Results are mean + standard error for at least three independent experiments. NAT1 for our subsequent kinetic characterization studies. A more complete analysis of these mutants with our panel of acceptor amine substrates will now be described below-
3.2.3.2-1 Substrate affinities
The Kmvalues of RE, RK, RM, RQ, and wild-type NAT1 for each acceptor amine substrate are summarized in Table 12. Ail of the NATl proteins, excluding RK, had Km values that spanned a rather remarkable range. For instance, RQ had a 16,500-fold range between KpAAp,and KSMZ,values. On the other hand, RK was unique among these NAT1 proteins because the Km values for the substrates in this panel spanned only a 13-fold range. Overall, the majority of the values were in the low to mid micrornolar range, indicative of an enzyme with relatively high affinity for its substrate.
Furthermore, some of the Km values observed in this study are lower than any previously reported for known substrates of the human NAT enzymes.
The two sole NATl proteins with a positively charged side-chain at position 127, wild-type NATl and RK, were the only NATs to exhibit high affinity for the NAT1- selective substrates (Table 12). Ail other mutant NAT1 proteins had 100- to 300-fold increases in both their KPAS, and KPABA,values (Table 12). Surprisingly, RE, with a negatively charged glutamic acidic side-chain, had lower Kmvalues than those exhibited by both RM and RQ (Table 12). An identical rank order of the KPAsmand KPABAmvaiues was observed for these wild-type and mutant NATl proteins.
A wide range in Km values was observed for the following series of aniline derivatives: pCA (41-fold), pTOL (42-fold), pAAP (63-fold) and ANL (27-fold), whereas a much more modest range was observed for both pAP (8.5-fold) and pABA (7.6-fold).
It was evident that some of the amino acid substitutions that may have hindered or decreased specificity for PAS or PABA, in turn enhanced specificity for those substrates with neutral or positively charged para-substituents. In fact, the wild-type NAT1 and RK TABLE12 Summary of Km values for wild-type and mutant NA Tl- R 127 proteins
The enzyme activity of bacterial lysates containing expressed recombinant NAT proteins was determined as described in Methods 2.2.1.6.3. Apparent Km values (mean i standard error) are in pM and results shown below are for at least three independent experiments.
RI 27E RI27K RI27M RI 27Q wt NAT1
PAS 744 -t 78 25 t 0.9 1285 k 85 1205 a 25 7.25 r 0.48
PABA 1860 + 75 50 14 2340 e 120 1970 + 90 5.40 + 0.81
ANL 38 I6 148 c 13 11717 206 II 2 1020 I80 proteins generally had the two highest Km values for the aniline derivatives bearing neutral or positively charged para-substituents. On the other hand, the RE mutant, with a negatively charged acidic side-chain, typically exhibited the lowest Kmvalue for each aniline derivative having a neutral or positively charged para-substituent. in general, the
Kmvalues of RM and RQ were intermediate between those proteins with a positively charged (wild-type NATl and RK) or negatively charged (RE) side-chain at position
127. This implies that the observed effect is a direct result of the chernical reactivity of the functional group at position 127, not a general structural or hydrophobic effect.
The significance of the length and chernical nature of the para-substituents for the NAT1-selective substrates was revealed in the kinetic parameters displayed by these mutants. Since the KANLmvalue of wild-type NATl was more than 120-fold greater than KPABA,,,, this suggested that perhaps the presence of both an aniline ring and a substituent were required to function as an NAT1-selective substrate. pAAP and PABA have para-acetyl and para-carboxylate groups, respectively, thus only differing in the nature of their terminal functional groups. It appears that the hydroxyl group of PABA likely functions only as an essential fine-tuning or modifying feature in the determination of NAT1-type substrate selectivity characteristics since there is less than a 3-fotd difference in the Kmvalues of wild-type NAT1 for PABA and p-AAP. On the other hand, conversion of this positive charge to a negative charge at position 127 yields a protein
(the RE mutant) with a KPABAmvalue that is 3500-fold greater than KpAAP,. This further exemplifies the critical role that position 127 must play in defining the active-site environment for NAT1-selective substrates.
The electronegativity of the chlorine atom in p-CA may potentially produce an overall slightly negative charge at the para-position, thus according to our hypothesis wild-type NATl may also have a high affinity for pCA. However, wild-type NATl had a KpCAmvalue of 285 pM that was 34-fold higher than its KPAS,value. Altematively, these data support our findings that the length of the para-substituent was also an important defining characteristic. It will be interesting in the future to use additional substrates to assess how differing substituent lengths may alter substrate affinity. Attempts were also made to reverse the proposed charge interaction by using an acceptor amine substrate such as pABA that has a positively charged group at pH 7.4. Although the RE mutant did have the lowest KpAB4, value, it was in the high pM range and only 4-fold lower than
RQ (Table 12). Perhaps when the active-site is better defined this approach can be revisited.
3.2.3.2.2 Molecular activities
The molecular activities of the NAT1-RI27 mutant proteins are summarized in
Table 13. The molecular activities for these NAT proteins varied considerably among different substrates with the /d, values spanning a range of almost 45,000-fold.
Individuaily, the RE, RK, RM, and RQ mutants and wild-type NAT1 displayed a range of molecular activities for al1 of the acceptor amine substrates that spanned 104-, 164-,
37-, 16-, and 269-fold, respectively (Table 13).
Each of the single point mutations at residue 127 imparted a marked decrease in molecular activity for each acceptor amine substrate, thus wild-type NAT1 had the highest k,,, values for each substrate (Table 13). In fact, the k,,, values of the mutants were more than 10-fold lower than wild-type NAT1 for each substrate, except pABA
(2.5-fold) and SMZ (6.5-fold). RK exhibited the largest single decrease (6200-fold;PAS) in molecular activity as compared to wild-type NAT1 (Table 13). Overall, it was interesting that the lowest km,values appeared to always be associated with the RE and
RK mutants. TABLE13 Summary of molecuiar activities for wild-type and mutant NA TI-RI27 proteins
The enzyme activity of bacterial lysates containing expressed recombinant NAT proteins was determined as described in Methods 2.2.1 -6.3for each acceptor amine substrate. Apparent k,,, values (mean i: standard error) are in s-'. Results are shown below from at least three independent experiments.
PAS
PABA
PCA
P- AP pTOL pABA pAAP
ANL
SM2 The NAT1-RI 27 mutants and wild-type NAT1 exhibited their lowest ktvalues for the two substrates pAAP and p-ABA, respectively. Interestingly, although pAAP was the substrate for which each mutant had the highest affinity, it lacked the features required to promote or enhance the rate of the acetylation reaction. Alternatively, toluidine was the substrate for which three NAT1 proteins (RN, RQ, wild-type NATI) displayed their highest molecular activities. This suggested that the volume occupied by the para-substituent was an integral component in determining the rate of acetylation. RK and RE exhibited their highest k,, values for the substrates pCA and aniline, respectively.
3.2.3.2.3 Specificity constants
The details of an enzyme's catalytic efficiency are revealed upon the determination of its specificity constant. We calculated the specificity constants (&JK,) for each of the mutant NAT1-RI27 proteins (Figure 36a). Since a significant amount of variation was observed in the k,, and Kmvalues for these proteins, it was not surprising the &/Km values of RE, RK, RM, RO,and wild-type NATl spanned a remarkable range of 40,000-, 1 83-, 21,000-, 12,500-, and 240,000-fold, respectively.
The specificity constants for wild-type NATl were greater than 10' M%" for al1 substrates, except pABA and SM2 (Figure 36a), and the highest for almost al1 the substrates in this panel. Only the RM and RQ mutants displayed specificity constants for a select few substrates (pCA, pAAP, and SMZ) that exceeded those of the wild- type NAT1 protein. Wild-type NATl had &/Km ratios for the NAT1-selective substrates
PAS and PABA that were more than three orders of magnitude greater than those of the
NAT1-RI 27 mutants. The sensitivity of the catalytic centre to alterations in charge status were reflected in the observation that either RE or RK displayed the lowest catalytic efficiency for each substrate. R127E 0 R127K 108 O R127M é A R127Q 0 0 wt NAT1 9 i
(b)
wild-type NAT2
wild-type NAT1
NAT1-RI 27Q
NATl-R1 27M
NAT1-RI 27K
NAT1-RI 27E
Figure 36: Specificity constants of wild-type NATl and mutant NAT+ RI27 proteins. (a) Kinetic analyses were perfomed using the acceptor amine substrates PAS, PABA, p-CA, pAP, pTOL, pABA, pAAP, AN1 and SMZ as described in Methods 2.2.1.6.3. kcat/Km values (mean t standard error) are from at least three independent experiments. (b) Ratios of specificity constants of SM2 to those for PAS. The specificity constants of RM and RQ were greater than 10' M-'s-' for al1 aniline
derivatives, except pABA (Figure 36a). In fact, al1 of the NATl proteins had kJK,
values for pABA that were less than one hundred, suggesting that this was an
extremely poor NAT substrate. Although the specificity constant of RM for SMZ was
less than 2000 M-'s-', RM still had the highest specificity constant for SMZ (Figure 36a).
Furthermore, the k,JK,(SMZ)/kJK,(PAS) ratio of the RM mutant was 36,000-fold
larger than wild-type NATl and was indicative of a protein with NAT2-type behavior
(Figure 36b). Alternatively, despite the poor catalytic efficiency of RK, this mutant
exhibited the highest NAT1-type behavior with a k,JKm(SMZ)/kaJK,(PAS) ratio of 0.036 that was still three orders of magnitude smaller than wild-type NATl (Figure 36b). Al1 together, the ratio of specificity constants revealed that each mutation imparted a significant impairment of NATl -type kinetic behavior.
3.2.3.2.4 pH activity profiles
In general, active sites contain several ionizable amino acid side-chains that participate in enzyme catalysis and hence the corresponding enzymic activity will Vary with alterations in pH. Recently, the StNAT structure revealed that His'07 was a rnember of a catalytic triad that was proposed to mediate the NAT reaction mechanism (Sinclair
et al., 2000). The pKa range of His residues in proteins is generally 5 to 8 (Fersht,
1985), which corresponds with the published pH profiles of mammalian NATs (Andres
et al., 1983; Andres et al., 1987).
In Our study, we made the following assumptions: 1) ionizable groups function as perfectly titrating acids and bases; 2) a single active ionizable enzyme is present; 3) protonic equilibriurn of intermediates exists; 4) there is no change in the rate- determining step due to pH (Fersht, 1985). Our experimental goals were to examine how alterations in pH modulated molecular activity and substrate affinity.
-1 32- The carboxylate group of PAS remained ionized and negatively charged at al1 pH values (5.63-9.6) used in this study. Although the pKa values of the free Arg and
Lys amino acids are - 12 and 10.8, respectively, there are examples where significant perturbations, arising from hydrophobicity, hydrogen-bonding or electrostatic interactions, can drarnatically alter the pKa in the active centre. Only the wild-type NAT proteins had detectable enzymic activity at pH values less than 6, whereas ail of the recombinant NATs were still functional at pH 9.60. The shape of pH-activity curves is a cornbination of the extent of alterations to the charge status of the enzyme or substrate and some degree of enzyme denaturation at low and high pH.
Overall, it is apparent that the molecular activities of the wild-type and mutant
NAT1 proteins displayed comparable pH dependence curves since the ordinate axis on each plot was 3.5 logarithrnic units. In particular, the broadest and most pronounced bell-shâped pattern of kCa values was obsenred for wild-type NAT1 (Figure 37a). On the other hand, there was only a 50-fold range in the molecular activities of RD and RE that yielded much shallower curves with a much less pronounced bell-shape (Figure
37b). The rnodest effect of pH on rnolecular activity for RD and RE may not be primarily due to the acidic functional groups, but a result of a general overall decrease in catalytic function. The remaining NAT1 mutant proteins (RK, RM, RN, RQ, and RS) displayed distinct bell-shaped curves that were comparable to wild-type NAT1 in their amplitude, but narrower at their apex (Figure 37c).
Plots of the logarithm of the kinetic parameter k,JK, against pH can be used to calculate the pKa of ionizable groups that are involved in a catalytic reaction. The width w of the curve at 50% of the maximal height and the mean pKa (=(pK, + pK2)/2), the pH at the maximum, can be used to determine the individual pKa values using the following equation: pK2- pK, = 2 * log (1oWi2 - 4 + 1 (from Fersht, 1985)
-133- Figure 37: Effect of pH on molecular activity of wild-type NATl and mutant NAT1-RI 27 proteins. Kinetic analyses of (a) wild-type NAT1, (b) RD, RE, and wild-type NAT2, and (c) RK, RM, RN, RQ, and RS were perfomed with substrates PAS (wild-type NATl and NAT-RI27 mutants) or SMZ (wild-type NAT2) as described in Methods 2.2.2.4. Experiments were performed in duplicate. We analyzed the curves in Figure 38 using this equation to provide rough estimates of the pKa values for each NAT1 protein. Since the cuwes are sirnilar in
Figure 38, it is not surprising that the estimated individual pK, (5.5-6.2) and pK, (8.7-9.7) values did not have a large range. These values presumably reflect the ionization of the
Cys6' (-8.5) and Hislo7(-6.5) residues. Overall, the wild-type and mutant NATs had comparable pKa values, which again suggests that the role of ArglZ7in NAT1-type substrate selectivity is independent of the pH.
Although pH dependence studies predominantly report how pH alters the molecular activity and specificity constants of an enzyme, the pH can also alter the Km by ionization of the enzyme-substrate complex (Fersht, 1985). Interestingly, al1 of the mutant NAT1 proteins, except RD and RE, had similar curves with a narrow sharp peak, in contrast to the broad flattened curve of wild-type NAT1 (data not shown). The two mutants with acidic functionai groups (RD and RE) exhibited Km values that were independent of the pH (data not shown).
3.2.4 Stabilities of wild-type and mutant NAT proteins
The relative stabilities of the wild-type and mutant NATs are summarized in Table
14. Wild-type NAT1 and NAT2 had t,, values of 6.4 hr and 32 hr, respectively. In general, the NAT1-FI25 mutant proteins were more stable than the NAT1-RI27 mutants. AI1 of the FI25 mutant proteins, except FY, had in vitro stabilities that were comparable to or greater than wild-type NAT2. FA exhibited a 4-fold increase in intrinsic stability relative to wild-type NATI, whereas the t,, values of the NAT1 mutants
FS, FT, and FV were even greater than the 32 hr of wild-type NAT2 (Table 14). On the other hand, the intrinsic stability of FY was 3-fold smaller than that of wild-type NAT1.
These results suggested that the size of the amino acid side-chain at position 125 was also an important determinant of protein stability for NAT1. Figure 38: Effect of pH on the specificity constants of wild-type NATl and mutant NAT1-RI 27 proteins. Kinetic analyses of (a) wild-type NAT1, (b) RD, RE and wild-type NAT2, and (c) RK, RM, RN, RQ and RS were performed with substrates PAS (wild-type NATl and NAT-RI27 mutants) or SMZ (wild-type NAT2) as described in Methods 2.2.2.4. Experiments were performed in duplicate. In vitro stabilities of wild-type and mutant NA T proteins
The t,, (in hours) is calculated to be the time at which 50% of the original enzyme activity remained upon preincubation of the bacterial lysate at 37" C and is used as an estimate of the intrinsic stabilty of the wild-type and mutant NAT proteins.
Protein
wild-type NAT1 wild-type NAT2 Amino acid substitutions at position 127 in NATl revealed some very interesting structural characteristics. Although the removal of positively charged residues such as
Arg is often associated with important structural consequences (Mrabet et ai., 19W), the replacement of the positively charged guanidinium group of with amino acids displaying a diverse range of functional groups, had only modest effects on the stability characteristics for many of these mutants (Table 14). In particular, the RD and RE mutants, with negatively charged side-chains, their amine derivatives RN and RQ, respectively, and the mutant RS containing the NAT2 Set-'" residue al1 exhibited k, values comparable to wild-type NAT1. Interestingly, the RK mutant with a conservation of positive charge at position 127, generated the least stable NAT1-RI27 mutant with a t,, t,, value of 15 min (Table 14). The long hydrophobic group of Met Iikely contributed to the inherent stability of the hydrophobic core and allowed the RM mutant to display an intrinsic stability comparable to wild-type NAT2. It is not uncommon that residues involved in enzyme catalysis have not been optimized for protein stability during evolution (Shoichet et al., 1995). This was clearly demonstrated in our studies since two of the NAT proteins (wild-type NATl and RK) with the highest affinity for the NAT1- selective substrates PAS and PABA also exhibited two of the lowest t,, values.
3.2.5 Chernical denaturation studies
Guanidine-hydrochloride (GnHCI) induced denaturation of proteins can also be used as a relative measure of the intrinsic stability of a protein. Active sites of enzymes are usually comprised of a relatively open and flexible regions optimized for the entry and exit of molecules participating in the enzymic reaction. If a residue is mutated in or near the active site then marked changes in its resistance to chernical denaturation by
GnHCl may be observed. Wild-type NAT1 displayed an IC, value that was roughly 5-fold lower than wild- type NAT2 (Table 15), consistent with our in vitro stability experiments (Table 14). All of the NAT1-FI25 mutant proteins had IC,, values that were less than the 99 pM of wild- type NATl (Table 15). Interestingly, FY had the largest IC,, value for al1 the NAT1-FI 25 mutant proteins, which suggests that indeed the srnaller side-chains permit increased flexibility proximal to the active site.
All of the mutant NATI-RI27 proteins, except RK, had IC, values that were greater than wild-type NAT1 (Table 15). The NAT proteins with a positive charge at position 127 (wild-type NAT1, RK, mutant NAT1 -F125s) had al1 of the lowest IC, values. This may suggest that ArglZ7indeed has an important functional role if NATl has opted to maintain this structurally unfavorable residue. Furthermore, a positively charged side-chain at position 127 could be important for maintaining a flexible active- site environment. Although a positively charged residue at position 127 was associated with increased sensitivity to chemical denaturation, the RD and RE mutants had IC,, values comparable to their amine derivatives (Table 15). RM was the NAT1-RI 27 mutant with the greatest intrinsic stability and resistance to chemical denaturation by
GnHCI.
3.2.6 Cofactor binding
Double-reciprocal plots of l/velocity versus 1/[substrate A] for varying concentrations of substrate B should depict parallel lines for enzymes that follow a ping- pong kinetic rnechanism (Fersht, 1985). In addition, increases in the concentration of substrate B are accompanied by concomitant increases in enzyme velocity. Initially, we wanted to ensure that the mutants we had selected for cofactor binding studies also displayed a ping-pong kinetic mechanism. Upon analysis of the recombinant wild-type and mutant NATs, ail NAT proteins generally exhibited a ping-pong kinetic rnechanism Chemical denaturation of wild-type and mutant NAT proteins
The IC,, values (mM) of the NAT proteins for Guanidine Hydrochloride (GnHCI) are calculated as the GnHCl concentration at which 50% enzyme activity is observed relative to that obtained in the absence of GnHCI upon incubation of the bacterial lysate at 37" C. lt is used as an esimate of the intrinsic stability of the wild-type and mutant NAT proteins.
Protein
wild-type NAT1 wild-type NAT2 (Figures 39, 40). Although it should be noted that the curves for N (Figure 40a) and
RK (Figure 40c) at [AcCoA] ~250pM do appear a little steeper than those at the other cofactor concentrations. However, overall these mutant NAT proteins were considered to exhibit sufficient NAT characteristic behavior for subsequent analyses.
In order to assess if the mutations we had introduced altered the binding of the cofactor acetyl-CoA, we carried out experirnents to determine the apparent and the true kinetic parameters for CoASAc. Calculations of the apparent parameters involved using a fixed acceptor amine concentration proximal to the Km for each NAT protein. A summary of the apparent kinetic parameters is Iisted in Table 16. Wild-type NAT2 had a KCoASAC,value that was roughly 3-fold higher than wild-type NATl (Figure 41a), however since different fixed acceptor amines (PAS and SMZ) were used it is difficult to assess the overall significance of this difference.
Ail of the NAT1-F1 25 mutants displayed KCoASAC,values that were less than 2-fold greater than wild-type NAT1 (Figure 41 a). On the other hand, a few select NAT1 -R127 mutants displayed marked differences in their cofactor binding characteristics. RD and
RE exhibited roughly 5-fold and 7-fold increases, respectively, in KCoASAcvaIues, whereas al1 the remaining RI27 mutants had cofactor binding affinities comparable to wild-type NATl (Figure 41 b). It has been suggested that the Gly126residue is the start of a putative structural P-loop for binding the phosphate groups of CoASAc (Sinclair et al., 2000). Perhaps the proximity of the negatively charged side-chains of RD or RE repelled the phosphate groups 03 CoASAc and decreased binding affinity. All of the
F125 mutants had molecular activities and catalytic eff iciencies for CoASAc that were markedly higher than those displayed for the RI27 mutants (Table 16). In particular,
FY, the only mutant with a phenyl ring at position 125 Iike the wild-type NATl residue, had the Iargest k-J K , ratio of al1 the NAT proteins. Figure 39: Double-reciprocal plots of l/velocity against l/[substrate] for (a) wild-type NATI, (b) wild-type NAT2 and (c) NAT1-Fl25S. Fixed concentrations of CoASAc (50 FM, 67 PM, 100 PM, 250 FM and 500 PM) were used. Duplicates were assayed for recombinant NAT protein at the acceptor amine concentrations indicated on the abscissa. Acetylated products were determined by HPLC analysis and the enzyme velocity is reported in nmoles/min/mg. The equation of these curves was deterrnined using the curve-fitting software package Ultrafit (Biosoft, Ferguson,MO). .- O*- - -O' .s :a - - -.--.- -I ' - --.- .-X - .- ,* - - *- a-- - O,--':.--- I ' 0- .--- - .-.- pl-[AcCo A] -- --500pM
1 I I I O 0.01 0.02 0.03 0.04 0.05
Figure 40: Double-reciprocal plots of l/velocity against I/[substrate] for (a) NAT1-F125Y, (b) NAT1-R127E, and (c) NAT1-RI 27K. Fixed concentrations of CoASAc (50 PM, 67 PM, 100 PM, 250 PM, and 500 PM) were used. Duplicates were assayed for recombinant NAT protein at the acceptor amine concentrations indicated on the abscissa. Acetylated products were determined by HPLC analysis and enzyme velocity is reported in nmoles/min/mg. The equation of these curves was determined using the curve-fitting software package Ultrafit (Biosoft, Ferguson,MO). Michaelis-Menten apparent kinetic parameters of NA T pro teins for CoASAc
Fixed concentrations of the acceptor amine were used at values that approximated the Km values for each respective recombinant NAT protein. Cofactor concentrations were used that spanned roughly IO-fold above and below the KCoASAC,value for each NAT protein. Enzymic activity of bacterial lysates containing expressed recombinant NAT proteins was determined as described in Methods 2.2.1.6.3. Apparent KmvaIues (rnean + standard error) are in PM, apparent /E, values (mean t standard error) are in s-', and k,jK,,, values are in M"s?
NATl -FI25A 45 sr: 1 NAT1-FI 25s 11 *1 NAT1-FI 25T 56k4 NAT1-FI 25V 122 +: 24 NAT1-FI 25Y 173 + 35
NAT1-R127D 0.95 sr: 0.30 NAT1-RI 27E 0.72 a 0.14 NAT1-RI 27K 0.75 + 0.09 NAT1-RI 27M 8.1 7 + 0.66
NAT1-RI ZN 6.11 -t- 1.05 NAT1-RI 27Q 4.98 + 1.12 NATl-RI 27s 3.70 + 0.38
wild-type NATl 210 =t 9 wild-type NAT2 0.45 + 0.04 CoASAc
Figure 41: Substrate specificities of wild-type and mutant NAT proteins for cofactor CoASAc. Kinetic analyses were performed using fixed concentrations of the acceptor amine (PAS or SMZ) thal approximated the respective Km values for each mutant (a) NAT1-FI25 and (b) NAT1-RI 27 protein. Enzyme activities were determined from bacterial lysates as outlined in Methods 2.2.1 -6.3. Results are mean t standard error for at least three independent experiments. The true kinetic parameters for the acceptor amine and CoASAc were determined by varying the concentrations of both of these substrates- The data obtained from these experirnents were transformed to primary kinetic plots of
[substrate]/velocity versus [substrate]. The term 'primary' is used to describe those plots, which use raw kinetic data. The following example describes how the true kinetic parameters for CoASAc were determined. The cornplementary analyses were performed for each set of data to aIso determine the true kinetic parameters of the NAT proteins for the acceptor amines. In the example shown in Figure 42a, the data were plotted and analyzed at fixed concentrations of cofactor (50, 100, 250, and 500 PM) with varying [acceptor amine]. The reciprocal of the slope of each curve was equal to the maximal velocity such that increases in cofactor concentration yielded shallower curves with higher enzymic velocities. A common ordinate intercept (KA,,) for this type of plot is another characteristic feature of enzymes exhibiting ping-pong kinetics. The
INma,and Kn/Vmaxvalues determined from the slope and ordinate intercept, respectively, were used for subsequent graphing procedures.
The apparent kinetic parameters of the NAT proteins for eithei- substrate were dependent on the concentration of the other substrate. Thus, the values that were determined from the primary kinetic plots in this example were then plotted against the reciprocal concentrations of the substrate CoASAc. Since the KJV,, value was a common ordinate intercept for fixed concentrations of cofactor, it is not surprising that these values were independent of the [CoASAc] (data not shown). This was additional evidence that a protein was displaying a ping-pong kinetic mechanism. On the other hand, the lNma,values were dependent on CoASAc concentration (Figure 42b) and these curves were used to determine the true kinetic parameters for CoASAc. The Km 1/[COAS Ac] Figure 42: Determination of true kinetic parameters for recombinant NAT proteins. (a) Primary kinetic plots of [PAS]/v against [PAS] for fixed concentrations of cofactor CoASAc (50 PM,100 FM, 250 PM and 500 FM). Duplicates were assayed for recombinanl NAT protein activity at the acceptor amine concentration indicated on the abscissa. Acetylated products were deterrnined by HPLC analysis and enzymic velocity is reported in nmoles/min/mg. The slope (1N,,J and ordinate intercept (Kfl,.,,,J were deterrnined for the curve at each cofactor concentration. (b) IN,, values from the primary plot were plotted against the reciprocal of the cofactor concentrations. True Kmand V,, values for CoASAc were determined by calculating the abscissa (-llKJ and ordinate (IN,,) intercepts, respectively. and V,, values for CoASAc were ascertained by the calculation of the abscissa intercepts (-1/Km) and ordinate intercepts (1N,A, respectively.
True kinetic parameters were determined for the wild-type and select mutant
NAT proteins and are summarized in Table 17. Although, the apparent kinetic parameters of RK for PAS and CoASAc were comparable to those of wild-type NAT1, no true kinetic constants coiild be calculated. RK was a very unstable protein (t, - 15 min), which may have precluded an accurate detemination of these values. The true
value for wild-type NAT2 was almost 5-fold greater than wild-type NAT1, which in part may explain the much higher intrinsic activity of hurnan NAT1.
The significance of a phenyl ring at position 125 in NAT1-type kinetic behavior is also highlighted by the true kinetic constants. Although the FS and FI mutants have comparable true K~~~~~~,values and only a Bfold difference in KPAS,values, the true kt values for FY are 10-fold greater than that for FS. This rnay suggest that the phenyl ring at position 125 modulated the efficiency or rate of the enzymic reaction more than the actual binding of substrate. Indeed, FY had roughly 22% efficiency relative to wild- type NAT1, whereas FS had only 1-2%. On the other hand, the exchange of positive and negative residues at position 127 drastically irnpaired the catalytic ability of this enzyme with the RE mutant displaying catalytic efficiencies that were less than 0.05% of wild-type NATI. These results further supported a model in which PhelZ5and Argl" are proximal to the CoASAc and acceptor substrate binding sites. Michaelis-Menten true kinetic parameters for NAT proteins True kinetic parameters were calculated as described in Results 3.2.6 and shown in Figure 40. The concentratioiis of both the acceptor amine and cofactor were varied and the kinetic data were plotted and were transformed to secondary plots of 1N,,, against lI[CoASAc]. Abscissa (-l/Km) and ordinate (1N,,,) intercepts were determined from secondary plots for calculation of the true kinetic parameters.
protein su bstrate wild-type NAT1 PAS AcCoA PAS AcCoA PAS AcCoA 2.7E2 (0.006%) NAT1-RI 27E PAS 10495 + 2655 2.88 0.68 AcCoA 3545 rt 565 8.1 E2 (0.05%)
wild-type NAT2 SMZ AcCoA 4. Discussion
ln this study, we observed that single point mutations could drastically alter the kinetic characteristics of the recombinant human NATl proteins. We employed separate panels of acceptor amine substrates to perform the kinetic characterization of two distinct series of mutant NATl proteins. The size of the amino acid side-chain at position 125 was demonstrated to be a key determinant of specificity for NAT2-selective substrates. Aitematively, our studies also revealed that a positively charged residue at position 127 was required for NAT1-type kinetic selectivity. No alterations in cofactor binding affinities were observed for the modified NAT1 proteins with amino acid substitutions at position 125, whereas only the introduction of a negatively charged side- chain at position 127 resulted in significant decreases in cofactor affinity. The purification of recombinant human NAT proteins enabled us to ultimately determine the kcatvalues for each NAT protein in this study. Although the Ir,, values account for the variable expression levels of the recombinant NAT proteins, differences in protein stability may also in part contribute to their marked differences in molecular activities.
Evidence was provided that human NAT1 was a robust catalyst for the acceptor amine substrates PAS and PABA with an extremely high catalytic efficiency.
The number of solved structures in the PDB has increased rapidly in the last decade and greatly enhanced Our understanding of enzymic catalytic reactions, however direct structural information is still only available for a very small percentage
(-1 %) of al1 proteins currently found in the SWISS-PROTfTrEMBL databases (Moult,
1999). Recent technologicat advances in structural determination, along with more labs functioning aImost as assembly lines in the production of diffraction quality crystals, has led to an increase in the rate of deposition of structural coordinates in the PDB. Furthermore, cornputer based modeling software programs are providing exciting opportunities to build structural models for protein homologues.
In the field of NAT structure-function studies, the crystal structure of the bacterial homologue SNAT (pdb entry le2t) was recently published (Sinclair et al., 2000) and may alfow us to circumvent the lack of a crystallographic structure of the human NAT proteins. StNAT is the only protein in the PDB that displays sufficient sequence identity
(> 30-35%) with NAT1 and could thus be capable of functioning as a template for homology modeling. The goal of developing such a rnodel for human NAT1 would be to provide a structural framework to describe and interpret the functional analyses perforrned in this study. Although the entire amino acid sequences of SNAT and NAT1 are only 27% identical, the amino-terminal regions of these two proteins share a much higher identity (35%) in the first 150 arnino acids and contain three highly conserved regions (corresponding to the NAT1 residues 34-42, 64-85, and 107-131 in Figure 43).
The amino acids that are proposed to constitute the catalytic triad in human NAT1
(CysBa,His107, AspI2') and the residues mutated in this study (Phe'2s and Arg12?) are located within these conserved sequences. In order to maximize the quafity of our model, we selected a Iinear NATl 100-amino acid segment (residues 29-131) that represented the highest amino acid sequence identity (37%) between SNAT and NAT1 .
Prior to building our homology model for interpretation of the kinetic data, it was important to confirm that in addition to sequence sirnilarity these proteins also shared secondary structural elements and protein folds. We submitted the linear amino acid sequences of StNAT and NATl to the following four automated public secondary structure prediction servers: PSA, NPS @ , PSIPRED, and PredictProtein. The consensus secondary structural elements were conserved between these NAT homologues in the region in which we performed our mutagenesis experiments t-w (P-sheet:l20-2, loop: 123-130, P-sheet: 131-5) and agree with the crystal structure of
SNAT. Since predictions for the catalytic triad are also consistent with the structural information available for SNAT, it appears that these homologues may share similar three-dimensional structures. The characteristic folding pattern of a family or class of proteins is often more highly conserved than the primary amino acid sequence. Since aIl the enzymes in class 2.3.1 (the 'acyltransferases') share a common function; perhaps they contain a fold that is unique to this class. In addition to SNAT, only two other members of EC 2.3.1, the xenobiotic acetyltransferase from Psuedomonas aeruginosa (PaXAT) and dihydrolipoarnide succinyltransferase (DHST) from E. coli, were identified as potential tempIates for human NATI. However, PaXAT and DHST aligned with the NAT1 residues 82 to 118 and 247 to 290, respectively, which would not allow us to build a model for the active-site environment. Alternatively, the fold recognition algorithm 3D-PSSM predicted that the fold of NATI (a+8 ) was consistent with the SNAT structure. All together, these findings suggested that StNAT was a more than suitable template to use in the development of a human NAT1 homology model.
The sequence identity between human NAT1 (residues 29-1 31) and StNAT is more than 37% and well above the 30% limit that is considered to be the threshold limit for accurate homology modeling (Marti-Renom et al., 2000). The SWISS-MODEL program (Guex and Peitsch, 1997) was utilized to develop a hornology model of human
NATl that is displayed as a SWISS-PdbViewer representation in Figure 44. There are only four residues Glya3,Prog7, and GlyI26) in our NATl homology model that are found in disallowed regions of the Ramachandran plot (data not shown). The spatial orientation of the Glu" residue will likely be altered from that observed in our mode1 because it is proposed to form a salt bridge with the highly conserved Arg64residue and stabilize (Sinclair et al., 2000). Not surprisingly, since the human NATl sequence was threaded around the structure of StNAT, the overall gross architecture and -1 53- backbone of the template and model are comparable (Figure 44a). In fact, the structural alignment of these structures in SWISS-PdbViewer yields a root mean square deviation of 1.92 A for the a-carbon atoms. Furthermore, the distinct structural elements of the cr-helical bundle (domain 1) and the P-barre1 (dornain 2) are conserved between these structures (Figure 44a). In particular, the catalytic triad is located within an (a+ p ) fold (residues 68-131) that consists of an alpha helix and three strands of an antiparallel P-sheet. An overlap of the template and model depicts the highly conserved nature of the catalytic tnad in a similar spatial pattern (Figure 44b). Further examination of the active site centre for the NATl mode1 reveals the close proximity of amino acid positions 125 and 127 to the residues of the catalytic triad (Figure 45). We do acknowledge that our current mode1 is not capable of finely dissecting the details of the
NAT catalytic mechanism. However, this model does provide invaluable information about the structural environment of the human NAT1 active site for the interpretation of the NAT kinetic parameters in this study.
4.1 Kinetic parameters of the modified human NATl proteins
An enzyme can confer specificity for a substrate through electrostatic or hydrophobic interactions, hydrogen bonds, van der Waals forces, and a complementary three-dimensional shape. A common underlying theme in NAT structure-function studies is to describe how these very similar proteins exhibit such distinct kinetic properties. Previous studies in our laboratory have demonstrated that amino acid positions 125 and 127 in the human NATs are key determinants of NAT2-type and
NAT1-type kinetic behavior, respectively (Goodfellow et al., 2000). The primary goal of the studies described herein was to delineate how the human NAT1 residues 125 and Figure 44: Structural model of human NATl (aa 29-131). (a) POV-RayTM generated Swiss-PdbViewer (ribbon diagram) representation of the hornology- modelled human NATl (aa 29-131) and the 3D structure of SLNAT (aa 29- 13l;pdb entry le2t). Catalytic triad residues are shown as sticks in blue. (b) Overlay of catalytic triad residues of human NAT1 model (cyan) and StNAT (red). Figure 45: Structural model of human NATl active site. NATl catalytic residues are shown in red. Val93 and Sep5 residues are shown in yellow, Phel25 is shown in cyan, and Arg127 is shown in blue. 127 specifically modulate the functional characteristics and kinetic selectivity of the
human NAT proteins.
4.1.1 NAT1-FI 25 Mutants
The mutations at position 125 in human NAT1 irnparted some of the most
remarkable alterations in kinetic parameters observed to date for NAT proteins. We
proposed that the size of residue 125 in NAT1 controls acceptor amine substrate
access to the active site. Thus, a thorough discussion of our results must incorporate
how the size of amino acid position 125 alters NAT kinetic selectivity.
Since a complementary shape is crucial for the efficient transmission of a rnoiecular or biochernical signal, steric restrictions may play a significant role in the determination of enzyme-substrate interactions as demonstrated in studies with an E.
coii class A TEM P-lactarnase (Vakulenko et al., 1999). The wild-type NAT1 protein has a specificity constant for the smaller NAT1-selective substrate PAS that was 15,000-fold greater than that for the larger NAT2-selective substrate. PheI2' is predicted to be a
member of a loop (spanning from AS~'~~to Gln130) secortdary structurai element.
Protein loops are often located at the protein surface where they can play important
roles in molecuIar function and the recognition of biological entities (Leszczynski and
Rose, 1986). In our rnodel the Phe12' residue is in close proxirnity to the catalytic triad and this large bulky residue (-136 A3) appears to loom over the active site and restrict
access to only those select smaller substrates (Figure 45). We propose that PhelZ5is functioning as a clamp around or above an entrance or passageway to the active site.
Thus, mutations that reduce the side-chain volume at position 125 should enhance affinity and selectivity for larger substrates such as SMZ. Indeed, Our functional analyses revealed that those NAT1-FI 25 mutants lacking a phenyl ring at position 125
had remarkable increases in NAT2-type kinetic selectivity (600-fold to 38,000-fold), despite only modest alterations in their kinetic selectivities for the NAT1 -selective -1 57- substrates PAS and PABA. Furthermore, the lq.JKm(PAS)/LJKm(SMZ) ratios can describe the kinetic behavior as NAT1-like (high value) or NAT2-like (low value). In particular, several mutants. FA (0.41), FS (1 .O), and FT (4.9), exhibited values close to unity suggesting that these proteins displayed equal kinetic selectivity for the NAT- selective substrates. The significant role that the phenyl ring at position 125 must play in the determination of NATI-type kinetic behavior was evident from the similar ratios of specificity constants demonstrated by the FY mutant and wild-type NATI. Plotting the ratio of specificity constants with respect to the molecular volume of the side-chah at position 125 for the wild-type and mutant NAT proteins enabled us to directly explore this relationship (Figure 46). It is clearly evident from this figure that increases in the amino acid side-chain volume were directly associated with increases in NAT1-type kinetic behavior. Thus, remarkably the size of a single residue in this 290 amino acid protein appears to be one of the critical deterrninants in NAT kinetic selectivity.
Furthermore, SWISS-PdbViewer representations of our series of mutant NAT1-FI 25 proteins confirm our functional studies and provide clear evidence that steric hindrance of Cysssincreases concomitantly with the side-chain volume of residue 125 (Figure 47).
Interestingiy, bacterial NATs, which have a conserved Phe residue at position 125, exhibit a NAT1 pattern of kinetic behavior with extremely low rates of SM2 acetylation and a high catalytic efficiency for 5-aminosalicyIic acid.
So far we have interpreted and discussed the kinetic data involving only the probe substrates PAS and SMZ. We now expand our analysis to include the sulfanilamidopyrimidines. (SDZ. SMR, SMZ), which differ only in the number of their methyl substituents on the pyrimidine ring. Not surprisingly from the above discussion of steric hindrance at position 125, the FA and FY mutants had the lowest and highest 60 80 1O0 120 140 160 Molecular Volume (A3)
Figure 46: Effect of amino aczid side-chain volume at position 125 on NAT kinetic selectivity. Kinetic analyses were performed using the NAT1- selective and NAT2-selective substrates PAS and SMZ, respectively. Enzyme activities were determined from bacterial lysates as described in Methods 2.2.1.6.3. k,$)(, values are reported in M-'s-1. Molecular volumes of amino acid side-chains were obtained froam Creighton (1 994). Figure 47: Catalytic core of wild-type and mutant NAT1-FI25 proteins. POV-RayTMgenerated Swiss-PdbViewer (ribbon diagrams) representations of hornology-modelled (a) wild-type NAT1 (aa 29-131) and mutants (b) FA, (c) FS, (d) FT, (e) RI, and (f) W. The amino acid side-chahs of the catalytic triad residues (Cys6*, His107, Asp122) and position 125 are shown. Green dashed lines represent putative hydrogen bonds as predicted by Swiss-PdbViewer. 'u- helices' are in green, 'b-sheets' are in orange, and 'loops' are in magenta. Kmvalues, respectively, for each of these substrates. Furtherrnore, the Kmvalues of the
FA, FS, and FT mutants decreased as the sulfonamide size increased from
SDZ+SMR+SMZ. From our studies, it thus appears that once the substrate has gained access to the NAT active site, it is optimum for the drug molecule to be as large as possible. Perhaps the methyl groups on the pyrimidine ring are forming favorable hydrogen bonds that stabilize the transition state of the enzymic reaction. Since SNAT was crystallized with an inhibitor (p-bromoacetanilide) bound in the active site, molecular docking studies should be capable of predicting with high accuracy the NAT residues that are forming H-bonds or hydrophobic interactions with the substrate.
Overall, this concept of a reciprocal relationship, a small side-chah and large substrate or vice versa, to describe enzyme-substrate interactions has also been reported for other drug metabolizing enzymes such as P450 2A5 (Uno et al., 1997) and the sulfotransferases SULTI A1 and SULT1A3 (Brix et al., 1999a). Since the lowest Km value was reported for the FA mutant with the smallest side-chain at 125 and the largest substrate (SMZ), we will have to engineer a larger active-site environment or employ larger substrates to further define NAT-substrate interactions. However, Gly is the only amino acid smaller than Ala, but will often destabilize a protein when introduced by mutagenesis (Achari et al., 1997). If we look for other targets, NAT1 (Helo6)and NAT2
(Leu1'=) only differ at one position arnong al1 residues within 6 A of the active-site Cys68 residue. Perhaps this conservative substitution will enhance affinity for the larger sulfonamides like the single Val+lle mutation in P4502A4/5 imparted a 42-fold increase in regiospecificity for androstenedione hydroxylation (1 wasaki et al., 1995).
Alternatively, additional details about the active site could be obtained using larger sulfonamide probe substrates (e.g. sulfadimethoxime, sulfasymazine) or those that differ in the nature of their N'-ring (e.g. thiazole). 4.1 -2 NAT1-RI 27 Mutants
In our present studies, we have proposed that the positively charged guanidinium group of Argt" interacts with the para-carboxylate group of the NAT1-selective substrate to optimize orientation of the substrate in the active site. Our human NAT1 homology model predicts that the distance between the guanidinium and sulfhydryl functional groups of Arg12' and Cyss8, respectively, is -13.5 A. This should be an adequate distance to facilitate the accommodation of the NAT acceptor amine substrate in the active site with the amino and carboxylate groups proximal to Cys6' and ~rg"?, respectively (Figure 48). It is noteworthy that the NAT protein in each species that contains an Argln residue also displayed the lowest Km values for the NAT1-selective substrates PAS or PABA (Table 18).
Electrostatics play a key role in the cataiytic mechanism of an enzyme.
However, it is extremely diff icult to correlate functional differences in enzymic activity with altered electrostatic fields. Investigators must generally rely on indirect rnethods, such as substrate binding properties or the pH dependence of catalysis, to measure electrostatic effects. In Our studies, wild-type NATl and RK, the only NATl proteins with positively charged side-chains at residue 127, exhibited Kmvalues for the NATI- selective substrates that were more than 30-fold lower than those displayed by the other mutant NAT1-RI27 proteins. Thus, since we proposed that a charge interaction was responsible for rnediating NAT1-type kinetic behavior, then removal of this positive charge should eliminate this interaction and hence selectivity for NAT1-type substrates.
We observed that al1 NATI-RI27 mutant proteins lacking a positive charge at amino acid position 127 exhibited significant decreases in affinity for the NAT1 -selective substrates PAS and PABA. Whilst we cannot be certain that residue 127 interacts with the substrate, the specificity of the effects that oui- mutagenesis elicited strongly Figure 48: Atomic distances in the active site of the human NAT1 homology model. Pro-RayTMgenerated Swiss-PdbViewer representation of NAT1 model (aa 29-131). Distances from the sulfhydryl group of the catalytic Cys68 residue to the functional groups of other members of the catalytic triad (His107 and Asp122) and those residues mutated in this present study (Phel25 and Arg127) are shown. Enzyme kinetic parameters for wiid-type NA T proteins from se veral species
Bacterial lysates containing expressed recombinant wild-type hurnan and mouse NAT proteins were used to quantify enzyme activity by HPLC as described in "Methods". PAS and PABA were used as NAT1-seledive probe drugs, apparent Km values are in PM, and acetyltransferase activity is in nmoles/min/mg. Three or greater independent experiments were performed and the mean values c SE are listed in the table for human and rnouse NATs. Hamster NAT1 (Ferguson et ai., 1994), hamster NAT2 (Ferguson et al., 1W6), rat NATs (Doll and Hein, 1995) were expressed in E. coii and assays were performed as described in Hein et al. (1991 ).
amino acid at S pecies Protein position 127 Substrate Km
Arg PAS Ser PAS
G~Y PAS Arg PAS Phe PAS
Hamster NAT1 8 PABA NATl 9 PABA NAT2 15 PABA NAT2 76A PABA
amino acid at acetyltransferase Species Protein position 127 Substrate activity
rat NAT1 13 Se r PABA 1.23 -e 0.05~ NAT2 20 Arg PABA 4632 + 5033
1. (Ferguson et al., 1994) 2. (Ferguson et al., 1996) 3. (DoIl and Hein, 1995) supports our model. Furthermore, the active site of StNAT with the bound irreversible inhibitor pbrornoacetanilide revealed that the bromine group appeared to interact with the Valg4 and eu'^ residues (Sinclair et al., 2000). Interestingly, the corresponding residues in our NATl homology model (Valg3and Sep5) were found to be located close to ~rg'~(Figure 45). This indeed suggests that the binding of substrate in the NAT active site will result in the spatial orientation of the substrate's para-substituent in the vicinity of Arg12'. Moreover, although these mutant NAT1-RI27 proteins displayed low affinities for PAS and PABA, they did have high affinities for other acceptor amine substrates. This suggests that the removai of the positive charge at residue 127 did not lead to general unfolding or misfolding of the protein, but maintained the integrity of the active site and only altered the chernical reactivity of this single functional group. The definitive evidence wiil require detailed structural information for the wild-type NATl and mutant NAT1-RI 27 proteins in the presence of a substrate analog.
Altematively, wild-type NAT1 and RK generally displayed the highest Kmvalues for those substrates lacking negatively charged para-substituents. It is noteworthy that it was RE that exhibited the lowest Km value for the majority of these substrates.
Overall, a general trend can be readily observed upon plotting the respective Kmvalues of the wild-type and mutant NAT1-RI27 proteins for each of the individual acceptor substrates (Figure 49). The curves for the NAT! -selective substrates PAS and PABA go from the bottom left (high affinity) to the top right (low affinity) as the charge at position 127 goes from positive (RI K) -t neutral (MI Q) + negative (E). In marked contrast, the curves for al1 of the other substrates proceed from the top left (low affinity) to the bottom right (high affinity). Overall, these results indicated that we appeared to have reversed this charge interaction. However, the reversal of polarity is one of the ultimate challenges to those working in the field of protein engineering. The total or +p -aminosalicylic acid -Cp -aminobenzoic acid - -A--p -chloroaniline - +-p -aminophen01 - -O-p -toluidine - -Cl - aniline - hl--p-aminoacetophenane +l--p-aminobenzylamine
Figure 49: Effect of para-substituent on substrate affinity for select NAT1- RI27 mutants. Kinetic analyses were performed using the acceptor amine substrates shown in Figure 34. Enzyme activities were determined from bacterial iysates as described in Methods 2.2.1.6.3 and Km values were repo-rted in FM. overall intemal electrostatic interactions in a protein are predominantly favourable (Oliva
and Moult, 1999), suggesting that alterations will destabilize this prepolarized
microenvironment and make efforts to achieve ion pair reversa1 very difficult (Hwang
and Warshel, 1988). The protease subtilisin BPN' is one of the few examples for which
these approaches have been successful since the ion pairs in its active site have not
been optimized during evolution (Wells et al., 1987). Furthermore, all of the NAT
proteins had Km values in the mM range for the only substrate (p-ABA) in which the
charge of the para-substituent was reversed or positive.
The kinetic mechanism of cysteine proteases involves the activation of the
catalytic Cys residue by a hydrogen bond network in which the other members of the
triad, Asp and His, increase the nucleophilicity of the thiol group by a 'charge relay
system' (Bromme et al., 1996). The predicted hydrogen bonds that support such a
mechanism along with those involving the catalytic triad residues are shown in Figure
50. In the context of Our NAT1-RI27 mutants, the epsilon nitrogen atorn of ArglZ7and
the hydroxyl group of SerlZ8form one of the five stabilizing hydrogen bonds in a loop
(Aspt2' - Gln13') proposed to be in the active-site environment. Replacement of Arg127
with any other amino acid resulted in a loss of H-bond formation with Sert2'. However,
since the Arg-tLys mutant, capable of forming a single hydrogen bond, maintained high
affinity for the NAT1-selective substrates, this suggested that the positively charged
terminal amino group of Lys was likely interacting with the carboxylate group of the
substrate. Furthermore, this implies that wild-type guanidinium group of arc^'^^ may
have at least two significant roles: (1) substrate binding and (2) maintenance of
backbone conformation (hydrogen bonding). The RK mutant exhibits a rnarked
decrease in ktvalues for the NAT1-selective substrates that may be attributed to alterations in the spatial orientation of this loop in the absence of the Arg127-Ser128 Figure 50: NAT1 active site loop hydrogen bond network (aa 122-130). NAT1 catalytic triad residues are in cyan, except Aspl= which is in magenta. Loop residues are in grey (aa 122-130). Backbone NH and CO groups are in blue and red, respectively. Hydrogen bonds are in green. hydrogen bond. Modest changes in the Michaelis constants with drastic reductions in kthave also been observed for this conserved Arg+Lys mutation in lactate dehydrogenase (Hart et al., 1987).
The substrates pAAP and PABA are very similar with an acetyl group and carboxylate group, respectively, as their para-substituents. Although pAAP does not have a negatively charged para-substituent Iike PABA, the KpMp,,, of wild-type NATl was only about 3-fold greater than Rs KPABA,,,value. Thus, the high affinity of wild-type
NATl for both PABA and pAAP suggests that the carbonyl group may in fact be an important deteminant of NAT1-type substrate selectivity, whereas the hydroxyl moiety of PABA functions to fine-tune substrate orientation. This lack of fine-adjustrnent is presumabty reflected in the markedly lower p-AAP molecular activities for each NATl protein as compared to their ktvalues for PABA. In Iight of what we observed with Our
NATl homology model, perhaps the mutants had higher affinity for p-AAP than the
NAT1-selective substrates due to subtle shifts in the backbone of this flexible loop such that the carboxylate group of PAS or PABA were now in electrostatic repulsion with an acidic NAT1 amino acid proximal to the active-site such as
Hydrophobic binding sites are a common component of the active-site environment for many enzymes and make important contributions towards the determination of substrate specificity. We examined the role that hydrophobic interactions may have had on the kinetic behavior of these wild-type and mutant NATl proteins. However, there did not appear to be a highly significant relationship (al1 R2c
0.55, data not shown) between the substrate hydrophobicity and the k,, or &/Km values for any of the NAT proteins. The relative binding energies of the NATl mutants were deterrnined to estimate the contributions of H-bonding, electrostatic interactions, and hydrophobic interactions towards the substrate specificity of each enzyme (Fersht,
1985). Values were calculated with respect to aniline to assess the role of the -1 69- substituents for each substrate. pAAP and PABA displayed the largest most consistent differences in binding energy (> 8 kcavmol) among al[ NAT proteins (data not shown).
4.2 Cofactor binding of wild-type NATs and mutant NAT proteins
In 1953 Bessman and Lipman first proposed that an acetyl-enzyme intermediate was formed during the transfer of an acetyl group from the cofador CoASAc to the acceptor amine. Although cofactor binding may be one of the select features that al1
NAT homologues share, only a relatively few investigations have addressed this area of
NAT research. However, it is imperative that both acceptor amine and cofactor binding characteristics be examined for any study that introduces mutations into the NAT proteins. In our present study, we determined the apparent and true kinetic constants of wild-type and mutant NAT proteins for the cofactor CoASAc to assess their contribution to the rernarkable alterations in acceptor amine binding. Overall, Our results for the wild-type NAT proteins were consistent with those reported by Deloménie et ai. (1 997).
The acetyl-CoA molecule is relatively large (809.6 Da) and can be subdivided into three functional units: P-mercaptoethylamine, pantothenic acid, and 3'-phospho
ADP. Proteins are capable of utilizing a variety of arnino acid sequences or motifs to facilitate CoASH binding (Engel and Wierenga, 1996). For exampie, site-directed mutagenesis has been used to identify Arg residues that are involved in mediating acetyl-CoA binding for rat choline acetyltransferase (Wu and Hersh, 1995) and human spermidine/spenine IV'-acetyltransferase (Lu et al., 1996). In order to identify the NAT cofactor binding site, deletion mutants of human NAT1 were constructed until the minimum sequence capable of binding [2-3H]acetyl-Co~was identified (residues 1-204)
(Sinclair and Sim. 1997). Detailed SNAT structural information has suggested that this protein utilizes a nucleotide binding motif, referred to as a 'structural P-loop', to bind CoASAc (Sinclair et al., 2000). This motif was first identified iri ATP- and GTP-binding proteins (Saraste et al., 1990) and is found in a diverse range of protein superfamilies including the sulfotransferases (Komatsu et al., 1994). A glycine amino acid initiates this four-residue motif with the amide nitrogens orientated to form hydrogen bonds with the phosphate oxygens of CoASAc. It has been proposed that the putative structural P- loop originates with the residue, which is located between the two residues mutated in Our present study, in al1 NAT proteins. Rifamycin amide synthase, one of the only two rnembers of the NAT sequence family that do not contain a Gly residue at position 126, catalyzes intramolecular amide formation. Since this enzymic reaction does not require the cofactor, there was presurnably no selection pressure for this protein to have a Gly residue at position 126 for mediating CoASAc binding. interestingly, mouse NAT3, the other NAT that lacks a Gly12' residue, has extremely low activity for al1 acceptor amine substrates tested to date (Estrada-Rodgers ef al., 1998b).
It was thus important to determine CoASAc binding affinities for our mutant proteins in light of the predictions that the putative cofactor binding location was proximal to the mutated residues in this study. AI1 of the mutant NAT1 proteins, except
RD and RE, had cofactor affinities that were comparable to the wild-type NAT1 protein.
The RD and RE mutants were the only two proteins that had negatively charged side chahs at position 127. Thus, it is interesting to speculate that their decreased cofactor affinities arose as a result of a negative interaction between the phosphate groups of the cofactor and the aspartate or glutamate functional groups. From the viewpoint of protein functionality, it may be quite advantageous for the protein to have the cofactor and acceptor amine substrate binding sites in such close proximity. On the other hand, it does seem rather surprising that this motif includes the only three residues not conserved between NAT1 and NAT2 in a span of 50 amino acids (1 00-150). Although it is the amide nitrogens of the backbone that form the H-bonds with the cofactor, -171 - differences in the chernical nature of the amino acids can produce slight alterations in backbone conformation and hence cofactor binding. Three-dimensional structural information for human NATl and further mutagenesis studies will help resolve some of these queries.
Double-reciprocal plots of kinetic data for the wild-type and select mutant NATs yielded sets of parallel Iines that are characteristic of enzymes displaying ping-pong kinetics and possessing an acetyl-enzyme intermediate. Linear transformation of the kinetic data, as outlined in the results section, enabled the calculation of the wild-type and select mutant NAT proteins (FS, FY,RE, RK) true Kmvalues for the acceptor amine substrate and CoASAc. The NAT1-Fl25S and NAT1-Fl25Y mutants had true ~oASAcm values that were comparable to wild-type NAT1 (only - 2-fold greater). Altematively, the high true eoASACmvalues of NATI-R127E may contribute to the large decrease in
PAS affinity of this mutant, which could arise from unproductive binding in the active site. Al1 together, these results suggested that the alterations observed in the kinetic parameters are primarily ctttributed to their ability to bind the acceptor amine substrates for al1 mutant NATs except RD and RE.
On the other hand, the mutant NATI-R127K exhibited some rather unique and unexpected kinetic properties. It was hypothesized that the positively charged Lys side- chain would provide a conservation of NAT1-type kinetic behavior. The apparent acceptor substrate and cofactor affinity characteristics of the RK mutant and the wild- type NATl protein indeed followed a very similar pattern. However, the RK double- reciprocal plot displayed nonparallel lines that were indicative of a protein not exhibiting a ping-pong kinetic mechanism. In addition, we were unable to determine the true kinetic parameters for RK. CoASH is a competitive inhibitor of acceptor amine binding and decreases the rate of N-acetylation (Weber and Hein, 1985). Perhaps Our cofactor recycling system is not robust enough to maintain adequate levels of CoASAc, thus -172- ailowing an increase in the concentration of CoASH to buildup. However, if this scenario were true one would expect the kinetics of more than one mutant NAT protein to be effected. Nonetheless, the RK mutant may be sensitive to CoASAc inhibition
since we have previously observed a similar example of product inhibition for one of our
NAT2 mutant proteins (Goodfeliow et ai., 2000). It is also quite possible that the tremendous decrease in the PAS molecular activity of RK (- 6200-fold) and the relative
instability (t, - 15 min) also played significant roles.
4.3 Relationship between protein expression, stability, IC,,, and
molecular activities for the mutant NAT1 proteins
Overall, the relationship between the maximal velocities and molecular activities
of the NAT1-FI 25 and NAT1-RI27 mutants was relatively comparable for rnoderate to
high rates of acetylation, but differed markedly at the lower enzyrnic activities (data not
shown). These data suggest that the maximal velocities underestimate the acetylation
activity, since it did not consider the relative numbers of NAT catalytic centres. Thus,
this observation likely reflects the fact that the contribution of the total number of
molecules of enzyme towards functional activity may be proportionally higher at these
lower enzymic activities. In other words, the differences in expression levels had a
more profound effect on the lower enzymic activities. The developrnent of a
methodology such as this should provide the means to precisely dissect the rate
constants of the recently proposed novel NAT catalytic mechanism.
Recombinant protein expression is often dictated by the inherent stability of the
folded protein. Protein stability encompasses thermodynamic forces (entropy and
enthalpy) and kinetic stability (unfolding kinetics) and is defined by the contributions of
multiple amino acids in a given protein. If a protein is unstable, then it will unfold, and become degraded by cellular processes and hence its expression will appear to be decreased upon Western blot analysis (Parsell and Sauer, 1989). Thus, it was not surprising that the three mutants (RK, FY, and RE) with the lowest intrinsic stabilities ais0 exhibited decreased NAT expression levers. Furthermore, FiK and FY were also more susceptible than wild-type NAT1 to chemical denaturation with GnHCI. One can envision an alternative scenario in which a mutation was engineered to produce enhanced protein stability (Shaw and Bott, 1996). In this example, the molecule would remain active in the cytosol for a longer duration, more molecu[es of the protein would accumulate, and a greater functional output would be generated. The RM and FV mutants exhibited the greatest molecular activities for the FI25 mutants and RI27 mutants, respectively, and displayed increased expression leveis. In addition, the size of the side-chain at position 125 was also clearly associated with the stability of the mutant NAT1-FI 25 proteins. The greatest intrinsic stabilities were displayed by those mutants lacking a phenyl ring side-chain at position 125. Furthermore, FV exhibited the higheçt rnolecular activity for each suffonamide substrate and was the most stable NAT protein in this study. On the other hand, it appeared that hydrophobicity might play a role in the intrinsic stability of the mutant NAT1-RI 27 proteins. NAT1-RI 27M, with the most hydrophobic amino acid substitution, displayed the greatest increase in protein stability, whereas the hydrophilic RK mutant was the least stable. However, the two other mutants with hydrophilic side-chains, RD and RE, exhibited t, values greater than wild-type NAT1.
It has been proposed that amino acids involved in enzyme catalysis are often not optimized for protein stability (Shoichet et al., 1995). The premise is that those residues involved in catalysis complement the substrate binding site or active-site, whereas substitutions will complement the local protein environment and increase protein stability at the expense of catalytic activity. For example, five catalytic residues in T4 -174- lysozyme were muteted to generate variants that exhibited decreased catalytic activity and increased relative stability (Shoichet et al., 1995). In our studies, W. which had a kinetic selectivity comparable to wild-type NAT1, was the only NAT1-FI 25 mutant protein that did not exhibit a marked increase in intrinsic stability. In contrast, each FA,
FS, FT, and FV mutant protein had a markedly lower molecular activity for the NAT1- selective substrates PAS and PABA, despite an increase in protein stability.
Arg residues often impart stabilizing influences on protein structure through eiectrostatic interactions (Mrabet et al., 1992). Inconsistent with these findings, we observed that many of the NAT1-RI27 mutants had increased intrinsic stabilities. On the other hand, the protein stability of the RK mutant, which had the only other positively charged side-chain, was significantly decreased. A Kl7*R mutation in Saccharomyces cerevisiae rnanganese-containing superoxide dismutase elicited a marked reduction in protein stability with no alteration in catalytic activity (Borders et al., 1998). Although in our study the RK mutant did have a markedly reduced molecular activity, there did not appear to be a correlation between protein stability and molecular activity for the NATl -
RI27 mutants.
4.4 Summary
We have dernonstraied that single point mutations in the human NATl proteins can produce remarkable alterations in their kinetic parameters. ln particular, the molecular volume of the residue at position 125 plays an integral role in the determination of NAT kinetic selectivity and protein stability. Increases in the size of the amino acid functional group at position 125 were associated with increases in NATI- type kinetic behavior. For instance, the mutant FY exhibited a pattern of substrate selectivity that was quite similar to that of wild-type NAT1 with almost a 14,000-fold preference for the NAT1-selective substrates, whereas the FA and FS mutants had
roughly an equal kinetic selectivity for the probe substrates PAS and SMZ. A hornology
model of human NATl predicts that the wild-type NATl Phe''' residue looms over the
active site and is consistent with our functional data thai steric factors at this location
rnay play a role in determining NAT kinetic selectivity. The mutants with smaller amino
acid side-chains at position 125 were also more stable, suggesting that perhaps a large functional group at this position imparted negative contributions towards NATl protein
stability.
The effects of the modifications at position 127 were not as dramatic as those at
125, but still quite intriguing. We have provided evidence that clearly demonstrates that
a positively charged side-chain at position 127 is a critical determinant in mediating high
substrate affinity for NAT1-selective substrates. Although the ArgTZ7residue has not
been implicated in the catalytic mechanism, removal of this residue led to marked
decreases in molecular activity that were not associated with differences in protein
stability. This suggests that the ultimate functional goal of Arg12' may be to orientate the
substrate in such a rnanner that the para-amino group is proximal to the acetyl-enzyme
intermediate. Only two of the mutant NAT1 proteins, RD and RE, had altered cofactor
binding affinities with respect to wild-type NAT1. These mutants, the only two with
negative charges at position 127, had decreased cofactor binding affinities that may
presumably arise from an electrostatic repulsion between the acidic functional groups
and the phosphate groups of CoASAc.
4.5 Future Studies
The SNAT structure has provided novel insight into the catalytic mechanism of
the human NAT proteins. It has been suggested by Sinclair et al. (2000) that the catalytic trÏad obsetved in StNAT is conserved among the NAT protein family. Since our homology model of human NATl predicts that the catalytic triad residues (Cys6', Hisl0'l,
Asp12') are clustered together, it will be important to provide functional evidence that these residues indeed play a critical role in the human NAT enzyrnic reaction. Previous site-directed mutagenesis studies in our lab demonstrated that Cysss in human NAT2 participates in the acetylation reaction (Dupret and Grant, 1992) and similar approaches will be utilized to explore the functional role of His107and Asp?
We will continue to explore the structural features of the human NAT proteins that govern their specificities for the cofactor and acceptor amine substrates using site- directed mutagenesis and an expanded spectrurn of probe substrates. The results of this present study suggest that the size of the active-site environment plays a key role in the determination of substrate specificity for the NAT1 proteins. We propose to mutate other amino acids, such as Leu106,which are within - 6 A of Cys68and not conserved between the human NATs. In parallet, putative active site NAT2 residues wiIl be mutated to amino acids with larger side chains. The rationale for this approach is that the larger arylamine and heterocyclic amine carcinogens are selectively metabolized by human NAT2. The engineering of a srnaller NAT2 active site will atternpt to identify the residues and characteristic features that govern their substrate selectivity for this class of compounds.
\Ne have provided the first evidence for the functional role of a NAT1 residue
(Arg12') in acceptor amine substrate binding. Alternatively, Valg4 and Leug6 were identified proximal to the amino group of the bound irreversible inhibitor p brornoacetanilide in the crystal structure of StNAT (Sinclair et al., 2000). Our NATl model predicts that Arg127and Valg3and SepS, the human homologues of Valg4and
LeuQ6,share a similar spatial environment. Since StNAT does not have a corresponding charged residue at position 127 or a residue capable of forming H-bond at position 95, -1 77- perhaps this is why StNAT exhibits a much lower affinity and activity for PAS and PABA
(Grant et al.. 1992a). The human NATl SeP5, unlike the corresponding NAT2 Heg5 residue, is capable of participating in H-bond formation. We will first address whether alterations of NATl Sep5 alter NAT1-type kinetic behavior. Complementary to our studies in human NATI, we will atternpt to engineer an increase in PAS and PABA enzymic activity by the introduction of the Argt2' or Se? residues into SMIAT.
A putative structural P-loop for nucleotide binding has been suggested to originate at Gly12? Our functional data showing that the mutants with the negatively charged acidic groups, RD and RE, had decreased cofactor binding affinities further support this hypothesis. Amino acid substitutions at position 126 would allow us to directly assess what role this residue plays in cofactor binding. In addition, the two members of the NAT sequence family that do not have a GlylZ6residue, mouse NAT3 and rifampcin amide synthase, exhibit atypical acetylation activity. lt would be interesting to speculate that we could enhance cofactor affinity and thus dramatically alter their enzymic function by introducing a Gly residue at position 126.
Our homology model of human NAT1 predicts that there is approximately 16 A between the Arg127and Cys6' residues, which leaves considerable room for the substrate to move around since the length of a phenyl ring is -3 A. Although there is some preliminary evidence that paminobenzoylglutamate is the endogenous substrate for the human NATs (Minchin, 1995). the engineering of NAT mutants containing unnatural amino acids (Davis et al., 1999) together with substrates that have para substituents differing in the number of carbon atoms may allow more accurate predictions of the identity of this endogenous substrate.
We have set up a collaboration with Dr. Dupret to address some fundamental questions on the potential role of the NATs as cysteine proteases. We will investigate what role cysteine protease inhibitors may have on NAT1 activity and also assess -1 78- whether this protein has cysteine protease like-activity. Researchers in this field must start to readdress the question of what the functional roles of these proteins are in vivo.
In the future, it wifl be extremely important to continue efforts towards the developrnent of an experimental three-dimensional structure of a human NAT protein. APPENDIX1 :
HPLC PROFILES OF ACENLATED STANDARDS ------o-'l--- 9 30 1 i SMR (8) 1 0-1 i \ 'l .O Ob I ! ---7l i ;'i 5'- I : ; \ i 1 0.04- 1 \ '\ je - \ 1 \ AC-SMR (2) 1 o.oz? \,, 1 ', ;; IOOI \. . , \, !' '. ! --. - - - -. - . - _ . - O 00
Figure 51: HPLC profiles of acetylated standards for (a) SMUAc-SMZ, (b) SMWAc-SMR, and (c) SDUAc-SDZ. Peaks representing substrate and acetylated products were resolved by the corresponding mobile phases listed in Table 7. Values for individual peaks are indicated in brackets after peakname and are in nmoles. AUFS represents absorbance units full scale. PABA (8) i; I i i !, 11
Figure 52: HPLC profiles of acetylated standardsfor (a) SPYIAc-SPY, (b) PABAfAc-PABA, and (c) pCNAc-gCA. Peaks representing substrate and acetylated products were resolved by the corresponding mobile phases listed in Table 7. Values for individual peaks are indicated in brackets after peak name and are in nmoles. AUFS represents absorbance units full scale. -0.0- 401
O O z.6 u-i- LI. O 7 5
Figure 53: HPLC profiles of acetylated standards for (a) SAAm/Ac-SAAm, (b) PAAPIAc-p-AAP, and (c) pABIAc-p-AB. Peaks representing substrate and acetylated products were resolved by the corresponding mobile phases Iisted in Table 7. Values for individual peaks are indicated in brackets after peak name and are in nmoles. AUFS represents absorbance units full scale. t::
TOL (5.935)
ANL (6-729)
Figure 54: HPLC profiles of acetylated standards for (a) PASIAc-PAS, (b) TOUAc-TOL, (c) AN UAc-ANL, and (d) p-APIAc-p-AP. Su bstrate and acetylated product peaks were resolved by the corresponding mobile phases listed in Table 7. Values for individual peaks are indicated in brackets after peak name and are in nrnoles. AUFS represents absorbance units full scale. APPENDIX2:
GST-NAT EXPRESSIONAND PURIFICATION A21 GST-NAT fusion proteins The glutathione S-transferase (GST) gene fusion system has been used successfully for a wide range of applications including large-scale purification studies (Volkel et al,, 1998), molecular immunology (Kasus-Jacobi et al., 2000) and so-called 'pull-down' experiments that are used to explore in vitro protein- protein interactions (Tsukazaki et al., 1998) and DNA-protein interactions (Ikeda et al., 2000). Recombinant Schistosoma japonicum GST has an apparent molecular weight of 26 kDa, enzymatically active when expressed in E. coli, and has a solved crystal structure that is identical to the native protein (McTigue et al., 1995). Recombinant proteins are expressed as C-terminal fusion proteins of S. japonjcum GST that can be isolated upon cleavage with specific proteases. Recombinant GST has a Km for glutathione of 430 * 70 PM (Walker et al., 1993) that permits mild elution conditions and hence minimal alterations to the functionality of the fusion protein. A2.1.1 Optirnization of expression conditions There is considerable interest in the pharmaceutical industry in the design and optimization of heterologous systems expressing human drug metabolizing enzymes (reviewed in (Guengerich et al,, 1997; Gillam, 1998; Masimirembwa et al., 1999)). The primary goal of many of these studies is ?O use in vitro methodologies to assess and predict whether a particular drug is capable of eticiting an adverse effect in an individual in the general population. The cytochromes P450 families 1 to 3 contain al1 of the P450 enzymes that are responsible for human drug metabolism and thus have been the primary focus of research efforts in this area. The P450s are membrane proteins, unlike the cytosoiic NAT proteins, and thus their recombinant expression faces additional challenges. Sequence modifications in the N-terminus enable differences in the codon preferences between mamrnals and bacteria to be overcome (Gillam, 1998). Since the role of the amino-terminus of the cytochromes P450 is to tether or link the P450 with the membrane, these mutations do not alter P450 function. The replacement of these hydrophobic anchors with amphipathic helices has enabled these engineered recombinant peripheral membrane proteins to be purified with sodium bicarbonate and no detergents (Sueyoshi et al., 1995). There are multitudes of examples in which expression systems have been optimized for the production of soluble recombinant protein and a few interesting examples have been highlighted below. Lower growth temperatures is a simple alteration that often increases the arnount of soluble recombinant protein expression in E. coli (Schein and Noteborn, 1988)- On the other hand, the addition of sorbitol and glycyl betaine can create osmotic stress in bacterial cells and prevent enzymes such as dimethylallyl pyrophosphate: 5'-AMP transferase from forming insoluble inclusion bodies (Biackwell and Horgan, 1991). Genetic manipulations of the expression vector or cloned insert are a complementary approach to augment soluble recombinant protein expression. For example, the removal of the rop gene frorn PET-3a can increase plasmid copy number and enhance the overall heterologous expression (Qoronfleh and Ho, 1993), whereas the mutagenesis of human respiratory syncytial virus (RSV) major glycoprotein resulted In a 278% increase in soluble protein expression levels (Murby et al., 1995). Since the ultirnate goal of our objective was to maximize the compartmentalization of the recombinant NAT protein into the soluble fraction, we exarnined the effects of a variety of parameters on protein expression. We were fortunate that the native human NATs are cytosolic proteins that are catalytically active as monomers, relatively small in size (32-33 kDa), and require no additional factors for functional prokaryotic expression. The enzymic activities of GST-NAT fusion proteins were determined for experimental conditions that differed with respect to: medium (LB, TB, 2X/T), growth temperatures (room temperature (24" C) and 37" C), presence or absence of the inducing agent IPTG, and length of protein induction (3 hr and 21 hr), Although some NAT activity was detected in the absence of IPTG, significant increases in acetylation were observed upon induction with IPTG in most sarnples (Figures 55 and 56). (a) ï I 1 LB medium room temperature ei Ti3 medium
O 1 O 1 [IPTG] (mW 3 hr overnight (21 hr)
O 1 O 1 [l PTG] (mM) 3 hr ovemight (21 hr)
Figure 55: Effect of growth conditions on NAT activity of GST-NAT1 fusion proteins. Cultures were grown in LB, TB, and 2XYT media at (a) room temperature and (b) 37" C. Recombinant protein expression was induced with 1 mM IPTG and cultures grown for 3 hr or 21 hr. Enzyme activity was detennined by assay outlined in Methods 2.2.1.6.3 and reported as nmoles 01 acetylated producVmg of lysate proteidmin. room temperature e7 TB medium
20
10
O O 1 O 1 [IPTG] (mM) 3 hr ovemight (21 hr)
O 1 O 1 [I PTG] (mM) 3 hr overnight (21 hr) Figure 56: Effect of growth conditions on NAT activity of GST-NAT2 fusion proteins. Cultures were grown in LB, TB, and 2XYT media at (a) room temperature and (b) 37" C. Recombinant protein expression was induced with 1 mM IPTG and cultures grown for 3 hr or 21 hr. Enzyme activity determined by assay outlined in Methods 2.2.1.6.3 and reported as nmoles of acetylated product/mg of lysate protein/min. Overall, the samples grown at room temperature had much greater enzymic activity than their respective counterparts at 37" C- The following growth conditions generated maximal rates of acetylation for both the GST-NAT1 and GST-NAT2 fusion proteins: LB or 2XTT medium at room temperature for 21 hr (Figures 55 and 56). These recombinant NAT1 and NAT2 enzymic activities were greater than any observed to date in Our lab and suggest that the GST protein has no detrirnental effect on NAT enzyme activity. Furthermore, if in fact GST does hinder NAT activity, then the amount of recombinant fusion protein produced was underestimated by measurements of N-acetylation. The enzymic activity of GST-NAT1 was afmost 500- fold greater than that of GST-NAT2. The marked discrepancies between the activities of recombinant human NAT1 and NAT2 have been well documented in the literature (Grant et al., 7991; Dupret and Grant, 1992). Perhaps, it may have been usefuf to also utilize the GST substrate 1-chloro-2,4- dinitrobenzene (CDNB) to monitor the GST activity and permit a more direct comparison of protein expression between the NAT proteins. It is always important to complernent these enzyme assays described above with studies that monitor protein expression levels. We examined the soluble (supernatant) and insoluble (pellet) fractions from the GST-NAT fusion proteins for each of the experimental conditions in Figures 55 and 56 by Coomassie staining and western blot analysis. The apparent molecular weight of the GST-NAT fusion protein is approximateiy 58-59 kDa. Experimental conditions producing one of the lowest obse~edGST- NAT1 enzyme activities (Figure 55b, LB medium, 37" C, [IPTG]=I .O mM, 21 hr growth) had no discernable band of the expected size in the supernatant fraction, but a significant band in the pellet fraction was visualized by Coomassie staining (Figure 57a). On the other hand, the conditions for which GST-NAT1 had the highest enzymic activity (Figure 55a, LB or 2XYT medium, room temperature, [IPTG]=I.O mM, 21 hr growth) exhibited a pattern of fusion protein expression pattern that was revealed to be primarily in the soluble fraction upon staining with Coomassie (Figure 57a). Western blot analysis of GST-NAT1 expression identified bands of sirnilar size and pattern (Figure 57b) as that observed for the Coomassie stained gels (Figure 57a). In particular, NAT antiserum #4769 confirmed that the low NAT activity of the GST-NAT fusion protein was associated with expression predorninantly in the pellet (Figure 57b), whereas high NAT activity had a greater degree of partitioning of the fusion protein into the soluble fraction (Figure 57b). Coomassie staining revealed a predominant band in the pellet fraction that was approxirnately the size of the GST-NAT2 fusion protein (Figure 58a). Our NAT antiserum #5231, capable of recognizing both NAT1 and NAT2, appeared to recognize a band the size of the GST-NAT2 protein, not found in Our control samples, that confirmed those results observed by Coomassie staining (Figure 58b). This NAT antiserum, despite being preincubated with native and denatured bacterial lysate proteins to remove nonspecific antibodies, still had a much higher background than antiserum #4769. Since the host bacterial strain XA90 was not protease deficient and protease inhibitors were not added during the preparation of the cell lysate, it is possible that the presence of multiple bands in some of the Ianes of Figure 58b may in fact be degradation products. However, results from other studies in Our lab with protease inhibitors (data not shown) suggests that these multiple bands likely arise from antiserum #5231 recognizing native E. coli XA9O proteins. AI1 together, these results suggested that GST-NAT1 should be selected for large-scale purification procedures with the following growth conditions: room temperature, [IPTG]= 1.O mM, and 2XYT medium. Although no truncated GST-NAT1 proteins were observed (Figure 57b); the expression plasrnid pGEX-4T-2/NAT1 was transforrned into the protease deficient E. coli strain BL21 to address any concerns about protein degradation. Neither an increase in NAT enzyme activity nor change in protein degradation products was observed for the BL21 recombinant GST-NAT1 proteins (data not shown). A Figure 57: GST-NAT1 expression patterns. Lysates (10 pg) of samples assayed for NAT enzymic activity in Figure 55 were separated on 12% SDS- PAGE gels and (a) visualized with Coomassie stain or (b) transferred to nitrocellulose, probed with NAT antiserum #4769 (primary antibody) and horseradish peroxidase labeled donkey anti-rabbit IgG (secondary antibody) and visualized by colour reaction with hydrogen peroxide and luminol. Expression conditions were as follows: A: LB, 37O C, [IPTG]=1.0 ml 21 hr; B: LB, room temperature, [IPTG]=1 .O mM, 21 hr, and C: 2XYT, room temperature, [IPTG]=1 .O mM,21 hr. M represents molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P-Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "S' represents the supernatant, "Pl the pellet, "open arroM the 58-59 kDa GST-NAT1 fusion protein. and "closedarrod'the 32-33 kDa NAT1 protein. Figure 58: GST-NAT2 expression patterns. Lysates (1 0 pg) of sarnples assayed for NAT enzymic activity in Figure 56 were separated on 12% SDS-PAGE gels and (a) visualized with Coomassie stain or (b) transferred to nitrocellulose, probed with NAT antiserum #5231 (primary antibody) and horseradish peroxidase labeled donkey anti-rabbit IgG (secondary antibody), and visualized by colour reaction with hydrogen peraxide and lurninol. Expression conditions were as follows: A: LB, 37" C, [IPTG]=1 .O m, 21 hr; B: LB, room temperature, [IPTG]=l.O mM, 21 hr, and C: 2XM. room temperature, [IPTG]=I .O mM, 21 hr. M represents molecular weight markers and are: Rabbit Muscle Myosin (205 kDa), E. coli P- Galactosidase (1 16 kDa), Rabbit Muscle Phosphorylase b (97.4 kDa), Bovine Albumin (66 kDa), Egg Albumin (45 kDa), and Bovine Erythrocytes Carbonic Anhydrase (29 kDa). "S' represents the supernatant, "Pl the pellet, "open arrod' the 58-59 kDa GST-NAT2 fusion protein, and "closed arrod' the 32-33 kDa NAT2 protein. common feature of GST gene fusion proteins is that oversonication denatures the protein and renders it incapable of binding to the glutathione sepharose 4B matrix (Frangioni and Neel, 1993)- Experiments were perfomed to determine how the acetylation activity of lysates prepared from XA90 and BL21 strains respcnded to sonication over time as an indicator of the folding of the protein. After 20 min of sonication (puiser set at 50% duty cycle), NAT activity was still > 90% for recombinant GST-NAT1 from XA90 cells with respect to lysates prepared according to the standard protocol (section 2.2.2-6.1), but < 50% in BL21 lysates (Figure 59a)- AIthough the GST-NAT1 protein from XA90 cells was relatively unaffected by an extended period of sonication, it displayed only modest temperature stability characteristics. The time for the GST-NAT1 protein to achieve 50% enzyme activity at 4" C and 37" C was 15 hr and 1 hr, respectively (Figure 59b). Overall, the conditions for the preparation and purification of the GST-NAT1 fusion protein are summarized below:
MEDIUM 2XYT TEMPERATURE room tempe rature BACTERIAL STRAIN )(A90 PROTEIN INDUCTION 21 hr SONICATION 20 min (50% duty cycle) Sonication (min)
O 200 400 600 800 1000 1200 1400 Tirne (min)
Figure 59: GST-NAT1 protein stability. (a) Effect of sonication on NAT activity of recombinant GST-NAT1 expressed in bacterial strains BL21 and XA90. Bacterial cells harboring the expressed recombinant fusion proteins were resuspended in TEDK buffer, sonicated with a Vibra CellTM 3 rnrn Stepped Micro-Tip and assayed for NAT activity as described in Methods 2.2.1.6.2. (b) Bacterial lysates of recombinant G ST-NAT1MASO were prepared, pooled, divided into equal parts and incubated at 4O C and 37" C. At specified time points, duplicate samples were removed and assayed for NAT enzymic activity.
A3.1 Introduction One of Our objectives in this study was to obtain detailed structural information of the human NAT proteins. Although the recent elucidation of the SfNAT structure has been an enorrnous aid in the interpretation of Our kinetic data, accurate three-dimensional information for a mamrnalian NAT is still a necessity in this field of research- The details for the preparation of the samples that were used in the various crystallization screens are found in Appendix 2 and section 3-1. Fortunately, sample availabiiity was not a limiting factor in Our studies, since we routinely purified at least 15 mg of NATl protein per litre of bacterial culture. The overall design of this crystal screen of human NAT1 encornpassed the following three main variables: salt, pH, and precipitant. The goal of this appendix was to provide an outline for the experimental crystal screens perforrned and the resulting information that was obtained from these studies.
A3.2 Materials and Methods A3.2-f Materials The precipitants Polyethylene Glycol 4000 (PEG 4K), ?EG 8K, and PEG 400, the cofactor CoASAc, the buffers Tris-HCI and sodium cacodylate, and the components of the buffer the purified protein was resuspended in (dithiothreitol and triethanolamine) were purchased frorn Sigma (Mississauga, ON). The precipitant ammonium sulfate was from ICN Biomedicals, lnc. (Auroa, OH), the buffers sodium acetate and sodium phosphate from BDH Chemicals (Toronto, ON), and EDTA from Bioshop (Burlington, ON). The cleaved purified protein was dialyzed with a Slide-A-LyzerB 10K (MWCO 10,000) from Pierce (Rockford, Il) and then concentrated with UltrafreeB-4 centrifuga1 filter devices from Millipore (Bedford, MA). Crystal screens were performed in 24 well plates from Nunc (Burlington, ON) using the Crystal ScreenTMand Crystal Screen ZTMsetsof reagents from Hampton Research (Laguna Niguel, CA) in the presence or absence of the irreversible NAT inhibitor p-bromoacetanilide and AcCoA (Sigma). A3.2.2 Methods A3.2.2.1 Preparation of Sample Protein purification was performed using the methods described in section 2.2.2.6 and as outlined in resutts section 3.1. Thrombin protease was used to cleave NATl frorn the GST-NAT1 fusion protein bound to the glutathione 4B-sepharose matrix. This eluted protein was then subjected to sequential steps of dialysis and protein concentration. Firstly, the NATl protein (- 2 ml) was injected into a Slide-A-Lyzer cassette (Pierce) and dialyzed overnight at 4" C with 2x11 of TED (10 mM triethanolamine-HCI, I mM EDTA, and 1 mM DTT), The protein was then removed from the cassette, the volume was recorded, and the protein concentration determined by Bradford analysis (Bradford, 1976). Next, this sample was loaded into an UltrafreeS-4centrifugal filter device and concentrated by centrifugation at 7500x9 for 10 min intervals at 4" C. Aliquots from the various steps in the purification were then loaded ont@a 12% SDS-PAGE gel, the proteins were separated by the rnethod of Laemmli (Laemmli, 1970), and protein purity was assessed by staining with Coomassie dye. Upon cmfirmation that the sample was pure, it was immediately snap frozen in liquid nitrogen and stored at -80" C. A3.2.2.2 Hanging Drop Method The purified protein was allowed to thaw on ice and then equilibrated to room temperature. While the protein was thawing, a vaseline filled 20 ml syringe was used to grease the outer edge of al1 the weils in a single row of a 24 well plate. The bottorn reservoirs in this single row were then each filled with 750 pl of a screen solution from Hampton Research (Tables 19 and 20) or a manually made solution. A 2 pl TABLE19
Ctystal Screen TM Solutions
Crysfal Screen Reagent Formulation TABLE20 Crystal ScreenZTMSolutions
Crystal Screen 2 Reaaent Formulation aliquot of the thawed protein sample was placed on a coverslip and an equivaient amount of solution from a bottorr; reservoir was added with the resulting solution mixed by pipetting. If an additive, such as CoASAc or p-bromoacetanilide, were part of the experirnental design, then it would be prernixed with the protein prior to sample application on the cover slip. The coverslip was then tumed over and pressed firmly down on the greased surface of the well to fom a tight seal. If there is a crack or leak in the seal, then the sample will dry out and the vapour diffusion technique wiII not work, These processes were repeated until the row was finished and would then shift to the next row continuing as described above until al1 the experimental conditions had been set-up. The plates were then placed in a room temperature incubator and monitored daily by visual inspection with a low-power light microscope. The results were categorized by the following general observations: clear, precipitate, needle crystals, or single crystals. A numerical value could also be included to indicate the relative strength of each feature. A3.2.2-3 Dynamic Light Scattering In general, dynamic light scattering (DLS) measures the intensity of light that is scattered by proteins in solution and is an indicator of the radius of gyration of the protein in solution. This procedure can be used as an effective screen to identify homogenous non-aggregated monodispersed samples that are much more amenable to crystallization. The device that we used, in Dr. Pai's lab at the University of Toronto, was bianked with the appropriate solution and then an aliquot (- 100-200 pl) of Our sample was injected into the sample cuvette- The computer software provided a determination of the baseline for the sample and also an estirnate of the molecular weight.
A3.3 Results The results from the crystal screen and dynamic light scattering experirnents are summarized in Tables 21 and 22, respectively- The individual experiments will be explained in more detail to allow a more full mderstanding of the approaches undertaken in this study. The initial screen using the Crystal ScreenTMsolutions (Table 19) resulted in no crystalline formation so the protein concentration was lowered and the screen expanded to also include the Crystal Screen21M solutions (Table 20). This yielded a few conditions (PEG, pH 75-85)that were considered favorable for the formation of crystalline particles and dependent on the presence of the protein sample, but the overall trend was towards precipitate formation (Table 21)- In order to attempt to decrease the levels of precipitate, we added the cofactor CoASAc, the irreversible inhibitor p-bromoacetanilide, and the reducing agent dithiothreitol (DTT) to our protein mixture. The addition of the substrates may aid in maintaining the protein in its native conformation. Reducing agents, such as DTT, prevent the oxidation of free sulfhydryl residues (cysteines) and are an important component of Our NAT functional assays. Oxidation of the cysteinyl thiol groups can lead to: the non-specific aggregation of the protein sample, protein denaturation, elimination of protein function, or heterogeneity of the sample. The results from this screen were relatively promising with a variety of solutions capabIe of producing micro crystals or crystalline fragments (Table 21 ). Since the NAT1 enzyme appears to be rather unstable when not in TED buffer, we performed a crystal screen of purified NAT1 in this buffer. The results suggested that solutions with sodium salts between pH 6.5-7.5 provided promising conditions for crystal formation (Table 21). Alternatively, since there is evidence that sorne crystallographers have had success with increasing the protein concentration of the sample, we also adapted this type of experimental design but it yielded no crystal formation. The consistent levels of precipitate suggested that Our sample was likely clumping together or aggregating which greatly limited our likelihood of obtaining crystals. In order to assess the quality of our starting protein sample we used a dynamic Iight scattering device that utilizes a laser to detect the distribution of the protein molecules in solution. ldeally a protein is monodispersed and present as a homogenous sample, whereas our results suggest that purified NAT1 was polydispersed in water and al1 TABLE21 Summary ofcrysta! screen strategies
no crystal formation
crystalline particles in 4/100; Hl:13,17,19,39 PEG 400-4000, pH 7.5-8.5, 0.1 M Tris- HCI
2.5 mg/rnl; ddH,O + -ll:I3,l7,19,3 only Hl:39 has crystalline fragments in 9 1 mM DTT t protein absence of protein
5 mg/ml; ddH,O + crystalline particles in 6/50; Hl:5,7,8,13,15,18 1 mM DTT smaller particles in 4/50; Hl:l6,2OY2l ,24 wide range in characteristics of solutions
5 mg/ml; TED needle like crystal; Hl:l
small crystalline particles; Hl:33,38; H2:28 sodium salts, pH 6.5-7.5
70 crystal formation TABLE22 Surnmaty of dynamic light scattering analysis of purified NA Tl protein
snap frozen Tris-HCI, pH 7.5 NaPO,, pH 6.5
5 mghl ddH,O not frozen PBS Tris-HCI, pH 7.5 NaPO,, pH 6.5 buffers that we examined (Table 22)- It should be noted that proteins that are polydispersed can still be crystallized, but it is often less likely and much more difficult Interestingly, the S. typhimurium NAT was crystallized as a 248 kDa assymetric unit (Sinclair et al., 2000). This rnay reveal some functional insight into how the NAT proteins rnay interact in the host cellular environment, however it is difficult to predict in vivo zssociations or interactions from such in vitro observations.
A3.4 Summary Although no conditions were identified that were capable of growing diffraction quality crystals, the studies described in this appendix are an excellent starting point for future experimental approaches- Furthermore, information frorn the S. typhimurium NAT structure may aid in the elucidation of the hurnan NAT structure. Detailed hurnan NAT structural information should be one of the highest priorities for future investigations.
Bell, D, A., Stephens, E. A., Castranio, T.. Umbach. D. M., Watson, M., Deakin. M., Elder. J., Hendrickse, C., Duncan, H. and Strange, R. C. (1995b). Polyadenylation polymorphism in the acetyltransferase 1 gene (NAT1) increases risk of colorectal cancer, Cancer Res. 55(16): 3537-42,
Benet, L Z,Mitcheil, J. R- and Sheiner, L 8- (1 99@).Pharmacokinetics: the dynamics of drug absorption, distribution. and elimination. The wharrnacoloaical basis of theraoeutics. A. G. Gilman, T. W. Rall, A. S. Nies and P. Taylor, New York, Pergamon Press: 1-32
Berman, H. M., Westbrook, J,, Feng, 2,Gilliland, G., Bhat. T. N., Weissig, H., Shindyalov, 1. N, and Boume, P. E. (2000). The Protein Data Bank, Nucleic Acids Res. 28(1): 235-42.
Bidwell, L. M., McManus, M. E., Gaedigk, A., Kakuta, Y., Negishi, M., Pedersen, L and Martin, J. L- (1999). Crystal structure of human catecholamine sulfotransferase- J. MOL Biol. 293(3): 521 -30.
Blackwell, J. R. and Horgan, R. (1991). A novel strategy for production of a highly expressed recombinant protein in an active fom, FEBS Lett. 295(1-3): 10-2-
Blum, M., Demierre, A., Grant, D. M., Heim, M. and Meyer, U. A- (1991). Molecular rnechanism of slow acetylation of drugs and carcinogens in humans. Proc. Natl. Acad. ScL USA 88(12): 5237-41.
Blum, M., Grant. 0.M.. McBride, W., Heim, M. and Meyer, U. A. (1990). Hurnan arylamine N-acetyltransferase genes: isolation, chromosomal localization, and functional expression. DNA Ce11 Biol. 9(3): 193-203.
Brjnicke, R. and Reif. W. (1953). Enzymatic inactivation of isonicotinic acid hydrazide in humans and animals. Arch. Exp. Pathol. Pharmak 220: 321-333-
Borders. C. L., Jr., Bjerrum, M. J., Schirmer, M. A- and Oliver, S. G. (1998). Characterization of recombinant Saccharomyces cerevisiae manganese- containing superoxide dismutase and its H30A and K170R mutants expressed in Escherichia coli. Biochemistry 37(32): 11 323-31 .
Borjigin, J., Wang, M. M. and Snyder, S. H. (1995). OiumaI variation in mRNA encoding serotonin N-acetyltransferase in pineal gland. Nature 378(6559): 783-5,
Boteju, L. W. and Hanna, P. E. (1994). Arylamine-nucleoside adduct formation: evidence for arylnitrene involvement in the reactions of an N-acetoxyarylamine. Chem. Res. Toxicol. 7(5): 684-9.
Bott, R. and Boelens. R- (1 999). The role of high-resolution structural studies in the development of commercial enzymes. Cur. Opin. Biotechnol. 1O(4): 391-7.
Bradford. M. M. (1976). A rapîd and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-54.
Brix, L. A., Barnett, A. C., Duggleby, R. G., Leggett, B. and McManus, M. E. (1999a). Analysis of the substrate specificity of human sulfotransferases SULTlA1 and SULTlA3: site-directed mutagenesis and kinetic studies. Biochemistry 38(32): 10474-9.
Brix, L A., Duggleby, R. G., Gaedigk, A. and McManus, M. E. (1 999b). Structural characterization of human aryl sulphotransferases. Biochem. J. 337(Pt 2): 337-43-
Brockmoller. J., Cascorbi, I., Kerb, R., Sachse, C. and Roots. 1. (1998). Polymorphisms in xenobiotic conjugation and disease predisposition. Toxicol. Lett 102-103: 173-83. Bromrne, D., Bonneau, P. R,, Purisima, E,, Lachance, P., Hajnik. S,, Thomas, D. Y. and Storer. A. C. (1996). Contribution to activity of histidine-aromatic, amide-aromatic. and aromatic-aromatic interactions in the extended catalytic site of cysteine proteinases. Biochemistry 35(13): 3970-9.
Butcher, N. J., Ilett, K F, and Minchin, R. F. (1998). Functional polymorphism of the human arylarnine N- acetyltransferase type 1 gene caused by Cl90T and G560A mutations. Pharmacogenetics 8(1): 67-72.
Butcher, N, J., Ilett. K- F. and Minchin, R. F. (2000). Substrate-dependent regulation of hurnan arylamine N- acetyltransferase-1 in cultured cells. Mol. Pharmacol. 57(3):468-73.
Caldwell, J. (1 978). The conjugation reactions: the poor relations of drug rnetabolism? Coniuaation reactions in dmq biotransformation. A. Aitio. London, Elsevier/North-Holland Biomedical Press.
Caldwell, J- (1988). Biological implications of xenobiotic metabolism. The Liver: Bioloqv and Pathobioloav. 1. M. Arias, W. 8. Jakoby, H. Popper, D. Schachter, D. A. Shafritz, New York. Raven Press, Ltd: 355-62.
Chakraborty. A. R., Davidson, A. and Howell, P. L (1999)- Mutational analysis of amino acid residues involved in argininosuccinate lyase activity in duck delta If crystallin. Biochernktry 38(8): 2435-43.
Chen, H. J. (1 996). Pharrnacogenetics of acetyltransferase and cytochrome P4501A2 phenotypes and genotypes in an Inuit population. MSc- Thesis, University of Toronto.
Cheon, H. G. and Hanna, P. E. (1992). Effect of group-selective modification reagents on arylamine N- acetyltransferase activities. Biochem. Pharmacol. 43(1O): 2255-68.
Chothia, C. (1992). Proteins. One thousand families for the molecular biologist. Nature 357(6379): 543-4.
Chou. H. C., Lang, N. P. and Kadlubar, F. F. (1995).Metabolic activation of the N-hydroxy derivative of the carcinogen 4-aminobiphenyl by human tissue sulfotransferases, Carcinogenesis 16(2): 413-7.
Chou, P- Y. and Fasman, G. D. (1974). Prediction of protein conformation. Biochemistry 13(2): 222-45.
Cleland, W- W. (1963). The kinetics of enzyme-catalyzed reactions with two or more substrates or products. Biochim, Biophys- Acta 67: 104-137.
Comtet, C.. Blanchet, C., Geourjon. C. and Deleage, G. (2000). NPSB: network protein sequence analysis. Trends Biochem. Sci 25(3): 147-50.
ConnelIy, J. C. and Bridges, J. W. (1980). The distribution and rote of cytochrome P-450 in extrahepatic organs. Proaress in Drua Metabolism. J. W- Bridges, L. F. Chasseaud. Chichester, John Wiley & Sons Ltd. 5: 2-1 11.
Coon. M. J., Vaz, A. D. N., McGinnity, D. F., and Peng, H.-M. (1998). Multiple activated oxygen species in P450 catalysis-contributionsto specificity in drug metabolism. Drug Metab. Disp. 26(12): 1190-3.
Cordes, M. H., Walsh, N. P., McKnight, C. J. and Sauer, R. T. (1 999). Evolution of a protein fold in vitro [published erratum appears in Science 1999 Sep 3;285(5433):1493]. Science 284(5412): 325-8.
Comish-Bowden, A. and Wharton, C. W. (1988). Enzvme Kinetics. Oxford, IR1Press.
Coughtrie, M. W., Sharp, S.. Maxwell, K. and Innes. N. P. (1998). Biology and function of the reversible sulfation pathway catalysed by human sulfotransferases and sulfatases. Cherna-Biol.Interactions 109(1-3): 3-27.
Creighton (1 994). Proteins Structure and Molecufar Pro~erties,New York, W, H. Freeman & Co. -204- Crespi, C. L and Miller. V. P. (1 999)- The use of heterologously expressed drug metabolizing enzymes-state of the art and prospects for the future. Pharmacol. Ther. 84(2): 121-31.
Cribb, A. E., Grant, D. M., Miller, M. A. and Spielberg, S. P. (1991). Expression of rnonomorphic arylamine N- acetyltransferase (NAT1) in human leukocytes. J. Pharmacol, Exp. Ther. 259(3): 1241-6.
Davis, B, G., Khurntaveepom, K, Bott, R. R. and Jones, J- B. (1999). Altenng the specificity of subtilisin Bacillus lentus through the introduction of positive charge at single amino acid sites. Bioorg. Med. Chem. ?(Il): 2303-1 1.
De Morais, S. M., Wilkinson, G. R.. Blaisdell, J., Nakamura, K. Meyer, U. A- and Goldstein. J. A. (1994). The major genetic defect responsible for the polymorphism of S-mephenytoin metabolism in humans. J. Brol. Chem. 269(22): 15419-22,
Debiec-Rychter, M.. Land, S. J. and King, C. M. (1 999). Histological localization of acetyltransferases in human tissue. Cancer Lett. 143(2): 99-1 02-
Deguchi, T., Mashimo, M, and Suzuki, T. (1990). Correlation between acetylator phenotypes and genotypes of polymorphic arylarnine N-acetyltransferase in human Iiver. J. BIoL Chem. 265(22): 12757-12760.
Delomenie, C., Goodfellow, G. H., Krishnamoorthy, R., Grant, D. M. and Dupret, J. M. (1997). Study of the role of the highly conserved residues Arg9 and ArgW in the catalytic function of human N-acetyltransferases NAT1 and NAT2 by site-directed mutagenesis. Biochem. J. 323(Pt 1): 207-1 5.
Delomenie. C.. Sica. L. Grant. D. M., Krishnamoorthy, R. and Dupret, J. M. (1996). Genotyping of the polymorphic N- acety ltransferase (NAT2') gene locus in two native African populations. Phamacogenetics 6(2): 177-85
Derewlany, L., Knie, B. and Koren. G. (1994). Arylamine N-acetyltransferase activity of the human placenta. J. Pharmacol. Exp. Ther. 269(2): 756-60.
Doll, M. A- and Hein, D. W. (1995)- Cloning, sequencing and expression of NAT1 and NAT2 encoding genes from rapid and slow acetylator inbred rats. Phamacogenetics S(4): 247-51.
Drayer, D- E., Strong. J. M.. Jones, B., SandIer, A. and Reide~berg,M. M. (1974). In vitro acetylation of drugs by human biood cells, Drug Metab. Dispos. 2(6): 499-505.
Drummond, G. S., Kelker, H. C. and Weber, W, W. (1980). N-acetylation of drugs: observations en the properties of partially purified N-acetyltransferase from peripheral blood of rabbit- Biochem. J. 187: 157-162. du Souich. P., Lalka, O., Slaughter, R., Elvin, A. T. and McLean, A- J. (1979). Mechanisms of nonlinear disposition kinetics of sulfamethazine. Clin. Pharmacol. Tner. 25(2): 172-183.
Dupret, J. M., Goodfellow, G. H., Janezic, S. A. and Grant, D. M. (1994). Structure-functionstudies of human arylamine N-acetyltransferases NAT1 and NAT2. Functional analysis of recombinant NATlINAT2 chimeras expressed in Escherichia coli. J. Biol. Chem. 269(43): 26830-5-
Dupret, J. M. and Grant, 0- M. (1992). Site-directed mutagenesis of recombinant human arylamine N- acetyitransferase expressed in Escherichia coli. Evidence for direct involvernent of Cys68 in the catalytic mechanism of polymorphic human NAT2. J. Biol. Chem. 267(11): 7381-5.
Eaton, D. L and Bammler, 7.K. (1999). Concise review of the glutathione S-transferases and their significance to toxicology. Toxicol, Sei. 49(2): 156-64. Ebisawa, T- and Deguchi, T- (1991). Structure and restriction fragment length polymorphisrn of genes for human liver arylamine N-acetyltransferases. Biochem. Biophys. Res, Commun. 177(3): 1252-7.
Eling. T. E- and Curtis, J- F. (1992). Xenobiotic rnetabolisrn by prostagtandin H synthase. Phannacol. Ther, 53(2): 261 -73-
Engel, C. and Wierenga, R. (1996). The diverse world of coenzyme A binding proteins. CurL Opin. Struct Biot- 6(6): 790-7.
Estrada, L, Kanelakis. K. C., Levy, G. N. and Weber, W. W. (2000). Tissue- and gender-specific expression of N- acetyltransferase 2 (Nat2') dunng development of the outbred mouse strain CD-I. Drug Metab Dispos 28(2): 13946.
Estrada-Rodgers, L, Levy, G- N-and Weber, W. W. (1998a)- Characterization of a hormone response element in the mouse N- acetyltransferase 2 (Na=*) promoter. Gene Expr- 7(1): 13-24.
Estrada-Rodgers, L-, Levy, G. N- and Weber, W. W. (1998b)- Substrate selectivity of mouse N-acetyltransferases 1, 2, and 3 expressed in COS-1 cells. Dmg Metab. Disp. 26(5): 502-5.
Evans, D, A, (1989). N-acetyltransferase. Phannacol. Thec 42(2): 157-234.
Ferguson, R. J,, Doll, M. A., Rustan. T. O-,Baurnstark, B. R-and Hein, D. W. (1994). Syrian hamster monornorphic N-acetyltransferase (NAT1) alleles: amplification. cloning, sequencing, and expression in E, coli. Pharmacogenetks 4(2): 82-90.
Ferguson, R. J., Doll, M. A., Rustan, T. DD.and Hein, D. W. (1996). Cloning, expression, and functional characterization of rapid and slow acetylator polymorphic N-acetyl-transferase encoding genes of the Syrian hamster. Phamacogenetics 6(1): 55-66.
Fersht, A. (1 985). Enzvme Structure and Mechanisms. Sâc Francisco, W. H. Freernan and Company.
Frangioni, J, V. and Neel, B, G- (1993). Anal. Biochem, 210: 179.
Franke, S., Klawitz, 1.. Schnakenberg, E., Rommel, B., Van de Ven, W., Bullerdiek, J. and Schloot, W. (1 994). Isolation and rnapping of cosrnid clone containing the human NAT2 gene. Biochem. Biophys. Res. Commun. 199(l): 52-5.
Gaudet, S., Palkovits. M. and Namboodiri, M. A. (1991). Regional distribution of arylamine and arylalkylamine N- acetyltransferase activities in the rat brain. Brain Res. 539(2): 355-7.
Gaudet, S- J,, Hayden, B. J., Chader, G. J. and Namboodiri, M. A. (1993). Differential regulation of arylamine and arylalkylarnine N- acetyltransferases in human retinoblastoma (Y-79)cells. Neurochem. Int. 22(3): 271-5,
Geoghegan, F. L., McPartlin, J. M., Weir, D. G. and Scott, J. M. (1995). para-acetamidobenzoylglutamate is a suitable indicator of folate catabolism in rats. J. Nutr. 125(10): 2563-70.
Gil, J. P. and Lechner. M. C. (1998). lncreased frequency of wild-type arylarnine-N-acetyltransferase allele NAT2'4 homozygotes in Portuguese patients with colorectal cancer. Carcinogenesk 1g(l): 37-41.
Gilbert, W., de Souza, S. J. and Long, M. (1997). Origin of genes. Proc. Natl. Acad. Sci. USA 94(15): 7698-703.
Gillarn, E. M- (1998). Hurnan cytochrome P450 enzymes expressed in bacteria: reagents to probe molecular interactions in toxicology. Clin. Exp. Pharmacol. Physiol- 25(11): 877-86. Gillam, E. M., Guo, 1,Ueng, Y. E, Yamazaki, H., Cock, 1.. Reilly, P. E,, Hooper, W, D. and Guengerich, F- P- (1995). Expression of cytochrome P450 3A5 in Eschenchia coli: effects of 5' modification, purification, spectral characterkation. reconstitution conditions, and catalytic activities [published erratum appears in Arch Biochem Biophys 1995 Apr 20;318(2):498]. Arch. Biochem. Biophys. 317(2): 374-84.
Glue, P. and Clement, R. P. (1999). Cytochrome P450 enzymes and drug metabolism-basic concepts and methods of assessment. Cell. and Molec. Neurobiol. 19(3): 309-23.
Gonzalez, F. J. (1998). The study of xenobiotic-metabolizing enzymes and their role in toxicity in vivo using targeted gene disruption. Toxicul. Lett 102-1 03: 161-6.
Gonzalez. F. J. and Nebert, 0. W. (1990)- Evolution of the P450 gene superfamily: animal-plant 'warfare', molecular drive and human genetic differences in drug oxidation. Trends Genet 6(6): 182-6.
Goodfellow, G. H., Dupret, J. M. and Grant, D. M. (2000)-Identification of amino acids imparting acceptor substrate selectivity to human arylamine acetyltransferases NAT1 and NAT2. Biochern- J- 348 Pt 1: 159-66,
Gotoh, 0. (1 992). Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. J. Biot. Chern. 267(1): 83-90.
Grant, D. M., Bell, D. A. and Grewal, R. (1994). Functional anaylsis of variant alleles of human arylamine acetyltransfe rase NAT2 by heterologous expression in E. coli. 7 0th International Symposium on Microsornes and Drug Oxidations, Toronto, Canada.
Grant, D. M., Blum, M., Beer, M. and Meyer, U. A. (1 991). Monomorphic and polymorphic human arylarnine N- acetyltransferases: a comparison of liver isozymes and expressed products of two cloned genes- Mol. Pharmacol. 39(2): 184-91.
Grant, O. M., Hughes, N. C., Janezic, S. A., Goodfellow, G. H., Chen, H, J., Gaedigk, A., Yu, V, L, and Grewal, R. (1 997). Human acetyltransferase polymorphisms. Mutai. Res. 376(1-2): 61 -70.
Grant, D. M., Josephy, P. D., Lord, H. L. and Morrison. L D. (1992a). Salmonella typhimurium strains expressing human arylarnine N-acetyltransferases: metabolism and mutagenic activation of aromatic amines- Cancer .Ses. 52(14): 3961-4.
Grant, D- M., Lottspeich. F. and Meyer, U- A. (1 989). Evidence for two closely related isozymes of arylamine N- acetyltransferase in human Iiver. FEBS Lett. 244(1): 203-7.
Grant, D. M. and Meyer, U. A. (1993). Arylamine N-acetyltransferase. Human Protein Data. vol. 2. A. Haeberli- Weinham, VCH.
Grant, D. M., Morike, K., Eichelbaum, M. and Meyer, U. A, (1 990)- Acetylation pharmacogenetics. The slow acetylator phenotype is caused by decreased or absent arylamine N-acetyttransferase in human Iiver. J. Clin. Invest. 85(3): 968- 72.
Grant. D. M.. Tang, B. K. and Kalow, W. (1984).A simple test for acetylator phenotype using caffeine. Br. J. Clin. Pharmacol. 1 7(4): 459-64.
Grant, D. M., Vohra, P., Avis. Y. and Ima, A. (1992b). Detection of a new polymorphism of human arylamine N- acetyltransferase NAT1 using paminosalicylic acid as an in vivo probe. J. Basic Clin. Phys. Pharmacol. 3((suppl)): 244. Group, M. V. S. R. (1991). Prevention of neural tube defects: results of the Medical Research Council Vitamin Study. MRC Vitamin Study Research Group. Lancet 338(876O): 131-7.
Guengerich, F- P. (1 992). Human cytochrorne P-450 enzymes, Life ScL SO(20): 1471-8.
Guengerich, F- P., Parikh, A., Johnson, E, F., Richardson, T, H., von Wachenfeldt, C., Cosme, J., Jung, F., Strassburg, C. P., Manns, M. P., Tukey, R. H., Pritchard, M., Foumel-Gigleux, S, and Burchell. B. (1997). Heterologous expression of human drug-metabolizing enzymes. Drug Metab. Dispos. 25(7 1): 123441.
Guex, N, and Peitsch, M. C. (1997)- SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18(15): 2714-23.
Hanna, P. E., Banks, R. B. and Marhevka, V. C. (1 982)- Suicide inactivation of hamster hepatic arylhydroxamic acid N,O- acyltransferase. A selectïve probe of N-acetyltransferase multiplicity. Mol. Pharmacol. 21 (1): 159-65.
Hanna, P. E., Sticha, K., Bergstrom, C, P. and Wagner, C. R, (1998). Arylamine N-acetyltransferases: overexpression. purification and characterization, 1st International Worksnop on Arylamine N-Acetyltransferase, Kuranda, Australia.
Hansson, L. O., Bolton-Grob, R., Massoud, T. and Mannervik, 6,(1 999a). Evolution of differential substrate specificities in Mu class glutathione transferases probed by DNA shuffling. J. Mol. Biol. 287(2): 265-76.
Hansson, L. O., Bolton-Grob, R., Widersten, M. and Mannervik. B. (1999b)- Structural deterrninants in domain II of human glutathione transferase M2-2 govern the charactei'ïstic activities with aminochrome, 2-cyano-1,3- dimethyl-l- nitrosoguanidine, and 1.2-dichloro-4-nitrobenzene. Protein Sci. 8(12): 2742-50.
Hart, K. W., Clarke, A. R., Wigley, D. B., Waldman, A. D., Chia, W. N., Barstow, D. A., Atkinson, T., Jones, J. B. and Holbrook, J. J. (1987)- A strong carboxylate-arginine interaction is important in substrate orientation and recognition in lactate dehydrogenase. Biochim, Biophys. Acta 914(3): 294-8.
Heirn, M. H.. Blum, M., Beer, M. and Meyer, U. A. (1991). Acetylation of serotonin in the rabbit pineal gland: an N- acetyltransferase with properties distinct from NAT1 and NAT2 is responsible. J. Neurochem. 57(4): 1095-9.
Hein, D, W. (1988)- Acetylator genotype and arylamine-induced carcinogenesis. Biochim. Biophys. Acta 948(1): 37- 66.
Hein, D.'W. (2000)- N-acetyltransferase genetics and their role in predisposition to aromatic and heterocyclic amine- induced carcinogenesis. Toxicoi. Lett 11 2-1 13: 349-56.
Hein, D. W., Doll, M. A., Fretland, A. J., Leff, M. A., Webb, S. J., Xiao, G. H., Devanaboyina, W. S., Nangju, N. A. and Feng, Y. (2000). Molecular genetics and epidemiology of the NATl and NAT2 acetylation polymorphisms. Cancer Epidemiol. Biomarkers Prev. 9(1): 29-42.
Hein, D. W.. Dolt, M. A., Gray, K., Rustan, T. D. and Ferguson, R. J. (1993a). Metabolic activation of N-hydroxy-2- aminofluorene and N-hydroxy-2-acetylaminofluoreneby monomorphic N-acetyltransferase (NATI) and polyrnorphic N-acetyltransferase (NAT2) in colon cytosols of Syrian hamsters congenic at the NAT2 locus. Cancer Res. 53(3): 509-14.
Hein. D. W., Doll, M. A., Rustan, T. D., Gray. K., Feng, Y., Ferguson, R. J. and Grant, D. M. (1993b). Metabolic activation and deactivation of arylamine carcinogens by recombinafit human NATl and polymorphic NAT2 acetyltransferases. Carcinogenesis 14(8): 1633-8. Hein, D. W., Ferguson, R. J., DoIl, M. A,, Rustan, T. D- and Gray. K. (1994)- Molecular genetics of human polymorphic Wacetyltransferase: enzymatic analysis of 15 recombinant wild-type, mutant, and chimeric NAT2 allozyrnes. Hum. Mol- Genet. 3(5): 729-34.
Hein, D. W., Kirlin. W. G., Ferguson, R. J. and Weber, W. W. (1985). Biochernical investigation of the basis for the genetic N-acetylation polymorphism in the inbred hamster. J. Phannacol, fip- Ther. 234(2): 358-64.
Hein, D. W., Rustan, T. D-, Bucher, K, D., Martin, W. J- and Furman, E. J, (1991 ). Acetylator phenotype-dependent and -independent expression of arylamine N-acetyltransferase isozymes in rapid and slow acetylator inbred rat Iiver- Drug Metab Dkpos 19(5): 933-7.
Helvig, C. and Capdevila, J. H. (2000). Biochernical characterization of rat P450 2C11 fused to rat or bacterial NADPH-P450 reductase domains. Biochemistry39(17): 5196-205.
Hemsley, A., Amheirn, N., Toney, M. D., Cortopassi, G- and Galas, D. J. (1989). A simple method for site-directed mutagenesis using the polymerase chain reaction- Nucleic Acids Res. 17(16): 6545-51.
Henning, S., Cascorbi, I., Munchow, B., Jahnke, V. and Roots, I. (1999). Association of arylamine N- acetyltransferases NAT1 and NAT2 genotypes to laryngeal cancer risk, Pharmacogenetjcs9(1): 103-1 1.
Hickman, D., Palamanda. J., Unadkat. J. and Sim, E. (1995). Enzyme kinetic properties of human recombinant arylamine N-acetyltransferase 2 allotypic variants expressed in Escherichia coli. Biochern. Pharmacol. 50(5): 697- 703.
Hickrnan, D-, Pope, J,, Patii, S. D., Fakis, G., Smelt, V., Stanley, L. A., Payton, M., Unadkat, J. D-and Sim, E. (1998). Expression of arylamine N-acetyltransferase in hurnan intestine- Gut 42(3): 402-9.
Hickman, D., Risch, A., Buckle, V., Spurr, N. K,, Jeremiah, S- J-, McCarthy, A. and Sim, E- (1994). ChromosomaI localization of human genes for arylamine N-acetyltransferase. Biochem. J. 297(Pt 3): 441 -5,
Hickman, D. and Sim, E. (1991). N-acetyltransferase polymorphism: cornparison of phenotype and genotype in humans. Biochem. Pharmacol. 42(5): 1007-14.
Hines, R. N., Cashman, J. R., Philpot, R. M., Williams. D-E- and Ziegler, D. M. (1994). The mammalian flavin- containing monooxygenases: molecular characterization and regulation of expression. Toxicol. AppL Pharmacol. 125(1): 1-6.
Ho, S. N., Hunt, H- O., Horton. R. M.. Pullen, J. K. and Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction [see comments]. Gene 77(1): 51-9.
Honig, B. (1 999)- Protein folding: from the levinthal paradox to structure prediction. J. Mol. Bioi. 293(2): 283-93.
Hubbard, A. L., Harrison, D. J., Moyes, C., Wyllie, A. H.. Cunningham, C-. Mannion, E. and Smith, C. A. (1997). N- acetyltransferaçe 2 genotype in colorectal cancer and selective gene retention in cancers with chromosome 8p deletions. Gut 41 (2): 229-34.
Hughes, N. C,, Janezic, S. A., McQueen, K. L., Jewett. M, A., Castranio, T., Bell, D, A. and Grant, D. M. (1998). Identification and characterization of variant alleles of human acetyltransferase NAT1 with defective function using p- aminosalicylate as an in-vivo and in-vitro probe. Pharmacagenetics8(1): 55-66.
Hwang, J. K. and Warshel, A. (1988). Why ion pair reversa1 by protein engineering is unlikely to succeed. Nature 334(6179): 270-2. Ikeda, Y., Sugawara, A-, Taniyama, Y., Uruno, A., lgarashi, K., Arima, S., Ito, S- and Takeuchi, K (2000). Suppression of Rat Tnromboxane Synthase Gene Transcription by Peroxisome Proliferator-activated Receptor gamma in Macrophages via an Interaction with NRF2- J- BioL Chem. 275(42): 33142-331 50. llett, K. F-, Ingram, D- M., Carpenter, D. S., Teitel, C- H., Lang, N- P-, Kadlubar, F. F. and Minchin, R. F. (1994). Expression of monomorphic and polymorphic N-acetyltransferases in human colon. Biochem. Pharmacol. 47(5): 914- 7.
Iwasaki, M., Darden, T. A., Pedersen, L, G. and Negishi, M- (1995). Altering the regiospecificity of androstenedione hydroxylase activity in P450s 2a-4/5 by a mutation of the residue at position 481. Biochemistry 34(15): 5054-9.
Jackson, V, N,, Cameron, J- M., Fraser, F., Zammit, V. A, and Price, N. T- (2000). Use of six chimenc proteins to investigate the role of intramolecular interactions in detemining the kinetics of camitine palmitoyltransferase 1 isoforms. J. BioL Chem. 275(26): 19560-6.
Jacobson, K. B. (1961). Effect of substrate structure on activity of pigeon Iiver acetyl transferase. J. Biol. Chem. 236(2): 343-8,
Jakoby, W. (1988). Detoxication: conjugation and hydrolysis. The Liver: Biologv and Pathobioloav. 1. M. Arias, W. B. Jakoby. H. Popper, D. Schachter, D. A. Shafritz. New York, Raven Press. Ltd.: 375-88.
Janezic, S. (1998). Genetic vanation in the bioactivation of arylamine procarcinogens in bladder cancer. Ph-D. Thesis, University of Toronto.
Jenner, P., Testa, B. and Di Cario, F. J. (1983). Xenobiotic and endobiotic metabolizing enzymes: an overstretched discrimination? Drua Metabolism and Distribution. J. W, Lamble. Cambridge, Elsevier Biomedical Press: 12-6.
Jones, O. T. (1999). Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292(2): 195-202,
Kadowaki, H., Kadowaki, T., Wondisford, F. E. and Taylor, S. 1. (1989)- Use of polymerase chain reaction catalyzed by Taq DNA polymerase for site-specific mutagenesis. Gene 76(1): 161-6.
Kakuta, Y., Pedersen, L. G., Carter, C. W,, Negishi, M, and Pedersen, L. C. (1997). Crystal structure of estrogen sulphotransferase. Nat. Struct Bioi. 4(11): 904-8.
Kapitulnik, J. and Strobel. H. W. (1 999). Extrahepatic dmg metabolizing enzymes. J. Biochem. Mol, Toxicol. 13(5): 227-30.
Kasus-Jacobi, A., Bereziat, V., Perdereau, D., Girard, J. and Burnol, A. F. (2000). Evidence for an interaction between the insulin receptor and Grb7, A role for two of its binding domains, PIR and SH2- Oncogene 19(16): 2052- 9.
Kauzmann, W. (1959). Adv. in Prot. Chem. 14: 1-63-
Kawakubo, Y, and Ohkido, M. (1998). Epidermai N-acetylation of p-aminobenzoyl glutamic acid: difference in response to ultraviolet B irradiation. J. Dematol. Sc. 16(2): 99-1 03.
Kay, L E. (1998). Protein dynamics from NMR. Nat. Struct. BioL 5 Suppl: 513-7.
Kilbane, A, J., Petroff, T. and Weber, W. W. (1991). Kinetics of acetyl CoA: arylamine N-acetyltransferasefrom rapid and slow acetylator human liver. Drug Metab. Disp. 19(2): 503-7. Klein. O. C., Namboodiri, M. A. and Auerbach, D. A, (1 981). The melatonin rhythm generating system: developmenta1 aspects. Life Sci. 28(18): 1975-86.
Knowles. M, A., Shaw. M, E, and Proctor, A. J. (1993). Deletion mapping of chromosome 8 in cancers of the unnary bladder using restriction fragment length polymorphisms and microsatellite polymorphisrns. Oncogene 8(5): 3357-64,
Komatsu, K., Driscoll. W. J., Koh, Y. C. and Strott, C. A. (1994)- A P-loop related motif (GxxGxxK) highly conserved in sulfotransferases is required for binding the activated sulfate donor. Biochem. Biophys. Res. Commun- 204(3): 1 178- 85.
Kotlyar, M- and Carson, S. W. (1999). Effects of obesity on the cytochrome P450 enzyme system. /nt. J. CIIn. Phar. Ther. 37(1): 8-19,
Kramer, W., Drutsa, V., Jansen, H. W., Kramer, B., Pflugfefder, M. and Fritz. H. J. (1984). The gapped duplex DNA approach to oligonucleotide-directed mutation construction. Nucieic Acids Res 12(24): 9441-56.
Kunkel, T. A. (1985). Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sei- USA 82(2): 488-92.
Laemmli. U. K. (1970). Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 227(259): 680-5.
Lang. N. P., Chu, O. L,Hunter, C. F., Kendall, D. C., Flammang, T. J. and Kadlübar, F-F. (1986). Role of aromatic amine acetyltransferase in human colorectal cancer. Arch. Surg. 121(1 1): 7259-61.
Leff, M. A-, Fretland, A. J., Doll, M. A. and Hein, O. W. (1999). Novel human N-acetyltransferase 2 alleles that differ in mechanism for slow acetylator phenotype. J. Biol. Chem. 274(49): 34519-22.
Leszczynski, J. F. and Rose, G. 0. (1986). Loops in globular proteins: a novel category of secondary structure- Science 234(4778): 849-55.
Lewis, ti. F., Watson, E. and Lake, B. G. (1998). Evolution of the cytochrome P450 superfarnily: sequence alignments and pharrnacogenetics. Mutat. Res 41 O(3): 245-70.
Li, A. P., Kaminski, D. L and Rasmussen, A. (1 995). Substrates of human hepatic cytochrome P450 3A4. Toxicology 104(1-3): 1-8.
Lin, H. J., Probst-Hensch, N. M.. Hughes, N. C., Sakamoto, G. T., Louie, A. D., Kau, 1. H., Lin, B. K., Lee, D. B., Lin, J., Frankl, H. D., Lee, E. R-, Hardy, S., Grant, D. M. and Haile, R. W. (t 998). Variants of N-acetyltransferase NAT1 and a case-control study of colorectal adenomas. Pharmacogenetics 8(3): 269-81.
Lindberg, R. L and Negishi, M. (1989). Alteration of mouse cytochrorne P450coh substrate specificity by mutation of a single amino-acid residue. Nature 339(6226): 6324.
Lu, L., Berkey, K. A. and Casero Jr-, R. A. (1996). RGFGIGS is an amino acid sequence required for acetyl coenzyme A binding and activity of human spermidine/spemine NI-acetyltransferase, J. Biol. Chem. 271 (31): 18920- 18924.
MacFerrin, K, D., Terranova, M. P., Schreiber, S. L and Verdine. G. L (1990). Overproduction and dissection of proteins by the expression-cassette polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87(5): 1937-41.
Marsolais, F. and Varin, L. (1995). Identification of amino acid residues critical for catalysis and cosubstrate binding in the flavonol 3-sulfotransferase. J. Biol. Chem. 270(51): 30458-63. -211- Marti-Renom, M. A., Stuart, A. C-,Fiser. A., Sanchez, R., Melo, F. and Sali, A. (2000)- Comparative protein stmcture modeling of genes and genomes [In Process Citation]- Annu Rev Biophys Biomol Struct29: 291-325.
Masimirembwa, C. M., Otter, C,,Berg, M., Jonson. M., Leidvik, B,, Jonsson. E,, Johansson, T., Backman, A., Edlund, A. and Anderson, T. B, (1999)- Heterologous expression and kinetic characterizationof human cytochromes P-450: validation of a pharmaceutical tool for dmg rnetabolism research, Drug Metab. Dispos. 27(10): 11 17-23
Matas, N.. Thygesen, P., Stacey, M., Risch, A. and Sim, E. (1 997). Mapping AAC1, AAC2 and AACP, the genes for arylarnine N- acetyltransferases, carcinogen metabolising enzymes on hurnan chromosome 8p22, a region frequently deleted in tumours. Cytogenet- Ce11 Genet- 77(3-4): 290-5.
McTigue, M. A., Williams, D. R, and Tainer, J. A. (1995). Crystal structures of a schistosomal drug and vaccine target: glutathione S-transferase from Schistosoma japonica and its cornplex with the leading antischistosornal drug praziquantel. J. Mol. Biol. 246(1): 21-7.
Meech, R-and Mackenzie, P. 1. (1997)- Structure and function of uridine diphosphate glucuronosyltransferases. Clin EXp Pharmacol Physiol24(12): 907-1 5.
Meisel. M., Schneider, T., Siegmund. W., Nikçchick, S., Klebingat, K. J. and Scherber, A- (1 986). Development of human polymorphic N-acetyltransferase- BioI. Res- Pregnancy PennatoL 7(2):74-6.
Meyer, CI. A. and Zanger, U, M. (1 997). Molecutar mechanisrns of genetic polymorphisms of drug metabolism. Annu. Rev. Pharmacol. Toxicol. 37: 269-96-
Miller, E. C. and Miller, J. A- (1 981). Searches for ultimate chernical carcinogens and their reactions with cellular rnacromotecules. Cancer W(I0): 232745.
Minchin. R. (1995). Acetylation of p-aminobenzoylglutamate, a folic acid catabofite, by recombinant human arylamine N-acetyltransferase and U937 cells. Biochem. J. 307 ( Pt 1): 1-3.
Minchin, R. (1998). Characterisation of the hurnan N-acetyltransferase type 1 gene promoter. Identification of ATCAT repeats flanking an AP-1 like motif in the minimum promoter sequence- First International Workshop on Arylamine N-Acetyltransferases, Kuranda, Austratia.
Minchin. R. F., Reeves, P. T., Teitel, C. H., McManus, M. E., Mojarrabi, B., llett, K. F- and Kadlubar, F. F, (1992). N- and O-acetylation of aromatic and heterocyclic amine carcinogens by human monomorphic and polymorphic acetyltransferases expressed in COS-1 cells. Biochem. Biophys. Res. Commun. 1 85(3): 839-44-
Moore, K. R. and Blakely, R. D. (1 994). Restriction site-independent formation of chimeras from homologous neurotransmitter-transporter cDNAs. Biotechniques 17(1): 130-5, 137.
Moult, J. (1999). Predicting protein three-dimensional structure. Curr. Opin. Biotechnol. 10(6): 583-8.
Mrabet, N, T., Van den Broeck, A.. Van den brande, I., Stanssens, P., Laroche, Y., Lambeir, A. M., Matthijssens, G., Jenkins, J-, Chiadmi, M., van Tilbeurgh, H. and et al. (1992). Arginine residues as stabilizing elements in proteins. Biochemistry 31 (8): 2239-53.
Munson, M., Balasubramanian, S., Fleming, K, G.,Nagi, A. D., O'Brien, R., Sturtevant. J, M. and Regan, L, (1996). What makes a protein a protein? Hydrophobic core designs that specify stability and structural properties. Protein Sc;. 5(8): 1584-93. Murby, M,, Samuelsson, E,, Nguyen, T. N., Mignard, L, Power, U., Binz, H., Uhlen, M. and Stahl, S. (1995). Hydrophobicity engineering to increase soiubility and stability of a recombinant protein from respiratory syncytial virus. Eur, J. Biochem. 230(1): 38-44.
Nakura, H,. ttoh, S.. Kusano, H,, Ishizone, H., Deguchi, T. and Kamataki, T. (1995)- Evidence for the lack of hepatic N-acetyltransferase in suncus (Suncus murinus). Biochem. Pharmacol. 50(8): 1165-70.
Namboodin, M- A. A., Dubbels, R- and Klein, D. C. (1987). Metabolism of aromatic amino acids and amines. Methods in Enzvmoloav. S. Kaufman, San Diego, Academic Press, Inc. 142: 583-90-
Negishi, M., Uno. T., Honkakoski, P., Sueyoshi, T., Darden, T. A. and Pedersen, L P. (1996). The roles of individual amino acids in altering substrate specificity of the P450 2a4/2a5 enzymes, Biochimie 78(8-9): 685-94.
Nelson, D- R, (1999). Cytochrome P450 and the individuality of species. Arch. Biochem, Biophys, 369(1): 1-10.
Nelson, D, R., Kamataki, T., Waxman, D_J., Guengerich, F, P-, Estabrook, R. W.. Feyereisen, R., Gonzalez, F- J., Coon, M- J., Gunsalus, 1. C., Gotoh, O., Okuda, K. and Nebert, 0. W. (1993). The P450 superfamily: update on new sequences, gene mapping. accession nurnbers. early trivial names of enzymes, and nomenclature. DNA Ce11 Biol. 12(1): 1-51-
Ohsako, S- and Deguchi, T. (1990). Cloning and expression of cDNAs for polymorphic and monornorphic arylamine N-acetyltransferasesfrom human Iiver. J. Biol. Chem, 265(8): 4630-4.
Oliva, M. T. and Moult, J. (1999). Local electrostatic optimization in proteins. Protein Eng. 12(9): 727-35.
Orzechowski, A., Schrenk, D., Bock-Hennig, 8. S-and Bock, K. W. (1994). Glucuronidation of carcinogenic arylamines and their N-hydroxy derivatives by rat and human phenol UDP-glucuronosyltransferase of the UGTl gene complex- Carcinogenesis15(8): 1549-53.
Ozawa. S., Abu-Zeid, M., Kawakubo, Y., Toyama, S., Yamazoe, Y. and Kato, R. (1990). Monomorphic and polymorphic isozymes of arylamine N-acetyltransferasesin hamster Iiver: purification of the isozymes and genetic basis of N- acetylation polyrnorphism. Carcinogenesis 11(1 2): 2137-44.
Pacifici, G. M., Bencini, C. and Rane, A. (1986). Acetyltransferase in humans: development and tissue distribution. Pharmacology 32(5): 283-9 1.
Parsell. D- A. and Sauer. R. T. (1989). The structural stability of a protein is an important determinant of its proteolytic susceptibility in Escherichia coli. J. Biol. Chem. 264(13): 7590-5-
Payton, M., Smelt, V., Upton, A. and Sim, E. (1999). A method for genotyping murine arylamine N-acetyltransferase type 2 (NAT2): a gene expressed in preimplantation embryonic stem cells encoding an enzyme acetylating the folate catabolite p-aminobenzoylglutamate. Biochem. PhamacoL 58(5): 779-85.
Peitsch, M_C. (1996). ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochern. Soc. Trans. 24(1): 274-9.
Plapp, B. V. (1995). Site-directed mutagenesis: a tool for studying enzyme catalysis. Methods in Enzvmoloav- D. L. Purkh. San Diego, Academic Press, Inc. 249: 91-1 19.
Posnett, D. N., McGrath, H. and Tam, J. P. (1988). A novel method for producing anti-peptide antibodies. Production of site-specific antibodies to the T cell antigen receptor beta-chain. J. Biol. Chem. 263(4): 1719-25. Probst, M- R,, Beer, M., Beer, D., Jeno, P., Meyer. U-A. and Gasser, R, (1994). Human Iiver arylacetamide deacetylase, Molecular cloning of a novel esterase involved in the rnetabolic activation of arylamine carcinogens with high sequence sirnilarity to hormone-sensitive lipase. J. BioI. Chem. 269(34): 21650-6.
Probst-Hensch, N. M., Haile, R. W., Ingles, S. A., Longnecker, M. P.. Han, C. Y., Lin, B. K., Lee, D- B-, Sakamoto, G. T., Frankl. H. D., Lee, E- R. and et al. (1995)- Acetylation polyrnorphisrn and prevalence of colorectal adenomas. Cancer Res, 55(lO): 20 17-20.
Probst-Hensch, N. M., Haile. R. W., Li, D. S., Sakamoto, G. T., Louie, A, D., Lin, 0- K., Frankl, H- D., Lee, E, R. and Lin, H. J. (1996). Lack of association between the polyadenylation polyrnorphism in the NAT1 (acetyltransferase 1) gene and colorectal adenomas. Carcinogenesis l7(lO): 2125-9.
Qoronfleh, M, W. and Ho, T. (1993). A modified pET vector that augments heterologous protein expression. Biotech, Letf. 15(4): 33740.
Rasband, W. S. and Bright, 0. S. (1995)- NIH Image: A public domain image processing program for the Macintosh. Microbeam Analysis Society Journal 4: 1 37- 149.
Riddle, B. and Jencks, W. P- (1971 ). Acetyl-coenzyme A: arylamine N-acetyltransferase. Role of the acetyl-enzyme intermediate and the effects of substituents on the rate. J. Biol. Chem. 246(10): 3250-8.
Rost. B. and Sander. C-(1993). Prediction of protein secondary st~ctureat better than 70% accuracy. J. Mol. Biol. 232(2): 584-99.
Sadrieh, N., Davis, C. D. and Snyderwine, E-G- (1 996). N-acetyltransferase expression and metabolic activation of the food- derived heterocyclic amines in the human rnamrnary gland. Cancer Res. 56(12): 2683-7.
Sali, A, (1998). 100.000 rotei in structures for the bioloaist. Structure-based functional genomics, Avalon, New Jersey.
Sambrook, J., Fritsch, E. F- and Maniatis, T. (1 989). Molecular Clonina:A Laboratorv Manual. Cold Spring Harbor,NY, Cold Spring Harbor Laboratory Press.
Saraste, M., Sibbald, P. R. and Wittinghofer, A- (1990). The P-loop-a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15(11): 430-4.
Schein, C. H. and Noteborn, M. H. M. (1988). Formation of soluble recombinant proteins in Eschenchia coliis favored by lower growth temperature. Bio/Technology 6: 291-4.
SchuIer, M. A- (1996). The role of cytochrome P450 monooxygenases in plant-insect interactions- Plant Physiol. 112(4): 1411-9.
Shaw, A. and Bott, R. (1 996). EngineerÏng enzymes for stability. Curr. Opin. Struct- Biol. 6(4): 546-50.
Shields, P- G. and Harris, C. C. (1991). Molecular epidemiology and the genetics of environmental cancer. J, Am- Med. Assoc. 266(5): 681-7.
Shoichet, B. K., Baase, W. A,. Kuroki, R. and Matthews, B. W. (1995). A relationship between protein stability and protein function. Proc. Natl. Acad- Sci. USA 92(2): 452-6.
Siess, E. A., Brocks, D. G. and Wieland, O, H. (1976). Subcellular distribution of key rnetabolites in isolated liver cells from fasted rats. FEBS Lett. 69(1): 265-71. Sinclair, J, and Sim, E- (1997). A fragment consisting of the first 204 amino-terminal amino acids of human arylamine N-acetyltransferase one (NATI) and the first transacetyfation step of catalysis, Biochem. Pharmacol. 53(1): 11-6,
Sinclair, J. C., Delgoda, R., Noble, M. E., Jarmin, S-, Goh, N. K. and Sim, E. (1998). Purification, characterization, and crystallization of an N-hydroxyarylamine O-acetyltransferase from Salmonella typ himurium, Protein Expr. Purif. 12(3): 371-80.
Sinclair, J. C., Sandy, J., Delgoda, R,, Sim, E, and Noble, M. E, (2000)- Structure of arylamine N-acetyttransferase reveals a catalytic triad. Nat, Stmct Biol. 7(7):5604.
Smelt, V. A., Mardon, H. J. and Sim, E. (1998). Placental expression of arylarnine N-acetyltransferases: evidence for linkage disequilibriurn between NAT17 0 and NAT2'4 alleles of the two human arylarnine N-acetyltransferase loci NAT1 and NAT2. Phannacol. Toxicol. 83(4): 149-57.
Smelt, V. A., Upton, A,, Adjaye, J., Payton, M. A-, BoukouvaIa, S., Johnson, N., Mardon, H- J. and Sim, E. (2000). Expression of arylamine N-acetyltransferases in pre-term placentas and in human pre-implantation embryos. Hum. Mol. Genet. 9(7): 11 01 -7.
Smith, T. J. and Hanna, P. E. (1986)- N-acetyltransferase multiplicity and the bioactivation of N- arylhydroxamic acids by hamster hepatic and intestinal enzymes. Carcinagenesis 7(5):697-702.
Stanley, L A., Copp, A. J., Pope, J., Rolls, S., Smelt, V., Peny, V- H. and Sim, E. (1998). lmmunochemical detection of arylamine N-acetyltransferase during mouse embryonic development and in adult mouse brain. Teratology58(5): 174-82.
Stanley, L A., Coroneos, E.. Cuff. R., Hickman, D-, Ward, A. and Sim, E, (1996). immunochemical detection of arylamine N-acetyltransferase in normal and neoplastic bladder. J. Histochem. Cytochem. 44(9): 1059-67.
Steinberg, M. S., Cohen. S. N. and Weber, W. W. (1971). Isotope exchange studies on rabbit liver N- acetyltransferase. Biochim. Biophys. Acta 235(1): 89-98.
Stevens, G. J,, Payton, M., Sim, E. and McQueen, C-A- (1999). N-acetylation of the heterocyclic amine batracylin by human Iiver. Drug Metab. Dispos. 27(9): 966-71.
Sticha, K. R., Bergstrom, C. P., Wagner, C. R. and Hanna, P. E. (1998). Characterization of hamster recombinant monomorphic and polymorphic arylamine N-acetyltransferases: bioactivation and mechanism-based inactivation studies with N-hydroxy-2-acetylarninofluorene. Biochem. Pharmacol. 56(1): 47-59.
Sticha, K. R., Sieg, C. A., Bergstrom, C. P., Hanna, P. E. and Wagner, C. R. (1997). Overexpression and large-scale purification of recombinant hamster polymorphic arylamine N-acetyltransferase as a dihydrofolate reductase fusion protein. Protein ExpL Purif 1O(1): 141-53.
Strange, R. C., Jones, P. W. and Fryer, A. A. (2000). Glutathione S-transferase: genetics and role in toxicology. Toxicol. Lett. 112-1 13: 357-63.
Stryer, L. (1988). Biochemistry. New York, W. H. Freernan and Company.
Stubbins, M. J., Harnes, L. W., Smith, G., Tarbit, M. H. and Wolf, C. R. (1996). Genetic analysis of the human cytochrome P450 CYP2C9 locus. Pharmacogenetics 6(5): 429-39.
Stultz, C. M., White, J. V. and Smith, T. F. (1993). Structural analysis based on state-space modeling. Protein Sci- 2(3): 305-14. Sueyoshi. T.. Park, L J., Moore, R., Juvonen, R. and Negishi, M. (1995). Molecular engineering of microsomal P450 2a-4 to a stable, water-soluble enzyme. Arch. Biochem- Biophys. 322(1): 265-71,
Tanaka, E. (1998)- Clinical importance of non-genetic and genetic cytochrome P450 function tests in liver disease. J. Clh Pharm. Ther. 23 (3): 16 1-70.
Taningher, M-, Malacarne, D., luotti, A., Ugolini, D. and Parodi, S, (1999). Drug metabolism polymorphisms as modulators of cancer susceptibility. Mutat Res 436(3): 227-61-
Taylor, J. VJ., Ott, J. and Eckstein, F. (1985). The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-rnodified DNA. Nucleic Acids Res. 13(24): 8765-85.
Testa, B., Di Carlo, F, J. and Jenner, P. (1981)- Xenobiotic metabolism: necessity, chance, mishap, or none of the above? Conce~tsin Druu Metabolism. P. Jenner, B. Testa. New York, Marcel Dekker, Inc.: 515-35.
Thompson, J. D., Higgins. D. G. and Gibson, T. J. (1994). CLUSTAL W: irnproving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight rnatrix choice. Nucleic Acids Fies. 22(22): 4673-80.
Trepanier, L A., Ray, K, Winand, N. J., Spielberg, S. P. and Cribb, A. E. (1 997)- Cytosolic arylamine N- acetyltransferase (NAT) deficiency in the dog and other canids due to an absence of NAT genes- Biochem. Pharmacol. 54(1): 73-80.
Tsukazaki. T., Chiang, T. A., Davison, A. F., Attisano, L. and Wrana, J. L. (1998). SARA, a FYVE domain protein that recruits Smad2 to the TG Fbeta receptor. Ce11 95(6): 779-91-
Uno, T., Mitchell. E., Aida, K., Lambert, M. H,, Darden, T. A-, Pedersen, L. G. and Negishi, M. (1997)- Reciprocal size-effect relationship of the key residues in deterrnining regio- and stereospecificities of DHEA nyaroxylase activity in P450 2a5. Biochemistry 36(11): 31 93-8,
Vakulenko, S. B., Taibi-Tronche, P., Toth, M., Massova, 1.. Lerner, S. A. and Mobashery, S. (1999). Effects on substrate profile by mutational substitutions at positions 164 and 179 of the class A TEM(pUC19) beta-lactamase from Escherichia coli. J. 8101- Chem. 274(33): 23052-60.
VaIlette, F., Mege. E., Reiss, A. and Adesnik, M- (1989). Construction of mutant and chimeric genes using the polymerase chairt reaction. Nucleic Acids Res. 17(2): 723-33.
Vatsis, K. P., Martell, K. J. and Weber, W. W. (1991). Diverse point mutations in the human gene for polymorphic N- acety ltransferase. Proc. NatL Acad. Scï. USA 88(14): 6333-7,
Vatsis, K. P. and Weber, W. W. (1993). Structural heterogeneity of caucasian N-acetyltransferase at the NAT1 gene locus. Arch. Biochem. Biophys. 301(1 ): 71-6.
Vaz, A. D., McGinnity, O. F. and Coon, M. J. (1998). Epoxidation of olefins by cytochrome P450: evidence from site- specific mutagenesis for hydroperoxo-iron as an electrophilic oxidant. Proc. NatL Acad. Sci. USA 95(7): 3555-60.
Vaz, A. D., Pernecky, S. J., Raner, G. M. and Coon, M. J. (1996). Peroxo-iron and oxenoid-iron species as alternative oxygenating agents in cytochrome P450-catalyzed reactions: switching by threonine-302 to alanine mutagenesis of cytochrome P450 2B4. Proc. Natl. Acad. Sci. USA 93(10): 4644-8.
Veronese, M. E., Burgess, W., Zhu, X. and McManus, M. E. (1994). Functional characterization of two human sulphotransferase cDNAs that encode monoamine- and phenol-sulphating forms of phenol sulphotransferase: substrate kinetics, thermal-stability and inhibitor- sensitivity studies. Biochem. J. 302(Pt 2):497-502. -216- Vogef, F. and Motuls-W. A. G- (1 979). Human Genetics. Berlin. Springer Verlag.
Voisin, P., Namboodiri, M. A. and Klein, D. C. (1984)- Arylamine N-acetyltransferase and arylalkylamine N- acetyltransferase in the rnammalian pineal gland. J. Biol. Chem. 259(17): 10913-8.
Volkel, O.. Blankenfeldt, W. and Schomburg, D. (1998). Large-scale production. purification and refolding of the full- length celtufar prion protein from Synan golden hamster in Escherichia coli using the glutathione S-transferase-fusion system. Eur. J. Biochem. 251(1 -2): 462-71.
Wagner, C. R., Bergstrom, C- P., Koning, K- R, and Hanna, P. E. (1 996)- Expression in Escherichia coli, purification, and substrate specificities of recombinant hamster monomorphic and polymorphic isozymes- Drug Metab. Dlsp. 24(2): 245-53,
Walker, J., Crowley, P., Moreman, A. D. and Barrett, J. (1993)- Biochemical properties of cioned glutathione S- transferases from Schistosoma mansoni and Schistosoma japonicum. Molec. Biochem. Parasitol. 61(2): 255-64.
Wang, H., Dick, R., Yin, H., Licad-Coles, E.. Kroel, D, L, Szklarz, G., Harlow, G., Halpert. J. R. and Correia, M. A. (1998). Structure-function relationships of hurnan liver cytochromes P450 3A: aflatoxin BI rnetabolisrn as a probe. Biochemistry 37(36): 12536-45-
Ward, A.. Hickman, D., Gordon, J. W. and Sim, E- (1992)- Arylamine N-acetyltransferase in human red blood cells. Biochem. Pharmacol. 44(6): 1099-1 04.
Ward, A-, Summers, M. J. and Sim, E. (1995). Purification of recombinant human N-acetyltransferase type 1 (NATI) expressed in E- coli and characterization of its potential role in folate metabolism. Biochem. Pharmacol. 49(12): 1759- 67.
Watanabe, M., Sofuni, T. and Nohmi, T. (1992). lnvolvement of Cysb9residue in the catalytic mechanism of N- hydroxylarylamine O-acetyltransferase of Salmonella typhimurium- J. BioL Chem. 267(12): 8429-36.
Waxman, D. J. (1 999). P450 gene induction by structurally diverse xenochemicals: central rote of nuclear receptors CAR, PXR, and PPAR. Arch. Biochem. Biophys. 369(1): 11-23.
Weber, W. W. and Cohen, S. N- (1967). N-acetylation of drugs: isolation and properties of an N-acetyltransferase from rab bit liver. Mol. Pharmacol. 3(3): 266-73.
Weber, W. W. and Cohen, S. N- (1 968). The mechanism of isoniazid acetylation by human N-acetyltransferase. Biochim. Biophys. Acta 151 (1): 276-8.
Weber. W. W. and Hein, D. W. (1985). N-acetylation pharmacogenetics. Pharmacol. Rev. 37(1): 25-79.
Weber, W. W. and Vatsis, K. P. (1 993). Individual variability in p-aminobenzoic acid N-acetylation by human N- acetyltransferase (NAT1) of peripheral blood. Pharmacogenetics 3(4): 2C9-12.
Weinshiiboum, R. M., Ottemess, O. M. and Szurnlanski. C. L. (1999). Methylation pharmacogenetics: catechol 0- methyltransferase, thiopurine methyltransferase, and histamine N-methyltransferase. Annu. Rev. Pharmacol- Toxicol. 39: 19-52.
Wells, J. A., Powers, D. B., Bott. R. R., Graycar, T. P. and Estell, 0.A- (1987). Designing substrate specificity by protein engineering of electrostatic interactions. Proc. Natl. Acad. Scï. USA 84(5): 1219-23.
Wick, M. J. and Hanna, P. E. (1990). Bioactivation of N-arylhydroxamic acids by rat hepatic N- acetyltransferase. Detection of multiple enzyme forms by mechanism- based inactivation. Biochem. Pharmacol. 39(6): 991-1 003. -217- Wick, M. J., Jantan, 1.8. and Hanna, P. E, (1 988). Irreversible inhibition of rat hepatic transacetylase activity by N- arylhydroxarnic acids. Biochem. Pharmacol. 37(7): 1225-31,
Wild, D., Feser, W., Michel, S., Lord, H. and Josephy, P. (1995)- Metabolic activation of heterocycIic aromatic amines catalyzed by human arylamine N-acetyltransferase isozymes (NAT1 aind NAT2) expressed in Salmonella typ hirnurium. Carcinogenesis 16(3): 643-8-
Windmill, K. F., Gaedigk, A., Hall, P. M., Samaratunga, H., Grant, D- M, and McManus, M. E. (2000). Localization of N-acetyltransferases NAT1 and NAT2 in human tissues. ToxicoL Sci- 54(1): 19-29.
Wolf, C. R. (1984). Distribution and regulation of drug-metabolizing enzymes in mammalian tissues. Foreinn CO~DOU~~Metabolisrn. J. Caldwell, G. 0,Paulson. London, Taylor & Francis: 37-49,
Wolf, C. R., Hartmann, R., Oesch, F. and Adams, D. J. (1985). Regulation and multiplicity of drug metabolising enzymes in tissues and cells. Drua metabolkm - molecular ap~roachesand pharmacoloav implications. G- Siest. Oxford, Pemagon Press Ltd: 121-30.
Wright, P. E. and Dyson, H. J- (1 999)- Intrinsically unstructured proteinsr re-assessing the protein structure- function paradigm. J. Mol. Biol. 293(2): 321-31.
Wu, O. and Hersh, L. 6-(1 995). Identification of an active site arginine in rat choline acetyltransferase by alanine scanning mutagenesis. J. Biol. Chern. 270(49): 291 1 1-29116.
Wuthrich, K. (1989). Protein structure determination in solution by nuclear rnagnetic resonance spectroscopy. Science 243(4887): 45-50.
Ziegler, D. M. (1988). Detoxication: oxidation and reduction. The Liverr Bioloav and Pathobioloav. I. M, Arias, W. B. Jakoby, H. Popper, D. Schachter. D. A. Shafritz. New York, Raven Press. Ltd: 363-74.
Ziegler, D. M. (1990). Flavin-containing monooxygenasesr enzymes adapted for multisubstrate specificity. Trends Pharmacol. Sci. 1 1(8): 321-4.