Role of Lamin A/C in Neuroblastoma Differentiation: Therapeutic Implications

UNIVERSITA’ DEGLI STUDI DELLA TUSCIA

DI VITERBO

DIPARTIMENTO DI AGROBIOLOGIA E AGROCHIMICA

CORSO DI DOTTORATO DI RICERCA IN

“GENETICA E BIOLOGIA CELLULARE”

XXIII CICLO

Role of Lamin A/C in neuroblastoma differentiation: therapeutic implications

BIO/11

Coordinatore: Prof. Giorgio PRANTERA

Tutors: Dr. Igea D‟AGNANO

Dr. Armando FELSANI

Dottorando: Giovanna MARESCA

To my family

INDEX

ABSTRACT ...... 1 1 INTRODUCTION ...... 3 1.1 NEUROBLASTOMA ...... 3 1.1.1 Neuroblastoma as a sympathetic nervous system-derived tumor ...... 4

1.1.2 Neuroblastoma cell lines as “in vitro” differentiation model ...... 7

1.1.3 Retinoids-induced neuroblastoma cell differentiation ...... 9

1.2 NUCLEUS AND NUCLEAR LAMINA ...... 10 1.2.1 Lamins ...... 11

1.2.2 Lamins during development and differentiation processes ...... 14

1.2.3 Lamins and regulation of the cellular mechanical properties ...... 16

1.2.4 Role of lamins in chromatin organization and gene expression ...... 17

1.2.5 Role of lamins in DNA replication and cell proliferation ...... 18

1.2.6 Laminopathies ...... 19

1.2.7 Lamins and cancer ...... 22

2 AIMS ...... 23 3 MATERIALS AND METHODS ...... 24 3.1 Cell lines maintenance, differentiation and treatments ...... 24 3.2 Generation of recombinant viruses and lentiviral infection of cells ...... 24 3.3 Western Blot analysis ...... 26 3.4 Immunofluorescence microscopy ...... 26 3.5 Total RNA preparation ...... 26 3.6 Real‐time RT‐PCR analysis ...... 27 3.7 Whole genome expression profiling...... 27 3.8 Plating Efficiency Assay ...... 30 3.9 In vitro Cell Migration Assay ...... 30 3.10 Zymography of Gelatinolytic Activity ...... 30 3.11 P-Glycoprotein immunostaining ...... 31 3.12 Calcein/AM Retention Assay ...... 31

4 RESULTS ...... 32 4.1 Silencing of LMNA gene inhibits RA-induced differentiation in SHSY5Y cell line ...... 32 4.2 Gene expression profiling of SHSY5Y CTR and miRL cells reveals an impairment of differentiation ...... 35 4.3 The impairment of cell differentiation in LMNA silenced SHSY5Y cells is associated with increased tumor progression ...... 38 4.4 Low levels of Lamin A/C expression are associated with increased resistance to chemotherapeutic agents ...... 41 5 DISCUSSION ...... 43 6 BIBLIOGRAPHY ...... 46 APPENDIX ...... 58

ABSTRACT

Neuroblastoma is one of the most aggressive solid tumors in childhood. The degree of its differentiation can influence patient outcome since high differentiated tumors have been correlated to favourable prognosis. Most neuroblastoma cells maintain the ability to differentiate in vitro in the presence of various agents, rendering them a good model to study the differentiation potential of these tumors. Nuclear lamins are type V intermediate-filament proteins that form a scaffoldlike meshwork underlying the inner nuclear membrane and have many different and not completely known functions. Among lamins, the A-type ones are expressed in differentiated tissues and are involved in the differentiation processes during the embryonal development. Their expression is reduced or absent in different human malignancies even though their role in the tumorigenesis is not yet characterized. Our aim was to investigate the role of Lamin A/C, belonging to A-type lamins, in the differentiation and tumorigenesis of neuroblastoma cells. We have also studied whether Lamin A/C could represent a marker of drug sensitivity, which could contribute to develop therapeutic strategies based on the molecular profile of the individual tumor. As cellular model we employed a neuroblastoma cell line able to differentiate in vitro and showing high expression levels of Lamin A/C, the SHSY5Y cell line. As differentiating stimulus we used the all-trans retinoic acid (RA), the most effective compound which has been shown to induce differentiation in neuroblastoma cells and that is employed as biological agent in clinics to improve patients‟ survival. Silencing of Lamin A/C blocked the differentiation processes activated by the RA in SHSY5Y cells, thus preventing the formation of neurites and inhibiting the expression of the tyrosine hydroxylase differentiation marker. The genome-wide gene-expression profiling of SHSY5Y cells silenced for LMNA gene (miRL cells), in the presence or not of the differentiating stimulus confirmed that miRL cells have down-regulated those genes necessary for the differentiation program. As well an increase of tumor progression related genes shifted the SHSY5Y cells phenotype towards a more aggressive one, with a higher resistance elicited versus some chemoterapic agents, thus demonstrating that Lamin A/C could represent a good marker of neuroblastoma tumor progression and of response to antitumoral therapeutics.

SOMMARIO

Il neuroblastoma è uno dei tumori solidi infantili più aggressivi. Il suo grado di differenziamento può influenzare lo sviluppo della malattia e l‟esito clinico poiché più il tumore risulta differenziato più la prognosi è favorevole. La maggior parte delle cellule di neuroblastoma mantiene la capacità di differenziare in vitro in presenza di diversi stimoli e ciò le rende un buon modello per studiare il potenziale differenziativo di tali tumori. Le lamine nucleari sono proteine che appartengono alla classe dei filamenti intermedi di tipo V. Formano una struttura reticolare al di sotto della membrana nucleare interna e svolgono diverse funzioni, alcune delle quali non sono state ancora del tutto chiarite. Tra le lamine, quelle di tipo A sono espresse nei tessuti differenziati e sono coinvolte nei processi differenziativi che avvengono durante lo sviluppo embrionale. La loro espressione risulta ridotta o assente in molti tumori umani, tuttavia non è stato ancora caratterizzato un loro ruolo nei processi di tumorigenesi. Il nostro obiettivo è stato quello di indagare il ruolo della Lamina A/C, appartenente alle lamine di tipo A, nel differenziamento e nella tumorigenesi delle cellule di neuroblastoma. Abbiamo inoltre verificato la possibilità che la Lamina A/C sia un marcatore di sensibilità ai farmaci chemioterapici, in quanto ciò consentirebbe di sviluppare strategie terapeutiche personalizzate sulla base del profilo molecolare del singolo tumore. Come modello cellulare abbiamo utilizzato la linea di neuroblastoma SHSY5Y, che esprime ad alti livelli la Lamina A/C ed è in grado di differenziare in vitro. Abbiamo scelto quale stimolo differenziativo l‟acido retinoico (RA), poiché è il composto più efficace nell‟indurre il differenziamento delle cellule di neuroblastoma ed è inoltre utilizzato in clinica per aumentare la sopravvivenza dei pazienti affetti da neuroblastoma. Il silenziamento della Lamina A/C nella linea SHSY5Y ha causato un blocco dei processi differenziativi attivati da RA, in quanto risultano inibite sia la formazione dei neuriti che l‟espressione del marcatore tirosina idrossilasi. Lo studio del profilo di espressione genica delle cellule SHSY5Y silenzate per il gene LMNA (cellule miRL), in presenza o meno dello stimolo differenziativo, ha confermato una repressione di diversi geni necessari al differenziamento. Le cellule miRL mostrano inoltre un incremento nell‟espressione di geni relati alla progressione tumorale che si accompagna ad un fenotipo più aggressivo nonché ad un‟aumentata resistenza ad alcuni farmaci chemioterapici. L‟espressione della Lamina A/C nel neuroblastoma potrebbe dunque essere un buon marcatore di progressione tumorale e di risposta alla terapia farmacologica.

1 INTRODUCTION

1.1 NEUROBLASTOMA

Neuroblastoma is an embryonic tumor of the autonomic nervous system and is the most common extracranial solid cancer in childhood. As can be expected with a disease of developing tissues, neuroblastoma generally occurs in very young children: close to 50 percent of neuroblastoma cases occur in children younger than two years old . The clinical presentation of neuroblastoma is extremely variable, ranging from highly aggressive phenotypes to benign tumors with a high propensity for spontaneous regression (Brodeur, 2003). Three broad risk categories (low, intermediate, and high risk) have been proposed on the basis of analysis of age at diagnosis, histology category, grade of tumor differentiation, DNA ploidy, and copy-number status at the MYCN oncogene locus at chromosome 11q. In particular the MYCN oncogene is target of high-level amplifications at chromosome band 2p24 observed in about 20% of neuroblastoma and since such amplification has been found to profoundly affect the patients‟ clinical outcome, it is routinely used as prognostic biomarker and for treatment stratification (Seeger et al., 1985). Treatment strategies employed in neuroblastoma patients depends on the risk group they belong to. Patients with localized neuroblastoma (low risk) have excellent event-free survival rates with surgical excision of tumor only and an overall survival rate higher than 95%. Intermediate risk group patients include children younger than 18 months with essentially non-MYCN–amplified tumors. They are subjected to surgery and chemotherapy (drugs employed are cyclophosphamide, doxorubicin, carboplatin and etoposide). Treatment of high-risk group patients includes multi-agent chemotherapy, surgery, and radiotherapy, followed by consolidation therapy with high-dose chemotherapy and peripheral blood stem cell rescue. Control of minimal residual disease with biological agents has also been shown to improve survival. The most effective compound is 13-cis - retinoic acid, which has been shown to induce differentiation in neuroblastoma cells (Matthay et al., 1999). The high degree clinical heterogeneity of neuroblastoma reflects the complexity of genetic and genomic events associated with the development and progression of this disease. Inherited genetic variants and mutations that initiate tumorigenesis have been identified in neuroblastoma and multiple somatically acquired genomic alterations have been described that are relevant to disease progression (Capasso and Diskin, 2010). Familial neuroblastoma is reported in only about 1% of patients and is caused by a very rare germline mutation in the anaplastic lymphoma kinase (ALK)

oncogene (Mosse et al., 2008). These mutations result in a constitutive activation of the kinase and a premalignant state. Children with either sporadic or familial neuroblastoma usually have loss-of- function mutations in the homeobox gene PHOX2B. Thus, genetic analysis of ALK and PHOX2B mutations should be considered every time a patient has family history of neuroblastoma (Mosse et al., 2004). Nevertheless, additional familial genes may still be discovered. A genome-wide association study of neuroblastoma is currently under investigation, with the support of Children‟s Oncology Group. To date, the study has shown that a relative common copy-number variation at 1q21 chromosome is associated with the neuroblastoma and that alleles with common single- nucleotide-polymorphism variations within the putative genes FLJ22536 and BARD1 are significantly enriched in neuroblastoma patients compared with control groups (Capasso et al., 2009; Maris et al., 2008).

1.1.1 Neuroblastoma as a sympathetic nervous system-derived tumor

The human nervous system consists of the Central Nervous System (CNS), comprising the brain and the spinal cord, and the Peripheral Nervous System (PNS), which links the CNS with the body‟s sense receptors, muscles, and glands. The PNS is divided in two components: the somatic or skeletal nervous system, which controls voluntary movement, and the autonomic nervous system, which regulates inner organ function via the sympathetic, parasympathetic or enteric ganglia. The human nervous system originates from the neural plate, an embryonic structure evolving from the ectodermal germ layer during the third week of gestation. During the process of neurulation, the neural plate invaginates ventrally and closes in order to form the neural tube, which will give rise to the CNS. During this closure, neural crest cells originate at the interface between the closing neural tube and the dorsal ectoderm (LaBonne and Bronner-Fraser, 1999). The neural tube is initially composed of a single layer of cells. However, as development proceeds and extensive cell division occurs, the neural tube becomes multilayered, with precursor cells dividing in the medial portion of the neural tube adjacent to the central cavity, which will give rise to ventricles. The portion of the neural tube adjacent to the ventricles becomes the Ventricular Zone (VZ) and contains neural stem cells and dividing progenitors (Greene and Copp, 2009). These stem cell populations are capable of self-renewing through symmetric cell divisions or can differentiate through asymmetric cell divisions.

Fig. 1.1 Nervous system development (cross-section): invagination of the dorsal ectoderm, closure of the neural tube, neural crest formation at the interface of the closing neural folds and dorsal ectoderm, and migration of the pluripotent crest cells (human time frame).

The neural tube expands in the head of the embryo to form the brain and in the trunk to form the spinal cord. The PNS derives from the neural crest and the ectodermal placodes. Neural crest cells delaminate from the neural tube and migrate extensively throughout the embryo to generate, differentiate, and populate numerous organs. The migrating neural crest cells are largely guided along distinct pathways by specialized adhesion molecules in the extracellular matrix or by

molecules on the surfaces of cells in the embryonic periphery. The movement through a varying cellular environment has important effects on their differentiation. In fact, during their migration specific growth factors induce neural crest cells to differentiate into distinct phenotypes including the neurons and glia of the sensory and visceral motor (autonomic) ganglia, the neurosecretory cells of the adrenal gland, and the neurons of the enteric nervous system. They also contribute to variety of non-neural structures such as melanocytes, cartilage, dentine, and bone. NSCs can persist in adult organism as undifferentiated immature populations, and can be recruited to replace dead or damaged cells following injury or during the course of normal development and aging (Anderson, 1997).

Fig. 1.2 The differentiation of neural crest cells. The establishment of each precursor type relies on signals provided by one of several specific peptide hormones.

Extensive parallel characterization of marker genes expressed in human Sympathetic Nervous System (SNS) during embryonic and fetal development and in human neuroblastoma, reveals that these tumors have immature neuronal characteristics, thus indicating their derivation from precursors cells of the sympathetic lineage (Hoehner et al., 1998). Recently, it has been proposed that mutations in specific neural stem cells or early neural progenitors can give rise to a small population (1-2% of the total) which is capable of tumor initiation. As described in the stem cell hypothesis of cancer initiation, neoplasms may be viewed as a heterogeneous population of cells formed by cancer cells and cancer stem cells (CSCs) (Bjerkvig et al., 2005). As normal stem cells, CSCs are capable of self-renewing and differentiation within the tumor. It has been shown that CSCs can naturally survive antitumoral treatments and could be responsible for tumor re-growth and metastasis. This resistance can be attributed not only to their quiescent nature but also to an elevated expression of anti-apoptotic proteins and drug efflux pumps belonging to superfamily of ABC transporters (Hirschmann-Jax et al., 2004). As a consequence, more effective chemotherapy could be achieved by specifically targeting also these cells. Although the very low representativeness of CSCs in tumors they have been identified in several brain tumors, including neuroblastoma, as well as in established cancer cell lines (Singh et al., 2004) (Walton et al., 2004). The neuronal CSCs express several surface markers peculiar of stem cells such as the CD133, CD34, ABCG2, and nestin (Mahller et al., 2009).

1.1.2 Neuroblastoma cell lines as “in vitro” differentiation model

The degree of neuroblastoma differentiation has been related with the patient outcome, high differentiation stage correlating to favorable prognosis (Hedborg et al., 1995). Nevertheless, the mechanisms governing neuroblastoma cell differentiation are only partially understood. In such a rare malignancy as neuroblastoma, access to fresh tumor material is limited and in vitro studies based on primary tumor explants are difficult to perform. The possibility to use long term cultures derived from neuroblastoma tumors allowed to study the peculiar properties of such tumors and to understand the propensity of neuroblastoma cells to differentiate in vitro and in vivo. As previously stated, neuroblastoma cells are very heterogeneous; usually they are undifferentiated, round and small with scant cytoplasm, but most of them retain the capacity to differentiate in vitro following an adequate stimulus (Edsjo et al., 2007).

Many established neuroblastoma cell lines contain at least 3 distinct morphological variants (Walton et al., 2004) (Ciccarone et al., 1989). The most common variant are the sympathoadrenal neuroblasts (N-type), which grow as poorly attached aggregates of small, rounded cells with short neuritic processes. The S-type cells are instead large and flattened cells that attach strongly to the substrate. They resemble Schwannian, glial or melanocytic progenitor cells and they are non- malignant. The third cell type is termed I because its phenotype is intermediate between the N and S type. I-type cells are small, flattened and moderately adherent, and have the potential to differentiate into N- or S-type cells (Ross et al., 1994). The ability of many neuroblastoma cell lines to differentiate in the presence of various agents (e.g. retinoids and phorbolesters such as 12-O-tetradecanoyl phorbol-13-acetate) and growth factors (NGF, BDNF) has led to the use of neuroblastoma cell lines as model systems to study tumor cell maturation in general and human neuronal differentiation in particular (Edsjo et al., 2007). One of the hallmarks of neuroblastoma differentiation in culture is the ability of the cells to form neurites, a property which is peculiar of normal neurons. During development, neurons assembled into functional networks by growing out axons and dendrites (collectively called neurites) which connect neurons each other through particular junctions, named synapses (or synaptic terminals), and allow the interneuronal transmission of electrical or chemical signals.

Fig. 1.3 General Structure of a Neuron. Each neuron has three basic parts: cell body (soma), one or more dendrites, and a single axon with a synaptic terminal.

Additional markers evidenced in neuroblastoma differentiated cells are the expression of neurofilaments; the synthesis of neurotransmitter biosynthetic enzymes; the expression of opioid, muscarinic and neurotrophin receptors; the presence of dense core granules, presumed sites of catecholamine storage; the expression of neuron specific enolase (NSE). When differentiated, neuroblastoma cells present either an adrenergic phenotype producing relatively high levels of tyrosine hydroxylase (TH) and dopamine-ß-hydroxylase (DBH), or a cholinergic phenotype showing a high activity of choline aceltyltransferase (ACHE) (Hill and Robertson, 1997) (Handler et al., 2000).

1.1.3 Retinoids-induced neuroblastoma cell differentiation

Among the most widely used agents that induce terminal differentiation reducing cell growth in selected neuroblastoma cell lines are retinoids. (Sidell, 1982). The retinoids (all-trans-retinoic acid or ATRA, 13-cis retinoic acid and 9-cis retinoic acid) are a class of polyisoprenoid lipids which include vitamin A (retinol) and its natural and synthetic analogs. Retinoids are compounds with multiple functions. They are involved in the control of cell proliferation, cell differentiation, and embryonic development. Vitamin A is indispensable for embryonic pattern formation, for visual function, and the differentiation of epithelial tissues. The signaling pathway of retinoids involves specific nuclear receptors that regulate gene expression: the retinoic acid receptors (RAR α, β, γ) and the retinoic X receptor (RXR α, β, γ). These non-steroid nuclear hormone receptors bind their retinoid ligands, target to retinoic responsive elements on DNA and up- or down-regulate transcription. Neuroblastoma cells constitutively express RARα, RARγ, RARβ and RXRs although the levels of RARβ are reduced compared to RARα and RARγ (Li et al., 1994). Neuroblastoma treatment with ATRA besides inhibiting cell growth results in a decreased anchorage-independent growth, and in the expression of some neuronal differentiation markers such as extensive neuritic processes, ultrastructurally and electrophysiologically similar to those of normal neurons; increased neuron specific enolase activity; slight accumulation of norepinephrine; up-regulation of GAP43, coding for the growth associated protein 43, a protein important in axonal growth. (Pahlman et al., 1984). Moreover, decrease in a number of proto-oncogenes (MYCN, MYB, HRAS), increase in the TrkB and RET receptors expression and activity, were shown to precede the morphological differentiation (Thiele et al., 1988). 9

As a therapeutic tool, retinoids, such as 13-cis-retinoic acid (isotretinoin), have been shown promising in reducing the risk of recurrence after high-dose chemotherapy and stem cell transplant. Recently, potentially more effective retinoids, such as fenretinide, are now being studied in clinical trials (Villablanca et al., 2006).

Fig. 1.4 Scheme of the intracellular pathways involving retinoids (CRBP: cellular retinol binding protein; CRABP: cellular retinoic acid binding protein; RARE: retinoic acid response element; RBP: retinol binding protein; RoDH: retinol dehydrogenase.)

1.2 NUCLEUS AND NUCLEAR LAMINA

In eukaryotic cells, the nucleus is a large membrane-bound organelle which houses the genetic material. The nucleus is separated from the cytoplasm by a nuclear membrane known as the nuclear envelope (NE) that consists of two parallel cellular membranes, an inner and an outer membrane, separated by 10 to 50 nanometers. The outer nuclear membrane (ONM) is continuous with the membrane of the rough endoplasmic reticulum (RER) and is studded with small openings called nuclear pore complexes (NPCs), which allow the movement of selected molecules in and out of the nucleus. In fact, the NE acts as a selective barrier controlling the traffic of macromolecules, including proteins and RNAs. The space between the membranes is called the perinuclear space and is continuous with the RER lumen. The inner nuclear membrane (INM) is lined by a complex meshwork of intermediate filament proteins forming the Nuclear Lamina (NL) that structurally

supports the NE and largely determines the overall shape of the interphase nucleus (Gerace and Burke, 1988).

Fig. 1.5 Schematic representation of nucleus structures

1.2.1 Lamins

The major components of the NL are type V intermediate filament (IF) proteins, the nuclear lamins. Like all proteins, they are synthesized in the cytoplasm and then transported into the nucleus, where they are assembled before being incorporated into the existing network of NL (Aebi et al., 1986). Lamins are divided into A and B types based on sequence homologies. In mammals, two major A-type lamins (Lamin A and C) and two major B-type lamins (Lamin B1 and B2) have been characterized. Minor isoforms such as the Lamin AΔ10 (Machiels et al., 1996), the germ cell- specific lamins C2 (Furukawa et al., 1994) and B3 (Furukawa and Hotta, 1993), have been also identified. While B-type lamins are encoded by different genes, Lamins A and C are derived from one gene, LMNA (located on chromosome 1q21.2-q21.3), by alternative splicing ((Broers et al.,

2006); (Schumacher et al., 2006); (Verstraeten et al., 2007)). These two latter lamins are produced in roughly equal amounts. Little is known about the regulation of lamins gene expression. Slight informations are available on the regulation of LMNA gene expression. LMNA promoter presents different regulatory motifs among which a retinoic acid-responsive element (Okumura et al., 2000), binding sites for various transcription factors such as c-Jun, c-Fos and Sp1/3 (Okumura et al., 2004) or transcriptional coactivator such as CREB-binding protein (Janaki and Parnaik, 2006). Within the first intron of LMNA gene there are also binding sites for two transcription factors, the hepatocyte nuclear factor-3β and the retinoic X receptor β (Arora et al., 2004). The lamins consist of an amino (N)-terminal globular domain, a central α-helical coiled-coil rod domain and a globular carboxy (C)-terminal tail domain. Like the components of other intermediate filaments, the lamin alpha-helical domain is used by two monomers to coil around each other, forming a dimer structure called “coiled coil”. Two of these dimer structures then join side by side, in an antiparallel arrangement, to form a tetramer called “protofilament”. Eight of these protofilaments are laterally combined and twisted to form the characteristic 10 nm intermediate filament structure. These filaments can be assembled or disassembled in a dynamic manner. Although A- and B-type lamins interact each other in vitro (Sasse et al., 1998), little is known about their composition and structure in the cells within the lamina. Lamins contain a structural motif similar to a type of immunoglobulin fold (Ig-fold) within their C-terminal domain (Dhe-Paganon et al., 2002). Unique among the other intermediate filaments, lamins contain also a nuclear localization signal (NLS) and, with the exceptions of lamins C and C2, a C-terminal CAAX motif (where C is cysteine, A is an aliphatic amino acid and X is any amino acid), which allows to extensive post-translational modification of these proteins.

Fig. 1.6 Schematic structure of mature lamin A and lamin C polypeptide chains. The lamin structure consists of a short amino terminal head domain, a central α-helical rod domain (red), and the carboxy-terminal domain containing the NLS and the Ig-fold (blue; the nine b-strands of the Ig-fold motif are depicted). 12

Lamins A, B1, and B2 are initially expressed as pre-lamins that require extensive posttranslational modifications of their carboxy-terminal –CAAX box to become mature lamins (Rusinol and Sinensky, 2006). The maturation process starts with farnesylation at the terminal cysteine site and is followed by cleavage of the last three amino acid residues of the CAAX motif and methylation of the carboxy-terminal cysteine. While the maturation of B-type lamins is terminated at this step, resulting in permanent farnesylation and carboxymethylation, an additional 15 amino acids are removed from the carboxyl terminus of farnesylated/carboxymethylated prelamin A (Corrigan et al., 2005). The last cleavage probably takes place during or after incorporation of this molecule into the nuclear lamina. Lamin C, which is 74 residues shorter than mature Lamin A, does not possess a –CAAX box and therefore is not farnesylated or otherwise modified. Besides to farnesylation and carboxymethylation, lamins are also posttranslationally modified by phosphorylation (Ottaviano and Gerace, 1985), sumoylation (Zhang and Sarge, 2008), ADP- ribosylation (Adolph, 1987), and possibly by glycosylation (Ferraro et al., 1989). At the onset of mitosis, the phosphorylation of lamins at specific sites by cyclin-dependent kinase 1 (Cdk1) and protein kinase C (PKC) is required to drive disassembly of the lamina (Dessev et al., 1988; Goss et al., 1994). Subsequently, dephosphorylation of the lamins by protein phosphatase1a is required for lamin/lamina assembly during the telophase/early G1 transition (Thompson et al., 1997).

Fig. 1.7 Posttranslational processing of the carboxyl terminus of prelamins A, B1, and B2. Processing takes place in a series of steps: (1) addition of a farnesyl group to the cysteine residue of the –CAAX box of pre-lamin A, prelamin B1 and prelamin B2 by a farnesyltransferase; (2) removal of the last three residues (2AAX) by an AAX endopeptidase; (3) methylation of the terminal carboxylic acid group (2COOH) by a carboxyl methyltransferase; (4) removal of the carboxyl terminal 15 amino acids of lamin Awith the farnesyl attached by the metalloprotease Zmpste24/FACE1. This last proteolysis step does not occur on B-type lamins and therefore they remain farnesylated.

1.2.2 Lamins during development and differentiation processes

Studies of the early development of Xenopus have shown that the individual types of lamins are differentially expressed in early development and that the changes in the nuclear lamina composition correlate with major programs in cell differentiation (Benavente et al., 1985). Similar changes in lamins expression have been reported in early developing Drosophila (Riemer et al., 1995) and chicken embryos (Lehner et al., 1987). In mammals, although at least one B-type lamin is expressed in all cells throughout development, the expression of A-type lamins is regulated during development (Schatten et al., 1985). In mice, B-type lamins are expressed during early development, while acquisition of the Lamin A/C expression varies according to developmental stage of tissue differentiation (Stewart and Burke, 1987) (Rober et al., 1989). This has been confirmed in several studies using human and 14

mouse cultured cells (Lin and Worman, 1997). More recently it has been shown that B-type lamins, but not A-type ones, are expressed in undifferentiated mouse and human embryonic stem (ES) cells. The regulated expression of A- and B-type lamins is also evident during differentiation of stem cells in culture. In fact, during the in vitro differentiation process, human ES cells appear to express Lamin A/C before a complete down-regulation of the pluripotency marker Oct-4, suggesting that Lamin A/C expression is an early indicator of ES cell differentiation (Constantinescu et al., 2006). Differential expression of A- and B-type lamins has also been shown during neurogenesis in the adult rat brain (Takamori et al., 2007). Comprehensions into the role of lamins during development come from the analysis of mutations in the B-type Drosophila lamin Dm0 that cause lethality at different embryonic or late pupal stages (Osouda et al., 2005). Further insights into the requirement for a specific lamin isoform during development have been obtained from knocking out either LMNA or LMNB1 in mice. The Lamin A/C-deficient animals develop normally until birth, but have severe postnatal growth retardation and develop muscular dystrophy (Sullivan et al., 1999). By contrast, mice that are null for Lamin A but express Lamin C and the B-type lamins appear to be healthy. On the other hand, Lamin B1-deficient mice die at birth and have defective lungs and bones (Vergnes et al., 2004). The developmental regulation of Lamin A/C expression has led various laboratories to hypothesize that these proteins play a role in differentiation. This has been recognized in muscle and adipocyte differentiation processes. More specifically, in the case of muscle, during myoblast differentiation there are changes in Lamin A/C organization strictly dependent from the tumor suppressor pRb (Muralikrishna et al., 2001). Expression of a mutant form of Lamin A in C2C12 myoblasts induces elevated levels of hyperphosphorylated pRb, leading to an inhibition of the differentiation of myoblasts into myotubes (Favreau et al., 2004). In addition, in vitro myogenesis is impaired in LMNA-null skeletal myocytes (Frock et al., 2006). Otherwise, several LMNA mutations have been linked to the development of lipodystrophies. In fact, it is known that the adipocyte differentiation factor, sterol response element binding protein 1 (SREBP1), interacts with the C terminus of Lamin A/C and that this interaction is impaired to various degrees by mutations in Lamin A (Lloyd et al., 2002; Hubner et al., 2006), thus contributing to the dysregulation of adipocyte differentiation.

1.2.3 Lamins and regulation of the cellular mechanical properties

The highest and well-established function of nuclear lamins is to provide shape and mechanical stability to the nucleus (Goldman et al., 2005). In support of this, the nuclei of LMNA knockdown fibroblasts display increased deformability and impaired viability under mechanical strain (Houben et al., 2007). Increased nuclear deformability is also observed in human ES cells lacking A-type lamins (Pajerowski et al., 2007). Moreover, cells either deficient in lamins or expressing mutant lamin proteins often contain deformed nuclei (Muchir et al., 2003; Bechert et al., 2003; Vaughan et al., 2001). Furthermore, several evidences support a role for the lamins in maintaining the mechanical properties of the entire cell by forming not only a complex network in the nucleus but also a bridge between the nucleus and the cellular membrane via the cytoskeleton. Indeed, Lamin A/C deficiency causes impaired mechanotransduction and decreased mechanical stiffness (Lammerding and Lee, 2005). These alterations may be explained by modifications in connections between the nucleoskeleton and the cytoskeleton. Specifically, the connection between the cytoplasm and nucleoplasm might be mediated by the interaction between integral proteins of INM (the Sun proteins Sun1 and Sun2) and of ONM (the nesprins nesprin-1, nesprin-2, and nesprin-3α) in the luminal space (Padmakumar et al., 2005; Ketema et al., 2007). In the nucleoplasm Sun proteins interact with Lamin A (Haque et al., 2006), while in the cytoplasm, nesprins are thought to bind to actin (Warren et al., 2005) and possibly microtubules (Wiche, 1998). This assembly is referred to as the LINC complex (for LInker of Nucleoskeleton and Cytoskeleton) and establishes a physical connection between the nucleoskeleton and the cytoskeleton (Crisp et al., 2006).

Fig. 1.8 A model for the LInker of Nucleoskeleton and Cytoskeleton (LINC) complex. Nuclear components, including lamins, bind to the inner nuclear membrane SUN domain proteins, which in turn bind to the KASH domain of the actin- associated giant nesprins on the outer nuclear membrane. The LINC complex establishes a physical connection between the nucleoskeleton and the cytoskeleton.

1.2.4 Role of lamins in chromatin organization and gene expression

In mammals, heterochromatin is highly organized and closely associated with the lamina at the nuclear periphery (Marshall and Sedat, 1999). Instead, actively transcribed regions (euchromatin) appear to have a more random distribution in the nucleoplasm (Francastel et al., 2000). Recent models of nuclear architecture describe lamins as determining factor for chromosome positioning throughout the nucleus (Dorner et al., 2007; Vlcek and Foisner, 2007; Reddy et al., 2008). As a consequence the lamins would be involved in anchoring chromatin to the nuclear lamina and would also act as a nucleoplasmic scaffold for organizing chromatin in the nucleus. The interaction between the lamins and chromatin involve their non-α-helical C-terminal tail domain and the N- and C-terminal tail domains of core histones (Mattout et al., 2007; Goldberg et

al., 1999). Several proteins have been also described as lamin-binding proteins which directly link both A- and B-types lamins to DNA (Schirmer and Foisner, 2007). Among these proteins are a Lamin B Receptor (LBR), which is an integral protein of the INM (Ye and Worman, 1994), the LAP2α protein, that binds specifically to Lamin A/C, the LAP2β protein, that interacts exclusively with B-type lamins (Dechat et al., 2000; Furukawa and Kondo, 1998), and the Barrier to Autointegration Factor (BAF), which has been reported to bind to dsDNA and to histones (Margalit et al., 2007). However, the functional significance of these complex interactions remains to be determined. On a more global level, lamins could influence gene expression also because they may provide a structural scaffold for the organization of RNA polymerase II transcriptional complexes but not for RNA polymerase I- and III-directed transcription (Spann et al., 2002). A-types lamins have been also described to interact with transcription factors thus regulating gene expression. These interactions appear to regulate transcription in several ways: by sequestering transcription factors in inactive complexes at the nuclear envelope, altering posttranslational modifications important for their function and regulating transcriptional complexes (Andres and Gonzalez, 2009).

1.2.5 Role of lamins in DNA replication and cell proliferation

Several lines of evidence indicate that lamins play a role in DNA replication. Indeed, a properly assembled nuclear lamina is necessary to DNA replication activity (Ellis et al., 1997). It has been shown that Lamin B1 colocalizes with the replication foci during late S phase in mouse 3T3 cells (Moir et al., 1994) and that Lamin A/C are present at sites of early replication in normal human fibroblasts (Kennedy et al., 2000). Functional lamins are needed for a correct localization of replication factors such as PCNA and RFC, which are required in the elongation phase of replication (Moir et al., 2000). The dependence of DNA replication on the nuclear lamina may be, in part, mediated by the tumor suppressor Retinoblastoma product (pRb) since a complex formed by pRb and Lamin A/C has been localized to replication foci (Ozaki et al., 1994). In consideration of the physical interaction between Lamin A/C and pRb, there are clear evidences that Lamin A/C is involved in the regulation of the cell cycle. pRb is a major cell cycle regulator that in its hypophosphorylated state binds and inhibits the E2F transcription factors family necessary for cell cycle progression (Giacinti and Giordano, 2006). Upon hyperphosphorylation of pRb, E2F is

released to initiate S phase. A role for lamins in this process is further suggested by the finding that hypophosphorylated pRb is tightly associated with Lamin A/C-enriched nucleoskeletal preparations of early G1 cells (Mancini et al., 1994). In addition, there is a dramatic reduction in pRb levels in LMNA−/− fibroblasts, indicating that lamins are involved in regulating the turnover and proteasomal degradation of pRb. Based on these findings, it has been suggested that the increased rate of cell proliferation and the decreased capacity to undergo cell cycle arrest reported for Lamin A/C-deficient cells is attributable to the destabilization of pRb (Johnson et al., 2004; Van Berlo et al., 2005).

1.2.6 Laminopathies

Many aspects of nuclear as well as cytoplasmic activity are affected by modifications of the NE and the nuclear lamina. Processes as fundamental as DNA replication, transcription, and cell survival are altered in response to disruption of nuclear lamina, overexpression of mutant or truncated lamins, and loss-of-function mutations of the LMNA gene. Given the diversity of functions affected by these alterations, it is not surprising that complex patterns of tissue-specific pathologies are associated with lamins defects in humans. At present, no mutations in the Lamin B genes have been linked with human diseases, thus presuming that mutations in B-type lamins could be embryonic lethal. Conversely, mutations in the LMNA gene has been directely associated with a variety of human disorders broadly named “laminopathies” that are classified into primary and secondary laminopathies. The primary laminopathies are caused by mutations in the LMNA gene. The secondary ones are caused by mutations in the gene ZMPSTE-24 encoding for the endoprotease FACE-1, enzyme which is required for the post-translational modification of the A-type lamins (Ben et al., 2005). The primary laminopathies are generally classified into five groups. Group 1. This is the most frequent group and concerns diseases of skeletal and cardiac muscle. The first mutations identified in the LMNA gene were those causing Autosomal-Dominant Emery- Dreifuss Muscular Dystrophy (AD-EDMD) (Bonne et al., 1999). LMNA mutations display a wide variability in the severity of the defects produced which could be lethal (Morris, 2001). However, mutations in LMNA could also be responsible for dilated cardiomyopathy with conduction system disease (DCM-CD1) without apparent dystrophy in the skeletal muscles (Fatkin et al., 1999). Limb girdle muscular dystrophy 1B (LGMD1B) is also caused by mutations in LMNA, and is associated

with fewer cardiac complications and tendon contractures (Muchir et al., 2000). The heterogeneity in phenotypes, even among members of a single family carrying the same LMNA mutation, indicates that these disorders represent a spectrum of diseases that may originate from a common genetic alteration and can be successively influenced by environmental factors. To date, diseases affecting striated muscle comprise about 60% of the laminopathies. Considerably, about 50% of patients diagnosed with AD-EDMD or EDMD have mutations in either the emerin (EMD) or LMNA genes (Ben et al., 2005). Group 2. The second group is associated with diseases in white adipose tissue and/or the skeleton, such as Dunnigan-type familial partial lipodystrophy (FPLD) and Mandibuloacral dysplasia (MAD) (Cao and Hegele, 2000) (Novelli et al., 2002). FPLD is inherited as an autosomal- dominant trait mainly associated with a missense mutation of Arg482. FPLD is characterized by an aberrant adipose tissue redistribution that may be a result of an autonomous defect in specific subsets of mesenchymal or adipocyte precursors (Shackleton et al., 2000). Rare autosomal-recessive mutations in the C-terminal domain of A-type lamins are responsible for MAD (Simha et al., 2003). MAD is a disease with many of the metabolic and fat depot redistribution phenotypes of lipodystrophy, but with a wide range of defects including alterations in skeletal development. Group 3. The third group is a single autosomal-recessive mutation in the rod domain of A-type lamins resulting in a peripheral neuropathy associated with demyelination of motor neurons, the Charcot-Marie-Tooth syndrome type 2b (CMT2B1) (Chaouch et al., 2003). Families homozygous for the R298C lamin variant have abolished deep-tendon reflexes, distal amyotrophy, motor deficits, and loss of large myelinated nerve fibers. The muscular weakening associated with this disease is likely a secondary result of loss of enervation and subsequent muscle atrophy. Interestingly, neurons in the sciatic nerve of the LMNA null mice showed extensive demyelination (De Sandre- Giovannoli et al., 2002). Group 4. The fourth group includes the premature aging diseases, Hutchinson Gilford Progeria Syndrome (HGPS) and some cases of atypical Werner syndrome. HGPS is a rare dominantly inherited disease associated with a splicing defect in exon 11 of the LMNA gene causing a 50 amino acid truncation in the Lamin A protein without affecting the Lamin C protein (De Sandre- Giovannoli et al., 2003). The resultant Lamin A mutant has been named Progerin. Patients show symptoms of premature aging, including severe growth retardation, loss of subcutaneous fat, alopecia, reduced bone density, and poor muscle development. The average age of death in HGPS is 12 to 15 years, usually due to severe artherosclerosis resulting in myocardial infarction or stroke (Sarkar and Shinton, 2001). A second premature aging syndrome is the autosomal-recessive 20

inherited Werner syndrome. Most (83%) patients have mutations at the WRN gene codifying for a DNA helicase-exonuclease. A few (15%) but significant number of cases of atypical Werner syndrome shows mutations in LMNA. These atypical patients have short stature, alopecia, osteoporosis, lipodystrophy, diabetes, and muscle atrophy (Chen et al., 2003). Group 5. The fifth group is a heterogeneous group of syndromes comprising overlapping pathologies in different tissues described in the first four groups, suggesting a possible continuum in the mechanisms underlying the laminopathies. To date, over 200 mutations from more than 1000 individuals have been identified in the LMNA gene, and a database on the nuclear envelopathies can be found at http://www.umd.be.

Fig. 1.9 Different mutations in LMNA are associated with different diseases. Most of the mutations resulting in the diseases affecting striated muscles are distributed throughout the gene. The majority of the mutations that result in Mandibuloacral disease, Dunnigan-type familial partial dystrophy, and Hutchinson Gilford Progeria syndrome cluster in the region of the LMNA gene encoding the C-terminal globular domain.

1.2.7 Lamins and cancer

The expression of the A-type lamins is often reduced or absent in subsets of cells with a low degree of differentiation and/or cells that are highly proliferating including human malignancies, particularly leukemias, lymphomas, some skin cancers, including basal cell and squamous cell carcinoma, adenocarcinoma of the stomach and colon, squamous and adenocarcinoma of the esophagus, small cell lung cancer, testicular germ cell tumors and cancerous prostate tissues. (Stadelmann et al., 1990) (Oguchi et al., 2002) (Venables et al., 2001) (Moss et al., 1999) (Broers et al., 1993) (Machiels et al., 1997) (Coradeghini et al., 2006). Altered expression and aberrant localization of A-type lamins often correlate with cancer subtypes and cancer aggressiveness, proliferative capacity and differentiation state. Given that tumor progression is often associated with regression from a more differentiated to a less differentiated state, loss of Lamin A/C expression may not be surprising. Even though the altered lamins expression are currently emerging as an additional event involved in malignant transformation and tumor progression, the role of A-type lamins in the tumorigenesis is not yet characterized and the molecular defect underlying the loss of A-type lamins in human cancer remained unknown. It has been reported that A-type lamins CpG island promoter hypermethylation is a significant predictor of poor outcome in some lymphomas (Agrelo et al., 2005). Cancer may also be considered an epigenetic disease and patterns of aberrant DNA methylation are now recognized to be a common hallmark of human tumors. In fact, transcriptional inactivation by CpG island promoter hypermethylation is a well-established mechanism for gene silencing in human tumors. Since A- type lamins present an important dual role as protector of chromatin from damage and as multifunctional regulators of gene transcription, the epigenetic silencing of LMNA gene in hematologic malignancies could aid understanding as to how lamins dysregulation could contribute to cellular transformation.

2 AIMS

Considering the involvement of Lamin A/C in the tissue differentiation during the embryonal development, the main objective of this work was to investigate whether Lamin A/C could regulate neuroblastoma differentiation. Neuroblastoma is a highly aggresive embryonic tumor of the autonomic nervous system and is the most common extracranial solid cancer in childhood. Moreover, taking into account the significance of differentiation stage in the neuroblastoma tumor progression I intended to identify a role of Lamin A/C in the tumorigenesis of this neuronal cancer and to investigate whether A-type lamins could also represent a marker of drug response. To this aims I chose a neuroblastoma model able to differentiate in vitro and showing high expression levels of Lamin A/C. As differentiating stimulus I used the all-trans retinoic acid, the most effective compound which has been shown to induce differentiation in neuroblastoma cells and that is employed as biological agent in clinics to improve patients‟ survival.

3 MATERIALS AND METHODS

3.1 Cell lines maintenance, differentiation and treatments

Human malignant neuroblastoma (NB) SHSY5Y cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were grown in a 1:1 mixture of Eagle's Minimum Essential Medium and F12 Medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone), 2 mM L-glutamine, 0.5% non- essential amino acids, 0.5% sodium pyruvate and 1% penicillin and streptomycin in a fully- humidified incubator containing 5% CO2 at 37˚C. LAN-5 NB cell line was a gift of Dr. Doriana Fruci and was grown in RPMI-1640 (Gibco, Grand Island, NY, USA) supplemented with 10% FBS, 2 mM L-glutamine, 100 U/L penicillin and 100μg/L streptomycin in a fully-humidified incubator containing 5% CO2 at 37˚C. For differentiation experiments cells were seeded at a density of 5×103 cells/cm2. The following day cells were induced to differentiate by 10 µM retinoic acid (ATRA; Sigma Chemical, St. Louis, MO, USA, named RA throughout the thesis) in a “differentiation medium” composed by 50% fresh and 50% conditioned culture medium. Cells were fed after 3 days with differentiation medium containing fresh RA. RA was dissolved in dimethyl sulfoxide (DMSO, Sigma Chemical, St. Louis, MO, USA) and stored as stock at -80˚C. Because of light sensitivity of RA, all incubations were performed under subdued lighting. The concentration of DMSO in each experiment was always ≤0.01%, which was not toxic and did not induce differentiation. For drugs experiments cells were seeded at a density of 5×103 cells/cm2. Twenty-four hours after plating, fresh medium was added and after further 24 hours (48 hours of growth) cells were treated with different doses of cis-platin (DDP) or etoposide (VP-16), both dissolved in DMSO , for 2 hours.

3.2 Generation of recombinant viruses and lentiviral infection of cells

LMNA-Knock Down SHSY5Y cell line (named miRL) was generated by using a lentiviral expression vector containing a double strand oligo encoding a pre-miRNA sequence as “knockdown cassette” thus enabling the expression of engineered miRNA sequence from Pol II promoters directed versus the LMNA mRNA. The knockdown cassette contains specific miRNA flanking sequences that allow proper processing of the miRNA. The expression vector design is based on the miRNA vector system developed in the laboratory of David Turner (U.S. Patent 24

Publication No. 2004/0053876) and includes the use of endogenous murine miR-155 flanking sequences. The lentiviral expression vector was produced using the BLOCK-iT Lentiviral Pol II miR RNAi Expression System (Invitrogen,, San Giuliano Milanese, Milan, Italy) to obtain from the pcDNA6.2-GW/EmGFP-miR-LMNA (Invitrogen) a Gateway®-adapted lentiviral destination vector (pLenti6/V5-DEST vector) according to the manufacturer‟s instructions. As a negative control we used the pcDNA™6.2-GW/± EmGFP-miR-neg control plasmid that contains an insert that can form a hairpin structure that is processed into mature miRNA, but is predicted not to target any known vertebrate gene. Briefly, to transfer the pre-miRNA cassette (named, LMNA pre-miRNA cassette or Neg CTR pre-miRNA cassette) from pcDNA™6.2- GW/+EmGFP-miR expression clone into pLenti6/V5- DEST vector, we performed two Gateway® recombination reactions as follows. An “entry clone” was generated by performing a BP recombination reaction between the attB substrate (pcDNA™6.2-GW/EmGFP-miR expression clone) and attP substrate (pDONR™221 vector) using BP Clonase™ II Enzyme Mix. Next, an LR recombination reaction between the resulting “entry clone” (attL substrate) and pLenti6/V5-DEST vector (attR substrate) was performed using LR Clonase™ II Enzyme Mix, obtaining the pLenti6/V5-GW/LMNA miRNA and the pLenti6/V5- GW/Neg CTR miRNA expression plasmids. In order to produce lentiviral stocks, these vectors (3 µg) and the ViraPower™ Packaging Mix (9 µg) were cotransfected into 6x106 packaging 293FT cells using Lipofectamine 2000 (Invitrogen Corp), according to the manufacturer‟s instructions. The supernatants were collected after 48 and 72 hours, and used for infection. SHSY5Y cells were seeded into 6-well plates at a concentration of 2×105 cells/well and the following day were infected for 18 hours with virus supernatant from pLenti6/V5-GW/LMNA miRNA or pLenti6/V5-GW/Neg CTR miRNA and then fresh medium was added. After 6 hours cells were subjected to a second round of infection for additional 18 hours. Stably transduced cells were selected by culturing in presence of blasticidin 3 µg/mL (Invitrogen). The transduced cells were screened by western blotting and real-time PCR assays to determine the levels of LMNA expression.

3.3 Western Blot analysis

Cultured cells were washed 2 times with PBS 1X and then incubated 1 min in urea buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris pH 8), scraped, harvested and then briefly sonicated. Proteins were subjected to SDS–polyacrylamide gels electrophoresis. The resolved proteins were blotted overnight to nitrocellulose membranes, which then were blocked in PBS 1X containing 5% non-fat milk for at least 1 hour. Blots were incubated with the following primary anti-human antibodies: anti-lamin A/C polyclonal antibody (N-18; Santa Cruz Biotechnology); anti-tyrosine hydroxyase polyclonal antibody (Cell Signaling); anti-GAPDH monoclonal antibody (6C5, Chemicon). The membranes were then incubated 45 min with the relevant secondary antibody (anti mouse, anti-rabbit or anti-goat IgG) conjugated with Alexa fluor 680 (Invitrogen) or IRDye 800 (LI-COR Biosciences) and analyzed with the Licor Odyssey Infrared Image System in the 700 or 800 nm channel.

3.4 Immunofluorescence microscopy

Cells were seeded on coverglass supports in complete medium and treated with ATRA for the indicated times. Cells fixed with 4% (w/v) paraformaldehyde were permeabilized in PBS containing 0.1% Triton-X100. NF200 was detected using the anti-NF200 monoclonal antibody (N52; Sigma). Alexa Fluor 594 goat anti-mouse was used as secondary antibody. Antibodies were diluted in PBS. The nuclei were stained with 1 mg/ml DAPI for 5 min in PBS. Finally, cells were washed in PBS, briefly rinsed in ddH2O and glasses were mounted in ProLong Gold anti-Fade Reagent (Molecular Probes). Images were acquired through a confocal laser scanning microscope (Leica Confocal Microsystem TCS 566 SP5). Images were processed using Leica Application Suite 6000. Brightness and contrast were adjusted. Figures were generated using Adobe Photoshop 7.0 and Adobe Illustrator 10.

3.5 Total RNA preparation

Cells were seeded in complete medium and after the different treatments were harvested and total RNA was isolated using NucleoSpin RNA II silica columns (Macherey-Nagel). RNA quantity was determined by absorbance at 260 nm using a NanoDrop UV-VIS spectrophotometer. Quality and integrity of each sample was checked using the Agilent BioAnalyzer 2100 (Agilent RNA 6000

Nanokit): samples with a RNA Integrity Number (RIN) index lower than 8.0 were discarded (Schroeder et al., 2006).

3.6 Real‐time RT‐PCR analysis

RNA (500 ng) was retro-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem) according to the manufacturer‟s instructions. Equal amount of cDNA was then subjected to real time PCR analysis with an Applied Biosystems 7900HT thermal cycler, using the SensiMix SYBR Kit (Bioline) and the following specific primers at a concentration of 200 nM:

LMNA (unigene Hs.594444) F: AGCAAAGTGCGTGAGGAGTT and R: AGGTCACCCTCCTTCTTGGT; TH (unigene Hs.435609) F: ACGCCAAGGACAAGCTCA and R: AGCGTGTACGGGTCGAACT; GAPDH (unigene Hs.544577) F: AGCCACATCGCTCAGACA and R: GCCCAATACGACCAAATCC; TBP (unigene Hs.590872) F: GAACATCATGGATCAGAACAACA and R: ATAGGGATTCCGGGAGTCAT; PPIA (unigene Hs.356331) F: ATGCTGGACCCAACACAAAT and R: TCTTTCACTTTGCCAAACACC. Each experiment was done in technical quadruplicates. Expression data were normalized using the Ct values of the internal controls GAPDH, TBP and PPI1A.

3.7 Whole genome expression profiling

The gene expression profiling was performed using the Agilent one-color microarray System (http://www.chem.agilent.com/enUS/Products/Instruments/dnamicroarrays/Pages/default.a spx). Poly A+RNA (500 ng) was retrotranscribed using oligo-dT primers linked to the T7- promoter and the resulting cDNA was used as a template for cyanine 3- CTP labelled cRNA preparation, using the Agilent Low Input Linear Amplification Kit. The labeled cRNA was purified with Qiagen‟s RNeasy mini spin columns. To monitor both the labelling reactions and the microarray performance, Agilent Spike-In Mix was added to the mRNA samples prior to labelling reactions according the RNA Spike-In protocol. Cyanine 3 labelled cRNA were hybridized to Agilent 4x44K whole human genome oligonucleotide microarray (GE2-v4_91). In this library the number of mRNAs is larger than the total number of genes, since in many cases different mRNAs probes (1 to 5) target the same gene. Agilent microarray probes are 60-mer DNA oligonucleotides and contains 41000 unique biological genes and transcripts. Microarray hybridizations were carried out in 27

Agilent‟s SureHyb Hybridization Chambers containing 1650 ng of Cyanine 3-labelled cRNA per hybridization. The hybridization reactions were performed at 65°C for 17 hours using Agilent‟s Gene Expression Hybridization Kit. The hybridized microarrays were disassembled at room temperature in Agilent Gene Expression Wash Buffer 1. After the disassembly, the microarrays were washed in Gene Expression Buffer 1 for one minute at room temperature, followed by washing with Gene Expression Wash Buffer 2 for one minute at 37°C. The microarrays were then treated with acetonitrile for one minute at room temperature. Post-hybridization image acquisition was accomplished using the Agilent Scanner G2564B, equipped with two lasers (532 nm and 635 nm) and a 48 slide auto-sampler carousel. Data extraction from the 20 bits TIFF images was accomplished by Agilent Feature Extraction ver 10.1 software using the standard Agilent one-color gene expression extraction protocol (GE1_107_Sep09). For all the subsequent analysis, the “gProcessedSignal” data column of the output file was used, containing the median signals corrected by spatial and multiplicative detrend. Data filtering was performed in Microsoft Excel using any of the following criteria to discard spots: spots with more than 5% of saturated pixel in any of the two channels, spots with a Signal/Noise ratio smaller than 3 in any of the two channels, where Signal = (median of the spot - median spot background level) and Noise is the Standard Deviation of the median spot background. Differential gene lists were obtained from filtered data using Agilent GeneSpring GX 7.3 and Microsoft Excel. A threshold of 100.0 in the absolute expression level was chosen to obtain a higher stringency. Differentially expressed genes were identified as those showing an average fold change ratio larger than 1.5 and lower than 1/1.5 in the linear scale. Functional annotations of differential gene lists was performed using the DAVID web tool (http://david.abcc.ncifcrf.gov/) (Huang et al., 2009), selecting the following categories both for functional clustering (high stringency) and charts: goterm_bp_4, goterm_bp_5, goterm_cc_4, goterm_cc_5, goterm_mf_4, goterm_mf_5, panther_bp_all, panther_mf_all, interpro, pir_superfamily, smart, panther_family, panther_subfamily, kegg_pathway, panther_pathway, chromosome, cytoband, cog_ontology, sp_pir_keywords, up_seq_feature. Gene clustering analysis was done using MeV 4.4 (MultiExperiment Viewer, TM4 suite , http://www.tm4.org/mev/) (Saeed et al., 2006). Subsets of differential genes associated to specific cancer features were selected, based on the gene annotations in the Cancer Gene Index of the National Cancer Institute (NCI). The database is a file in XML format that can be downloaded from the URL: https://cabig.nci.nih.gov/inventory/data-resources/cancer-gene-index/. The current Index version 28

(June 2009) is a collection of records on about 7000 human genes identified as having an association with cancer, based on data mining of Medline. A gene is included in the database if the name co-occurs in a single Medline sentence with a cancer disease or compound/treatment term found in the NCI Thesaurus. The gene symbols are those defined by the HUGO Gene Nomenclature Committee, and the annotations of Agilent microarray probes are updated to 15 January 2010. We have compiled three gene symbol lists by extracting, from the whole Cancer Gene Index, genes associated to the following three Boolean queries, inserted as Regular Expressions in the search tool of a pure text editor (TextPad): List1: “migration OR invasion OR invasive OR metastasis OR adhesion OR adhesive”; List2: “drug resistance OR drug resistant OR survival OR survive OR sensitive OR sensitivity”; List3: “aggressive OR aggression OR progression OR progressive”. A gene was included in out lists if any of the terms in the corresponding query appeared in the gene annotation records. In particular most of the search terms in these lists appeared within the annotations tags , or . The overlap between the three gene lists is shown in the Venn diagram below.

List1 List2

228 584 514

986 295 210

437

List3

Fig. 3.1 Venn diagram of the three gene lists obtained from the Cancer Gene Database of the National Cancer Institute (NCI). Numbers correspond to gene symbols in the different set regions.

We selected for specific analysis subsets of genes differential in our experiments and with a match in at least one of the three lists List1, List2 or List3.

3.8 Plating Efficiency Assay

One thousand cells were seeded at clonal density on a 35 mm Ø dish in complete medium. After 10 days from seeding, cells were fixed for 1 hour with a solution of 2% methilene blue in 96% ethanol. Dishes were then accurately washed with double distilled H2O and colonies were counted. The number of colonies formed was expressed as percent of colonies with respect of cells seeded. A total of three independent experiments were performed.

3.9 In vitro Cell Migration Assay

The assay was performed in Boyden chambers. Cells (8 x 105 cells/800 µl) were added to the upper chamber in complete medium without FBS. The lower compartment was filled with 200 µl of complete medium containing 10% FBS, or with medium supplemented with 0.1% bovine serum albumin (BSA) to evaluate random migration (negative control). The compartments were separated by an 8-mm pore size polycarbonate filter (Costar Corp., Cambridge, MA), coated with gelatin (5 µg/ml; Sigma, Milan, Italy) for chemotaxis. After incubation for 6 hours in a humidified

5% CO2 atmosphere at 37°C, cells on the upper side of the filter were removed mechanically and cells that had migrated to the lower surface of the filter were fixed in ethanol and stained with crystal violet solution (2% crystal violet, 10% ethanol) for 30 min. Cells were washed twice with distilled water, 200 µL of a 10% acetic acid solution was added, and cells were incubated at room temperature for 1 hour. Absorbance was measured at 570 nm. Each migration was tested in quintuplicate and experiments were repeated at least three times.

3.10 Zymography of Gelatinolytic Activity

Subconfluent cells were incubated for 24 hours in complete medium containing 1% FBS. Supernatants were collected and centrifuged (2000 g, 10 min, 4°C) to remove cellular debris. The conditioned media (CM) of cells were concentrated with Centricon-30 concentrators (Amicon, Danvers, MA). Each sample derived from 4x103 cells was applied to SDS-PAGE on a 10% polyacrylamide gel with 0.2% (w/v) gelatin. Gel electrophoresis was performed under non-reducing conditions without boiling. The gel was rinsed twice for 30 minutes in 2.5% (v/v) Triton X-100 to remove SDS and renature the proteins and incubated with activation buffer (50 mM Tris-HCl pH

7.6; 5 mM CaCl2;1 µM ZnCl2; 1% Triton X-100) overnight at 37°C with constant shaking. The gel

was stained with 0.1% (w/v) Coomassie Brilliant Blue R-250 in 50% (v/v) methanol and 10% (v/v) acetate and then destained in 10% (v/v) methanol and 10% (v/v) acetate. Enzymatic activity was detected as a white band on the resulting blue background of undigested gelatin.

3.11 P-Glycoprotein immunostaining

Cells (106/sample) were washed in Washing Buffer (WB, PBS; 10 mM NaN3; EDTA 0.002%) and purified anti-P-Glycoprotein mouse (4E3.16, Calbiochem) or control IgG, diluted in complete medium at 12.5 μg/mL, were added to samples and incubated for 1 hour on ice. Cells were washed twice with WB and incubated in WB containing goat anti-mouse RPE (Southern Biotec Associates) for 40 min. After washing twice in WB, cells were resuspended in 300 μl of PBS for flow cytometric analysis. Ten thousand events per sample were acquired by using a FACScan cytofluorimeter.

3.12 Calcein/AM Retention Assay

Cells (5x105/sample) were suspended in 1 mL of complete medium and incubated with or without Verapamil (5 µM, Sigma–Aldrich USA) for 30 min at 37 oC. Then cells were washed two times in PBS containing 0.2% BSA to eliminate Verapamil retained in cells. Washed cells were suspended into the same medium and incubated with Calcein/AM (100 nM, Sigma–Aldrich USA) for 20 min at 37 oC. Finally, cells were washed twice in PBS containing 0.2% BSA, cooled to 4 oC and analysed by FACS. Twenty thousand events per sample were acquired by using a FACScan cytofluorimeter.

4 RESULTS

4.1 Silencing of LMNA gene inhibits RA-induced differentiation in SHSY5Y cell line

To investigate whether Lamin A/C could play a role in neuroblastoma differentiation, the SHSY5Y and LAN-5 neuroblastoma cell lines, showing different expression levels of Lamin A/C, were induced to differentiate for 3, 5 and 7 days in response to 10 µM RA. SHSY5Y cells increased the expression of Lamin A/C upon induction with RA as evaluated at protein and mRNA level. Conversely, LAN-5 cells showed barely detectable expression levels of Lamin A/C protein and of LMNA mRNA, with no variation during the induced differentiation (Figure 4.1 A and B).

Fig. 4.1 Increased Lamin A/C expression during RA-induced differentiation in SHSY5Y cell line. A) Levels of Lamin A/C protein in the SHSY5Y and LAN-5 neuroblastoma cell lines untreated or after 10 µM RA treatment for 3, 5 and 7 days (d) as detected by Western blot analysis using anti-Lamin A/C N18 polyclonal antibody. Each lane was loaded with 30 µg of proteins from cell lysate. GAPDH was used as a loading control. The experiment was repeated three times showing similar results. Representative blots are presented. B) Quantitative RT-PCR analysis of LMNA mRNA levels in SHSY5Y (white) and LAN-5 (black) cells untreated or after 10 µM RA treatment for 3, 5 and 7 days. The amounts of LMNA mRNA were normalized to GAPDH housekeeping gene. Data are reported as mRNA quantification relative to SHSY5Y untreated cells and are average of three separate experiments. Bars represent standard deviation. NT, untreated cells.

To gain insight into the function of Lamin A/C in neuroblastoma differentiation, we silenced LMNA gene in SHSY5Y cell line and studied the effects during the differentiation processes. LMNA knock-down was obtained by infecting the cells with a lentiviral vector carrying an artificial miRNA targeting the LMNA mRNA (see Materials and Methods). The LMNA silenced SHSY5Y cells, named miRL cells throughout the thesis, show a reduction in Lamin A/C expression of about 70% compared to control (CTR) cells infected with a control vector (Figure 4.2 A). The reduced Lamin A/C expression resulted in the impairment of neuronal differentiation as indicated by the inhibition of the formation of neuritic processes in miRL compared to CTR cells differentiated for 5 days (Figure 4.2 B).

Fig. 4.2 Silencing of LMNA in SHSY5Y cell line during RA-induced differentiation. A) Levels of Lamin A/C protein in SHSY5Y CTR and miRL cells untreated or after 10 µM RA treatment for 3, 5 and 7 days as detected by Western blot analysis using anti-Lamin A/C N18 polyclonal antibody. Each lane was loaded with 30 µg of proteins from cell lysate. GAPDH was used as a loading control. The experiment was repeated three times showing similar results. A representative blot is presented. B) Inverted light microscope images of CTR and miRL cells untreated or after 10 µM RA treatment for 5 days.

Consistent with the outgrowth inhibition of neurites is the decreased expression in miRL cells of the neuronal differentiation marker Neurofilament-200 (NF200), the intermediate filament that provides structural support for the neuritic processes (Figure 4.3 A). The impairment of differentiation in miRL cells is further confirmed by the loss of induction of the noradrenergic differentiation marker tyrosine hydroxylase (TH), as evaluated by Western blot analysis and qRT- PCR (Figure 4.3 B and C).

Fig. 4.3 Silencing of LMNA impairs the RA-induced differentiation in SHSY5Y cell line. A) Representative confocal images of CTR and miRL cells untreated (NT) or after 10 µM RA treatment for 5 days, immunostained with anti-NF200 N52 monoclonal antibody (red) and with the DNA dye DAPI (blue). B) Levels of tyrosine hydroxylase (TH) protein in CTR and miRL cells NT or after 10 µM RA treatment for 3 and 5 days as detected by using anti-TH polyclonal antibody. Each lane was loaded with 30 µg of proteins from cell lysate. GAPDH was used as a loading control. The experiment was repeated three times showing similar results. A representative blot is presented. B) Quantitative RT-PCR analysis of TH mRNA levels in CTR (white) and miRL (black) cells untreated or after 10 µM RA treatment for 1 and 2 days. The amounts of TH mRNA were normalized to GAPDH housekeeping gene. Data are reported as mRNA quantification relative to CTR NT cells and are average of three separate experiments. Bars represent standard deviation.

4.2 Gene expression profiling of SHSY5Y CTR and miRL cells reveals an impairment of differentiation

To get insight into the impairment of cell differentiation produced by the LMNA silencing in SHSY5Y cells, we compared the gene expression profile of CTR and miRL cells both in RA treated and untreated cells, using the Agilent microarray technology. As concerns the gene expression profiling in the two cell lines during the differentiation, it was determined at day 5 of RA treatment. A hierarchical cluster of expression data was obtained from the one-color microarray experiment (Figure 4.4). The set used for clustering is composed by the 1801 genes that are modulated at least 1.5 fold by retinoic acid in both CTR and miRL cells (see intersection set in the next Figure 4.5 A). The 4 columns correspond to the four samples. As expected, the sample tree on the top shows that the untreated and the RA treated samples behave differently, since the two untreated samples and the two RA treated ones cluster together in couple. To investigate the differential gene expression between CTR and miRL RA-treated cells we defined two sets of genes obtained comparing RA-treated samples with untreated ones in CTR (CTR RA/CTR NT), or in miRL (miRL RA/miRL NT ) cells. The Venn diagram in Figure 4.5 shows that 1782 genes are modulated by RA only in CTR cells, with 247 up-regulated genes and 1535 down-regulated genes, while 1131 are the genes modulated only in miRL cells, with 694 up- regulated and 437 down-regulated genes. A number of 1801 genes are regulated during RA induction independently of LMNA expression both in CTR and in miRL cells. To gain more insights into the possible mechanisms underlying differential gene expression patterns, functional analysis of differential gene lists was performed by the DAVID web tool, to find statistically over-represented functional groups. The main statistically significant (p < 0.05) functional categories modulated during differentiation in CTR cells are listed in Table 1, among them “nervous system development” for up-regulated genes and , “DNA replication”, “nuclear division” and “regulation of cell cycle” for down-regulated genes. Similarly, the main statistically significant (p < 0.05) functional categories modulated by RA only in miRL cells are listed in Table 2: the list includes “metallothionein”, “cell migration” and “angiogenesis” for up-regulated genes and “nervous system development”, “neurogenesis” and “generation of neurons” for down- regulated genes.

Fig. 4.4 Hierarchical cluster of expression data obtained from the one-color microarray experiment. The set used for clustering is composed by the 1801 genes that show an average ratio in the linear scale either greater than 1.5 or smaller than 1/1.5, both for (miRL RA/miRL NT) and (CTR RA/CTR NT) ratios (see intersection set in light grey in Fig. 4.5A). Each gene is visualized as a single row and each sample is represented by a single column. Euclidean distance, with average linkage, is the metric used for clustering. The rainbow color scale indicate the Log2 absolute expression of the genes, with lighter colors noting higher levels of expression, where the color scale ranges from 15.0 to 7.0 as shown in the scale bar on the right of the figure. Only microarray probes with official gene symbol annotation were used. CTR, SHSY5Y control cells; miRL, LMNA silenced SHSY5Y cells; RA 5d, RA treated cells for 5 days.

Fig. 4.5 Venn diagram and histograms of the sets of differentially expressed genes between CTR e miRL cells after RA treatment. Venn diagram of two sets of differentially expressed genes, showing an average relative ratio greater than 1.5 or smaller than 1/1.5 in the linear scale: the CTR* set, obtained comparing RA-treated samples with untreated (NT) ones in CTR cells, (CTR RA /CTR NT) ratio, is composed by a total of 3583 genes, while the miRL* set, obtained comparing RA-treated samples with NT ones in miRL cells, (miRL RA/miRL NT) ratio, is composed by a total of 2932 genes. The {CTR*-miRL*} set, in white, is composed by 1782 genes modulated by RA only in CTR cells, with 247 up-regulated genes and 1535 down-regulated genes. The {miRL*-CTR*} set, in dark grey, is composed by 1131genes modulated by RA only in miRL cells, with 694 up-regulated and 437 down-regulated genes. In the two histograms, up-regulated genes are in red and down-regulated genes are in green.

4.3 The impairment of cell differentiation in LMNA silenced SHSY5Y cells is associated with increased tumor progression

Since undifferentiated neuroblastoma tumors are related to a worse clinical outcome we have studied whether the impairment of cell differentiation occurred in LMNA silenced cells could be associated to a more aggressive phenotype. We first compared the expression profiles of undifferentiated CTR and miRL cells. The genes whose expression was down-regulated by LMNA silencing were 636, while those whose expression was up-regulated were only 100 (Table 3). In order to deeper investigate a possible link between Lamin A/C and tumor progression we defined a list of genes associated to specific cancer features (e.g. metastasis, drug resistance, and tumor progression) obtained using the Cancer Gene Index database of the NCI. Comparing the whole gene expression profile of miRL cells versus CTR cells to the gene annotations in the Cancer Gene Index, we found a differential expression in 43 genes (15 up-regulated and 28 down-regulated) which were related to the more aggressive phenotype. Among these we found down-regulated tumor suppressor genes (H19, TSPAN13, APC2, INHBA, SYK, TFAP2B, SPRY2, FHIT, NEURL, KISS1R, SP100, PTCH1, CASP2) and up-regulated metalloproteases (MMP9, MMP15), angiogenic factors (ENPP2) and metastases-associated genes (MALAT1, ETV5, CTHRC1) (Fig. 4.6 and Supplementary table S.1). We then investigated how such gene modifications could affect some biological features which are characteristic of a more aggressive tumor phenotype. First, we studied the clonogenic ability of the CTR and miRL SHSY5Y cell lines by evaluating the plating efficiency of the two cell lines. An increase of more than 50% in the ability to form colonies was obtained in the miRL compared to the CTR cells (Figure 4.7 A). As second point we analyzed the motility of the two cell lines, since an increase of this cell function is strictly associated to the tumor progression. Silencing of LMNA gene significantly increases the migration activity of SHSY5Y cells in response to FBS 10% as compared to the CTR cells. Whereas, migration in the absence of chemoattractant (negative control) is limited (Figure 4.7 B). Tumor progression involves also the acquisition by tumor cells of the capability to degrade the basement membrane thus invading the surrounding environment and, in general, remodeling the extracellular matrix. Thus we examined whether LMNA silencing could lead to an increased protease secretion by the tumor cells. In the zymographic analysis of the conditioned media from SHSY5Y cells, lower levels of secreted 72-kDa gelatinase (also designed MMP2) were found in CTR than in miRL cell cultures (Figure 4.7 C).

Fig. 4.6 Relative expression of tumor aggressiveness related genes in miRL versus CTR cells. Directional fold change values for a subset of genes, related to tumor aggressiveness, identified in microarray experiment as either up- regulated (red bars) or down-regulated (green bars), when comparing LMNA silenced SHSY5Y cells versus CTR cells. Gene symbols are indicated on the left (specifications are reported in Supplementary Tables S.1). The fold-change (fc) values are in the linear scale. To visualize changes relative to the down-regulated genes, they were converted in negative values using the formula (-1/fc). This gene set was selected according to the annotations in the NCI Cancer Gene Index database, combining specific gene lists obtained from the database (see Materials and Methods). 39

Fig. 4.7 Silencing of LMNA induces a more aggressive tumor phenotype in SHSY5Y line. A) Plating efficiency of CTR and miRL cells referred as percent of colonies formed 10 days after seeding. B) Migration assay in CTR and miRL cells. Single cell suspensions in DMEM supplemented with 0.1% BSA were incubated for 6 hours on top of gelatin- coated filters. The migration was evaluated by filling the lower compartment with medium containing 10% Fetal Bovine Serum (FBS). DMEM supplemented with 0.1% BSA was used as negative control to evaluate random migration. C) Analysis of metalloproteases secretion in CTR and miRL cells. Conditioned media of both cell lines, incubated for 48 hours in medium containing 1% FBS, were collected and analyzed for gelatin zymography. Equivalent amounts of proteins were loaded. White bands against a dark background correspond to the gelatinolytic areas of MMP2 (72 kDa) activity. Below is reported the densitometric quantification of the bands.

4.4 Low levels of Lamin A/C expression are associated with increased resistance to chemotherapeutic agents

Since tumor progression is generally associated with a reduced cellular ability to respond to antineoplastic treatments, we also investigated whether A-type lamins could represent a marker of sensitiveness to conventional antitumoral therapy. Therefore we studied the effect of Cisplatin (DDP) and Etoposide (VP-16) drugs on the cell survival of CTR and miRL SHSY5Y cell lines. Colony formation ability was assayed after treating the cells with different doses of the two drugs. Silencing of LMNA resulted in a significant increase of cell survival values for both compounds (Figure 4.8 A). This increased drug resistance in LMNA silenced cells is consistent with the augmented expression of the efflux/conditional transporter P-glycoprotein (Pgp), that belongs to the ABCB subgroup of the ATPBinding-Cassette (ABC) transporter superfamily and is known to confer resistance to a broad variety of structurally unrelated chemotherapeutic agents and to restrict bioavailability of many therapeutic drugs in experimental models (Figure 4.8 B). The increase in Pgp expression at the cell surface resulted in higher Pgp functional activity as assessed by alterations in calcein accumulation, a probe which is widely used to evaluate Pgp functionality (Figure 4.8 C). Thus the larger amounts of Pgp detected by flow cytometry in miRL cells are likely to represent quantity of Pgp available for drug efflux.

Fig. 4.8 Silencing of LMNA is associated with increased resistance to chemotherapeutic agents. A) Effect of cisplatin (DDP; left panel) or etoposide (VP-16; right panel) in CTR and miRL cells as evaluated by colony forming assay. Cell survival data are reported as percent of control and are average of three different experiments with similar results. Bars represent standard deviation. Black square, miRL; open diamond, CTR. B) Flow cytometry analysis of Pgp expression as evaluated by immunofluorescence using a monoclonal antibody recognizing an external epitope of the Pgp. In the left panel are reported the flow cytometry histograms of negative control (Neg, mouse IgG), CTR and miRL cells after immunostaining. In the right panel are reported the Pgp positive cells in the CTR and miRL samples relative to the negative control. C) Pgp functionality using calcein assay. Calcein mean fluorescence values in each sample were referred to the relative control. Verapamil 10 µM was used as competitive inhibitor of the Pgp function to obtain a directed increase of calcein uptake. Data are average of three different experiments with similar results. Bars represent standard deviations.

5 DISCUSSION

We studied the effect of Lamin A/C down-regulation on the differentiation processes of neuroblastoma cells. The degree of neuroblastoma differentiation has been related with a favorable prognosis of the patients. However, the mechanisms governing such differentiation are only partially understood. The ability of many neuroblastoma cell lines to activate neuronal differentiation in vitro in the presence of various agents, such as retinoids, allowed studying key differentiation properties of neuroblastoma cells which are in common with primary neurons. Our working hypothesis came from an initial observation that various neuroblastoma cell lines express different levels of Lamin A/C protein. Among the cell lines able to differentiate we then chose the noradrenergic neuroblastoma cell line (SHSY5Y) with the highest expression of Lamin A/C, and we silenced the LMNA gene codifying for Lamin A/C in order to study the effects on the differentiation of such cells. Our results show that silencing of LMNA in SHSY5Y cells inhibited their ability to differentiate and gave rise to a more aggressive tumor phenotype thus demonstrating a central role of Lamin A/C in the neuroblastoma tumor differentiation and progression. We show that Lamin A/C expression increases in SHSY5Y cells during the differentiation program induced by retinoic acid. Our results are in agreement with different studies on the early development of Xenopus as well as of Drosophila and chicken embryos showing that the nuclear lamina composition correlate with major programs in cell differentiation (Stick and Hausen, 1985) (Lehner et al., 1987) (Riemer et al., 1995). Also in mammals various authors showed that the expression of A-type lamins is regulated according to developmental stage of tissue differentiation (Benavente et al., 1985) (Guilly et al., 1990) (Rober et al., 1989) (Mattia et al., 1992) (Lin and Worman, 1997). In addition, in a more recent study Constantinescu and colleagues showed that Lamin A/C expression is an early indicator of embryonal stem cell differentiation (Constantinescu et al., 2006). In particular, it has been recognized as marker of muscle and adipocyte differentiation (Favreau et al., 2003) (Frock et al., 2006) (Lloyd et al., 2002). For the first time we demonstrate that Lamin A/C is necessary for the differentiation of neuroblastoma tumor cells. Indeed, silencing the LMNA gene in SHSY5Y cells produced the inhibition of the differentiation program as firstly evidenced by the reduced cellular ability to form mature neurites. In fact, neurites are normally outgrown from neurons functional networks connecting neurons each other through synapses and allow the interneuronal transmission of electrical or chemical signals thus rendering differentiated neurons one of the main functional cell type of the nervous system. Further confirmation of the differentiation impairment is represented by

the decreased levels of the rate-limiting enzyme in noradrenalin synthesis, tyrosine hydroxylase (TH). In fact, as also reported by Kume and colleagues undifferentiated noradrenergic SHSY5Y cells cannot produce noradrenalin because they do not express TH (Kume et al., 2008). Consistent with the inhibition of cell differentiation occurred in LMNA silenced cells are the data from the gene expression profiling. Microarrays allowed us to measure the expression of thirty-one thousand genes. Among them we first chose those genes that are co-modulated by a differentiation stimulus in CTR and miRL cells and we correlated them basing on hierarchical clustering. This approach allowed us to group together the untreated or retinoic acid treated cells evidencing a good clusterization of microarray data with the cellular response to a differentiation stimulus. Even though the LMNA silenced cells did not differentiate, it is likely that the signaling pathway engaged by retinoic acid is generally still functioning in miRL cells. Their different response to the differentiating agent could be ascribed to reduced activity of Lamin A/C in various pathways related to transcription, preventing the expression of genes necessary for the completion of the differentiation program. In fact, Lamin A/C functions as nucleoplasmic scaffold in both anchoring chromatin to the nuclear lamina and organizing RNA polymerase II transcriptional complexes (Dorner et al., 2007; Vlcek and Foisner, 2007; Reddy et al., 2008); as well as Lamin A/C could interact with some transcription factors (Andres and Gonzalez, 2009). Noteworthy, the expression of the genes codifying for retinoic acid receptors are not changed in LMNA silenced cells further supporting our hypothesis. Extending the analysis to the genes differentially changed in response to retinoic acid we evidenced a strongly reduced number of down-regulated genes in miRL compared to CTR cells. Consistent with the inhibition of cell differentiation in miRL cells is the down-regulation of genes which belong to the DAVID functional categories such as „nervous system development‟, „neurogenesis‟, „generation of neurons‟, further confirming that LMNA silencing impair neuronal differentiation. On the other hand, in CTR cells most of the down-regulated genes belong to „regulation of cell cycle‟ and „nuclear division‟ categories, confirming that these cells exited from the cell cycle and acquired the propensity to differentiate. This is also evident analyzing the genes mainly up-regulated in response to retinoic acid in CTR cells, most of them belonging to the „nervous system development‟ category. One of our additional goals was to identify a small subset of genes that are most diagnostic of sample differences. Analyzing the DAVID functional annotation of the up-regulated genes in miRL cells exposed to retinoic acid it is evident that the LMNA silenced cells respond to the differentiating agent by increasing the expression of genes related to tumor progression (e.g. „cell 44

migration‟ and „angiogenesis‟ categories) and not principally to differentiation as one could have expected giving a differentiation stimulus. Indeed, focusing on the two cell lines not induced to differentiate we clearly demonstrated the expression of a more aggressive phenotype in the miRL cells compared to CTR, evidencing the up-regulation of genes related to cancer progression (metalloproteases, angiogenic factors, and metastases-associated gene) and the down-regulation of tumor suppressor genes, demonstrating that Lamin A/C contributes to maintain normal cellular processes. We also demonstrated that alterations of such genes expression resulted in modifications of some biological behaviors. In fact, consistent with the increased expression of metalloproteases or metastases associated genes, is an augmented ability of the cells to positively respond to a migratory stimulus and to increase the secretion of MMP2, with a consequent higher proteolytic activity of miRL cells. The more aggressive phenotype elicited by the LMNA silenced cells correlates with a higher resistance to antitumoral chemotherapic treatments. Generally, a more differentiated tumor phenotype is less aggressive and determines a favorable patient‟s outcome due to its higher sensitivity to drugs. The greater drug resistance elicited by miRL cells is in part to be ascribed to the increased expression levels of the multidrug-related efflux pump P-glycoprotein (Pgp). In fact, the Pgp could be responsible of a reduced intracellular drug amount as indicated by the decreased intracellular calcein accumulation, widely used as fluorescent probe to assay membrane permeability (Karaszi et al., 2001). However, no modification in the expression of genes codifying for Pgp has been observed strongly indicating that a posttranslational event have been occurred to regulate this protein expression. Indeed, very recent papers reported about the cellular processes involved in the posttranslational regulation of cellular transport protein such as the ATP- binding cassette Pgp (Yoo et al., 2010) (Titapiwatanakun and Murphy, 2009). In conclusion, in agreement with other authors (Prokocimer et al., 2006) (Agrelo et al., 2005) (Stadelmann et al., 1990) (Oguchi et al., 2002) (Venables et al., 2001) (Moss et al., 1999) (Broers et al., 1993) (Machiels et al., 1997) (Coradeghini et al., 2006), our data clearly demonstrate that low levels of Lamin A/C expression are associated with poor tumor differentiation and augmented tumor progression determining a more aggressive phenotype. The characterization of neuroblastoma tumors on the basis of A-type lamins expression may provide information about the response of an individual patient‟s tumor to proposed therapy, allowing the development of new therapeutic strategies based on a rational use of the drugs depending on the molecular profile of the individual tumor. A-types lamins could represent a good marker of tumor progression and of sensitiveness to conventional antitumoral therapeutics.

6 BIBLIOGRAPHY

Adolph,K.W. (1987). ADPribosylation of nuclear proteins labeled with [3H]adenosine: changes during the HeLa cycle. Biochim. Biophys. Acta 909, 222-230.

Aebi,U., Cohn,J., Buhle,L., and Gerace,L. (1986). The nuclear lamina is a meshwork of intermediate-type filaments. Nature 323, 560-564.

Agrelo,R., Setien,F., Espada,J., Artiga,M.J., Rodriguez,M., Perez-Rosado,A., Sanchez-Aguilera,A., Fraga,M.F., Piris,M.A., and Esteller,M. (2005). Inactivation of the lamin A/C gene by CpG island promoter hypermethylation in hematologic malignancies, and its association with poor survival in nodal diffuse large B-cell lymphoma. J. Clin. Oncol. 23, 3940-3947.

Anderson,D.J. (1997). Cellular and molecular biology of neural crest cell lineage determination. Trends Genet. 13, 276-280.

Andres,V. and Gonzalez,J.M. (2009). Role of A-type lamins in signaling, transcription, and chromatin organization. J. Cell Biol. 187, 945-957.

Arora,P., Muralikrishna,B., and Parnaik,V.K. (2004). Cell-type-specific interactions at regulatory motifs in the first intron of the lamin A gene. FEBS Lett. 568, 122-128.

Bechert,K., Lagos-Quintana,M., Harborth,J., Weber,K., and Osborn,M. (2003). Effects of expressing lamin A mutant protein causing Emery-Dreifuss muscular dystrophy and familial partial lipodystrophy in HeLa cells. Exp. Cell Res. 286, 75-86.

Beck,B.H. and Welch,D.R. (2010). The KISS1 metastasis suppressor: a good night kiss for disseminated cancer cells. Eur. J. Cancer 46, 1283-1289.

Ben,Y.R., Muchir,A., Arimura,T., Massart,C., Demay,L., Richard,P., and Bonne,G. (2005). Genetics of laminopathies. Novartis. Found. Symp. 264, 81-90.

Benavente,R., Krohne,G., and Franke,W.W. (1985). Cell type-specific expression of nuclear lamina proteins during development of Xenopus laevis. Cell 41, 177-190.

Bi,X., Tong,C., Dockendorff,A., Bancroft,L., Gallagher,L., Guzman,G., Iozzo,R.V., Augenlicht,L.H., and Yang,W. (2008). Genetic deficiency of decorin causes intestinal tumor formation through disruption of intestinal cell maturation. Carcinogenesis 29, 1435-1440.

Bjerkvig,R., Tysnes,B.B., Aboody,K.S., Najbauer,J., and Terzis,A.J. (2005). Opinion: the origin of the cancer stem cell: current controversies and new insights. Nat. Rev. Cancer 5, 899-904.

Bonne,G., Di Barletta,M.R., Varnous,S., Becane,H.M., Hammouda,E.H., Merlini,L., Muntoni,F., Greenberg,C.R., Gary,F., Urtizberea,J.A., Duboc,D., Fardeau,M., Toniolo,D., and Schwartz,K. (1999). Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat. Genet. 21, 285-288.

Brodeur,G.M. (2003). Neuroblastoma: biological insights into a clinical enigma. Nat. Rev. Cancer 3, 203- 216.

Broers,J.L., Ramaekers,F.C., Bonne,G., Yaou,R.B., and Hutchison,C.J. (2006). Nuclear lamins: laminopathies and their role in premature ageing. Physiol Rev. 86, 967-1008. 46

Broers,J.L., Raymond,Y., Rot,M.K., Kuijpers,H., Wagenaar,S.S., and Ramaekers,F.C. (1993). Nuclear A- type lamins are differentially expressed in human lung cancer subtypes. Am. J. Pathol. 143, 211-220.

Cao,H. and Hegele,R.A. (2000). Nuclear lamin A/C R482Q mutation in canadian kindreds with Dunnigan- type familial partial lipodystrophy. Hum. Mol. Genet. 9, 109-112.

Capasso,M., Devoto,M., Hou,C., Asgharzadeh,S., Glessner,J.T., Attiyeh,E.F., Mosse,Y.P., Kim,C., Diskin,S.J., Cole,K.A., Bosse,K., Diamond,M., Laudenslager,M., Winter,C., Bradfield,J.P., Scott,R.H., Jagannathan,J., Garris,M., McConville,C., London,W.B., Seeger,R.C., Grant,S.F., Li,H., Rahman,N., Rappaport,E., Hakonarson,H., and Maris,J.M. (2009). Common variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat. Genet. 41, 718-723.

Capasso,M. and Diskin,S.J. (2010). Genetics and genomics of neuroblastoma. Cancer Treat. Res. 155, 65-84.

Chaouch,M., Allal,Y., De Sandre-Giovannoli,A., Vallat,J.M., Amer-el-Khedoud,A., Kassouri,N., Chaouch,A., Sindou,P., Hammadouche,T., Tazir,M., Levy,N., and Grid,D. (2003). The phenotypic manifestations of autosomal recessive axonal Charcot-Marie-Tooth due to a mutation in Lamin A/C gene. Neuromuscul. Disord. 13, 60-67.

Chen,L., Lee,L., Kudlow,B.A., Dos Santos,H.G., Sletvold,O., Shafeghati,Y., Botha,E.G., Garg,A., Hanson,N.B., Martin,G.M., Mian,I.S., Kennedy,B.K., and Oshima,J. (2003). LMNA mutations in atypical Werner's syndrome. Lancet 362, 440-445.

Ciccarone,V., Spengler,B.A., Meyers,M.B., Biedler,J.L., and Ross,R.A. (1989). Phenotypic diversification in human neuroblastoma cells: expression of distinct neural crest lineages. Cancer Res. 49, 219-225.

Constantinescu,D., Gray,H.L., Sammak,P.J., Schatten,G.P., and Csoka,A.B. (2006). Lamin A/C expression is a marker of mouse and human embryonic stem cell differentiation. Stem Cells 24, 177-185.

Coradeghini,R., Barboro,P., Rubagotti,A., Boccardo,F., Parodi,S., Carmignani,G., D'Arrigo,C., Patrone,E., and Balbi,C. (2006). Differential expression of nuclear lamins in normal and cancerous prostate tissues. Oncol. Rep. 15, 609-613.

Corrigan,D.P., Kuszczak,D., Rusinol,A.E., Thewke,D.P., Hrycyna,C.A., Michaelis,S., and Sinensky,M.S. (2005). Prelamin A endoproteolytic processing in vitro by recombinant Zmpste24. Biochem. J. 387, 129-138.

Crisp,M., Liu,Q., Roux,K., Rattner,J.B., Shanahan,C., Burke,B., Stahl,P.D., and Hodzic,D. (2006). Coupling of the nucleus and cytoplasm: role of the LINC complex. J. Cell Biol. 172, 41-53. de Blaquiere,G.E., May,F.E., and Westley,B.R. (2009). Increased expression of both insulin receptor substrates 1 and 2 confers increased sensitivity to IGF-1 stimulated cell migration. Endocr. Relat Cancer 16, 635-647.

De Sandre-Giovannoli,A., Bernard,R., Cau,P., Navarro,C., Amiel,J., Boccaccio,I., Lyonnet,S., Stewart,C.L., Munnich,A., Le,M.M., and Levy,N. (2003). Lamin a truncation in Hutchinson-Gilford progeria. Science 300, 2055.

De Sandre-Giovannoli,A., Chaouch,M., Kozlov,S., Vallat,J.M., Tazir,M., Kassouri,N., Szepetowski,P., Hammadouche,T., Vandenberghe,A., Stewart,C.L., Grid,D., and Levy,N. (2002). Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot-Marie-Tooth disorder type 2) and mouse. Am. J. Hum. Genet. 70, 726-736.

De,B.M., Castellino,R.C., Lu,X.Y., Deyo,J., Sturla,L.M., Adesina,A.M., Perlaky,L., Pomeroy,S.L., Lau,C.C., Man,T.K., Rao,P.H., and Kim,J.Y. (2006). Medulloblastoma outcome is adversely associated with overexpression of EEF1D, RPL30, and RPS20 on the long arm of chromosome 8. BMC. Cancer 6, 223.

Dechat,T., Korbei,B., Vaughan,O.A., Vlcek,S., Hutchison,C.J., and Foisner,R. (2000). Lamina-associated polypeptide 2alpha binds intranuclear A-type lamins. J. Cell Sci. 113 Pt 19, 3473-3484.

Dessev,G., Iovcheva,C., Tasheva,B., and Goldman,R. (1988). Protein kinase activity associated with the nuclear lamina. Proc. Natl. Acad. Sci. U. S. A 85, 2994-2998.

Dhe-Paganon,S., Werner,E.D., Chi,Y.I., and Shoelson,S.E. (2002). Structure of the globular tail of nuclear lamin. J. Biol. Chem. 277, 17381-17384.

Dorner,D., Gotzmann,J., and Foisner,R. (2007). Nucleoplasmic lamins and their interaction partners, LAP2alpha, Rb, and BAF, in transcriptional regulation. FEBS J. 274, 1362-1373.

Edsjo,A., Holmquist,L., and Pahlman,S. (2007). Neuroblastoma as an experimental model for neuronal differentiation and hypoxia-induced tumor cell dedifferentiation. Semin. Cancer Biol. 17, 248-256.

Ellis,D.J., Jenkins,H., Whitfield,W.G., and Hutchison,C.J. (1997). GST-lamin fusion proteins act as dominant negative mutants in Xenopus egg extract and reveal the function of the lamina in DNA replication. J. Cell Sci. 110 ( Pt 20), 2507-2518.

Estecha,A., Sanchez-Martin,L., Puig-Kroger,A., Bartolome,R.A., Teixido,J., Samaniego,R., and Sanchez- Mateos,P. (2009). Moesin orchestrates cortical polarity of melanoma tumour cells to initiate 3D invasion. J. Cell Sci. 122, 3492-3501.

Farias,E.F., Ong,D.E., Ghyselinck,N.B., Nakajo,S., Kuppumbatti,Y.S., and Lopez,R. (2005). Cellular retinol- binding protein I, a regulator of breast epithelial retinoic acid receptor activity, cell differentiation, and tumorigenicity. J. Natl. Cancer Inst. 97, 21-29.

Fatkin,D., MacRae,C., Sasaki,T., Wolff,M.R., Porcu,M., Frenneaux,M., Atherton,J., Vidaillet,H.J., Jr., Spudich,S., De,G.U., Seidman,J.G., Seidman,C., Muntoni,F., Muehle,G., Johnson,W., and McDonough,B. (1999). Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N. Engl. J. Med. 341, 1715-1724.

Favreau,C., Dubosclard,E., Ostlund,C., Vigouroux,C., Capeau,J., Wehnert,M., Higuet,D., Worman,H.J., Courvalin,J.C., and Buendia,B. (2003). Expression of lamin A mutated in the carboxyl-terminal tail generates an aberrant nuclear phenotype similar to that observed in cells from patients with Dunnigan-type partial lipodystrophy and Emery-Dreifuss muscular dystrophy. Exp. Cell Res. 282, 14-23.

Favreau,C., Higuet,D., Courvalin,J.C., and Buendia,B. (2004). Expression of a mutant lamin A that causes Emery-Dreifuss muscular dystrophy inhibits in vitro differentiation of C2C12 myoblasts. Mol. Cell Biol. 24, 1481-1492.

Ferraro,A., Eufemi,M., Cervoni,L., Marinetti,R., and Turano,C. (1989). Glycosylated forms of nuclear lamins. FEBS Lett. 257, 241-246.

Francastel,C., Schubeler,D., Martin,D.I., and Groudine,M. (2000). Nuclear compartmentalization and gene activity. Nat. Rev. Mol. Cell Biol. 1, 137-143.

Frock,R.L., Kudlow,B.A., Evans,A.M., Jameson,S.A., Hauschka,S.D., and Kennedy,B.K. (2006). Lamin A/C and emerin are critical for skeletal muscle satellite cell differentiation. Genes Dev. 20, 486-500.

Furukawa,K. and Hotta,Y. (1993). cDNA cloning of a germ cell specific lamin B3 from mouse spermatocytes and analysis of its function by ectopic expression in somatic cells. EMBO J. 12, 97-106.

Furukawa,K., Inagaki,H., and Hotta,Y. (1994). Identification and cloning of an mRNA coding for a germ cell-specific A-type lamin in mice. Exp. Cell Res. 212, 426-430.

Furukawa,K. and Kondo,T. (1998). Identification of the lamina-associated-polypeptide-2-binding domain of B-type lamin. Eur. J. Biochem. 251, 729-733.

Gee,J.M., Robertson,J.F., Ellis,I.O., Nicholson,R.I., and Hurst,H.C. (1999). Immunohistochemical analysis reveals a tumour suppressor-like role for the transcription factor AP-2 in invasive breast cancer. J. Pathol. 189, 514-520.

Gerace,L. and Burke,B. (1988). Functional organization of the nuclear envelope. Annu. Rev. Cell Biol. 4, 335-374.

Giacinti,C. and Giordano,A. (2006). RB and cell cycle progression. Oncogene 25, 5220-5227.

Goldberg,M., Harel,A., Brandeis,M., Rechsteiner,T., Richmond,T.J., Weiss,A.M., and Gruenbaum,Y. (1999). The tail domain of lamin Dm0 binds histones H2A and H2B. Proc. Natl. Acad. Sci. U. S. A 96, 2852-2857.

Goldman,R.D., Goldman,A.E., and Shumaker,D.K. (2005). Nuclear lamins: building blocks of nuclear structure and function. Novartis. Found. Symp. 264, 3-16.

Goss,V.L., Hocevar,B.A., Thompson,L.J., Stratton,C.A., Burns,D.J., and Fields,A.P. (1994). Identification of nuclear beta II protein kinase C as a mitotic lamin kinase. J. Biol. Chem. 269, 19074-19080.

Greene,N.D. and Copp,A.J. (2009). Development of the vertebrate central nervous system: formation of the neural tube. Prenat. Diagn. 29, 303-311.

Guha,M., Xia,F., Raskett,C.M., and Altieri,D.C. (2010). Caspase 2-mediated tumor suppression involves survivin gene silencing. Oncogene 29, 1280-1292.

Guilly,M.N., Kolb,J.P., Gosti,F., Godeau,F., and Courvalin,J.C. (1990). Lamins A and C are not expressed at early stages of human lymphocyte differentiation. Exp. Cell Res. 189, 145-147.

Gunduz,E., Gunduz,M., Beder,L., Nagatsuka,H., Fukushima,K., Sutcu,R., Delibas,N., Yamanaka,N., Shimizu,K., and Nagai,N. (2009). Downregulation of TESTIN and its association with cancer history and a tendency toward poor survival in head and neck squamous cell carcinoma. Arch. Otolaryngol. Head Neck Surg. 135, 254-260.

Guo,F., Li,Y., Liu,Y., Wang,J., Li,Y., and Li,G. (2010). Inhibition of metastasis-associated lung adenocarcinoma transcript 1 in CaSki human cervical cancer cells suppresses cell proliferation and invasion. Acta Biochim. Biophys. Sin. (Shanghai) 42, 224-229.

Handler,A., Lobo,M.D., Alonso,F.J., Paino,C.L., and Mena,M.A. (2000). Functional implications of the noradrenergic-cholinergic switch induced by retinoic acid in NB69 neuroblastoma cells. J. Neurosci. Res. 60, 311-320.

Haque,F., Lloyd,D.J., Smallwood,D.T., Dent,C.L., Shanahan,C.M., Fry,A.M., Trembath,R.C., and Shackleton,S. (2006). SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Mol. Cell Biol. 26, 3738-3751.

Harper,K., Arsenault,D., Boulay-Jean,S., Lauzier,A., Lucien,F., and Dubois,C.M. (2010). Autotaxin promotes cancer invasion via the lysophosphatidic acid receptor 4: participation of the cyclic AMP/EPAC/Rac1 signaling pathway in invadopodia formation. Cancer Res. 70, 4634-4643.

Hedborg,F., Bjelfman,C., Sparen,P., Sandstedt,B., and Pahlman,S. (1995). Biochemical evidence for a mature phenotype in morphologically poorly differentiated neuroblastomas with a favourable outcome. Eur. J. Cancer 31A, 435-443.

Hill,D.P. and Robertson,K.A. (1997). Characterization of the cholinergic neuronal differentiation of the human neuroblastoma cell line LA-N-5 after treatment with retinoic acid. Brain Res. Dev. Brain Res. 102, 53-67.

Hirschmann-Jax,C., Foster,A.E., Wulf,G.G., Nuchtern,J.G., Jax,T.W., Gobel,U., Goodell,M.A., and Brenner,M.K. (2004). A distinct "side population" of cells with high drug efflux capacity in human tumor cells. Proc. Natl. Acad. Sci. U. S. A 101, 14228-14233.

Hoehner,J.C., Hedborg,F., Eriksson,L., Sandstedt,B., Grimelius,L., Olsen,L., and Pahlman,S. (1998). Developmental gene expression of sympathetic nervous system tumors reflects their histogenesis. Lab Invest 78, 29-45.

Holgren,C., Dougherty,U., Edwin,F., Cerasi,D., Taylor,I., Fichera,A., Joseph,L., Bissonnette,M., and Khare,S. (2010). Sprouty-2 controls c-Met expression and metastatic potential of colon cancer cells: sprouty/c-Met upregulation in human colonic adenocarcinomas. Oncogene 29, 5241-5253.

Hong,S.B., Oh,H., Valera,V.A., Stull,J., Ngo,D.T., Baba,M., Merino,M.J., Linehan,W.M., and Schmidt,L.S. (2010). Tumor suppressor FLCN inhibits tumorigenesis of a FLCN-null renal cancer cell line and regulates expression of key molecules in TGF-beta signaling. Mol. Cancer 9, 160.

Houben,F., Ramaekers,F.C., Snoeckx,L.H., and Broers,J.L. (2007). Role of nuclear lamina-cytoskeleton interactions in the maintenance of cellular strength. Biochim. Biophys. Acta 1773, 675-686.

Huang,H., Sossey-Alaoui,K., Beachy,S.H., and Geradts,J. (2007). The tetraspanin superfamily member NET-6 is a new tumor suppressor gene. J. Cancer Res. Clin. Oncol. 133, 761-769.

Hubner,S., Eam,J.E., Hubner,A., and Jans,D.A. (2006). Laminopathy-inducing lamin A mutants can induce redistribution of lamin binding proteins into nuclear aggregates. Exp. Cell Res. 312, 171-183.

Janaki,R.M. and Parnaik,V.K. (2006). An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein. Biochem. Biophys. Res. Commun. 348, 1132-1137.

Johnson,B.R., Nitta,R.T., Frock,R.L., Mounkes,L., Barbie,D.A., Stewart,C.L., Harlow,E., and Kennedy,B.K. (2004). A-type lamins regulate retinoblastoma protein function by promoting subnuclear localization and preventing proteasomal degradation. Proc. Natl. Acad. Sci. U. S. A 101, 9677-9682.

Kao,Y.R., Shih,J.Y., Wen,W.C., Ko,Y.P., Chen,B.M., Chan,Y.L., Chu,Y.W., Yang,P.C., Wu,C.W., and Roffler,S.R. (2003). Tumor-associated antigen L6 and the invasion of human lung cancer cells. Clin. Cancer Res. 9, 2807-2816.

Karaszi,E., Jakab,K., Homolya,L., Szakacs,G., Hollo,Z., Telek,B., Kiss,A., Rejto,L., Nahajevszky,S., Sarkadi,B., and Kappelmayer,J. (2001). Calcein assay for multidrug resistance reliably predicts therapy response and survival rate in acute myeloid leukaemia. Br. J. Haematol. 112, 308-314.

Karst,A.M., Dai,D.L., Martinka,M., and Li,G. (2005). PUMA expression is significantly reduced in human cutaneous melanomas. Oncogene 24, 1111-1116.

Kennedy,B.K., Barbie,D.A., Classon,M., Dyson,N., and Harlow,E. (2000). Nuclear organization of DNA replication in primary mammalian cells. Genes Dev. 14, 2855-2868.

Ketema,M., Wilhelmsen,K., Kuikman,I., Janssen,H., Hodzic,D., and Sonnenberg,A. (2007). Requirements for the localization of nesprin-3 at the nuclear envelope and its interaction with plectin. J. Cell Sci. 120, 3384-3394.

Kume,T., Kawato,Y., Osakada,F., Izumi,Y., Katsuki,H., Nakagawa,T., Kaneko,S., Niidome,T., Takada- Takatori,Y., and Akaike,A. (2008). Dibutyryl cyclic AMP induces differentiation of human neuroblastoma SH-SY5Y cells into a noradrenergic phenotype. Neurosci. Lett. 443, 199-203.

LaBonne,C. and Bronner-Fraser,M. (1999). Molecular mechanisms of neural crest formation. Annu. Rev. Cell Dev. Biol. 15, 81-112.

Lammerding,J. and Lee,R.T. (2005). The nuclear membrane and mechanotransduction: impaired nuclear mechanics and mechanotransduction in lamin A/C deficient cells. Novartis. Found. Symp. 264, 264-273.

Layton,T., Stalens,C., Gunderson,F., Goodison,S., and Silletti,S. (2009). Syk tyrosine kinase acts as a pancreatic adenocarcinoma tumor suppressor by regulating cellular growth and invasion. Am. J. Pathol. 175, 2625-2636.

Lehner,C.F., Stick,R., Eppenberger,H.M., and Nigg,E.A. (1987). Differential expression of nuclear lamin proteins during chicken development. J. Cell Biol. 105, 577-587.

Li,C., Einhorn,P.A., and Reynolds,C.P. (1994). Expression of retinoic acid receptors alpha, beta, and gamma in human neuroblastoma cell lines. Prog. Clin. Biol. Res. 385, 221-227.

Lin,F. and Worman,H.J. (1997). Expression of nuclear lamins in human tissues and cancer cell lines and transcription from the promoters of the lamin A/C and B1 genes. Exp. Cell Res. 236, 378-384.

Liu,Z., Li,L., Yang,Z., Luo,W., Li,X., Yang,H., Yao,K., Wu,B., and Fang,W. (2010). Increased expression of MMP9 is correlated with poor prognosis of nasopharyngeal carcinoma. BMC. Cancer 10, 270.

Lloyd,D.J., Trembath,R.C., and Shackleton,S. (2002). A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies. Hum. Mol. Genet. 11, 769-777.

Machiels,B.M., Ramaekers,F.C., Kuijpers,H.J., Groenewoud,J.S., Oosterhuis,J.W., and Looijenga,L.H. (1997). Nuclear lamin expression in normal testis and testicular germ cell tumours of adolescents and adults. J. Pathol. 182, 197-204.

Machiels,B.M., Zorenc,A.H., Endert,J.M., Kuijpers,H.J., van Eys,G.J., Ramaekers,F.C., and Broers,J.L. (1996). An alternative splicing product of the lamin A/C gene lacks exon 10. J. Biol. Chem. 271, 9249-9253.

Mahller,Y.Y., Williams,J.P., Baird,W.H., Mitton,B., Grossheim,J., Saeki,Y., Cancelas,J.A., Ratner,N., and Cripe,T.P. (2009). Neuroblastoma cell lines contain pluripotent tumor initiating cells that are susceptible to a targeted oncolytic virus. PLoS. One. 4, e4235.

Mancini,M.A., Shan,B., Nickerson,J.A., Penman,S., and Lee,W.H. (1994). The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein. Proc. Natl. Acad. Sci. U. S. A 91, 418-422.

Margalit,A., Neufeld,E., Feinstein,N., Wilson,K.L., Podbilewicz,B., and Gruenbaum,Y. (2007). Barrier to autointegration factor blocks premature cell fusion and maintains adult muscle integrity in C. elegans. J. Cell Biol. 178, 661-673.

Maris,J.M., Mosse,Y.P., Bradfield,J.P., Hou,C., Monni,S., Scott,R.H., Asgharzadeh,S., Attiyeh,E.F., Diskin,S.J., Laudenslager,M., Winter,C., Cole,K.A., Glessner,J.T., Kim,C., Frackelton,E.C., Casalunovo,T., Eckert,A.W., Capasso,M., Rappaport,E.F., McConville,C., London,W.B., Seeger,R.C., Rahman,N., Devoto,M., Grant,S.F., Li,H., and Hakonarson,H. (2008). Chromosome 6p22 locus associated with clinically aggressive neuroblastoma. N. Engl. J. Med. 358, 2585-2593.

Marshall,W.F. and Sedat,J.W. (1999). Nuclear architecture. Results Probl. Cell Differ. 25, 283-301.

Matthay,K.K., Villablanca,J.G., Seeger,R.C., Stram,D.O., Harris,R.E., Ramsay,N.K., Swift,P., Shimada,H., Black,C.T., Brodeur,G.M., Gerbing,R.B., and Reynolds,C.P. (1999). Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. Children's Cancer Group. N. Engl. J. Med. 341, 1165-1173.

Mattia,E., Hoff,W.D., den,B.J., Meijne,A.M., Stuurman,N., and van,R.J. (1992). Induction of nuclear lamins A/C during in vitro-induced differentiation of F9 and P19 embryonal carcinoma cells. Exp. Cell Res. 203, 449-455.

Mattout,A., Goldberg,M., Tzur,Y., Margalit,A., and Gruenbaum,Y. (2007). Specific and conserved sequences in D. melanogaster and C. elegans lamins and histone H2A mediate the attachment of lamins to chromosomes. J. Cell Sci. 120, 77-85.

Mattsson,J.M., Laakkonen,P., Stenman,U.H., and Koistinen,H. (2009). Antiangiogenic properties of prostate-specific antigen (PSA). Scand. J. Clin. Lab Invest 69, 447-451.

Mohammad,M.A., Ismael,N.R., Shaarawy,S.M., and El-Merzabani,M.M. (2010). Prognostic value of membrane type 1 and 2 matrix metalloproteinase expression and gelatinase A activity in bladder cancer. Int. J. Biol. Markers 25, 69-74.

Moir,R.D., Montag-Lowy,M., and Goldman,R.D. (1994). Dynamic properties of nuclear lamins: lamin B is associated with sites of DNA replication. J. Cell Biol. 125, 1201-1212.

Moir,R.D., Spann,T.P., Herrmann,H., and Goldman,R.D. (2000). Disruption of nuclear lamin organization blocks the elongation phase of DNA replication. J. Cell Biol. 149, 1179-1192.

Morris,G.E. (2001). The role of the nuclear envelope in Emery-Dreifuss muscular dystrophy. Trends Mol. Med. 7, 572-577.

Moss,S.F., Krivosheyev,V., de,S.A., Chin,K., Gaetz,H.P., Chaudhary,N., Worman,H.J., and Holt,P.R. (1999). Decreased and aberrant nuclear lamin expression in gastrointestinal tract neoplasms. Gut 45, 723-729.

Mosse,Y.P., Laudenslager,M., Khazi,D., Carlisle,A.J., Winter,C.L., Rappaport,E., and Maris,J.M. (2004). Germline PHOX2B mutation in hereditary neuroblastoma. Am. J. Hum. Genet. 75, 727-730.

Mosse,Y.P., Laudenslager,M., Longo,L., Cole,K.A., Wood,A., Attiyeh,E.F., Laquaglia,M.J., Sennett,R., Lynch,J.E., Perri,P., Laureys,G., Speleman,F., Kim,C., Hou,C., Hakonarson,H., Torkamani,A., Schork,N.J., Brodeur,G.M., Tonini,G.P., Rappaport,E., Devoto,M., and Maris,J.M. (2008). Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 455, 930-935.

Muchir,A., Bonne,G., van der Kooi,A.J., van,M.M., Baas,F., Bolhuis,P.A., de,V.M., and Schwartz,K. (2000). Identification of mutations in the gene encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy with atrioventricular conduction disturbances (LGMD1B). Hum. Mol. Genet. 9, 1453-1459.

Muchir,A., van Engelen,B.G., Lammens,M., Mislow,J.M., McNally,E., Schwartz,K., and Bonne,G. (2003). Nuclear envelope alterations in fibroblasts from LGMD1B patients carrying nonsense Y259X heterozygous or homozygous mutation in lamin A/C gene. Exp. Cell Res. 291, 352-362.

Muralikrishna,B., Dhawan,J., Rangaraj,N., and Parnaik,V.K. (2001). Distinct changes in intranuclear lamin A/C organization during myoblast differentiation. J. Cell Sci. 114, 4001-4011.

Nakamura,M., Shimada,K., and Konishi,N. (2008). The role of HRK gene in human cancer. Oncogene 27 Suppl 1, S105-S113.

Negorev,D.G., Vladimirova,O.V., Kossenkov,A.V., Nikonova,E.V., Demarest,R.M., Capobianco,A.J., Showe,M.K., Rauscher,F.J., III, Showe,L.C., and Maul,G.G. (2010). Sp100 as a potent tumor suppressor: accelerated senescence and rapid malignant transformation of human fibroblasts through modulation of an embryonic stem cell program. Cancer Res. 70, 9991-10001.

Novelli,G., Muchir,A., Sangiuolo,F., Helbling-Leclerc,A., D'Apice,M.R., Massart,C., Capon,F., Sbraccia,P., Federici,M., Lauro,R., Tudisco,C., Pallotta,R., Scarano,G., Dallapiccola,B., Merlini,L., and Bonne,G. (2002). Mandibuloacral dysplasia is caused by a mutation in LMNA-encoding lamin A/C. Am. J. Hum. Genet. 71, 426-431.

Oguchi,M., Sagara,J., Matsumoto,K., Saida,T., and Taniguchi,S. (2002). Expression of lamins depends on epidermal differentiation and transformation. Br. J. Dermatol. 147, 853-858.

Okuducu,A.F., Janzen,V., Ko,Y., Hahne,J.C., Lu,H., Ma,Z.L., Albers,P., Sahin,A., Wellmann,A., Scheinert,P., and Wernert,N. (2005). Cellular retinoic acid-binding protein 2 is down-regulated in prostate cancer. Int. J. Oncol. 27, 1273-1282.

Okumura,K., Hosoe,Y., and Nakajima,N. (2004). c-Jun and Sp1 family are critical for retinoic acid induction of the lamin A/C retinoic acid-responsive element. Biochem. Biophys. Res. Commun. 320, 487-492.

Okumura,K., Nakamachi,K., Hosoe,Y., and Nakajima,N. (2000). Identification of a novel retinoic acid- responsive element within the lamin A/C promoter. Biochem. Biophys. Res. Commun. 269, 197-202.

Osouda,S., Nakamura,Y., de Saint,P.B., McConnell,M., Horigome,T., Sugiyama,S., Fisher,P.A., and Furukawa,K. (2005). Null mutants of Drosophila B-type lamin Dm(0) show aberrant tissue differentiation rather than obvious nuclear shape distortion or specific defects during cell proliferation. Dev. Biol. 284, 219- 232.

Ottaviano,Y. and Gerace,L. (1985). Phosphorylation of the nuclear lamins during interphase and mitosis. J. Biol. Chem. 260, 624-632.

Ozaki,T., Saijo,M., Murakami,K., Enomoto,H., Taya,Y., and Sakiyama,S. (1994). Complex formation between lamin A and the retinoblastoma gene product: identification of the domain on lamin A required for its interaction. Oncogene 9, 2649-2653.

Padmakumar,V.C., Libotte,T., Lu,W., Zaim,H., Abraham,S., Noegel,A.A., Gotzmann,J., Foisner,R., and Karakesisoglou,I. (2005). The inner nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope. J. Cell Sci. 118, 3419-3430.

Pahlman,S., Ruusala,A.I., Abrahamsson,L., Mattsson,M.E., and Esscher,T. (1984). Retinoic acid-induced differentiation of cultured human neuroblastoma cells: a comparison with phorbolester-induced differentiation. Cell Differ. 14, 135-144.

Pajerowski,J.D., Dahl,K.N., Zhong,F.L., Sammak,P.J., and Discher,D.E. (2007). Physical plasticity of the nucleus in stem cell differentiation. Proc. Natl. Acad. Sci. U. S. A 104, 15619-15624.

Pelletier,L., Rebouissou,S., Paris,A., Rathahao-Paris,E., Perdu,E., Bioulac-Sage,P., Imbeaud,S., and Zucman-Rossi,J. (2010). Loss of hepatocyte nuclear factor 1alpha function in human hepatocellular adenomas leads to aberrant activation of signaling pathways involved in tumorigenesis. Hepatology 51, 557- 566.

Prasad,P.D., Stanton,J.A., and Assinder,S.J. (2010). Expression of the actin-associated protein transgelin (SM22) is decreased in prostate cancer. Cell Tissue Res. 339, 337-347.

Prokocimer,M., Margalit,A., and Gruenbaum,Y. (2006). The nuclear lamina and its proposed roles in tumorigenesis: projection on the hematologic malignancies and future targeted therapy. J. Struct. Biol. 155, 351-360.

Reddy,K.L., Zullo,J.M., Bertolino,E., and Singh,H. (2008). Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature 452, 243-247.

Riemer,D., Stuurman,N., Berrios,M., Hunter,C., Fisher,P.A., and Weber,K. (1995). Expression of Drosophila lamin C is developmentally regulated: analogies with vertebrate A-type lamins. J. Cell Sci. 108 ( Pt 10), 3189-3198.

Rober,R.A., Weber,K., and Osborn,M. (1989). Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 105, 365- 378.

Ross,R.A., Spengler,B.A., Rettig,W.J., and Biedler,J.L. (1994). Differentiation-inducing agents stably convert human neuroblastoma I-type cells to neuroblastic (N) or nonneuronal (S) neural crest cells. Prog. Clin. Biol. Res. 385, 253-259.

Rusinol,A.E. and Sinensky,M.S. (2006). Farnesylated lamins, progeroid syndromes and farnesyl transferase inhibitors. J. Cell Sci. 119, 3265-3272.

Sakashita,K., Tanaka,F., Zhang,X., Mimori,K., Kamohara,Y., Inoue,H., Sawada,T., Hirakawa,K., and Mori,M. (2008). Clinical significance of ApoE expression in human gastric cancer. Oncol. Rep. 20, 1313- 1319.

Santos,A.M., Jung,J., Aziz,N., Kissil,J.L., and Pure,E. (2009). Targeting fibroblast activation protein inhibits tumor stromagenesis and growth in mice. J. Clin. Invest 119, 3613-3625.

Sarkar,P.K. and Shinton,R.A. (2001). Hutchinson-Guilford progeria syndrome. Postgrad. Med. J. 77, 312- 317.

Sasse,B., Aebi,U., and Stuurman,N. (1998). A tailless Drosophila lamin Dm0 fragment reveals lateral associations of dimers. J. Struct. Biol. 123, 56-66.

Schatten,G., Maul,G.G., Schatten,H., Chaly,N., Simerly,C., Balczon,R., and Brown,D.L. (1985). Nuclear lamins and peripheral nuclear antigens during fertilization and embryogenesis in mice and sea urchins. Proc. Natl. Acad. Sci. U. S. A 82, 4727-4731.

Schirmer,E.C. and Foisner,R. (2007). Proteins that associate with lamins: many faces, many functions. Exp. Cell Res. 313, 2167-2179.

Schroeder,A., Mueller,O., Stocker,S., Salowsky,R., Leiber,M., Gassmann,M., Lightfoot,S., Menzel,W., Granzow,M., and Ragg,T. (2006). The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC. Mol. Biol. 7, 3.

Schumacher,J., Reichenzeller,M., Kempf,T., Schnolzer,M., and Herrmann,H. (2006). Identification of a novel, highly variable amino-terminal amino acid sequence element in the nuclear intermediate filament protein lamin B(2) from higher vertebrates. FEBS Lett. 580, 6211-6216.

Seeger,R.C., Brodeur,G.M., Sather,H., Dalton,A., Siegel,S.E., Wong,K.Y., and Hammond,D. (1985). Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N. Engl. J. Med. 313, 1111-1116.

Senda,T., Shimomura,A., and Iizuka-Kogo,A. (2005). Adenomatous polyposis coli (Apc) tumor suppressor gene as a multifunctional gene. Anat. Sci. Int. 80, 121-131.

Shackleton,S., Lloyd,D.J., Jackson,S.N., Evans,R., Niermeijer,M.F., Singh,B.M., Schmidt,H., Brabant,G., Kumar,S., Durrington,P.N., Gregory,S., O'Rahilly,S., and Trembath,R.C. (2000). LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat. Genet. 24, 153-156.

Shankar,J., Messenberg,A., Chan,J., Underhill,T.M., Foster,L.J., and Nabi,I.R. (2010). Pseudopodial actin dynamics control epithelial-mesenchymal transition in metastatic cancer cells. Cancer Res. 70, 3780-3790.

Shimizu,M., Shimamura,M., Owaki,T., Asakawa,M., Fujita,K., Kudo,M., Iwakura,Y., Takeda,Y., Luster,A.D., Mizuguchi,J., and Yoshimoto,T. (2006). Antiangiogenic and antitumor activities of IL-27. J. Immunol. 176, 7317-7324.

Sidell,N. (1982). Retinoic acid-induced growth inhibition and morphologic differentiation of human neuroblastoma cells in vitro. J. Natl. Cancer Inst. 68, 589-596.

Simha,V., Agarwal,A.K., Oral,E.A., Fryns,J.P., and Garg,A. (2003). Genetic and phenotypic heterogeneity in patients with mandibuloacral dysplasia-associated lipodystrophy. J. Clin. Endocrinol. Metab 88, 2821-2824.

Singh,S.K., Hawkins,C., Clarke,I.D., Squire,J.A., Bayani,J., Hide,T., Henkelman,R.M., Cusimano,M.D., and Dirks,P.B. (2004). Identification of human brain tumour initiating cells. Nature 432, 396-401.

Spann,T.P., Goldman,A.E., Wang,C., Huang,S., and Goldman,R.D. (2002). Alteration of nuclear lamin organization inhibits RNA polymerase II-dependent transcription. J. Cell Biol. 156, 603-608.

Stadelmann,B., Khandjian,E., Hirt,A., Luthy,A., Weil,R., and Wagner,H.P. (1990). Repression of nuclear lamin A and C gene expression in human acute lymphoblastic leukemia and non-Hodgkin's lymphoma cells. Leuk. Res. 14, 815-821.

Stewart,C. and Burke,B. (1987). Teratocarcinoma stem cells and early mouse embryos contain only a single major lamin polypeptide closely resembling lamin B. Cell 51, 383-392.

Stick,R. and Hausen,P. (1985). Changes in the nuclear lamina composition during early development of Xenopus laevis. Cell 41, 191-200.

Sullivan,T., Escalante-Alcalde,D., Bhatt,H., Anver,M., Bhat,N., Nagashima,K., Stewart,C.L., and Burke,B. (1999). Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147, 913-920.

Takai,D., Yagi,Y., Wakazono,K., Ohishi,N., Morita,Y., Sugimura,T., and Ushijima,T. (2001). Silencing of HTR1B and reduced expression of EDN1 in human lung cancers, revealed by methylation-sensitive representational difference analysis. Oncogene 20, 7505-7513.

Takamori,Y., Tamura,Y., Kataoka,Y., Cui,Y., Seo,S., Kanazawa,T., Kurokawa,K., and Yamada,H. (2007). Differential expression of nuclear lamin, the major component of nuclear lamina, during neurogenesis in two germinal regions of adult rat brain. Eur. J. Neurosci. 25, 1653-1662.

Tang,L., Dai,D.L., Su,M., Martinka,M., Li,G., and Zhou,Y. (2006). Aberrant expression of collagen triple helix repeat containing 1 in human solid cancers. Clin. Cancer Res. 12, 3716-3722.

Teider,N., Scott,D.K., Neiss,A., Weeraratne,S.D., Amani,V.M., Wang,Y., Marquez,V.E., Cho,Y.J., and Pomeroy,S.L. (2010). Neuralized1 causes apoptosis and downregulates Notch target genes in medulloblastoma. Neuro. Oncol. 12, 1244-1256.

Thiele,C.J., Deutsch,L.A., and Israel,M.A. (1988). The expression of multiple proto-oncogenes is differentially regulated during retinoic acid induced maturation of human neuroblastoma cell lines. Oncogene 3, 281-288.

Thompson,L.J., Bollen,M., and Fields,A.P. (1997). Identification of protein phosphatase 1 as a mitotic lamin phosphatase. J. Biol. Chem. 272, 29693-29697.

Titapiwatanakun,B. and Murphy,A.S. (2009). Post-transcriptional regulation of auxin transport proteins: cellular trafficking, protein phosphorylation, protein maturation, ubiquitination, and membrane composition. J. Exp. Bot. 60, 1093-1107.

Ungerer,C., Doberstein,K., Burger,C., Hardt,K., Boehncke,W.H., Bohm,B., Pfeilschifter,J., Dummer,R., Mihic-Probst,D., and Gutwein,P. (2010). ADAM15 expression is downregulated in melanoma metastasis compared to primary melanoma. Biochem. Biophys. Res. Commun. 401, 363-369.

Van Berlo,J.H., Voncken,J.W., Kubben,N., Broers,J.L., Duisters,R., van Leeuwen,R.E., Crijns,H.J., Ramaekers,F.C., Hutchison,C.J., and Pinto,Y.M. (2005). A-type lamins are essential for TGF-beta1 induced PP2A to dephosphorylate transcription factors. Hum. Mol. Genet. 14, 2839-2849.

Vaughan,A., Alvarez-Reyes,M., Bridger,J.M., Broers,J.L., Ramaekers,F.C., Wehnert,M., Morris,G.E., Whitfield,W.G.F., and Hutchison,C.J. (2001). Both emerin and lamin C depend on lamin A for localization at the nuclear envelope. J. Cell Sci. 114, 2577-2590.

Venables,R.S., McLean,S., Luny,D., Moteleb,E., Morley,S., Quinlan,R.A., Lane,E.B., and Hutchison,C.J. (2001). Expression of individual lamins in basal cell carcinomas of the skin. Br. J. Cancer 84, 512-519.

Vergnes,L., Peterfy,M., Bergo,M.O., Young,S.G., and Reue,K. (2004). Lamin B1 is required for mouse development and nuclear integrity. Proc. Natl. Acad. Sci. U. S. A 101, 10428-10433.

Verstraeten,V.L., Broers,J.L., Ramaekers,F.C., and van Steensel,M.A. (2007). The nuclear envelope, a key structure in cellular integrity and gene expression. Curr. Med. Chem. 14, 1231-1248.

Villablanca,J.G., Krailo,M.D., Ames,M.M., Reid,J.M., Reaman,G.H., and Reynolds,C.P. (2006). Phase I trial of oral fenretinide in children with high-risk solid tumors: a report from the Children's Oncology Group (CCG 09709). J. Clin. Oncol. 24, 3423-3430.

Vlcek,S. and Foisner,R. (2007). A-type lamin networks in light of laminopathic diseases. Biochim. Biophys. Acta 1773, 661-674.

Wali,A. (2010). FHIT: doubts are clear now. ScientificWorldJournal. 10, 1142-1151.

Walton,J.D., Kattan,D.R., Thomas,S.K., Spengler,B.A., Guo,H.F., Biedler,J.L., Cheung,N.K., and Ross,R.A. (2004). Characteristics of stem cells from human neuroblastoma cell lines and in tumors. Neoplasia. 6, 838- 845.

Warren,D.T., Zhang,Q., Weissberg,P.L., and Shanahan,C.M. (2005). Nesprins: intracellular scaffolds that maintain cell architecture and coordinate cell function? Expert. Rev. Mol. Med. 7, 1-15.

Wiche,G. (1998). Role of plectin in cytoskeleton organization and dynamics. J. Cell Sci. 111 ( Pt 17), 2477- 2486.

Wu,M. and Ho,S.M. (2004). PMP24, a gene identified by MSRF, undergoes DNA hypermethylation- associated gene silencing during cancer progression in an LNCaP model. Oncogene 23, 250-259.

Wu,S.H., Zhang,J., Li,Y., and Li,J.M. (2006). [Expression of ETV5 and MMP-7 in early stage cervical squamous cell carcinoma and its role in lymphatic metastasis]. Ai. Zheng. 25, 315-319.

Yasuoka,H., Yamaguchi,Y., and Feghali-Bostwick,C.A. (2009). The pro-fibrotic factor IGFBP-5 induces lung fibroblast and mononuclear cell migration. Am. J. Respir. Cell Mol. Biol. 41, 179-188.

Ye,Q. and Worman,H.J. (1994). Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane. J. Biol. Chem. 269, 11306-11311.

Yoo,B.K., Chen,D., Su,Z.Z., Gredler,R., Yoo,J., Shah,K., Fisher,P.B., and Sarkar,D. (2010). Molecular mechanism of chemoresistance by astrocyte elevated gene-1. Cancer Res. 70, 3249-3258.

Yoshimizu,T., Miroglio,A., Ripoche,M.A., Gabory,A., Vernucci,M., Riccio,A., Colnot,S., Godard,C., Terris,B., Jammes,H., and Dandolo,L. (2008). The H19 locus acts in vivo as a tumor suppressor. Proc. Natl. Acad. Sci. U. S. A 105, 12417-12422.

You,S., Zhou,J., Chen,S., Zhou,P., Lv,J., Han,X., and Sun,Y. (2010). PTCH1, a receptor of Hedgehog signaling pathway, is correlated with metastatic potential of colorectal cancer. Ups. J. Med. Sci. 115, 169- 175.

Yuen,H.F., Chan,Y.P., Cheung,W.L., Wong,Y.C., Wang,X., and Chan,K.W. (2008). The prognostic significance of BMP-6 signaling in prostate cancer. Mod. Pathol. 21, 1436-1443.

Zhang,Y.Q. and Sarge,K.D. (2008). Sumoylation regulates lamin A function and is lost in lamin A mutants associated with familial cardiomyopathies. J. Cell Biol. 182, 35-39.

Zhou,M., Liu,Z., Zhao,Y., Ding,Y., Liu,H., Xi,Y., Xiong,W., Li,G., Lu,J., Fodstad,O., Riker,A.I., and Tan,M. (2010). MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J. Biol. Chem. 285, 21496-21507.

APPENDIX

Table 1. Functional analysis of differential gene lists performed by the DAVID web tool showing statistically over-represented functional groups in {CTR*-miRL*} .

{CTR*-miRL*} up-regulated genes Category Term Count % PValue Genes SP_PIR_KEYWORDS protein transport 14 5,738 5,79E-03 SNX18 SEC31B ZMAT3 CCDC91 RAB11FIP2 TOM1L2 BCAP29 AAGAB CEP290 RAB6B APPBP2 ERC1 TNPO1 JAKMIP1 GOTERM_BP_4 GO:0006325~chromatin organization 12 4,918 1,27E-02 TSPYL1 CHD9 TBL1XR1 RSF1 HIRA HDAC10 NAP1L3 JMJD1C SETD2 BAZ2A SMARCA2 TCF7L1 GOTERM_BP_4 GO:0007399~nervous system development 23 9,426 3,29E-02 TWSG1 ADAM23 ALDH5A1 FMR1 CNP REST ITM2B PCDHB10 TIMP3 APLP2 TGFB2 BBS1 NAV2 BAX SEMA4C NPTN CNTN2 CEP290 FOXC1 NRSN1 KCNQ2 CLN8 KALRN

{CTR*-miRL*} down-regulated genes Category Term Count % PValue Genes KEGG_PATHWAY hsa03040:Spliceosome 46 3,061 1,45E-18 CHERP CCDC12 NHP2L1 TRA2B U2AF2 SNRPB2 SNRPD1 HSPA1A SF3B2 CTNNBL1 PRPF19 HSPA1L HNRNPA3 SF3B1 SFRS7 DDX46 PCBP1 PRPF8 USP39 LSM5 MAGOHB LSM4 LSM3 SNRNP70 HNRNPC LSM2 ACIN1 DHX8 EFTUD2 SFRS13A SFRS1 SF3A2 SF3A1 RBMX SFRS3 HNRNPU PRPF6 SNRPB SNRPA PHF5A SNRPF THOC3 SNRPE TXNL4A SNRPG BAT1

GOTERM_BP_4 GO:0000280~nuclear division 48 3,194 5,37E-10 AURKA PTTG2 CDCA8 RAD21 OIP5 TARDBP INCENP CDCA2 NUP37 CDCA3 ANAPC1 ANAPC2 RAN SGOL1 UBE2I UBE2C DCTN1 NCAPD2 DCLRE1A CHMP1A HAUS8 PPP5C HAUS6 FZR1 CCDC99 HAUS1 TIPIN ANLN CEP55 KIAA1009 TUBB NUMA1 BUB1 PBRM1 BUB3 PINX1 BGLAP CDC23 CDC20 PMF1 LOC442308 MIS12 CCNB1 FSD1 NOLC1 PLK1 CENPV SETD8 C13ORF34 TXNL4A

GOTERM_BP_4 GO:0050658~RNA transport 26 1,730 1,40E-07 NUP98 NUP160 EIF5A NUP93 NUP188 NUP214 RAE1 DDX19B NUP210 NPM1 MAGOHB NUP37 TPR NUP35 PABPN1 RANBP17 NUP88 RAN SFRS13A SMG1 NUP85 NUP155 DDX39 NUP205 THOC3 BAT1

GOTERM_MF_5 GO:0034062~RNA polymerase activity 12 0,798 1,62E-04 POLRMT POLR2F POLR3K POLR2J POLR2I POLR3A POLR1B POLR2D MED21 POLR2C POLR3B POLR3E GOTERM_BP_5 GO:0006260~DNA replication 31 2,063 4,15E-04 ING5 HMGB1 NUP98 LIN9 HUS1 NAP1L1 TIPIN RPA3 TK1 RPA1 TOP1 MCM8 POLE3 POLM ATRIP PINX1 CCDC88A NOL8 CINP RFC3 ORC3L RFC1 RRM2 NCOA6 TOP3A ORC5L PTMS RBM14 CHAF1B DUT MED1

GOTERM_BP_5 GO:0006281~DNA repair 38 2,528 3,68E-03 RAD23B HMGB1 RAD51C HUS1 PTTG2 RPA3 PRPF19 HSPA1L RPA1 FANCL FANCM MUTYH RAD21 SETMAR H2AFX FANCG ATRIP NTHL1 RTEL1 WDR33 FANCB NUDT1 SMG1 XRCC6BP1 RFC3 DCLRE1A RFC1 TDP1 GADD45G NCOA6 RAD18 RUVBL2 RBM14 OGG1 PARP2 CHAF1B BTBD12 BARD1

GOTERM_CC_5 GO:0000792~heterochromatin 10 0,665 4,46E-03 SUZ12 PCGF2 SIN3B INCENP TRIM28 H2AFX MBD3 TOP2B CBX5 TCP1P3 GOTERM_BP_4 GO:0051726~regulation of cell cycle 41 2,728 7,14E-03 CCNT2 CKS1B FZR1 ZAK HUS1 LOC389842 STAT5B TIPIN RPS15A ANLN BOP1 CASP3 BCL2 NPM1 BUB1 AATF H2AFX FANCG TPR SIK1 INSR ATRIP BUB3 ANAPC2 GTPBP4 GMNN CDC23 CDKN3 UBE2C CDK4 PKIA PTPN11 CCNB1 CDKN1C PRKCQ CHMP1A MAD2L1BP GADD45G TSC2 CKS2 RBM38

GOTERM_BP_4 GO:0051253~negative regulation of RNA metabolic process 44 2,927 7,32E-03 HMGB1 HMX1 HAT1 PAX4 GLI2 VPS72 CBX5 RPS26 EPC1 SAP30 PCGF2 SIN3B NPM1 DDX20 TCF4 SIK1 ENO1 ZNF593 ARID5B RXRA RBL1 TRIM28 MLXIPL SFRS13A ZNF8 ILF3 UBE2I MBD3 SPEN PKIA SFRS13B HDAC5 CDKN1C SUZ12 PA2G4 CHMP1A SALL4 SMARCE1 JAZF1 RPS13 RBPJ TBL1X NSD1 BARD1

GOTERM_CC_4 GO:0016585~chromatin remodeling complex 11 0,732 5,21E-02 HDAC5 SAP30 CSNK2A1 SMARCE1 ACTL6B MBD3 ARID1B RBM10 TBL1X CHD4 CBX5

Table 2. Functional analysis of differential gene lists performed by the DAVID web tool showing statistically over-represented functional groups in {miRL*-CTR*} .

{miRL*-CTR*} up-regulated genes Category Term Count % PValue Genes PIR_SUPERFAMILY PIRSF002564:metallothionein 5 0,729 5,16E-04 MT2A MT1B MT1H MT1G MT1X GOTERM_BP_5 GO:0006749~glutathione metabolic process 7 1,020 2,75E-04 G6PD GPX4 GSTT1 GGT1 GCLM SOD2 GLRX2 GOTERM_BP_5 GO:0016477~cell migration 16 2,332 4,52E-02 PVR PPARD SOX1 BCAR1 WASF2 MYH9 GDNF BTG1 ANG BAX CKLF SDCBP POU3F3 LAMC1 APBB2 PPAP2A PANTHER_MF_ALL MF00270:Membrane traffic regulatory protein 12 1,749 5,14E-04 SNX9 LAMP2 PACSIN1 SNX5 STXBP5 SYT12 APBA3 SDCBP SYNGR2 SYT17 SNX10 SYNGR3 PANTHER_MF_ALL MF00091:Cytoskeletal protein 42 6,122 3,48E-03 GFAP PDLIM7 BCAR1 FKSG2 WASF2 PDLIM4 PDLIM3 RDX PDLIM1 PROSAPIP1 KIFC3 VCL TTLL3 KIF13A KRT81 LOC392288 MC1R ANK3 MAP1LC3B RIBC1 CNN1 ZYX TUBA1C CAP2 ACTN4 ACTN1 KRT10 DYNLT1 MYL12B ACTN3 CSRP1 MYL12A MYH9 KIF1C FNBP1 TNNT1 SPAG6 TUBA4A MAP4 WDR1 DNAL1 KATNAL1

SP_PIR_KEYWORDS angiogenesis 7 1,020 2,27E-02 TYMP EGFL7 AGGF1 ANG EFNA1 ZC3H12A MFGE8

{miRL*-CTR*} down-regulated genes Category Term Count % PValue Genes GOTERM_CC_4 GO:0016363~nuclear matrix 8 1,839 3,17E-04 GMCL1 FIGN SFPQ ENC1 TP53 NUFIP1 RUVBL1 THOC1 GOTERM_CC_4 GO:0044451~nucleoplasm part 27 6,207 6,54E-04 MEAF6 STK38 SETD1B NUFIP1 NFYA IVNS1ABP COIL CBX5 SFRS4 HAND2 OGT GTF3C2 TFDP1 ELP2 RBBP4 TP53 YTHDC1 TOPBP1 SFRS1 USF1 CCNL2 MED17 C19ORF2 RUVBL1 EP400 THOC1 MED1

GOTERM_BP_4 GO:0006325~chromatin organization 20 4,598 2,03E-03 MEAF6 RBBP4 RCOR1 SETD1B CTCF WHSC1 HLTF CBX5 EYA3 RPS6KA5 KDM2B SMARCD2 H2AFV MSL1 RTF1 SUPT16H RUVBL1 MLL3 MPHOSPH8 EP400 GOTERM_BP_4 GO:0007399~nervous system development 42 9,655 2,65E-03 FGFR1 NBN IRX5 CEP120 NNAT LINGO1 GATA2 GPC2 TUBB HEY1 CRMP1 SRR CDK5RAP3 KCNQ2 NRG1 GUSBP3 OLFM1 C17ORF28 TWIST1 IRS2 GNAO1 ENC1 KIF5C EPM2A TP53 ALMS1 DPYSL2 PROX1 YWHAE CTNNA2 ATRX SHOX2 VEGFA MTR RACGAP1P NAIP ID4 SEMA4D RBPJ GAP43 MED1 MYH10

GOTERM_BP_5 GO:0016568~chromatin modification 16 3,678 3,29E-03 MEAF6 RBBP4 RCOR1 SETD1B CTCF WHSC1 HLTF EYA3 RPS6KA5 KDM2B SMARCD2 MSL1 RTF1 RUVBL1 MLL3 EP400 GOTERM_BP_4 GO:0022008~neurogenesis 25 5,747 1,06E-02 FGFR1 NBN CEP120 IRX5 NNAT GATA2 LINGO1 GPC2 TUBB CDK5RAP3 C17ORF28 TWIST1 GNAO1 KIF5C TP53 ALMS1 YWHAE CTNNA2 VEGFA RACGAP1P ID4 SEMA4D RBPJ GAP43 MYH10 GOTERM_BP_5 GO:0006281~DNA repair 15 3,448 1,09E-02 ESCO1 NBN GEN1 UNG LIG1 TP53 LIG3 SMG1 TOPBP1 EYA3 ATRX TYMS DCLRE1B SFPQ SUPT16H GOTERM_BP_5 GO:0048699~generation of neurons 23 5,287 2,07E-02 FGFR1 NBN GNAO1 IRX5 NNAT KIF5C TP53 ALMS1 YWHAE CTNNA2 GATA2 LINGO1 GPC2 TUBB VEGFA RACGAP1P CDK5RAP3 ID4 SEMA4D GAP43 MYH10 TWIST1 C17ORF28 GOTERM_BP_4 GO:0007420~brain development 14 3,218 2,29E-02 IRS2 CEP120 GNAO1 NNAT YWHAE PROX1 CTNNA2 ATRX GATA2 SRR ID4 CDK5RAP3 MYH10 MED1 Table 3. Differentially expressed genes between CTR and miRL cells

Down-regulated genes in miRL vs CTR cells Up-regulated genes in miRL vs CTR cells

GENE SYMBOL Gene Name GENE SYMBOL Gene Name TGFB2 transforming growth factor, beta 2 BOD1L biorientation of chromosomes in cell division 1-like TARSL2 threonyl-tRNA synthetase-like 2 FAM20C family with sequence similarity 20, member C TAGLN transgelin SSTR2 somatostatin receptor 2 XRCC6BP1 XRCC6 binding protein 1 CNTNAP2 contactin associated protein-like 2 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) AK5 adenylate kinase 5 CRYGC crystallin, gamma C MSX2 msh homeobox 2 POPDC2 popeye domain containing 2 KIDINS220 kinase D-interacting substrate, 220kDa CCL24 chemokine (C-C motif) ligand 24 SPON2 spondin 2, extracellular matrix protein ZC3HAV1L zinc finger CCCH-type, antiviral 1-like SYNPO synaptopodin PHF2 PHD finger protein 2 RAB11FIP2 RAB11 family interacting protein 2 (class I) C20orf141 chromosome 20 open reading frame 141 GREM1 gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) TIGD7 tigger transposable element derived 7 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) CSNK1A1L casein kinase 1, alpha 1-like ZNF397 zinc finger protein 397 ATF3 activating transcription factor 3 STK19 serine/threonine kinase 19 GABPB1 GA binding protein transcription factor, beta subunit 1 ADAM23 ADAM metallopeptidase domain 23 CSNK1G1 casein kinase 1, gamma 1 TM4SF1 transmembrane 4 L six family member 1 CREB3L1 cAMP responsive element binding protein 3-like 1 BAALC brain and acute leukemia, cytoplasmic BEX5 brain expressed, X-linked 5 HS6ST3 heparan sulfate 6-O-sulfotransferase 3 CRABP2 cellular retinoic acid binding protein 2 P4HTM prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum) HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha EIF3A eukaryotic translation initiation factor 3, subunit A GALNT14 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) GALR3 galanin receptor 3 SCG2 secretogranin II (chromogranin C) ADM adrenomedullin TMEM204 transmembrane protein 204 CHMP4B chromatin modifying protein 4B TNIP2 TNFAIP3 interacting protein 2 AASDH aminoadipate-semialdehyde dehydrogenase HS3ST5 heparan sulfate (glucosamine) 3-O-sulfotransferase 5 TMEM38B transmembrane protein 38B HMOX1 heme oxygenase (decycling) 1 IRX5 iroquois homeobox 5 BTBD11 BTB (POZ) domain containing 11 CHRM2 cholinergic receptor, muscarinic 2 PSD3 pleckstrin and Sec7 domain containing 3 SKP2 S-phase kinase-associated protein 2 (p45) CD86 CD86 molecule EYA1 eyes absent homolog 1 (Drosophila) CADM3 cell adhesion molecule 3 SLC35F3 solute carrier family 35, member F3 GPR68 G protein-coupled receptor 68 C16orf72 chromosome 16 open reading frame 72 KIAA1033 KIAA1033 GSC goosecoid homeobox REST RE1-silencing transcription factor CSNK1A1P casein kinase 1, alpha 1 pseudogene HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) WNT6 wingless-type MMTV integration site family, member 6 RSC1A1 regulatory solute carrier protein, family 1, member 1 MUC4 mucin 4, cell surface associated PTPRE protein tyrosine phosphatase, receptor type, E LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 KCTD12 potassium channel tetramerisation domain containing 12 ZNF467 zinc finger protein 467 ETV5 ets variant 5 SREBF1 sterol regulatory element binding transcription factor 1 TUBA1C tubulin, alpha 1c NPM3 nucleophosmin/nucleoplasmin, 3 C3orf62 chromosome 3 open reading frame 62 CNN1 calponin 1, basic, smooth muscle AHNAK AHNAK nucleoprotein DLK1 delta-like 1 homolog (Drosophila) ZFX zinc finger protein, X-linked S100A11 S100 calcium binding protein A11; S100 calcium binding protein A11 pseudogene ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 TCF4 transcription factor 4 IGFBP5 insulin-like growth factor binding protein 5 CDH22 cadherin-like 22 ACP2 acid phosphatase 2, lysosomal RILPL1 Rab interacting lysosomal protein-like 1 HTR2B 5-hydroxytryptamine (serotonin) receptor 2B UBXN7 UBX domain protein 7 MARVELD1 hypothetical LOC100270710; MARVEL domain containing 1 NR4A3 nuclear receptor subfamily 4, group A, member 3 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit C17orf55 chromosome 17 open reading frame 55 PCDH17 protocadherin 17 LOC100292283 hypothetical protein LOC100292283 XPR1 xenotropic and polytropic retrovirus receptor HIST1H1D histone cluster 1, H1d SCG5 secretogranin V (7B2 protein) C21orf90 chromosome 21 open reading frame 90 PROCR protein C receptor, endothelial (EPCR) BCAM basal cell adhesion molecule (Lutheran blood group) PURG purine-rich element binding protein G RAB3C RAB3C, member RAS oncogene family OAZ3 ornithine decarboxylase antizyme 3 GRIN1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 FAP fibroblast activation protein, alpha MTSS1L metastasis suppressor 1-like C1orf96 chromosome 1 open reading frame 96 CXXC4 CXXC finger 4 C9orf129 chromosome 9 open reading frame 129 KRTAP2-4 keratin associated protein 2-1; keratin associated protein 2-4; keratin associated protein 2-3; APOE hypothetical LOC100129500; apolipoprotein E similar to keratin associated protein 2-4; keratin associated protein 2-2 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) SF3A2 splicing factor 3a, subunit 2, 66kDa DKK2 dickkopf homolog 2 (Xenopus laevis) P4HA1 prolyl 4-hydroxylase, alpha polypeptide I CHST8 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 RBP1 retinol binding protein 1, cellular JMJD1C jumonji domain containing 1C KIF1C kinesin family member 1C NGFR nerve growth factor receptor (TNFR superfamily, member 16) PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 CTHRC1 collagen triple helix repeat containing 1 BHLHE23 basic helix-loop-helix family, member e23 EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex); CADPS Ca++-dependent secretion activator dihydrolipoamide S-succinyltransferase pseudogene (E2 component of 2-oxo-glutarate complex) TAOK1 TAO kinase 1 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like GRIA3 glutamate receptor, ionotrophic, AMPA 3 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) S100A16 S100 calcium binding protein A16 GRIN2D glutamate receptor, ionotropic, N-methyl D-aspartate 2D TOM1L2 target of myb1-like 2 (chicken) LEPR leptin receptor BAZ2A bromodomain adjacent to zinc finger domain, 2A MT1A metallothionein 1A TNPO1 transportin 1 LOC100133660 hypothetical LOC100133660 ANKRD32 ankyrin repeat domain 32 EMD emerin RALGDS ral guanine nucleotide dissociation stimulator MYL3 myosin, light chain 3, alkali; ventricular, skeletal, slow EML2 echinoderm microtubule associated protein like 2 FAM100A family with sequence similarity 100, member A GREM2 gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) RBPMS RNA binding protein with multiple splicing ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 CEBPD CCAAT/enhancer binding protein (C/EBP), delta CLDN5 claudin 5 PXK PX domain containing serine/threonine kinase MMP15 matrix metallopeptidase 15 (membrane-inserted) KIAA1715 KIAA1715 MSN moesin ZNF700 zinc finger protein 700 IRS2 insulin receptor substrate 2 ZNF488 zinc finger protein 488 NRXN3 neurexin 3 MAP3K3 mitogen-activated protein kinase kinase kinase 3 PPP1R8 protein phosphatase 1, regulatory (inhibitor) subunit 8 FOXP1 forkhead box P1 LRRC17 leucine rich repeat containing 17 GNG8 guanine nucleotide binding protein (G protein), gamma 8 PRPH peripherin RTBDN retbindin TRIB2 tribbles homolog 2 (Drosophila) CTGF connective tissue growth factor PPP2R2B protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform MOS v-mos Moloney murine sarcoma viral oncogene homolog PHLDA1 pleckstrin homology-like domain, family A, member 1 LYNX1 Ly6/neurotoxin 1 LOC100132831 A20-binding inhibitor of NF-kappaB activation 2 pseudogene MYO1C myosin IC PPP2R2C protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform MAN1A2 mannosidase, alpha, class 1A, member 2 GFRA2 similar to GDNF family receptor alpha 2; GDNF family receptor alpha 2 C22orf39 chromosome 22 open reading frame 39 ASB8 ankyrin repeat and SOCS box-containing 8 RAPGEF5 Rap guanine nucleotide exchange factor (GEF) 5 OTUD4 OTU domain containing 4 LOC402360 similar to hCG1742476 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 PDIA2 protein disulfide isomerase family A, member 2 PRR13 proline rich 13 SYNC syncoilin, intermediate filament protein AAGAB alpha- and gamma-adaptin-binding protein p34 ARHGAP1 Rho GTPase activating protein 1 PLAU plasminogen activator, urokinase HNF1A HNF1 homeobox A MAOB monoamine oxidase B LOC100287521 hypothetical protein LOC100287521 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) NFIX nuclear factor I/X (CCAAT-binding transcription factor) FGL1 fibrinogen-like 1 FLJ22184 hypothetical protein FLJ22184 CLDN11 claudin 11 TNIP1 TNFAIP3 interacting protein 1 WWC1 WW and C2 domain containing 1 JAZF1 JAZF zinc finger 1 LCE3E late cornified envelope 3E ZMAT4 zinc finger, matrin type 4 LOC100132644 similar to hCG38670 NEURL neuralized homolog (Drosophila) RGMA RGM domain family, member A C2orf14 chromosome 2 open reading frame 14; Uncharacterized protein C2orf14-like 2; Uncharacterized protein C2orf14-like 1 C5orf46 chromosome 5 open reading frame 46 SLC39A14 solute carrier family 39 (zinc transporter), member 14 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) PVRL1 poliovirus receptor-related 1 (herpesvirus entry mediator C) MEGF6 multiple EGF-like-domains 6 TRAF3 TNF receptor-associated factor 3 FHIT fragile histidine triad gene ARID1B AT rich interactive domain 1B (SWI1-like) AP1S1 adaptor-related protein complex 1, sigma 1 subunit IGF2 insulin-like growth factor 2 (somatomedin A); insulin; INS-IGF2 readthrough transcript RFC3 replication factor C (activator 1) 3, 38kDa SFRS16 splicing factor, arginine/serine-rich 16 CCDC71 coiled-coil domain containing 71 TGOLN2 trans-golgi network protein 2 RPL22 ribosomal protein L22 pseudogene 11; ribosomal protein L22 AIF1L allograft inflammatory factor 1-like LOC649294 similar to hCG2023245; hypothetical LOC649294 PALLD palladin, cytoskeletal associated protein OR10H2 olfactory receptor, family 10, subfamily H, member 2 MEX3D mex-3 homolog D (C. elegans) MAST4 microtubule associated serine/threonine kinase family member 4 CRHR1 corticotropin releasing hormone receptor 1 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 SCAF1 SR-related CTD-associated factor 1 KRT18 keratin 18; keratin 18 pseudogene 26; keratin 18 pseudogene 19 GFER growth factor, augmenter of liver regeneration BAK1 BCL2-antagonist/killer 1; BCL2-like 7 pseudogene 1 SLC25A29 solute carrier family 25, member 29 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) PPA2 pyrophosphatase (inorganic) 2 LOC392352 similar to TRIMCyp PTPN1 protein tyrosine phosphatase, non-receptor type 1 NYNRIN KIAA1305 GRK5 G protein-coupled receptor kinase 5 MEGF8 multiple EGF-like-domains 8 LBH limb bud and heart development homolog (mouse) C15orf39 chromosome 15 open reading frame 39 RPRD1A regulation of nuclear pre-mRNA domain containing 1A CDCA7L cell division cycle associated 7-like LOC441245 hypothetical LOC441245 PARP10 poly (ADP-ribose) polymerase family, member 10 NCRNA00085 non-protein coding RNA 85 EVX1 even-skipped homeobox 1 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) ODZ3 odz, odd Oz/ten-m homolog 3 (Drosophila) PRR7 proline rich 7 (synaptic) RAMP1 receptor (G protein-coupled) activity modifying protein 1 FOXQ1 forkhead box Q1 MRGPRF MAS-related GPR, member F ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 ZNF331 zinc finger protein 331 LCE2D late cornified envelope 2D CALD1 caldesmon 1 EN2 engrailed homeobox 2 PKM2 similar to Pyruvate kinase, isozymes M1/M2 (Pyruvate kinase muscle isozyme) (Cytosolic thyroid hormone-binding protein) (CTHBP) (THBP1); pyruvate kinase, muscle C6orf176 chromosome 6 open reading frame 176 MLL3 myeloid/lymphoid or mixed-lineage leukemia 3 TSPO translocator protein (18kDa) C1orf113 chromosome 1 open reading frame 113 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 MAP1LC3A microtubule-associated protein 1 light chain 3 alpha FKSG2 apoptosis inhibitor STAT5B signal transducer and activator of transcription 5B OTOF otoferlin LOC100129034 hypothetical protein LOC100129034 HERC5 hect domain and RLD 5 MIB1 mindbomb homolog 1 (Drosophila) KCNG1 potassium voltage-gated channel, subfamily G, member 1 CHPT1 choline phosphotransferase 1 CCDC109B coiled-coil domain containing 109B GLTP glycolipid transfer protein; glycolipid transfer protein pseudogene 1 LOC728875 hypothetical LOC728875 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha FLJ35390 hypothetical LOC255031 PRKCH protein kinase C, eta C17orf96 chromosome 17 open reading frame 96 HSPA5 hypothetical gene supported by AF216292; NM_005347; heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) ADAMTSL2 similar to ADAMTS-like 2; ADAMTS-like 2 LOC648740 ACTB pseudogene UBTF upstream binding transcription factor, RNA polymerase I PDE4B phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila) NKD2 naked cuticle homolog 2 (Drosophila) BBC3 BCL2 binding component 3 KCNC3 potassium voltage-gated channel, Shaw-related subfamily, member 3 LOC100288578 similar to cytochrome c oxidase subunit II ZFP1 zinc finger protein 1 homolog (mouse) LOC100126784 hypothetical LOC100126784 BRP44L brain protein 44-like SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 GFAP glial fibrillary acidic protein SCRG1 stimulator of chondrogenesis 1 CRLF1 cytokine receptor-like factor 1 DMPK dystrophia myotonica-protein kinase ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) SERTAD4 SERTA domain containing 4 UGT8 UDP glycosyltransferase 8 C12orf51 chromosome 12 open reading frame 51 CCDC50 coiled-coil domain containing 50 FAM195A chromosome 16 open reading frame 14 DNAJC18 DnaJ (Hsp40) homolog, subfamily C, member 18 ITPRIPL1 inositol 1,4,5-triphosphate receptor interacting protein-like 1 POLM polymerase (DNA directed), mu RNF113B ring finger protein 113B TBL1X transducin (beta)-like 1X-linked MT1G metallothionein 1G LOC541472 hypothetical LOC541472 RAVER2 ribonucleoprotein, PTB-binding 2 CHST13 carbohydrate (chondroitin 4) sulfotransferase 13 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence KIAA1199 KIAA1199 MTP18 mitochondrial protein 18 kDa MECP2 methyl CpG binding protein 2 (Rett syndrome) LMO4 LIM domain only 4 ANP32C acidic (leucine-rich) nuclear phosphoprotein 32 family, member C MED1 mediator complex subunit 1 APC2 adenomatosis polyposis coli 2 C14orf43 chromosome 14 open reading frame 43 ALDOAP2 aldolase A, fructose-bisphosphate pseudogene 2 UBQLN1 ubiquilin 1 NDUFA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa RARA retinoic acid receptor, alpha PIR pirin (iron-binding nuclear protein) PPME1 protein phosphatase methylesterase 1 ADAMTS7 similar to hCG1991431; similar to COMPase; ADAM metallopeptidase with thrombospondin type 1 motif, 7 LOC100288367 similar to hCG2004312 ADRA2A adrenergic, alpha-2A-, receptor MFHAS1 malignant fibrous histiocytoma amplified sequence 1 NUBPL nucleotide binding protein-like MT1L metallothionein 1L (gene/pseudogene); metallothionein 1E; metallothionein 1 pseudogene 3; metallothionein 1J (pseudogene) JOSD2 Josephin domain containing 2 ETHE1 ethylmalonic encephalopathy 1 GLI2 GLI family zinc finger 2 LMNB2 lamin B2 LOC440461 SH3 domain containing 20 pseudogene MT2A metallothionein 2A ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 SILV silver homolog (mouse) ATAD3B similar to AAA-ATPase TOB3; ATPase family, AAA domain containing 3B FLJ40504 hypothetical protein FLJ40504 SEMA5B sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B MTHFR 5,10-methylenetetrahydrofolate reductase (NADPH) ERLIN2 ER lipid raft associated 2 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 COL5A2 collagen, type V, alpha 2 SIK2 salt-inducible kinase 2 LTBP1 latent transforming growth factor beta binding protein 1 SDK2 sidekick homolog 2 (chicken) NEUROG3 neurogenin 3 TSPAN10 tetraspanin 10 HIP1 huntingtin interacting protein 1 CEP250 centrosomal protein 250kDa TFAP2B transcription factor AP-2 beta (activating enhancer binding protein 2 beta) SYN1 synapsin I CKAP2L cytoskeleton associated protein 2-like C19orf73 chromosome 19 open reading frame 73 AQP2 aquaporin 2 (collecting duct) PGK1 phosphoglycerate kinase 1 MARK2 MAP/microtubule affinity-regulating kinase 2 DNM1P35 DNM1 pseudogene 35 CREBBP CREB binding protein UNC119 unc-119 homolog (C. elegans) PID1 phosphotyrosine interaction domain containing 1 IGSF1 immunoglobulin superfamily, member 1 PDZD4 PDZ domain containing 4 USP48 ubiquitin specific peptidase 48 PTMS parathymosin PEX6 peroxisomal biogenesis factor 6 SP100 SP100 nuclear antigen HIST1H4B histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; histone cluster 2, H4b HIST1H4D histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; histone cluster 2, H4b HIST1H4L histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; histone cluster 2, H4b EGLN1 egl nine homolog 1 (C. elegans) LRRC28 leucine rich repeat containing 28 FN1 fibronectin 1 ZNF205 zinc finger protein 205 SORBS3 sorbin and SH3 domain containing 3 FAM123B family with sequence similarity 123B LOC388564 hypothetical protein LOC388564 PKD2 polycystic kidney disease 2 (autosomal dominant) GDNF glial cell derived neurotrophic factor KRTAP4-1 keratin associated protein 4-1 DPYSL3 dihydropyrimidinase-like 3 LCE1D late cornified envelope 1D PDPK1 3-phosphoinositide dependent protein kinase-1 GATAD1 GATA zinc finger domain containing 1 L3MBTL3 l(3)mbt-like 3 (Drosophila) NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) TMEM175 transmembrane protein 175 CHRM3 cholinergic receptor, muscarinic 3 HIST1H3J histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; histone cluster 2, H3d HIST1H3D histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; histone cluster 2, H3d HIST1H3B histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; histone cluster 2, H3d HIST1H3F histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; histone cluster 2, H3d IL27 interleukin 27 CEACAM20 carcinoembryonic antigen-related cell adhesion molecule 20 ZNF575 zinc finger protein 575 SPOCK1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 CMIP c-Maf-inducing protein LOC728449 hypothetical protein LOC728449 ZNF433 zinc finger protein 433 MAPRE2 microtubule-associated protein, RP/EB family, member 2 HEBP2 heme binding protein 2 LOC442249 similar to keratin 18 ASXL3 additional sex combs like 3 (Drosophila) TMEM88 transmembrane protein 88 ACTN4 actinin, alpha 4 IFITM5 interferon induced transmembrane protein 5 SOX3 SRY (sex determining region Y)-box 3 STRN4 striatin, calmodulin binding protein 4 LENG8 leukocyte receptor cluster (LRC) member 8 SAMD4A sterile alpha motif domain containing 4A MRPL23 mitochondrial ribosomal protein L23 CENPN centromere protein N ADAM15 ADAM metallopeptidase domain 15 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 AQP1 aquaporin 1 (Colton blood group) LMNA lamin A/C AKT2 v-akt murine thymoma viral oncogene homolog 2 HBEGF heparin-binding EGF-like growth factor MRPS36 mitochondrial ribosomal protein S36 CDH24 cadherin-like 24 TET1 tet oncogene 1 TPSG1 tryptase gamma 1 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 FLRT3 fibronectin leucine rich transmembrane protein 3 ANXA6 annexin A6 PKN2 protein kinase N2 CRTC1 CREB regulated transcription coactivator 1 SORBS2 sorbin and SH3 domain containing 2 RPS2P45 ribosomal protein S2 pseudogene 45 PDLIM5 PDZ and LIM domain 5 POM121 POM121 membrane glycoprotein (rat) ELFN1 extracellular leucine-rich repeat and fibronectin type III domain containing 1 C6orf27 chromosome 6 open reading frame 27 LOC283711 hypothetical protein LOC283711 INHBA inhibin, beta A UTS2R urotensin 2 receptor PACRG PARK2 co-regulated TCP1P3 hypothetical gene supported by BC000665; t-complex 1 LOC729046 ribosomal protein L17 pseudogene 22; ribosomal protein L17 pseudogene 36; ribosomal protein L17 pseudogene 20; similar to ribosomal protein L17; ribosomal protein L17 pseudogene 33; ribosomal protein L17 pseudogene 34; ribosomal protein L17 pseudogene 9; ribosomal protein L17; ribosomal protein L17 pseudogene 18; ribosomal protein L17 pseudogene 7; ribosomal protein L17 pseudogene 39 TGFB3 transforming growth factor, beta 3 TSHZ1 teashirt zinc finger homeobox 1 C14orf102 chromosome 14 open reading frame 102 PRR5 Rho GTPase activating protein 8; proline rich 5 (renal); PRR5-ARHGAP8 fusion TMBIM6 transmembrane BAX inhibitor motif containing 6 TSPAN12 tetraspanin 12 DBH dopamine beta-hydroxylase (dopamine beta-monooxygenase) HES7 hairy and enhancer of split 7 (Drosophila) HRK harakiri, BCL2 interacting protein (contains only BH3 domain) NPPB natriuretic peptide precursor B LRRN1 leucine rich repeat neuronal 1 DKK1 dickkopf homolog 1 (Xenopus laevis) CYB5R3 cytochrome b5 reductase 3 RPL22P15 ribosomal protein L22 pseudogene 15 MLEC malectin LOC645181 PDGFA associated protein 1; similar to PDGFA associated protein 1 PDAP1 PDGFA associated protein 1; similar to PDGFA associated protein 1 LOC100130152 hypothetical protein LOC100130152 CHD3 chromodomain helicase DNA binding protein 3 MAPK11 mitogen-activated protein kinase 11 ING5 inhibitor of growth family, member 5 RPL35 ribosomal protein L35; ribosomal protein L35 pseudogene 1; ribosomal protein L35 pseudogene 2 COL27A1 collagen, type XXVII, alpha 1 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 SPEN spen homolog, transcriptional regulator (Drosophila) GNG5 guanine nucleotide binding protein (G protein), gamma 5 MSI2 musashi homolog 2 (Drosophila) GTPBP1 GTP binding protein 1 DIAPH2 diaphanous homolog 2 (Drosophila) TSEN15 tRNA splicing endonuclease 15 homolog (S. cerevisiae) PRNP prion protein SCOC short coiled-coil protein PITPNM1 phosphatidylinositol transfer protein, membrane-associated 1 ANG angiogenin, ribonuclease, RNase A family, 5 ZNF236 zinc finger protein 236 MDK midkine (neurite growth-promoting factor 2) CDC42EP5 CDC42 effector protein (Rho GTPase binding) 5 DCN decorin TNRC18 trinucleotide repeat containing 18 SYK spleen tyrosine kinase MRPL2 mitochondrial ribosomal protein L2 CACNG7 calcium channel, voltage-dependent, gamma subunit 7 PRR12 proline rich 12 PDK1 pyruvate dehydrogenase kinase, isozyme 1 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 RPL23AP32 ribosomal protein L23a pseudogene 32 FAM43B family with sequence similarity 43, member B MT1X metallothionein 1X LOC100131581 hypothetical LOC100131581 EDN1 endothelin 1 CAB39L calcium binding protein 39-like KIT similar to Mast/stem cell growth factor receptor precursor (SCFR) (Proto-oncogene tyrosine-protein kinase Kit) (c-kit) (CD117 antigen); v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog H19 H19, imprinted maternally expressed transcript (non-protein coding) RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) KIF1B kinesin family member 1B FKBP10 FK506 binding protein 10, 65 kDa KLF10 Kruppel-like factor 10 TSPAN6 tetraspanin 6 ZCCHC2 zinc finger, CCHC domain containing 2 RND3 Rho family GTPase 3 RHBDL1 rhomboid, veinlet-like 1 (Drosophila) GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 LOC440917 similar to 14-3-3 protein epsilon (14-3-3E) (Mitochondrial import stimulation factor L subunit) (MSF L); tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide KISS1R KISS1 receptor COL16A1 collagen, type XVI, alpha 1 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae); hypothetical LOC100132364 NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa PSMB9 proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) SPRY2 sprouty homolog 2 (Drosophila) SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 LOC642031 hypothetical protein LOC642031 WASF2 WAS protein family, member 2 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) FBXL17 F-box and leucine-rich repeat protein 17 CD4 CD4 molecule RCOR3 REST corepressor 3 POU3F3 POU class 3 homeobox 3 ZC3H7B zinc finger CCCH-type containing 7B MYPOP Myb-related transcription factor, partner of profilin C18orf23 chromosome 18 open reading frame 23 UBE2W ubiquitin-conjugating enzyme E2W (putative) HS2ST1 heparan sulfate 2-O-sulfotransferase 1 VASH2 vasohibin 2 RARG retinoic acid receptor, gamma TWIST2 twist homolog 2 (Drosophila) PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 ALDOA aldolase A, fructose-bisphosphate ZSCAN10 zinc finger and SCAN domain containing 10 LOC152024 hypothetical LOC152024 C8orf4 chromosome 8 open reading frame 4 PPAP2B phosphatidic acid phosphatase type 2B PPP2R3B protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta EYA4 eyes absent homolog 4 (Drosophila) RHOG ras homolog gene family, member G (rho G) MYH14 myosin, heavy chain 14 RALA v-ral simian leukemia viral oncogene homolog A (ras related) GATC glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) MT3 metallothionein 3 FTL similar to ferritin, light polypeptide; ferritin, light polypeptide GPC4 glypican 4 DDR2 discoidin domain receptor tyrosine kinase 2 FCRLB Fc receptor-like B GPRIN1 G protein regulated inducer of neurite outgrowth 1 HK2 hexokinase 2 pseudogene; hexokinase 2 TRIM25 tripartite motif-containing 25 FAM59A hypothetical protein LOC100130616; family with sequence similarity 59, member A LRP5 low density lipoprotein receptor-related protein 5 SPPL2B signal peptide peptidase-like 2B CASP2 caspase 2, apoptosis-related cysteine peptidase LOC646973 hypothetical LOC646973 TAF3 TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa ZNF579 zinc finger protein 579 PTCH1 patched homolog 1 (Drosophila) FAM124A family with sequence similarity 124A PDLIM3 PDZ and LIM domain 3 TIFA TRAF-interacting protein with forkhead-associated domain ANXA5 annexin A5 PBX2 pre-B-cell leukemia homeobox 2 CACNG4 calcium channel, voltage-dependent, gamma subunit 4 LOC100128164 four and a half LIM domains 1 pseudogene ACTN3 actinin, alpha 3 COX8A cytochrome c oxidase subunit 8A (ubiquitous) FMNL2 formin-like 2 AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 VGF VGF nerve growth factor inducible CACNA1I calcium channel, voltage-dependent, T type, alpha 1I subunit LCE1A late cornified envelope 1A PXMP4 peroxisomal membrane protein 4, 24kDa CAND1 cullin-associated and neddylation-dissociated 1 ITPKB inositol 1,4,5-trisphosphate 3-kinase B FAM133B family with sequence similarity 133, member B pseudogene; similar to FAM133B protein; family with sequence similarity 133, member B LRRC8A leucine rich repeat containing 8 family, member A FILIP1L filamin A interacting protein 1-like IER5 immediate early response 5 MT1H metallothionein 1H THRAP3 thyroid hormone receptor associated protein 3 CASKIN1 CASK interacting protein 1 CAPG capping protein (actin filament), gelsolin-like ING3 inhibitor of growth family, member 3 COX6A2 cytochrome c oxidase subunit VIa polypeptide 2 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) HRASLS HRAS-like suppressor C3orf32 chromosome 3 open reading frame 32 BGLAP bone gamma-carboxyglutamate (gla) protein; polyamine-modulated factor 1 TESC tescalcin SLC2A13 solute carrier family 2 (facilitated glucose transporter), member 13 EXPH5 exophilin 5 NBEAL2 neurobeachin-like 2 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa SLC1A1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 LPP LIM domain containing preferred translocation partner in lipoma FANCB Fanconi anemia, complementation group B DPP9 dipeptidyl-peptidase 9 LOH3CR2A loss of heterozygosity, 3, chromosomal region 2, gene A LOC100288755 hypothetical LOC100288755 CDK5R2 cyclin-dependent kinase 5, regulatory subunit 2 (p39) RNF5 ring finger protein 5; ring finger protein 5 pseudogene 1 CDK6 cyclin-dependent kinase 6 C14orf21 chromosome 14 open reading frame 21 ZNF48 zinc finger protein 48 SLIT1 slit homolog 1 (Drosophila) BCL2L12 BCL2-like 12 (proline rich) GPRC5B G protein-coupled receptor, family C, group 5, member B OR4D2 olfactory receptor, family 4, subfamily D, member 2 RPS26 ribosomal protein S26 pseudogene 38; ribosomal protein S26 pseudogene 39; ribosomal protein S26 pseudogene 35; ribosomal protein S26 pseudogene 31; ribosomal protein S26 pseudogene 20; ribosomal protein S26 pseudogene 54; ribosomal protein S26 pseudogene 2; ribosomal protein S26 pseudogene 53; ribosomal protein S26 pseudogene 25; ribosomal protein S26 pseudogene 50; ribosomal protein S26 pseudogene 6; ribosomal protein S26 pseudogene 8; ribosomal protein S26 NTNG2 netrin G2 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) NDOR1 NADPH dependent diflavin oxidoreductase 1 ZNF234 zinc finger protein 234 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 C9orf69 chromosome 9 open reading frame 69 NDUFS7 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) AATK apoptosis-associated tyrosine kinase IRX3 iroquois homeobox 3 KIAA0319L KIAA0319-like ELN elastin EPDR1 ependymin related protein 1 (zebrafish) PLK1S1 non-protein coding RNA 153 WDR4 WD repeat domain 4 LOC100289410 similar to hCG1774568 INSR insulin receptor LOC650226 ankyrin repeat domain 26 pseudogene GOLPH3 golgi phosphoprotein 3 (coat-protein) CCDC108 coiled-coil domain containing 108 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 SYCE1L hypothetical protein LOC100130958 PRR24 hypothetical protein LOC255783 KLK3 kallikrein-related peptidase 3 NAV2 neuron navigator 2 CTRB2 chymotrypsinogen B2 DIAPH1 diaphanous homolog 1 (Drosophila) C16orf68 chromosome 16 open reading frame 68 LOC100129122 hypothetical LOC100129122 C17orf74 chromosome 17 open reading frame 74 LBX1 ladybird homeobox 1 DIRC1 disrupted in renal carcinoma 1 PRSS36 protease, serine, 36 BMPR1B bone morphogenetic protein receptor, type IB LCE5A late cornified envelope 5A CYB561D1 cytochrome b-561 domain containing 1 TTYH1 tweety homolog 1 (Drosophila) CLMN calmin (calponin-like, transmembrane) NACAP1 nascent-polypeptide-associated complex alpha polypeptide pseudogene 1 LOC100291560 hypothetical protein LOC100291560 PMEPA1 prostate transmembrane protein, androgen induced 1 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha DHRS2 dehydrogenase/reductase (SDR family) member 2 PPP3R1 protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform TBC1D2B TBC1 domain family, member 2B CCND1 cyclin D1 LRP6 low density lipoprotein receptor-related protein 6 AAAS achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) PIGL phosphatidylinositol glycan anchor biosynthesis, class L ZSCAN5A zinc finger and SCAN domain containing 5A SLC8A2 solute carrier family 8 (sodium/calcium exchanger), member 2 OR2H1 olfactory receptor, family 2, subfamily H, member 1 ALPPL2 alkaline phosphatase, placental-like 2 UQCRC1 ubiquinol-cytochrome c reductase core protein I PRKACA protein kinase, cAMP-dependent, catalytic, alpha LOC100292388 hypothetical protein LOC100292388 CCDC124 coiled-coil domain containing 124 TPI1 TPI1 pseudogene; triosephosphate isomerase 1 DHDH dihydrodiol dehydrogenase (dimeric) PRIC285 peroxisomal proliferator-activated receptor A interacting complex 285 RAB6B RAB6B, member RAS oncogene family C14orf139 chromosome 14 open reading frame 139 HSPB1 heat shock 27kDa protein-like 2 pseudogene; heat shock 27kDa protein 1 STAC2 SH3 and cysteine rich domain 2 FAM162A family with sequence similarity 162, member A CYP4V2 cytochrome P450, family 4, subfamily V, polypeptide 2 EXOC3L2 exocyst complex component 3-like 2 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma CAMK1D calcium/calmodulin-dependent protein kinase ID NPAS3 neuronal PAS domain protein 3 ARC activity-regulated cytoskeleton-associated protein LCE1C late cornified envelope 1C ATF6B activating transcription factor 6 beta CHDH choline dehydrogenase FTSJ3 FtsJ homolog 3 (E. coli) ZNF385A zinc finger protein 385A DOCK7 dedicator of cytokinesis 7 CARHSP1 calcium regulated heat stable protein 1, 24kDa PHF20 PHD finger protein 20 MAGEE1 melanoma antigen family E, 1 SNX10 sorting nexin 10 SH3KBP1 SH3-domain kinase binding protein 1 C16orf81 chromosome 16 open reading frame 81 FAM129B family with sequence similarity 129, member B PABPC4L poly(A) binding protein, cytoplasmic 4-like MCAT malonyl CoA:ACP acyltransferase (mitochondrial) TRIM44 tripartite motif-containing 44 CBLL1 Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 KCNC1 potassium voltage-gated channel, Shaw-related subfamily, member 1 C21orf58 chromosome 21 open reading frame 58 RTN3 reticulon 3 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant ZNF124 zinc finger protein 124 CD99 CD99 molecule TMTC2 transmembrane and tetratricopeptide repeat containing 2 TPR translocated promoter region (to activated MET oncogene) TMEM99 transmembrane protein 99 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa SLC38A7 solute carrier family 38, member 7 TMEM101 transmembrane protein 101 TES testis derived transcript (3 LIM domains) IQSEC2 IQ motif and Sec7 domain 2 ADD1 adducin 1 (alpha) AK3L1 adenylate kinase 3-like 2; adenylate kinase 3-like 1 ACTG2 actin, gamma 2, smooth muscle, enteric TAS1R1 taste receptor, type 1, member 1 GOLGA8F golgi autoantigen, golgin subfamily a, 8D; golgi autoantigen, golgin subfamily a, 8C; similar to Golgin subfamily A member 8-like protein 1; golgi autoantigen, golgin subfamily a, 8F; golgi autoantigen, golgin subfamily a, 8G LOC100132161 similar to hCG1993567 LMNB1 lamin B1 EXOC5 exocyst complex component 5 RAB5C RAB5C, member RAS oncogene family TSPAN13 tetraspanin 13 CD151 CD151 molecule (Raph blood group) EPHX3 epoxide hydrolase 3 MT1B metallothionein 1B C11orf75 hypothetical LOC728675; chromosome 11 open reading frame 75 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 APH1A anterior pharynx defective 1 homolog A (C. elegans) SOX2 SRY (sex determining region Y)-box 2 LOC100131149 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4; similar to HSPC125 LOC728855 hypothetical LOC728855 ARHGEF16 Rho guanine exchange factor (GEF) 16 Supplementary table S.1

Gene Gene Name References Symbol metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) MALAT1 (Guo et al., 2010) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) EEF1D (De et al., 2006) apolipoprotein E APOE (Sakashita et al., 2008) transmembrane 4 L six family member 1 TM4SF1 (Kao et al., 2003) insulin-like growth factor binding protein 5 IGFBP5 (Yasuoka et al., 2009) fibroblast activation protein, alpha FAP (Santos et al., 2009) AHNAK nucleoprotein AHNAK (Shankar et al., 2010) moesin MSN (Estecha et al., 2009) ectonucleotide pyrophosphatase/phosphodiesterase 2 ENPP2 (Harper et al., 2010) ets variant 5 ETV5 (Wu et al., 2006) insulin receptor substrate 2 IRS2 (de Blaquiere et al., 2009) collagen triple helix repeat containing 1 CTHRC1 (Tang et al., 2006) matrix metallopeptidase 15 (membrane-inserted) MMP15 (Mohammad et al., 2010) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) MMP9 (Liu et al., 2010) caspase 2, apoptosis-related cysteine peptidase CASP2 (Guha et al., 2010) patched homolog 1 (Drosophila) PTCH1 (You et al., 2010) SP100 nuclear antigen SP100 (Negorev et al., 2010) BCL2-antagonist/killer 1 BAK1 (Zhou et al., 2010) KISS1 receptor KISS1R (Beck and Welch, 2010) retinol binding protein 1, cellular RBP1 (Farias et al., 2005) neuralized homolog (Drosophila) NEURL (Teider et al., 2010) harakiri, BCL2 interacting protein (contains only BH3 domain) HRK (Nakamura et al., 2008) peroxisomal membrane protein 4, 24kDa PXMP4 (Wu and Ho, 2004) endothelin 1 EDN1 (Takai et al., 2001) fragile histidine triad gene FHIT (Wali, 2010) sprouty homolog 2 (Drosophila) SPRY2 (Holgren et al., 2010) ADAM metallopeptidase domain 15 ADAM15 (Ungerer et al., 2010) BCL2 binding component 3 BBC3 (Karst et al., 2005) HNF1 homeobox A HNF1A (Pelletier et al., 2010) transcription factor AP-2 beta (activating enhancer binding protein 2 beta) TFAP2B (Gee et al., 1999) transgelin TAGLN (Prasad et al., 2010) testis derived transcript (3 LIM domains) TES (Gunduz et al., 2009) spleen tyrosine kinase SYK (Layton et al., 2009) cellular retinoic acid binding protein 2 CRABP2 (Okuducu et al., 2005) interleukin 27 IL27 (Shimizu et al., 2006) decorin DCN (Bi et al., 2008) inhibin, beta A INHBA (Hong et al., 2010) adenomatosis polyposis coli 2 APC2 (Senda et al., 2005) tetraspanin 13 TSPAN13 (Huang et al., 2007) bone morphogenetic protein 6 BMP6 (Yuen et al., 2008) kallikrein-related peptidase 3 KLK3 (Mattsson et al., 2009)