Transcriptional signatures of sexual selection, stress, and development in salmon lice (Lepeophtheirus salmonis)
BY
JORDAN DONALD POLEY
A Thesis Submitted to the Graduate Faculty in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Department of Pathology and Microbiology Faculty of Veterinary Medicine University of Prince Edward Island
Jordan D. Poley Charlottetown, PEI Jan 2nd, 2018 ©2018, Poley
i THESIS/DISSERTATION NON-EXCLUSIVE LICENSE Family Name: Poley Given Name: Jordan Middle Name: Donald Full Name of University: University of Prince Edward Island Faculty, Department, School: Faculty of Veterinary Medicine, Department of Pathology & Microbiology Degree for which thesis/dissertation was presented: Doctor of Philosophy Date Degree Awarded: May, 2018 Thesis/dissertation Title: Transcriptional signatures of sexual selection, stress, and development in salmon lice (Lepeophtheirus salmonis) Date of Birth: October 25th, 1990
In consideration of my University making my thesis/dissertation available to interested persons, I, Jordan Poley, hereby grant a non-exclusive, for the full term of copyright protection, license to my University, The university of Prince Edward Island: (a) to archive, preserve, produce, reproduce, publish, communicate, convert into any format, and to make available in print or online by telecommunication to the public for non-commercial purposes; (b) to sub-license to Library and Archives Canada any of the acts mentioned in paragraph (a).
I undertake to submit my thesis/dissertation, through my University, to Library and Archives Canada. Any abstract submitted with the thesis/dissertation will be considered to form part of the thesis/dissertation. I represent that my thesis/dissertation is my original work, does not infringe any rights of others, including privacy rights, and that I have the right to make the grant conferred by this non-exclusive license. If third party copyrighted material was included in my thesis/dissertation for which, under the terms of the Copyright Act, written permission from the copyright owners is required I have obtained such permission from the copyright owners to do the acts mentioned in paragraph (a) above for the full term of copyright protection I retain copyright ownership and moral rights in my thesis/dissertation, and may deal with the copyright in my thesis/dissertation, in any way consistent with rights granted by me to my University in this non-exclusive license. I further promise to inform any person to whom I may hereafter assign or license my copyright in my thesis/dissertation of the rights granted by me to my University in this non-exclusive license.
Signature: Date:
ii
University of Prince Edward Island
Faculty of Veterinary Medicine
Charlottetown
CERTIFICATION OF THESIS WORK
We, the undersigned, certify that______, (full name) (degrees) candidate for the degree of ______has presented his/her thesis with the following title: ______(as it appears on title page of thesis) that the thesis is acceptable in form and content, and that a satisfactory knowledge of the field covered by the thesis was demonstrated by the candidate through an oral examination held on December 14th, 2017.
Examiners’ Names Examiners’ Signatures Dr. Nadia Aubin-Horth ______Dr. David Speare ______Dr. Mark Fast ______Dr. Mark Braceland ______Dr. John Burka ______
Date
iii ABSTRACT The salmon louse (Lepeophtheirus salmonis) is an important ectoparasitic copepod of wild and farmed salmon. Management of this parasite in Atlantic salmon aquaculture relies on chemicals administered as baths or in the feed. Unfortunately, multiple-drug resistance has now been reported in all major salmon producing countries, threatening the sustainability of the industry. The development of novel treatments for sea lice has been challenging due to a lack of functional studies and genomic characterization for this non-model species. These knowledge gaps have also impeded progress in finding markers to detect and monitor resistance in the field as part of drug management. In this thesis, a characterization of approximately 20,000 L. salmonis transcripts is described across studies monitoring physiological differences related to chemical exposure. Basal expression differences between sexes, populations, stages, and microsporidian infection are also integrated with these data to both characterize known phenotypes and explore novel responses. An accumulation of gene expression data from different projects described herein were also combined with previously published L. salmonis transcriptomic datasets to make cross-study comparisons and consensus-based gene annotation and characterization.
Meta-analysis of male and female L. salmonis transcriptomes revealed important insights on sexual selection and its relationship with sexually dimporphic traits in lice.
Markers were identified for both reproduction and the sexually dimorphic nature of drug resistance, immunity, mobility, and energy expenditure, among other traits.
Additionally, male-biased genes appear to be evolving faster than female-biased or unbiased genes, potentially explaining sex differences related to drug resistance. The physiology of lice when exposed to two commonly used delousing drugs, cypermethrin
iv and emamectin benzoate (EMB), was also assessed and characterized across baseline variables such as sex and population. The presence of a novel, vertically-transmitted microsporidian infection was also described in relation to EMB exposed lice, revealing sophisticated patterns of gene expression that included stress-specific genes, general stress genes, and genes that respond non-additively to stress. From a broader perspective, data from multiple studies was used to provide robust annotation of genes involved in stress, including 50 secretory and excretory protein (SEP) genes that respond concordantly to chemical exposures, microsporidian infection, and other environmental challenges such as hyposalinity. These genes are overexpressed in feeding lice compared to starved, and have annotations for digestion, host- immunomodulation, and antimicrobial effects. Other stress markers include heat shock proteins Hsp27 and Hsp70, which respond to stress generally, and could have important roles in future L. salmonis studies. Finally, the efficacy, ultrastructural impacts, and molecular responses of L. salmonis to the most recently licensed therapeutant, lufenuron, was described for the first time. Lufenuron is a chitin synthesis inhibitor and the first new louse drug on the market in nearly two decades. In this work, novel assays were designed to test the physiological responses of lice to this drug without using salmon hosts, and transcriptomic and metabolomic responses were integrated with observations from transmission electron microscopy to describe the failed molting process. Altogether, the work described in this dissertation represents the most comprehensive analysis of gene function in L. salmonis, offering new targets for parasite control, drug resistance monitoring, and stress detection for future work.
v ACKNOWLEDGEMENTS Special thanks to…
my supervisor, Dr. Mark Fast for his mentorship during my PhD program and for providing me with a strong framework to explore new scientific ideas. Thank you for the amazing opportunity, valuable guidance and support.
my committee members, Drs. John Burka, Gary Conboy, Rob Hurta, and Fred Kibenge for the thought-provoking discussions on novel approaches to my experiments and interpretations.
Drs. Ben Sutherland, Sara Purcell, and Laura Braden for their mentorship and collaboration on many projects throughout my degree. I look forward to continuing our work into the future!
Thank you to Dr. Ben Koop and members of of the Koop Lab for hosting me over 5 months in Victoria, BC – you are all awesome! To Drs. Simon Jones and Shona Whyte, thank you for your help with the design, interpretation, and writing of during our collaborations. I am also very grateful for having the unwaivering support of Dr. Marva Sweeney-Nixon throughout all of my degrees at UPEI.
To all Hoplites, thank you for including me in your research, for the many discussions, stimulating debates, and coffees.
Thank you to the funding agencies that supported my research during my PhD: National Sciences and Engineering Research Council of Canada, Canada Excellence Research Chair, Mitacs Canada, Elanco Animal Health, Novartis Animal Health, University of Prince Edward Island, and Atlantic Veterinary College.
To my family – Thank you to my parents for pushing me to pursue my interests and for inspiring me to leave it all on the ice. Also, thank you to my brother, Jason for reminding me that my interpretation of “cool” is different from that of most people’s.
A special thank you to my finacée, Kayla for her support throughout this journey, for believing in me no matter the circumstances, and especially for helping me design and practice my presentations. For all of the late night drive-thru dates, study breaks, and encouragement, thank you! I love you so much!
vi LIST OF TABLES Table 1.1: Classes of drugs used to treat sea lice
Table 2.1: Sex-biased contigs in three populations of L. salmonis
Table 2.2: Degree of sex-bias in three L. salmonis populations using consensus sex- biased transcripts.
Table 2.3: Transcripts linked to male reproduction based on expression profiles and annotation.
Table 3.1: Primers and assay parameters for RT-qPCR
Table 4.1: Microsporidia (MS) Facilispora margolisi infections in adult female salmon lice Lepeophtheirus salmonis (F0) and their F1 larval progeny as determined by PCR.
Table 4.2: Unique SwissProt IDs for transcripts differentially expressed by EMB exposure and F. margolisi infection.
Table 4.3: Transcripts expressed exclusively in MS+ pre-adult L. salmonis, putatively of microsporidia F. margolisi origin
Table 5.1: Health status of L. salmonis exposed to 1.0 μg L-1 cypermethrin for 24 h (Bioassay I) or 5.0 μg L-1 cypermethrin for 30 min before 23.5 h seawater holding (Bioassay II).
Table 5.2: Proteases differentially expressed by cypermethrin treatment
Table 6.1: All differentially expressed transcripts in lufenuron-treated vs control lice
Table 6.2: GO categories enriched by transcripts downregulated by lufenuron exposure
Table 6.3: Differential metabolite signatures of lufenuron-treated lice compared to controls.
Table A.1: Experimental design for RNA profiling
Table A.2: Pacific lice degradative enzyme suppression from EMB
Table A.3: Survival differences between Atlantic populations
Table A.4: Overview of factors influencing Atlantic lice transcriptomes
vii LIST OF FIGURES
Figure 2.1: Principal Component Analysis of three populations of L. salmonis
Figure 2.2: A consensus approach to identify sex-biased transcripts in L. salmonis
Figure 2.3: Co-expressed transcripts with putative roles in male reproduction
Figure 2.4: Candidate sex-biased transcripts involved with sensory system related functions in L. salmonis
Figure 3.1: Expression of nAChα7 across sexes and populations of L. salmonis.
Figure 3.2: Expression of nAChα3 across sexes and populations of L. salmonis
Figure 3.3: Effects of sex, population, and EMB on LR9 gene expression
Figure 3.4: Expression of p-glycoprotein between sex and population combinations.
Figure 4.1: Vertical transmission of Facilispora margolisi in Lepeophtheirus salmonis
Figure 4.2: Experimental design for the transcriptome response of copepodid lice to emamectin benzoate (EMB) and/or microsporidia (MS).
Figure 4.3. Principal Component Analysis of copepodids exposed to F. margolisi and/or EMB clustered by gene expression
Figure 4.4. Significantly differentially expressed transcripts in response to the microsporidia F. margolisi, to the parasiticide EMB, or an interaction of the two
Figure 4.5: Stressor interacting genes clustered by expression profiles
Figure 4.6: Multiple experiment analysis of double stressor down-regulated genes
Figure 5.1: Larvae bioassay apparatus
Figure 5.2: Principal Component Analysis (PCA) of salmon louse samples (500 copepodids) exposed to cypermethrin or seawater.
Figure 5.3: Matabolic signaling pathway putatively controlling the transcriptomic response of L. salmonis to cypermethrin
Figure 5.4: Hierarchical clustering of transcripts involved in cell signaling
Figure 5.5: L. salmonis sequences annotated to cytochrome p450s are overexpressed by cypermethrin
Figure 5.6: Hierarchical clustering of candidate stress markers in L. salmonis
viii Figure 6.1: Effects of lufenuron on L. salmonis infection
Figure 6.2: Development of Lepeophtheirus salmonis following eggstring/nauplii I treatment with seawater (SW), SW + acetone (Control), or seawater + acetone + 500 ppb lufenuron
Figure 6.3: Principal Component Analysis (PCA) of L. salmonis exposed to multiple concentrations of lufenuron
Figure 6.4: Chitin synthesis pathway derived from Drosophila melanogaster (KEGG: dme00520) showing genes are conserved across insects and copepods
Figure 6.5: Lepeophtheirus salmonis expression of phosphoacetylglucosamine mutase showing a concentration-dependent induction under lufenuron exposure
Figure 6.6: Heatmap of chitin/cuticle-related transcripts differentially expressed by at least one concentration of lufenuron
Figure 6.7: Heatmap of correlation coefficients (Pearson’s r) derived from a pairwise comparison (all against all) of cuticle/chitin-related transcripts differentially expressed by at least one concentration of lufenuron
Figure 6.8: Images of control Lepeophtheirus salmonis nauplii II integument and underlying tissue during apolysis using electron microscopy
Figure 6.9: Images of Lepeophtheirus salmonis nauplii II integument and underlying tissue during apolysis 24 h post lufenuron treatment using electron microscopy.
Figure 6.10: Images of control Lepeophtheirus salmonis copepodid integument using electron microscopy
Figure 6.11: Images of Lepeophtheirus salmonis copepodid integument 48 h post lufenuron treatment using electron microscopy
Figure A.1: Pacific lice degradative enzyme and transporter suppression
RT-qPCR confirmed the down-regulation at 50 ppb of degradative enzymes
Figure A.2: Principal component analysis of samples based on gene expression
Figure A.3: Expression of genes potentially related to resistance in Atlantic lice
Figure A.4: Genes responding to EMB specifically in resistant females
ix LIST OF ABBREVIATIONS
ACP – accessory gland proteins ANOVA – analysis of variance ATP – adenosine triphosphate AVC – Atlantic Veterinary College Aza- Azamethiphos BC – British Columbia BLAST – basic local alignment search tool BMA – bay management area bp – base pair BPU – benzoylurea CaCO3 – calcium carbonate CBD – chitin binding domain CDD – conserved domain database cDNA – complementary DNA CNRQ – calibrated normalized relative quantities Cq – quantification cycle CV – coefficient of variation Cyper - cypermethrin CYP – cytochrome Cy3 – cyanine 3 dye Cy5 – cyanine 5 dye DAVID – database for annotation, visualization, and integrated discovery DDT – dichlorodiphenyltrichloroethane Delta – delamethrin DFO – Department of Fisheries and Oceans DIG - dioxygenin DNA – deoxyribonucleic acid dN – non-synonymous mutation dph – days post hatch dS – synonymous mutation EC50 – half maximal effective concentrations EMB – emamectin benzoate ENSEMBL – European Molecular Biology Laboratory EST – expressed sequence tags FC – fold change GABA – gamma-Aminobutyric acid GC-MS – gas chromatography – mass spectrometry GEO – gene expression omnibus GluCl – glutamate gated chloride channel GO – gene ontology H2O2 – hydrogen peroxide HMSC – Huntsman Marine Science Centre HSD – honest significant difference IgSF – immunoglobulin superfamily
x IL - interleukin IRAC – insecticide resistance action committee ISH – in situ hybridization IVM – ivermectin kdr – knockdown resistance KEGG – Kyoto encyclopedia of genes and genomes L – litre LC-QTOF/MS – liquid chromatography quadruple time of flight mass spectrometry Mb – megabases MDR – multi-drug resistance mg – milligram MHC – major histocompatibility complex ML – macrocyclic lactone MS – male specific (Chapter 2) MS – microsporidian (Chapter 4) MS+ - Facilispora margolisi positive MS- - Facilispora margolisi negative nAChR – nicotinic acetylcholine receptor NB – New Brunswick NBF – neutral buffered formalin NCBI – National Center for Biotechnology Information NF-H2O – nuclease free water NTC – no template control PBO – piperonyl butoxide PC – principal component PCA – principal components analysis PIR – protein information resource PMT – photomultiplier tube PO – propylene oxide ppb – parts per billion PVC – polyvinyl chloride QC – quality control qPCR - quantitative polymerase chain reaction RNA – ribonucleic acid RNAi – RNA interference rRNA – ribosomal RNA RT – reverse transcription SD – standard deviation SEP – secretory and excretory products SFP – seminal fluid protein SLC – solute carrier SNP – single nucleotide polymorphism SP – Swiss Prot SSU rDNA – small subunit ribosomal DNA SUR – sulfonyl urea receptor SW – seawater
xi TEM – transmission electron microscopy TIC – total ion count TNF – tumor necrosis factor tRNA – transfer RNA Tryp-sp trypsin-like serine protease TSA - transcriptome Shotgun Assembly UniProt – universal protein resource USD – U.S dollar μg – microgram μM – micrometer
xii TABLE OF CONTENTS TRANSCRIPTIONAL SIGNATURES OF SEXUAL SELECTION, STRESS, AND DEVELOPMENT IN SALMON LICE (LEPEOPHTHEIRUS SALMONIS)...... I THESIS/DISSERTATION NON-EXCLUSIVE LICENSE ...... II CERTIFICATION OF THESIS WORK ...... III ABSTRACT ...... IV ACKNOWLEDGEMENTS ...... VI DEDICATION ...... ERROR! BOOKMARK NOT DEFINED. LIST OF TABLES ...... VII CHAPTER 1: INTRODUCTION ...... 1 1.1 OVERVIEW & OBJECTIVES ...... 1 1.2 BACKGROUND ...... 2 1.2.1 Subspecies and life cycle of L. salmonis ...... 3 1.2.2 Effects of L. salmonis on salmon physiology...... 5 1.3 CONTROLLING SEA LICE IN AQUACULTURE ...... 8 1.3.1 Chemical control strategies ...... 9 1.3.2 Drug resistance in L. salmonis ...... 12 1.3.3 Alternative control measures...... 16 1.4 MOLECULAR GENETICS OF SALMON LICE...... 18 1.5 CHARACTERIZING NON-MODEL ORGANISMS THROUGH TRANSCRIPTOMICS ...... 21 CHAPTER 2: SEX-BIASED GENE EXPRESSION AND SEQUENCE CONSERVATION IN ATLANTIC AND PACIFIC SALMON LICE (LEPEOPHTHEIRUS SALMONIS) ...... 23 ABSTRACT ...... 24 2.1 INTRODUCTION ...... 25 2.2 MATERIALS AND METHODS ...... 27 2.2.1 Lepeophtheirus salmonis populations and collections ...... 27 2.2.2 Atlantic and Pacific L. salmonis Microarray Datasets ...... 28 2.2.3 Sex-biased Gene Expression in L. salmonis ...... 30 2.2.4 Sequence conservation in sex-biased and unbiased transcripts ...... 31 2.2.5 Novel transcript discovery using sex-biased orphans ...... 32 2.3 RESULTS...... 32 2.3.1 Sex-biased gene expression in L. salmonis ...... 32 2.3.2 Sequence conservation in sex-biased transcripts ...... 34 2.3.3 Consensus of sex-biased transcripts in three populations of L. salmonis ...... 35 2.3.4 Male-biased transcripts in three populations of L. salmonis ...... 37 2.3.5 Female-biased transcripts in three populations of L. salmonis ...... 47 2.3.6 Annotation of L. salmonis sex-biased orphan contigs ...... 49 2.4 DISCUSSION ...... 50 2.4.1 Discovery of sex-biased transcripts related to reproduction in L. salmonis ...... 52 2.4.2 Sex-biased transcription related to sexually dimorphic phenotypes of L. salmonis ...... 56 2.4.3 Strengths and limitations of using a consensus-based approach to identify sex-bias ...... 59 2.4.4 Conclusions ...... 60 AVAILABILITY OF DATA AND MATERIALS ...... 61 SUPPORTING INFORMATION (ADDITIONAL FILES) ...... 61 ACKNOWLEDGEMENTS ...... 61
xiii CHAPTER 3: TOWARDS A CONSENSUS: MULTIPLE EXPERIMENTS PROVIDE EVIDENCE FOR CONSTITUTIVE EXPRESSION DIFFERENCES AMONG SEXES AND POPULATIONS OF SEA LICE (LEPEOPHTHEIRUS SALMONIS) RELATED TO EMAMECTIN BENZOATE RESISTANCE ...... 62 ABSTRACT ...... 63 3.1 INTRODUCTION ...... 64 3.2 METHODS ...... 66 3.3 RESULTS & DISCUSSION ...... 70 3.3.1 Conclusions ...... 77 ACKNOWLEDGEMENTS ...... 78 CHAPTER 4: EFFECTS OF THE VERTICALLY TRANSMITTED MICROSPORIDIAN FACILISPORA MARGOLISI AND THE PARASITICIDE EMAMECTIN BENZOATE ON SALMON LICE (LEPEOPHTHEIRUS SALMONIS)...... 79 ABSTRACT ...... 80 4.1 INTRODUCTION ...... 81 4.2 METHODS ...... 85 4.2.1 Animals ...... 85 4.2.2 Culture of L. salmonis larvae ...... 85 4.2.3 Polymerase chain reaction (PCR) detection ...... 86 4.2.4 Exposure of salmon to L. salmonis ...... 86 4.2.5 Histology ...... 87 4.2.6 In-situ hybridization probe design, synthesis and assay ...... 87 4.2.7 Exposure to EMB and extraction of RNA ...... 88 4.2.8 Microarray Analysis ...... 89 4.2.9 Pre-adult L. salmonis exposed to EMB ...... 90 4.3 RESULTS...... 92 4.3.1 Vertical transmission of F. margolisi ...... 92 4.3.2 Histological identification of F. margolisi in L. salmonis ...... 94 4.3.3 Transcriptomic response of copepodid salmon lice to F. margolisi ...... 95 4.3.3.1 Overview ...... 95 4.3.3.2 MS-specific response genes...... 96 4.3.3.3 General stress response genes...... 98 4.3.3.4 Interacting stressor response genes ...... 100 4.3.4 Microsporidian genes on the salmon louse microarray ...... 104 4.4 DISCUSSION ...... 106 4.4.1 Microsporidia transmission and stage-specific effects ...... 106 4.4.2 Lice response to F. margolisi ...... 108 4.4.3 Non-additive impacts on lice hosts from parasiticide and microsporidia ...... 109 4.4.4 Non-host material in next-generation sequencing data ...... 111 4.4.5 Conclusions ...... 111 AVAILABILITY OF DATA AND MATERIALS ...... 112 SUPPORTING INFORMATION (ADDITIONAL FILES) ...... 112 ACKNOWLEDGEMENTS ...... 112 CHAPTER 5: CYPERMETHRIN EXPOSURE INDUCES METABOLIC AND STRESS- RELATED GENE EXPRESSION IN COPEPODID SALMON LICE (LEPEOPHTHEIRUS SALMONIS) ...... 113 ABSTRACT ...... 114
xiv 5.1 INTRODUCTION ...... 115 5.2 METHODS ...... 117 5.2.1 Parasite collection and culture ...... 117 5.2.2 Cypermethrin bioassays and survival analysis ...... 118 5.2.3 RNA extraction and purification ...... 120 5.2.4 Microarray Analysis ...... 120 5.2.5 Consensus response to other stressors in L. salmonis ...... 121 5.2.6 Microarray validation and RT-qPCR exploration ...... 122 5.3 RESULTS...... 124 5.3.1 Efficacy of in vitro cypermethrin exposures ...... 124 5.3.2 Global gene expression profiles of L. salmonis exposed to cypermethrin ...... 125 5.3.3 Cypermethrin exposure alters the expression of genes in stress signaling pathways ...... 126 5.3.4 Differential expression of metabolic enzymes ...... 129 5.3.5 Development and transport-related transcripts respond to cypermethrin ...... 133 5.3.6 Consensus transcripts responding to stress across L. salmonis studies ...... 134 5.3.7 Newly annotated transcripts responding to cypermethrin in L. salmonis ...... 136 5.4 DISCUSSION ...... 137 5.4.1 Metabolic enzymes are induced by cypermethrin exposure ...... 139 5.4.2 Stress-signaling transcripts are differentially expressed by cypermethrin ...... 142 5.4.3 Conclusions ...... 145 AVAILABILITY OF DATA AND MATERIALS ...... 146 SUPPLEMENTARY INFORMATION (ADDITIONAL FILES) ...... 146 ACKNOWLEDGEMENTS ...... 146 CHAPTER 6: HIGH LEVEL EFFICACY OF LUFENURON AGAINST SEA LICE (LEPEOPHTHEIRUS SALMONIS) LINKED TO RAPID IMPACT ON MOULTING PROCESSES ...... 147 ABSTRACT ...... 149 6.1 INTRODUCTION ...... 150 6.2. MATERIALS & METHODS ...... 152 6.2.1 Lice collection and culture ...... 152 6.2.2 Lufenuron bioassays...... 152 6.2.3 In vivo challenge with lufenuron ...... 155 6.2.4 RNA extraction ...... 156 6.2.5 Microarray ...... 156 6.2.6 RT-qPCR...... 157 6.2.7 Metabolomics ...... 159 6.2.8 Transmission electron microscopy ...... 159 6.3 RESULTS...... 160 6.3.1 Impacts of lufenuron on survival ...... 160 6.3.2 Impacts of lufenuron on L. salmonis gene expression ...... 163 6.3.2.1 Expression differences in early moulting and chitin synthesis ...... 164 6.3.2.2 Cuticle-related transcripts are downregulated by lufenuron ...... 168 6.3.2.3 Expression of developmental genes after exposure to lufenuron ...... 170 6.3.2.4 Genes related to the stress response ...... 172 6.3.3 Metabolomics discovery ...... 173 6.3.4 Impacts of lufenuron on ultrastructure of the cuticle ...... 175 6.4 DISCUSSION ...... 180 6.4.1 Efficacy of lufenuron against sea lice ...... 181 6.4.2 Impacts of lufenuron on L. salmonis physiology ...... 182 6.4.3 Drug resistance in sea lice ...... 188
xv 6.4.4 BPUs for controlling sea lice ...... 190 6.4.5 Conclusions ...... 191 AVAILABILITY OF DATA AND MATERIALS ...... 191 COMPETING INTERESTS ...... 191 SUPPLEMENTAL INFORMATION (ADDITIONAL FILES) ...... 192 ACKNOWLEDGEMENTS ...... 192 CHAPTER 7: DISCUSSION ...... 193 7.1 CLUSTERING ANALYSES LEAD TO PUTATIVE GENE ANNOTATIONS ON A LARGE SCALE ...... 194 7.2 CONSENSUS-BASED GENE ANNOTATION FOR DETERMINING MOLECULAR MARKERS ...... 195 7.3 DRUG RESISTANCE IN L. SALMONIS ...... 198 7.4 FUTURE DIRECTIONS ...... 200 APPENDIX 1: TRANSCRIPTOMIC RESPONSES TO EMAMECTIN BENZOATE IN PACIFIC AND ATLANTIC CANADA SALMON LICE LEPEOPHTHEIRUS SALMONIS WITH DIFFERING LEVELS OF DRUG RESISTANCE ...... 202 ABSTRACT ...... 203 A.1 INTRODUCTION...... 203 A.2 MATERIALS AND METHODS ...... 207 A.2.1 Pacific salmon lice collection, EMB exposure and RNA extraction ...... 207 A.2.2 Atlantic salmon lice collection, EMB exposure, and RNA extraction ...... 209 A.2.3 cDNA preparation and microarray hybridization ...... 210 A.2.4 Transcriptome analyses ...... 211 A.2.5 Reverse transcription quantitative polymerase chain reaction (RT-qPCR) ...... 213 A.3 RESULTS ...... 215 A.3.1 Transcriptomic effects of emamectin benzoate (EMB) exposure in Pacific lice ...... 215 A.3.2 EMB sensitivity differences between Atlantic lice populations ...... 217 A.3.3 Comparative influence of sex, population and EMB on Atlantic lice transcriptomes ...... 218 A.3.4 Genes differing in baseline expression between populations in both sexes (Atlantic) ...... 221 A.3.4 Genes differing in baseline expression between populations in only one sex (Atlantic) ...... 222 A.3.5 Genes responding to EMB in both sexes and populations (Atlantic) ...... 224 A.3.6 Genes responding to EMB specifically in one sex-population combination (Atlantic) ...... 225 A.3.6 Additional RT-qPCR exploration ...... 225 A.4 DISCUSSION ...... 228 A.4.1 Lack of induced transcriptional responses from EMB ...... 228 A.4.2 Degradative enzymes and other potential resistance candidates ...... 230 A.4.3 Relevance for aquaculture...... 234 A.4.4 Conclusions ...... 235 AVAILABILITY OF DATA AND MATERIALS ...... 235 SUPPLEMENTARY INFORMATION (ADDITIONAL FILES) ...... 235 ACKNOWLEDGEMENTS ...... 236 REFERENCES...... 237
xvi 1 Chapter 1: Introduction
2 1.1 Overview & Objectives 3 The research described in this dissertation focused on the functional characterization
4 and annotation of the salmon louse (Lepeophtheirus salmonis (Krøyer, 1837))
5 transcriptome. Primary aims included bridging knowledge gaps in sexual selection,
6 reproduction, stress responses, drug resistance, and development in this economically
7 important, non-model parasite. The projects described herein will largely focus on the
8 molecular responses of L. salmonis when exposed to different parasiticides used in
9 Atlantic salmon (Salmo salar (Linnaeus, 1758)) aquaculture. These molecular responses
10 are further characterized by assessing their interaction across sexes, populations, stages,
11 or in the presence of a biotic stressor. A commonly used L. salmonis microarray was a
12 key analytical tool of this work, enabling high-resolution analyses of louse physiology
13 by monitoring the expression of ~20,000 transcripts. The specific objectives of this
14 work were to:
15 i. Characterize baseline transcriptome differences between male and female L.
16 salmonis to better understand sexual selection, sexual dimorphism, and
17 reproduction.
18 ii. Compare patterns of gene expression in lice with differing sensitivity to the
19 delousing agent emamectin benzoate to uncover genes involved in resistance.
20 iii. Explore transcriptomic responses of L. salmonis to different stressors and
21 identify genes with general, specific, or non-additive responses to stress.
1 22 iv. Determine the physiological responses of L. salmonis to lufenuron, a chitin
23 synthesis inhibitor and the newest chemical therapy to be licensed for sea lice in
24 Atlantic salmon aquaculture.
25 1.2 Background 26 Sea lice are ectoparasitic copepods of the family Caligidae (Burmeister, 1885), a group
27 that parasitizes a wide range of marine fishes. Species of Caligus and Lepeophtheirus
28 are the best-studied genera from this family, largely due to their importance in Atlantic
29 salmon (Salmo salar) aquaculture (Johnson et al., 2004) and wild salmon ecology
30 (Costello, 2006). Lice infections alter host physiology, even at low numbers, through
31 feeding on host mucus, epidermis, and blood (Wagner et al., 2008). The degree of
32 damage inflicted by sea lice varies depending on the intensity of infection (Wagner et
33 al., 2008), environmental factors (e.g. season; Boxaspen, 2006), and the profiles of
34 stage, sex and species of attached lice (Boltaña et al., 2016; Wagner et al., 2008).
35 Overall, sea lice cost the global aquaculture industry a minimum of USD 500 million
36 per year (Costello, 2009; Liu and Bjelland, 2014). Impacts on wild populations of
37 salmon are complex and more difficult to quantify (Helland et al., 2015). Nonetheless,
38 lice transmission between wild and farmed salmon is expected (Krkošek et al., 2005),
39 which could impact conservation efforts for wild salmon (Godwin et al., 2015). The
40 salmon louse (Lepeophtheirus salmonis) is largely responsible for these challenges in
41 the Northern Hemisphere, while problems in the Southern Hemisphere are frequently
42 caused by Caligus rogercresseyi (Burka et al., 2012). Other Caligus sp. are also present
43 globally depending on the location and hosts present (Pike and Wadsworth, 1999), but
44 are typically less prevalent (Johnson and Jakob, 2012). The following thesis is limited to
2 45 salmon louse (L. salmonis) responses under different experimental conidtions, and
46 therefore further background and discussion will be focused on this species.
47 1.2.1 Subspecies and life cycle of L. salmonis 48 There are two allopatric subspecies of L. salmonis; one in the Atlantic Ocean (L.
49 salmonis salmonis) and one in the Pacific Ocean (L. salmonis oncorhynchi) (Skern-
50 Mauritzen et al., 2014). These subspecies have co-evolved on different salmonids for
51 2.5 – 11 million years (Yazawa et al., 2008), but are nonetheless reproductively
52 compatible without the loss of fitness for up to two generations (Skern-Mauritzen et al.,
53 2014). Weak population structure is also characteristic of both subspecies due to
54 panmixia (Besnier et al., 2014; Glover et al., 2011; Messmer et al., 2011). Yazawa et al.,
55 (2008) compared thousands of Atlantic and Pacific ESTs alongside the mtDNA genome
56 for each subspecies, reporting an average divergence of 3.2% for nuclear genes and
57 7.1% for the entire mitochondrial genome. Aside from differences in morphology
58 (Johnson and Albright, 1991; Schram, 1993) and drug susceptibility (Aaen et al., 2015;
59 Saksida et al., 2013), unique physiology, behavior, or host interactions associated with
60 Atlantic or Pacific strains of L. salmonis have yet to be tested directly.
61 Salmon louse development occurs in eight life stages, each of which is separated
62 by a moult (Hamre et al., 2013). The life cycle begins with hatching of nauplius larvae
63 from egg strings where the louse will remain free-floating through two moults (nauplii I
64 to II and nauplii II to copepodid). During these larval stages, lice depend on yolk stores
65 as an energy source (Pike and Wadsworth, 1999). These stores decline with age (Dalvin
66 et al., 2009), and at around day 5 post-moulting to copepodids, the probability of host
67 settlement becomes significantly lower than for recently moulted individuals (Tucker et
68 al., 2000). Copepodid-staged larvae are the first-infectious stage of lice, which use
3 69 kairomones and mechanoreception to locate a host (Mordue and Birkett, 2009). The
70 salmon louse shows strong host specificity towards salmonids, with a few reports of
71 certain life stages on other fish, and appears to differ between the two subspecies (Burka
72 et al., 2012; Jones and Prosperi-Porta, 2011). Genes controlling both host discrimination
73 and verification have recently been identified (Komisarczuk et al., 2017). Interupting
74 host location and/or recognition is an active area of sea lice research (Núñez-Acuña et
75 al., 2016; O’Shea et al., 2017).
76 Lice typically settle on fins or in protected areas (e.g. inside of the mouth,
77 behind the operculum) using maxillae to grasp the fish (Bron et al., 1991; Treasurer and
78 Wadsworth, 2004). Second antennae are then hooked into the epithelium before a
79 frontal filament is extruded to anchor the louse beneath the epithelium for subsequent
80 moulting (Bron et al., 1991). Copepodids moult through two chalimus stages (chalimus
81 I and II) in situ before developing sequentially to mobile pre-adult I, II, and adult stages.
82 On average, the moult through chalimus stages at 10oC takes 12 and 14 days for males
83 and females, respectively (Hamre et al., 2013). Although slight differences in
84 cephalothorax size of chalimus II lice can be used to initially determine sex
85 phenotypically (Eichner et al., 2015b; Hamre et al., 2013), dimorphism of the genital
86 segments are not present until the pre-adult stages (Ritchie et al., 1996). Males reach the
87 pre-adult and adult stages faster than females (Hamre et al., 2013; Johnson, 1993),
88 potentially as a mechanism of mate selection related to adult males forming mate-pairs
89 with pre-adult II females (Hull et al., 1998; Ritchie et al., 1996). Extensive
90 morphological changes also occur in recently moulted adult females, characterized by
91 moult completion, post-moulting growth, and egg production (Eichner et al., 2008).
4 92 Observations of the mating process are described by Ritchie et al., (1996), which
93 ultimately involves a pair of spermatophores being deposited onto the adult female
94 genital segment, blocking the copulatory ducts and preventing further insemination
95 (Pike and Wadsworth, 1999). Post-copulatory mate guarding is also common (Ritchie et
96 al., 1996), and sperm can be stored in seminal receptacles of the female for weeks (Huys
97 and Boxshall, 1991). Despite these behaviours to increase success of first copulatory
98 males, polyandry has been observed in L. salmonis, resulting in clutches with multiple
99 paternal inputs (Todd et al., 2005). Pairs of egg strings are first observed at
100 approximately 10 days post moulting to adult females at 10oC (Eichner et al., 2008) and
101 females can produce up to 11 pairs of egg strings in a lifetime (up to 191 days at 7oC),
102 with each pair producing approximately 300 viable eggs (Heuch et al., 2000).
103 1.2.2 Effects of L. salmonis on salmon physiology 104 Atlantic salmon infected with sea lice present with skin lesions (Jónsdóttir et al., 1992),
105 increased stress (Fast et al., 2006), altered swimming behavior (Bui et al., 2016), and
106 lower feeding rates (i.e. reduced growth (Godwin et al., 2015) compared to uninfected
107 individuals. Mortality is also a concern, especially at higher infestation pressures (Pike
108 and Wadsworth, 1999). Attachment sites and grazing areas of mobile L. salmonis are
109 characterized by inflammation, edema, and hyperplasia (Jónsdóttir et al., 1992), which
110 form gross lesions, and lead to scale loss and hemorrhaging in epizootics (Pike and
111 Wadsworth, 1999). Lice induced skin lesions also compromise the primary
112 immunological barrier of the fish, leading to secondary infections (Johnson and
113 Albright, 1992) . This is paired with the potential for sea lice to directly transmit other
114 pathogens to salmon as disease vectors (Novak et al., 2016), and therefore, the true
115 impact of L. salmonis can be difficult to quantify.
5 116 The molecular and biochemical signatures of infected Atlantic salmon include
117 changes in the mucosal microbiome (Llewellyn et al., 2017) and biochemistry (Fast et
118 al., 2002; Ross et al., 2000), blood parameters (Fast et al., 2006; Grimnes and Jakobsen,
119 1996), brain serotonergic activity (Øverli et al., 2014), and local (i.e. site of louse
120 attachment) and systemic gene expression (Braden et al., 2015a, 2012a; Fast et al.,
121 2006; Skugor et al., 2008; Sutherland et al., 2014). However, the physiological impacts
122 of L. salmonis infections on salmon strongly depends on the species (Fast et al., 2002),
123 size (Sutherland et al., 2011), and life stage (Braden et al., 2015a) of the host.
124 Susceptibility to L. salmonis has a significant genetic component, likely involving
125 thousands of loci in the genome (Hamilton et al., 2017). Generally, Atlantic salmon
126 (Salmo salar), chum salmon (Oncorhynchus keta), and sockeye salmon (Oncorhynchus
127 nerka) are considered to be very susceptible to sea lice infections while coho salmon
128 (Oncorhynchus kisutch) and pink salmon (Oncorhynchus gorbuscha) are resistant
129 (Braden et al., 2015b; Fast et al., 2002; Sutherland et al., 2014). Still, other salmonids
130 such as rainbow trout (Oncorhynchus mykiss) and chinook salmon (Oncorhynchus
131 tshawytscha) display intermediate resistance to these infections (Fast et al., 2002;
132 Johnson, 1993; Johnson and Albright, 1992). Comparative analyses of different host
133 responses to lice infections have been useful in understanding the mechanisms
134 underlying successful parasite rejection.
135 In resistant salmonids, lice settlement results in a rapid and pronounced
136 inflammatory response combined with epithelial hyperplasia at the site of attachment
137 (Johnson and Albright, 1992). Early cellular infiltrate consists of neutrophils and
138 lymphocytes while more chronic responses also include macrophages (Johnson and
6 139 Albright, 1992). The response of interleukin (IL) 1β+, tumor necrosis factor (TNF) α+,
140 and major histocompatibility complex (MHC) II+ cells at the site of infection is
141 exaggerated and occurs earlier in resistant salmon (Braden et al., 2015b). Other genes
142 involved in inflammation (e.g. IL10, TNFβ, COX2), the acute phase response (e.g.
143 complement components c3 and c7), and tissue remodeling (e.g. MMP13) also show
144 unique expression profiles in resistant individuals (Braden et al., 2015b, 2012; Jones et
145 al., 2007; Sutherland et al., 2014). These expression profiles correspond to a
146 hyperplastic lesion at the site of louse attachment, which partially or fully engulfs the
147 parasite before it is sloughed off in mucus (Johnson and Albright, 1992; Jones, 2013).
148 Overall, lice rejection in resistant salmonids is characterized by an early, pronounced,
149 and regulated innate response.
150 Atlantic salmon lack a sufficient defense to reject salmon lice, largely due to a
151 poorly timed, weak inflammatory response to attachment. At a molecular level,
152 responses to lice are described as bi-phasic, where an initial, ineffective inflammatory
153 response involving increased expression of immune markers similar to those described
154 for resistant salmonids (e.g. IL-1β, TNFα) is followed by downregulation of these genes
155 during chalimus development (Fast et al., 2006; Skugor et al., 2008). A second wave of
156 inflammation corresponding with lice moulting to mobile pre-adults is then observed
157 (Fast et al., 2006; Skugor et al., 2008); however, due to the importance of a localized
158 innate response, it is unsuccessful at removing mobile lice. This host response may be
159 due to superior immunomodulation of Atlantic salmon, as the expression of several
160 genes decreases exclusively in this host at the louse attachment site (Braden et al.,
161 2012). It is therefore clear that salmonids have different types and degrees of immune
7 162 responses toward L. salmonis infections. However, the host-parasite relationship of
163 salmon and lice is dynamic, and involves both the host immune response and lice
164 secretory and excretory products (SEPs; Fast et al., 2007).
165 Lice SEPs are characterized by low molecular weight trypsin-like serine
166 proteases and prostaglandin E2 (Fast et al., 2003; Firth et al., 2000) and are thought to
167 have important roles in immune evasion, host vasodilation, and tissue digestion
168 (Johnson et al., 2002). Fast et al., (2007) demonstrated the suppression of IL1β
169 expression in an LPS-stimulated Atlantic salmon head kidney cell line (SHK-1) exposed
170 to a fraction of lice secretory products containing, among other things, trypsins.
171 Trypsins are also found in the excretions from Ixodes scapularis, a species of tick which
172 displays a diverse profile of proteases, protease inhibitors, degradative enzymes, and
173 solute transporters in their saliva (Gulia-Nuss et al., 2016). More recent transcriptome
174 studies have shed light on this gene repertoire in L. salmonis (ssp. oncorhynchi) by
175 comparing fed lice to starved lice at 24 and 48 h (Braden et al., 2017). Many trypsin-
176 like serine proteases were overexpressed in the fed lice, alongside carboxypeptidases,
177 cysteine-type endopeptidases, and cytochrome P450s. These genes are also important
178 candidates for better understanding co-evolution of salmon and lice, as their expression
179 is dependent on the host species (Braden et al., 2017).
180 1.3 Controlling sea lice in aquaculture 181 There are numerous approaches for controlling sea lice in Atlantic salmon aquaculture.
182 These strategies can broadly be categorized into two groups depending on whether the
183 intervention includes the use of a chemical.
8 184 1.3.1 Chemical control strategies 185 Five classes of chemicals are licensed to treat sea lice in Atlantic salmon aquaculture,
186 including bath administered pyrethroids, organophosphates and hydrogen peroxide
187 (H2O2), and in-feed avermectins and benzoylureas (summarized in Igboeli et al. (2014)).
188 Some regions such as Norway have routinely used all available compounds to treat lice
189 infestations, while other regions (e.g. Canada) have been limited to a select few
190 treatment options based on local licensing and regulations (summarized in (Aaen et al.,
191 2015)). The frequency of treatments also varies depending on region, as farming sites
192 near wild salmon runs have strict treatment thresholds based on the number of gravid
193 females per fish. In Norway, this threshold is set conservatively at 0.5 females/fish
194 during the winter and 0.2 females/fish during times of salmon migration (Lovdata,
195 2012). In British Columbia, higher treatment thresholds (3 motiles/fish; DFO, 2017) are
196 paired with coordinated treatments during juvenile pink salmon migrations (Peacock et
197 al., 2013), whereas no treatment threshold exists in Eastern Canada. Globally, chemical-
198 based therapies are the most effective treatment strategy used against sea lice in Atlantic
199 salmon aquaculture.
200 Table 1: Classes of drugs used to treat sea lice Example Mechanism of Class Administration Compound Action Inihibition of Organophosphate Bath Azamethiphos acetylcholinesterase Irreversible opening Pyrethroid Bath Cypermethrin of sodium channel Target site Oxidizing Agent Bath Hydrogen Peroxide unknown Macrocyclic Emamectin Irreversible opening In-feed Lactone Benzoate of GluCl- channel May inhibit Benzoylurea In-feed Lufenuron chitin synthase 1
9 201 Chemical interventions for sea lice can be optimized by accounting for water
202 temperature, weather, drug residual time, treatment frequency (i.e. drug rotation),
203 genetic profiles (i.e. status of resistance within a population), the stages involved in the
204 infection, and the status of co-infection. Accurate dosing and drug rotation are essential
205 for avoiding or prolonging the development of resistance (Sangster, 2001). However,
206 both the bath and in-feed treatment methods have challenges with dosing as compared
207 to parasiticide administration in agriculture. In the case of bath treatments, the lipophilic
208 nature of pesticides and drugs can lead to inadequate mixing with seawater, creating
209 pockets with sub-therapeutic concentrations of the chemical in skirt and tarpaulin-based
210 bath treatments. Alternatively, salmon are pumped into well boats for bath treatments,
211 which may lead to stress and skin abrasions. With in-feed treatments, dosing issues are
212 due to uneven feeding rates between individuals in the cage, especially when diseased
213 fish cease to eat (Whyte et al., 2011). Despite increasing supplementation of non-
214 chemical alternative strategies for lice control, the five chemical classes currently used
215 in aquaculture are still heavily relied upon to manage sea lice.
216 The mode of action for chemical therapies used to treat sea lice vary widely,
217 with differences in their pharmacodynamics, spectrum of activity, and duration of
218 protection offered. Three of the chemical classes are considered to be neurotoxins and
219 include pyrethroids [cypermethrin (Cyper) and deltamethrin (Delta)], organophosphates
220 (azamethiphos; Aza), and avermectins [emamectin benzoate (EMB) and ivermectin
221 (IVM)]. Both the pyrethroids and organophosphates induce an excitatory paralysis in
222 exposed lice through irreversible depolarization of neurons (Elliott, 1989; Karami-
223 Mohajeri and Abdollahi, 2011). Pyrethroids bind para-sodium channels in their open
10 224 conformation, leading to an uncontrolled influx of Na+ ions into the cell (Soderlund,
225 2011). Conversely, organophosphates bind the acetylcholinesterase enzyme, preventing
226 the inactivation (i.e. cleaving) of acetylcholine (ACh) in synaptic clefts (Pope et al.,
227 2005). The spectrum of activity for pyrethroids ranges across all stages while
228 organophosphates appear to only impact mobile stages of lice (Aaen, 2016). Although
229 the mechanisms responsible for these stage differences remain unclear, it is nonetheless
230 important for advising optimal management strategies.
231 The mechanism of action for macrocyclic lactones (ML) differs from that of
232 pyrethroids and organophosphates in that a flaccid paralysis results through irreversible
233 hyperpolarization of lice muscle and neurons post-exposure (Stone et al., 1999;
234 Wolstenholme and Rogers, 2005). Specifically, EMB and IVM bind glutamate-gated
235 chloride channels, maintaining an open confirmation which leads to an influx of
236 chloride ions into neurons. From a pharmacokinetic perspective, IVM has a lower
237 therapeutic index than EMB and is known to cause lethargy post-treatment due to
238 greater accumulation in the brain (Sevatdal et al., 2005a).
239 The remaining chemical treatments, H2O2 and benzoylureas, have less defined
240 mechanisms of action in sea lice. Hydrogen peroxide is a popular treatment for other
241 fish diseases (e.g. amoebic gill disease, saprolegnia, etc.), and was adopted for use
242 against sea lice in the early 1990s (Thomassen, 1993). One proposed mechanism for
243 H2O2 action is the formation of an oxygen bubble in hemolymph (Bruno and Raynard,
244 1994), which causes the louse to detach and float to the surface of the water. Lice
245 recovery and reattachment post-H2O2 treatment has been observed (Johnson et al., 1993;
246 McAndrew et al., 1998). Along with the pyrethroids, organophosphates, and EMB,
11 247 resistance to H2O2 has been reported (Helgesen et al., 2015), making the benzoylureas
248 the only class of chemicals where drug resistance is not an issue for sea lice
249 management (discussed below). Benzoylureas are chitin synthesis inhibitors, and may
250 not have issues with resistance due to more limited use (Igboeli et al., 2014), as
251 environmental and pharmacokinetic considerations are important with these
252 compounds. Specifically, high concentrations of the available benzoylureas,
253 teflubenzuron and diflubenzuron, are required to reach adequate dosing due to poor
254 absorption (approximately 3.75%) across the gastrointestinal tract (Pike and
255 Wadsworth, 1999). This in turn presents problems for surrounding ecosystems, as these
256 compounds have long residence times in sediment and affect benthic arthropod
257 moulting (Haya and Davies, 2005). Nonetheless, studies on teflubenzuron
258 administration to farmed Atlantic salmon showed 70-80% decreases in overall sea lice
259 abundance on fish (Ritchie et al., 2002) and is still used in some farming regions.
260 1.3.2 Drug resistance in L. salmonis 261 Drug resistance is a microevolutionary phenomenon observed in many pathogens of
262 human, veterinary, and agricultural importance. Resistance is observed when the
263 proportion of drug tolerant individuals in a population is higher than that of a normal
264 population of the same species and is inherited (Prichard et al., 1980). In L. salmonis,
265 high reproductive capacity (Todd et al., 2005), panmixia (Besnier et al., 2014; Glover et
266 al., 2011), a highly polymorphic genome, and the overall low therapeutic indeces of
267 most delousing chemicals (Haya and Davies, 2005) have set the stage for the emergence
268 of resistant populations. The prolonged use of five chemical classes to treat sea lice has
269 now led to the selection of multiple-resistant populations across the Atlantic Ocean,
270 while the Pacific salmon louse remains sensitive to EMB and H2O2, the only treatments
12 271 used on the West Coast to date. The organophosphates were the first chemical class
272 used for sea lice control starting in the 1970s in Norway (Roth et al., 1993). Issues with
273 resistance to these compounds were documented in the 1990s, leading to temporary
274 cessation of the treatments before continuing use in 2008 (Aaen et al., 2015). Despite
275 emamectin benzoate having replaced the organophosphates for nearly a decade during
276 this time, resistance was observed shortly after the re-introduction of organophosphates
277 in 2009 (Kaur et al., 2017). Several regions such as Norway and Atlantic Canada
278 continue to use oragnophosphates and other drugs on populations of lice known to be
279 resistant to these compounds (Gautam et al., 2017; Atlantic Canada Fish Farmers
280 Association, 2015, https://www.barentswatch.no/).
281 The mechanisms of resistance to some chemicals are known and genetic markers
282 for screening and improved management have helped advance policy. For example,
283 PatoGen Analyse AS recently developed a high-throughput screening assay based on
284 the discovery of a nonsynonymous SNP (Phe362Tyr) in the acetylcholine esterase 1
285 gene of L. salmonis (ace1) (Kaur et al., 2015b). This SNP controls Aza resistance across
286 the Atlantic Ocean (Kaur et al., 2017, 2015b), and was used to screen 6658 lice
287 collected from 55 different farm sites across the Norwegian coast in the largest
288 molecular screening effort for L. salmonis to date (Kaur et al., 2016). This assay can
289 also detect whether an individual is heterozygous or homozygous for Phe362Tyr,
290 providing important estimates related to specific population (e.g. farm site) tolerances
291 (Kaur et al., 2016, 2015b). Similarly, 31 SNPs related to deltamethrin resistance have
292 been discovered across 10 mitochondrial genes (Carmona-Antoñanzas, G Bekaert et al.,
293 2017; Nilsen and Espedal, 2015), and could be used for screening strategies similar to
13 294 that of the Phe362Tyr assay. However, the majority of these SNPs were discovered
295 using lab-bred strains of lice that differed in Delta sensitivity by ~143-fold (Carmona-
296 Antoñanzas, G Bekaert et al., 2017) and, therefore, field validation is still required.
297 Unfortunately, the mechanisms of resistance for other sea lice treatments such as EMB
298 and H2O2 are less clear.
299 Upon the release of EMB as a treatment for sea lice in early 2000, many regions
300 used the drug exclusively as it offered better efficacy and a broad spectrum of activity
301 compared to other available compounds. The therapeutic index was also much wider
302 than a commonly used analogue, IVM, which had frequently been used off-label before
303 EMB was available (Davies and Rodger, 2000). Overall, male lice are more tolerant to
304 EMB than females, regardless of the degree to which a population is EMB resistant
305 (Igboeli et al., 2013). EMB-resistant and sensitive strains have been compared using
306 transcriptomics, which suggests a polygenic mechanism controls resistance to EMB
307 (Appendix 1). Some studies have shown unique acetylcholine receptor (AChR)
308 expression profiles associated with EMB sensitivity, where the AChRα3 subunit is
309 expressed highest in the sensitive population and AChRα7 is expressed higher in
310 resistant lice (Chapter 3;Carmichael et al., 2013a; Sutherland et al., 2015). Similarly,
311 AChRα3 and AChRα7 are highest expressed in females and males, respectively (Chapter
312 2;Sutherland et al., 2015). Another gene classically involved in IVM resistance, p-
313 glycoprotein (pgp), has also been associated with EMB sensitivity (Igboeli et al., 2012);
314 although this finding has been inconsistent (Chapter 2; Sutherland et al., 2015). More
315 research is required to elucidate potential SNPs in the target site as well as other
316 possible mechanisms such as decreased cuticular absorption and detoxification.
14 317 Interestingly, no fitness cost was associated with EMB resistance over four generations
318 (Espedal et al., 2013).
319 Resistance to H2O2 has been reported in Scotland (Treasurer et al., 2000) and
320 more recently in Norway (Helgesen et al., 2015) and is associated with increases in the
321 expression and activity of catalase (cat), an antioxidant enzyme responsible for
322 decomposing H2O2 into water and oxygen. However, resistance monitoring in the field
323 is extremely limited for this compound and much work remains to determine the degree
324 of resistance within different populations and the mechanism(s) responsible for
325 increased tolerance.
326 The benzoylureas are the only class of licensed delousing compounds where
327 resistance has not been reported for any population of L. salmonis (Aaen et al., 2015).
328 Teflubenzuron and/or diflubenzuron are currently used against sea lice in many
329 countries including Canada (ACFFA, 2016; Burridge et al., 2010). With the recent
330 release of another benzoylurea for sea lice control (Chapter 6), screening efforts will be
331 important in determining the rise of resistance against these compounds. The
332 mechanisms of benzoylurea resistance in other arthopods are similar to those of the
333 pyrethroids, where a SNP in the binding site (Douris et al., 2016) and/or selected
334 overexpression of metabolic enzymes (e.g. Cytochrome P450s; Bogwitz et al., 2005) is
335 responsible. To date, resistance monitoring for sea lice has occurred long after
336 resistance has been selected and when interventions are unlikely to be successful.
337 Although improvements in determining individual treatment efficacies have been made
338 using publicly available lice counts and treatment data (see:
339 https://www.barentswatch.no/en/fishhealth/), other regions such as Eastern Canada have
15 340 only been screened for EMB (Jones et al., 2013) and Aza (Kaur et al., 2017) resistance.
341 As mechanisms of resistance become known, screening efforts will greatly improve
342 management and policy associated with treatment decisions, timing, and selection.
343 Furthermore, qualities such as the type (i.e. monogenic or polygenic) and nature (i.e.
344 cross-resistance) of resistance will offer important insights on future strategies.
345 1.3.3 Alternative control measures 346 Numerous non-chemical control strategies have been implemented in salmon
347 aquaculture to supplement drug and pesticide treatments with varying success. Similar
348 to chemical interventions, the type and frequency of alternative treatments vary widely
349 with region. In 2016, Norwary reduced medicinal treatments by 41% due to issues with
350 resistance, but were able to maintain similar overall lice numbers during this time
351 (Helgesen and Jansen, 2017). However, fish injuries and mortalities were higher with
352 the increased non-chemical interventions (Helgesen and Jansen, 2017), perhaps due to
353 the novelty of applying these treatments. Cleaner fish (e.g. wrasse and lumpfish) are the
354 most common alternatives currently used in Europe (Gonzalez and Boer, 2017), and
355 show up to 96% efficacy in tank-based trials with 5% cleaner fish:salmon ratios
356 (Leclercq et al., 2014). These treatments have not yet been implemented in North
357 America, as native cleaner fish (e.g. cunner, Tautogolabrus adspersus) are not suitable
358 (Mackinnon, 1995). Nonetheless, several issues remain to be resolved with the use of
359 this new treatment, largely from an ecological standpoint. For example, the most
360 commonly used type of cleaner fish currently are lumpfish (~65%; (Powell et al.,
361 2017)), which are mainly supplied by fisheries, and may therefore be unsustainable in
362 the long term. Other concerns include escapees and interbreeding between distinct
363 populations of cleaner fish in the wild (Gonzalez and Boer, 2017), the effects of which
16 364 remain unknown. Farming efforts for both lumpfish and other cleaner fish are,
365 however, well underway (Leclercq et al., 2014; Powell et al., 2017), which could help
366 alleviate some of this ecological strain. Additional concerns with cleaner fish include
367 disease transmission to salmon, seasonal efficacy/viability, opportunistic feeding (i.e. on
368 salmon pellets) and preferential feeding on adult lice.
369 Numerous control strategies have been developed based on the phototactic
370 nature and diurnal vertical migration of L. salmonis larvae (Heuch et al., 1995), which
371 are found at high densities in the first few meters of the water column. These include
372 physical barriers (e.g. sieves, snorkel cages; Stien et al., 2016), specialized underwater
373 feeding systems and strategic light manipulation (Frenzl et al., 2014) to help reduce
374 salmon passing through high-densities of lice larvae. Additionally, filtration systems
375 have been developed for well and harvest boat discharge to avoid re-introducing lice
376 onto farm sites (O’Donohoe and McDermott, 2014). Simple, holisitic changes such as
377 these have been part of the important progression towards improved management in this
378 maturing industry.
379 Functional feeds against sea lice provide a promising addition (or
380 supplementation) to current chemical control measures, with some in use and others
381 currently in development. Immunostimulant diets have reduced lice counts between 30-
382 50% in some lab-based trials, concomitant to increased expression of known resistance
383 markers (e.g. IL1β) (Covello et al., 2012; Poley et al., 2013; Sutherland et al., 2017).
384 Fine tuning of the host response and optimizing the effects of these feeds is progressing
385 with molecular based analyses of the host response to these treatments (Jodaa Holm et
386 al., 2016; Núñez-Acuña et al., 2015; Núñez-Acuña et al., 2016; Purcell et al., 2013;
17 387 Skugor et al., 2016). However, higher range efficacies achieved with some chemicals
388 continue to outcompete these products for widespread use. Other alternative treatments
389 currently in production include the lice laser (Beck Engineering), vaccines (Carpio et
390 al., 2011; Raynard et al., 2002), repellants (Hastie et al., 2013; O’Shea et al., 2017),
391 closed containment pens (Nilsen et al., 2017), integrated multitrophic aquaculture
392 (Bartsch et al., 2013), selective breeding (Gharbi et al., 2015), and mechanical delousing
393 (Sletmoen, 2016). Important future steps with alternative treatments will include an
394 expansion of efficacy data, especially from the field, where the viability of single and
395 combination treatments can be accurately assessed.
396 1.4 Molecular genetics of salmon lice 397 The L. salmonis genome is available in multiple assemblies including three for the
398 Atlantic subspecies and one for the Pacific subspecies. Researchers in Western Canada
399 created contig-based assemblies for both male and female L. salmonis salmonis
400 genomes (NCBI, 2015; BioProject: PRJNA280127) and a female sample of L. salmonis
401 oncorhynchi (NCBI, 2010; BioProject: PRJNA40179). Another contig-based assembly
402 of L. salmonis salmonis is available in ENSEMBL (LSalAtl2s, 2013), which predicts
403 that the genome has approximately 13,000 protein-coding genes and 420 small non-
404 coding genes. Licebase, a consortium that makes some L. salmonis genomic data public,
405 can be used to probe the genome for annotations (https://licebase.org/). Unfortunately, a
406 genomic map is not presently accessible to all researchers. The mitochondrial genome
407 of L. salmonis is published (Carmona-Antoñanzas, Bekaert et al., 2017; Yasuike et al.,
408 2012), and contains 12-13 protein coding genes, 21-22 tRNA genes, and 2 rRNA genes.
409 Transcriptomic resources for L. salmonis and other sea lice species have largely been
18 410 created through EST generation with contiguous transcript assemblies (Yasuike et al.,
411 2012; Yazawa et al., 2008) and, to date, microarrays are the most popular tool for
412 monitoring global gene expression profiles of L. salmonis (see Carmichael et al., 2013b;
413 Dalvin et al., 2009; Edvardsen et al., 2014; Eichner et al., 2015a, 2008; Yasuike et al.,
414 2012) for all microarray platforms). Other transcriptomic tools that have been used for
415 studying L. salmonis include a 6000 SNP array (Besnier et al., 2014), RNA sequencing
416 (Carmona-Antoñanzas et al., 2015), and RT-qPCR (e.g. Chapter 2, many others
417 referenced herein).
418 Gene expression studies have greatly improved our understanding of baseline
419 differences related to L. salmonis physiology. The majority of variation in lice
420 transcriptomes can be attributed to differences between males and females where
421 approximately 40% of all transcripts are expressed higher in one sex compared to the
422 other (Chapter 2). Similarly, expression profiles vary widely across life stages ((Eichner
423 et al., 2008); Chapter 4; https://licebase.org/) and populations differing in drug
424 resistance (Appendix 1). Although tissues such as gut, brain, subcuticular epithelium,
425 etc. differ in their gene expression profiles (Edvardsen et al., 2014), individual tissue
426 extractions have been rare in gene expression studies executed thus far and, instead,
427 whole-body homogenates and pooling have been used to provide generalized expression
428 patterns for L. salmonis. Future studies targeting tissue specific expression will likely
429 gain high-resolution insight into the degree of transcriptomic change occurring in
430 samples, e.g. isolation of the gut transcriptome during feeding or subcuticular tissue
431 during moulting. The sea lice research community continues to improve aspects of
432 study design and sample collection to best answer important research questions.
19 433 Transcriptomic responses to stress have been studied using EMB exposures
434 (Carmichael et al., 2013b), starvation (Braden et al., 2017), hyposalinity and
435 temperature (Sutherland et al., 2012). Lice also display unique expression profiles when
436 infecting different species of salmon (Braden et al., 2017) and immunostimulated
437 Atlantic salmon (Sutherland et al., 2017), suggesting certain host environments may be
438 stressful or suboptimal to the louse. Recently, L. salmonis infected with the
439 microsporidium Facilispora margolisi (Jones et al., 2012a), showed similar
440 transcriptome profiles to those observed after EMB exposure (Chapter 4), providing the
441 first evidence on the influence of lice microbiomes on basal gene expression. Other,
442 more targeted assessments have also been completed on genes such as
443 acetylcholinesterase 1 and 2 (Kaur et al., 2015a) and aquaporins (Stavang et al., 2015)
444 where phylogenetics was paired with gene expression data to provide further
445 characterization. However, the most effective tool for characterizing the function of
446 individual L. salmonis genes has been transcript knockdown using RNA interference
447 (RNAi; Eichner et al., 2014).
448 Adult females exposed to double-stranded (ds) RNA targeting the L. salmonis
449 yolk-associated protein (LsYAP), ecdysone receptor (LsEcR), retinoid X receptor
450 (LsRXR), iron regulatory proteins 1 and/or 2 (LsIRP1 and LsIRP2), a chitinase (LsChi2),
451 or the microsomal triglyceride transfer protein (LsMTP) resulted in reproductive and/or
452 developmental abnormalities often associated with decreased infectivity and mortality
453 (Dalvin et al., 2009; Eichner et al., 2015a, 2015c; Khan et al., 2017; Sandlund et al.,
454 2016, 2014; Tröße et al., 2015). Similarly, the knockdown of LsCOPB2 and LsKEDL,
455 genes found in the ovaries, eggs, and gut of adult female L. salmonis resulted in the
20 456 absence of egg string production entirely (Tröße et al., 2014). Important physiological
457 insights have also been drawn for the infective copepodid stage of lice, including
458 LsHXP1 knockdown on swimming activity (Øvergård et al., 2017) and LsalIR25a and
459 LsalIR8b knockdown on host discrimination and recognition (Komisarczuk et al.,
460 2017). Other RNAi experiments did not produce a detectable phenotypic change
461 (Eichner et al., 2015d, 2014), suggesting possible compensatory mechanisms or the
462 need for higher-resolution analyses to detect physiological manifestations. The
463 characterization of L. salmonis genes by RNAi continues to expand, and will provide
464 novel targets for potential control strategies and improved annotation in future
465 experiments.
466 1.5 Characterizing non-model organisms through transcriptomics 467 Model organisms are species that have been studied extensively in at least one facet of
468 their biology, offering essential information on conserved entities (e.g. genetics, cell
469 signaling) across taxa. Based on common descent (Darwin, 1871), annotated nucleotide
470 and protein sequences from model organisms can be used to extrapolate biological
471 features to less-studied organisms (i.e. non-model organisms), for example in cases
472 where systems biology is applied to study plasticity (Aubin-Horth and Renn, 2009).
473 Conserved genes involved in core functions such as cell division, DNA repair, and
474 protein synthesis allow for in silico homology-based annotation across a wide range of
475 eukaryotes. However, some components of biological processes such as ontogeny,
476 behavior, reproduction, and metabolism are taxa-specific. Annotation via sequence
477 homology therefore becomes dependent on the evolutionary proximity of the nearest
478 model organism and the presence and quality of exisiting annotations for that species.
21 479 The majority of model arthropods are insects and roundworms, which leaves at least
480 500 million years of divergence between L. salmonis and popular genomic models such
481 as Drosophila melanogaster (Lee et al., 2013; Osorio et al., 1997; Regier et al., 2010).
482 Therefore, some genes with conserved functions across Arthropoda can be annotated
483 easily via local alignment algrorithms (Marchler-Bauer et al., 2014; UniProt, 2015),
484 while others are likely to remain unknown (Khalturin et al., 2009) until experimental
485 evidence is provided for a relevant species.
486 Differential gene expression can be measured to detect phenotypic plasticity and
487 evolved responses between populations (DeBiasse and Kelly, 2015). Basal gene
488 expression differences, such as those between sexes or populations, can provide key
489 insights on selection and adaptation (Ellegren and Parsch, 2007; Gleason and Burton,
490 2015), while expression responses to environmental perturbations can reveal
491 mechanisms of plasticity (Aubin-Horth and Renn, 2009). Of course, the interaction
492 between genotype and responses to the environment is also of interest (DeBiasse and
493 Kelly, 2015). There are many tools for annotating these responses at the gene level,
494 including sequence alignments (Marchler-Bauer et al., 2014), Gene Ontology (Primmer
495 et al., 2013), clustering algorithms (Stuart et al., 2003), and pathway analysis (Kanehisa
496 and Goto, 2000), among other more novel approaches such as ecological annotation,
497 which describes environment-dependent gene function (Landry and Aubin-Horth,
498 2007). Therefore, this dissertation will use transcriptomics for the annotation of L.
499 salmonis genes that respond generally, specifically, or synergistically to environmental
500 perturbations and that differ in baseline expression between sexes, populations, and
501 stages to describe plasticity and adaptation in this important non-model parasite.
22 502 Chapter 2: Sex-biased gene expression and 503 sequence conservation in Atlantic and Pacific 504 salmon lice (Lepeophtheirus salmonis)
505 Adapted from : Jordan D. Poley1, Ben J. G. Sutherland2,3, Simon R. M. Jones4, Ben 506 F. Koop2, Mark D. Fast1. (2016) BMC Genomics 17:483.
507 1Atlantic Veterinary College, University of Prince Edward Island, Department of 508 Pathology & Microbiology, 550 University Ave, Charlottetown PE, C1A 4P3, Canada
509 2Centre for Biomedical Research, Department of Biology, University of Victoria, 3800 510 Finnerty Rd, Victoria BC, V8W 3N5, Canada
511 3Institut de Biologie Intégrative et des Systèms (IBIS), Département de biologie, 512 Université Laval, 1030 Avenue de la Medecine, Québec, QC Canada
513 4Pacific Biological Station, 3190 Hammond Bay Road, Nanaimo BC, Canada V9T 6N7
514 JDP contributed meta-analyses of sex-biased transcripts from all data sets, result 515 interpretation, wrote manuscript.
516 BJGS assisted with experimental design, microarray experiments, transcriptome 517 analysis, and writing
518 SRMJ designed the experiments, collected Pacific lice, writing
519 BFK: designed the experiments, analysis, writing
520 MDF: designed the experiments, collected Atlantic lice, writing
521 Copyright 2016. The authors
23 522 Abstract 523 Salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae), are highly important
524 ectoparasites of farmed and wild salmonids, and cause multi-million dollar losses to the
525 salmon aquaculture industry annually. Salmon lice display extensive sexual dimorphism
526 in ontogeny, morphology, physiology, behavior, and more. Therefore, the identification
527 of transcripts with differential expression between males and females (sex-biased
528 transcripts) may help elucidate the relationship between sexual selection and sexually
529 dimorphic characteristics. Sex-biased transcripts were identified from transcriptome
530 analyses of three L. salmonis populations, including both Atlantic and Pacific
531 subspecies. A total of 35-43% of all quality-filtered transcripts were sex-biased in L.
532 salmonis, with male-biased transcripts exhibiting higher fold change than female-biased
533 transcripts. For Gene Ontology and functional analyses, a consensus-based approach
534 was used to identify concordantly differentially expressed sex-biased transcripts across
535 the three populations. A total of 127 male-specific transcripts (i.e. those without
536 detectable expression in any female) were identified, and were enriched with
537 reproductive functions (e.g. seminal fluid and male accessory gland proteins). Other
538 sex-biased transcripts involved in morphogenesis, feeding, energy generation, and
539 sensory and immune system development and function were also identified.
540 Interestingly, as observed in model systems, male-biased L. salmonis transcripts were
541 more frequently without annotation compared to female-biased or unbiased transcripts,
542 suggesting higher rates of sequence divergence in male-biased transcripts.
543 Transcriptome differences between male and female L. salmonis described here provide
544 key insights into the molecular mechanisms controlling sexual dimorphism in L.
545 salmonis. This analysis offers targets for parasite control and provides a foundation for
24 546 further analyses exploring critical topics such as the interaction between sex and drug
547 resistance, sex-specific factors in host-parasite relationships, and reproductive roles
548 within L. salmonis.
549 2.1 Introduction 550 Sexual dimorphism describes the phenotypic differences between sexes of the same
551 species. It is ubiquitous across the animal kingdom and is favored through a
552 combination of sexual selection, intersexual competition for resources, and fundamental
553 differences in reproductive roles (Darwin, 1871; Hedrick and Temeles, 1989; Slatkin,
554 1984). Genes overexpressed in one sex relative to the other are known as sex-biased
555 genes, and include genes expressed in both sexes (but higher in one) or genes expressed
556 in only one sex (sex-specific; reviewed in Ellegren and Parsch, 2007; Parsch and
557 Ellegren, 2013). A large proportion, often greater than 50%, of genes exhibit sex-biased
558 expression in many species including fruit flies Drosophila spp. (Catalán et al., 2012;
559 Ranz et al., 2003), the nematode Caenorhabitis elegans (Reinke et al., 2004), parasitic
560 flatworms Schistosoma spp. (Fitzpatrick et al., 2005, 2004), the water flea Daphnia
561 pulex (Eads et al., 2007), the African clawed frog Xenopus laevis (Malone et al., 2006),
562 the songbirds Taeniopygia guttata and Sylvia communis (Naurin et al., 2011), the olive
563 flounder Paralichthys olivaceus (Fan et al., 2014), the mouse Mus musculus (Yang et
564 al., 2006), and humans Homo sapiens (Khaitovich et al., 2005; Rinn and Snyder, 2005).
565 This trend is largely driven by expression differences in the gonad. As such,
566 transcriptome profiling is a highly useful approach to understand the mechanisms
567 underlying sexual dimorphism and reproduction.
568 Crustaceans are one of the most diverse animal taxa, comprising more than 850
25 569 families with approximately 67,000 species (Ahyong et al., 2011; Martin and Davis,
570 2001). They are ecologically important, serving essential roles in the food chain and
571 primary production in marine ecosystems (Carpenter et al., 1985). Furthermore,
572 crustaceans play important roles in aquaculture as both farmed animals (62 species
573 worth over USD 34.8 billion per year; (Fisheries and Aquaculture Department, 2013,
574 2012) and as parasites of farmed fish (Boxshall, 2005). Most parasitic crustaceans are
575 species within the class Copepoda, which displays a vast array of sexual dimorphism in
576 anatomy, reproductive roles, sensory systems, and host/parasite relationships (Boxshall,
577 2005). One of the most studied parasitic copepod, the salmon louse Lepeophtheirus
578 salmonis, causes more than USD 480 million in losses to the Atlantic Salmon (Salmo
579 salar) aquaculture industry annually (Costello, 2009). Additionally, drug resistant
580 strains of L. salmonis (and other sea lice species) have emerged globally (reviewed by
581 Aaen et al., 2015), threatening the sustainability and productivity of the industry.
582 Lepeophtheirus salmonis displays sexual dimorphism among several
583 morphological, physiological, and behavioural characters. This phenomenon is observed
584 in the motile parasitic stages of the lice (pre-adult I, II, and adult) although sex-specific
585 differences in cephalothorax size and molt timing are also evident at preceding stages
586 (Eichner et al., 2015b). In addition, males develop faster than females, but they mature
587 at approximately half the size of the adult female (Eichner et al., 2015b; Hamre et al.,
588 2013; Johnson and Albright, 1991). Sex differences in the morphology of the genital
589 segment, abdomen, and appendages occur in all motile stages (Johnson and Albright,
590 1991). Distinct sex-associated behavioral characteristics related to reproductive success
591 including frequency of host switching (Hull et al., 1998; Wotton et al., 2014;
26 592 Stephenson, 2012), mate location (Ingvarsdóttir et al., 2002), blood feeding (Brandal et
593 al., 1976), and mate-guarding (Hull et al., 1998; Ritchie et al., 1996) have also been
594 reported. Sexually dimorphic physiology is also evident when L. salmonis are exposed
595 to a commonly used antiparasitic compound, emamectin benzoate (EMB). Although
596 EMB-resistance is widespread (Aaen et al., 2015), males consistently show higher
597 tolerance to EMB compared with females, regardless of the overall level of resistance
598 within the population (Igboeli et al., 2013; Sutherland et al., 2015; Whyte et al., 2013).
599 However, the molecular mechanisms underpinning sex-specific anatomy, behavior, and
600 physiology in L. salmonis, and copepods in general, remain poorly understood.
601 The present study investigates sex-biased gene expression in three populations
602 of L. salmonis using newly-generated transcriptomic data from Pacific Canada L.
603 salmonis as well as a novel analysis of an available published dataset from Atlantic
604 Canada L. salmonis (Sutherland et al., 2015). A consensus-based, meta-analysis
605 approach was used to identify sex-biased transcripts putatively responsible for sexual
606 dimorphism in L. salmonis. Additionally, L. salmonis sequence conservation with
607 related species (UniProt or Conserved Domain Database; e < 10-10) was integrated with
608 sex-biased expression results to investigate sex-specific selective pressure and genomic
609 constraint.
610 2.2 Materials and Methods
611 2.2.1 Lepeophtheirus salmonis populations and collections 612 Adult L. salmonis were collected from Atlantic salmon aquaculture farms on the
613 Atlantic and Pacific coasts of Canada. Two populations of Atlantic L. salmonis were
614 collected in the spring of 2013 from Bay Management Area 2a (BMA-2a; Back Bay)
27 615 and 2b (BMA-2b; Grand Manan) in the Bay of Fundy, New Brunswick (NB), as
616 described in full previously (Igboeli et al., 2013; Sutherland et al., 2015). A third
617 population representing Pacific L. salmonis was collected from the Broughton
618 Archipelago, British Columbia (BC) in 2010. Atlantic and Pacific L. salmonis are
619 considered allopatric subspecies (Skern-Mauritzen et al., 2014). For all collections, egg
620 strings were removed from adult females and larvae reared to the infective copepodid
621 stage in static seawater hatch systems as previously described (Igboeli et al., 2013).
622 Copepodids (F1 generation) were then used to infect Atlantic salmon (Salmo salar) and
623 allowed to develop to the pre-adult II stage. Pre-adult (F1) lice from all populations
624 were used in 24 h in vitro EMB bioassays (described below) before collection and
625 storage at -80oC for RNA extraction. The Pacific lice experiment was approved under
626 the Fisheries and Oceans Canada Pacific Region Animal Care Committee protocol
627 number 09-001. For Atlantic lice experiments, please see (Sutherland et al., 2015).
628 2.2.2 Atlantic and Pacific L. salmonis Microarray Datasets 629 Two microarray datasets were used to compare sex differences in L. salmonis from the
630 Atlantic (2013 collection) and Pacific (2010 collection) coasts of Canada. The Atlantic
631 dataset was accessed from NCBI through Gene Expression Omnibus (GEO) accession
632 GSE56024 (Sutherland et al., 2015). In this study a total of 77 pre-adult Atlantic L.
633 salmonis, 38 females and 39 males from BMA-2a and BMA-2b were exposed to four
634 concentrations of EMB (0.1, 25, 300, and 1000ppb) and a seawater control, as
635 previously reported. The bioassay protocol was identical for both populations. This
636 study compared the effects of EMB on L. salmonis including the interactions between
637 population (BMA-2a is more EMB-resistant than BMA-2b; (Jones et al., 2013;
638 Sutherland et al., 2015) and sex. However, baseline differences between males and
28 639 females were not reported. The Pacific dataset was provided by the same laboratory
640 group (B. Koop and S. Jones, unpublished data), which exposed 39 pre-adult Pacific L.
641 salmonis, 21 females and 19 males, to low doses of EMB (0.01, and 0.1ppb) or a
642 seawater control. Lower doses of EMB were selected based on the high EMB-
643 sensitivity of this population (Saksida et al., 2013). For all F1 generation cultures, lice
644 were maintained in filtered seawater at 10 ± 2 oC and 32 ± 2 ppt. The Pacific dataset has
645 been uploaded to GEO under the accession GSE73734.
646 A 38K oligonucleotide microarray (eArray, Agilent) designed with expressed
647 sequence tags (ESTs) from Atlantic and Pacific L. salmonis (Yasuike et al., 2012) was
648 used to analyze all lice in this study. Annotation of each contig was completed using
649 BLASTx and RPS-BLAST against SwissProt and Conserved Domain Database (e < 10-
650 10), respectively. A total of 18 – 21 hybridizations for each sex and population
651 combination (117 total hybridizations) were completed. Hybridizations were completed
652 using methods for sample preparation, microarray hybridization, and scanning as
653 previously reported (Sutherland et al., 2015, 2012). Briefly, all slides were scanned
654 using a Perkin Elmer ScanArray® at 5 μm resolution and optimized PMT intensities (1-
655 2% of array spots saturated). Filtering and quantification was completed using Imagene
656 8.1 (Biodiscovery) before completing statistical analyses in GeneSpring GX v12.6
657 (Agilent). A quality control (QC) filtered probe list was created for each population
658 (Table 1) with probes included for statistical analysis only if at least 65% of the samples
659 in any one condition had raw fluorescent intensities ≥ 500 and showed no poor quality
660 spots.
29 661 2.2.3 Sex-biased Gene Expression in L. salmonis 662 Microarray data was used to characterize baseline expression differences between male
663 and female L. salmonis. Sex-biased probes were identified using a two-way ANOVA
664 with sex and EMB as explanatory variables (Benjamini-Hochberg multiple test
665 correction; p < 0.01; fold change (FC) ≥ 1.5). The effects of EMB on Atlantic L.
666 salmonis transcriptomes was minor (Sutherland et al., 2015) and a significant
667 transcriptomic effect was not detected in Pacific L. salmonis used here (i.e. no probes
668 showed differential expression by EMB). The effects of EMB exposures were also
669 controlled for in the statistical model by only using transcripts affected by a main effect
670 of sex and through consensus-based analyses (described below). All probes with a main
671 effect of sex for each individual population are compiled into Additional File 1.
672 Sex-biased probes from each population were used to create a consensus list for
673 functional analyses. This list was limited to probes exhibiting significant and concordant
674 sex-bias in all three populations of L. salmonis described here (Fig 2). Sex-biased
675 probes from individual population analysis can be found in Additional File 1, while sex-
676 biased probes identified using the consensus sex-biased method can be found in
677 Additional File 2. As duplicate probes represent unique contigs (i.e. transcripts) on the
678 array (Yasuike et al., 2012), contig IDs are also included in the additional files. The
679 variation between duplicate probes of consensus sex-biased transcripts is quantified in
680 Additional File 2. Only unique transcripts are used to calculate the proportion of sex-
681 biased expression in Atlantic and Pacific L. salmonis.
682 Differences in the degree of sex-bias were assessed by binning transcripts based
683 on their degree of differential expression between male and female L. salmonis (Ranz et
684 al., 2003). Transcripts with low sex-bias were those overexpressed by a fold change
30 685 (FC) of ≥ 1.5 but < 4, while highly sex-biased transcripts had a FC ≥ 4. A mean FC
686 value representing all three populations was also included (Additional File 2). Any
687 transcript that did not pass the background QC filter in 100% of the individuals within
688 one sex was considered to be sex-specific in this study. However, based on lower limits
689 of detection for microarrays, these transcripts may not be biologically sex-specific. A
690 transcript similarity assessment was also completed using all QC-filtered probes against
691 kunitz/BPTI-like toxin (probe ID: C259R052). Transcripts with similar expression
692 patterns to kunitz/BPTI-like toxin were determined using a Pearson’s correlation (0.95 <
693 r < 1.0). These transcripts are described in Additional File 2.
694 Functional enrichment of the consensus sex-biased transcript list was done using
695 Gene Ontology (GO), InterPro, and SwissProt (SP) and Protein Information Resource
696 (PIR) Keywords (SP_PIR_Keywords) with DAVID bioinformatics (Huang et al., 2009,
697 2008; D. W. Huang et al., 2007) using a modified Fisher’s exact test (p < 0.05;
698 genes/enrichment category ≥ 4). Unique SwissProt accession ID’s were compared
699 against a QC filter background list designed to include transcripts passing QC filters in
700 all populations (Table 1). To reduce redundancy of Gene Ontology categories, GO
701 Trimming was used with an 80% soft trim threshold (Jantzen et al., 2011). All GO
702 analyses can be found in Additional File 3.
703 2.2.4 Sequence conservation in sex-biased and unbiased transcripts 704 To investigate rates of sequence divergence in sex-biased transcripts, unique contigs
705 passing QC filter for each population were binned into one of three categories: Male-
706 biased (overexpressed by males), female-biased (overexpressed by females) or unbiased
707 (no expression difference between sexes). All contigs on the microarray were annotated
31 708 using UniProt (UniProt, 2015) and Conserved Domain Database (NCBI, CDD;
709 Marchler-Bauer et al., 2014) with the best match being the alignment with the lowest
710 Expect value followed by the highest bitscore (Yasuike et al., 2012). Transcripts with no
711 significant match (e > 1.0-10) were considered orphans (labeled as “unknown” in
712 additional files). To assess the degree of sequence conservation between male-biased,
713 female-biased and unbiased transcripts, the proportion of orphans relative to annotated
714 transcripts in each of these categories was assessed based on similar methodologies
715 (Cutter and Ward, 2005; Eads et al., 2007). Sequence conservation in male-biased and
716 female-biased transcripts from the consensus list was also analyzed (Table 1).
717 2.2.5 Novel transcript discovery using sex-biased orphans 718 Based on the robust approach using a consensus sex-biased transcript list, orphans
719 showing concordant sex-bias across all populations were re-annotated using a less
720 conservative threshold of e > 1.0-5. This annotation threshold is common amongst other
721 sea lice transcriptomic studies and is generally considered an acceptable cut-off for
722 annotation (Khalturin et al., 2009). This annotation was used for exploratory transcript
723 prediction but not for the main analysis or the Gene Ontology enrichment analysis. Sex-
724 biased orphan annotation results can also be found in Additional File 2.
725 2.3 Results
726 2.3.1 Sex-biased gene expression in L. salmonis 727 Sex-biased transcripts were identified in three populations of pre-adult II L. salmonis
728 using a 38K oligonucleotide microarray. Two of the populations were from the Atlantic
729 subspecies L. salmonis salmonis and were collected from separate bay management
730 areas (BMA-2a and BMA-2b) in the Bay of Fundy, New Brunswick (Sutherland et al.,
731 2015), and the third was from the Pacific subspecies L. salmonis oncorhynchi (Skern-
32 732 Mauritzen et al., 2014) collected from the Broughton Archipelago, British Columbia
733 (BC). Eighteen to 21 F1 generation preadult males and females from each population
734 were analyzed in individual microarray hybridizations (total n = 117 individuals and
735 hybridizations). A total of 34.7 – 42.7% of all unique contigs passing quality control
736 (QC) filters were significantly sex-biased (Benjamini-Hochberg multiple test correction;
737 p < 0.01; fold change (FC) ≥ 1.5) in Atlantic and Pacific L. salmonis (Table 1).
738 Including only the transcripts expressed in both sexes, a Principal Component Analysis
739 (PCA) separated male and female samples along the first principal component (PC1;
740 explaining the most variation) in all three populations, representing 50.2%, 39.5% and
741 53.4% of the transcriptional variation in BMA-2a, BMA-2b, and Pacific lice,
742 respectively (Fig 1). No consistent differences were observed between the proportions
743 of transcripts overexpressed in males relative to females in each population (Table 1).
744 Sex-biased transcripts for each population, including p-values, fold changes,
745 annotations, and accession identifiers, can be found in Additional File 1
746 Table 1: Sex-biased contigs in three populations of L. salmonis Unique Proportion (%) of orphans contigs sex- Male- Female- Lice passing biased biased biased Male- Female- Unbiased QC (%) contigs contigs biased biased filter BMA-2a 11859 34.7 1955 2157 45.1 37.1 33.1 BMA-2b 8527 40.0 1729 1682 48.9 32.8 32.4 Pacific 14923 42.7 3068 3303 51.8 28.3 34.0 Consensus 7889 N/A 368 461 50.7 20.1 N/A
33 747 2.3.2 Sequence conservation in sex-biased transcripts 748 The L. salmonis contigs used for microarray construction (Yasuike et al., 2012) were
749 annotated using BLASTx and RPS-BLAST against SwissProt and CDD, respectively.
750 Contigs without annotation (e > 10-10) are marked as unknown in the additional files.
751 The proportion of orphans relative to annotated transcripts in male-biased, female-
752 biased, and unbiased categories was assessed for each population. This approach has
753 been used in model organisms such as flies and nematodes (Cutter and Ward, 2005;
754 Eads et al., 2007). Male-biased transcripts from all three L. salmonis populations had a
755 higher proportion of orphans compared with female-biased and unbiased transcripts
756 (Table 1). Female-biased and unbiased transcripts did not show consistent differences in
757 the proportion of orphans (Table 1). These data suggest lower sequence conservation of
758 male-biased transcripts in L. salmonis.
34 759 760 Figure 1: Principal Component Analysis of three populations of L. salmonis. 761 Individual lice are represented in blue (males) and red (females). Sexes are separated on 762 PC1 (x-axis) in all populations by 50.2%, 39.5% and 53.4% for BMA-2a, BMA-2b, and 763 Pacific lice, respectively. Only transcripts expressed by both sexes (i.e. excluding sex- 764 specific probes) were included in PCA analysis.
765 2.3.3 Consensus of sex-biased transcripts in three populations of L. salmonis 766 To assess the functional impacts of sex-biased expression in L. salmonis, differentially
767 expressed transcripts between sexes from each population were used to generate a
768 consensus list (Fig 2). A total of 1470 unique transcripts, out of a total of 7889 were
769 shown to be significantly sex-biased in all three populations with 829 of these showing
770 concordant expression profiles (Fig 2; Additional File 2). Using this consensus list (i.e.
35 771 requiring concordant differential expression being identified in all three populations),
772 368 transcripts showed male-bias and 461 were female-biased.
773 774 Figure 2: A consensus approach to identify sex-biased transcripts in L. salmonis 775 Sex-biased transcripts are displayed for each population separately. A consensus on sex- 776 biased expression was achieved by creating a list of transcripts showing concordant 777 differential expression between males and females across all three populations. Sex- 778 biased transcripts for each individual population analysis can be found in Additional 779 File 1 while consensus transcripts are displayed in Additional File 2.
780 As expected from the individual population analyses, consensus male-biased transcripts
781 showed a 2.5-fold higher proportion of orphans compared with those showing female-
782 bias (Table 1). Differences in the degree of sex-biased expression, as measured by fold
783 change (FC) also varied between male- and female-biased transcripts. On average,
784 84.8% of the transcripts overexpressed in females had low sex-bias (FC ≥ 1.5 and ≤ 4),
785 whereas transcripts overexpressed in males had equal proportions of high and low sex-
36 786 bias (Table 2). Interestingly, 127 male-biased transcripts were not expressed above
787 background levels in any of the 58 females assayed and therefore are referred to as
788 male-specific. In contrast, only 20 transcripts were female-specific in the consensus list.
789 Here, fold changes are reported as the range of differential expression between males
790 and females across all populations, unless the transcript was sex-specific, and then it is
791 denoted as such. Fold changes specific to each population for consensus sex-biased
792 transcripts can be found in Additional File 2.
793 Table 2: Degree of sex-bias in three L. salmonis populations using 794 consensus sex-biased transcripts. Proportion (%) Sex-bias Population Low Fold Change High Fold Change (≥ 1.5 but < 4) (≥4 fold) BMA2a 51.5 48.5 BMA2b 55.3 44.7 Male Pacific 37.7 62.3 Mean FC 49.9 50.1 BMA2a 85.5 14.5 BMA2b 98.5 1.5 Female Pacific 77.3 22.7 Mean FC 84.8 15.2
795 2.3.4 Male-biased transcripts in three populations of L. salmonis 796 The majority of annotated male-biased transcripts had roles in reproduction, for
797 example being accessory gland proteins (Acps) and seminal fluid proteins (SFPs;
798 reviewed by Avila et al., 2011). Transcripts known to regulate proteolysis for
799 reproduction-related functions were highly male-biased in L. salmonis and included 16
800 proteases and 13 protease inhibitors, 10 of each being male-specific. However, a high
801 degree of variance was observed in the expression of proteolytic transcripts among
802 Pacific males (Fig 3). To better understand this expression pattern, a transcript similarity
803 assessment using kunitz/BPTI-like toxin (probe ID: C259R052) showed that 110
37 804 transcripts were strongly co-expressed (Pearson’s correlation, 0.95 < r < 1.0; Fig 3).
805 Although Atlantic males showed constitutive expression of these transcripts, Pacific
806 males showed a characteristic “on/off” expression profile, with 10 of 19 individuals
807 showing low, or absence of expression (Fig 3).
808 809 Figure 3: Co-expressed transcripts with putative roles in male reproduction. A 810 total of 110 transcripts were co-expressed with BPTI/kunitz-like toxin (probe ID: 811 C259R052) based on Pearson’s correlation (0.95 < r < 1) against the consensus QC- 812 filtered transcript list (Table 1). Males and females are separated into each population 813 on the x-axis. Normalized relative intensities (y-axis) are represented by log-2 Cy5/Cy3 814 ratios.
815 This co-expressed transcript list contains numerous representatives from known
816 functional categories of male reproduction including peroxidases, pH regulators,
817 kinases, and transporters, among others (Table 3). As seminal fluid proteins (SFPs) are
818 only expressed in males (Chapman, 2001), transcripts exhibiting male-specific
819 expression are putatively assigned as candidate SFPs in L. salmonis. Many of these
38 820 transcripts also enriched the Swiss-Prot (SP) and Protein Information Resource (PIR)
821 Keyword (SP_PIR_Keyword) secreted (19 transcripts; p < 0.0001, Additional File 3),
822 further supporting the involvement of these transcripts as SFPs or accessory gland
823 proteins (reviewed by Avila et al., 2011).
39 824 Table 3: Transcripts linked to male reproduction based on expression profiles and annotation. Degree of Functional CDD Transcript Description Male-bias Probesd References Category Accession (FCc) Protease 30.8 - (Dorus et al., 2010; Keratin-associated protein C088R043 smart00131 inhibitors 277.1 Sonenshine et al., 2011)
e Kunitz_BPTI MS C084R101 smart00131 (Clauss et al., 2011; Costa et al., 2009; Dorus et al., 2010; Kunitz_BPTI MS C057R056 smart00131 Findlay et al., 2008; Rogers et Kunitz_BPTI MS C259R083 pfam00014 al., 2008; Sonenshine et al., 2011; Veselsky et al., 1985) Kunitz/BPTI-like toxina MS C259R052 pfam00014 Papilina MS C063R028 Papilina MS C183R014 pfam00014 (South et al., 2011) Papilina MS C066R049 Papilina MS C142R005 Tissue factor pathway (Clauss et al., 2011; Pilch and MS C213R048 pfam00014 inhibitor 2a Mann, 2006) Antichymotrypsin-2a 2.9 - 4.2 C077R006 cd00172 (Clauss et al., 2011; Dorus et al., 2010; Laflamme and SERine Proteinase MS C215R048 cd00172 Wolfner, 2013; Ram and INhibitors (serpins) Wolfner, 2007; Sonenshine et Serpin-Z10 1.6 - 2.4 C182R015 cd00172 al., 2011)
40 Kinases Adenylate kinase 2.1 - 10.4 C104R155 TIGR01360 isoenzyme1 Adenylate kinase (Dorus et al., 2010; Konno et 1.9 – 4.8 C153R147 isoenzyme1 al., 2015) TIGR01360 Adenylate kinase 2.1 - 7.1 C031R080 isoenzyme1 Casein kinase I isoform MS C070R100 cd14016 alpha (Dorus et al., 2010; Muhlrad Casein kinase I isoform and Ward, 2002) 1.8 - 4.8 C244R145 cd00180 epsilon (Baer et al., 2009; Sonenshine Hexokinase type 2 2.5 - 7.9 C066R139 COG5026 et al., 2011) Probable adenylate kinase 1.9 - 5.7 C212R032 isoenzyme F38B2.4 (Dorus et al., 2010; Konno et TIGR01360 Probable adenylate kinase al., 2015) 2.0 - 5.7 C028R063 isoenzyme F38B2.4 Pyruvate kinase 2.3 – 5.0 C020R004 pfam00224 (Dorus et al., 2010; Pyruvate kinase 2.0 – 4.6 C015R041 cd00288 Sonenshine et al., 2011) Pyruvate kinase 1.9 - 5.0 C155R159
Proteases Calpain-A catalytic subunit MS C197R005 smart00720 (Pilch and Mann, 2006; Calpain-A catalytic subunit MS C018R134 smart00230 Sonenshine et al., 2011) Carboxypeptidase Ba MS C161R058 cd03860 (Baer et al., 2009; Pilch and
41 Mann, 2006) Cytosolic non-specific MS C261R120 COG0624 dipeptidase (Baer et al., 2009; Braswell et al., 2006; Pilch and Mann, Cytosolic non-specific 1.9 - 2.9 C145R086 COG0624 2006) dipeptidase Proprotein convertase 2.5 - 4.2 C118R013 cd00064 (Dorus et al., 2010) subtilisin/kexin type 5a Serine protease persephone MS C118R020 smart00020 (Ligoxygakis et al., 2002) (Netzel-Arnett et al., 2009; Testisin 2.2 – 9.8 C007R130 smart00020 Scarman et al., 2001) Tryp_SPc, Trypsin-like 5.5 – 322.5 C158R134 serine protease (Dorus et al., 2010; Ram and Tryp_SPc, Trypsin-like MS C009R051 smart00020 Wolfner, 2007; Sonenshine et serine protease al., 2011) Tryp_SPc, Trypsin-like MS C008R159 serine protease Zinc metalloproteinase nas- (Ram and Wolfner, 2007; 2.1 - 3.7 C134R018 cd04280 15a Sonenshine et al., 2011) (Pilch and Mann, 2006; Yu et Prostasinab MS C135R082 cd00190 al., 1994) (Dorus et al., 2010; Pilch and ZnMc_adamalysin_II_like MS C083R024 cd04269 Mann, 2006) Proclotting enzyme heavy MS C006R078 smart00020 (Kelleher et al., 2009)
42 chain Gamma- 1.7 – 3.4 C120R152 cl19223 (Walker et al., 2006) glutamyltranspeptidase 1b pH Carbonic anhydrase 1 MS C183R004 cd00326 regulation Carbonic anhydrase 9 MS C196R116 (Dorus et al., 2010; Holm et al., 1996; Inaba et al., 2003; Carbonic anhydrase 9 MS C131R016 cd00326 Mawson and Fischer, 1953) Carbonic anhydrase 9 MS C161R087 Structural (Baer et al., 2009; Reinhardt Actin MS C223R146 PTZ00004 et al., 2009) Lamin Dm0 1.5 - 6.6 C220R106 pfam00038 (Chen et al., 2013) (Baer et al., 2009; Small et al., Outer dense fiber protein 2.5 - 5.2 C121R150 pfam02463 2009) (Dorus et al., 2010; Yan et al., Kelch-like protein 20 MS C022R130 NA 2004) (Baer et al., 2009; Sonenshine Tubulin alpha-2 chain MS C160R074 cd02186 et al., 2011) Transport Solute carrier family 15 4.1 - 9.3 C170R033 TIGR00926 member 1 Solute carrier family 2, (Baer et al., 2009; Dorus et facilitated glucose 1.5 - 2.8 C192R047 pfam00083 al., 2010) transporter member 1 Sodium/glucose 1.6 – 3.1 C170R069 pfam00474
43 cotransporter 4 Solute carrier family 22 2.5 - 4.3 C072R016 TIGR00898 member 6-B Sodium-dependent nutrient MS C167R125 pfam00209 amino acid transporter 1 Aquaporin-12Ab 1.7 - 5.3 C096R035 NA (LsGlp1_v1c) (Dorus et al., 2010; C. G. Huang et al., 2007) Aquaporin-3 (Lsaqp12L2c) 3.7 - 10.4 C030R103 cd00333 Other (Milardi et al., 2012; Pilch and Mucin-like glycoprotein 3.3 - 9.9 C218R155 pfam01456 Mann, 2006)
(Albert et al., 1999; Albert et Major royal jelly protein 3a MS C089R070 NA al., 1999; Drapeau et al., 2006; Schmitzová et al., 1998) Chorion peroxidase heavy MS C176R138 chaina pfam03098 (Konstandi et al., 2005; Tootle Chorion peroxidase heavy MS C154R094 and Spradling, 2008) chaina Peroxidasea MS C026R132 pfam03098 Energy Fructose-bisphosphate 2.0 – 3.4 C230R040 PRK09197 aldolase (Cheah and Yang, 2011; Fructose-bisphosphate Konno et al., 2015; Laflamme 1.8 – 3.0 C085R145 PRK09197 aldolase and Wolfner, 2013) Fructose-bisphosphate 1.9 – 3.3 C069R104 cd00946
44 aldolase Glycogen phosphorylase 1.7 – 2.5 C107R029 cd04300 Glycogen phosphorylase 1.6 – 3.2 C085R148 cd04300 Glycogen phosphorylase, 1.6 – 3.5 C171R004 cd04300 brain form Fertility Protein ref(2)Pb 1.6 - 3.9 C036R126 cd14320 (Dezelee et al., 1989) 825 a Transcripts annotated with signal peptide for secretion (SwissProt) 826 b Transcripts annotated using e < 10-5 827 cThe degree of male-bias is indicated by a range of fold change (FC) across populations d Unique contig IDs can 828 be found in Additional File 2 using the probe IDs listed here. 829 eMS indicates the listed probes showed male-specific expression. 830 fMatched to sequences from (Stavang et al., 2015)
45 831 Several other male-biased transcripts had putative roles in morphogenesis and
832 the nervous system. Male-biased transcripts were enriched for cellular component
833 assembly involved in morphogenesis (4 transcripts, p = 0.03), ossification (here
834 probably calcification; 4 transcripts, p = 0.02), and Z disc (5 transcripts, p < 0.0001; Fig
835 5). Additionally, male-biased transcripts were enriched for potassium ion binding (4
836 transcripts, p = 0.02), calcium ion binding (12 transcripts, p = 0.03), ion channel activity
837 (5 transcripts, p = 0.04), and solute:cation symporter activity (5 transcripts, p = 0.01;
838 Additional File 3), showing differences in sensory-system related functions. Other sex-
839 biased transcripts involved in the nervous system, including their sex-biased expression
840 profiles, are reported in Figure 4. As salmon lice display sexually dimorphic patterns of
841 mobility (i.e. mate location (Ingvarsdóttir et al., 2002), frequency of host switching
842 (Hull et al., 1998), and responses to neurotoxic drugs (Appendix 1, Chapter 3), these
843 transcripts will serve as important markers to better understand sex-related differences
844 in the L. salmonis sensory system.
46 845 846 Figure 4: Candidate sex-biased transcripts involved with sensory system related 847 functions in L. salmonis. Transcripts with high expression relative to Cy3 reference 848 pool are green while low expressing transcripts relative to the Cy3 reference pool are 849 red.
850 2.3.5 Female-biased transcripts in three populations of L. salmonis 851 Female-biased transcripts were enriched for basic molecular processes including RNA
852 processing (60 transcripts, p < 0.0001), ribosome biogenesis (38 transcripts, p <
853 0.0001), and transcription (41 transcripts, p < 0.0001) (Additional file 3). Within these
854 categories, some multi-subunit protein complexes were completely female-biased
855 including chaperonin-containing T-complex (CCT-complex; 5 transcripts, p = 0.0002),
856 Nup107-160 complex (4 transcripts, p = 0.02), spliceosome (11 transcripts, p = 0.02),
47 857 histone deacetylase complex (4 transcripts, p = 0.04) and ribonucleoprotein complex (30
858 transcripts, p = 0.0009). Protein complex formation was also enriched in the female-
859 biased list, for example the GO category macromolecular complex subunit organization
860 (28 transcripts, p < 0.0001).
861 Several transcripts related to cell division and organization were overexpressed
862 in females and some significantly enriched GO categories included cell cycle (35
863 transcripts, p < 0.0001), DNA replication (17 transcripts, p < 0.0001), and cell
864 proliferation (13 transcripts, p = 0.004) (Additional file 3). Furthermore, GO enrichment
865 of ATP binding (60 transcripts, p < 0.0001), ATP-dependent helicase activity (10
866 transcripts, p = 0.001), and ATPase activity (15 transcripts, p = 0.005; Additional File 3)
867 indicated female-biased energy generation.
868 As observed with male-biased transcripts, female-biased transcripts were also
869 enriched for reproductive functions. The GO category in utero embryonic development
870 (8 transcripts, p = 0.005; Additional File 3) was significantly enriched despite the
871 absence of mating across all experiments (female lice are not sexually mature at the pre-
872 adult stage; Ritchie et al., 1996). These included nuclear autoantigenic sperm protein
873 (FC = 2.7 – 10.0), pre-mRNA processing factor 19 (FC = 1.6 – 2.6), and protein
874 arginine N-methyltransferase 1, among others (FC = 1.7 – 2.5; Additional File 3).
875 Female-biased transcripts were also enriched for nuclear hormone receptor binding (4
876 transcripts, p = 0.02) with an additional female-specific transcript containing the c4 zinc
877 finger common to nuclear hormone receptors (Zn_C4; CDD: smart00390; e = 2.14-15).
878 Several other female-biased transcripts not included in GO categories also have
879 potential roles in reproduction including piwi-like protein 1 (FC = 2.6 – 8.3) and
48 880 peroxiredoxin 1 (FC = 1.6 – 3.1). Lastly, transcripts involved in sex determination were
881 female-biased in all populations, including prohibitin-2 (Carmichael et al., 2013a; FC =
882 1.5 – 9.6) and pre-mRNA-splicing regulator female-lethal(2)D (Granadino et al., 1990;
883 FC = 1.7 – 2.4).
884 Some transcripts related to morphology, feeding, and detoxification were also
885 female-biased across all populations. Transcripts such as serine proteinase stubble
886 catalytic chain (female-specific), la protein homolog (FC = 1.5 – 2.5), and digestive
887 organ expansion factor homolog (FC = 1.7 – 2.9), are involved in development, while
888 trypsin-1 (FC = 3.1 – 12.0) and quinone oxidoreductase (FC = 2.1 – 116.5) have
889 putative roles in feeding and detoxification, respectively. Lastly, immune-related
890 transcripts, like rhotekin-2 (female-specific), ras-related protein Rab-32 (female-
891 specific), and complement component 1 Q subcomponent-binding protein,
892 mitochondrial (FC = 1.6 – 4.0), were female-biased in all L. salmonis populations.
893 Female-biased transcripts therefore represent several candidates responsible for
894 controlling sexual dimorphism at the molecular level in L. salmonis. Based on these
895 findings, immunity, energy expenditure, and organogenesis are examples of previously
896 unknown sexual dimorphism in salmon lice.
897 2.3.6 Annotation of L. salmonis sex-biased orphan contigs 898 Sex-biased orphan contigs were compared to known sequences using UniProt (e ≤ 10-5)
899 to augment novel transcript discovery in the non-model L. salmonis. Although this
900 threshold is less conservative than that used for the original microarray annotation
901 (Yasuike et al., 2012), it has been frequently used in other sea lice transcriptomic
902 studies (Carmichael et al., 2013b; Eichner et al., 2008; Valenzuela-Muñoz et al., 2015),
903 being generally acceptable for gene annotation (Khalturin et al., 2009). This method
49 904 was used for novel transcript discovery only and these newly annotated transcripts were
905 not included in GO analyses. A total of 16 female-biased and 12 male-biased transcripts
906 were subsequently annotated (Additional File 2) using this method. This additional
907 annotation did not substantially change observations made on sequence divergence
908 differences in male and female-biased transcripts, and many of the newly annotated
909 female-biased transcripts had similar functions to those identified in the enrichment
910 analysis described above, including transcription, translation, and cell cycle (Additional
911 File 3).
912 Potential links to reproduction were observed among several of the newly
913 annotated male-biased orphans, including prostasin (male-specific), gamma-
914 glutamyltranspeptidase (FC = 1.7 – 3.4), and protein ref(2)P (FC = 1.6 – 2.3) (Table 3).
915 A male-specific transcript, c-factor, was also identified. However, the function of this
916 transcript in L. salmonis remains unknown. Additionally, male-biased transcripts
917 involved in neuromuscular development and function were discovered, including
918 excitatory amino acid transporter 3 (SLC1A1; FC = 2.3 - 3), twitchin (FC = 1.6 – 5.7),
919 and sarcoplasmic/endoplasmic reticulum calcium ATPase 1 (FC = 1.5 – 7.6). Probe
920 identifiers, e-values, bitscores, SwissProt accessions, and descriptions for newly
921 annotated transcripts can be found in Additional File 2.
922 2.4 Discussion 923 The economically and ecologically important parasite, salmon lice L. salmonis
924 (Copepoda: Caligidae) displays sexual dimorphism in ontogeny, morphology,
925 physiology, and behavior (Brandal et al., 1976; Eichner et al., 2015b; Hamre et al.,
926 2013; Hull et al., 1998; Igboeli et al., 2013; Ingvarsdóttir et al., 2002; Wotton et al.,
50 927 2014; Johnson and Albright, 1991; Ritchie et al., 1996; Stephenson, 2012). However,
928 little is known about the molecular mechanisms that control these traits and the possible
929 interactions they may have with chemical response/resistance, host-parasite interactions,
930 and overall population dynamics. Here, sex-biased transcripts were identified within
931 three populations of L. salmonis (including two subspecies; Skern-Mauritzen et al.,
932 2014) from the Atlantic and Pacific coasts of Canada. Our observation revealed a large
933 proportion (34.7 – 42.7%) of sex-biased expression (Table 1) consistent with findings in
934 other arthropods (Eads et al., 2007; Ranz et al., 2003), nematodes (Reinke et al., 2004),
935 amphibians (Malone et al., 2006), fish (Small et al., 2009), birds (Naurin et al., 2011),
936 and mammals (Rinn and Snyder, 2005). Principal component analysis supported this
937 finding as males and females were separated on PC1 in all populations. These data
938 suggest large differences in baseline gene expression between male and female L.
939 salmonis that could potentially impact parasite control strategies. For example, routine
940 lice counting and staging is the primary management strategy used to inform treatment
941 regimes in aquaculture. However, pre-adult male and female L. salmonis are often
942 grouped into a single category for these counts (Lees et al., 2008; Whyte et al., 2014).
943 The basal differences in gene expression reported here and the interactive effects of sex
944 with chemical treatment and resistance described elsewhere (Appendix 1), suggests a
945 more informative strategy would be to separately count male and female preadult L.
946 salmonis in both farm and laboratory settings whenever possible.
947 There were no consistent differences between the proportion of male-biased
948 relative to female-biased transcripts in L. salmonis (Table 1), despite observations in
949 other crustaceans like Caligus rogercresseyi, another species of parasitic copepod, and
51 950 Daphnia pulex which suggested a slight over-representation of male-biased transcripts
951 (Eads et al., 2007; Farlora et al., 2014). However, we did find that a larger proportion of
952 male-biased transcripts had higher fold change than those with female-bias. In this
953 study, sex-biased expression was assessed across multiple populations of L. salmonis
954 reared under similar conditions, thus offering a more comprehensive overview of gene
955 expression differences than is obtained in single cohort transcriptome analyses.
956 However the sex-biased transcripts identified here were limited to ~22,000 unique
957 contig sequences (i.e. transcripts) on the microarray and it was not possible to examine
958 some of the more complex facets of sex-biased expression (i.e. sex-specific alternative
959 transcripts (McIntyre et al., 2006). Additionally, studies using whole-body homogenates
960 offer general patterns of sex-bias but lack the resolution to detect sex-biased expression
961 in individual tissues (Catalán et al., 2012) and control for differences in tissue allometry
962 (Chintapalli et al., 2007). Tissue-specific extractions will be an important tool for future
963 studies examining sex-biased gene expression in L. salmonis. Nonetheless,
964 characterization of sex-biased transcripts reported here provides numerous molecular
965 targets putatively underlying sexual dimorphism in L. salmonis, offering important
966 insight for pest management and future drug development for this non-model organism.
967 2.4.1 Discovery of sex-biased transcripts related to reproduction in L. salmonis 968 Male-biased transcripts displayed greater sex-bias compared with female-biased
969 transcripts in L. salmonis, similar to findings in D. melanogaster (Ranz et al., 2003).
970 Among the highly male-biased transcripts, 127 were not expressed above background
971 detection in any of the 58 females assayed in this study. These transcripts represent
972 putative seminal fluid proteins (SFPs) based on their expression profiles (SFPs are only
52 973 expressed in males; Chapman, 2001) and annotations (Table 3 and references therein).
974 SFPs are transferred to females during mating, impacting a variety of physiological
975 processes such as sperm storage, egg production, feeding, behavior, and receptivity to
976 re-mating (reviewed in Avila et al., 2011). Although genes involved in reproduction
977 tend to evolve rapidly (Swanson and Vacquier, 2002), many of the functional
978 constituents of seminal fluid are conserved from arthropods to mammals (Chapman,
979 2001; Mueller et al., 2004). For example, genes involved in proteolysis are essential for
980 sperm transfer, storage, and activity, among other functions (Laflamme and Wolfner,
981 2013; McGraw et al., 2004). A total of 10 proteases and 10 protease-inhibitors were
982 identified as male-specific in this study with several others showing male-bias (Table
983 3). All protease inhibitors putatively involved in reproduction contained at least one
984 kunitz or serpin domain (CDD accessions: pfam00014 and cd00172, respectively),
985 which are the predominant classes of protease inhibitors in seminal fluid (Laflamme and
986 Wolfner, 2013). In turn, proteases such as serine protease persephone and calpain-A
987 catalytic subunit also had relevant annotations to SFPs based on their ability to
988 modulate toll signaling in D. melanogaster (Fontenele et al., 2013; Ligoxygakis et al.,
989 2002). The transfer of immunomodulatory and antimicrobial SFPs may aid females in
990 defending against infections that are introduced during mating (McGraw et al., 2004;
991 Peng et al., 2005). Many of the L. salmonis proteases assigned as SFPs also contained
992 trypsin-like domains (CDD: cd00190 and smart00020) including prostasin, proclotting
993 enzyme heavy chain, and three additional transcripts without SwissProt annotation (i.e.
994 CDD only). These transcripts represent important targets for understanding the
995 proteolytic events controlling reproduction and mating in L. salmonis.
53 996 Female-biased transcripts also had putative reproductive functions, including
997 five with nuclear hormone receptor activity, one of which was female-specific.
998 Recently, a sex-linked SNP in the L. salmonis prohibitin-2 gene with a pattern of
999 female-biased expression was identified in three strains of L. salmonis from Scotland
1000 (Carmichael et al., 2013a). Similarly, a transcript annotated as prohibitin-2 was female-
1001 biased in all three populations of L. salmonis assayed in this study. The prohibitin-2
1002 gene is likely involved in sex determination (Carmichael et al., 2013a) along with pre-
1003 mRNA-splicing regulator female-lethal(2)D (Granadino et al., 1990), which was also
1004 female-biased in L. salmonis.
1005 Overall, functional enrichment for reproduction was less clear in female-biased
1006 transcripts compared with male-biased transcripts. Many of the putative female-biased
1007 transcripts potentially involved with reproduction had GO annotation with many other
1008 functional categories and only a small number were female-specific. For example,
1009 nuclear autoantigenic sperm protein (NASP) and histone deacetylase 1 (HD1), were
1010 female-biased in L. salmonis and have reproductive roles in similar species (Farlora et
1011 al., 2014; Karoonuthaisiri et al., 2009; Wang et al., 2009). However, these transcripts
1012 were in the enriched GO category in utero embryonic development (p = 0.005), which
1013 is taxonomically constrained (Deegan et al., 2010) and inconsistent with the virgin
1014 status of the lice used here (Ritchie et al., 1996). Furthermore, the functions of NASP
1015 and HD1 differ in other species such as C. elegans in which they are important for
1016 female development and male-specific gene repression (Grote and Conradt, 2006).
1017 These discrepancies make it difficult to identify putative female-biased reproduction
1018 genes in the present work. In an earlier study by Eichner and colleagues (Eichner et al.,
54 1019 2008), L. salmonis genes involved in reproduction were overexpressed in adult females
1020 compared to preadult II females. As the present study used preadult II females, it may
1021 have missed the identification of some female reproductive genes that are induced later
1022 in development than the stages evaluated here. Future studies assessing the expression
1023 and localization of these transcripts will offer insight on their exact functions. Much
1024 work remains to identify female-biased reproductive genes in L. salmonis, including the
1025 extensive changes likely to occur in female mating-responsive genes post transfer of
1026 male spermatophores (e.g. see Mack et al., 2006; Rogers et al., 2008).
1027 In general, sex-biased genes evolve faster than unbiased genes, with those
1028 exhibiting male-bias showing the highest rates of evolution (reviewed by Ellegren and
1029 Parsch, 2007). This trend is heavily influenced by sex-biased transcripts involved in
1030 reproduction as these typically exhibit higher than normal rates of positive selection
1031 (reviewed by Ellegren and Parsch, 2007; Swanson and Vacquier, 2002). Only male-
1032 biased transcripts showed a consistently higher number of orphans in each L. salmonis
1033 population (45.1 – 51.8%) when compared to female-biased (28.3 – 37.1%) and
1034 unbiased (32.4 – 34.0%) transcripts. This trend was largely driven by the putative SFPs
1035 in this study (i.e. male-specific transcripts), of which 65.4% were orphans. As higher
1036 rates of nucleotide substitutions are often caused by a relaxed functional constraint or
1037 greater positive selection on certain transcripts (reviewed in (Ellegren and Parsch, 2007;
1038 Swanson and Vacquier, 2002)), higher-resolution analyses including non-
1039 synonymous/synonymous mutation ratios (dN/dS; Muse, 1996; Zhang et al., 2004) and
1040 codon-usage bias (Hershberg and Petrov, 2008; Powell and Moriyama, 1997) will be
1041 important in clarifying the effects of selection on these L. salmonis genes. These
55 1042 analyses will yield important information regarding evolutionary processes affecting
1043 reproduction, population dynamics, and drug resistance. In particular, it will be
1044 important to identify whether genes involved in drug resistance are similar to those
1045 involved in sex-biased expression, as this will provide insight on molecular mechanisms
1046 behind the higher rate of drug resistance in male L. salmonis. Specifically this will
1047 inform on whether the increased resistance is due to inherent physiological factors that
1048 differ between the sexes, or to the evolutionary rate of resistance mechanisms.
1049 2.4.2 Sex-biased transcription related to sexually dimorphic phenotypes of L. salmonis 1050 L. salmonis exhibits extensive sexual dimorphism in morphology at the pre-adult and
1051 adult stages (Johnson and Albright, 1991). Several sex-biased transcripts discovered
1052 here have related functions including the male-biased transcripts enriching the GO
1053 categories cellular components involved in morphogenesis (4 transcripts, p = 0.03) and
1054 Z-disc (sarcomere; 5 transcripts, p < 0.0001). Additionally, serine proteinase stubble
1055 catalytic chain was female-specific in L. salmonis and is required for proper formation
1056 of appendages in Drosophila spp. (Appel et al., 1993). Therefore, these transcripts
1057 represent targets for understanding sexually dimorphic morphology including features
1058 that are important in mating (described in Hull et al., 1998; Johnson and Albright, 1991;
1059 Ritchie et al., 1996). The sex-biased orphans described here are also ideal candidates for
1060 understanding mate guarding, a common mating behavior in crustaceans, which is
1061 known to be sexually antagonistic (Jormalainen, 1998). Therefore, transcripts involved
1062 in mate guarding are unlikely to be annotated due to rapid sexual selection
1063 (Jormalainen, 1998) and taxonomic constraint (Khalturin et al., 2009).
1064 Other molecular links to sexual dimorphism in L. salmonis were observed in
56 1065 transcripts such as longitudinal lacking protein, trypsin-1, and digestive organ
1066 expansion factor, which were female-biased in this study and have roles in salivary
1067 gland, trachea, and digestive organ development and function (Kerman et al., 2008; Tao
1068 et al., 2013). Based on female L. salmonis having a greater requirement for blood in the
1069 meal (Brandal et al., 1976), these transcripts will serve as important markers for
1070 understanding sexually dimorphic feeding patterns and related host-parasite
1071 interactions.
1072 Male-biased L. salmonis transcripts also enriched several GO categories related
1073 to the sensory system, which is generally known to be more refined in male copepods
1074 (Boxshall, 2005). These included potassium ion binding (4 transcripts, p = 0.02),
1075 solute:cation symporter activity (5 transcripts, p = 0.01), and calcium ion binding (12
1076 transcripts, p = 0.03), among others (Additional File 3). Males are known to transfer
1077 between salmonid hosts more frequently than females (Hull et al., 1998; Wotton et al.,
1078 2014) with mate location primarily being the responsibility of the male (Ingvarsdóttir et
1079 al., 2002). Thus, transcripts involved in the sensory system and muscle development
1080 (e.g. Z disc; Additional File 3) represent putative targets for understanding
1081 neuromuscular differences related to increased mobility in males. Furthermore,
1082 chemical cues are essential components of host and mate location in L. salmonis and
1083 serve to optimize the probability of mating through balancing the proportion of males
1084 relative to females on each host (Stephenson, 2012). Chemosensory signaling and
1085 behavioral responses to non-host semiochemical treatments known to interfere with host
1086 recognition are sexually dimorphic in L. salmonis (Hastie et al., 2013; Ingvarsdóttir et
1087 al., 2002). Based on the high evolutionary rates of genes involved in chemoreception
57 1088 (Sánchez-Gracia et al., 2009), sex-biased orphans should be considered candidate
1089 targets for understanding the chemical ecology of L. salmonis.
1090 The identification of sex-biased transcripts in L. salmonis also provided
1091 preliminary evidence for sexually dimorphic characteristics previously unknown in
1092 salmon lice. For example, immune-related transcripts such as rhotekin-2 and ras-related
1093 protein Rab-32 were female-specific in this study while other related transcripts were
1094 female-biased (Additional File 2). Gene Ontology analysis also indicated a higher
1095 energy expenditure in female L. salmonis based on the female-biased expression of 15
1096 transcripts enriching ATPase activity coupled and 60 transcripts enriching ATP binding
1097 (Additional File 3). This is a similar finding to the GO analysis of sex-biased expression
1098 in D. pulex (Eads et al., 2007), and may serve as an explanation for the lower frequency
1099 of inter-host transfer in female L. salmonis (Hull et al., 1998; J Wotton et al., 2014).
1100 Although male-biased transcripts such as glycogen phosphorylase, fructose-
1101 bisphosphate aldolase, and hexokinase-2 enriched the GO category glucose metabolic
1102 process (7 transcripts; p =0.02), these are likely acting as an energy source for
1103 spermatogenesis (Cheah and Yang, 2011). These data indicate an increased basal energy
1104 demand in female L. salmonis that is important for understanding observed sex
1105 differences in drug tolerance and resistance (Igboeli et al., 2013; Appendix 1).
1106 Collectively, the candidate sex-biased transcripts described here represent putative
1107 markers controlling energy expenditure, morphology, and the immune and sensory
1108 systems of L. salmonis.
58 1109 2.4.3 Strengths and limitations of using a consensus-based approach to identify sex-bias 1110 Recently, seven aquaporin paralogs were characterized in L. salmonis, each with
1111 different expression profiles across stage and sex (Stavang et al., 2015). Two of these
1112 aquaporins (LsGlp1_v1 (KR005660.1) and Lsaqp12L2 (KR005666.1)) showed male-
1113 specific and male-biased expression, respectively. In the present work, two male-biased
1114 contigs annotated as aquaporin 3 (BT121448.1) and aquaporin-12A (BT121051.1; see
1115 Table 3) showed more than 99% sequence similarity to LsGlp1_v1 and Lsaqp12L2,
1116 respectively (Additional File 4). Therefore, aquaporin 3 and LsGlp1_v1 appear to be the
1117 same transcript based on sequence alignment, as are aquaporin-12A and Lsaqp12L2.
1118 Here, aquaporin 3 was only expressed above background fluorescence in one of the 58
1119 females assayed, supporting the expression profile previously reported (Stavang et al.,
1120 2015). Additionally, aquaporin-3 was shown to be highly male-biased in the closely
1121 related C. rogercresseyi (Farlora et al., 2014), suggesting this gene is important for a
1122 male-specific function in salmon lice. This type of transcriptomic consensus will be
1123 important for functional categorizations in future sea lice studies.
1124 Within the 1407 transcripts shown to be sex-biased in Atlantic and Pacific
1125 populations, only 829 showed concordant expression profiles. The majority of
1126 transcripts in the discordant list (Additional File 2) were involved in cuticle formation
1127 and molting and, therefore, transcripts that potentially oscillate in expression levels at
1128 different molt intervals (Eichner et al., 2008; Turek and Bringmann, 2014) were
1129 eliminated from this interpretation. However, the consensus identification of sex-biased
1130 transcripts in L. salmonis did prove to be over-conservative in some cases, causing
1131 particular transcripts with putative sex-bias to be overlooked. For instance, trypsin-4
1132 (probe: C054R168), annotated from Anopheles gambiae and involved in host seeking
59 1133 behavior and blood feeding (Muller et al., 1995), was female-specific in BMA2a and in
1134 Pacific L. salmonis. However, this probe did not pass quality filters in the BMA2b
1135 population and was eliminated from the consensus list. Female L. salmonis are known
1136 to feed more heavily on blood than males (Brandal et al., 1976), with certain trypsins
1137 known to be involved in digestion and immune evasion on salmonid hosts (Fast et al.,
1138 2003, 2007; Kvamme et al., 2004). Additionally, a similar transcript annotated to
1139 trypsin-1 was female-biased in this study (Additional File 2). Therefore, monitoring
1140 individual population analyses from this work is also important for identifying potential
1141 sex-biased markers in L. salmonis. Nonetheless, the consensus set of sex-biased
1142 transcripts identified here supports the characterization of L. salmonis transcript as
1143 markers for reproduction, morphogenesis, behavior, and other sexually dimorphic traits
1144 for targeted approaches (i.e. knock-out/knock-down, recombinant production, in vitro
1145 characterization, etc.) in future studies. This improved understanding of sex-biased gene
1146 expression in L. salmonis will inform future studies examining host-parasite
1147 interactions, drug resistance, reproduction, and novel drug discovery.
1148 2.4.4 Conclusions 1149 A consensus-based, meta-analysis approach was used to analyze the L. salmonis
1150 transcriptome, clearly identifying sex-biased transcripts associated with sexually
1151 dimorphic traits. Specifically, male-biased transcripts showed higher degrees of sex-bias
1152 and lower sequence similarity compared with female-biased transcripts. The enrichment
1153 of male-biased transcripts associated with reproduction was likely responsible for these
1154 trends. Our results provided insights into known and novel forms of sexual dimorphism
1155 in L. salmonis including immunity, energy expenditure, morphology, feeding, and
60 1156 mobility. These sexual dimorphisms will be important to consider for industry-relevant
1157 applications in areas such as parasiticidal drug response, reproductive roles, and host-
1158 parasite relationships. The current work shows that sex-biased gene expression is
1159 abundant in the pre-adult L. salmonis transcriptome and is likely to control several
1160 aspects of sexual dimorphism in this species.
1161 Availability of Data and Materials 1162 The datasets supporting the results of this article are available in the Gene Expression 1163 Omnibus repository, GSE73734 and GSE56024. Atlantic data set described and 1164 uploaded to GEO in Appendix 1.
1165 Supporting Information (Additional Files) 1166 Additional File 1 – Sex-biased and sex-specific transcripts in individual populations 1167 Additional File 2 – Consensus sex-biased and sex-specific transcripts, co-expressed 1168 “kunitz cluster”, and newly annotated sex-biased orphans 1169 Additional File 3 – Gene Ontology, SP-PIR_Keywords, and InterPro 1170 Additional File 4 – Sequence alignment of L. salmonis aquaporins 1171 All additional files can be accessed online at DOI: 10.1186/s12864-016-2835-7
1172 Acknowledgements 1173 This work was supported by Elanco Fish Health Research Chair; NSERC Discovery 1174 (610108); ACOA-AIF TREAT2 (199308); and Innovation PEI – Development and 1175 Commercialization grant DCFG (210205-70). JDP was supported by NSERC PGSD3 1176 (290948462). Thanks to Drs. Shona Whyte, Spencer Greenwood, Laura Braden, and 1177 John Burka for comments on early drafts of the manuscript. Also, thanks to the aquatics 1178 staff at AVC for their assistance in fish husbandry and animal care.
61 1179 Chapter 3: Towards a consensus: Multiple 1180 experiments provide evidence for constitutive 1181 expression differences among sexes and 1182 populations of sea lice (Lepeophtheirus salmonis) 1183 related to emamectin benzoate resistance
1184 Adapted from: Jordan D. Poley1, Okechukwu O. Igboeli1, and Mark D. Fast1. 1185 (2015) Aquaculture 448:445-50.
1186 1Atlantic Veterinary College, University of Prince Edward Island, 550 University Ave, 1187 Charlottetown PE, C1A 4P3, Canada
1188 JDP contributed all molecular and statistical analyses and wrote the manuscript. 1189 OOI designed an executed the bioassays, assisted with RNA extractions and writing 1190 MDF designed the experiments and assisted in writing
1191 © 2015 Elsevier B.V. All rights reserved.
62 1192 Abstract 1193 Sea lice (Lepeophtheirus salmonis) are ectoparasitic copepods that impose a heavy
1194 financial burden on the salmon aquaculture industry. A parasiticide, emamectin
1195 benzoate (EMB; trade name SLICE®), was widely used to control sea lice before EMB
1196 resistant strains of lice emerged. Several genetic mechanisms are likely responsible for
1197 EMB resistance however these are not yet fully understood. Resistance is further
1198 complicated by sex differences in EMB tolerance with males often showing better
1199 survival upon EMB exposure compared to females. Here, candidate EMB-resistance
1200 genes were used to explore differences between sex, population, and exposure to EMB
1201 using two in vitro bioassays and an in vivo experiment. Two acetylcholine receptor
1202 subunits (nAChRα3 and nAChRα7) showed opposite expression profiles across the
1203 assays, with male and EMB-resistant lice showing significant overexpression of
1204 nAChRα7 and downregulation of nAChRα3 compared to females and EMB-sensitive
1205 lice, respectively. Furthermore, a novel gene candidate LR9 showed induced expression
1206 upon EMB exposure with the highest expressing group being EMB-resistant males. An
1207 ABC transporter, pgp, also showed highest expression in EMB-resistant males but this
1208 finding was not consistent across all experiments. Other gene candidates like CYP18A
1209 and peroxinectin did not show similar expression profiles to work completed on other
1210 populations or species of sea lice. These data have provided a consensus with other
1211 transcriptomic studies showing that neuronal acetylcholine receptor subunits are
1212 differentially regulated between sexes and populations of sea lice. This unique
1213 expression profile, alongside analysis of other EMB resistance genes, provides a
1214 detailed snapshot of mechanisms responsible for resistance in sea lice.
63 1215 3.1 Introduction 1216 Chemical therapeutants are currently the most effective method for controlling sea lice,
1217 Lepeophtheirus salmonis (Krøyer, 1837) and Caligus spp infestations in salmonid
1218 aquaculture (Burridge et al., 2010; Denholm et al., 2002). These treatments include
1219 bath-administered pesticides like hydrogen peroxide, organophosphates, and
1220 pyrethroids, as well as in-feed drugs from the avermectin and benzoylurea classes
1221 (Burridge et al., 2010). However, the aquaculture industry has become over-reliant on
1222 these treatment options and consequently, resistance has been reported to the majority
1223 of available therapeutants (reviewed in Aaen et al., 2015). Understanding the
1224 mechanisms responsible for resistance is vital to improving management strategies and
1225 development of future therapeutants for sea lice.
1226 Avermectins are a class of drugs traditionally used for treating both human and
1227 livestock parasitic worm infections including heartworm disease, onchocerciasis, and
1228 river blindness (Shoop et al., 1995). The use of avermectins is also well documented in
1229 Atlantic salmon aquaculture with the administration of ivermectin (IVM) and
1230 emamectin benzoate (EMB) as sea lice treatments (Horsberg, 2012). In salmon, EMB is
1231 administered as an in-feed treatment over a seven-day period at 50μg/kg fish biomass
1232 per day (Ramstad et al., 2002). The drug is distributed to the mucus, skin, and blood of
1233 the fish, reaching tissue-specific maximum concentrations between 75-128 ppb
1234 (Sevatdal et al., 2005b). Lice are exposed to EMB through ingestion of these tissues and
1235 potentially through direct contact with the skin and mucus. Upon absorption by the
1236 louse, EMB acts on glutamate-gated chloride channels (GluCl-), forcing the channel to
1237 irreversibly open (Arena et al., 1995; Cornejo et al., 2014) leading to hyperpolarization,
1238 flaccid paralysis, and death of the parasite (Stone et al., 2000; Stone et al., 1999). Ease
64 1239 of administration, extended protection, and good efficacy on all host-associated life
1240 stages made EMB an ideal sea lice treatment prior to the emergence of drug resistance
1241 (Horsberg, 2012; Jones et al., 2013; Stone et al., 2000; Stone et al., 2000).
1242 Resistance to EMB has been reported in all major Atlantic salmon farming
1243 industries around the world with the exception of British Columbia, Canada (Saksida et
1244 al., 2013). Resistance mechanisms continue to be selected for through persistent
1245 application of avermectins, either in the form of IVM or increased doses of EMB (M.
1246 Beattie, personal communication). Recent studies suggest the mechanisms of EMB
1247 resistance include differential gene expression of degradative enzymes, P-glycoprotein,
1248 GABA-gated chloride channels, and neuronal acetylcholine receptors, amongst others
1249 (reviewed by Aaen et al., 2015). These genes primarily show differences in baseline
1250 expression levels between sex and population, which far surpass the response observed
1251 under EMB exposures (Carmichael et al., 2013c; Appendix 1). Sex and population
1252 differences are also observed in EMB half maximal effective concentrations (EC50),
1253 where males constantly show higher EMB tolerance compared to females (Whyte et al.,
1254 2013; Appendix 1) and different populations of lice show a wide variability in EMB
1255 sensitivity (Igboeli et al., 2013; Jones et al., 2013; Appendix 1).
1256 The present study investigated candidate EMB resistance genes using qPCR in a
1257 series of in vitro and in vivo EMB exposures. Previously explored genes such as
1258 neuronal acetylcholine receptor subunit α3 and P-glycoprotein (Carmichael et al.,
1259 2013b; Igboeli et al., 2012) were further characterized in Atlantic L. salmonis
1260 populations alongside several novel genes of interest. Expression patterns were
1261 monitored in male and female L. salmonis across multiple EMB doses in populations
65 1262 with differing sensitivity to EMB from the Bay of Fundy, New Brunswick (NB),
1263 Canada.
1264 3.2 Methods 1265 Adult female L. salmonis were collected from the Bay of Fundy, NB, in the spring of
1266 2012 from two different sites known as Bay Management Area 2a (BMA-2a; Back Bay)
1267 and 2b (BMA-2b; Grand Manan). Lice from BMA-2a are considered more EMB-
1268 resistant than those from BMA-2b (Jones et al., 2013; Appendix 1), which was
1269 confirmed by calculating EC50 on F0 generation lice post collection (Igboeli et al.,
1270 2013). Egg strings were removed from the adult female lice and hatched to the infective
1271 copepodid stage in static seawater hatch systems (Igboeli et al., 2013). Copepodids (F1
1272 generation) were then used to infect Atlantic salmon (Salmo salar; 97 ± 8 grams)
1273 housed in two separate 60L saltwater recirculation tanks (20 fish/tank); one for BMA-2a
1274 lice (EMB-resistant) and one for BMA2b (EMB-sensitive).
1275 Two in vitro bioassays were used to compare sex and population differences in
1276 the presence of EMB. The first in vitro experiment (multiple-dose EMB bioassay) was
1277 reported in (Igboeli et al., 2013) and used 86 pre-adult II L. salmonis (43 EMB-resistant
1278 and 43 EMB-sensitive) exposed to four concentrations of EMB (0.1, 25, 300, 1000ppb)
1279 and a seawater control for 24 h. At 24-h post EMB exposure, the condition of male and
1280 female lice from both populations was evaluated (Igboeli et al., 2013) and all lice were
1281 flash frozen and stored at -80oC. The second in vitro experiment (single-dose EMB
1282 bioassay) used pre-adult II lice inbred from the F1 described above to produce an F2
1283 generation, but from BMA-2b only (males = 10; females = 8) and exposed them to
1284 100ppb of EMB and a sea water control for 24 h. Survival and storage was conducted as
66 1285 above, with the exception of no calculation of EC50 values due to the use of a single
1286 EMB dose.
1287 An in vivo trial was also conducted by (Igboeli et al., 2013), using lice remaining
1288 on fish from the multiple-dose EMB bioassay described above. Briefly, six Atlantic
1289 salmon were sampled for lice enumeration as a pre-treatment count. The remaining fish
1290 were placed on a triple dose EMB treatment (150 μg/kg fish biomass per day for 7 days)
1291 and sampled at 1 (n=5) and 13 days (n=10) post EMB cessation (dpec) for lice
1292 enumeration. As all fish were given EMB treatment, only sex and population
1293 differences were analyzed for the in vivo experiment. Lice collected at 1 dpec were flash
1294 frozen and stored at -80oC until RNA extractions were performed.
1295 Total RNA extraction from individual lice from both bioassays and in vivo
1296 collection was performed using TRIzol® as per manufacturers’ instructions (Life
1297 Technologies; Chomczynski, 1993; Chomczynski and Mackey, 1995) with follow-up
1298 DNase treatment using TURBO® DNase (Ambion) as per manufacturer’s instructions.
1299 RNA quantity and quality was analyzed using spectrophotometry (NanoDrop 2000;
1300 Thermo Scientific) and Experion™ RNA StndSens analysis kit (Bio-Rad) as per
1301 manufacturer’s instructions. Samples were suspended in nuclease-free H2O (NF-H2O)
1302 and stored at -80oC until further use.
1303 High quality, DNase-treated RNA (1 μg) was reverse transcribed to cDNA using
1304 the Reverse Transcription System® (Promega) as per manufacturer’s instructions. Post
1305 cDNA synthesis, each sample was diluted 2-fold with nuclease free H2O and stored at -
1306 20oC. A pool containing 2 μL from each individual sample was created to develop
1307 standard curves (six steps, five-fold dilution series) and to use as an internal positive
67 1308 control for between-plate calibrations. All qPCR assays were run using a Mastercycler
1309 ep realplex thermal cycler (Eppendorf) with SsoAdvanced™ SYBR® Green Supermix
1310 (Bio-Rad) as per manufacturer’s instructions. A three-step program was used for all RT-
1311 qPCR assays: 10 min at 95oC for denaturation; 40 amplification cycles of 95oC for 15
1312 sec, specific annealing temperature (Table 2) for 20 sec, then 72oC for 30 sec; followed
1313 by melt curve analysis starting at 60oC and increasing by increments 0.5oC to 95oC to
1314 ensure a single amplicon. Annealing temperatures were optimized for each primer pair
1315 using an 8-point temperature gradient ranging from 55-65oC. Two standard curves
1316 containing at least 5 dilutions were created for each primer pair with efficiencies
1317 between 0.95 and 1.05 with r2 values between 0.95 and 1. Aliquots of 2-fold diluted
1318 cDNA were subsequently diluted 10-fold in nuclease-free water for sample analysis.
1319 Raw quantification cycle (Cq) values were imported into QBasePlus version 2.4
1320 (Biogazelle) for calibrated normalized relative quantity (CNRQ) calculations using
1321 primer specific efficiencies (Hellemans et al., 2007). Three reference genes (elongation
1322 factor-1α, ribosomal protein subunit-20, and vinculin; Table 2) were used to normalize
1323 gene expression, with a geNorm M-value of <1.0 and a coefficient of variation <0.5.
1324 Each sample was run in duplicate with 945/981 (96.3 %) replicate reactions within 0.5
1325 cq of one another for all experiments. Negative-RT controls were a minimum of 6
1326 cycles behind the lowest expressing sample and no-template controls (NTC) did not
1327 amplify.
68 1328 Table 1: Primers and assay parameters for RT-qPCR Gene Size Temp (Reference a Primer Sequences E o b or Uniprot) (bp) ( C) Elongation factor-1α* F TTAAGGAAAAGGTCGACAGAC 77 1 65 (Frost and Nilsen, 2003) R GCCGGCATCACCAGACTT Ribosomal protein F GTCACCTCAACCTCCACTCC subunit 20* 274 1.01 65 (Frost and Nilsen, 2003) R TGACTTGCCTCAAAGTGAGC Vinculin* F AGATTCCAACACTGGGAACG (Sutherland et al., 78 0.99 57.8 R CAGAGTCCATTTTTGCTCCC 2012) TTCTACAGAATTGAAAGATCCGC P-glycoprotein F ACGAGTC 114 1 60 (Heumann et al., 2012) TACATAGTACCCGCATAGGCAAA R GAAAGG F AGGTATACGGGAAGGCAC LR9 (Q96B70) 102 1 57.8 R TGGCCAAAGGTACCCAGTCCT F TGGGCTTTGGCCGCTCCAAA Peroxinectin (Q9VEG6) 104 1.04 65 R GGCTGTGTCCGAATCGAAAGGCA CYP18A1 (Q95078) F TGGGAGGTGAAACCGTCGTAGT CCCCCAGAAGCTGGGATAACTCT 111 0.95 60 R GT Acetylcholine receptor F GAATTTTGGTGAGGGGGAAT subunit α3 201 1.04 57.8 (Carmichael et al., R ACCATTGGACTTGACGATCC 2013b) Acetylcholine receptor F CTCTGCCGCACATCCACCCC 134 1.03 65 subunit α7 (A8DIU0) R TGGTGGAGGCGGAGGCTGAT 1329 aEfficiency calculation using standard curves 1330 bAnnealing temperature for qPCR reactions 1331 *Reference genes
1332 CNRQ values from QBasePlus were log2 transformed for statistical analysis in
1333 R studio (Team, 2016). Genes of interest were selected from other studies or an RNA-
1334 seq experiment (M. Fast, unpublished) based on differential expression between
1335 populations of sea lice. For each gene of interest (Table 2), analysis was carried out
1336 by ANOVA (p<0.05; R) and included main effects of EMB, sex, and population, as
69 1337 well as interaction effects of all conditions involved. Tukey’s HSD (p<0.05) post-hoc
1338 tests were used to determine significant differences among groups.
1339 3.3 Results & Discussion
1340 In the multiple-dose EMB bioassay, males were less affected by EMB (i.e. higher EC50)
1341 than were females (Igboeli et al., 2013). No differences were observed between the EC50
1342 of lice populations, despite large-scale analyses consistently showing BMA2a lice are
1343 more EMB-resistant than BMA2b lice (Jones et al., 2013). Additionally, lice collected
1344 for microarray analysis from the same sites, during the same year, showed this EMB-
1345 resistance trend (Appendix 1). Lastly, the EC50 values of the F0 generations used to
1346 propagate F1 and F2 lice used here also confirmed that these populations differ in EMB-
1347 susceptibility (Igboeli et al., 2013). The high confidence intervals in EC50 calculations
1348 observed by (Igboeli et al., 2013) suggest that a greater sample size and more
1349 concentrations representing a geometrical series are required to accurately determine
1350 effective concentrations for individual cohorts. The single-dose EMB bioassay on F2
1351 lice (EMB-sensitive only) showed 100% survival in both controls and 100ppb EMB
1352 treated lice. Finally, the in vivo trial was previously reported by (Igboeli et al., 2013),
1353 who showed higher survival in the EMB-resistant population compared with EMB-
1354 sensitive lice across all time points.
1355 A total of six candidate genes (Table 2) were analyzed for differential expression
1356 between sex, population, and exposure to EMB. Candidate genes were selected from
1357 other studies or RNA-seq results (M. Fast, unpublished) showing differential expression
1358 between populations differing in EMB susceptibility. Two of these genes were neuronal
1359 acetylcholine receptor (nAChR) subunits α3 and α7 (nAChRα3 and nAChRα7).
70 1360 Although nAChRα7 was not altered by EMB exposure in the present study, EMB-
1361 resistant males overexpressed nAChRα7 by 5.9 fold compared to EMB-resistant females
1362 and 1.9 fold compared to EMB-sensitive males (multiple-dose EMB bioassay;
1363 interaction effect of sex and population; p < 0.0001; Figure 1A). Males also showed
1364 higher expression of nAChRα7 compared to females in both the single-dose EMB
1365 bioassay and the in vivo trial (main effect of sex; p < 0.01; Figure 1B-C).
1366 Contrary to the expression profile of nAChRα7, the nAChRα3 subunit showed
1367 overexpression in females in both the single-dose EMB bioassay and the in vivo trial
1368 (main effect of sex; p < 0.01; Figure 2A-B); a similar finding to that in Appendix 1.
1369 Additionally, EMB-sensitive lice showed higher expression of nAChRα3 compared to
1370 EMB-resistant lice in the multiple-dose EMB bioassay, but no effect of sex (p < 0.0001;
1371 Figure 2C). Recently, two Scottish populations (males only) differing in EMB
1372 sensitivity also showed that EMB-sensitive lice overexpressed nAChRα3 relative to
1373 EMB-resistant lice (Carmichael et al., 2013b).
71 1374 1375 Figure 1: Expression of nAChα7 across sexes and populations of L. salmonis. A) 1376 Resistant males showed the highest nAChα7 expression in the multiple-dose EMB 1377 bioassay followed by sensitive males (sex and population interaction effect; p < 1378 0.0001). B) Males overexpressed nAChα7 compared to females (main effect of sex) in 1379 both the single-dose EMB bioassay (p < 0.0001) and C) the in vivo trial (p = 0.009). 1380 Conditions that do not share a letter are significantly different (Tukey HSD; p ≤ 0.05)
1381 Overall, males show higher expression of nAChRα7 and lower expression of
1382 nAChRα3 relative to females, as do EMB-resistant populations relative to EMB-
72 1383 sensitive (Figures 1 and 2 A-C). The distinct nAChR expression profile shown here
1384 alongside recent transcriptomic studies (Carmichael et al., 2013c; Appendix 1) indicates
1385 differences in nAChR subunit abundance and/or receptor composition between sexes
1386 and populations of sea lice. With this consensus-based approach, it appears as though
1387 differences in nAChR abundance between sub-populations differing in EMB-resistance
1388 are a core finding across lice from NB, Canada and lice from Scotland. The nAChR’s
1389 are highly conserved cation channels involved in neuromuscular signaling and serve as
1390 important pharmacological targets for many drugs (Pohanka, 2012). Although nAChR
1391 are not targets for avermectins, IVM was shown to allosterically regulate human and
1392 chick nAChRα7 in vitro (Krause et al., 1998). Furthermore, avermectin resistance has
1393 been linked to drug modulation at other non-target ligand-gated ion channels (Rao et al.,
1394 2009). Both nAChRα3 and nAChRα7 are found in the CNS but homomeric nAChRα7
1395 are generally selective for calcium while receptors containing nAChRα3 have greater
1396 specificity for sodium and potassium (Pohanka, 2012). Genes related to both potassium
1397 and calcium signaling have previously shown differential expression between similar
1398 populations of L. salmonis and in response to EMB (Appendix 1). Although it remains
1399 unclear exactly what role nAChR plays in EMB resistance, the constitutive expression
1400 differences in sea lice nAChR subunits suggest selection of a specific profile across sex
1401 and population, potentially affecting physiology, EMB response and resistance.
73 1402 1403 Figure 2: Expression of nAChα3 across sexes and populations of L. salmonis. 1404 Females overexpressed nAChα7 compared to males in both the A) single-dose EMB 1405 bioassay (p = 0.008) and the B) in vivo trial (p = 0.002). C) Regardless of sex or the 1406 presence of EMB, the EMB-sensitive population overexpressed nAChα7 compared to 1407 EMB-resistant lice (multiple-dose EMB bioassay, main effect of population; p < 1408 0.0001). Conditions that do not share a letter are significantly different (Tukey HSD; p 1409 ≤ 0.05).
1410 The only gene to respond to EMB differently among sex/population groups (i.e.
1411 three-way interaction effect) was leukocyte receptor cluster member-9 (LR9; multiple-
1412 dose EMB bioassay; p = 0.02; Figure 3). In a preliminary RNA-seq experiment, LR9
1413 was identified as differentially expressed between EMB-resistant and EMB-sensitive
1414 populations from NB, Canada (M. Fast, unpublished). Here, basal expression of LR9
1415 was 5.6 fold higher in EMB-resistant males compared with EMB-resistant females and
1416 5.7 fold higher than EMB-sensitive males (interaction of sex and population; p <
1417 0.0001; Figure 3). Additionally, EMB had a main effect on LR9 expression increasing in
1418 a dose-dependent manner. Within sex and population combinations, only EMB-
1419 sensitive males showed significant overexpression at 300ppb (4.7 fold) and 1000ppb
1420 (12.1 fold) compared with respective controls (Figure 3).
1421 This is the first report with experimental evidence on LR9 in L. salmonis.
1422 Although the exact function of this target is yet to be classified in crustaceans, based on
1423 the annotation, this gene represents a receptor from the immunoglobulin superfamily
74 1424 (IgSF) (Zucchetti et al., 2009) and is involved in immunity in a crustacean relative,
1425 Eriocheir sinensis (Guo et al., 2011). Generally, immunity is decreased in invertebrates
1426 exposed to pesticides (Coors et al., 2008); however, the present data indicate
1427 overexpression of LR9 in a dose-dependent response to EMB. As induced
1428 transcriptomic responses to EMB are rare, further characterization of this target is
1429 required for a full understanding of its involvement in EMB resistance and crustacean
1430 biology.
1431 1432 Figure 3: Effects of sex, population, and EMB on LR9 gene expression. Conditions 1433 that do not share a letter are significantly different (3-way interaction effect;Tukey 1434 HSD, p ≤ 0.05). Different colours represent EMB concentrations (see x-axis).
1435 The ABC transporter, P-glycoprotein (pgp), is a well-known resistance marker
1436 for avermectin resistance (reviewed by Lespine et al., 2012). In sea lice, pgp has shown
1437 an overall higher expression in males compared with females and a higher expression in
1438 resistant populations compared with sensitive populations (Igboeli et al., 2013).
1439 Furthermore, EMB exposure has been shown to induce pgp expression in some studies
1440 (Igboeli et al., 2012) and not in others (Appendix 1). Expression patterns of pgp
75 1441 observed in this study showed an interaction between sex and population (p = 0.002) in
1442 the multiple-dose EMB bioassay. EMB-resistant males overexpressed pgp 3.9 fold
1443 compared with EMB-resistant females while no difference was observed between males
1444 of the two populations (Figure 4). EMB-resistant females overexpressed pgp 2.6 fold
1445 compared with EMB-sensitive females but to a lesser extent than in males (Figure 4).
1446
1447 Figure 4: Expression of p-glycoprotein between sex and population combinations. 1448 Sex and population show an interaction effect on P-glycoprotein (interaction effect of 1449 sex and population; p = 0.002). Groups not sharing a letter are significantly different 1450 (Tukey HSD; p < 0.05).
1451 Conflicting results were observed in the single-dose EMB bioassay of sensitive
1452 lice, which showed overexpression of pgp in females compared to males (main effect of
1453 sex; p < 0.0001). Furthermore, no significant differences were observed in pgp
1454 expression from the in vivo trial (data not shown). The presence of EMB did not
1455 significantly affect pgp expression levels in any of the experiments presented here, but
1456 rather only showed differences in basal expression of sex and population combinations.
76 1457 It is clear from this experiment and others (Igboeli et al., 2013, 2012; Appendix 1) that
1458 pgp is selected for in EMB-resistant L. salmonis from the Bay of Fundy, NB, Canada.
1459 However, Scottish laboratory strains of L. salmonis differing in EMB susceptibility do
1460 not show this same trend (Carmichael et al., 2013b; Heumann et al., 2012).
1461 The remaining genes, cytochrome p450 18A1(CYP18A1) and peroxinectin
1462 showed no significant differences in either the single-dose EMB bioassay or the in vivo
1463 trial (data not shown). Sex and population combinations did show differential
1464 expression of both genes in the multiple-dose EMB bioassay but with low fold changes
1465 and no main effects (data not shown). The trends observed for similarly annotated genes
1466 in Caligus rogercresseyi (peroxinectin; Núñez-Acuña and Gallardo-Escárate, 2015) and
1467 in Scottish L. salmonis (CYP18A; (Carmichael et al., 2013b), which showed differential
1468 expression upon exposure to delousing drugs, were not observed in this study.
1469 3.3.1 Conclusions 1470 Resistance to EMB has been studied in sea lice at the molecular level by qPCR and
1471 microarray (Carmichael et al., 2013c; Igboeli et al., 2013, 2012; Appendix 1).
1472 Resistance is currently thought to be under polygenic control, with multiple genes
1473 involved in parasite protection (Espedal et al., 2013; Appendix 1). Here, sex and
1474 population were shown to influence gene expression of nAChRα3, nAChRα7, LR9, and
1475 pgp while only one gene (LR9) was differentially expressed by EMB exposure. In terms
1476 of whole transcriptome response, sex and population have greater effects on gene
1477 expression compared with EMB exposure (Appendix 1) making these conditions
1478 important for characterizing targets potentially involved in drug resistance.
1479 Based on these results (and others), differential expression of nAChR subunits is
1480 an important property affecting EMB sensitivity in sea lice, offering valuable insight on
77 1481 EMB resistance. The nAChR is a common drug target for many therapeutants and
1482 therefore a better understanding of receptor type, composition, and abundance is
1483 required to fully understand their role in sea lice biology and drug response/resistance.
1484 Furthermore, a novel target, LR9, showed expression patterns linked with drug
1485 resistance in the in vitro EMB exposure, providing an additional target for future work.
1486 Acknowledgements 1487 This work was funded by Atlantic Canada Opportunities Agency (ACOA) and Novartis 1488 Animal Health with stipend support (JDP) from an NSERC PGSD 3 and MITACS 1489 Accelerate fellowships. The authors would like to thank Dr. Shona Whyte, Dr. Ben 1490 Sutherland, and Dr. Laura Braden for comments on early drafts of the manuscript.
1491
78 1492 Chapter 4: Effects of the vertically transmitted 1493 microsporidian Facilispora margolisi and the 1494 parasiticide emamectin benzoate on salmon lice 1495 (Lepeophtheirus salmonis)
1496 Adapted from: Jordan D. Poley1*, Ben J.G. Sutherland2,3*, M.D Fast1, Ben F. 1497 Koop2, Simon R. M. Jones4. (2017) BMC Genomics 18:630.
1498 1Atlantic Veterinary College, University of Prince Edward Island, Department of 1499 Pathology & Microbiology, 550 University Ave, Charlottetown, PEI, C1A 4P3, Canada
1500 2Centre for Biomedical Research, Department of Biology, University of Victoria, 3800 1501 Finnerty Rd, Victoria, BC, V8W 3N5, Canada
1502 3Institut de Biologie Intégrative et des Systèms (IBIS), Département de biologie, 1503 Université Laval, 1030 Avenue de la Medecine, Québec, QC, G1V 0A6, Canada
1504 4Pacific Biological Station, 3190 Hammond Bay Road, Nanaimo, BC, V9T 6N7, 1505 Canada
1506 *These authors contributed equally to this work.
1507 JDP performed PCR diagnosis of microsporidia, analyzed gene expression data with 1508 BJGS, performed qPCR laboratory work and analysis, and wrote the manuscript with 1509 BJGS.
1510 BJGS designed the experiment with BFK and SRMJ, performed all microarray 1511 laboratory work, performed qPCR, conducted microarray analysis and qPCR analysis 1512 with JDP, and wrote the manuscript with JDP.
1513 MDF contributed to writing of the manuscript and data analysis.
1514 BFK designed and conceived the experiment, contributed to data analysis, and 1515 contributed to manuscript writing.
1516 SRMJ: Designed and conceived of experiment, performed L. salmonis collection and 1517 culture, experimental infections and exposures to emamectin benzoate, in situ 1518 hybridizations and all histology, contributed to writing the manuscript and data analysis.
1519 Copyright 2017. The authors
79 1520 Abstract 1521 Microsporidia are highly specialized, parasitic fungi that infect a wide range of
1522 eukaryotic hosts from all major taxa. Infections cause a variety of damaging effects on
1523 host physiology from increased stress to death. The microsporidian Facilispora
1524 margolisi infects the Pacific salmon louse (Lepeophtheirus salmonis oncorhynchi), an
1525 economically and ecologically important ectoparasitic copepod that can impact wild and
1526 cultured salmonids. Vertical transmission of F. margolisi was demonstrated by using
1527 PCR and in situ hybridization to identify and localize microsporidia in female L.
1528 salmonis and their offspring. Spores and developmental structures of F. margolisi were
1529 identified in 77% of F1 generation copepods derived from infected females while
1530 offspring from uninfected females all tested negative for the microsporidia. The
1531 transcriptomic response of the salmon louse to F. margolisi was profiled at both the
1532 copepodid larval stage and the pre-adult stage using microarray technology. Infected
1533 copepodids differentially expressed 577 transcripts related to stress, ATP generation and
1534 structural components of muscle and cuticle. The infection also impacted the response
1535 of the copepodid to the parasiticide emamectin benzoate (EMB) at a low dose of 1.0 ppb
1536 for 24 h. A set of 48 transcripts putatively involved in feeding and host
1537 immunomodulation were up to 8-fold underexpressed in the F. margolisi infected
1538 copepodids treated with EMB compared with controls or either stressor alone.
1539 Additionally, these infected lice treated with EMB also overexpressed 101 transcripts
1540 involved in stress resistance and signalling compared to the other groups. In contrast,
1541 infected pre-adult lice did not display a stress response, suggesting a decrease in
1542 microsporidian virulence associated with lice maturity. Furthermore, copepodid
1543 infectivity and moulting was not affected by the microsporidian infection. This study
80 1544 demonstrated that F. margolisi is transmitted vertically between salmon louse
1545 generations and that biological impacts of infection differ depending on the stage of the
1546 copepod host. The infection caused significant perturbations of larval transcriptomes
1547 and therefore must be considered in future studies in which impacts to host development
1548 and environmental factors are assessed. Fitness impacts are probably minor, although
1549 the interaction between pesticide exposure and microsporidian infection merits further
1550 study.
1551 4.1 Introduction 1552 Microsporidia are a diverse group of obligate intracellular, spore-forming parasites of
1553 invertebrates and vertebrates with over 150 genera and 1,200 recognized species
1554 (Keeling and Fast, 2002). Molecular phylogenetic evidence indicates that microsporidia
1555 are highly specialized fungi that parasitize a wide range of hosts (Keeling, 2009). Many
1556 microsporidia have damaging impacts on agriculture, apiculture, and aquaculture
1557 industries (Cali and Takvorian, 2014; Higes et al., 2007; Nylund et al., 2011), as well as
1558 human health (Didier and Weiss, 2006) particularly when immunocompromised
1559 (Keeling and Fast, 2002). Microsporidia are also of interest due to their use as biological
1560 control agents against insect pests (Hajek and Delalibera, 2010; Lomer et al., 2001). To
1561 date, microsporidia infecting humans and important insects have received the most
1562 research attention despite nearly half of all known microsporidia having aquatic hosts
1563 (Stentiford et al., 2013). For example, microsporidian infections of crustaceans, a
1564 diverse subphylum with approximately 67,000 species (Ahyong et al., 2011; Martin and
1565 Davis, 2001), are only beginning to be uncovered. Given the ubiquity of crustaceans in
1566 the aquatic environment, the lack of information on interacting stressors within these
81 1567 organisms, and the economic importance of crustacean culture (i.e. 6.9 M tonnes worth
1568 $36 billion USD; FAO, 2016), studies examining the consequences of microsporidian
1569 infections are needed.
1570 The microsporidian spore is the only stage capable of surviving outside of a host
1571 cell (Keeling and Fast, 2002) and is the infective stage. Spores contain sporoplasm (i.e.
1572 infectious cytoplasm) and a polar filament that erupts under pressure and penetrates the
1573 host cell, providing a route through which the sporoplasm and nucleolar material can
1574 enter. Merogonic development of the parasite enlarges the host cell and this is followed
1575 by sporogonic development of the parasite. Spores can be released to infect adjacent
1576 cells (i.e. autoinfection), or to infect other individuals (e.g. through urine, faeces,
1577 decomposition) (Keeling and Fast, 2002). Passage of infective spores among individual
1578 hosts in water or food may be the most common mode of horizontal transmission.
1579 Spores can also transmit vertically through eggs to infect offspring. Given the intimate
1580 association of microsporidia within host cells, it is not surprising that these parasites can
1581 have major effects on their hosts (Vávra and Ronny Larsson, 2014). Drastic host
1582 transcriptomic reductions in various functions have been observed in vivo (Watson et
1583 al., 2015). Pathological and physiological consequences of microsporidia infections
1584 have been characterized for a few terrestrial species, but infections in the marine
1585 environment remain poorly understood.
1586 Microsporidia have evolved reduced genomes and other biological components
1587 (e.g. the known genome sizes are in the range of bacteria, 2.3-19.5 Mb) (Keeling and
1588 Fast, 2002). The genome of the microsporidia Encephalitozoon cuniculi is well
1589 characterised and consists of ~2.9 Mb across 11 chromosomes, with approximately
82 1590 2,000 potential protein coding genes (Katinka et al., 2001). Most studied microsporidia
1591 have a conserved set of microsporidia-specific genes, suggesting that genome reduction
1592 may have occurred prior to the diversification of the lineage (Heinz et al., 2012;
1593 Nakjang et al., 2013), but lineage-specific gene expansion and novelty is expected. The
1594 molecular basis and mechanisms of host manipulation are still being uncovered
1595 (recently reviewed in Dean et al., 2016).
1596 Salmon lice are ectoparasitic copepods belonging to the family Caligidae
1597 (suborder Siphonostomatoida) that infect both wild and farmed salmonids, causing
1598 losses of more than $500 M USD/annum globally to the aquaculture industry (Costello,
1599 2009). The salmon louse Lepeophtheirus salmonis is the most well studied species and
1600 has a direct life cycle with two free-living naupliar stages, an infective copepodid stage,
1601 two sessile parasitic chalimus stages, and three motile parasitic preadult and adult stages
1602 during which the lice are larger and more damaging to the host (Hamre et al., 2013).
1603 Genetically distinct subspecies of L. salmonis occur in the Atlantic and Pacific Oceans
1604 (Skern-Mauritzen et al., 2014; Yazawa et al., 2008). Infections on farmed Atlantic
1605 salmon Salmo salar are controlled by treatment with in-feed emamectin benzoate
1606 (EMB), although lice in the Atlantic Ocean have become resistant to this drug and to
1607 many others (reviewed by Aaen et al., 2015). Alternative, non-chemical management
1608 options are required, and given the relevance of microsporidia to pest control combined
1609 with recent descriptions of microsporidia infections in sea lice, this area requires
1610 investigation.
1611 Infections with two microsporidian species have been described in sea lice.
1612 Desmozoon lepeophtherii was originally identified in L. salmonis infecting farmed
83 1613 Atlantic Salmon S. salar in Scotland and Norway (Freeman, 2003; Freeman and
1614 Sommerville, 2009; Nylund et al., 2010) and a genetic variant of D. lepeophtherii was
1615 described from L. salmonis on farmed S. salar in the Pacific Ocean (Freeman and
1616 Sommerville, 2011; Jones et al., 2012a). The second microsporidian, Facilispora
1617 margolisi, was identified in L. salmonis infecting S. salar and Pacific salmon
1618 (Oncorhynchus spp.), and in two other Lepeophtheirus species from salmonid and non-
1619 salmonid fishes in the northeast Pacific Ocean (Jones et al., 2012a). The prevalence of
1620 D. lepeophtherii in Pacific L. salmonis ranges from 5% to 15% whereas that of F.
1621 margolisi ranges from 50% to 90% (Jones et al., 2012a).
1622 Histological evidence of F. margolisi spores within ovarian tissue (Jones et al.,
1623 2012a) suggests the possibility of vertical transmission. Furthermore, nothing is known
1624 regarding the effects of the infection on the survival, infectivity and fecundity of L.
1625 salmonis. Here we provide further evidence of vertical transmission of F. margolisi and
1626 determine whether the microsporidian affects copepodid survival and infectivity. We
1627 then characterize the impacts of the microsporidian infection on the copepod
1628 transcriptome, compare this response to known stress genes for L. salmonis, and
1629 determine whether the response is affected by the addition of a stressor (low dose
1630 EMB). Finally, we use this dataset and identify probes that are probably of
1631 microsporidian origin on the commonly used L. salmonis microarray. We then use these
1632 probes to diagnose infection status in an existing published transcriptome dataset of pre-
1633 adult L. salmonis, validate the findings using RT-qPCR, and compare the responses of
1634 pre-adult and copepodid lice to the microsporidian infection.
84 1635 4.2 Methods
1636 4.2.1 Animals 1637 Ovigerous Lepeophtheirus salmonis were collected from wild adult Chum Salmon
1638 Oncorhynchus keta or farmed Atlantic Salmon (Salmo salar) and maintained in aerated
1639 seawater at 10°C for no longer than 48 h before processing.
1640 Chum Salmon from the Nanaimo River hatchery were reared from swim-up fry
1641 in a mixture of freshwater and seawater (9.2 °C – 10.0 °C) and provided a daily ration of
1642 commercial pellets. Any procedure involving the use of animals was carried out in
1643 accordance with the recommendations of the Canadian Council for Animal Care. All
1644 procedures were approved by the Pacific Regional Animal Care Committee at the
1645 Pacific Biological Station under the Animal Use Protocol 11-004.
1646 4.2.2 Culture of L. salmonis larvae 1647 Four experiments (Exp. 1-4) were conducted in which the F. margolisi infection status
1648 of individual adult female L. salmonis and their nauplius or copepodid offspring were
1649 determined and compared (Table 1). For each experiment between 20 and 40 ovigerous
1650 copepods bearing two intact and pigmented egg strings were selected. From each, one
1651 egg string was placed into a sterile flask containing 300 mL of aerated seawater and
1652 incubated at 10°C for six to eight days. The second egg string and the anterior third of
1653 the cephalothorax were preserved separately in 95% ethanol and the remainder of the
1654 specimen was preserved in neutral buffered 10% formalin (NBF). All dissections were
1655 conducted using tools rinsed sequentially with 4% sodium hypochlorite, water and 95%
1656 ethanol between specimens. The infection status of each specimen was determined from
1657 separate polymerase chain reactions (PCR, see below) of the cephalothorax and egg-
1658 string.
85 1659 In Exp. 1, 20 larval cultures were separately filtered through 47 mm cellulose
1660 acetate/cellulose nitrate membranes with a pore size of 8.0 μm (EMD Millipore). The
1661 membranes were flash-frozen in liquid nitrogen and stored at -80°C for subsequent PCR
1662 analysis. In Exp. 2, 24 larval cultures were pooled according to infection status of the
1663 source copepod. The numbers of copepodids and nauplii in each pool were determined
1664 by microscopic examination and used to infect naïve salmon (see below). In Exp. 3, 40
1665 larval cultures were separately pooled according to infection status of the source
1666 copepod and fixed in NBF for 24 h followed by storage in 70% ethanol for in situ
1667 hybridisation assays (see below). In Exp. 4, 40 larval cultures were pooled according to
1668 the F. margolisi infection status of the source copepod. Each pool was divided into 16
1669 sub-pools, 14 of which were maintained in aerated seawater for use in the emamectin
1670 benzoate (EMB) exposure study (see below) while the remaining two pools from each
1671 of infected and uninfected females were filtered and stored as above for PCR
1672 confirmation.
1673 4.2.3 Polymerase chain reaction (PCR) detection 1674 DNA was extracted from ethanol-preserved specimens using the DNeasy Animal Tissue
1675 protocol (Qiagen), as per manufacturer’s instructions. A region of F. margolisi SSU
1676 rDNA was amplified with PCR as described by (Jones et al., 2012a). Samples were
1677 scored F. margolisi positive (MS+) or negative (MS-) using 1.5% agarose gel
1678 electrophoresis.
1679 4.2.4 Exposure of salmon to L. salmonis 1680 Juvenile Chum Salmon (11.0 ± 0.3 g; n = 6 per tank) were acclimated for 6 days in
1681 duplicate 30-L tanks containing aerated seawater at 30 ppt and 9°C, flowing at 1 L min-
1682 1. Fish in each tank were exposed to 1570 and 1680 7-day post hatch (dph) copepodids
86 1683 derived from infected and uninfected female copepods (Exp. 2, above), respectively,
1684 using the method described earlier (Jones et al., 2006). At 15 dph, the salmon were
1685 euthanized by immersion in 200 mg L-1 tricaine methane sulphonate and all copepods
1686 were removed and stored in 95% ethanol. Each copepod was assessed microscopically
1687 for stage of development and for the presence of F. margolisi by using PCR.
1688 4.2.5 Histology 1689 NBF-preserved specimens from Exp. 3 were processed routinely for histology and
1690 subsequent microscopic examination as previously described (Jones et al., 2012a).
1691 During processing the larvae were aggregated prior to embedding to facilitate detection.
1692 Sections of 5 μm were applied to uncoated or silane coated glass microscope slides and
1693 stained routinely (Gram or Giemsa stains), or processed for in-situ hybridisation,
1694 respectively.
1695 4.2.6 In-situ hybridization probe design, synthesis and assay 1696 An 84 bp region of the F. margolisi SSU rRNA gene was amplified (see primers in
1697 Additional File 6) to serve as template for subsequent digoxygenin (DIG) labelling
1698 reactions using a probe synthesis kit (Roche Applied Science). Each reaction contained
1699 2μl of genomic DNA, 1x PCR reaction buffer (Invitrogen), 1.5mM MgCl2 (Invitrogen),
1700 0.2mM of each dNTP, 0.025U/μl of Platinum® Taq DNA polymerase (Invitrogen), and
1701 sterilized water. Positive (F. margolisi DNA) and negative (water) controls were
1702 included alongside all reactions. The PCR profile consisted of 95°C for 5 min, 35 cycles
1703 at 95°C for 30 sec, 55°C for 30 sec, and extension at 72°C for 2 min, followed by a final
1704 extension at 72°C for 10 min. Amplified PCR products were visualized on ethidium
1705 bromide stained, 1% agarose gels. PCR products were purified using QIAquick® PCR
1706 Purification Kit (Qiagen) and quantified with NanoDrop-1000 Spectrophotometer. DIG-
87 1707 labelling reactions were carried out according to the manufacturer’s instructions using
1708 30 ng of purified PCR product with the same primers and thermal profile as the
1709 conventional PCR and DIG labelled products were purified as described above.
1710 The ISH protocol was adapted from earlier work (Jones et al., 2003). Tissue
1711 sections on silane-coated slides were routinely deparaffinized and permeabilized with
1712 20ng/μl of proteinase K (Qiagen) for 10 min. Sections were incubated with 50 μl of
1713 hybridization buffer (5.1 ml deionised formamide, 2.0 ml 20x standard saline citrate
1714 (SSC; 3M NaCl, 0.3M sodium citrate, pH 7.0), 2.0 ml 5% dextran sulphate, 0.5 ml
1715 denatured sperm DNA (10 mg/ml), 0.2 ml 50x Denhardt’s solution (1% acetylated
1716 bovine serum albumin (BSA), 1% polyvinylpyrrolidone, and 1% Ficoll 400 in
1717 molecular biology grade water) and 25 μl 10% sodium dodecyl sulphate (SDS) per
1718 10ml of solution) for 1 hr at 37°C. A volume of 50 μl of digoxygenin (DIG) - labelled
1719 probe (0.1 ng/μl in hybridization buffer) was placed on each tissue section.
1720 Hybridization, formazan precipitation, and probe visualization were performed at 37°C
1721 following an established protocol (Jones et al., 2003). Controls included sections from
1722 PCR-positive and -negative adult copepods stained with DIG - labelled probe and
1723 sections from PCR-positive copepods stained with unlabelled probe.
1724 4.2.7 Exposure to EMB and extraction of RNA 1725 Four experimental conditions were tested (Exp. 4) based on the presence of the
1726 microsporidian F. margolisi (MS+ or MS-) and EMB (EMB+ or EMB-). These
1727 conditions are labeled as MS+/EMB+, MS+/EMB-, MS-/EMB+, MS-/EMB-, and each
1728 with seven biological replicates. Each replicate was a flask containing between 50 and
1729 75 copepodids. EMB (Sigma-Aldrich) was dissolved at a concentration of 1.0 ppb and
1730 aerated cultures were maintained for 24 hr at 10°C before filtration, flash-freezing and
88 1731 storage as above. The frozen filters were homogenized (mixer mill; Retsch® MM 301),
1732 and total RNA was extracted using TRIzol® (Invitrogen), as per manufacturers’
1733 instructions. Total RNA was purified through RNeasy spin columns with an on-column
1734 DNase I treatment (Qiagen). Total RNA was quantified by spectrophotometry
1735 (NanoDrop-1000), and quality checked by electrophoresis on a 1% agarose gel.
1736 Samples were then randomized for all downstream nucleic acid manipulations.
1737 4.2.8 Microarray Analysis 1738 Labeled cRNA was generated from total purified RNA using Low Input Quick Amp
1739 Labeling kits (Agilent) as per manufactures’ instructions and as reported previously
1740 (Sutherland et al., 2012). A Cy3-cRNA pool was generated for a reference design by
1741 synthesizing Cy3-cRNA from three randomly selected samples from each of the four
1742 experimental conditions and combining equimolar amounts from each into a common
1743 pool. Samples were hybridized as per manufacturer’s instructions as previously
1744 described (Jones et al., 2003) to a 38K oligo microarray designed using previously
1745 annotated ESTs from both Pacific and Atlantic L. salmonis (Yasuike et al., 2012) using
1746 eArray (Agilent). Slides were scanned on a ScanArray® Express (Perkin Elmer) at 5
1747 μm resolution using PMT settings optimized to have the median signal of ~1-2% of
1748 array spots saturated (Cy5: 70; Cy3: 75).
1749 Images were quantified in Imagene 8.1 (Biodiscovery), poor spots flagged, and
1750 background corrected as reported previously (Sutherland et al., 2012). Sample files were
1751 loaded into GeneSpring 13.0 (Agilent). Raw sample files have been uploaded to GEO
1752 (GSE94692). Samples were normalized as follows: raw value threshold of 1.0;
1753 intensity-dependent Lowess normalization; and baseline transformation to the median of
1754 all samples. Control spots, and any probes not passing the following filter were removed
89 1755 from the analysis: raw values ≥ 500 in both Cy3 and Cy5 channels and no poor quality
1756 flags in at least 65% of samples in any one condition. A principle component analysis
1757 was performed within GeneSpring (Agilent) on the samples to investigate for any
1758 clustering of technical or biological variables.
1759 Probes were tested using a two-way ANOVA (p < 0.01; FC ≥ 1.5) for main
1760 effects of microsporidia, main effects of EMB, and a significant interaction effect of
1761 microsporidia and EMB. Probes with a significant interaction effect were subtracted
1762 from the main effect lists to be considered with the interaction effect list. Probes with a
1763 significant interaction effect were separated by k-means clustering using the least
1764 number of clusters until cluster redundancy was visible (Euclidean distance metric; 6
1765 clusters; 50 iterations; Agilent). Gene Ontology and pathway analysis was performed on
1766 significant entity lists using UniProt accession numbers in the DAVID bioinformatics
1767 tool (Huang et al., 2009, 2008, 2007) using a modified Fisher’s exact test (p < 0.05;
1768 genes/enrichment category ≥ 4) with a background list of all entities passing quality
1769 control filters. This background list was used for a principal components analysis that
1770 clustered samples according to expression of genes. Samples were colored or shaped
1771 differently in order to identify trends associated with experimental conditions.
1772 4.2.9 Pre-adult L. salmonis exposed to EMB 1773 A fifth experiment, which was previously described (Appendix 1), included exposure of
1774 F1 generation pre-adult II L. salmonis (21 females and 19 males) to either seawater,
1775 0.01 ppb EMB (Sigma-Aldrich), or 0.1 ppb EMB. These lice were collected from
1776 farmed Atlantic salmon in the Broughton Archipelago, British Columbia (BC). Using
1777 the previously extracted RNA, as described (Chapter 2), cDNA for detection of the
1778 microsporidian and qPCR of selected genes in these archived samples was synthesized
90 1779 for individual lice from 1 ug of purified RNA using iScript Reverse Transcription
1780 Supermix kit (BioRad) as per manufacturer’s instructions (see Appendix 1). Detection
1781 of F. margolisi was completed as described earlier (Jones et al., 2012a) with the
1782 exception that cDNA derived from purified RNA was used as template and a touch-
1783 down PCR assay with decreasing annealing temperatures from 63oC to 58oC was
1784 completed before standard PCR for an additional 25 cycles to amplify the target
1785 sequence.
1786 The microarray results were validated using RT-qPCR of five targets to confirm
1787 expression patterns. Primer efficiencies were confirmed by creating standard curves
1788 with 5-6 points and a 5-fold series dilution with a r2 > 0.95 and effeciencies between
1789 0.90 and 1.05. For RT-qPCR amplification, SsoAdvanced SYBR Green Supermix
1790 (BioRad) was used in 11 μl reactions with 1 μl template and 0.1 μM of each primer
1791 using the following program: 95°C for 2 min, followed by 40 cycles of 95°C for 5 sec
1792 and 60°C for 15 sec. Melt curve analysis was performed at the end of each qPCR assay
1793 by increasing the temperature in 0.5°C increments (65°C to 95°C) every 5 sec. No
1794 template controls (NTC) and no RT controls were negative for all genes assayed.
1795 Normalization for genes of interest was completed using qbase-PLUS (Biogazelle;
1796 Gent, Belgium) with an output of log2 ratios relative to the reference genes elongation
1797 factor 1α (ef1α) and ribosomal protein subunit 20 (rps20). Reference gene stability was
1798 assessed using geNorm (Vandesompele et al., 2002), which showed an M value of 0.35
1799 and a coefficient of variation (CV) of 0.13.
1800 Normalized log2 expression measured by RT-qPCR was compared to Cy5/Cy3
1801 log2 expression ratios produced by the microarray. For genes specifically expressed in
91 1802 MS+ lice on the microarray, this was validated by RT-qPCR. For genes expressed in all
1803 conditions, a Pearson’s correlation (R v. 3; Team, 2016) used to validate the microarray
1804 (Additional File 6).
1805 4.3 Results
1806 4.3.1 Vertical transmission of F. margolisi 1807 Four experiments (Exp.) were conducted to evaluate different aspects of the biology of
1808 F. margolisi, including vertical transmission in L. salmonis (Table 1). Exp. 1 was used
1809 to evaluate vertical transmission of the microsporidian. Exp. 2 was also for this purpose,
1810 but included an experimental infection to test the effect on infectivity and development.
1811 Exp. 3 was used for in situ hybridization in order to determine locations of F. margolisi
1812 within the louse. Exp. 4 was used to perform transcriptome profiling of the interaction
1813 of F. margolisi infection and EMB exposure. Further details regarding each experiment
1814 are provided in Table 1. F. margolisi was detected in the cephalothorax and egg string
1815 samples of approximately 60% of the screened F0 individuals within these four
1816 experiments (n = 124). The microsporidian was detected in both the cephalothorax and
1817 matched egg string from 96% (n = 47) of F margolisi positive (MS+) copepods in
1818 which both tissues were tested. In the first experiment (Exp. 1), when individual egg
1819 strings were used to cultivate F1 individuals, 92% of the MS+ egg strings gave MS+
1820 copepodid pools and none of the MS- egg strings produced MS+ offspring.
92 1821 Table 1: Microsporidia (MS) Facilispora margolisi infections in adult female salmon
1822 lice Lepeophtheirus salmonis (F0) and their F1 larval progeny as determined by PCR. F individual (MS+ / total) F samples (MS+ / total) Source of F 0 1 EXP 0 lice Cephalothorax Egg String F0 positive F0 negative
1 Chum Salmon 12/20 12/20 11/12 (pools) 0/8
2 Chum Salmon 14/24 13/24 28/39 0/42
3 Atlantic Salmon 25/40 N/A N/A N/A
4 Atlantic Salmon 23/40 22/40 2/2 (pools) 0/2
Total 74/124 (60%) 47/84 (56%) 28/39 (72%)* 0/42 (0%)*
1823 In experiment (Exp.) 1, each F1 nauplius and copepodid pool originated from a single F0 1824 egg string. In Exp. 2, F1 chalimus II staged lice had developed from pools of MS+ or 1825 MS- eggs derived from F0 females. In Exp. 3, F1 nauplius and copepodid pools were 1826 reserved for in situ hybridizations. In Exp. 4, 40 larval cultures derived from MS+ or
1827 MS- F0 females were divided into 16 pools for each of MS+ and MS- groups, 14 for 1828 microarray analysis and 2 for PCR confirmation of F. margolisi (PCR confirmation 1829 pools shown in the table). All PCR-positive results in the egg string were also positive 1830 in the cephalothorax. *Totals only include individuals, not pools.
1831 At 15 days post infection, Chum Salmon (Oncorhynchus keta) were infected
1832 with L. salmonis copepodids of known MS infection status (Exp. 2, Table 1) and there
1833 was no significant difference in the intensity of infection for MS+ or MS- lice (MS+:
1834 6.5 ± 0.56; MS-: 7.0 ± 0.52 lice / fish; Chi2-test, p = 0.53). Most copepods in both
1835 infection groups (97.4% and 95.2%, respectively) had developed to the late chalimus II
1836 stage at the time of sampling. F. margolisi was detected in 72% of the chalimus II lice
1837 derived from MS+ egg strings but not in any from MS- egg strings (28/39 see Exp. 1 in
1838 Table 1).
93 1839 4.3.2 Histological identification of F. margolisi in L. salmonis 1840 In-situ hybridization (ISH) identified F. margolisi DNA in histological sections from
1841 adult female L. salmonis shown previously to be PCR-positive for F. margolisi (see
1842 Exp. 3), but not in any of the negative controls. In the adult louse, ISH-positive spores
1843 and non-sporogonic structures were associated with cells immediately below the cuticle,
1844 in striated muscle, glandular tissues, ovary and egg strings (Figure 1). ISH-positive
1845 reactions were also visualised within unidentified tissues of larval copepods derived
1846 from PCR-positive females (Figure 1).
1847
1848 Figure 1: Vertical transmission of Facilispora margolisi in Lepeophtheirus 1849 salmonis. Microsporidian infection (arrows) in the copepod ovary (a) and egg string (b) 1850 by in-situ hybridisation. Microsporidian spores (arrow) in Giemsa-stained egg string 1851 (c). Microsporidian spores (arrows and arrowheads) in Giemsa-stained (d) and in-situ 1852 hybridisation (e) preparations of nauplius larvae. Insets are higher magnification 1853 images.
94 1854 4.3.3 Transcriptomic response of copepodid salmon lice to F. margolisi
1855 4.3.3.1 Overview
1856 Copepodid pools (F1; see Exp. 4), each originating from a single adult female (MS+ or
1857 MS-), were incubated either in seawater alone (unexposed control) or in seawater
1858 containing 1 ppb emamectin benzoate (EMB) to evaluate the effect of MS infection and
1859 the effect of combined MS and EMB on the L. salmonis transcriptome (7 pools per
1860 condition, 28 pools in total; Figure 2). Principal components analysis (PCA) of all
1861 quality filtered transcripts indicated a larger effect of MS than of EMB (Figure 3). The
1862 first axis differentiated the MS+ and MS- pools and explained 29.5% of the total
1863 variation. Clustering associated with EMB exposure was less obvious. Treatment
1864 groupings most distant from one another in the PCA were MS-/EMB- and MS+/EMB+.
1865 The number of differentially expressed transcripts also supported a greater effect of MS
1866 than 1 ppb EMB (Figure 4). MS infection affected 577 transcripts whereas EMB
1867 affected 228 transcripts (main effects with no interaction effect; p ≤ 0.01 and fold
1868 change (FC) ≥ 1.5; Additional File 1). The range of FC was also greater for transcripts
1869 with a main effect of MS (FC = -9.7 to 4.5) compared with those showing a main effect
1870 of EMB (FC = -2.8 to 2.4; Additional File 1). Similarities between the effects MS and
1871 EMB were indicated from 150 transcripts concordantly differentially expressed by EMB
1872 and MS (Figure 4; Additional File 1).
1873 To better characterize response genes, transcripts were classified into the
1874 following categories: i) MS-specific response genes; ii) general stress response genes,
1875 responding concordantly to MS and EMB; and iii) interacting stressor genes, whose
1876 response depended on the presence of the second stressor (see Figure 4). As the
1877 majority of transcripts affected by EMB exposure also responded to MS infection
95 1878 (Figure 4), an EMB-specific response category was not included. All transcripts with an
1879 EMB-specific response can be found in Additional File 1.
MS-/EMB- MS+/EMB-
1880 MS-/EMB+ MS+/EMB+
1881 Figure 2: Experimental design for the transcriptome response of copepodid lice to 1882 emamectin benzoate (EMB) and/or microsporidia (MS). Each condition has seven 1883 biological replicates and each replicate is a pool of copepodid lice. The factorial design 1884 allows for analysis of genes responding to MS, EMB or having an interaction effect of 1885 the two factors.
1886 4.3.3.2 MS-specific response genes 1887 Of the 577 transcripts responding to F. margolisi infection (main effect, no MS/EMB
1888 interaction effect), 427 (74%) were MS-specific (Figure 4). Of these, 212 were
1889 overexpressed and 215 were underexpressed in MS+ L. salmonis.
96 1890
1891 Figure 3. Principal Component Analysis of copepodids exposed to F. margolisi 1892 and/or EMB clustered by gene expression. Samples are quality filtered transcriptome 1893 profiles of lice pools that are either positive (blue) or negative (red) for the 1894 microsporidia infection. Clustering indicates that PC1 (X-axis) explains the most 1895 variation, with 29.5% of total variation explained. Samples were either exposed to the 1896 parasiticide emamectin benzoate (triangles) or control (square), but this had less of an 1897 effect than that of the microsporidia. PC2 (Y-axis) explains 24.5% and PC3 (Z-axis) 1898 explains 7.1% of the total variation. PC2 and PC3 were not as clearly associated with a 1899 treatment group as was the infection status, which was separated along PC1.
1900 Overexpressed MS-specific transcripts included 12 cuticle-associated transcripts
1901 (e.g. cuticle protein 6, cuticle protein 7, cuticle protein C14.6) and 18 transcripts
1902 associated with muscle (e.g. myosin heavy chain muscle, myosin-3, tropomyosin,
1903 tropomyosin-2, tropomyosin alpha-1 chain, troponin I and troponin T; Additional File
1904 1). Cytoskeleton-related transcripts were overexpressed and enriched (GO:
1905 cytoskeleton, 14 transcripts; p = 0.003) in MS+ lice including restin homolog, actin
1906 clone 403, actin-related protein 2/3 complex subunit 4, actin cytoplasmic 1, tubulin
1907 alpha-1A chain, tubulin alpha-3 chain, and tubulin beta-1A chain.
97 1908 Underexpressed MS-specific transcripts were related to the mitochondria (e.g.
1909 GO: mitochondrial part, 16 transcripts; p < 0.01; Additional File 2) and ribosomes.
1910 Mitochondria-related transcripts included NADH dehydrogenase 1 alpha subcomplex
1911 subunits 2, 10 and 12, cytochrome c oxidase subunit 1, 5B and 6B, CYP450 2J2 and
1912 CYP450 2L1 (Additional File 1). Ribosomal proteins (rp) underexpressed in MS+ lice
1913 included those present in the mitochondria (e.g. 28S rp s32, 39S rp L22, 39S rp L23,
1914 39S rp L32, 40S rp s12 and 60S rp L12) and those in the cytoplasm (e.g. 40S rp s16, 60S
1915 rp L3, 60S rp L29, 60S rp L30, 60S rp L44, rp s6 kinase beta 2), suggesting an overall
1916 reduction in ribosome constituents in the MS+ lice.
1917
1918 Figure 4. Significantly differentially expressed transcripts in response to the 1919 microsporidian F. margolisi, to the parasiticide EMB, or an interaction of the two.
1920 4.3.3.3 General stress response genes 1921 A total of 150 transcripts were overexpressed in both the MS+ and EMB+ treatment
1922 groups (main effects, no interaction effect). These were enriched for protein folding and
1923 ATP binding functions (Table 2; Additional File 2). Overexpressed transcripts included
1924 several previously associated with stress in L. salmonis such as 60kDa heat shock
1925 protein mitochondrial, DnaJ homolog subfamily A member 1, heat shock 70kDa protein
98 1926 cognate 4, heat shock protein 90-alpha, heat shock cognate protein 90-beta and T-
1927 complex proteins (TCP) TCP-1-alpha, TCP-1-beta, TCP-1-epsilon, TCP-1-theta, and
1928 TCP-1-zeta (Additional File 1; Sutherland et al., 2012a). Fold changes of these
1929 transcripts were more modest than those of MS-specific response genes, and were
1930 typically in the range of 1.5- to 2.1-fold (Additional File 1).
1931 Underexpressed general stress response transcripts included seven proteases
1932 (e.g. trypsin-1, neprilysin-11, carboxypeptidase B, and hypodermin-B; Table 2;
1933 Additional File 1). All underexpressed proteases were annotated as secreted by
1934 SP_PIR_Keyword, and this list was enriched for peptidase activity acting on L-amino
1935 acid peptides (Table 2). Furthermore, multiple solute carrier (SLC) family members
1936 were underexpressed including high affinity copper uptake protein 1 (slc31A1), solute
1937 carrier family 15 member 1 (slc15A1) and sodium-dependent phosphate transport
1938 protein 2B (slc34A2). These transcripts, and others, enriched the GO category substrate-
1939 specific transmembrane transporter activity (Table 2). Transporters were
1940 underexpressed in MS+ lice and in EMB+ lice, and five of these were underexpressed in
1941 both groups.
99 1942 Table 2: Unique SwissProt IDs for transcripts differentially expressed by EMB 1943 exposure and F. margolisi infection. Count P-value of Functional Annotation Accession (# Unique SwissProt IDs) enrichment Term ID MS EMB Shared MS EMB Overexpressed contigs ATP binding GO:0005524 25 18 10 4E-04 2E-05 Chaperone Keywords 16 10 10 2E-08 3E-06 Chaperonin-containing GO:0005832 4 4 4 3E-04 5E-05 T-complex Chaperonin Cpn60/TCP-1 IPR002423 9 6 6 3E-11 2E-07 Cytosol GO:0005829 15 11 7 0.002 0.001 Nucleotide-binding Keywords 31 17 9 2E-05 8E-04 Protein folding GO:0006457 17 11 11 6E-10 3E-07 Protein metabolic process GO:0019538 36 26 15 4E-04 1E-05 Underexpressed contigs Disulfide bond Keywords 20 12 9 2E-05 8E-05 Extracellular region GO:0005576 17 8 7 1E-05 0.003 Glycoprotein Keywords 21 15 13 0.005 1E-04 Integral to membrane GO:0016021 32 17 14 0.005 0.005 Peptidase activity, acting on GO:0070011 13 8 7 7E-04 0.002 L-amino acid peptides Peptidase S1 and S6, IPR001254 6 4 3 6E-04 0.004 chymotrypsin/Hap Protease Keywords 13 8 7 8E-04 0.002 Serine protease Keywords 8 6 5 8E-05 9E-05 Secreted Keywords 13 8 7 1E-04 5E-04 Substrate-specific transmembrane transporter GO:0022891 10 6 5 0.02 0.03 activity Transmembrane Keywords 32 17 14 3E-04 0.001 1944 Transcripts (unique SwissProt IDs only) from each main effect list (2-way ANOVA; p < 1945 0.01; FC ≥ 1.5 main effect and no interaction effect) were analyzed independently and 1946 then compared for similar functional enrichments including Gene Ontology (GO), 1947 InterPro (IPR), and SP_PIR_Keyword (Keywords). The numbers of transcripts 1948 responding to both stressors are displayed in the shared count column. See Additional 1949 File 1 and 2 for transcript IDs and SwissProt accessions for each functional term.
1950 4.3.3.4 Interacting stressor response genes 1951 The expression of 290 transcripts showed a significant interaction between EMB
1952 exposure and MS (p < 0.01 and FC ≥ 1.5; Figure 4). The expression similarities among
100 1953 these transcripts were characterized by k-means clustering to separate them into six
1954 general patterns (clusters A-F; Figure 5). Transcripts in clusters A, C, and E were
1955 overexpressed and B, D, and F were under-expressed in at least one of the treatment
1956 groups relative to the controls.
1957 1958 Figure 5: Stressor interacting genes clustered by expression profiles. Transcripts (n 1959 = 290) responding to MS or EMB differently depending on the presence of the second 1960 stressor (i.e. significant interaction effect) as characterized by k-means clustering of 1961 expression levels in six clusters (A-E; k = 6). Mean expression profiles are represented 1962 by the black lines for each cluster.
1963 The majority of the transcripts with significant interaction effects belong to two
1964 classes. Genes in cluster A (32/290 transcripts; Figure 5) had equal overexpression in
101 1965 both single stressors (MS or EMB) but were not overexpressed additively in the double
1966 stressor condition (MS+/EMB+). These transcripts were similar to the general stress
1967 response genes described above, including calreticulin, Dnaj homolog subfamily B
1968 member 11, and stress-induced-phosphoprotein 1 (Additional File 3). The second main
1969 class included transcripts in clusters E (101/290) and F (49/290), that were only affected
1970 in the double stressor group (EMB+/MS+) (Figure 5). Cluster E included overexpressed
1971 catalase, DnaJ homolog subfamily A member 1, heat shock protein 81-1, or structural
1972 transcripts such as myosin heavy chain, myosin light chain alkili, muscle M-line
1973 assembly protein unc-89, tropomyosin, and many others (Additional File 3). Cluster F
1974 included transcripts only underexpressed in MS+/EMB+ lice such as the transporters
1975 slc25A36, protein spinster, and RhGB. RhGB was previously shown to be down-
1976 regulated in L. salmonis by EMB, cypermethrin, and hyposalinity (Chapter 4).
1977 Cluster B had the largest fold changes, and contained 48 transcripts 1.8- to 8-
1978 fold underexpressed in the double stressor condition (Figure 5). Some of these
1979 transcripts were also slightly downregulated (FC < 2) in MS+ lice. Cluster B largely
1980 contained serine-type endopeptidases including those annotated as trypsin-1 (9 different
1981 contigs), anionic trypsin-1, chymotrypsin A chain C, chymotrypsin BI (2 different
1982 contigs), hypodermin-B, ovochymase-1, and collagenase (Figure 6; Additional File 3).
1983 Also included were other degradative enzymes such as cathepsin-L light chain,
1984 cathepsin-D, and carboxylesterase (2 different contigs), and detoxification-related
1985 transcripts such as cytochrome p450 2J2 and carboxypeptidase B (4 different contigs).
1986 Of the 34 annotated transcripts in Cluster B, 22 were annotated with the
102 1987 SP_PIR_Keyword secreted, 16 of which contained at least one trypsin-like protease
1988 domain (CDD: smart00020, NCBI).
C) A (P n ) ) o L) C C lm T A ) A a (A (P C L) (P S t + A T y tl. n B (P (A it A ta M B B lin n is /E a o es + EM EM s g r S w in g M m m lo d ru ro ro e d in f f m fe n g. g. g. ro i e e e f in p. -r -r -r g. g. x n n n re re re ow ow ow p- p- ve Type Description Probe ID D D D U U O Aspartic endopeptidase cathepsin D C176R163 X X X carboxypeptidase B C205R034 X X X C184R041 X X X X Carboxypeptidase C088R011 X X X X C074R104 X X Cystein-type cathepsin L light chain C255R047 X X X X endopeptidase legumain C079R052 X X anionic trypsin-1 C036R034 X X X chymotrypsin A chain C C118R037 X X X chymotrypsin BI C213R156 X X X X X C213R138 X X X X X collagenase C093R121 X X X X hypodermin-B C118R088 X X X ovochymase-1 C100R117 X X X X trypsin-1 C035R118 X X Serine-type C064R094 X X endopeptidase C012R041 X X X X X C096R167 X X X C152R115 X X X X X C172R033 X X X X X C180R118 X X C219R119 X X C264R056 X X X placental protein 11 C158R157 X X X serine protease C080R027 X X X X X abhydrolase C162R144 X X X Hydrolase PI-PLC protein 3 C264R076 X X X phospholipase A2 C091R068 X X X X X cytochrome P450 2J2 C172R018 X X X (Euk_Ferritin) domain C121R160 X X X GILT-like protein C223R078 X X X X aquaporin-9 C047R025 X X X Other SLC15A1 C110R135 X X X COesterase C071R020 X carboxylesterase C221R124 X protein C03F11.3 C090R136 X X X X 1989 granulin-7 C087R159 X X X X
1990 Figure 6: Multiple experiment analysis of double stressor down-regulated genes. 1991 The 48 transcripts in Cluster B were underexpressed in all EMB+/MS+ lice compared to 1992 other groups (interaction effect, p < 0.01 and FC ≥ 1.5). Using these transcripts, a cross- 1993 experiment comparison was performed with previously published L. salmonis 1994 transcriptome data, which indicated that these transcripts may be involved in feeding, 1995 stress responses, and drug resistance. Only annotated transcripts are shown. Further 1996 information on the transcripts in Cluster B and the studies with similar transcripts can be 1997 found in Additional File 4.
103 1998 Transcripts within cluster B were further compared with other published L.
1999 salmonis microarray datasets due to their putative secreted degradative enzyme
2000 function. Of the 48 unique transcripts (based on unique contig identifiers), 36 were
2001 overexpressed in actively feeding lice relative to starved lice (Figure 6; Braden et al.,
2002 2017), 20 transcripts were overexpressed in EMB-resistant relative to EMB-sensitive
2003 Atlantic lice, and 32 transcripts were down-regulated by 50 ppb EMB exposure in pre-
2004 adult Pacific lice (Appendix 1). Furthermore, 20 transcripts were affected in Pacific
2005 copepodids by hyposaline conditions (Figure 6 and Additional File 4) (Sutherland et al.,
2006 2012). These genes may therefore be important for a range of processes, including
2007 feeding, stress response and drug resistance.
2008 4.3.4 Microsporidian genes on the salmon louse microarray 2009 Archived individual transcriptome profiles of pre-adult Pacific salmon lice exposed to
2010 very low concentrations of EMB that did not affect the transcriptome (GEO accession:
2011 GSE73734; Chapter 2) were tested for the presence of F. margolisi using PCR probes
2012 (see Methods). Of the 40 samples, 22 (55%) were MS+ and 18 were MS-, permitting the
2013 analysis of genes affected by MS within these pre-adult individuals.
2014 In the pre-adult transcriptomes, few differences were observed between MS+
2015 and MS- individuals (Additional File 5). However, the expression of 20 transcripts was
2016 detected in all 22 MS+ individuals, but not in any of the 18 MS- samples (i.e. 100% of
2017 MS- samples had a Cy5 value below the QC filter background). Interestingly, these
2018 transcripts did not pass background fluorescence thresholds in any of the copepodid
2019 samples from the previously described MS/EMB study, regardless of MS infection
2020 status. Of the 20 transcripts expressed exclusively in MS+ pre-adults, 14 (70%) were
2021 annotated to genes from other microsporidian parasites such as Spraguea lophii (4
104 2022 transcripts) and Nosema ceranae (3 transcripts; Table 3). Two of the remaining six
2023 transcripts were annotated to the slime mold Dictyostelium discoideum and the
2024 causative agent of malaria Plasmodium falciparum, and four had no annotation. The
2025 presence and absence of expression in the MS+ and MS- samples identified on the
2026 microarray was validated using RT-qPCR for subunit alpha of phenylalanyl-tRNA
2027 synthetase, heat shock protein 90, and 40S ribosomal protein S4 (Table 3; Additional
2028 File 6).
2029 Table 3: Transcripts expressed exclusively in MS+ pre-adult L. salmonis, putatively of 2030 microsporidia F. margolisi origin Contig ID SwissProt E- Description Organism value 5725753* S7XG51 4E-76 Ribosomal S4 Spraguea lophii 5733902* S7XQV3 6E-84 Beta-tubulin Spraguea lophii 5722217* A0A0F9Z835 5E-67 Heat shock 90 Nosema ceranae 5734902* H8Z9X9 3E-56 Heat shock 90 Nematocida parisii 5725884* A0A0F9WFB6 2E-60 Heat shock 70 Nosema ceranae Phenylalanyl-tRNA Ordospora 5724134* A0A0B2UJK9 3E-132 synthetase alpha colligata 5729536* A0A059EU36 9E-129 Ribosomal S4 Anncaliia algerae Trachipleistophora 5727693* L7JXU0 0 Elongation factor 2 hominis 5723341* Q25002 1E-153 Elongation factor 1 Glugea plecoglossi 5727856* S7XVR1 7E-75 Heat shock 70 Spraguea lophii 5726266* A0A0F9WBW4 2E-116 Tubulin alpha Nosema ceranae Diphosphate 5722879* S7XU13 7E-155 Spraguea lophii reductase Dictyostelium 5727653 Q553P2 3E-11 Uncharacterized discoideum Antonospora 5734574* C8CG41 4E-9 Polar tube protein locustae Plasmodium 5724095 W4J6D6 5E-9 Uncharacterized falciparum Encephalitozoon 5733921* E0S8Y5 4E-14 Uncharacterized intestinalis 2031 Annotation using e < 10E-5 with UniProt BLASTx (UniProt, 2015) 2032 * Contig sequence best aligns with another microsporidian sequence
105 2033 The exclusive presence of these transcripts in MS+ individuals, combined with
2034 their annotation to genes from other microsporidian species suggests that they are not
2035 from L. salmonis but rather of microsporidia origin in the original samples used to
2036 create the microarray. The concordance in profiles between the diagnostic primers
2037 (Jones et al., 2012a), microarray probes, and RT-qPCR primers suggests that these
2038 sequences may be useable to screen for the presence of F. margolisi in individual adult
2039 L. salmonis samples, but not in copepodid pools. These probes will be flagged as
2040 microsporidian origin in future updates of the 38k microarray annotation file.
2041 4.4 Discussion 2042 Microsporidia can have large effects on their hosts and have potential as biological
2043 control agents in pest management. In this study, we demonstrate that Facilispora
2044 margolisi, a parasite of L. salmonis in the eastern Pacific Ocean (Jones et al., 2012a), is
2045 vertically transmitted and has stage-specific impacts on host energetic and structural
2046 gene expression. Infection was associated with transcriptomic evidence of a stress
2047 response in copepodids, which was absent in the pre-adults. However, infection with F.
2048 margolisi did not affect the number of L. salmonis copepodids able to attach and moult
2049 on Chum Salmon. Combinations of drug and MS infection impacted transcripts
2050 previously identified as related to feeding and drug response and resistance. These
2051 results are discussed below in terms of the evolution and biology of key traits in salmon
2052 lice.
2053 4.4.1 Microsporidia transmission and stage-specific effects 2054 Vertical transmission of microsporidia is common in other crustacean hosts and can be
2055 the sole means of transmission (Kelly et al., 2003) or as part of a mixed transmission
2056 strategy (Andreadis, 2005). Vertical transmission of F. margolisi was identified using
106 2057 PCR and in situ hybridization to locate the parasite within the ovary and developing
2058 embryos of infected L. salmonis females and their offspring. Spore dimorphism in F.
2059 margolisi, specifically the presence of larger spores with longer polar filaments,
2060 indicates the possibility of horizontal transmission (Jones et al., 2012a), but this was not
2061 yet confirmed experimentally. Vertically transmitted microsporidia generally are less
2062 virulent than horizontally transmitted species as they depend on host survival for
2063 replication (Dunn and Smith, 2001). Nonetheless, vertically transmitted MS can affect
2064 host growth (Kelly et al., 2003), and induce male feminization (Terry et al., 1999),
2065 thereby impacting sex ratios (Terry et al., 2004).
2066 Despite the absence of measurable effects on L. salmonis infectivity or
2067 development, infection with F. margolisi impacted host transcriptomes particularly in
2068 larval stages. MS+ copepodids differentially expressed 577 transcripts that were
2069 enriched for energetic and stress functions whereas in adults only 123 transcripts were
2070 differentially expressed. Of these transcripts, only five were differentially expressed in
2071 both developmental stages, including a mitochondrial chaperone DnaJ homolog
2072 subfamily A member 1, calreticulin, and three transcripts without annotation (Additional
2073 Files 1 and 5). The reason for the reduced host impact at later lice life stages is not
2074 known, but it may be related to the reduced virulence required for vertical transmission.
2075 Furthermore, copepodids are generally more sensitive to stress than adults. For example,
2076 pre-adult L. salmonis show a transcriptional response to 50 ppb EMB but not 25 or 10
2077 ppb EMB (Appendix 1) while copepodids respond at 1 ppb EMB, as observed here.
2078 Improved understanding of the sites of microsporidian infections during early copepod
107 2079 development may inform our understanding of the physiological impacts of these
2080 infections.
2081 4.4.2 Lice response to F. margolisi 2082 MS+ copepodids underexpressed mitochondrial component genes, including ribosomal
2083 subunits and those involved in mitochondrial organization. Close proximity between
2084 early stages of F. margolisi and mitochondria of L. salmonis has been observed (Jones
2085 et al., 2012a). This is a common strategy among microsporidia that results from reduced
2086 mitosomes and an inability to generate ATP (Keeling, 2009). Intricate manipulations of
2087 the host mitochondria structure, and function permit energy acquisition for
2088 microsporidian growth and development (Hacker et al., 2014; Van Der Giezen et al.,
2089 2005). In the host this can cause prolonged energetic stress by up-regulating important
2090 metabolic pathways (Dussaubat et al., 2012; Holt et al., 2013; Mayack and Naug, 2009).
2091 Increased metabolic activity was suggested in this study as MS+ copepodids
2092 overexpressed genes involved in cellular respiration and ATP binding while transcripts
2093 related to mitochondrial structure were underexpressed. It is therefore possible that F.
2094 margolisi is associated with manipulation of mitochondrial structure and function in L.
2095 salmonis.
2096 The overexpression of muscle- and cuticle-related transcripts in F. margolisi
2097 infected copepodids may also be a result of manipulation by the microsporidia. Mature
2098 spores and other developmental stages of F. margolisi were observed within striated
2099 muscle and subcuticular connective tissue of L. salmonis using in situ hybridization,
2100 supporting previous findings from electron microscopy (Jones et al., 2012a). Although
2101 there was no indication of an innate immune response against F. margolisi in the lice,
2102 this may be due to the generally poor annotation of immunity genes in crustaceans
108 2103 (Clark and Greenwood, 2016). Microsporidian infections are known to impact a variety
2104 of immune-related genes in other arthropods (Aufauvre et al., 2014; Biron et al., 2005)
2105 and nematodes (Bakowski et al., 2014). Transcripts without annotation accounted for
2106 47% of those affected by MS and may be useful to consider for future studies on biotic
2107 stress in L. salmonis.
2108 4.4.3 Non-additive impacts on lice hosts from parasiticide and microsporidia 2109 Our observed interactions between drug treatment and microsporidian infection may be
2110 important in understanding the development of drug resistance in L. salmonis. In this
2111 study, differences from controls in the transcriptome of MS+ L. salmonis exposed to
2112 EMB were greater than differences from either stressor alone, and a total of 290
2113 transcripts showed differential expression in a non-additive manner. In the western
2114 honeybee Apis mellifera, additive impacts were observed between MS infection and
2115 chemical exposure that resulted in changes to fitness costs depending on the mechanism
2116 of drug resistance (Agnew et al., 2004). Pesticide exposure may also affect
2117 microsporidian virulence and host susceptibility, as observed in the microsporidia
2118 Flabelliforma magnivora and Nosema ceranae infecting Daphnia magna (Coors et al.,
2119 2008) and A. mellifera (Wu et al., 2012), respectively.
2120 The largest fold changes between MS+/EMB+ lice and controls were for
2121 transcripts in cluster B (Figure 5), which were underexpressed in only the MS+/EMB+
2122 lice. These specific transcripts are also involved in feeding (Braden et al., 2017), stress
2123 response (Sutherland et al., 2012), and EMB resistance (Appendix 1). Braden et al.,
2124 (2017) found 36 of the 48 cluster B transcripts to be underexpressed after 24h and 48h
2125 of starvation (Additional File 4). Based on annotation, these transcripts may be involved
2126 in feeding and digestion, as well as host immunosuppression (Figure 6) and included 16
109 2127 trypsin-like serine proteases. Trypsin-like serine proteases are present in lice secretions
2128 (Fast et al., 2003, 2007; Firth et al., 2000) and many of these transcripts were most
2129 highly expressed in the gut relative to other tissues (Edvardsen et al., 2014). Another
2130 transcript from this cluster, hypodermin B, inhibits the activation of complement
2131 component C3 in vitro (Hu et al., 2015) and may therefore play a role in
2132 immunomodulating salmonid hosts. Although F. margolisi infection or EMB exposure
2133 alone had minimal effects on these transcripts, in combination they resulted in
2134 underexpression (FC = 1.5 – 8.0). Future studies should address the localized effects of
2135 F. margolisi infection based on large gene expression changes associated with infected
2136 lice tissues (i.e. muscle, cuticle, mitochondria, and glandular tissue) (Figure 1 and Jones
2137 et al., 2012) in order to determine possible interactive effects of microsporidia infection
2138 and louse feeding, digestion, mobility, moulting, energy expenditure, and overall
2139 fitness.
2140 In addition, 32 of the 48 cluster B transcripts were also found to be down-
2141 regulated from an exposure to 50 ppb EMB in Pacific pre-adult lice, and overexpressed
2142 in an EMB resistant Atlantic L. salmonis population (Additional File 4; Appendix 1).
2143 Resistance to EMB occurs in L. salmonis in the northeast and northwest Atlantic Ocean
2144 while lice in the Pacific subspecies remain sensitive (Aaen et al., 2015; Saksida et al.,
2145 2013). Although there is no evidence that the presence of F. margolisi contributes to the
2146 maintenance of EMB sensitivity in the Pacific lice, the correlation and the non-additive
2147 impacts of F. margolisi and EMB on genes involved in stress, feeding, and host
2148 attachment indicate the need for further research to better understand a role of
2149 microsporidian infections on drug tolerance, selection, and fitness.
110 2150 4.4.4 Non-host material in next-generation sequencing data 2151 We identified a set of 20 transcripts within the L. salmonis microarray that most likely
2152 belong to the microsporidian F. margolisi. The presence of non-host material in a
2153 sequence database highlights the importance of identifying and/or removing non-target
2154 eukaryotic sequences from assemblies, as wild individuals or lines with persisting,
2155 vertically transmitted intracellular eukaryotic parasites represent a mixture of organisms
2156 (Kumar et al., 2013). These microsporidian-like transcripts were only detectable in
2157 cDNA generated from MS+ pre-adults, but not in that from MS+ copepodids,
2158 potentially indicating stage-specific expression of F. margolisi genes or a higher
2159 effective microsporidian load in pre-adult lice. Future RNA-sequencing studies can
2160 potentially use these genes to quantify microspodidan infections in L. salmonis hosts as
2161 has been done with human microsporidia (Watson et al., 2015).
2162 4.4.5 Conclusions 2163 Although F. margolisi induced a stress-like transcriptomic response in copepodids of L.
2164 salmonis, signatures of stress were absent in pre-adults and the infection did not cause
2165 changes in salmon lice development or infection potential towards fish hosts.
2166 Collectively our observations of limited impacts within later host developmental stages
2167 are consistent with vertical transmission of the microsporidian and its high prevalence
2168 within L. salmonis populations. However, the non-additive effects from combinations of
2169 microsporidia infection and parasiticide treatment merit further study. In addition to
2170 microsporidia, the salmon louse also hosts viruses (Økland et al., 2014) and bacteria
2171 (Barker et al., 2009) and the present observations suggest there is a need to better
2172 understand the possible influence of this hyperparasitism with respect to copepod
111 2173 sensitivity to parasiticides as well as the confounding effects these infections may have
2174 on transcriptomic studies.
2175 Availability of Data and Materials 2176 The datasets supporting the results of this article are available in the NCBI Gene 2177 Expression Omnibus (GEO) repository, GSE94692 for the copepodid data and 2178 GSE73734 (Chapter 2) for the pre-adult data.
2179 Supporting Information (Additional Files) 2180 Additional File 1: Differentially expressed transcripts by microsporidia and EMB 2181 Additional File 2: Gene Ontology 2182 Additional File 3: Interaction of microsporidia and EMB within k-means clustering 2183 Additional File 4: Consensus transcripts within Cluster B across L. salmonis studies 2184 Additional File 5: Pre-adult L. salmonis responses to F. margolisi infection and 2185 microsporidian genes on the microarray 2186 Additional File 6: Primers for RT-qPCR validation and in situ hybridization 2187 All files can be accessed online at DOI: 10.1186/s12864-017-4040-8
2188 Acknowledgements 2189 Thanks to Sara Purcell for help in designing and executing PCR assays to detect F. 2190 margolisi from total RNA. Thanks to Eliah Kim for culturing and filtering salmon lice 2191 larvae and to Lisa Zhang for collecting the in situ hybridization data. Thanks to Stuart 2192 Jantzen for creating the study design figure (Figure 1) and for discussions on the 2193 analysis. This work was supported by Genome BC, Fisheries and Oceans Canada 2194 (DFO), Novartis/Elanco Animal Health (MDF), ACOA (AIF-199308; MDF) and 2195 NSERC discovery (RGPIN/402288-12; MDF). During this work, JDP was supported by 2196 an NSERC PGS D3 and BJGS was supported by an NSERC CGS graduate fellowship.
112 2197 Chapter 5: Cypermethrin exposure induces 2198 metabolic and stress-related gene expression in 2199 copepodid salmon lice (Lepeophtheirus salmonis)
2200 Jordan D. Poley1, Laura M. Braden1, Amber M. Messmer2, Shona K. Whyte1, Ben 2201 F. Koop2, Mark D. Fast1. (2016) Comparative Biochemistry and Physiology – 2202 Genomics and Proteomics: Part D 20:74-84
2203 1Hoplite Lab, Department of Pathology & Microbiology, Atlantic Veterinary College, 2204 University of Prince Edward Island, 550 University Ave, Charlottetown PE, C1A 4P3, 2205 Canada
2206 2Centre for Biomedical Research, Department of Biology, University of Victoria, 2207 Victoria BC, V8W 3N5, Canada
2208 JDP designed the study with MDF, executed the bioassay, performed microarray 2209 analysis, assissted with RT-qPCR analysis, and wrote the manuscript. 2210 LMB preformed qPCR laboratory work and analysis, assisted with writing. 2211 AMM carried out cDNA and cRNA amplifications and microarray hybridizations and 2212 data normalization. 2213 SKW assisted with bioassay design and writing 2214 BFK assisted with data analysis and writing 2215 MDF designed the study with JDP, assisted with data analysis and writing
2216 © 2016 Elsevier Inc. All rights reserved.
113 2217 Abstract 2218 Cypermethrin has been administered for decades to control salmon lice (Lepeophtheirus
2219 salmonis) infestations in Atlantic salmon farming regions globally. However, resistance
2220 to cypermethrin and other available therapeutants has threatened the sustainability of
2221 this growing industry. To better understand the effects of cypermethrin on L. salmonis, a
2222 38K oligonucleotide microarray and RT-qPCR analyses were applied to pools of
2223 copepodid larvae exposed to 1.0ppb cypermethrin or seawater controls for 24 h.
2224 Phenotypic assessments and global gene expression profiles showed a significant
2225 disruption of homeostasis in copepodid L. salmonis exposed to cypermethrin. Multiple
2226 degradative enzymes were overexpressed in cypermethrin-treated lice including five
2227 trypsin-like serine proteases and three cytochrome p450s CYP3a24 (p = 0.03, fold
2228 change (FC) = 3.8; GenBank accession no. JP326960.1), CYP6w1 (p = 0.008, FC = 5.3;
2229 GenBank accession no. JP317875.1), and CYP6d4 (p = 0.01; FC = 7.9; GenBank
2230 accession no. JP334550.1). These enzymes represent preliminary markers for
2231 understanding the physiological response of L. salmonis to cypermethrin exposure. A
2232 general stress response was also observed in cypermethrin-treated lice which included
2233 differential expression of cell signaling genes involved in the induction of cell growth,
2234 solute transport, and metabolism. Lastly, a consensus-based analysis was completed
2235 with two previously published L. salmonis transcriptome studies revealing genes that
2236 respond to cypermethrin, emamectin benzoate (another delousing agent) and
2237 hyposalinity. This included concordant differential expression of heat shock beta-1,
2238 ammonium transporter Rh types B, and 72kDa type IV collagenase across different L.
2239 salmonis studies. This is currently the most comprehensive transcriptome assessment of
114 2240 chemical exposure on the first infectious stage of L. salmonis, providing novel markers
2241 for studying drug resistance and general stress in this important parasite.
2242 5.1 Introduction 2243 Pyrethroid pesticides have been used for decades to control parasites and vectors
2244 impacting agriculture, aquaculture, and human health (Carter, 1989; Hart et al., 1997;
2245 Ujihara et al., 2011). Pyrethroids target para-sodium channels of pests, stabilizing a state
2246 of open conformation in neurons leading to depolarization, excitatory paralysis, and
2247 eventually death (reviewed by Soderlund, 2011). The salmon aquaculture industry
2248 strongly depends on pyrethroids for controlling salmon lice infestations as evidenced by
2249 prolonged and continued use in farms across the globe (Burridge et al., 2010). In the
2250 mid 1990’s, cypermethrin (Excis®) was introduced in Norway (Grave et al., 2004) and
2251 Scotland (Hart et al., 1997) as the first synthetic pyrethroid for salmon lice, although
2252 natural analogues had been used earlier (Roth et al., 1993). Currently, cypermethrin (as
2253 Excis® or Betamax®, Novartis) and/or the closely related deltamethrin (Alpha Max®,
2254 Parmaq) have been used in all major salmon farming regions except Western Canada
2255 (reviewed in Aaen et al., 2015). Due to prolonged use and a limited number of
2256 alternative options, pyrethroid-resistant strains of salmon lice have become widespread
2257 (Aaen et al., 2015).
2258 Pyrethroid resistance has been studied extensively in mosquitoes (Ranson et al.,
2259 2011), household pests (Valles et al., 2000), crop pests (Kranthi et al., 2001), and
2260 ectoparasites of livestock (Sharma et al., 2012). Generally, two molecular mechanisms
2261 are responsible for decreased sensitivity to pyrethroids. The first is knockdown
2262 resistance (kdr) where a single nucleotide polymorphism (SNP) within the sodium
115 2263 channel decreases the binding efficiency of the pesticide (Williamson et al., 1996).
2264 Resistance can emerge as a consequence of one or several SNPs each of which can
2265 provide different degrees of resistance (Davies et al., 2007). Pyrethroid resistance can
2266 also arise through the overexpression of detoxification enzymes, including
2267 monoxygenases (i.e. cytochrome p450s or CYP; Scott, 1999), esterases (Valles et al.,
2268 2000), and/or glutathione-S-transferases (GST; (Kostaropoulos et al., 2001). These
2269 enzymes generally attach or expose polar regions of xenobiotics, yielding more
2270 hydrophilic products that are more readily excreted (Humphrey and Ringrose, 1986).
2271 Additionally, these enzymes are often responsible for side- and cross-resistance to other
2272 pesticides as observed in Myzus persicae (Devonshire and Moores, 1982), Anopheles
2273 spp. (Brogdon and Barber, 1990; Mitchell et al., 2012), Culex pipiens (Hardstone et al.,
2274 2007), Musca domestica (Liu and Yue, 2000), and Heliothis virescens (Zhao et al.,
2275 1996).
2276 Overexpression of metabolic enzymes has been suggested as the primary
2277 mechanism of pyrethroid resistance in L. salmonis (Aaen et al., 2015; Sevatdal et al.,
2278 2005), the most problematic salmon louse species in the Northern hemisphere (Costello,
2279 2009). For example, the involvement of monoxygenases in detoxifying pyrethroids was
2280 demonstrated by Sevatdal and colleagues (2005) using the oxidase inhibitor piperonyl
2281 butoxide (PBO). The authors noted a significant increase in sensitivity to pyrethroids
2282 when L. salmonis were pre-treated with PBO and also observed a positive correlation
2283 between haem peroxidase activity and half maximal effective concentrations (EC50).
2284 These data suggest the involvement of CYPs in pyrethroid detoxification and resistance
2285 in L. salmonis. However, the specific CYP(s) involved in these processes remain
116 2286 unknown. Furthermore, the involvement of other metabolic enzymes and non-classical
2287 mechanisms such as the overexpression of proteases (Gong et al., 2005) or decreased
2288 cuticular penetration (Liu and Scott, 1995) have not been monitored in L. salmonis
2289 exposed to pyrethroids.
2290 In this study, a 38K oligonucleotide microarray and RT-qPCR analyses were
2291 used to describe changes in gene expression of L. salmonis exposed to cypermethrin. A
2292 cross-study comparison was also used to provide a consensus on the transcriptomic
2293 signature of stress in L. salmonis. This work provides putative markers for future studies
2294 aimed at understanding pyrethroid-resistance and general stress in the economically and
2295 ecologically important salmon louse.
2296 5.2 Methods
2297 5.2.1 Parasite collection and culture 2298 Salmon lice (L. salmonis) were collected from marine aquaculture sites in Bay
2299 Management Area 2a (BMA2a) of the Bay of Fundy, New Brunswick, Canada, in July
2300 2014. Gravid females were returned to the Huntsman Marine Science Centre, St.
2301 Andrews, NB, in chilled coolers for egg string removal and culture. Egg strings were
2302 placed in a flow-through hatch system with seawater (>32 ppt) maintained at 10-12oC to
2303 develop to the infective copepodid stage over eight days. At this time, lice were
2304 transported in chilled containers containing seawater to the Atlantic Veterinary College,
2305 Charlottetown, PE. Upon arrival, a 10% water change was completed and lice were held
2306 until the following day for in vitro bioassay procedures.
2307 Seawater (32 ± 2 mg mL-1) containing F1 generation L. salmonis was filtered to
2308 a volume of 4 L in a large plastic beaker. In an effort to obtain only live copepodids, a
2309 light source was placed over the beaker for 10 min at which point inactive copepodids
117 2310 (those lying on the bottom of the beaker) were removed using a serological pipette,
2311 similar to methods used in other laboratories (Bricknell et al., 2006). The water
2312 containing live copepodids was then swirled to achieve a uniform mixture of lice before
2313 removing three, 15 mL samples for enumeration and staging using a stereoscope.
2314 Greater than 95% of lice were copepodids at this time with the remaining larvae being
2315 nauplii II (mean ± SD of 3.0 ± 0.3 copepodids/mL).
2316 5.2.2 Cypermethrin bioassays and survival analysis 2317 Two in vitro bioassays were designed to evaluate survival of copepodid salmon lice
2318 exposed to cypermethrin (Betamax®, Novartis Animal Vaccines Ltd., Braintree, Essex,
2319 UK). A stock solution of 1 mg L-1 was made by combining 20 μL of 50 mg mL-1
2320 Betamax® (batch # 1706115) with 999.98 mL of filtered seawater. Then, 20 mL of stock
2321 solution was combined with 1980 mL of filtered seawater resulting in a 10 μg L-1
2322 cypermethrin working solution.
2323 The first bioassay (Bioassay I) exposed copepodids to 1.0 μg L-1 cypermethrin
2324 or a seawater control for 24 h in glass beakers (VWR, Mississauga, ON) at 12 ± 1oC.
2325 Each condition had a total volume of 500mL with six replicates and approximately 500
2326 lice per beaker based on initial counts. Post bioassay cessation, copepodids were filtered
2327 using 80μM mesh and dried using a serological pipette before collection in pre-frozen (-
2328 80oC) centrifuge tubes. Samples were stored at -80oC until later use.
2329 The second bioassay (Bioassay II) was designed to closely mimic an actual
2330 cypermethrin treatment carried out on a salmon farm (modified from Hart et al., 1997).
2331 First, 100 mL of seawater containing copepodids (approximately 300 total) was poured
2332 through polyvinyl chloride (PVC) tubes with 80μM mesh glued to the bottoms (Figure
2333 1A). The PVC tubes were then placed in glass Petri dishes containing 5.0 μg L-1
118 2334 cypermethrin or filtered seawater (each condition carried out in triplicate; Figure 1B).
2335 The treatment lasted for 30 min at which time the PVC tubes (containing lice) were
2336 removed and rinsed in clean, filtered seawater. Each tube was then completely
2337 submerged in a new beaker containing seawater for 23.5 h at 12 ± 1oC.
2338 2339 Figure 1: Larvae bioassay apparatus A) PVC tubes containing an 80μM meshed 2340 bottom B) Apparatus used in Bioassay II for copepodid L. salmonis exposures to 5.0 μg 2341 L-1 cypermethrin for 30 min before sea water rinsing and holding.
2342 After 24 h, lice from each bioassay were assessed for survival similar to the
2343 technique used for staging and enumeration mentioned above. Briefly, water was
2344 swirled in each beaker before removing a 15 mL (Bioassay I) or 30 mL (Bioassay II)
2345 aliquot for analysis under a light source. Different volumes were sampled from each
2346 bioassay due to differences in copepodid densities. The percentage of surviving lice was
2347 counted for each sample by lightly brushing each copepodid with forceps to monitor
2348 their response to stimulus. Copepodids able to swim in response to the stimulus were
2349 considered healthy (mobile) while those that did not respond were considered
2350 immobilized or dead.
119 2351 5.2.3 RNA extraction and purification 2352 Total RNA was extracted from pools of lice in Bioassay I (n = 6) using TRI-Reagent as
2353 per manufacturers’ instructions (Thermo Fisher Scientific, Burlington, ON)
2354 (Chomczynski, 1993; Chomczynski and Mackey, 1995). An in-solution DNase
2355 treatment (Thermo Fisher Scientific) was then completed before RNA purification using
2356 RNeasy MinElute clean-up kits (Qiagen, Toronto, ON) as per manufacturer’s
2357 instructions. RNA quantity and purity was analyzed using spectrophotometry
2358 (NanoDrop 2000; Thermo Fisher Scientific) while agarose gel electrophorehesis was
2359 used to assess RNA integrity. For all steps, samples were suspended in nuclease-free
2360 water and stored at -80oC until further use.
2361 5.2.4 Microarray Analysis 2362 Pools of 500 copepodid L. salmonis from Bioassay I were profiled on an
2363 oligonucleotide microarray (eArray, Agilent, Santa Clara, CA) designed with expressed
2364 sequence tags (ESTs) from Atlantic and Pacific L. salmonis (Yasuike et al., 2012).
2365 Sample preparation, microarray hybridization, and scanning were performed as
2366 previously reported (Sutherland et al., 2015, 2012). All slides were scanned using a
2367 Perkin Elmer (Waltham, MA) ScanArray® at 5 μm resolution and optimized PMT
2368 intensities for approximately 1-2% spot saturation (Cy3:70; Cy5:65), quantified using
2369 Imagene 8.1 (Biodiscovery, Hawthorne, CA) before importing data into GeneSpring
2370 GX v12.6 (Agilent) for probe filtering and statistical analyses. A quality control (QC)
2371 filtered probe list included probes with ≥ 500 Cy5 and Cy3 fluorescence intensity in at
2372 least 50% of the samples of at least one condition (controls or cypermethrin-treated).
2373 Probes that had samples containing poor quality flags were removed from analysis. Raw
120 2374 data was uploaded to Gene Expression Omnibus (GEO, NCBI) under the accession
2375 GSE76555.
2376 Using a Welch’s unpaired t-test (i.e. no assumption of equal variance), probes
2377 with p < 0.01 and fold change (FC) ≥ 1.5 (GeneSpring GX v13; Agilent) were
2378 considered differentially expressed between cypermethrin and control samples. Probes
2379 representing the same unique contig (transcript) are displayed with a range of FC in the
2380 manuscript. Differentially expressed transcripts were used for functional enrichment
2381 analyses in DAVID bioinformatics (Huang et al., 2009, 2008; D. W. Huang et al., 2007)
2382 using a modified Fisher’s exact test (p < 0.05; genes/enrichment category ≥ 4)
2383 comparing against a QC-filtered list (Additional File 1). For Gene Ontology (GO), GO
2384 Trimming (Jantzen et al., 2011) was used to reduce redundancies in ontology categories
2385 using an 80% soft trim threshold.
2386 5.2.5 Consensus response to other stressors in L. salmonis 2387 Differentially expressed transcripts in cypermethrin-treated lice were compared to other
2388 L. salmonis transcriptome data from the same microarray platform (Sutherland et al.,
2389 2012a; Appendix 1). Analyzed data was accessed from supplemental files of the
2390 previous publications. The first study obtained was an analysis of the response of
2391 Pacific copepodid L. salmonis to a fine-scale reduction in salinity (30 mg mL-1 vs 29-25
2392 mg mL-1) for 24 h before transcriptomic analyses (Sutherland et al., 2012). The second
2393 study obtained was an analysis of two Atlantic populations of L. salmonis exposed to
2394 five concentrations of emamectin benzoate (EMB; 0-1000 μ L-1; Appendix 1) a
2395 commonly used therapeutant for salmon lice (Horsberg, 2012). The Atlantic populations
2396 included pre-adults collected from EMB-sensitive and EMB-resistant sites in the Bay of
2397 Fundy, NB. Transcripts with a main effect of hyposalinity stress (Sutherland et al.,
121 2398 2012) or EMB exposure (Appendix 1) were compared to the present data using a contig-
2399 specific approach. Transcripts concordantly differentially expressed by different
2400 stressors can be found in Additional File 1. Lice used here are presumed to be EMB-
2401 resistant based on previous work (Igboeli et al., 2013; Jones et al., 2013; Appendix 1).
2402 Transcripts showing concordant expression profiles across studies can be found in
2403 Additional File 1.
2404 5.2.6 Microarray validation and RT-qPCR exploration 2405 The same RNA samples used for microarray analysis in the cypermethrin experiment
2406 were used for RT–qPCR validation targeting transcripts differentially expressed
2407 between treatments. Putative CYP transcripts not represented on the array were also
2408 chosen for RT-qPCR analysis based on previous findings (Sevatdal et al., 2005a).
2409 Synthesis of cDNA was performed with 2 μg of total RNA in 20 μl reactions using
2410 iScript Reverse Transcription Supermix kit (BioRad) as per manufacturer’s
2411 instructions. Reactions without RT enzyme were included confirmed no genomic
2412 contamination. To generate a standard curve, equimolar amounts of RNA from
2413 cypermethrin exposed and control lice were pooled and PCR products generated using
2414 GoTaq Green PCR Mastermix (Promega, Madison, WI). Transcript-specific standard
2415 curves (5-point, 5-fold series dilution) were designed to confirm primer efficiency. RT-
2416 qPCR amplification was performed using SsoAdvanced SYBR Green Supermix
2417 (BioRad) in 11 μl reactions with 1 μl template and 0.1 μM of each primer using the
2418 following thermal regime: 95°C for 30 sec, followed by a combined annealing and
2419 extension step of 60°C for 40 cycles. Melt curve analysis was performed by increasing
2420 the temperature from 65°C to 95°C in 0.5°C increments every 5 sec. Melt curves and
122 2421 gel electrophoresis confirmed single product formation for all transcripts assayed.
2422 Additionally, the amplicons for all CYP sequences were gel-purified using QIAquick
2423 Gel Extraction Kit (Qiagen, Toronto, ON) as per manufacturer’s instructions and sent to
2424 The Centre for Applied Genomics (TCAG) at the Hospital for Sick Children, Toronto,
2425 ON, Canada for target verification (Additional File 3). All RT-qPCR reactions were
2426 completed using the Realplex Thermocycler (Eppendorf; Mississauga, ON). RT–qPCR
2427 data normalization was completed using qbase-PLUS (Biogazelle; Gent, Belgium) with
2428 an output of log2 ratios relative to two reference genes, elongation factor 1α (ef1α) and
2429 vinculin. The stability of reference genes was tested using geNorm (Vandesompele et
2430 al., 2002) which showed a collective M value of 0.48 and coefficient of variation (CV)
2431 of 0.17.
2432 Microarray analysis compared six control and six cypermethrin-treated pools of
2433 copepodid L. salmonis (Bioassay I). However, due to insufficient amounts of RNA in
2434 one sample (a control) post-array hybridizations, RT-qPCR analysis of the six CYPs
2435 was completed using five control samples and six cypermethrin-treated samples.
2436 Statistical significance for CYP sequences was identified using an unpaired t-test
2437 without assuming equal variance with a p < 0.05 and FC ≥ 1.5 (R v. 3; Team, 2016).
2438 Validation of five transcripts of interest was performed on a subset of the samples due
2439 to low remaining RNA availability (5 control; 4 experimental). Expression levels were
2440 validated by testing the correlation of log2 expression values for RT–qPCR samples
2441 against microarray log2 expression ratios (Cy5/Cy3) (Additional File 3).
123 2442 5.3 Results
2443 5.3.1 Efficacy of in vitro cypermethrin exposures 2444 Few copepodids were assessed as mobile (responded to brushing stimulus) after in vitro
2445 cypermethrin treatments. In Bioassay I, only 17.7 ± 4.5% (mean ± SE) of lice treated
2446 with 1.0 μg L-1 cypermethrin for 24 h were responsive (i.e. mobile; Table 1). Similarly,
2447 16.2 ± 4.1% of lice in Bioassay II responded to stimulus after 5.0 μg L-1 cypermethrin
2448 exposure for 30 min followed by a 23.5 h seawater holding period (Table 1).
2449 Table 1: Health status of L. salmonis exposed to 1.0 μg L-1 2450 cypermethrin for 24 h (Bioassay I) or 5.0 μg L-1 cypermethrin 2451 for 30 min before 23.5 h seawater holding (Bioassay II). Live (%) Bioassay Replicate Control Cypermethrin 1 89.5 23.1 2 100.0 26.7 3 94.1 8.3 I 4 92.9 26.7 5 100.0 0.0 6 100.0 21.4 Mean ± SE 96.1 ± 1.9 17.7 ± 4.5 1 100.0 18.2 2 92.9 8.3 II 3 100.0 22.2 Mean ± SE 97.6 ± 2.3 16.2 ± 4.1
2452 Cypermethrin-treated lice that responded to brushing stimulus appeared weak compared
2453 to controls (personal observation), similar to the “moribund” phenotype described by
2454 Westcott and colleagues (Westcott et al., 2008). The control groups for both bioassays
2455 were healthy and dispersed throughout the water column at 24 h with greater than 95%
2456 of L. salmonis responding to stimulus (Table 1).
124 2457 5.3.2 Global gene expression profiles of L. salmonis exposed to cypermethrin 2458 Transcriptomic profiles were compared between pools of 500 copepodids exposed to
2459 either 1.0 μg L-1 cypermethrin or seawater (controls) for 24 h (n = 6; Bioassay I). Using
2460 the QC filtered probes, Principal Component Analysis (PCA) separated cypermethrin-
2461 treated lice from controls on a combination of the first and second principal components
2462 (PC), contributing 28.9% (x-axis) and 18.4% (y-axis) of the variation in lice
2463 transcriptomes, respectively (Figure 2). Samples from both control and cypermethrin-
2464 treated groups spanned PC3 (11.3%, z-axis) displaying unexplained variation between
2465 individual pools. Indeed, biological replicates of control samples appeared more
2466 widespread in PCA, suggesting higher individual expression variability compared with
2467 cypermethrin-treated samples (Figure 2). Overall, copepodids exposed to cypermethrin
2468 overexpressed 147 transcripts and under-expressed 123 transcripts (p < 0.01; FC ≥ 1.5)
2469 compared with controls. A complete list of transcripts including p-values, fold changes,
2470 and descriptions can be found in Additional File 1.
125 2471
2472 Figure 2: Principal Component Analysis (PCA) of salmon louse samples (500 2473 copepodids) exposed to cypermethrin or seawater. Cypermethrin-exposed lice (blue 2474 triangles) are generally plotted in the middle of the y-axis where the x- and z-axes 2475 intersect. These samples are separated from controls (red squares) on the x-axis (PC1; 2476 28.9%) and the y-axis (PC2; 18.4%). The z-axis (PC3; 11.3%) represents unexplained 2477 variation in the data (i.e. biological replicates from both groups span this axis).
2478 5.3.3 Cypermethrin exposure alters the expression of genes in stress signaling pathways 2479 Several transcripts differentially expressed in cypermethrin-treated lice have putative
2480 roles in classical cell signaling pathways including those regulating target of rapamycin
2481 (TOR) and forkhead box protein (FOXO; see Kegg reference maps: 04150 and 04068,
2482 respectively (Kanehisa et al., 2014; Kanehisa and Goto, 2000).Transcripts known to act
126 2483 upstream in growth factor signaling were overexpressed in cypermethrin-treated lice
2484 and included insulin receptor subunit beta, protein rhomboid, and protein toll (Figure 3;
2485 Additional File 1). This finding was supported by the overexpression of ras homolog
2486 enriched in brain (rheb) and the downregulation of eukaryotic initiation factor (eif)-4E-
2487 type 2, which suggests an increase in TOR-related signaling (Teleman, 2010) in
2488 cypermethrin-treated lice (Figure 3). Transcripts that were related but didn’t share exact
2489 annotations to those found in the Kegg pathway included 40S ribosomal protein s13 and
2490 eif 4-gamma 2, which were overexpressed by cypermethrin (Figure 4).
2491 2492 Figure 3: Matabolic signaling pathway putatively controlling the transcriptomic 2493 response of L. salmonis to cypermethrin. The L. salmonis tanscripts with related 2494 annotations to genes controlling TOR and FOXO (see Kegg maps 04150 and 04068, 2495 respectively) are highlighted purple. A heat map is associated with each L. salmonis 2496 transcript indicating the fold change between cypermethrin (cy) and control (cn).
2497 Coinciding with the growth-related expression patterns described above,
2498 transcripts known to promote nuclear translocation and/or stability of FOXO (reviewed
2499 by Eijkelenboom and Burgering, 2013) were downregulated by cypermethrin including
127 2500 protein arginine N-methyltransferase 1 (prmt1), ubiquitin carboxyl-terminal hydrolase
2501 L3 (uch-L3), and histone deacetylase 1 and 6 (hdac1 and hdac6, respectively; Figure 3).
2502 Additionally, a transcript known to suppress FOXO indirectly, dual specificity protein
2503 phosphatase 10 (mkp5) was overexpressed in the cypermethrin group. Generally,
2504 transcripts involved in cell signaling cascades (see Figures 3 and 4) showed a
2505 statistically significant but low degree of FC (1.5 – 2.0) difference between
2506 cypermethrin-treated and control lice (Additional File 1).
2507 2508 Figure 4: Hierarchical clustering of transcripts involved in cell signaling. 2509 Transcripts were selected based on UniProt annotation, inclusion in Kegg pathways 2510 (map04150 and map04068), and/or consensus with other L. salmonis transcriptomic 2511 studies. Gene expression is mapped based on mean log2 normalized intensities of each 2512 entity, with red representing low expressing transcripts and green showing high 2513 expressing transcripts. All transcripts were significantly differentially expressed by 2514 cypermethrin exposure (p < 0.01; FC ≥ 1.5).
128 2515 5.3.4 Differential expression of metabolic enzymes 2516 A large number of proteases were differentially expressed in cypermethrin-treated lice
2517 (Table 2). The keyword “protease” was enriched in both upregulated (12 transcripts; p <
2518 0.0001) and downregulated (10 transcripts; p = 0.01) transcripts of L. salmonis exposed
2519 to cypermethrin (Additional File 2). Six metalloproteases (p = 0.0009), five serine
2520 proteases (p = 0.004), and one calcium dependent cysteine-type endopeptidase (calpain-
2521 B catalytic subunit 2; Table 2; Additional File 1, 2) were induced by cypermethrin. Four
2522 of the overexpressed proteases had at least one trypsin-like serine protease domain
2523 (Tryp-sp; CDD Accession: cd00190 or smart00020) with another five containing a
2524 multiple peptidase family M12A domain (cd04280; Additional File 1, 2). Many of these
2525 proteases also enriched the keyword secreted (11 transcripts; p < 0.0001) and the GO
2526 categories extracellular region (13 transcripts; p < 0.0001) and zinc binding (12
2527 transcripts; p = 0.03; Additional File 2), providing additional information on the subset
2528 of proteases overexpressed by cypermethrin.
2529 Proteases showing downregulation in cypermethrin-treated lice enriched
2530 functional categories such as collagen degradation (4 transcripts; p = 0.0007),
2531 metalloprotease (6 transcripts; p = 0.006), and peptidase acting on L-amino acid
2532 peptides (10 transcripts; p = 0.03; Additional File 2). Several downregulated proteases
2533 also contained multiple fibronectin type II domains (FII domains; cd00062), enriching
2534 the InterPro category Type II fibronectin collagen binding (p = 0.001; Additional File
2535 2). Therefore, while the up-regulated transcripts were enriched for proteases,
2536 extracellular region, and zinc binding, down-regulated transcripts were enriched for
2537 collagen binding.
129 2538 Table 2: Proteases differentially expressed by cypermethrin treatment. CDD SwissProt Probe ID p-value FCc Probe Description Accession Accession C106R059, 7.90E-05 2.2 to 2.3 Zinc metalloproteinase nas-4a,b cd04280 P55112 C165R136 C041R091, 0.006 4.7 to 6.5 Zinc metalloproteinase nas-7 a,b cd04280 P55113 C229R146 C159R162 2.19E-04 1.64 Zinc metalloproteinase nas-15 a,b cd04280 P55115 Membrane metallo-endopeptidase-like 1, C046R111 0.008 2.91 COG3590 Q9JLI3 soluble form a,b C198R069, 9.53E-04 2.5 to 2.9 82 kDa matrix metalloproteinase-9 a,b pfam01456 P14780 C172R137 C061R058, 0.008 1.5 to 1.6 Chymotrypsin BI a smart00020 Q00871 C022R035 C019R031 0.006 1.90 Coagulation factor IX a,b smart00020 P16291 C027R167, 0.004 1.64 Neurotrypsin a smart00020 P56730 C189R088 C036R023 0.005 1.53 Calpain-B catalytic subunit 2 smart00230 Q9VT65 C205R034 0.008 1.51 Carboxypeptidase B a,b cd03860 P04069 C165R123 0.007 1.64 Plasma kallikrein light chain a cd00190 P26262 C044R084 0.007 1.51 Protein rhomboid pfam01694 P20350 C208R009, C008R155, 0.003 1.8 to 2.3 Destabilase isopeptidase pfam05497 N/A C081R030, C013R018 C060R019 6.82E-05 4.22 Trypsin-like serine protease cd00190 N/A C085R028, -1.6 to - 0.006 72 kDa type IV collagenase a cd00062 P33434 C096R024 1.7 C002R073, 9.07E-04 -2.4 to - 72 kDa type IV collagenase a cd00062 P08253
130 C149R164 2.5 C212R025 0.007 -2.18 82 kDa matrix metalloproteinase-9 a,b cd00062 P14780 C168R013 0.002 -1.77 Matrix metalloproteinase-9 a,b cd00062 P50282 C021R125 0.005 -1.54 Cytosolic non-specific dipeptidase COG0624 Q96KP4 C094R097 7.95E-04 -1.97 CAAX prenyl protease 1 homolog N/A Q80W54 C140R043, -1.5 to C138R076, 0.009 Proteasome subunit beta type-1 cd03757 P40304 1.6 C035R049 C030R009 0.001 -1.51 Proteasome subunit beta type-3 cd03759 O73817 C094R047, -1.6 to - Ubiquitin carboxyl-terminal hydrolase 0.008 pfam01088 P15374 C217R136 1.7 isozyme L3 Ubiquitin carboxyl-terminal hydrolase C061R020 0.005 -1.64 pfam01088 Q9Y5K5 isozyme L5 2539 asecretion signal: GO(0005576) 2540 bzinc binding site: KW-0862 2541 cFC = Fold change; the least significant p-value and a range of FC is presented where more than one probe was 2542 significantly differentially expressed for a sinlge contig.
131 2543 Limited induction of enzymes related to xenobiotic detoxification and oxidative
2544 stress was observed in cypermethrin-treated lice. From the QC filter probe list, several
2545 transcripts containing at least one of the keywords “cytochrome”, “esterase”,
2546 “glutathione”, “peroxidase”, or “multidrug” showed no differential expression between
2547 control and cypermethrin-treated lice (Additional File 1). Moreover, related enzymes,
2548 such as S-formylglutathione hydrolase, glutaredoxin 3, monothiol glutaredoxin S-11,
2549 monothiol glutaredoxin S-17, copper chaperone for superoxide dismutase, and
2550 oxidoreductase NAD-binding domain-containing protein 1 were downregulated in
2551 cypermethrin-exposed lice (Figure 4). Based on evidence supporting the involvement of
2552 CYPs in pyrethroid detoxification and resistance in L. salmonis (Sevatdal et al., 2005a),
2553 sequences that were not available prior to microarray fabrication were queried for
2554 containing a CYP superfamily domain (CDD: cll2078; e < 10-10) using the
2555 Transcriptome Shotgun Assembly (TSA) database in NCBI (Additional File 3). Six of
2556 these transcripts were selected for RT-qPCR based on similarities to markers of
2557 pyrethroid-resistance in other arthropods (Additional File 3). RT-qPCR analysis
2558 revealed three CYP sequences were overexpressed in cypermethrin-treated L. salmonis
2559 including CYP3a24 (p = 0.03, FC = 3.8; GenBank accession no. JP326960.1), CYP6w1
2560 (p = 0.008, FC = 5.3; GenBank accession no. JP317875.1), and CYP6d4 (p = 0.01; FC
2561 = 7.9; GenBank accession no. JP334550.1) (Figure 5). Additionally, CYP3a24 and
2562 CYP6w1 were highly co-expressed across all samples with a Pearson’s correlation r =
2563 0.97 (p < 0.0001). Other transcripts assayed using RT-qPCR and containing the CYP
2564 domain (cll2078) that did not show differential expression included CYP44, CYP6a18,
2565 and CYP6k1. The sequenced amplicons and melt curve analysis of each CYP confirmed
132 2566 the production of single and specific targets (Additional File 3). Considering the large
2567 number of metabolic enzymes assayed using microarray and RT-qPCR analysis, the
2568 induction of CYP3a24, CYP6w1, and CYP6d4 suggests a targeted response toward
2569 cypermethrin in L. salmonis.
2570 2571 Figure 5: L. salmonis sequences annotated to cytochrome p450s are overexpressed
2572 by cypermethrin. Expression differences are represented by log2 calibrated normalized 2573 relative quantities (CNRQ) using ef1α and vinculin as reference genes. Differential 2574 expression was calculated using an unpaired t-test with a p < 0.05 and FC ≥ 1.5 2575 signifying a significant difference. All CYP sequence information can be found in 2576 Additional File 3.
2577 5.3.5 Development and transport-related transcripts respond to cypermethrin 2578 Transcripts overexpressed after exposure to cypermethrin enriched functional categories
2579 such as developmental process (15 transcripts; p = 0.01), organ morphogenesis (6
2580 transcripts; p = 0.04), and wound healing (4 transcripts; p = 0.002). These categories
2581 included transcripts involved with actin reorganization, neuromuscular development,
133 2582 chaperone activity, and solute transport. The overexpression of transcripts related to
2583 actin organization included dystonin, myosin-Va, protein ovo, PDZ domain-containing
2584 protein (protein inturned), and several aforementioned proteases (e.g. 82kDa matrix
2585 metalloproteinase 9; Additional File 1). As cypermethrin is neurotoxic (Soderlund,
2586 2011), transcripts with related functions in neurodevelopment and amino acid transport
2587 were also of interest. Transcripts annotated to neurotrypsin, ring finger protein unkempt,
2588 zinc protein 593 homolog and serine/threonine-protein kinase tricorner (trc) were
2589 overexpressed in cypermethrin-treated L. salmonis while neuroparsin-B, enhancer of
2590 split mbeta protein, and cystein-rich with EGF-like domain protein 2 were
2591 downregulated (Additional File 1). These transcripts all play important roles in the
2592 nervous system based on sequence annotations. Lastly, six transporters from the solute
2593 carrier family (SLC) were differentially expressed in cypermethrin-treated L. salmonis
2594 including downregulation of zinc transporter ZIP11 (SLC39A11), mitochondrial 2-
2595 oxodicarboxylate carrier (SLC25a21), and ammonium transporter Rh types B and C
2596 (RhBG and RhCG, respectively) and upregulation of large neutral amino acids
2597 transporter small subunit 1 (SLC7A1) and solute carrier organic anion transporter
2598 family member 4A1 (SLCO4A1; Additional File 1).
2599 5.3.6 Consensus transcripts responding to stress across L. salmonis studies 2600 Transcripts involved in stress response were overexpressed by cypermethrin, enriching
2601 the GO category response to stimulus (13 transcripts; p = 0.007). The same microarray
2602 platform used here has identified transcripts differentially expressed under stress
2603 conditions in other studies. A total of 55 transcripts differentially expressed under
2604 cypermethrin exposure here were concordantly differentially expressed in copepodid L.
2605 salmonis exposed to sub-optimal salinities (see Additional File 1; (Sutherland et al.,
134 2606 2012). Similarly, 14 transcripts had the same expression response as pre-adult L.
2607 salmonis exposed to five concentrations of EMB (Additional File 1; Appendix 1); 11 of
2608 which were overexpressed by pesticide. Within these consensus transcripts, heat shock
2609 beta-1 (Hsp27), RhBG, and 72kDa type IV collagenase (mmp2) were concordantly
2610 differentially expressed across all studies (Additional File 1). An alpha-crystallin B
2611 chain contig was also overexpressed in cypermethrin-treated lice and contained two
2612 conserved sequence domains (alpha crystallin; cd06526; e = 1.3-29) common to small
2613 stress-induced proteins. This domain was also found in the Hsp27 sequences mentioned
2614 above (cd06526; e = 7.0-31). Putative L. salmonis stress markers are displayed using
2615 hierarchical clustering in Figure 6, inclusive to those with GO tags representing stress
2616 response, signaling, and/or consensus with other transcriptomic studies of L. salmonis
2617 (Sutherland et al., 2012a; Appendix 1).
135 2618
2619 Figure 6: Hierarchical clustering of candidate stress markers in L. salmonis. 2620 Transcripts were selected based on UniProt annotation and consensus with other L. 2621 salmonis transcriptomic studies. Expression is mapped based on mean log2 normalized 2622 intensities of each transcript, with red representing low expressing transcripts and green 2623 showing high expressing transcripts. All transcripts were significantly differentially 2624 expressed by cypermethrin exposure (p < 0.01; FC ≥ 1.5).
2625 5.3.7 Newly annotated transcripts responding to cypermethrin in L. salmonis 2626 A total of 98 transcripts differentially expressed by cypermethrin were not annotated
2627 during the original microarray assembly (e < 10-10; (Yasuike et al., 2012) and are
2628 included in Additional File 1 as “unknown”. To better track these transcripts across
2629 studies, UniProt and the Conserved Domain Database (CDD; Marchler-Bauer et al.,
2630 2014) were used to annotate these sequences with e < 10-5 as a cut-off. This annotation
2631 cut-off has been used in other salmon lice studies (Eichner et al., 2008; Valenzuela-
2632 Muñoz et al., 2015) and is regarded as a standard annotation for high-throughput
2633 transcriptomic studies (Khalturin et al., 2009). A total of 9 unknowns differentially
136 2634 expressed by cypermethrin had significant matches using UniProt BLASTx (UniProt,
2635 2015) with an additional 28 protein domain matches using CDD (Marchler-Bauer et al.,
2636 2014). This annotation of previously unknown transcripts revealed several differentially
2637 expressed sequences had annotations related to findings presented above. Among these,
2638 lachesin (FC = 1.5), folliculin interacting protein 1 (FC = 2.0), and the SLC SLC25A29
2639 (FC = 1.6), were overexpressed under cypermethrin exposure. Additionally, two
2640 transcripts (probe IDs: C060R019 and C237R156) were overexpressed by cypermethrin
2641 and contained a Tryp-sp domain (FC = 4.2; CDD: cd00190; e = 3.4-11) and a
2642 cytochrome c oxidase (COX1) domain (FC = 1.8; CDD: pfam00115; e = 6.9-5),
2643 respectively (Additional File 1). A detailed list of newly annotated transcripts including
2644 Uniprot and CDD accessions with e-values is available in Additional File 1.
2645 5.4 Discussion 2646 Chemotherapeutants have been used for decades to control ectoparasitic copepods (L.
2647 salmonis and Caligus spp.) in the Atlantic salmon aquaculture industry. These
2648 treatments include bath-administered organophosphates, pyrethroids, hydrogen peroxide
2649 and in-feed macrocyclic lactones (e.g. EMB) and benzoylureas (i.e. chitin synthesis
2650 inhibitors; (Burridge et al., 2010). Resistance to most available therapeutants has
2651 emerged globally in L. salmonis and other salmon louse species (Aaen et al., 2015),
2652 likely due to overuse and inadequate drug rotation. The severity of these issues varies
2653 substantially between countries due to region-specific licensing and regulation of drugs
2654 and pesticides (reviewed in Grant, 2002; Haya and Davies, 2005; Igboeli et al., 2014).
2655 Atlantic Canada has administered pyrethroids less than many other salmon farming
2656 regions, with use limited to 2009-2010 under an emergency drug release program
137 2657 (Whyte et al., 2014). Based on this, pyrethroid-resistant strains of L. salmonis are not
2658 suspected to be present in the Bay of Fundy, which is also supported by recent field
2659 trials and in vitro bioassays (Whyte et al., 2014). However, L. salmonis appear to
2660 comprise a single panmictic population in the Atlantic (Besnier et al., 2014) and so the
2661 potential for pyrethroid-resistant alleles in Atlantic Canada cannot be fully discounted.
2662 In the present study, pools of 500 copepodid L. salmonis were exposed to
2663 cypermethrin using in vitro bioassay techniques. Copepodid L. salmonis exposed to
2664 either 1.0 μg L-1 cypermethrin for 24 h (Bioassay I) or 5.0 μg L-1 for 30 min (Bioassay
2665 II) exhibited low, but similar, proportions of survival of around 16-18% compared with
2666 > 95% in controls. These concentrations of cypermethrin are lower than the
2667 recommended concentration normally administered on salmon farms (15 μg L-1
2668 cypermethrin as Betamax® for 30 min; Burridge et al., 2010; Marín et al., 2015). Lower
2669 concentrations were used due to previous optimizations in pilot studies where
2670 copepodid L. salmonis exposed to 15 μg L-1 cypermethrin for 30 min resulted in no
2671 surviving lice (100% immobile; data not shown). The efficacy of bath-administered
2672 pesticides on copepodid and chalimus stages of L. salmonis has generally been difficult
2673 to assess in the field where stage-specific pre- and post-treatment counts are compared
2674 (Whyte et al., 2014). However, post-treatment counts can occur up to two weeks after
2675 treatment administration (Whyte et al., 2014), potentially not reflecting the number of
2676 lice present directly after treatments. In the two bioassays reported here, approximately
2677 80% of L. salmonis were immobile after exposures to cypermethrin indicating that low-
2678 concentrations of this pesticide can immobilize the majority of copepodids collected
2679 from New Brunswick.
138 2680 The effect of cypermethrin exposure was also assessed at the transcriptomic
2681 level using a 38k oligonucleotide microarray and RT-qPCR. Control and cypermethrin-
2682 treated samples were clearly separated using PCA (Figure 2). Overall, 270 unique
2683 transcripts were differentially expressed (p < 0.01; FC ≥ 1.5) by cypermethrin with an
2684 additional three cytochrome p450 sequences not present on the microarray showing
2685 overexpression in treated lice using RT-qPCR analyses. Therefore, these low
2686 concentrations of cypermethrin affected both the survival and gene expression profiles
2687 of copepodid L. salmonis, demonstrating a strong impact on viability. Based on the in
2688 vitro bioassays reported here, larval copepodids exposed to pyrethroids in the field are
2689 likely to become (and remain) immobilized during cypermethrin exposures.
2690 5.4.1 Metabolic enzymes are induced by cypermethrin exposure 2691 Several groups of genes are known to detoxify pyrethroids, including monoxygenases
2692 (Scott, 1999), transferases (Kostaropoulos et al., 2001), and esterases (Valles et al.,
2693 2000). These enzymes are also constitutively overexpressed in several pyrethroid-
2694 resistant pests (Ranson et al., 2011), in some cases offering more than 1300-fold
2695 tolerance compared to naïve strains (Hardstone et al., 2007). The selected
2696 overexpression of metabolic genes can also impact side- or cross-resistance to other
2697 compounds like organophosphates (Brogdon and Barber, 1990; Ibrahim et al., 2016),
2698 which are frequently used to treat salmon lice (Burridge et al., 2010). In this study, the
2699 response of xenobiotic detoxification enzymes was limited to the overexpression of
2700 three CYPs including CYP3a24, CYP6w1, and CYP6d4 under cypermethrin exposure.
2701 This supports previous findings (Sevatdal et al., 2005a) where pyrethroids induced
2702 monoxygenase activity in L. salmonis. However, other genes previously associated with
2703 pyrethroid response/resistance in related arthropods were not differentially expressed in
139 2704 cypermethrin-treated L. salmonis (see Additional File 1). The lice used in this study are
2705 known to be EMB-resistant (Igboeli et al., 2013; Jones et al., 2013; Appendix 1), as is
2706 the case globally (Aaen et al., 2015), which could potentially impact transcriptomic
2707 responses to other drugs. For example, phospholipid hydroperoxide glutathione
2708 peroxidase was not differentially expressed in this study (Additional File 1) but did
2709 show overexpression to three concentrations (1, 2, and 3 μg L-1) of deltamethrin in a
2710 closely related species of copepod, Caligus rogercresseyi (Chavez-Mardones and
2711 Gallardo-Escárate, 2014). The baseline expression of this transcript however is 7.2 fold
2712 higher in EMB-resistant L. salmonis compared with EMB-sensitive (Appendix 1) which
2713 may affect induction under cypermethrin exposure. Overall, the upregulation of three
2714 CYP sequences in response to cypermethrin provides a novel set of markers for
2715 pyrethroid detoxification in L. salmonis that will be useful for future studies on salmon
2716 lice responses and resistance to pesticides, including those involving cross-resistance or
2717 interactions between treatments.
2718 Four of the six CYP sequences analyzed using RT-qPCR in this study belonged
2719 to the CYP6 family (CYP6k1, CYP6w1, CYP6d4, and CYP6a18). These sequences were
2720 prioritized based on the involvement of CYP6 enzymes in pyrethroid-resistant strains of
2721 Amsacta albistriga (CYP6B47; Muthusamy and Shivakumar, 2015), house flies
2722 (CYP6D1; Tomita and Scott, 1995), Anopheles gambiae (CYP6P3 and CYP6M2;
2723 Djouaka et al., 2008; Stevenson et al., 2011), and Helicoverpa armigera (CYP6AE11;
2724 Brun-Barale et al., 2010), among others (Scott, 1999). L. salmonis sequences annotated
2725 to CYP6w1 and CYP6d4 were overexpressed with a FC > 5 in cypermethrin-treated lice
2726 compared to controls while CYP6k1 and CYP6a18 were not differentially expressed.
140 2727 Additionally, CYP6w1 and CYP3a24 were highly co-expressed among all samples
2728 (Pearson’s correlation, r = 0.97). However, the annotation of L. salmonis CYP
2729 sequences reported here should be interpreted with caution as a complete
2730 characterization of the L. salmonis CYP repertoire has yet to be conducted. As a non-
2731 model organism, L. salmonis transcripts have primarily been annotated using sequence
2732 similarity to related genes found in databases. Differences in database use and
2733 stringency of annotation, as well as phylogenetic distance to other model organisms has
2734 made comparing between studies difficult. For example, a L. salmonis sequence
2735 annotated as CYP3A24 (GenBank accession no. BT080577.1) was shown to be
2736 downregulated in lice exposed to EMB (Carmichael et al., 2013b). However, this
2737 sequence was only 66% similar (with 55% coverage) to the CYP3a24 described here
2738 (GenBank accession no. JP326960.1; blastn alignment, NCBI). Therefore, an approach
2739 similar to that used for CYP characterization of Daphnia pulex (Baldwin et al., 2009)
2740 and/or Drosophila melanogaster (Chung et al., 2009) are urgently required for L.
2741 salmonis to ensure that accurate cross-experiment comparisons can be made through
2742 direct annotations of these important metabolic enzymes in future studies.
2743 Aside from increased CYP activity, several proteases were differentially
2744 expressed in treated L. salmonis (Table 2; Additional File 1), supporting extensive
2745 changes in metabolic activity associated with cypermethrin exposure. Among these, five
2746 serine proteases were overexpressed by cypermethrin, three of which contained at least
2747 one Tryp-sp domain (CDD: cd00190 or smart00020). These domains were also
2748 identified in two other contigs overexpressed by cypermethrin including chymotrypsin
2749 BI (FC = 1.5 – 1.6) and an unknown (FC = 4.2; Additional file 1). Genes containing
141 2750 trypsin-like domains are known to directly metabolize the pyrethroid deltamethrin
2751 through hydrolysis in both arthropods (Yang et al., 2008) and mammals (Xiong et al.,
2752 2014). Changes in protease activity have also been linked to chemical resistance in A.
2753 gambiae (Vontas et al., 2005), C. pipiens pallens (Lv et al., 2015), D. melanogaster
2754 (Pedra et al., 2004), Musca domestica (Ahmed et al., 1998), and C. elegans (Viñuela et
2755 al., 2010). In these cases, proteases are constitutively overexpressed in resistant strains
2756 compared with sensitive and are often induced by chemical exposure. Increases in
2757 protease activity have also been suggested as compensatory mechanisms for elevated
2758 energy demands associated with stress (e.g. chemical exposure) and resistance (Ahmed
2759 et al., 1998; Pedra et al., 2004). Furthermore, the role of proteases in protein synthesis
2760 has been suggested as a potential mechanism for facilitating the induction of
2761 detoxification enzymes such as CYPs (Ahmed et al., 1998). Though it remains unclear
2762 exactly what role proteases have in responding to pyrethroids, those identified here (and
2763 in related L. salmonis studies (Carmichael et al., 2013b) are key markers for
2764 understanding the molecular responses involved with pesticide exposure and resistance
2765 in salmon lice.
2766 5.4.2 Stress-signaling transcripts are differentially expressed by cypermethrin 2767 Cypermethrin exposure resulted in the differential expression of several L. salmonis
2768 transcripts putatively involved in cell signaling cascades. Specifically, transcripts in
2769 growth factor-related signaling pathways were overexpressed in cypermethrin-treated
2770 lice while the activity of FOXO transcription factors appeared to be inhibited. This
2771 profile is compatible with that observed in related species where growth factor signaling
2772 is known to negatively regulate FOXO activity (Eijkelenboom and Burgering, 2013).
2773 This trend was largely supported by the overexpression of insulin receptor subunit beta,
142 2774 protein rhomboid, and rheb (Hay and Sonenberg, 2004; Urban et al., 2001) in
2775 cypermethrin-treated lice. As growth signaling inhibits FOXO activity, the
2776 downregulation of transcripts such as pmrt1, uch-L3, uch-L5, hdac1 and hdac6, which
2777 have known roles in promoting nuclear translocation and/or stability of FOXO
2778 (Eijkelenboom and Burgering, 2013) was of interest. Gene Ontology categories such as
2779 system development (12 transcripts; p = 0.01), and collagen catabolic process (4
2780 transcripts; p =0.001) were also enriched by downstream effectors of these pathways
2781 under exposure to cypermethrin (Additional File 2).
2782 This cell signaling profile was not expected based on the importance of FOXO
2783 in maintaining homeostasis, repairing damaged DNA, and resisting oxidative stress
2784 (Eijkelenboom and Burgering, 2013). However, several transcripts with potential
2785 functions in mitigating neurotoxicity were differentially expressed in this study
2786 including those known to respond to external stimuli (Additional File 2; response to
2787 stimulus; 13 transcripts, p = 0.007). For example, a transcript responsible for dendritic
2788 tiling in D. melanogaster, trc (Emoto et al., 2004), was overexpressed by cypermethrin
2789 in this study. Interestingly, the TOR pathway (which is induced by growth factors;
2790 Teleman, 2010) has been shown to interact directly with trc and is necessary for its
2791 regulation (Koike-Kumagai et al., 2009). Several L. salmonis transcripts also showed
2792 concordant expression profiles when exposed to other abiotic stressors (see Additional
2793 File 1; (Sutherland et al., 2012a; Appendix 1) including Hsp27, RhGB, and mmp2. It is
2794 noteworthy that these transcripts responded to stress across different life stages,
2795 populations, and subspecies of L. salmonis (Atlantic and Pacific; Skern-Mauritzen et al.,
2796 2014), making them strong candidates as markers in future stress-related studies. In
143 2797 particular, the two sequences annotated to Hsp27 are of interest based on similar
2798 biomarkers of stress in related copepods (reviewed in (Lauritano et al., 2012) and other
2799 model arthropods such as D. melanogaster (Mukhopadhyay et al., 2002).
2800 The L. salmonis contigs annotated as Hsp27 (probe ID’s: C222R048 and
2801 C172R035) contain the conserved alpha crystallin domain (Jakob et al., 1993; CDD
2802 accession: cd06526, e = 7.0-31) of stress-induced chaperones known as small heat shock
2803 proteins (sHsps) (Jakob et al., 1993). This class of heat-shock proteins function in stress
2804 resistance by preventing protein unfolding/aggregation (reviewed by Basha et al., 2012)
2805 and apoptosis (Lewis et al., 1999), and promote cell survival (Ahmad et al., 2008). They
2806 also have essential roles in model stress tolerance systems such as encystation in
2807 Artemia embryos (Liang et al., 1997) and anhydrobiosis in tardigrades (Reuner et al.,
2808 2010). Though sHsps are often expressed in multiple tissues (Pauli et al., 1990), their
2809 roles in the neuromuscular system are especially important. For example, in transgenic
2810 strains of D. melanogaster overexpressing Hsp27 specifically in neurons, increased life
2811 span, resistance to ROS, and superior locomotion was observed compared with wild
2812 type strains (Liao et al., 2008). Based on these data and the overexpression of Hsp27
2813 (and other sHsps such as alpha crystallin B chain) in L. salmonis exposed to
2814 cypermethrin and other abiotic stressors, these transcripts are likely to have important
2815 roles in stress resistance in L. salmonis.
2816 Although candidate biomarkers for future experiments studying the roles of
2817 stress and pesticide metabolism and resistance are presented, more evidence is required
2818 to elucidate the cell signaling pathways controlling the response to cypermethrin and
2819 other pesticides in L. salmonis. For instance, it remains unknown how stage-specific
144 2820 differences and/or length of pesticide exposure might impact gene expression.
2821 Differentiating the gene expression profiles of healthy and immobilized L. salmonis will
2822 also be crucial to understanding stress responses including those elicited under pesticide
2823 exposure. For example, M. domestica surviving exposure to
2824 dichlorodiphenyltrichloroethane (DDT) have higher CYP and GST activity compared to
2825 animals who succumb to the effects of treatment (Ahmed et al., 1998). In the present
2826 work, expression profiles of cypermethrin-treated lice were largely represented (~80%)
2827 by immobile individuals (Table 2). Therefore, fold changes of some transcripts may be
2828 diluted based on expression differences between mobile and immobile lice. Lastly,
2829 pathway analysis and experimental annotation for crustacean transcriptomes is scarce in
2830 general and therefore progress in in silico and experimental annotation for L. salmonis is
2831 urgently required. More insight would be provided from future studies assessing
2832 transcriptional differences between short-term (30 min) and chronic (24h or more)
2833 exposures to cypermethrin (and other pesticides) in L. salmonis using sequences
2834 described here.
2835 5.4.3 Conclusions 2836 Low concentrations of cypermethrin caused a clear disruption of homeostasis in
2837 copepodid L. salmonis which was observed through decreases in mobility and
2838 differential gene expression responses (Figure 2). Lice exposed to cypermethrin
2839 overexpressed metabolic enzymes associated with insecticide detoxification including
2840 three cytochrome p450s, adding to previous work (Sevatdal et al., 2005a). The
2841 differential expression of numerous proteases also supports a crucial role for these
2842 transcripts in responding to pesticides like cypermethrin and EMB (Appendix 1) in L.
2843 salmonis. Lastly, cypermethrin exposures induced several transcripts involved in stress-
145 2844 resistance and cell growth and development, potentially through differential expression
2845 of the TOR and FOXO pathways (see Figure 3). Many of the affected transcripts have
2846 known roles in neurodevelopment, actin reorganization, and solute transport in related
2847 species, with some being differentially expressed by other abiotic stressors (Sutherland
2848 et al., 2012a; Appendix 1). The transcripts described herein represent candidate markers
2849 for further studying stress tolerance and pesticide resistance in L. salmonis.
2850 Availability of Data and Materials 2851 Raw and normalized microarray data has been uploaded to Gene Expression Omnibus 2852 (NCBI) under the accession GSE76555
2853 Supplementary Information (Additional Files) 2854 Additional File 1 – Differentially expressed transcripts and newly identified orphans 2855 Additional File 2 – Gene Ontology, SP_PIR_Keywords, and InterPro 2856 Additional File 3 – RT-qPCR analyses 2857 All additional files can be accessed at DOI: 10.1016/j.cbd.2016.08.004
2858 Acknowledgements 2859 This work was funded by Elanco Fish Health Research Chair; NSERC Discovery 2860 (610108); ACOA-AIF TREAT2 (199308); Innovation PEI – Development and 2861 Commercialization grant DCFG (210205-70). Stipend support (JDP) from NSERC 2862 PGSD3 (290948462), MITACS Accelerate fellowships (IT02292), and Canadian 2863 Excellence Research Chair. The authors would like to thank the staff at Huntsman 2864 Marine Science Centre for aiding in lice collection and culture. Also, thanks to Drs. Ben 2865 Sutherland and John Burka for comments on early drafts of the manuscript.
146 2866 Chapter 6: High Level Efficacy of Lufenuron Against 2867 Sea Lice (Lepeophtheirus salmonis) Linked to Rapid
2868 Impact on Moulting Processes
2869 Adapted from: Jordan D. Poley1, Laura M. Braden1, Amber M. Messmer2, 2870 Okechukwu O. Igboeli1, Shona K. Whyte1, Alicia Macdonald3, Jose Rodriguez3, 2871 Marta Gameiro3, Lucien Rufener4,5, Jacques Bouvier4,5, Dorota W. Wadowska4, 2872 Ben F. Koop2, Barry C. Hosking3, Mark D. Fast1§. (2017) Submitted to 2873 International Journal for Parasitology: Drugs and Drug Resistance.
2874 1Hoplite Lab, Department of Pathology & Microbiology, Atlantic Veterinary College, 2875 University of Prince Edward Island, 550 University Ave, Charlottetown PE, C1A 4P3, 2876 Canada
2877 2Centre for Biomedical Research, Department of Biology, University of Victoria, 2878 Victoria BC, V8W 3N5, Canada
2879 3Elanco Canada Limited, 150 Research Lane, Guelph, Ontario N1G 4T2, Canada
2880 4Elanco Centre de Recherche Santé Animale SA; CH-1566 St.-Aubin; Switzerland
2881 5INVENesis LLC, Chemin de Belleroche 14, 2000 Neuchâtel, Switzerland
2882 6Electron Microscopy Laboratory, Atlantic Veterinary College, University of Prince 2883 Edward Island, 550 University Ave, Charlottetown, PEI, C1A 4P3, Canada
2884 JDP contributed to the execution of all experiments with lufenuron, extracted RNA, 2885 analyzed microarray data and electron micrographs, and wrote the manuscript with 2886 MDF. 2887 LMB: Completed RT-qPCR validation and exploration, and contributed to writing. 2888 AMM: Completed microarray hybridizations and scanning for microarrays. 2889 OOI: Contributed to bioassay development and execution. 2890 SKW: Contributed to writing, study design and field applications. 2891 AM: Contributed to study design and field applications. 2892 JR: Contributed to study design and field applications. 2893 MG: Contributed to study design and field applications. 2894 LR: Contributed to study design and field applications. 2895 JB: Contributed to study design and field applications. 2896 DWW: Completed electron microscopy work. 2897 BFK: Contributed to writing of the manuscript and data analysis. 2898 BH: Contributed to writing and study design.
147 2899 MDF: Contributed to writing of the manuscript, data analysis, and study design and 2900 execution. 2901 Copyright 2017. The authors
148 2902 Abstract 2903 Drug resistance in the salmon louse Lepeophtheirus salmonis is a global issue for
2904 Atlantic salmon aquaculture. Multi-drug resistance has been described across most
2905 available compound classes with the exception of the benzoylureas. To target this gap
2906 in effective management of L. salmonis and other species of sea lice (e.g. Caligus spp.),
2907 Elanco Animal Health is developing an in-feed treatment containing lufenuron (a
2908 benzoylurea) to be administered prior to seawater transfer of salmon smolts and to
2909 provide long-term protection of salmon against lice infestations. Benzoylureas disrupt
2910 chitin synthesis, formation, and deposition during all moulting events. However, the
2911 mechanism(s) of action are not yet fully understood and most research completed to
2912 date has focused on insects. We exposed the first parasitic stage of L. salmonis to 700
2913 ppb lufenuron for three hours and observed over 90% reduction in survival to the
2914 chalimus II life stage on the host, as compared to vehicle controls. This agrees with a
2915 follow up in vivo administration study on the host, which showed >95% reduction by
2916 the chalimus I stage. Transcriptomic responses of lice exposed to lufenuron included
2917 genes related to moulting, epithelial differentiation, solute transport, and general
2918 developmental processes. Global metabolite profiles also suggest that membrane
2919 stability and fluidity is impacted in treated lice, possibly in vesicle transport. These
2920 molecular signals are likely the underpinnings of an abnormal moulting process and
2921 cuticle formation observed ultrastructurally using transmission electron microscopy.
2922 Treated nauplii-staged lice exhibited multiple abnormalities in the integument,
2923 suggesting that the coordinated assembly of the epi- and procuticle is impaired. In all
2924 cases, treatment with lufenuron had rapid impacts on L. salmonis development. We
2925 describe multiple experiments to characterize the efficacy of lufenuron on eggs, larvae,
149 2926 and parasitic stages of L. salmonis, and provide the most comprehensive assessment of
2927 the physiological responses of a marine arthropod to a benzoylurea chemical.
2928 6.1 Introduction 2929 Lufenuron is a benzoylurea (or benzoylphenyl-urea; BPU) that was discovered in the
2930 1980s by Ciba-Geigy and subsequently marketed in animal health, bioprotection, and
2931 crop protection in products such as SentinelTM, ProgramTM, MatchTM, etc. Other BPUs
2932 have been used to control ticks, mosquitos and flies of importance in companion
2933 animals, human disease, agriculture, and aquaculture (Dean et al., 1998; Merzendorfer,
2934 2013; Ritchie et al., 2002; Sun et al., 2015).
2935 Benzoylureas bind chitin synthase 1 in terrestrial arthropods (Douris et al., 2016)
2936 causing inhibition of chitin biosynthesis (IRAC group 15; Sparks and Nauen, 2015) in
2937 target pests. These compounds have a broad spectrum of activity which can extend
2938 across generations through impacts on reproduction, egg-hatching, and moulting of
2939 larvae (Mommaerts et al., 2006) and are ideal intervention tools as they can be
2940 administered orally and have low toxicity to host vertebrates (i.e. humans, dogs, fish,
2941 etc.). The latter is exemplified by the approval and use of diflubenzuron in drinking
2942 water to control Aedes aegypti in Brazil (Belinato and Valle, 2015; WHO, 2006). In this
2943 and other cases, BPUs have been important alternatives for treating drug-resistant pest
2944 populations (Merzendorfer, 2013).
2945 Lepeophtheirus salmonis and other ectoparasitic sea lice species (Family:
2946 Caligidae) are the most economically important pathogens of salmon farming
2947 worldwide. Infestation thresholds within the industry are set conservatively in most, but
150 2948 not all, farming regions with a focus on protecting wild populations of salmon from the
2949 impacts of farm-based spill over.
2950 Drug resistance in sea lice is a global issue for salmon aquaculture and multi-
2951 drug resistance (MDR) has been described for most of the licenced compound classes
2952 (i.e. pyrethroids, organophosphates, avermectins and hydrogen peroxide) with the
2953 exception of BPUs (reviewed in Aaen et al., 2015). In particular, emamectin benzoate
2954 (EMB; Slice®), an in-feed avermectin treatment, was used nearly exclusively in many
2955 countries from 2000-2007 before resistance developed in Eastern Canada, Chile,
2956 Scotland, Norway, and the Faroe Islands (Igboeli et al., 2014). No new drug therapies
2957 against sea lice have been licensed since. To target this gap in effective management
2958 tools for sea lice, Elanco Animal Health is developing an in-feed lufenuron treatment to
2959 be administered prior to seawater transfer of salmon smolts and to provide long-term
2960 protection of salmon against sea lice infestation at sea.
2961 Lufenuron is not the first BPU to be used against sea lice, as diflubenzuron
2962 (LepsidonTM) and teflubenzuron (CalicideTM) have, and are currently, being used in
2963 different salmon farming regions (Igboeli et al., 2014). However, these drugs have poor
2964 absorption across the gastrointestinal tract of salmon and represent a major ecological
2965 concern for non-target species such as lobsters (Scottish Executive, 2002; Olsvik et al.,
2966 2015). Despite prior use and research on BPUs, the mode of action for these drugs has
2967 not been characterized in crustaceans. In insects, chitin synthase, a transmembrane
2968 glycosyltransferase (family 2) responsible for the synthesis and polymerization of chitin
2969 (Merzendorfer, 2006), is a target site for BPUs (Douris et al., 2016). However, based
2970 on the multifunctional nature of this enzyme, the complexity of the moult process in
151 2971 general, and the large phylogenetic distance between copepods and insects, taxa-specific
2972 BPU responses are expected. Furthermore, sea lice development is poorly understood
2973 from a genomic standpoint and may hold clues for novel drug discovery. The
2974 objectives of the current work were to (1) develop a system whereby the responses of
2975 planktonic L. salmonis larvae exposed to lufenuron could be studied in a physiologically
2976 meaningful way, (2) determine genes and pathways in lice that are responsive to
2977 lufenuron, and (3) examine the ultrastructural impacts of lufenuron on sea lice
2978 cuticles. These lines of investigation were pursued to characterize the mode of action of
2979 lufenuron on L. salmonis and potentially other parasitic copepods.
2980 6.2. Materials & Methods
2981 6.2.1 Lice collection and culture 2982 For all experiments, salmon lice (L. salmonis) were collected from marine aquaculture
2983 sites in Bay Management Areas 1a or 2a (BMA1a or BMA2a) of the Bay of Fundy,
2984 New Brunswick (NB) Canada between 2013 and 2015. Eggstrings were collected from
2985 gravid females for hatching at the Huntsman Marine Science Centre (HMSC) in St
2986 Andrews, NB, or the Atlantic Veterinary College (AVC) in Charlottetown, PE.
2987 Hatching parameters are described in Chapter 5 and Appendix 1.
2988 6.2.2 Lufenuron bioassays 2989 Multiple bioassay experiments were carried out using larvae and adult L. salmonis for in
2990 vitro exposures to lufenuron. In all experiments, F0 generation lice were collected from
2991 farms in the Bay of Fundy and eggstrings reared in the laboratory at 11 ± 1oC, either at
2992 the AVC or at the HMSC (from where copepodids were transported to AVC for
2993 bioassay work), until desired life stages were achieved. In all cases, stock solutions of
2994 lufenuron were made by dissolving 2.5-5.0 mg of lufenuron in 12.5 mL of methanol
152 2995 (Fisher Scientific; ON) or acetone (Sigma-Aldrich; ON) before diluting 1:1 with
2996 nuclease-free water. Working solutions were made using 10 mL of stock lufenuron
2997 dissolved in 990 mL of filtered seawater from the Bay of Fundy before further dilutions
2998 to obtain desired concentrations. In the first bioassay (B1), lufenuron was dissolved in
2999 methanol before exposing copepodids to 700 ppb lufenuron or a solvent control (0.35%
3000 methanol alone) for three h. Immediately following the bioassay, lice from each
3001 condition were rinsed in SW and used to infest Atlantic salmon (Salmo salar) smolts (n
3002 = 4; ca. 150 g) housed in single 10 L tank systems. For infection, each salmon was
3003 removed from its tank, anesthetized using 1 ppm tricaine methanesulfonate (MS-222;
3004 Sigma-Aldrich, ON) and exposed to 100 copepodids for five min before recovery in the
3005 original tanks. Salmon were sacrificed one week later using 2.5 ppm MS-222 for lice
3006 staging and enumeration. Water temperature was maintained at 11 ± 2oC with salinity
3007 >32 ppt for all challenges and bioassays.
3008 Lice from the same cohort as those reported in Chapter 5 were used in the
3009 second and third bioassays (B2 and B3, respectively). Similar to B1, copepodids in B2
3010 were pre-treated with lufenuron, but acetone was used instead of methanol to emulsify
3011 lufenuron for this assay. Copepodids from B2 were used to infest Atlantic salmon
3012 smolts (ca. 150 g) housed in five 30 L tanks. Three fish were housed in each tank, with
3013 three tanks used for treated copepodids and two tanks for control copepodids. Salmon
3014 were sacrificed 12 days post-infection for lice staging and enumeration as described in
3015 B1.
3016 The B3 experiment was designed to monitor changes in gene expression related
3017 to lufenuron exposure with a commonly used L. salmonis microarray (described below).
153 3018 Triplicate pools of 500 copeopdids were used for each of seven conditions including
3019 seawater (SW) and SW + acetone controls along with five concentrations of lufenuron
3020 (30, 300, 700, 1000, and 1500 ppb) in SW + acetone. Lufenuron exposures lasted for
3021 three h before each pool was individually rinsed and held in SW for 21 h at 10 ± 2oC
3022 with salinity >32 ppt. Each pool of 500 copepodids was collected at this time and
3023 stored at -80oC for RNA extractions.
3024 In Bioassay IV (B4), pools of 500 nauplius II staged lice were exposed to either
3025 700 ppb lufenuron or an acetone control (n = 5; pools of 400) for three h before rinsing
3026 and holding in SW. Each pool was collected separately and stored at -80oC for RNA
3027 extractions and RT-qPCR analysis.
3028 Two additional bioassays similar to B4 were conducted for transmission electron
3029 microscopy (TEM; B5) and metabolomics discovery (B6). Lice in B5 were sampled
3030 from each group (n = 5-10) at 24 and 48 h post-lufenuron exposure and stored in 2%
3031 glutaraldehyde at 4oC before processing within 24 h of collection. For B6, pools of 500
3032 copepodid lice were separated into treated and control groups (n = 6) and collected after
3033 24 h for storage at -80oC.
3034 A seventh bioassay (B7) was conducted to investigate impacts of lufenuron on
3035 eggstrings and the exposure at the first moult of the planktonic stage. Adult female lice
3036 collected from farms in the Bay of Fundy, NB, were brought back to the laboratory at
3037 AVC, whereby paired eggstrings were separated between control and treatment
3038 conditions. Eggstrings (n = 25) were exposed for 24-72 h (i.e. until first emergence of
3039 nauplii I stage larvae) to either acetone controls or 500 ppb lufenuron in a 500 mL glass
3040 beaker with aeration at 12 ± 1oC. A SW-only control was conducted using eggstrings
154 3041 from the same cohort (n = 25), but from different individuals than those treated with
3042 lufenuron. These exposures were replicated from three separate collections between
3043 October 1 and November 17, 2014. Following the first hatch, nauplii and remaining
3044 eggstrings were passed through a filter (100 μm) and washed with new SW prior to
3045 being placed back in a 500 mL beaker with new seawater for the remainder of the
3046 observational period (4-7 days post-treatment). Hatch rate, behaviour and
3047 developmental stages were assessed.
3048 6.2.3 In vivo challenge with lufenuron 3049 Atlantic salmon from a commercial hatchery in NB, Canada were transported to the
3050 AVC and acclimated at 11 ± 1oC in a freshwater flow-through system. Smolts (n = 680;
3051 weighing 59 ± 7.3 g) were evenly distributed in two rooms with eight replicate tanks in
3052 each. Each room was on a separate biofiltration loop with four tanks per experimental
3053 condition in each system. Control fish (n = 8 tanks) were fed a base salmon diet
3054 throughout the course of the study, whereas treated fish (n = 8 tanks) were administered
3055 the same base salmon feed with the top-coated inclusion of lufenuron at a dose rate of 5
3056 mg/kg bw/day for 7 days (total dose 35 mg/kg), before being returned to the same base
3057 salmon feed without lufenuron after 7 days treatment. After a further 7 days, all tanks
3058 underwent conversion to a recirculating SW (instant ocean) system over a 17 day period
3059 until the system could be maintained at 32 ± 3 ppt for the remainder of the study. After
3060 5 weeks post-administration of the medicated feed, fish in all tanks were exposed to
3061 approximately 100 copepodid-staged lice per fish, cultured at the HMSC and obtained
3062 from adult female eggstrings collected from Bay of Fundy salmon farms. At 13-14 days
3063 post-infestation (dpi), 10 arbitrarily selected salmon from each tank were sampled and
3064 the sea lice enumerated and compared between groups. All experiments using Atlantic
155 3065 salmon followed the guidelines provided by the Canadian Council on Animal Care
3066 (http://www.ccac.ca/Documents/Standards/Guidelines/Fish.pdf) and were approved by
3067 the UPEI Animal Care Committee (UPEI Animal Care Protocol #16-023).
3068 6.2.4 RNA extraction 3069 Total RNA was extracted from pooled copepodids from B3 and nauplii from B4 using
3070 TRI-Reagent as per manufacturer’s instructions (Thermo Fisher Scientific, Burlington,
3071 ON) (Chomczynski, 1993; Chomczynski and Mackey, 1995). All samples were
3072 subjected to an in-solution DNase treatment (Thermo Fisher Scientific) before RNA
3073 purification using RNeasy MinElute clean-up kits (Qiagen, Toronto, ON) as per
3074 manufacturer’s instructions. RNA quantity and purity was analyzed using
3075 spectrophotometry (NanoDrop 2000; Thermo Fisher Scientific) while RNA integrity
3076 was assessed using 1% agarose gel electrophoresis. All samples were suspended in
3077 nuclease-free water and stored at -80oC until further use.
3078 6.2.5 Microarray 3079 The RNA extracted from 21 pools of 500 copepodid L. salmonis from B3 were
3080 hybridized on a 38K oligonucleotide microarray (eArray, Agilent; Santa Clara, CA)
3081 designed with expressed sequence tags (ESTs) from Atlantic and Pacific L. salmonis
3082 (Sutherland et al., 2012; Yasuike et al., 2012). Sample preparation, microarray
3083 hybridization, and scanning were performed alongside samples previously reported in
3084 Chapter 5. Scanning was completed using a Perkin Elmer (Waltham, MA) ScanArray®
3085 while Imagene 8.1 (Biodiscovery; Hawthorne, CA) was used for image quantification.
3086 Probe filtering and statistical analyses were executed using GeneSpring GX v13.0
3087 (Agilent). A quality control (QC) filtered probe list included probes with ≥500 Cy5 and
3088 Cy3 fluorescence intensity in at least 66% samples of at least one condition. Probes that
156 3089 had samples containing poor quality flags were removed from the analysis. Raw data
3090 was uploaded to Gene Expression Omnibus (GEO, NCBI) under the accession
3091 GSE99880.
3092 A one-way ANOVA without the assumption of equal variance and post-hoc
3093 Tukey HSD (p < 0.01; fold change (FC) ≥ 1.5) was used to determine differentially
3094 expressed probes between groups. Probes representing the same unique contig
3095 (transcript) are displayed with a range of FC in the manuscript. Unique UniProt
3096 accessions in the differentially expressed transcript list were used for functional
3097 enrichment analyses in DAVID v6.8 (Huang et al., 2009, 2008, 2007) using a modified
3098 Fisher’s exact test (p < 0.05; genes/enrichment category ≥4) comparing against the QC-
3099 filtered background list (Additional File 1). Transcripts with discordant differential
3100 expression between two or more concentrations of lufenuron (i.e. significant
3101 upregulation at one concentration and significant downregulation in another) or with
3102 differential expression between acetone and SW controls (see Additional File 1) were
3103 not included in this analysis. The GO Trimming program (Jantzen et al., 2011) was
3104 used to reduce redundancies in gene ontology (GO) categories using an 80% soft trim
3105 threshold. Hierarchical clustering was also used with a Euclidian distance metric and
3106 Ward’s linkage rule to display similar groups of transcripts.
3107 6.2.6 RT-qPCR 3108 The same RNA samples used for microarray analysis, and the RNA extracted from
3109 nauplii II lice in B4, were used for RT–qPCR analysis of 15 genes. Six genes were
3110 selected for microarray validation and nine genes for further exploration (Additional
3111 File 3). Genes selected for exploration were chosen based on functional evidence of
3112 their role in L. salmonis development (Sandlund et al., 2016).
157 3113 First strand synthesis of cDNA was performed as previously reported in Chapter
3114 5. Transcript-specific standard curves (5-point, 5-fold series dilution) were designed to
3115 confirm that primer efficiencies were 90% - 105% with an R2 of > 0.95. RT-qPCR
3116 amplification was performed in triplicate using SsoAdvanced SYBR Green Supermix
3117 (BioRad) in 11 μL reactions with 1 μL template and 0.1 μM of each primer using the
3118 following thermal regime: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and
3119 a combined annealing and extension step of 60°C for 15 sec. Melt curve analysis was
3120 performed by increasing the temperature from 65°C to 95°C in 0.5°C increments every
3121 5 sec. Melt curves and gel electrophoresis confirmed single product formation for all
3122 transcripts assayed. All RT-qPCR reactions were completed using a CFX96
3123 Thermocycler (BioRad). Each gene of interest was normalized to the geometric mean
3124 of two reference genes, elongation factor 1-alpha (ef1α) and eukaryotic initiation factor
3125 4 (eif4) (Additional File 3) in qBase-PLUS (Biogazelle; Gent, Belgium; Hellemans et
3126 al., 2007) with an output of log2 expression ratios. Reference gene stability was tested
3127 using geNorm (Vandesompele et al., 2002) and showed a collective M value of 0.71 and
3128 coefficient of variation (CV) of 0.24.
3129 Microarray validation was completed using the normalized log2 expression
3130 ratios from the microarray (i.e. Cy5/Cy3) and from RT-qPCR (gene of
3131 interest/geometric mean of reference genes) for each sample using a Pearson’s
3132 correlation (p < 0.05) (Additional File 3). Statistically significant expression
3133 differences between experimental conditions were determined using a one-way
3134 ANOVA with post-hoc Tukey’s HSD (p < 0.05) for all comparisons. All RT-qPCR
3135 analyses were performed in R (R v.3; Team, 2016).
158 3136 6.2.7 Metabolomics 3137 Twelve sea lice samples (B6: six control; six treated) were submitted (100 mg/sample)
3138 to Metabolomics Discovery (Berlin, Germany) for targeted and non-targeted metabolite
3139 screening. Non-targeted metabolite profiling consisted of GC-MS and LC-QTOF/MS
3140 analyses. Using these methodologies, metabolites were analysed in the range of 50-
3141 1700 Da with an accuracy up to 1-2 ppm and a resolution of mass/Δmass = 40,000.
3142 Metabolites measured in the LC were annotated according to their accurate mass and
3143 subsequent sum formula prediction. Metabolites that were not annotated in the LC-MS-
3144 analyses were listed according to their accurate mass and retention time (accurate
3145 mass@retention time, e.g. [email protected]). Target metabolites were identified by
3146 Metabolomic Discoveries proprietary databases. For analysis, the appropriate analytical
3147 platform was chosen: LC-QTOF/MS, GC-MS or both. Sample concentrations were
3148 adjusted to optimally detect necessary metabolites. Abundances of all metabolites were
3149 normalized against an internal standard, and differential abundances between conditions
3150 were calculated using Welch’s t-test (p < 0.05).
3151 6.2.8 Transmission electron microscopy 3152 The protocol for TEM was adjusted based on the developmental stage of the lice.
3153 Artificial water or growth medium was used as a buffer. Lice in nauplius stage were
3154 processed as whole organisms (see B5). Lice in copepodid stages were divided into
3155 cephalothorax and abdominal sections.
3156 Nauplii stage lice were placed in 2% glutaraldehyde (SPI Supplies; London,
3157 ON) buffered in artificial SW for fixation. The organisms were left in the fixative for
3158 no more than 24 h at 4oC. After primary fixation samples were washed in artificial SW
3159 for 10 min twice and post-fixed in buffered 1% osmium tetroxide for 1 h at room
159 3160 temperature. Samples were then dehydrated in ascending concentration of ethanol
3161 starting with 50% and finishing with 100% solution followed by permeation with 100%
3162 propylene oxide (PO). Each step took 10 min and was done twice. Infiltration of
3163 samples with resin comprised of three steps and took place at room temperature.
3164 Samples were infiltrated with 1:1 mixture of Spurr/PO. After 1 h the solution was
3165 changed to 2:1 mixture of Spurr/PO, which lasted for 1 h and ended with 100% Spurr
3166 overnight with infiltration under vacuum. Individual samples were embedded in flat
3167 silicone molds and left overnight in the oven at 70oC.
3168 For copepodid stages, processing was modified to extend dehydration in
3169 infiltration steps. Dehydration in ascending concentrations of ethanol took 12 h for each
3170 step and the solution was changed twice. Permeation in PO took 1 h with two changes
3171 of solution. Each step for infiltration with resin lasted 24 h and the last step of
3172 infiltration with 100% resin took place under vacuum.
3173 Polymerized blocks were cut on a Reichert-Jung Ultracut E ultramicrotome.
3174 Light microscopy sections were 0.5 µm thick and were stained with 1% toluidine blue.
3175 Sections cut to 90 nm were placed on a 200 µm mesh copper super grid and stained with
3176 5% uranyl acetate and Sato lead stain, and were viewed on a Hitachi 7500 TEM at 80
3177 kV. Digital images were captured with an AMT XR 40 side mounted camera.
3178 6.3 Results
3179 6.3.1 Impacts of lufenuron on survival 3180 Moulting was significantly disrupted in L. salmonis larvae exposed to lufenuron.
3181 Infections of Atlantic salmon with copepodids pre-treated with lufenuron resulted in 88
3182 and 93% reductions of attached chalimus lice 7 and 12 dpi, respectively (Fig 1).
3183 Additionally, only one of ca. 500 nauplii II L. salmonis exposed to 700 ppb lufenuron
160 3184 for 3 h successfully moulted to the copepodid stage. In bioassays where a moulting
3185 event did not occur during the assessment period (see methods for B3-B4 and B6), no
3186 significant differences were observed in survival (survival >90% in both treated and
3187 control groups; data not shown). Similarly, no difference in lice survival was observed
3188 when using acetone or methanol as a solvent compared to SW alone. When Atlantic
3189 salmon were fed a diet containing 5 mg/kg lufenuron for 7 days and infested with lice 5
3190 weeks later, a 96% reduction in lice was observed by 14 dpi compared with controls
3191 (Fig 1). Lufenuron levels in the feed were confirmed through submission to the
3192 analytical laboratory at SGS Canada.
a 200
25 a
h
h
s i
s 150
f
i /
20 f
/
e
e
c
i
c
l
i
l
f
15 f
o o
100
r
r
e
e b
b 10
m
m
u u
N 50 N 5 b b 0 0
3193 Control Lufenuron Control Lufenuron 3194 Figure 1: Effects of lufenuron on L. salmonis infection. Lice counts were completed 3195 for two separate infection experiments between 100 and 150 degree days post lice 3196 infection (ddpi) of Atlantic salmon (Salmo salar). The first experiment (left plot; see 3197 section 2.3) used salmon fed lufenuron at the recommended dose of 35 mg/kg or a 3198 control feed diet over 7 days. Five weeks post lufenuron cessation, fish (n = 640) were 3199 infected with 100 copepodids per fish. In the second experiment (right plot, see B2), lice 3200 were pre-treated with 700 ppb lufenuron or acetone controls for 3 h before infecting 3201 salmon (n = 6) with 500 copepodids per fish. Letters denote significant differences in 3202 total live larval counts (t-test; p < 0.05).
161 3203 Exposure of eggstrings for 24-72 h in 500 ppb lufenuron did not impact hatch
3204 success compared to acetone controls (i.e. all >90% hatch rate; n = 3). Following hatch,
3205 the behaviour and development of planktonic lice differed between SW and acetone
3206 controls, such that ca. 80% of the latter were mobile within the water column while
3207 nearly 100% of the former were dispersed in the water column. Only three of ca. 1000
3208 lice from the lufenuron-treated group were observed floating or swimming within the
3209 water column. The majority of lice found at the bottom of the beaker in both the acetone
3210 control or lufenuron treatment were immobile. By 7 days post-hatch, the only
3211 movements of larvae in the lufenuron-treated groups were peristaltic contractions of the
3212 gut (n = 5) and some fast twitch movement of the swimming legs (n = 9). At this point,
3213 SW and acetone control lice had developed to copepodid stage larvae, successfully
3214 completing two moults (i.e. nauplii I to nauplii II; nauplii II to copepodid), whereas the
3215 lufenuron-treated lice remained as nauplii I (Fig 2). There were, however, significantly
3216 fewer lice that developed to the infective copepodid stage in the acetone controls
3217 compared to SW controls in this experiment (one-way ANOVA; p = 0.009, n = 9).
5 1
a 0
1 b
L
m
5
/
e
c
i
L 5
c 0 3218 SW Control Lufenuron
162 3219 Figure 2: Development of Lepeophtheirus salmonis following eggstring/nauplii I 3220 treatment with seawater (SW), SW + acetone (Control), or seawater + acetone + 3221 500 ppb lufenuron (Lufenuron; B7). Lice development was assessed at 7 days post 3222 hatch as an average lice number for each stage enumerated per 5 ml count (completed in 3223 triplicate per system). Letters denote significant differences in total live larval counts 3224 using a one-way ANOVA (p < 0.05).
3225 6.3.2 Impacts of lufenuron on L. salmonis gene expression 3226 Lufenuron had large impacts on the L. salmonis transcriptome, with 1045 differentially
3227 expressed transcripts in at least one concentration of lufenuron (30, 300, 700, 1000, and
3228 1500 ppb) compared with acetone controls (Tukey’s HSD; p < 0.01 and FC ≥ 1.5). The
3229 majority (61%) of these were downregulated by treatment (Table 1).
3230 Table 1: All differentially expressed transcripts in lufenuron-treated vs control lice. # of transcripts upregulated # of transcripts downregulated Treatment by lufenuron vs control by lufenuron vs control Group (ppb) 1.5≤FC<2 FC≥2 1.5≤FC<2 FC≥2
30 107 12 175 120
300 267 76 230 183
700 211 31 214 129
1000 178 17 208 114
1500 100 16 116 79
3231 Principal Component Analysis (PCA) separated acetone controls from lufenuron-
3232 treated lice on the first and second principal components, which explained 31.4% and
3233 20.4% of the variation in lice transcriptomes, respectively. Variation between
3234 biological replicates of lice treated with 30-1000 ppb lufenuron was greater than
3235 differences between treatments for some samples (Fig 3). Lice in the SW control,
163 3236 acetone (emulsifier) control, and 1500 ppb lufenuron groups were tightly clustered
3237 within their respective conditions (Fig 3). Lice exposed to acetone alone differentially
3238 expressed 301 transcripts compared to lice maintained in SW (t-test without the
3239 assumption of equal variance; p < 0.01 and FC ≥ 1.5; Additional File 1). These
3240 transcripts were removed for gene enrichment analyses (see tags in Additional File
3241 1). Overall, seawater and acetone controls were separated from all lufenuron-treated
3242 samples using 16,259 QC filtered probes (Fig 3), indicating that lufenuron exposure
3243 causes substantial changes to the gene expression profiles of L. salmonis copepodid
3244 larvae. )
% Seawater
4 .
0 Acetone
2 (
30 ppb
2
t
n 300 ppb e
n 700 ppb o
p 1000 ppb m
o 1500 ppb C
3245 Component 1 (31.4%)
3246 Figure 3: Principal Component Analysis (PCA) of L. salmonis exposed to multiple 3247 concentrations of lufenuron. A total of 21 samples represented by the expression of 3248 16,259 probes passing QC filters. Each square represents a pool of approximately 500 3249 copepodids exposed to seawater alone, acetone alone, or acetone and lufenuron (30 - 3250 1500 ppb) for 3 h before a 21 h holding period in seawater, at which time lice were flash 3251 frozen and stored for RNA extractions.
3252 6.3.2.1 Expression differences in early moulting and chitin synthesis 3253 Cell signalling involved in L. salmonis moulting has been studied at the transcriptional
3254 level (Eichner et al., 2015a; Sandlund et al., 2016). Candidate genes described by
164 3255 (Sandlund et al., 2016) were probed here using microarray and/or RT-qPCR (Additional
3256 Files 1 and 3) in both copepodid (B3) and nauplii II staged lice (B4) exposed to
3257 lufenuron. The retinoic acid receptor (LsRXR; Eichner et al., 2015a) transcript was
3258 induced (FC = 1.5) by 1500 ppb lufenuron compared to controls in copepodids only.
3259 However, the expression of transcripts annotated to hormone receptors (e.g. LsEcR and
3260 LsHR38), transcription factors (LsE74 and LsE75), and peptidases (e.g. LsCP1;
3261 Additional File 3) involved in L. salmonis development (Sandlund et al., 2016) were
3262 unchanged by lufenuron in this study (data not shown).
3263 Based on the strong characterization of developmental genes in Drosophila
3264 melanogaster, sequences from the chitin synthesis pathway (KEGG: dme00520) were
3265 used as queries to identify L. salmonis orthologs in the Transcriptome Shotgun
3266 Assembly (TSA) database (NCBI) using a BLASTX algorithm (Fig 4). All chitin
3267 synthesis genes were conserved between D. melanogaster and L. salmonis (Fig 4), with
3268 between 58% and 84% positive matches in the alignments (Additional File 5).
3269 Lufenuron-treated lice differentially expressed three genes in the chitin synthesis
3270 pathway including glucose-6-phosphate isomerase, glucosamine-6-phosphate-N-
3271 acetyltransferase, and phosphoacetylglucosamine mutase (PAGmut; Fig 5, Additional
3272 File 1). PAGmut showed a concentration-dependent increase in expression when
3273 exposed to lufenuron (Fig 5), which was confirmed using RT-qPCR. However,
3274 microarray and RT-qPCR data for G6P isomerase were not significantly correlated (r =
3275 0.32; p = 0.2; Additional File 3); the only instance in six genes used to validate the
3276 microarray. Other notable members of this pathway such as chitin synthase 1 (LsCHS1)
3277 and the chitinases LsChi1 and LsChi2 (see contig ID: 5727818 and 5733254) were not
165 3278 differentially expressed by lufenuron. This was confirmed using specific primers
3279 obtained from (Sandlund et al., 2016) for RT-qPCR.
GLYCOLYSIS/ GLUCONEOGENESIS Glucose
Hexokinase CHITIN {Ls: Hexokinase type 2} Hex-A METABOLISM E = 9e-170 Chitin Chitinase {Ls: Probable chitinase 2} Cht9 Glc-6P -82 E = 1e Glucose-6-phosphate isomerase {Ls: Glucose-6-phosphate isomerase}
Pgi Chitobiose Hexosaminidase E = 0 {Ls: Chitooligosaccharidolytic beta-N-acetylglucosaminidase} Hexo1 Chitinase -167 {Ls: Probable chitinase 2} E = 1e Fru-6P
Cht9 glutamine Glucosamine fructose-6-phosphate aminotransferase E = 1e-82 {Ls: Glucosamine fructose-6-phosphate aminotransferase [isomerizing] 2} GlcNAc glutamate Gfat1 E = 4e-147 Pyruvate N-aceylglucosamine kinase* {Ls: N-acetyl-D-glucosamine kinase} GlcN-6P CG.6218 -45 E = 3e Glucasamine-6-phosphate-N-acetyltransferase Acetyl CoA {Ls: Probable glucosamine-6-phosphate-N-acetyltransferase}
CoA CG.1969 E = 2e-69
GlcNAc-6P
Phosphoacetylglucosamine mutase {Ls: Phosphoacetylglucosamine mutase} nst E = 7e-150
GlcNAc-1P
UDP acetylhexosamine pyrophosphorylase UTP {Ls: UDP-N-acetylglucosamine pyrophosphorlase}
Ppi mmy E = 4e-147
UDP-GlcNAc
Chitin synthase {Ls: Chitin synthase} kkv E = 0
Chitin 3280 3281 Figure 4: Chitin synthesis pathway derived from Drosophila melanogaster (KEGG: 3282 dme00520) showing genes are conserved across insects and copepods. The gene name 3283 provided by KEGG is on top followed by the gene name for sea lice (taken from 3284 microarray annotation) and the abbreviated gene name on bottom with the 3285 corresponding e-value derived from a BLASTx search using the D. melanogaster 3286 sequence against the TSA database (NCBI) limited to L. salmonis sequences. Those 3287 sequences highlighted in red were differentially expressed in at least one condition.
3288 Other transcripts with important roles in regulating moulting, but not found in
3289 the traditional chitin synthesis pathway, were differentially expressed by lufenuron.
166 3290 Two transcripts, chitin deacetylase (CDA) and UDP-glucose 6-dehydrogenase, showed
3291 similar patterns of expression to PAGmut, with 2.9-fold higher expression in 1500 ppb
3292 lufenuron-treated lice compared to acetone controls. The expression of nine transcripts
3293 from the solute carrier (SLC) family was also changed by lufenuron, including SLC2A1
3294 and SLC35B1, which transport glucose and sucrose, respectively. Downregulated
3295 transcripts enriched several GO categories related to transport including regulation of
3296 transport (22 transcripts; p = 0.009), vesicle (37 transcripts; p < 0.05), and
3297 transmembrane transport (16 transcripts; p = 0.04). Overall, only three transcripts
3298 related to chitin synthesis were induced by lufenuron treatment while more than 50
3299 transport-related transcripts were downregulated.
3300 3301 Figure 5: Lepeophtheirus salmonis expression of phosphoacetylglucosamine mutase 3302 showing a concentration-dependent induction under lufenuron exposure (see B3). 3303 Calibrated normalized relative quantities (CNRQ) were calculated against ef1α and eif4 3304 reference genes. Letters denote significant differences in expression between conditions 3305 (p<0.05).
167 3306 6.3.2.2 Cuticle-related transcripts are downregulated by lufenuron 3307 A group of 18 transcripts without UniProt annotations, but containing chitin-binding
3308 domains (CBD), as determined using RPS-BLAST against the Conserved Domain
3309 Database (NCBI; e < 10E-5), were downregulated between 1.5 and 3.3-fold in at least
3310 one of the treatment groups compared with controls (Fig 6; Additional File 1). Ten of
3311 these transcripts had CBDs with conserved cysteines common to chitinases (CDD:
3312 pfam01607; cys) while eight others lacked these conserved cysteines (CDD:
3313 pfam00379; non-cys). Another seven transcripts containing at least one C-type lectin
3314 domain (CDD: cd00037) were also downregulated between 1.5 and 4.4-fold in
3315 lufenuron-treated lice. The C-type lectin transcripts were positively correlated with
3316 transcripts containing a CBD (Fig 7 and Additional File 4), suggesting these transcripts
3317 are co-expressed. An additional two transcripts annotated as cuticle protein CP14.6, a
3318 known structural component of the tobacco hornworm (Manduca sexta) cuticle (Rebers
3319 et al., 1997), were also downregulated by 1000 and 1500 ppb lufenuron in this study
3320 (Fig 6). Together, 20 novel L. salmonis transcripts with putative roles in chitin
3321 metabolism and cuticle structure were impacted in L. salmonis exposed to lufenuron.
3322 Validation of these expression patterns was completed with RT-qPCR analysis
3323 of one CP14.6 transcript (contig 5735548), a C-type lectin transcript (contig 5732078),
3324 and one transcript with a non-cys CBD domain (contig 5729852), all of which were
3325 significantly correlated between microarray and RT-qPCR assays (Pearson’s
3326 correlation, p < 0.05; Additional File 3). Overall, 35 transcripts with annotations
3327 (SwissProt and/or CDD) to the L. salmonis cuticle were differentially expressed by
3328 exposure to lufenuron (Fig 6 and 7).
168 3329
3330 Figure 6: Heatmap of chitin/cuticle-related transcripts differentially expressed by 3331 at least one concentration of lufenuron. Hierarchical clustering (Euclidian distance 3332 metric; Ward’s linkage rule) clustered transcripts based on averaged expression profiles 3333 in each lufenuron treatment. Expression is represented as Log2 Cy5/Cy3 ratios.
169 3334 3335 Figure 7: Heatmap of correlation coefficients (Pearson’s r) derived from a pairwise 3336 comparison (all against all) of cuticle/chitin-related transcripts differentially 3337 expressed by at least one concentration of lufenuron. Each transcript, represented by 3338 a probe ID (see Additional File 1), is plotted once on the x-axis and y-axis. An example 3339 of a negative (red) and positive (green) correlation is represented in the scatterplots on 3340 the right (blue and pink, respectively). All correlation coefficients from this analysis can 3341 be viewed in Additional File 4.
3342 6.3.2.3 Expression of developmental genes after exposure to lufenuron 3343 Many L. salmonis transcripts downregulated by lufenuron had roles in the structural
3344 integrity of epithelia and muscle based on gene annotations (Table 2). These transcripts
3345 enriched GO categories such as muscle structure development (19 transcripts; p = 2-6)
3346 and epithelium development (23 transcripts; p = 0.001; Table 2). Other transcripts with
3347 roles in tissue development enriched the GO categories foregut morphogenesis (four
3348 transcripts; p = 0.002), neuron differentiation (21 transcripts; p = 0.01), tissue
3349 morphogenesis (17 transcripts; p = 0.0009), and growth (19 transcripts; p = 0.001;
170 3350 Additional File 2). Transcripts responsible for cellular development and differentiation
3351 were also downregulated by lufenuron, enriching GO categories actin cytoskeleton
3352 organization (15 transcripts; p = 0.0008) and actin filament binding (six transcripts; p =
3353 0.01), among others (Additional File 2). Many of these transcripts were annotated
3354 against developmental genes of D. melanogaster such as protein sarah, protein
3355 strawberry notch, multiple EGF-like domain, reticulon-4, ryanodine receptor, wing disc
3356 development protein, and armadillo segment polarity protein (Additional File 1).
3357 Another eight transcripts downregulated by lufenuron enriched the GO categories
3358 chaeta development (four transcripts; p = 0.02) and epithelia-mesenchymal transition
3359 (four transcripts; p = 0.02), suggesting roles for these transcripts in L. salmonis
3360 moulting. Transcripts overexpressed by lufenuron largely enriched GO categories
3361 related to transcription and translation; although five transcripts did enrich the
3362 smoothened signalling pathway (p = 0.03), a pathway responsible for accurate
3363 patterning of D. melanogaster segments (Alcedo et al., 1996). Therefore, changes in
3364 gene expression related to lufenuron exposure in L. salmonis suggest a systemic impact
3365 on development, with downregulation in multiple structural constituents of the cuticle,
3366 muscle, and epithelia, as well as important effectors for cell differentiation, solute
3367 transport, and tissue morphogenesis (Table 2).
171 3368 Table 2: GO categories enriched by transcripts downregulated by lufenuron exposure. General GO # p- GO Term Functions Category Transcripts value Muscle muscle structure GO:0061061 19 2E-06 development striated muscle cell GO:0055002 9 4E-04 development GO:0045214 sarcomere organization 6 6E-04 structural constituent of GO:0008307 4 0.006 muscle GO:0030018 Z disc 6 0.01 skeletal muscle organ GO:0060538 5 0.02 development Epithelia GO:0060429 epithelium development 23 0.001 epithelial-mesenchymal GO:0001837 4 0.02 transition GO:0002064 epithelial cell development 9 0.02 Cell Structure actin cytoskeleton GO:0030036 15 8E-04 organization regulation of cell GO:0010769 morphogenesis involved in 8 0.005 differentiation GO:0051015 actin filament binding 6 0.01 GO:0048468 cell development 41 8E-06 Tissue GO:0009887 organ morphogenesis 20 6E-04 Development GO:0040007 growth 19 0.001 GO:0007440 foregut morphogenesis 4 0.002 GO:0030182 neuron differentiation 21 0.01 GO:0022416 chaeta development 4 0.02 Stress GO:0042493 response to drug 8 0.006 GO:0007584 response to nutrient 6 0.004 GO:0050896 response to stimulus 72 0.004
3369 6.3.2.4 Genes related to the stress response 3370 The identification of transcripts involved in a stress response to lufenuron exposure was
3371 difficult to quantify in this study. Exposure to 0.35% acetone (used to emulsify
3372 lufenuron) caused upregulation of known L. salmonis stress markers such as heat shock
3373 beta 1 and major vault protein (Additional File 1; Chapter 5) when compared to lice
3374 maintained in SW. Of the 301 transcripts that were differentially expressed between
3375 acetone and SW controls (Additional File 1), 150 were also differentially expressed
172 3376 between acetone controls and at least one concentration of lufenuron. These transcripts
3377 were not included in GO analysis and are flagged in Additional File 1. Surprisingly,
3378 many transcripts related to stress that did not respond to acetone exposure were
3379 downregulated in lufenuron-treated lice, enriching GO categories such as response to
3380 stimulus (72 transcripts; p = 0.004) and response to drug (eight transcripts; p = 0.006).
3381 6.3.3 Metabolomics discovery 3382 In total, 997 compounds were analysed using a metabolomics approach. Unfortunately,
3383 major compounds of interest (e.g. N-Acetyl-D-glucosamine 6-phosphate, D-
3384 Glucosamine 6-phosphate, UDP-N-acetyl-alpha-D-glucosamine) were below the limit
3385 of detection. Different normalisation methods were tested and normalisation on the
3386 total ion count (TIC) gave the best result and was used for analysis. To provide an
3387 initial overview of all analysed samples, a PCA was calculated (Additional file
3388 6). Despite a large amount of variation between samples, 16.2% of the dataset’s
3389 variance could be explained by the classification into control and treated lice. A total of
3390 36 metabolites were found to be changed significantly (t-test; p < 0.05) in the drug
3391 treated samples compared to untreated controls, most commonly phosphatidic acid and
3392 other lipids (Table 5). The profile in treated animals showed mostly a downregulation
3393 of metabolites with polyunsaturated fatty acid moieties. The metabolite with the highest
3394 increase in the drug treated lice had a molecular weight of 509.98 Da corresponding to
3395 lufenuron, confirming the detection method.
173 3396 Table 3: Differential metabolite signatures of lufenuron-treated lice compared to 3397 controls. Log2 FC Metabolite p-value Lufenuron/Control Phosphatidic acid (33:2) 0.03 -1.6 Phosphatidic acid (39:6) 0.04 -1.4 Phosphatidic acid (37:6) 0.03 -1.4 Phosphatidic acid (39:7) 0.03 -1.4 Phosphatidylglycerol (14:0) 0.03 -1.3 PA 1-heptadecanoyl-2-(9Z-tetradecenoyl)- 0.04 -1.3 sn-glycero-3-phosphate Phosphatidic acid (37:3) 0.02 -1.3 1,2-di-(9Z-octadecenoyl)- 0.03 -1.3 sn-glycero-3-pyrophosphate Phosphatidic Acid (35:3) 0.03 -1.3 Phosphatidylglycerol (32:0) 0.01 -1.3 Phosphatidic Acid (35:1) 0.03 -1.2 814.683@2 0.01 -0.93 Phosphatidylethanolamine (18:4/20:3) 0.02 -0.90 306.145@4 0.03 -0.87 Trp-Ser-Ser 0.005 -0.84 Arg-Met-Phe-Asp 0.02 -0.78 Serine 0.004 -0.63 [email protected] 0.04 -0.59 Asn-Ile-Ile-Val 0.03 -0.41 2,3-Dihydro-5,5',7,7'-tetrahydroxy-2-(4- hydroxyphenyl)[3,8'-bi-4H-1- 0.01 -0.37 benzopyran]-4,4'-dione Palmitoleoyl Ethanolamide 0.02 0.40 Citronellyl anthranilate 0.02 0.44 9-Hexadecenoylcarnitine 0.004 0.52 2''-O-Acetylrutin 0.04 0.53 Leucine 0.02 0.64 [email protected] 0.03 0.64 Ile-Arg-Lys 0.01 0.69 [email protected] 0.02 0.69 Phosphatidylglycerol (42:11) 0.04 0.84 Lys-Lys-Met-Phe 0.02 0.86 [email protected] 0.001 0.87 Arg-Asn-Gln-Arg 0.05 1.1 [email protected] 0.01 1.1 Ile-His-Phe 0.04 1.2 [email protected] 0.04 1.2 [email protected] (lufenuron) 0.0 2.8 Mannose 0.2 1.1 Glucose 0.5 -0.19
174 Glucosamine 0.6 -0.052 Glucose-6-phosphate 0.7 0.068
3398 6.3.4 Impacts of lufenuron on ultrastructure of the cuticle 3399 Transmission electron microscopy was employed to look at the ultrastructural
3400 components of L. salmonis integument and underlying epithelium across stage (nauplii
3401 and copepodid) and treatment. These assessments were largely qualitative and were
3402 aided by earlier work on the characterization of chalimus-staged L. salmonis cuticles
3403 during moulting (Bron et al., 2000a) and intermoult (Bron et al., 2000b). In nauplii II
3404 stage individuals, the cuticle in many regions had separated from the epithelial layer as
3405 part of apolysis and the formation of the exuvial cleft was evident in all nauplii samples
3406 (Fig 8-9). Formation of the new cuticle was observed between this space and the
3407 epithelial layer. The old epicuticle and procuticle remained distinct after the old cuticle
3408 was shed with a large band of electron-lucent material beneath the procuticle in the
3409 exuvial cleft (Fig 8C+D and 9C+D). Only lufenuron-treated lice exhibited the formation
3410 of electron-dense foci in this electron-lucent material in the exuvial cleft (Fig 9). In
3411 some cases, the electron-dense focii were associated with fissures/pores running through
3412 the old procuticle (Fig 9D).
175 3413 3414 Figure 8: Images of control Lepeophtheirus salmonis nauplii II integument and 3415 underlying tissue during apolysis using electron microscopy. A-B) 10,000x 3416 magnification with scale bar = 2μm. C-D) 60,000x magnification with scale bar = 3417 500nm. Abbreviations: Old cuticle (Oc), new procuticle (P), epidermis (Ep), vesicle 3418 aggregates (V), old epicuticle (Oe), old procuticle (Op), exuvial cleft 3419 (Ec), new epicuticle (E), transitional procuticle (Tp), apical membrane (A), and diffuse 3420 substance beneath Op in the Ec (black star).
176 3421 3422 Figure 9: Images of Lepeophtheirus salmonis nauplii II integument and underlying 3423 tissue during apolysis 24 h post lufenuron treatment using electron microscopy. A) 3424 10,000x magnification with scale bar = 2μm, B) 20,000x magnification with scale bar = 3425 2μm C) 60,000x magnification with scale bar = 500nm, D) 120,000x magnification with 3426 scale bar = 100nm. Abbreviations: Old cuticle (Oc), epithelium (Ep), vesicle 3427 (V), secondary membrane separating electron dense epithelium (white arrow heads), 3428 exuvial cleft (Ec), procuticle (P), poorly defined epicuticle and transitional procuticle 3429 (E/Tp), old procuticle (Op), diffuse substance beneath Op in the Ec (black star), 3430 electron-dense focii (white stars), apical membrane (A), and old epicuticle (Oe).
3431 In the newly synthesized cuticle of lufenuron-treated nauplii, the epicuticle and
3432 transitional procuticle were not distinct as was observed in controls (Fig 8-9). The
3433 procuticle of all nauplii lice had not yet subdivided into the endocuticle and exocuticle;
3434 however, control lice had far more electron-dense procuticles with some electron-lucent
3435 spaces near the apical membrane of the epithelium (Fig 8). In lufenuron-treated nauplii,
3436 these electron-lucent spaces were interspersed throughout the procuticle and were more
177 3437 frequent (Fig 9), although these observations were not quantified. In contrast, lice
3438 treated with lufenuron had a more electron-dense epithelium with the appearance of a
3439 secondary membrane below which electron-dense vesicles were observed to aggregate
3440 (Fig 9). This secondary membrane was not observed in controls, which also exhibited
3441 numerous electron-dense vesicles aggregating below the epithelium (Fig 8). Despite the
3442 irregularities observed in both the old and new cuticles of lufenuron-treated lice, ecdysis
3443 had proceeded and parts of the new cuticle were evident in both control and treated
3444 nauplii.
3445 3446 Figure 10: Images of control Lepeophtheirus salmonis copepodid integument using 3447 electron microscopy. A) 10,000x magnification with scale bar = 2μm B) 60,000x 3448 magnification with scale bar = 500nm, C) 30,000x magnification with scale bar = 3449 500nm. Abbreviations: Epicuticle (E), procuticle (P), epithelium (Ep), electron-dense 3450 band separating cuticle and Ep (black arrow heads), exocuticle (Exo), endocuticle 3451 (Endo), and vesicles (V).
178 3452 3453 Figure 11: Images of Lepeophtheirus salmonis copepodid integument 48 h post 3454 lufenuron treatment using electron microscopy. A) Dead, deformed copepodid at 3455 80,000x magnification with scale bar = 500nm. An ecdysial membrane (Em) was 3456 observed in treated lice that had arrested moulting. The epicuticle (E) often had several 3457 microridges, B) Mobile copepodid with region of completed moult at 10,000x 3458 magnification with scale bar = 2μm. The procuticle (P) is well adhered to the epithelium 3459 (Ep), C) 120,000x magnification with scale bar = 100nm showing 3460 mobile treated copepodid integument with an electron-lucid endocuticle (Endo), an 3461 unorganized epicuticle (E), and a poorly defined band between the cuticle and epidermis 3462 (black arrow head). The exocuticle (Exo) appeared normal.
3463 At the 48 h sampling time, lice in the control group had completed the moult to
3464 copepodids while only one louse in the lufenuron-treated group remained mobile,
3465 despite being deformed (data not shown). In control copepodids, an electron dense
3466 epicuticle separated the procuticle from the external environment (Fig 10). The
3467 procuticle was further subdivided into the exocuticle (outermost) and endocuticle
3468 (innermost) layers. The endocuticle of some control animals appeared to be secreted in
179 3469 layers, forming overlaying laminae of electron dense chitin microfibrils (Fig 10C). A
3470 greater electron-dense layer adjacent to the epithelium, similar in appearance to the
3471 epicuticle, was always present in control copepodids (Fig 8C). In some sections,
3472 structure of the exocuticle and endocuticle was unclear and appeared electron-lucid (Fig
3473 8B); variability was likely explained by differences in moult timing (age) of the
3474 copepodids and focal differences in cell populations or cellular physiology.
3475 All treated copepodids appeared deformed macroscopically (data not shown)
3476 due to arrested moulting through the transition to copepodids (48 h). In some cases,
3477 deformed lice were only early in initiating the moult as evidenced by the presence of an
3478 ecdysial membrane (Fig 11A; see Bron et al., 2000). For the louse that remained mobile
3479 48 h post treatment (Fig 11B+C), the epicuticle was disorganized and heterogeneous
3480 with regard to electron-density (Fig 11C). Although the procuticle of this individual was
3481 similar to controls (Fig 11B-C), the electron dense band between the epithelium and
3482 endocuticle was barely present (Fig 11C). Therefore, lice surviving treatment through
3483 the moult transition also exhibit physiological impacts from lufenuron exposure.
3484 6.4 Discussion 3485 Lufenuron is a new in-feed treatment for sea lice. It is currently marketed under the
3486 tradename ImvixaTM in Chile and is under consideration for use in North America and
3487 Europe. Lufenuron is the first new drug therapy to be licensed against sea lice in
3488 aquaculture in nearly two decades. Based on the success of lufenuron and other BPUs
3489 in veterinary medicine and agriculture and the worsening issues with drug-resistant lice
3490 in salmon aquaculture, lufenuron will be an important addition to the short list of
3491 parasite management strategies currently being used in the industry. In the present
180 3492 study, we (1) established a system whereby the responses of the planktonic stages of the
3493 parasite to lufenuron could be studied in a physiologically meaningful way, (2)
3494 identified genes, molecular pathways, and metabolites that changed in response to
3495 lufenuron exposure, and (3) described the ultrastructural impacts of lufenuron on larval
3496 sea lice cuticles and underlying epithelia. These results are discussed in terms of drug
3497 efficacy, similarities and differences to BPU responses in insects, and the molecular
3498 mechanisms controlling L. salmonis development and drug resistance.
3499 6.4.1 Efficacy of lufenuron against sea lice 3500 A bioassay exposure model was adopted from Chapter 5 to carry out short-term
3501 lufenuron immersions for different life stages of L. salmonis. Acetone and methanol
3502 were used as vehicles to maintain lufenuron in SW solution; however, solubility issues
3503 with methanol resulted in acetone working the best. Acetone exhibited some toxicity to
3504 the larval sea lice, but there were no significant differences with respect to mortality in
3505 nauplii or copepodid staged lice and so this vehicle was used throughout further
3506 studies. A general stress response due to acetone exposure is measured by
3507 transcriptomics in Additional File 1.
3508 The maximum residue limit for lufenuron in the fillets of finfish has been
3509 established at 1350 µg/kg (ppb) by several major regulatory agencies (EFSA, 2010;
3510 European Medicines Agency, 2015; Food and Drug Administration (FDA), 2016). A
3511 lower concentration of 700 ppb was chosen as the dose for 3-h immersion with the
3512 initial infective copepodid stage for assessment of impact on infestation and
3513 development. Even at this concentration for a short exposure time, a major reduction in
3514 lice developing through to the first moult was observed (ca. 90%). This matched well
3515 with exposure of copepodid stage lice to fish fed 5 mg lufenuron/kg bw/day for 7 days,
181 3516 showing 96% reductions compared to fish fed a control diet (Fig 1). The inability of
3517 exposed eggstrings and nauplii larvae to develop to the infective copepodid or any
3518 exposed copepodids to develop to pre-adult stages of lice suggests rapid uptake of
3519 lufenuron by both immersion and digestion. While examination of adult females on
3520 treated hosts are required to definitively determine the impact of lufenuron on egg
3521 production and progeny development, immersion of females and their eggstrings with
3522 500 ppb lufenuron demonstrated that the drug may impact progeny of surviving adults,
3523 and extend protection into the next generation. These impacts parallel those of
3524 lufenuron in a wide range of other arthropod species. For example, D. melanogaster fed
3525 high doses of lufenuron were able to complete development within the instar stage, but
3526 died during ecdysis to the next instar (Wilson and Cryan, 1997). Although adult D.
3527 melanogaster fed the drug were not impacted, oogenesis was impaired and their eggs
3528 failed to hatch (Wilson and Cryan, 1997). Topical treatment of potato tuber moth
3529 Solanum tuberosum eggs did not affect hatching success, yet 90% of the lufenuron-
3530 treated animals were unable to complete the moult through the first instar stage
3531 (Edomwande et al., 2000). Lufenuron has also reduced the size of oocytes, number of
3532 chorionated oocytes, and the incorporation of N-acetylglucosamine into chitin in the
3533 ovaries of the triatomine bug, Rhodnius prolixus (Mansur et al., 2010). Therefore, the
3534 general effects of lufenuron on larvae and eggs of L. salmonis are similar to those
3535 previously observed for insects.
3536 6.4.2 Impacts of lufenuron on L. salmonis physiology 3537 Nauplii II-staged lice arrested moulting between 24 and 48 h post exposure to lufenuron
3538 and showed a variety of macroscopic deformities (data not shown). Ultrastructural
3539 differences between lufenuron-treated lice and control lice were difficult to quantify,
182 3540 largely due to variation within and between individual cuticles. Qualitative assessments
3541 were facilitated by earlier work (Bron et al. 2000a), who also reported wide variability
3542 in cuticle morphology for chalimus-staged L. salmonis during moulting. Despite
3543 surviving 24 h post treatment, ultrastructural differences were observed in lufenuron-
3544 treated nauplii lice, including the formation of electron-dense focii beneath the old
3545 cuticle in the exuvial cleft, a poorly organized epicuticle, a diffuse procuticle, and lack
3546 of an electron-dense layer joining the endocuticle to the epithelium. This phenotypic
3547 aberration is likely a result of chitin synthesis being a cell autonomous process
3548 (Gangishetti et al., 2009) and developmental differences in individual moult timing
3549 (Eichner et al., 2015b) will likely contribute some variability. Ultrastructural differences
3550 in treated L. salmonis cuticles corresponded with the disruption of gene expression
3551 related to moulting, largely in the downregulation of transcripts involved in the
3552 structural integrity of muscle and epithelium, as well as numerous polysaccharide-
3553 binding genes such as C-type lectins and transcripts with CBDs. Several other L.
3554 salmonis transcripts annotated to well-characterized D. melanogaster developmental
3555 genes or solute transporters were also downregulated by lufenuron. Benzoylureas
3556 generally cause a wide range of phenotypic abnormalities due to their interference with
3557 chitin formation (Post et al., 1974), abundance (Gangishetti et al., 2009; Merzendorfer
3558 et al., 2012), and deposition (Post and Vincent, 1973) and, therefore, the polygenic
3559 response observed here was expected.
3560 The L. salmonis chitin synthesis pathway was described for the first time here by
3561 matching contiguous sequences from the microarray assembly (Yasuike et al., 2012)
3562 with transcripts from the well-characterized D. melanogaster pathway (Fig 4 and
183 3563 Additional File 5). Although the mechanism of action for BPUs is not yet fully
3564 characterized, convincing evidence exists for chitin synthase 1 (CHS) as a binding site
3565 (Douris et al., 2016). Based on the high conservation of this gene (Merzendorfer,
3566 2006), the L. salmonis chitin synthase 1 (LsCHS-1; GenBank: KX349436.1; Fig 4) is a
3567 likely binding site for lufenuron in sea lice. Our analyses show that the majority of
3568 genes in the chitin synthesis pathway, including LsCHS-1, were not differentially
3569 expressed by lufenuron, a finding consistent with observations in BPU-treated beetles
3570 Triboleum castaneum (Merzendorfer et al., 2012) and flies D. melanogaster
3571 (Gangishetti et al., 2009). Only PAGmut, an isomerase residing two steps upstream of
3572 LsCHS-1 and responsible for converting N-acetylglucosamine-6-phosphate (GlcNAc6P)
3573 to GlcNAc1P (Kato et al., 2005), was overexpressed greater than 2-fold in treated lice
3574 (Fig 5). Two additional transcripts, CDA and UG6D, showed similar responses to
3575 PAGmut with nearly 3-fold overexpression in the 1500 ppb lufenuron group compared
3576 to controls. To our knowledge, CDA is the first chitin deacetylase (contig: 5731222) to
3577 be described for this species. Studies using RNAi in T. castaneum revealed certain
3578 chitin deacetylases are essential for successful moulting while others are redundant
3579 (Arakane et al., 2009). Likewise, a chitin deacetylase is responsible for chitin
3580 organization of the locust Locusta migratoria cuticle (Yu et al., 2016). Therefore,
3581 despite few genes being induced by lufenuron exposure, PAGmut, CDA, and UG6D are
3582 important candidates for future studies assessing the regulation of L. salmonis moulting
3583 and responses to BPUs.
3584 Chitin synthesis occurs in epithelial cells where newly synthesized chitin is
3585 translocated across the plasma membrane for deposition and organization (reviewed in
184 3586 (Merzendorfer, 2013, 2006). In the present study, metabolomics analysis of lufenuron-
3587 treated lice showed downregulation of several membrane constituents, namely
3588 phosphatidic acids (Table 3). Numeorus genes related to membrane structure and
3589 transport were also downregulated by lufenuron, enriching GO categories such as
3590 transmembrane transport (16 transcripts), apical plasma membrane (7 transcripts), and
3591 vesicle (37 transcripts; Table 2). These expression changes corresponded to
3592 physiological difference between lufenuron-treated lice and controls which included
3593 vesicles aggregating below a secondary-type membrane that separated an electron-dense
3594 epithelium in treated lice only (Figs 8-9). Another BPU, diflubenzuron, was shown to
3595 inhibit GTP-dependent Ca2+ transport processes in intracellular vesicles of isolated
3596 cockroach Periplaneta americana integument cells (Nakagawa and Matsumura, 1994).
3597 As chitin is translocated across the membrane in vesicles, the molecular signals
3598 observed here might be involved in chitin transportation. Benzoylurea binding to the
3599 sulfonylurea transporter (SUR) was suggested as the mechanism causing vesicle
3600 inhibition (Abo-Elghar et al., 2004), although this remains ambiguous (Meyer and
3601 Moussian, 2013). Probes corresponding to the L. salmonis SUR (described by
3602 Carmona-Antoñanzas et al., 2015) were not differentially expressed by lufenuron
3603 despite passing QC filters for all groups (Additional File 1). Therefore, translocation of
3604 L. salmonis chitin from epithelial cells might be disrupted by lufenuron and other BPUs
3605 but, to date, the mechanism controlling this inhibition remains unresolved. Nonetheless,
3606 transporters described herein should be considered important candidates for studies on
3607 L. salmonis moulting and BPU exposure.
185 3608 Understanding development of the non-model L. salmonis has become an
3609 important area of research in the past decade, largely due to the potential for novel drug
3610 discovery. Analyses focused on the L. salmonis lifecycle (Hamre et al., 2013), moulting
3611 (Bron et al., 2000), instar growth and moult increment (Eichner et al., 2015b),
3612 intramoult transcriptome variation (Eichner et al., 2008), and characterization of
3613 numerous developmental genes such as retinoic acid receptor (LsRXR; Eichner et al.,
3614 2015a), ecdysone receptor (LsEcR; Sandlund et al., 2016), chitinases (LsChi1, LsChi2,
3615 etc.; Eichner et al., 2015c; Sandlund et al., 2016), yolk-associated protein (LsYAP;
3616 (Dalvin et al., 2009), heme peroxidase (Øvergård et al., 2017), and trypsin-like protease
3617 (Skern-Mauritzen et al., 2009) have allowed for a better understanding of development
3618 in L. salmonis and copepods in general. In the present study, only one gene with
3619 experimental evidence in L. salmonis development, LsRXR, was differentially expressed
3620 by lufenuron (upregulated at 1500 ppb). The 60mer probe on the microarray spans the
3621 1409-1468 region of LsRXR (GenBank: KJ361516.1;) common to all spliceforms of this
3622 gene (Eichner et al., 2015a), offering a generalized expression pattern for these
3623 transcripts. Interestingly, RNAi studies on LsRXR revealed that knockdown individuals
3624 upregulate numerous genes with chitin binding domains (Eichner et al., 2015a), similar
3625 to those described here. Chitin binding domains (CBD; pfam01607 and pfam00379) are
3626 found in numerous genes essential for the moulting process including chitinases, chitin
3627 deacetylases, peritrophic membrane proteins, cuticular proteins, and lectins and can be
3628 subdivided into two groups based on the presence or absence of a conserved cysteine
3629 motif. In this study, the expression of LsRXR was negatively correlated with transcripts
3630 containing a CBD (Fig 7), similar to observations in LsRXR knockdowns (Eichner et al.,
186 3631 2015a). The L. salmonis CBD transcripts did not show sequence similarity to D.
3632 melanogaster chitinases involved in chitin synthesis (KEGG: dme00520; see Fig 4),
3633 suggesting these transcripts may have other functions (reviewed by (Arakane and
3634 Muthukrishnan, 2010; Rebers and Willis, 2001). Although some L. salmonis chitinases
3635 have been characterized (Eichner et al., 2015c), a full classification of L. salmonis genes
3636 with CBDs like that of model insects (e.g. T. castaneum (Zhu et al., 2008)) and A.
3637 gambiae (Cornman et al., 2008)) are required to elucidate their exact functional
3638 relevance to BPU exposure and moulting. For example, mosquitoes (A. gambiae) have
3639 156 genes with a non-cys CBD, which display a variety of functions (Cornman et al.,
3640 2008). Experimental annotation and phylogenomic studies of these genes will provide
3641 higher resolution analyses of L. salmonis cuticle proteins lacking sufficient annotation
3642 for future studies.
3643 Among transcripts downregulated by lufenuron were seven transcripts
3644 containing at least one C-type lectin domain (CDD: cd00037), all of which showed
3645 patterns of co-expression with CBD genes (Fig 4; Additional File 4). Similar to CBDs,
3646 only the conserved domain of these genes could be used for annotation as no reviewed
3647 UniProt IDs matched these L. salmonis sequences. The presence of C-type lectin
3648 domains in transcripts downregulated by lufenuron suggests a variety of potential
3649 interactions including those with N-acetylglucosamine (Bauters et al., 2017; Sugawara
3650 et al., 2004), calcium carbonate (CaCO3) (Mann et al., 2000), and mannose (Takahashi
3651 et al., 2006), among others (CDD: cd00037). In D. melanogaster, genes with C-type
3652 lectin domains are important for proper wing and appendage formation (Ray et al.,
3653 2015), while studies in crustaceans show that some C-type lectins are important in the
187 3654 moult cycle and may have roles in exoskeleton hardening and biomineralization (Inoue
3655 et al., 2001; Kuballa et al., 2011; Kuballa and Elizur, 2008). Therefore, it will be
3656 important to determine any taxa-specific effects of lufenuron as molecular responses to
3657 BPUs are not well understood in crustaceans. Transcripts with limited or no annotation
3658 are likely to perform taxa-specific functions (Khalturin et al., 2009) and will be useful
3659 for better characterizing moulting. For example, CaCO3 is an important component of
3660 crustacean cuticle (Greenway, 1985), but not insect cuticles, and therefore BPUs may
3661 exert slightly different effects on L. salmonis physiology compared to observations in
3662 insects. Given their relevant annotation and experimental evidence to arthropod
3663 development, co-expression with L. salmonis CBD genes (Fig 7), and downregulation
3664 by exposure to lufenuron (Additional File 1), transcripts with C-type lectin domains
3665 reported here should be considered important for future assessments of L. salmonis
3666 moulting.
3667 6.4.3 Drug resistance in sea lice 3668 Drug resistant strains of sea lice are a major threat to the sustainability of Atlantic
3669 salmon aquaculture (reviewed by Aaen et al., 2015). Lufenuron will be an important
3670 resource for farmers and health professionals struggling to manage multiple-resistant
3671 populations of this parasite, offering long-term protection during an important growth
3672 phase for salmon. Although the present study sheds light on the physiological
3673 responses of lice to this chemical, knowledge gaps in the mechanisms controlling
3674 resistance for some of the other classes of delousing chemicals will make it difficult to
3675 assess potential issues with cross-resistance. For example, widespread resistance to
3676 EMB, the last drug to be licensed for sea lice control (Stone et al., 1999), has spread to
3677 all major salmon farming regions globally except British Columbia, Canada (Aaen et
188 3678 al., 2015; Saksida et al., 2013). Lice used in the experiments reported here come from
3679 populations characterized as resistant to EMB (Igboeli et al., 2013; Jones et al., 2013;
3680 Appendix 1). Benzoylureas are the only class of drugs approved for sea lice where
3681 resistance is not reported to be an issue (Aaen et al., 2015). Interestingly, when EMB-
3682 resistant strains of the armyworm Spodoptera exiga were re-selected in the lab over six
3683 generations with EMB, no cross-resistance with lufenuron was observed (Ishtiaq et al.,
3684 2014). However, resistance to BPUs has been observed in a few terrestrial pests and is
3685 often conferred either by a single nucleotide polymorphism (SNP) in the chitin synthase
3686 1 gene (Douris et al., 2016), or by overexpression of metabolic enzymes such as
3687 cytochrome P450s (Bogwitz et al., 2005; Gangishetti et al., 2009), glutathione-S-
3688 transferases, and carboxylases (Nascimento et al., 2015). Selection of metabolic
3689 detoxification can have important roles in cross-resistance with other compounds as has
3690 been shown for organophosphates and pyrethroids (Rodriguez et al., 2002). Lufenuron
3691 exposure did not induce a pronounced metabolic response in L. salmonis in this study
3692 (Additional File 1). In contrast, proteases and other metabolic enzymes are
3693 differentially expressed under exposure to neurotoxins such as cypermethrin (Chapter 5)
3694 and EMB (Carmichael et al., 2013c; Appendix 1). It is noteworthy that some enzymes
3695 putatively involved in chemical detoxification are not present on the L. salmonis
3696 microarray and thus remain to be analyzed regarding their response to lufenuron
3697 exposure; namely cytochrome p450 (Chapter 5). Future studies assessing the efficacy
3698 and molecular responses of multiple drug treatments against sea lice are needed to better
3699 understand the interactions between treatments and selection for resistance.
189 3700 6.4.4 BPUs for controlling sea lice 3701 Diflubenzuron (Lepsidon) and teflubenzuron (Calicide) have been used for over two
3702 decades in some countries to control sea lice, yet no mechanistic data and sparse clinical
3703 efficacy data are available in the literature (Branson et al., 2000; Ritchie et al., 2002).
3704 This is the first report on the efficacy, molecular responses, and ultrastructural
3705 impacts of lufenuron in a crustacean and represents the most comprehensive
3706 examination of BPU impacts on an aquatic arthropod. The first infectious stage
3707 (copepodids) was used for transcriptomics and metabolomics analyses with pools of 500
3708 lice in each sample. This stage was chosen based on it likely being the first stage to
3709 encounter the drug under field conditions. The high level of efficacy of lufenuron within
3710 a single moult in both free-living larvae and parasitic stages of lice assayed here further
3711 suggests rapid removal of any stage attaching to the host salmon.
3712 Lice from the same cohort were used in both the transcriptomic analysis (B3)
3713 and the efficacy experiment (B2). We observed 93% fewer chalimus II-staged lice on
3714 salmon in the lufenuron-treated group 12 dpi, a comparable reduction to lice infesting
3715 lufenuron-fed Atlantic salmon (96% reduction). Responses to some BPUs are known to
3716 be dependent on temperature (Ritchie et al., 2002), concentration administered
3717 (Gangishetti et al., 2009), and timing of parasite development (Merzendorfer et al.,
3718 2012). Lufenuron will be administered in-feed to salmon at 35 mg/kg over a target 7
3719 day period and therefore uptake of the drug by L. salmonis will largely occur through
3720 digestion of mucus, skin, and blood of the host, with some contact exposure through the
3721 mucus. Concentration thresholds for gene expression responses and timing of parasite
3722 collection, ideally to be completed at different time points throughout the entire
3723 moulting process, will require further attention. Moreover, as the action of BPUs is
190 3724 specific to those cells expressing chitin synthase 1 (i.e. largely epithelial tissue), the
3725 degree of change between certain genes described herein may be diluted if the genes are
3726 also expressed in unrelated tissues.
3727 6.4.5 Conclusions 3728 In this study, the efficacy of lufenuron treatments (~90%) was similar for L. salmonis
3729 pre-soaked in the drug for 3 h compared to those lice infesting a treated salmon host. In
3730 all cases, lufenuron was effective against eggs, larvae, and parasitic stages of L.
3731 salmonis, suggesting a broad, rapid impact of this drug on sea lice.
3732 Transcriptomics and metabolomics suggest lufenuron impacts numerous cuticle
3733 and developmental proteins as well as solute transport. However, hormonal signaling
3734 related to moulting and genes in the chitin synthesis pathway were largely unaffected by
3735 this drug. These molecular signals were linked to abnormal formation of the newly
3736 synthesized cuticle and inadequate metabolism of the old cuticle, potentially because of
3737 downregulation of novel chitin-binding and C-type lectin genes. Future studies
3738 assessing the impacts of lufenuron in lice attached to the host will be important in
3739 further characterizing the mechanisms of action of this drug throughout the entire
3740 process of parasite moulting.
3741 Availability of Data and Materials 3742 The datasets supporting the results of this article are available in the NCBI Gene 3743 Expression Omnibus (GEO) repository, GSE99880.
3744 Competing Interests 3745 Elanco Canada Ltd. is seeking to license lufenuron as an aquaculture treatment against 3746 sea lice infection and some of the authors are scientific officers within Elanco.
191 3747 Supplemental Information (Additional Files) 3748 Additional File 1 – Differentially expressed transcripts by lufenuron exposure, QC 3749 filter, and seawater vs acetone controls 3750 Additional File 2 – Gene Ontology analysis of differentially expressed transcripts 3751 Additional File 3 – RT-qPCR primers and microarray validation 3752 Additional File 4 – Pearson’s correlation values (r) for chitin-related transcripts 3753 Additional File 5 – Chitin synthesis pathway: BLASTx D. melanogaster against L. 3754 salmonis TSA database (NCBI) 3755 Additional File 6 – PCA based on 997 metabolites of L. salmonis
3756 Acknowledgements 3757 This work was funded by Elanco Fish Health Research Chair; NSERC Discovery 3758 (610108); ACOA-AIF TREAT2 (199308); Innovation PEI – Development and 3759 Commercialization grant DCFG (210205-70). JDP was supported by an NSERC PGS3. 3760 The authors would like to thank the staff at Huntsman Marine Science Centre (Chris 3761 Bridger), and Cooke Aquaculture (Leighanne Hawkins, Keng Pee Ang) for aiding in 3762 site access, lice collection and culture. Also, thanks to the aquatics staff at the Atlantic 3763 Veterinary College for help with fish husbandry and lice infections.
192 3764 Chapter 7: Discussion
3765 Sea lice are an important group of parasitic copepods (Family: Caligidae) affecting wild
3766 and cultured finfish in brackish and marine water (Johnson et al., 2004). The salmon
3767 louse (Lepeophtheirus salmonis) is the most well described species from this group,
3768 featuring studies on behavior, reproduction, host interactions, evolution, ontogeny,
3769 epidemiology, and more (Aaen et al., 2015; Pike and Wadsworth, 1999). The use of
3770 molecular resources for studying L. salmonis has rapidly expanded over the last decade,
3771 leading to the discovery of important markers that will improve parasite management,
3772 support novel treatment discovery, and broaden the capacity of future studies to detect
3773 physiological anomalies. Despite these advances, it is clear that challenges related to
3774 gene annotation for sea lice and some other non-model organisms are vast, driven
3775 mainly by large evolutionary distances to model species (e.g. Drosophila melanogaster,
3776 Caenohabditis elegans, Danio rerio; (Dahm and Geisler, 2006; Joyce and Palsson,
3777 2006). For example, only 14 crustacean genomes have been sequenced to date
3778 compared with 259 insect genomes and 89 roundworm genomes (NCBI, accessed
3779 October 15th, 2017). Additionally, numerous insects and roundworms have been used to
3780 study development, disease, toxicology, genetics, and more, providing relevent
3781 phenotypes to better test gene function. Therefore, studies using systems biology
3782 approaches to experimentally annotate L. salmonis genes are needed to better
3783 understand the relationships between molecular biology, evolution and physiology of
3784 this important parasite.
193 3785 7.1 Clustering analyses lead to putative gene annotations on a large scale 3786 Transcriptomics has emerged as an important method for studying physiology,
3787 especially in non-model organisms where sequences with little or no annotation can still
3788 be probed for experimental characterization. In particular, clustering analyses based on
3789 transcriptome similarity or gene co-expression (Eisen et al., 1999; Stuart et al., 2003)
3790 have been useful in determining the function and regulation of L. salmonis transcripts
3791 under certain environmental conditions. Principal Components Analysis, an
3792 unsupervised method for clustering samples (Sturn et al., 2002), was paired with
3793 analyses of variance throughout this dissertation to determine the relative impacts of
3794 numerous dependent variables on L. salmonis gene expression. Baseline variables such
3795 as sex and population were consistently more influential on lice transcriptomes than
3796 stress (Appendix 1; Chapter 3), showing comparable differences to those observed
3797 between life stages (see https://licebase.org/) where thousands of genes are differentially
3798 expressed. These baseline gene expression differences correspond with well-
3799 documented phenotypes related to behavior, morphology, and physiology and are
3800 therefore key to fully characterizing L. salmonis transcriptome responses to
3801 environmental changes.
3802 Clustering analyses based on expression similarity were also important for novel
3803 gene discovery and annotation in this work as co-regulated genes are often involved in
3804 similar cellular processes (Stuart et al., 2003). In Chapter 2, L. salmonis genes with
3805 expression profiles correlating (Pearson’s r > 0.95) to a male-specific protease inhibitor
3806 (contig: C259R052; a Kunitz serine protease inhibitor) revealed a putative set of
3807 seminal fluid protein (SFP) genes with conserved annotations to other arthropod and
3808 vertebrate SFPs. A large proportion of these genes (65%) had no similarity to sequences
194 3809 in databases, which was expected based on the high rates of positive selection known to
3810 act on reproductive genes (Swanson and Vacquier, 2002). These genes offer novel
3811 targets for pest control and should be considered in future studies assessing reproduction
3812 in L. salmonis and other sea lice species.
3813 Using similar methods, a group of novel genes with chitin binding domains
3814 (CBDs; CDD: pfam01607 and pfam00379) were negatively correlated with a conserved
3815 nuclear receptor, LsRXR (Chapter 6) which is involved in development (Eichner et al.,
3816 2015a). This finding aligned with differential expression caused by RNAi-mediated
3817 knockdown of LsRXR where the same CBD genes described in Chapter 6 were
3818 upregulated (Eichner et al., 2015a), again showing a negative correlation. Still, other
3819 clustering-based analyses such as hierarchical clustering (Chapters 2, 5, and 6) and k-
3820 means clustering (Chapters 4) were useful in providing general annotations to L.
3821 salmonis genes, especially those involved in stress. In particular, k-means clustering
3822 helped identify key gene modules affected by abiotic and biotic stressors alone and in
3823 combination (Chapter 4). This was among the first studies to simultaneously identify L.
3824 salmonis genes with generalized stress responses, genes with stress-specific responses,
3825 and genes with non-additive responses to multiple stressors. Therefore, clustering
3826 methods have been, and will continue to be, essential for L. salmonis gene annotation
3827 and generating future hypotheses around the molecular mechanisms responsible for
3828 stress tolerance and reproduction.
3829 7.2 Consensus-based gene annotation for determining molecular markers 3830 In many occasions described here, a consensus-based analysis led to the discovery of
3831 both individual gene markers and modules of genes that previously had no functional
195 3832 context in sea lice. The detection of sex-biased gene expression in L. salmonis (Chapter
3833 2) was an important step in understanding the relationship between sexual selection and
3834 sexual dimorphism (Ellegren and Parsch, 2007) and also aided in establishing markers
3835 related to reproduction (mentioned above). Sex-biased L. salmonis genes were
3836 determined using a consensus based, meta-analysis approach which stipulated that only
3837 those genes that were concordantly differentially expressed between males and females
3838 across three populations, including both the Atlantic and Pacific subspecies, would be
3839 considered as sex-biased. This provided robust annotation to hundreds of genes related
3840 to both previously described sex differences in ontogeny and feeding (Brandal et al.,
3841 1976; Eichner et al., 2015b; Johnson, 1993) and novel sexual dimorphisms in energy
3842 generation and the sensory system. Consensus on expression patterns were also
3843 provided for important genes such as prohibitin-2, a gene involved in sex determination,
3844 which verified observations of female-biased expression from previous studies on
3845 Scottish lice populations (Carmichael et al., 2013a). Similarly, the aquaporin gene
3846 LsGlp1_v1 was male-specific in both Norwegian and Canadian populations of L.
3847 salmonis (Stavang et al., 2015); Chapter 2) and in another sea louse, Caligus
3848 rogercresseyi, suggesting a male-specific function for this gene in sea lice. Concurrence
3849 across datasets on gene annotation provides the rigor required to invest in follow up
3850 studies examining the effects of these genes on important sex-specific functions.
3851 Consensus-based gene annotation was also employed across studies,
3852 particularly those using the L. salmonis 38K oligonucleotide microarray (Yasuike et al.,
3853 2012), which allowed for contig-specific comparisons between analyses (Chapters 4 and
3854 5). For example, Hsp27, RhBG, and mmp2 were concordantly differentially expressed in
196 3855 response to Cyper, EMB, hyposalinity (discussed in Chapter 5), and starvation (Braden
3856 et al., 2017), representing important markers for a general stress response. Other stress-
3857 associated genes such as the classic stress marker Hsp70 were overexpressed by
3858 hyposalinity (Sutherland et al., 2012), F. margiolisi infection, and EMB (Chapter 4).
3859 These markers have been identified in several other copepods as being key to the stress
3860 response (Lauritano et al., 2012) and therefore these genes may serve to fill an
3861 important gap in sea lice research where molecular markers could be used for the
3862 detection of cell stress when phenotypic manifestations are not distinguishable.
3863 The power of consensus-based analyses was best showcased through the
3864 discovery of L. salmonis secretory and excretory product (SEP) genes. Through cross-
3865 experiment comparisons, these genes now form the most well annotated gene module
3866 for this non-model parasite (Braden et al., manuscript in prep). In the early 2000s, a
3867 series of studies displayed the importance of louse SEPs in the host-parasite interaction
3868 with several trypsins being of notable significance (Fast et al., 2003, 2007; Firth et al.,
3869 2000). These studies largely focused on the impacts of parasite SEPs on the host and, to
3870 date, a complete gene profile encoding these products was never determined or
3871 characterized. The annotation of approximately 50 transcripts, including 16 with
3872 trypsin-like serine protease domains (CDD: cd00190 or smart00020; e > 10-10) is
3873 described in Chapter 4 using both in silico and experimental annotations. Aside from
3874 trypsins, other serine endopeptidases, cysteine endopeptidases, carboxypeptidases,
3875 solute transporters, and immune factors were grouped by k-means clustering in Chapter
3876 4 as being downregulated by the combination of EMB treatment and F. margolisi
3877 infection. This gene module has also been described across numerous other L. salmonis
197 3878 studies showing highest expression in the gut compared with other tissues (Edvardsen et
3879 al., 2014) and in feeding lice compared to those that are starved (Braden et al., 2017).
3880 They show constituitive overexpression in EMB-resistant lice (Appendix 1) and are
3881 suppressed by EMB exposure in EMB-sensitive lice only (i.e. no response in EMB-
3882 resistant individuals; Appendix 1; Chapter 4). Additionally, hyposaline conditions lead
3883 to the overexpression of these genes (Sutherland et al., 2012) while the exposure of
3884 copepodids to cypemethrin does not impact their expression (Chapter 5). Lastly, males
3885 and females show equal expression of these genes (Chapter 2). Altogether, these genes
3886 have similar annotations to tick SEPs involved in feeding, host evasion, and digestion
3887 (Gulia-Nuss et al., 2016), yielding important insights on L. salmonis parasitism and
3888 providing promising candidates for future studies and novel intervention breakthroughs.
3889 7.3 Drug Resistance in L. salmonis 3890 Drug resistance is among the most pressing issues threatening the sustainability of
3891 salmon aquaculture and is generally poorly described (reviewed by (Aaen et al., 2015).
3892 Molecular markers are important for monitoring and managing pest resistance on land
3893 (Coles et al., 2006; Djimde et al., 2001; Prichard et al., 2007) and have shown promise
3894 for filling similar roles in aquaculture (Kaur et al., 2016; McEwan et al., 2016).
3895 However, many of the mechanisms controlling resistance in sea lice have yet to be
3896 elucidated, including potential interactions between chemcials, for example in the form
3897 of cross-resistance. Known mechanisms of resistance in land-based pests have been
3898 useful in determining some of the mechanisms of resistance selected for in lice, such as
3899 that for azamethiphos (Kaur et al., 2015b). Similarly, evidence for the involvement of
3900 monoxygenase-mediated drug detoxification (Sevatdal et al., 2005) was supported by
198 3901 this work as three candidate CYP450s were overexpressed by cypermethrin exposure in
3902 copepodids (Chapter 5). However, other mechanisms of resistance appear to be specific
3903 to salmon lice such as SNPs in L. salmonis mitochondrial genes conferring maternally
3904 inherited deltamethrin resistance in lab-bred strains (Carmona- Antoñanzas et al., 2016).
3905 Nonetheless, field validation of SNPs controlling resistance has only been successful for
3906 one delousing compound and, therefore, important next steps for improving
3907 management will include the discovery and validation of such markers.
3908 Gene markers for successfully detecting EMB-resistant populations in the field
3909 have not yet been determined. Studies using comparative gene expression analyses of
3910 populations differing in EMB sensitivity and their response to varying concentrations of
3911 EMB have suggested a polygenic mechanism for EMB resistance composed of
3912 constituitive expression differences rather than induced mechanisms (Carmichael et al.,
3913 2013b; Igboeli et al., 2012); Appendix 1; Chapter 3). A linkage group related to EMB-
3914 resistance was also discovered using a 6000 SNP array, and included some genes that
3915 have differential expression under EMB exposure, such as Hsp27 (Besnier et al., 2014;
3916 Chapter 4; Appendix 1). However, the quantitative contributions of these markers to
3917 EMB resistance remain unknown and, to date, no single gene has consistently shown
3918 involvement. Determining markers for resistance in helminthes to analogous
3919 compounds (e.g. IVM) has also been challenging due to the polygenic nature of
3920 resistance and the high genetic diversity across populations (Prichard and Roulet, 2007).
3921 A combination of transcriptomic approaches has so far been insufficient in determining
3922 markers of EMB-resistance in L. salmonis and, therefore, novel approaches such as
3923 epigenitcs, proteomics, and metabolomics, will be useful in this search.
199 3924 7.4 Future directions 3925 The use of systems biology in sea lice research continues to uncover important
3926 mechanisms controlling physiologically relevant phenomena. These discoveries will be
3927 important for parasite control, novel treatment breakthroughs, and improved resolution
3928 in future L. salmonis studies. The transcriptome is, however, a dynamic system and
3929 cannot be fully explained by a single snapshot in time. Future studies will benefit from
3930 using time-to-response assays (Carmona-Antonanzas et al., 2016) and multiple sample
3931 collections across time to determine the sequence of gene expression responses, and
3932 how they transition during a plastic response (Aubin-Horth and Renn, 2009). Common
3933 garden experiments will also aid in differentiating plastic and evolved responses
3934 between different populations of lice (DeBiasse and Kelly, 2015) as was done for
3935 different families of L. salmonis for infection success and EMB tolerance (Ljungfeldt et
3936 al., 2014). Other advancements in study design, including analyses on isolated tissues
3937 (Edvardsen et al., 2014), will be useful in accurately quantifying gene responses which
3938 are likely to occur locally (discussed in Chapters 4 and 6).
3939 Experimental gene annotation was an important aspect of this work and yielded
3940 novel information and characterization on thousands of L. salmonis genes. However,
3941 new sets of challenges are evident, including cross-platform comparisons of sequence
3942 data derived by different methods (e.g. different EST generation for microarray
3943 assemblies). Although a database with L. salmonis sequence information exists, a
3944 linkage map is not available, and lice-specific gene names are rarely used and remain
3945 inconsistent in the literarture. Future work would benefit from an agreed upon naming
3946 scheme for L. salmonis genes, including those with no annotation (i.e. orphans) so that
3947 data produced from systems biology methods can be easily compared across studies.
200 3948 Other approaches such as epigenetics, metabolomics, and proteomics will help to
3949 further characterize plastic and evolved responses in L. salmonis, including those
3950 markers currently described by transcriptomics. Additionally, novel forms of gene
3951 annotation (e.g. ecological annotations) will be useful in determining gene function for
3952 this non-model parasite (Landry and Aubin-Horth, 2007). Overall, L. salmonis is the
3953 most well-described parastic copepod and, with molecular resources expanding rapidly,
3954 will become an important model species for the study of sea lice biology.
201 3955 Appendix 1: Transcriptomic responses to 3956 emamectin benzoate in Pacific and Atlantic Canada 3957 salmon lice Lepeophtheirus salmonis with differing 3958 levels of drug resistance
3959 Ben J. G. Sutherland1,4, Jordan D. Poley2, Okechukwu O. Igboeli2, Johanna R. 3960 Jantzen1, Mark D. Fast2, Ben F. Koop1, Simon R. M. Jones3 (2015) Evolutionary 3961 Applications 8:133-148
3962 1Centre for Biomedical Research, Department of Biology, University of Victoria, 3963 Victoria, British Columbia, Canada V8W 3N5
3964 2Hoplite Lab, Department of Pathology and Microbiology, Atlantic Veterinary College, 3965 University of Prince Edward Island, Charlottetown, PEI, Canada C1A 4P3
3966 3Pacific Biological Station, 3190 Hammond Bay Road, Nanaimo, British Columbia, 3967 Canada V9T 6N7
3968 4Institut de Biologie Intégrative et des Systèmes (IBIS), Département de biologie, 3969 Université Laval, Québec, Québec, Canada G1V 0A6
3970 BJGS contributed to experimental design, performed microarray work, sample 3971 preparation, statistical analyses, and wrote the manuscript. 3972 JDP and JRJ performed qPCR work. 3973 OOI collected and cultured lice, performed bioassays and extracted RNA. 3974 MDF designed experiments, and contributed to analysis and manuscript preparation. 3975 BFK conceived of the study, designed experiments, and contributed to analysis and 3976 manuscript preparation. 3977 SRMJ conceived of the study, designed experiments and contributed to analysis and 3978 manuscript preparation.
3979 Copyright 2015. The authors
202 3980 Abstract 3981 Salmon lice Lepeophtheirus salmonis are an ecologically and economically important
3982 parasite of wild and farmed salmon. In Scotland, Norway and Eastern Canada, L.
3983 salmonis have developed resistance to emamectin benzoate, one of the few parasiticides
3984 available for salmon lice. Drug resistance mechanisms can be complex, potentially
3985 differing among populations and involving multiple genes with additive effects (i.e.
3986 polygenic resistance). Indicators of resistance development may enable early detection
3987 and countermeasures to avoid the spread of resistance. Here we collect sensitive Pacific
3988 L. salmonis and sensitive and resistant Atlantic L. salmonis from salmon farms,
3989 propagate in lab (F1), expose to emamectin benzoate in bioassays, and evaluate either
3990 baseline (Atlantic only) or induced transcriptomic differences between populations. In
3991 all populations induced responses were minor and a cellular stress response was not
3992 identified. Pacific lice did not up-regulate any genes in response to emamectin benzoate,
3993 but down-regulated degradative enzymes and transport proteins at 50 ppb emamectin
3994 benzoate. Baseline differences between sensitive and now resistant Atlantic lice were
3995 much greater than responses to exposures. All resistant lice overexpressed degradative
3996 enzymes, and resistant males, the most resistant group, overexpressed collagenases to
3997 the greatest extent. These results indicate an accumulation of baseline expression
3998 differences related to resistance.
3999 A.1 Introduction 4000 Development of parasiticide resistance in endo- and ectoparasites of importance to
4001 veterinary or human health is a major issue globally. Chemical control is ubiquitous
4002 across many parasite taxa, with administration ease and initial efficacy leading to over-
4003 reliance, and in some cases resistance (Sangster, 2001). For example, trichostrongylid
203 4004 nematode parasites of sheep are commonly resistant to the major classes of
4005 anthelmintics which can limit sheep production (Gilleard et al., 2005). Although
4006 currently much less severe than that which occurs in nematodes of sheep, resistance to
4007 anthelmintics in nematodes of horses and cattle suggests a similar future concern
4008 (Kaplan and Vidyashankar, 2012). Control of the cattle tick Rhipicephalus microplus is
4009 limited by the development of resistance to the acaricides used to treat this and other
4010 tick species (Abbas et al., 2014). Alongside agriculturally important parasites,
4011 mosquitoes vectors of malaria are becoming resistant to chemical treatments throughout
4012 Africa (Ranson et al., 2011), and the head louse Pediculus humanus capitis is also
4013 becoming resistant to commonly used parasiticides in North America, leading to
4014 increased infestations (Yoon et al., 2014). New drugs are slow and expensive to develop
4015 (Kaplan and Vidyashankar, 2012) and thus the preservation of efficacy of existing
4016 treatments is critical (Kaplan, 2004; Sangster, 2001) through various management and
4017 husbandry strategies and reduction of reliance on chemical control (Kaplan, 2004;
4018 Kaplan and Vidyashankar, 2012).
4019 A major challenge to salmon aquaculture is the recent development of resistance
4020 of salmon lice to several important chemical control methods. Salmon lice are
4021 ectoparasitic copepods that feed on skin, mucus, and blood of wild and farmed salmon
4022 causing host damage and potentially facilitating secondary infections (Fast, 2014).
4023 Parasiticide treatments are used to remove lice from farmed salmon. As a result, the
4024 aquaculture industry is largely reliant on chemical control (Igboeli et al., 2014; Johnson
4025 et al., 2004) with limited diversity of mechanisms of action, increasing the potential for
4026 resistance development (Denholm et al., 2002). A commonly used in-feed treatment is
204 4027 emamectin benzoate (EMB; trade name SLICE™, Merck), a macrocyclic lactone
4028 avermectin derivative that is thought to bind parasite glutamate-gated chloride channels
4029 causing hyperpolarization in neuromuscular cells, paralysis, and death (Arena et al.,
4030 1995; Glendinning et al., 2011; Stone et al., 1999). Medicated feed is given over a seven
4031 day period and EMB accumulates in flesh and mucus (at 70-100 ppb when administered
4032 at 50 µg kg-1) (Sevatdal et al., 2005a). Resistance to EMB has emerged in L. salmonis in
4033 Norway (Espedal et al., 2013), Scotland and Atlantic Canada (Carmichael et al., 2013c;
4034 Jones et al., 2013; Jones et al., 2012; Lees et al., 2008) as well as in Caligus
4035 rogercresseyi in Chile (Bravo et al., 2008), whereas lice in Western Canada remain
4036 sensitive (Saksida et al., 2013). This is an important issue for the health and welfare of
4037 wild and domestic salmon.
4038 Pesticide resistance can occur by direct disruption of target site binding,
4039 metabolism and detoxification of the active product, increased compound efflux, or
4040 reduced uptake through the cuticle or digestive lining (i.e. penetration resistance)
4041 (Bonizzoni et al., 2012; Clark et al., 1995; Igboeli et al., 2012). Metabolic resistance is
4042 typically polygenic, with many small and additive effects, whereas target site disruption
4043 can be monogenic, with a large effect (i.e. knockdown resistance) (Ffrench-Constant et
4044 al., 2004). Resistance mechanisms can also occur together. For example,
4045 complementary mechanisms may explain geographic variation in
4046 dichlorodiphenyltrichloroethane (DDT) resistance in knockdown resistant (kdr)
4047 mosquitoes (Brooke, 2008; Donnelly et al., 2009). Importantly, selective pressures
4048 leading to monogenic or polygenic resistance typically differ. Polygenic resistance is
4049 favoured when drug exposures occur within a range of tolerance for a portion of the
205 4050 population, whereas monogenic resistance is favoured when exposure occurs outside the
4051 range of tolerance (see (Ffrench-Constant et al., 2004). Genomics and transcriptomics
4052 enable exploration of complementary resistance mechanisms, such as metabolism or
4053 sequestration (David et al., 2005; Ffrench-Constant et al., 2004), and can also be useful
4054 in monitoring and managing resistance (Pedra et al., 2004; Vontas et al., 2005; Zhao et
4055 al., 2006).
4056 In Atlantic and Pacific L. salmonis subspecies (Skern-Mauritzen et al., 2014;
4057 Yazawa et al., 2008) the dynamics, mechanisms, or potential of EMB resistance are
4058 active areas of study. Resistant L. salmonis populations were collected from salmon
4059 farms in Norway and propagated for four generations, or crossed with a sensitive
4060 laboratory strain (Espedal et al., 2013). Pure strains remained resistant through the
4061 generations, hybrids were of intermediate sensitivity between resistant and sensitive
4062 strains, and no reproductive or survival costs were associated with resistance. Also
4063 indicating a lack of costs, Atlantic Canada L. salmonis remained highly resistant over
4064 three generations without continued selection (Igboeli et al., 2013). Intermediate hybrid
4065 sensitivity suggests polygenic resistance (Espedal et al., 2013) as identified in other
4066 species to ivermectin (for review see Clark et al., 1995). In some cases, resistance may
4067 be due to increased efflux of EMB by P-glycoprotein (pgp), for example through up-
4068 regulation of pgp transcription in response to EMB presence (Heumann et al., 2012) or
4069 increased baseline levels of pgp mRNA (Igboeli et al., 2012). Male-specific pgp up-
4070 regulation in response to EMB has also been identified, with resistant lice increasing
4071 expression to a greater extent than sensitive (Igboeli et al., 2013). Baseline and induced
4072 (at 200 ppb EMB) transcriptome differences were recently explored in male L. salmonis
206 4073 from Scottish populations with differing EMB sensitivity; the largest effect identified
4074 was between populations regardless of EMB presence and the authors highlighted
4075 reduced expression of a GABA-gated chloride channel and a neuronal acetylcholine
4076 receptor in the resistant population in response to EMB, among others (Carmichael et
4077 al., 2013b). Whether EMB resistance in L. salmonis involves multiple factors and the
4078 specifics of these factors are yet to be determined.
4079 Here, we apply a 38K oligonucleotide microarray (Sutherland et al., 2012;
4080 Yasuike et al., 2012) and reverse transcription quantitative PCR (RT-qPCR) to profile
4081 gene expression responses of sensitive Pacific lice to EMB (0, 10, 25, 50 ppb), and to
4082 compare baseline and induced (0, 0.1, 25, 300, 1000 ppb) expression differences
4083 between sensitive and resistant Atlantic lice (Igboeli et al., 2013). Sex-specific
4084 differences in EMB resistance have been identified (Igboeli et al., 2013; Jones et al.,
4085 2013; Westcott et al., 2008) and accordingly we profile transcriptomic responses in both
4086 male and female pre-adult Atlantic L. salmonis. Our study provides the first baseline
4087 dataset for EMB transcriptome responses of the Pacific subspecies of L. salmonis and
4088 provides new insight on resistance mechanisms in the Atlantic subspecies.
4089 A.2 Materials and Methods
4090 A.2.1 Pacific salmon lice collection, EMB exposure and RNA extraction 4091 Pacific L. salmonis were obtained from Atlantic salmon Salmo salar farms near
4092 Campbell River, BC, in March 2009. From these individuals, nauplius larvae were
4093 hatched, grown to copepodids, which were allowed to attach to laboratory-reared
4094 Atlantic salmon as previously described (Sutherland et al., 2014). After 40 days, salmon
4095 were sedated with metomidate hydrochloride (Aquacalm, Syndel) and pre-adult lice
4096 were collected (777 individuals). Stock emamectin benzoate (PESTANAL®, Sigma-
207 4097 Aldrich) was prepared to 100 mg/L in methanol, then diluted to working concentrations
4098 in seawater. After removal from fish, lice were held briefly in 10oC seawater for less
4099 than 1 h. Approximately 25 pre-adult stage I and II male and female individuals were
4100 haphazardly distributed into each of 24 beakers containing 500 ml filtered and aerated
4101 seawater (10oC; 30 parts per thousand (ppt) salinity). Groups of six beakers were
4102 assigned to four EMB concentrations (0, 10, 25 or 50 ppb; Table 1) and temperature
4103 was maintained at 10oC by incubation in a water bath. After 24 h lice from each beaker
4104 were collected on a mesh filter and flash frozen (n = 24 pools). Total RNA was
4105 extracted from frozen tissue using TRIzol® (Life Technologies) followed by RNeasy
4106 column purification (Qiagen), as per manufacturers’ instructions. Purified total RNA
4107 was tested by agarose gel electrophoresis for quality and by spectrophotometry
4108 (NanoDrop-1000) for purity and quantity. Use of research animals complied with
4109 Fisheries and Oceans Canada Pacific Region Animal Care Committee protocol number
4110 09-001.
208 4111 Table 1: Experimental design for RNA profiling Sample sizeb for each EMB Subspecies Stage Sex [EMB concentration (ppb)] resistance [0] [10] [25] [50] pre- Pacific mixed sensitive 6 6a 6 6 adult
[0] [0.1] [25] [300] [1000] low 4 4 4 4 4 female pre- high 4 4 4 2 4 Atlantic adult low 4 4 3 4 4 male high 4 4 4 4 4 4112 aCondition used for RT-qPCR only 4113 bBiological replicates are individuals for Atlantic and pools of ~25 lice for Pacific lice.
4114 A.2.2 Atlantic salmon lice collection, EMB exposure, and RNA extraction 4115 Atlantic L. salmonis were collected in 2012 from Atlantic salmon farms in Back Bay
4116 (resistant) and near Grand Manan, New Brunswick (sensitive) (Jones et al., 2012). Live
4117 lice were moved to the Atlantic Veterinary College (University of Prince Edward
4118 Island) and grown on Atlantic salmon for approximately 80-90 days until the extrusion
4119 of the third set of egg strings. Larvae from these egg strings were grown to copepodids
4120 then allowed to rear to the pre-adult stage on Atlantic salmon (Covello et al., 2012;
4121 Jones et al., 2013). Subsequently, salmon were sedated with tricaine methanesulfonate
4122 (MS-222) and lice were collected in Petri dishes with seawater (10 oC, 33 ppt salinity).
4123 Petri dishes were swirled and only adherent lice were used in subsequent studies. EMB
4124 exposures were performed as per standardized bioassay protocols (Westcott et al.,
4125 2008). There have been no observable differences in gene expression, phenotype, or
4126 survival from the concentration of methanol (EMB solvent) in the EMB dilutions
4127 (Hoplite lab personal communication) and standardized bioassay protocols do not call
4128 for a solvent control (Westcott et al., 2008). Therefore here we did not include both a
4129 seawater and solvent control. Lice from each population were separated by sex, and four
209 4130 individuals were distributed to each of 40 flasks containing seawater (10 oC, 33 ppt
4131 salinity). The flasks were assigned in duplicate to 20 treatment groups: EMB
4132 concentration (0, 0.1, 25, 300, 1000 ppb), sex and population (resistant, sensitive; Table
4133 1). EMB concentrations were selected to include those used in Pacific lice exposures
4134 (e.g. 25 ppb) and those known to cause phenotypic effects in resistant Atlantic lice (e.g.
4135 1000 ppb; M. Fast, personal observation). After 24 h, lice from each beaker were flash
4136 frozen individually and kept at -80 oC until RNA extraction (Table 1). Total RNA was
4137 extracted as described above, with the exception of using TURBO DNase treatment
4138 (Life Technologies) prior to RNeasy column purification (Qiagen). Purified total RNA
4139 was tested by agarose gel and automated electrophoresis (Experion; Bio-Rad). Use of
4140 research animals for this study was approved by Canadian Animal Care Committee
4141 protocol #12-016.
4142 To confirm EMB sensitivity differences between the resistant and sensitive
4143 populations, 24-h bioassays were performed on a subset of the parental collection (F0)
4144 and on lice propagated in lab (F1). For F0 lice, these bioassays were performed in
4145 duplicate flasks with 10 lice per flask per condition (i.e. for each sex, population, and
4146 concentration combination), and for F1 lice with five and four lice per condition for
4147 resistant and sensitive populations, respectively (F1 EC50 bioassay sample sizes were
4148 constrained in order to reserve lice for RNA profiling bioassays). After 24 h, lice were
4149 evaluated as per standards (Westcott et al., 2008) and EC50 values were calculated in
4150 GraphPad (v6; Prism).
4151 A.2.3 cDNA preparation and microarray hybridization 4152 For each sample, 825ng of total RNA was amplified to Cy5-labeled cRNA using the
4153 Low-Input Quick Amp system (Agilent; v6.5). A Cy3-cRNA reference pool used to
210 4154 hybridize alongside samples (Churchill, 2002) was generated for the Pacific and
4155 Atlantic lice experiments, ensuring the inclusion of at least one individual from all
4156 experimental conditions. The sample and reference pool combination was hybridized to
4157 oligonucleotide microarrays designed using previously annotated ESTs from both
4158 Pacific and Atlantic L. salmonis (Yasuike et al., 2012; eArray design ID 024389;
4159 Agilent), scanned on a ScanArray Express (Perkin Elmer) and quantified on Imagene
4160 (v8.1; BioDiscovery) as previously reported (Sutherland et al., 2012). For each probe,
4161 the background median was subtracted from the foreground, samples were imported
4162 into GeneSpring GX11 (Agilent), any negative raw values were changed to 1.0, and
4163 each array was normalized by intensity-dependent Lowess normalization (Yang et al.,
4164 2002) (Agilent).
4165 A.2.4 Transcriptome analyses 4166 Pacific and Atlantic experiments were analyzed separately. For each experiment, quality
4167 control filters retained probes passing the following criteria in at least 65% of the
4168 samples in any one condition: no poor quality flags and raw signal ≥ 500 in both
4169 channels.
4170 Pacific lice exposures to 0, 25 and 50 ppb (n = 6 pools per condition; Table 1)
4171 were profiled by microarray (the 10 ppb condition was only included in subsequent RT-
4172 qPCR analysis). Differential expression was tested by one-way ANOVA without equal
4173 variance assumption (Benjamini-Hochberg multiple test corrected p ≤ 0.01), followed
4174 by post-hoc Tukey HSD (p ≤ 0.01) and fold change filter (FC ≥ 1.5) between
4175 conditions.
4176 Atlantic male and female pre-adult lice from sensitive and resistant populations
4177 exposed to 0, 0.1, 25, 300 and 1000 ppb were profiled by microarray (n = 20 conditions;
211 4178 Table 1). Differential expression was tested by three-way ANOVA (Benjamini-
4179 Hochberg multiple test corrected p ≤ 0.01) using population, sex, and EMB
4180 concentration as factors, and including interaction effects. Each condition contained
4181 four biological replicates except for two conditions that had insufficient high quality
4182 RNA (i.e. male sensitive 25 ppb (n = 3) and female resistant 300 ppb (n = 2); Table 1).
4183 Probes with a significant three-way interaction effect were removed from all other
4184 significant effect lists and clustered by k-means clustering based on similar expression
4185 (Euclidean distance metric; 4 clusters; Agilent). Fold changes were calculated based on
4186 marginal means for each comparison described below (i.e. controlling for other factors
4187 in the model due to unequal sample size in some conditions; Table 1). Probes with a
4188 significant sex by population interaction were removed from sex or population main
4189 effect lists, and fold change filtered (FC ≥ 1.5) between populations to identify genes
4190 specific to one sex (unchanging or discordant in other sex) or regulated to a larger
4191 extent in one sex than the other. Probes with a significant main effect of population
4192 were fold change filtered between resistant and sensitive populations (FC ≥ 1.5). Probes
4193 with a significant main effect of EMB concentration were fold change filtered against
4194 the 0 ppb control (FC ≥ 1.5).
4195 Gene Ontology and pathway enrichment was performed in DAVID
4196 Bioinformatics using a modified Fishers Exact Test (Huang et al., 2009) (p ≤ 0.05;
4197 number genes in category ≥ 4) and result redundancy was reduced using GO Trimming
4198 (80% soft trim threshold; (Jantzen et al., 2011). For this analysis, Entrez-IDs assigned to
4199 contigs used for probe design (Yasuike et al., 2012) were used. Background lists for
4200 enrichment comparisons (i.e. all probes passing quality control) were specific to each
212 4201 experiment (Pacific = 12,085 probes; Atlantic = 15,578). Principal component analysis
4202 was performed in GeneSpring using normalized expression values for all probes passing
4203 quality control filters in Atlantic lice.
4204 A.2.5 Reverse transcription quantitative polymerase chain reaction (RT-qPCR) 4205 Pacific L. salmonis samples described above (including the 10 ppb condition) were used
4206 for RT-qPCR analysis. Each SuperScript® III (Invitrogen) reverse transcription reaction
4207 included 2.5 µg total RNA and a 50:50 mix of random hexamers and oligo(dT)20
4208 primers (total per reaction 50 ng), as per manufacturer’s instructions. Resultant cDNA
4209 samples were diluted 20-fold. A standard curve for primer testing was generated from a
4210 seven-fold dilution of a sample from each condition and used in a five-fold, six point
4211 serial dilution. All primers were tested for efficiency between 80-110%, and for a single
4212 product by melt curve analysis and amplicon purification and sequencing as previously
4213 reported (Sutherland et al., 2011). qPCR amplification was performed using SsoFast
4214 EvaGreen with Low Rox (Bio-Rad) as per manufacturers’ instructions for the
4215 MX3000P thermocycler (Agilent) using the following thermal regime: 95 oC for 5 min
4216 (1 cycle); 95 oC for 20s then 55 oC for 30s (40 cycles); followed by a melt curve (55 oC
4217 to 95 oC reading fluorescence at 0.5 oC increments). Samples were run in duplicate and
4218 accepted when technical replicates were within 0.5 cycles. A no template control (NTC)
4219 and -RT control was run for each gene. Although some contaminating gDNA remained
4220 after column purifications, -RT controls for each gene were more than six cycles greater
4221 than the most dilute sample for that gene, and thus would have a minimal effect on
4222 quantification (Laurell et al., 2012). Genes of interest were normalized using structural
4223 ribosomal protein s20, a validated L. salmonis normalizer candidate (Frost and Nilsen,
4224 2003) in qBASEplus (Biogazelle) using primer-specific efficiencies.
213 4225 Pacific salmon lice can carry a microsporidian parasite Facilispora margolisii at
4226 approximately 50% prevalence (Jones et al., 2012b). Since the impact of the
4227 microsporidia on L. salmonis, or on the L. salmonis response to EMB has not yet been
4228 characterized, to ensure that there was no confounded variation due to differences in
4229 microsporidian infection among groups Pacific lice pools used here were tested for F.
4230 margolisii using diagnostic primers (Jones et al., 2012b). All pools tested positive.
4231 Additionally, a subset of samples from Atlantic L. salmonis was also tested, but no
4232 positives were detected, which is consistent with the observation that F. margolisii has
4233 not been found in Atlantic L. salmonis (S. Jones, personal observation).
4234 Atlantic lice used in the microarray experiment were also used for RT-qPCR
4235 analysis, with the exception of one sensitive female 1000 ppb sample that did not
4236 amplify (total n = 76). Total RNA was reverse transcribed using 400 ng input in
4237 iScript™ Reverse Transcription Supermix (Bio-Rad) with a mix of random hexamers
4238 and oligo(dT) primers, as per manufacturer’s instructions. Subsequently, cDNA samples
4239 were diluted 10-fold. Additionally, primer efficiency was performed as described above,
4240 except that the standard curve was prepared with an initial 2-fold dilution, and a single
4241 product was confirmed for the amplicons by melt curve analysis. qPCR amplification
4242 was performed using SsoAdvanced™ SYBR® Green Supermix (Bio-Rad) as per
4243 manufacturers’ instructions for the Mastercycler ep realplex thermal cycler (Eppendorf)
4244 using the following thermal regime: 95 oC for 10 min (1 cycle); 95 oC for 15s, primer
4245 specific annealing temperature (see Table S1) for 15s, then 72 oC for 15s (40 cycles);
4246 followed by a melt curve (55 oC to 95 oC reading fluorescence at 0.5 oC increments).
4247 Samples were run in duplicate (99.63% of technical replicates within 0.5 cycles). As
214 4248 above, NTC did not amplify, and -RT controls were more than 6 Ct above the lowest
4249 expressed samples. Candidate normalizer genes included structural ribosomal protein
4250 s20 (rps20), elongation factor 1-alpha (ef1a) and vinculin (vcl). The most stable as
4251 calculated by geNORM (Vandesompele et al., 2002) were rps20 and ef1a (geNORM M-
4252 value and coefficient of variation of 0.339 and 0.118, respectively), and therefore the
4253 geometric mean of these two genes were used to normalize genes of interest in
4254 qBASEplus (Biogazelle) using primer-specific efficiencies (Table S1).
4255 For both the Pacific and Atlantic samples, the log2 RT-qPCR normalized value
4256 and the log2 microarray value for each sample were correlated in R (Team, 2016) using
4257 linear models with microarray values as the independent variable and RT-qPCR values
4258 as the dependent variable to obtain an adjusted R-squared value and slope of the
4259 relationship for each gene. Pacific RT-qPCR (which included the 10 ppb condition) was
4260 tested for significance by one-way ANOVA and post-hoc Tukey HSD in R.
4261 A.3 Results
4262 A.3.1 Transcriptomic effects of emamectin benzoate (EMB) exposure in Pacific lice 4263 The transcriptional response of Pacific lice to EMB was minimal until 50 ppb (only
4264 three differentially expressed probes at 25 ppb). Although no probes were up-regulated
4265 at 50 ppb, 148 probes were down-regulated (relative to either 0 or 25 ppb; Table 2). All
4266 differentially expressed genes can be found in Table S2. The down-regulated genes at
4267 50 ppb (43 unique annotations) was enriched for proteolysis (11 genes; p = 6.7E-06)
4268 and included probes annotated as degradative enzymes including trypsin-1,
4269 carboxypeptidase B, chymotrypsin, collagenase, acidic mammalian chitinase,
4270 hypodermin-B and others (Table 3). Additional enriched functions included lipid
4271 metabolism (5 genes; p = 0.025), cation binding (10 genes; p = 0.04) among others (see
215 4272 Table S3); several other enzymes and transporters were down-regulated. The
4273 suppression at 50 ppb EMB was confirmed by RT-qPCR, and the lack of differential
4274 expression until 50 ppb was confirmed by assessing the additional dataset at 10 ppb by
4275 RT-qPCR (Fig. 1).
4276 Table 2: Differential expression in Atlantic and 4277 Pacific lice responding to EMB. 4278 Probes responding to EMB exposure in Atlantic and 4279 Pacific lice. Atlantic responses increased until 300 ppb, 4280 and Pacific lice response was minimal until 50 ppb 4281 EMB. Condition Probes ≥ Probes ≥ Subspecies vs. control 1.5-fold 2-fold 0.1 ppb 22 4 25 ppb 236 44 Atlantic 300 ppb 513 118 1000 ppb 474 86 25 ppb 3 3 Pacific 50 ppb 148 144
4282 4283 Figure 1: Pacific lice degradative enzyme and transporter suppression
216 4284 RT-qPCR confirmed the down-regulation at 50 ppb of degradative enzymes 4285 trypsin-1 (trp1) and carboxypeptidase-1 (cpb1), as well as transporters aquaporin-9 4286 (aqp-9) and high-affinity copper transport protein (slc). Conditions that do not share a 4287 letter above the boxplot are significantly different from each other (Tukey HSD p ≤ 4288 0.05). Boxplot displays median and interquartile range.
4289 Table 3: Pacific lice degradative enzyme suppression from EMB 4290 Descriptions, corrected p-value and linear fold change for genes present in Gene 4291 Ontology category proteolysis (bold font), or with known degradative function. FC FC Corr. Probe ID Probe description EMB 25 EMB 50 p-value vs. 0 vs. 0 C068R042 Acidic mammalian chitinase 0.0023 - -3.8 C036R034 Anionic trypsin-1 0.0035 - -7.3 C005R080 Anionic trypsin-2 0.0018 - -6.4 C102R046 Aspartic proteinase oryzasin-1 0.0025 - -5.8 C020R062 Carboxypeptidase B 0.0018 - -4.5 C009R120 Cathepsin D 0.0021 - -5.4 C099R025 Cathepsin K 0.0045 - -6.6 C022R035 Chymotrypsin BI 0.0021 - -4.6 C123R134 Collagenase 0.0018 - -3.8 C053R101 Gamma-glutamyl hydrolase 0.0018 - -6.5 C133R012 Neprilysin-2 0.0026 - -3.1 C100R117 Ovochymase-1 0.0018 - -9.7 C158R157 Placental protein 11 0.0032 - -5.0 C171R022 Probable cysteine proteinase 0.0035 - -4.0 At3g43960 C080R027 Putative serine protease K12H4.7 0.0021 - -3.9 C028R010 Transmembrane serine protease 8 0.0018 - -9.5 C042R088 Trypsin-1 0.0018 - -2.4 C171R148 Zinc carboxypeptidase A 1 0.0018 - -6.7
4292 A.3.2 EMB sensitivity differences between Atlantic lice populations 4293 Bioassays confirmed increased resistance in the Back Bay lice relative to those from
4294 Grand Manan (Table 4) and indicated the highest resistance in males. Furthermore,
4295 bioassays of the F1 generation propagated in the laboratory followed similar trends. All
4296 F1 lice were healthy-vigorous at 0, 0.1, and 25 ppb EMB. At 300 ppb four sensitive
4297 males were healthy-vigorous, three weak (swimming but not attaching to the beaker),
217 4298 and one immobile (no twitching), whereas nine resistant males were healthy-vigorous
4299 and one moribund (immobile and twitching). At 300 ppb one sensitive female was
4300 healthy-vigorous, four weak and three immobile, whereas six resistant females were
4301 healthy-vigorous, and four weak. At 1000 ppb, all lice in both populations were
4302 immobile.
4303 Table 4: Survival differences between Atlantic populations 4304 EC50 (ppb) for male and female lice from the two populations with 4305 differing EMB sensitivity. EC50 ppb (95% CI) Population Males Females Back Bay 840 (614, 1047) 254 (218, 296) (Resistant) Grand Manan 63 (11, 352) 75 (13, 432) (Sensitive) 4306
4307 A.3.3 Comparative influence of sex, population and EMB on Atlantic lice transcriptomes 4308 The most influential factor affecting gene expression was sex (Fig. 2; Table 5; PC1:
4309 40.9% of total variation). Population also had a large effect: males or females clustered
4310 by population in the PCA, and many genes differed between populations (Table 5). The
4311 only sex-population combination to show a large effect from EMB dose in the PCA was
4312 the resistant females (Fig. 2).
218 4313 Table 5. Overview of factors influencing Atlantic lice 4314 transcriptomes 4315 Numbers of significant probes shown for each 4316 effect (sex, population (Pop) and EMB 4317 concentration (EMB conc) and interaction prior 4318 to fold change filters. Probes with a three-way 4319 interaction are not included in two-way 4320 interaction or main effect lists, and probes with a 4321 significant two-way interaction are not included 4322 in the main effect lists involved in the interaction. Comparison Number of probes Sex * Pop * EMB conc 151 Sex * Pop 8242 Sex * EMB conc 26 Pop * EMB conc 19 Sex 4683 Pop 3699 EMB conc 1413
219 4323
Sensitive Sensitive males females
Resistant females
Resistant males
4324 4325 Figure 2: Principal component analysis of samples based on gene expression 4326 Male and female lice samples separated along the x-axis (PC1: 40.9% of variation), and 4327 populations separated by y- and z-axes (PC2: 28.3% and PC3: 20.7%, respectively). A 4328 separation of EMB doses is identifiable in the resistant females only. Colors display 4329 EMB concentration (red = 0; blue = 0.1; gray = 25; green = 300; brown = 1000), and 4330 shape displays the sex (triangle = male; square = female), population is labelled beside 4331 each cluster.
4332 The main objective of this study is to identify genes related to EMB resistance,
4333 and therefore the most relevant genes are those 1) differing in baseline expression
4334 between populations consistently in both sexes (main effect population); 2) differing in
4335 baseline expression between populations inconsistently in sexes (sex by population
4336 interaction); 3) responding to EMB exposure in both sexes and populations (main effect
220 4337 EMB); and 4) responding to EMB exposure specifically in one sex-population
4338 combination (three-way interaction of sex, population and EMB). Genes in these four
4339 categories will be presented in the next four sections.
4340 A.3.4 Genes differing in baseline expression between populations in both sexes (Atlantic) 4341 A large number of genes were differentially expressed between populations consistently
4342 in both sexes, regardless of EMB presence (main effect population; Table 5). Resistant
4343 lice overexpressed 446 probes relative to sensitive (141 of which were greater than 2.5-
4344 fold). The highest overexpressed genes in resistant lice were peroxidasin homolog (2
4345 probes; > 140-fold; Fig. 3A), collagenase, ovochymase-1, trypsin-1, phospholipid
4346 hydroperoxide glutathione peroxidase (mitochondrial), cathepsin D, and
4347 carboxypeptidase B (>5-fold; Table S2). Overexpressed genes in resistant lice were
4348 enriched for lipid metabolic process (16 genes; p = 1.1E-4), response to chemical
4349 stimulus (13 genes; p = 0.005), catalytic activity (58 genes; p = 0.003), and serine-type
4350 peptidase activity (7 genes; p = 0.002), among others (Table S3).
4351 Sensitive lice overexpressed 549 probes relative to resistant (134 of which were
4352 greater than 2.5-fold). The highest overexpressed probes did not have annotation (six
4353 probes > 100-fold), and the highest annotated probe was serine protease inhibitor
4354 dipetalogastin (10-fold). Overexpressed genes in sensitive lice were enriched for
4355 calcium ion binding (17 genes p = 2E-6), system development (21 genes; p < 0.001),
4356 cell differentiation (19 genes; p < 0.001), extracellular region (10 genes; p = 0.02),
4357 microtubule binding (5 genes; p < 0.005), and endopeptidase activity (9 genes; p < 0.02)
4358 among others (Table S3). The endopeptidase activity genes included papilin, stubble,
4359 calpain 11, proteasome subunit alpha type 4 and others; this category was composed of
221 4360 different genes than those in the serine-type peptidase activity category that was
4361 enriched in the resistant lice overexpression list.
4362
4363 4364 Figure 3: Expression of genes potentially related to resistance in Atlantic lice 4365 (A) The expression of peroxidasin homolog (pxdn) was highly overexpressed in the 4366 resistant population for both sexes, and (B) zinc metalloproteinase nas-14 (nas-14) was 4367 specifically overexpressed in resistant males. (C) In contrast to the strong differences 4368 between populations, the effect of EMB dose was minor, although several genes were 4369 differentially expressed, including kynurenine-3 monooxygenase (kmo). (D) As 4370 identified in previous candidate gene approaches, here p-glycoprotein (pgp) was 4371 overexpressed in the resistant population, and had highest expression in males. Data in 4372 (A-C) is from the microarray, and (D) RT-qPCR.
4373 A.3.4 Genes differing in baseline expression between populations in only one sex (Atlantic) 4374 Resistance to EMB may be sex-dependent (Igboeli et al., 2013; Jones et al., 2013;
4375 Whyte et al., 2013), and therefore it is worthwhile to consider genes that differ between
4376 populations in only one sex (i.e. not differentially expressed or discordant in the other).
222 4377 Specifically overexpressed in resistant males (but not in resistant females) were
4378 1217 probes. Highly overexpressed were metalloproteinases zinc metalloproteinase nas-
4379 6, and nas-4 (FC > 50) as well as 72 kDa type IV collagenase, trypsin-like serine
4380 protease and matrix metalloproteinase-9 (FC > 10; Table S2; Fig. 3B). In comparison,
4381 1048 probes were overexpressed in sensitive males, including many unannotated
4382 probes, or those annotated as chitin_bind_4 and cuticle protein cp14 (FC > 45).
4383 Specifically overexpressed in resistant females (but not in resistant males) were
4384 936 probes. Highly overexpressed were tristetraproline, trypsin-1, hemicentin-1,
4385 trypsin-4, and von Willebrand factor D and EGF domain-containing protein (FC > 50).
4386 In comparison, 913 probes were overexpressed in sensitive females. Many of these were
4387 unannotated but several with high fold change included tyrosine aminotransferase, 72
4388 kda type IV collagenase, histone-lysine N-methyltransferase setd7, vitellogenin-2, and
4389 heparan sulfate 2-O-sulfotransferase pipe (FC > 5).
4390 Additionally, there was a subset of genes differentially expressed between
4391 populations that were concordantly regulated in both sexes, but to a larger extent in one
4392 sex than the other. Male resistant lice overexpressed 146 probes to a greater extent than
4393 the female resistant lice; this list was enriched for proteolysis (Table S3) and included
4394 chorion peroxidase heavy chain (380-fold in males, 120-fold in females), anionic
4395 trypsin-1, matrix metalloproteinase-9 (12-fold in males, 1.8-fold in females), among
4396 others (Table S2). In comparison, female resistant lice overexpressed 41 probes to a
4397 greater extent than the male lice, but this list had no functional enrichment. Male
4398 sensitive lice overexpressed 105 probes to a greater extent than female sensitive lice;
4399 this list was enriched for transition metal ion binding (Table S3) and included a
223 4400 disintegrin and metalloproteinase with thrombospondin motifs 12, 18 and 20 (>20-fold
4401 in males, >6-fold in females), as well as venom allergen 3 (>60-fold in males, >12-fold
4402 in females) among others (Table S2). Female sensitive lice overexpressed 73 probes to a
4403 greater extent than male sensitive lice, including histone-lysine N-methyltransferase
4404 setd7 (25-fold in females, 3-fold in males), nuclear pore membrane glycoprotein 210
4405 (54-fold in females, 3-fold in males), protein disulfide-isomerase A4 (6-fold in females,
4406 2-fold in males) and gamma-aminobutyric acid receptor subunit beta-like (2.5-fold in
4407 females, 1.7-fold in males).
4408 A.3.5 Genes responding to EMB in both sexes and populations (Atlantic) 4409 Relatively few genes responded to EMB dose. Some genes responded in both sexes and
4410 populations consistently, although most had low fold change (e.g. only 38 probes ≥ 2.5-
4411 fold at 300 ppb). Of these genes, the number of differentially expressed genes increased
4412 with EMB dose until 300 ppb; at 1000 ppb the number and identity of differentially
4413 expressed genes were similar to that at 300 ppb (Table 2; Table S2).
4414 Among the most significantly up-regulated genes from EMB exposure were ring
4415 finger protein nhl-1, and alpha- and beta-taxilin (FC ≥ 1.5 at 25, 300 and 1000 ppb; p ≤
4416 5E-9). However, even these genes did not have high fold change. Up-regulation was
4417 also identified for genes involved in ion binding or transport, including voltage-gated
4418 potassium channel subunit beta-2, sarcoplasmic calcium-binding protein (beta chain),
4419 calcium activated potassium channel slowpoke, caldesmon, and calmodulin.
4420 Genes down-regulated in response to EMB exposure in Atlantic lice also only
4421 had moderate fold change, including several metalloproteinases (e.g. zinc
4422 metalloproteinase nas-4 and nas-15, matrix metalloproteinase-9, astacin, 72 kDa type
4423 IV collagenase) and transporters (e.g. solute carrier family 25 member 38, ABC
224 4424 transporter G family member 20, and low-affinity cationic amino acid transporter;
4425 Table S2). Additionally, a probe annotated as kynurenine 3-monooxygenase was down-
4426 regulated at 300 and 1000 ppb (FC > 1.5; p < 0.001; Fig. 3C).
4427 A.3.6 Genes responding to EMB specifically in one sex-population combination (Atlantic) 4428 A strong expression change over EMB doses was identified specifically in resistant
4429 females. These genes are likely to have contributed to the separation of resistant female
4430 samples by dose in the PCA (Fig. 2). To further characterize these 151 probes, they
4431 were clustered into four clusters with similar expression (Fig. 4A). Clusters (i) and (iii)
4432 contain genes with elevated expression in resistant female controls (0 ppb) and either
4433 decrease to the level of the sensitive lice, or to the level of all other conditions,
4434 respectively. Cluster (iv) contains genes with low expression in resistant female controls
4435 that increases to the level of the sensitive lice. This cluster contains probes annotated as
4436 glutenin high molecular weight subunits, plasmodium histidine-rich protein, a
4437 disintegrin and metalloproteinase with thrombospondin motifs 20, adhesive plaque
4438 matrix protein, and several unknowns. Probes present in each cluster are shown in Table
4439 S2. The expression of a disintegrin and metalloproteinase with thrombospondin motifs
4440 20 was confirmed by RT-qPCR (Fig. 4B).
4441 A.3.6 Additional RT-qPCR exploration 4442 The expression data from the microarray was validated with RT-qPCR for the Pacific
4443 (as discussed above; Fig. 1) and Atlantic lice, and most genes correlated well between
4444 the methods (Fig. S1). This included the degradative enzymes adamts20, pxdn, nas14,
4445 cpb, transporters slc and aqp-9, as well as genes with low fold change (e.g. hspb1,
4446 kcnab2, txlnb, kmo; see Table S1 for full names). From these comparisons, it appeared
4447 that the RT-qPCR had a larger range than the array for the Atlantic lice (as per the slope
225 4448 of the relationship), whereas the opposite was true for the Pacific lice. The reason for
4449 this is not clear, but the correlation between methods was good in both subspecies.
4450 Additionally, to further test for evidence of the cellular stress response in Pacific lice,
4451 we evaluated the expression of heat shock protein 90 using previously characterized
4452 primers (Sutherland et al., 2012). However, consistent with the microarray analysis, no
4453 differential expression was identified at 10, 25 or 50 ppb EMB (data not shown).
4454 Several interesting candidates from previous work on EMB resistance in L.
4455 salmonis were evaluated by RT-qPCR in the Atlantic lice, including p-glycoprotein
4456 (Igboeli et al., 2013), as well as neuronal acetylcholine receptor and GABA-gated
4457 chloride channel (Carmichael et al., 2013b). p-glycoprotein was not significantly
4458 affected by EMB dose (main effect or interaction; p > 0.1), but had higher expression in
4459 males than females (p < 0.0001), and higher expression in the resistant population in
4460 both sexes (main effect population p < 0.005; Fig. 3D), but no significant sex by
4461 population interaction effect. The expression of GABA-gated chloride channel was
4462 dependent on the population, sex and dose of EMB, and slightly increased over the
4463 doses of EMB in most population/sex combinations (except in male resistant lice; Fig.
4464 S2A). Over the doses of EMB neuronal acetylcholine receptor did not change
4465 substantially, and did not have a large baseline difference between populations (Fig.
4466 S2B).
226 A (i) (ii)
2 )
n 0
o
i s
s -2
e
r p
x -4
e
( 2
g -6
o l -8
(iii) (iv)
2 )
n 0
o
i s
s -2
e
r p
x -4
e
( 2
g -6
o l
-8
0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0
......
2 0 0 2 0 0 2 0 0 2 0 0 2 0 0 2 0 0 2 0 0 2 0 0
0 0 0 0 0 0 0 0
3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0
1 1 1 1 1 1 1 1 Resistant Sensitive Resistant Sensitive Resistant Sensitive Resistant Sensitive Female Male Female Male
B
5
)
0
2 s
t 0
m a
d three-way
a (
2 -5 interaction g
o p<0.0001 l
-10
0 1 5 0 0 0 1 5 0 0 0 1 5 0 0 0 1 5 0 0
. . . .
2 0 0 2 0 0 2 0 0 2 0 0
0 0 0 0
3 0 3 0 3 0 3 0
1 1 1 Resistant Sensitive Resistant Sensitive 1 4467 Female Male 4468 Figure 4: Genes responding to EMB specifically in resistant females 4469 (A) Genes changing with EMB dose differently depending on sex and population were 4470 clustered based on expression into four clusters (i-iv). These genes were mainly 4471 comprised of genes responding to EMB exposure in the female resistant population. (B) 4472 The expression of a gene within cluster (iv), a disintegrin and metalloproteinase with 4473 thrombospondin motifs 20 (adamts20) was confirmed by RT-qPCR.
227 4474 A.4 Discussion 4475 The regional differences in the sensitivity to EMB among populations of Atlantic L.
4476 salmonis (Igboeli et al., 2013) provides a system to investigate transcriptomic
4477 differences contributing to resistance mechanisms (e.g. polygenic resistance; Ffrench-
4478 Constant et al., 2004). Polygenic resistance is likely in EMB-resistant L. salmonis
4479 (Espedal et al., 2013). The inclusion of a sensitive Pacific population in this study
4480 provides a first dataset of the induced transcriptomic response of Pacific lice to 10-50
4481 ppb EMB, which can be indirectly compared to the Atlantic responses. However,
4482 differences between the exposures methods (e.g. pooling of multiple males and females
4483 in Pacific samples, and individual profiling in Atlantic samples) and the lice biology
4484 (e.g. presence of microsporidia infections in the Pacific lice) between the two analyses
4485 are important to consider while comparing these responses.
4486 A.4.1 Lack of induced transcriptional responses from EMB 4487 Atlantic lice baseline expression differences were much greater in number and fold
4488 change than induced responses, in agreement with the relative contributions of baseline
4489 and induced (200 ppb EMB) transcriptomic differences in Scottish EMB-resistant and -
4490 sensitive male L. salmonis (Carmichael et al., 2013b). Interestingly, Pacific lice did not
4491 up-regulate any genes in response to EMB; although, a suite of genes were down-
4492 regulated in only the highest EMB dose (50 ppb). Some induced responses in resistant
4493 lice may occur, for example up-regulation of p-glycoprotein occurred in response to
4494 EMB in resistant populations of L. salmonis (Igboeli et al., 2013). However, EMB-
4495 induced fold change may be moderate; Chilean EMB-resistant Caligus rogercresseyi
4496 only had moderate differences in expression of detoxification (e.g. cytochrome P450s)
228 4497 or transport genes (multidrug resistance protein 1 (mrp1); Pgp1) as detected by semi-
4498 quantitative PCR (Cárcamo et al., 2011).
4499 There was little evidence of an induced cellular stress response in the
4500 transcriptomic response to EMB in either subspecies (Atlantic or Pacific) even though
4501 many lice were exhibiting phenotypic signs of stress in bioassays at 300 and especially
4502 1000 ppb. The lack of transcriptomic signatures of stress from the EMB exposure is a
4503 notable difference from the cellular stress response observed during salinity
4504 perturbations of copepodid L. salmonis (Sutherland et al., 2012). EMB-resistant Chilean
4505 C. rogercresseyi did not up-regulate heat shock protein from EMB (Cárcamo et al.,
4506 2011), and no stress response was identified in the spot prawn Pandalus platyceros
4507 exposed to EMB, although other biological functions were affected (e.g.
4508 transcription/translation control; (Veldhoen et al., 2012). It is probable that other
4509 parasiticides with other mechanisms of action would induce different responses than
4510 those viewed here; for example, the antioxidant response of Caligus rogercresseyi was
4511 induced by the pyrethroid deltamethrin, which was attributed to increases in free
4512 radicals during the biodegradation of deltamethrin within the louse (Chavez-Mardones
4513 and Gallardo-Escárate, 2014). Stress response genes were induced in response to the
4514 pyrethroid permethrin in pyrethroid-resistant A. gambiae (Vontas et al., 2005). Given
4515 the phenotypic variation that occurs even in endpoint detection of bioassays (Westcott et
4516 al., 2008) and in treatment response analysis (Jones et al., 2013) it will be important to
4517 continue to profile louse responses to EMB and other parasiticides, building on markers
4518 identified here, in previous work (Carmichael et al., 2013b; Chavez-Mardones and
229 4519 Gallardo-Escárate, 2014; Igboeli et al., 2013), or on markers associated with louse stress
4520 (Sutherland et al., 2012).
4521 A.4.2 Degradative enzymes and other potential resistance candidates 4522 A main finding of the present work was the overexpression of degradative enzymes in
4523 resistant relative to sensitive lice (in both sexes), as well as the highest overexpression
4524 of many of these genes specifically in the resistant males. The highest resistance in
4525 EC50 bioassays was viewed in resistant males in the current study and in previous work
4526 (Igboeli et al., 2013), and therefore elevated expression of degradative enzymes is
4527 associated with the most resistant condition. Interestingly, at higher doses of EMB,
4528 many of these enzymes were down-regulated in both Pacific and Atlantic salmon. The
4529 resistant population may therefore be less impacted by decreases in these genes
4530 following high doses of EMB exposure. In salmon lice, secretory degradative enzymes
4531 are likely important during feeding on optimal hosts (Fast et al., 2003) and possibly
4532 during other functions.
4533 The association of degradative enzymes with resistant phenotypes has been
4534 viewed in other species. For example, elevated baseline expression of peptidases was
4535 identified in pyrethroid-resistant Anopheles gambaie (Vontas et al., 2005), and in both
4536 field- and laboratory-selected DDT-resistant Drosophila melanogaster (Pedra et al.,
4537 2004). Functional enzymatic studies have also indicated this result, for example with
4538 increased proteolytic activity in an insecticide resistant house fly Musca domestica
4539 (Ahmed et al., 1998). Both trypsin and chymotrypsin were overexpressed in a
4540 deltamethrin-resistant population of the mosquito Culex pipiens pallens, and
4541 cotransfection and stable expression of these two proteins in cell culture increased cell
4542 viability in response to deltamethrin relative to controls (Gong et al., 2005). It is not
230 4543 clear what the function of the degradative enzymes would be in the resistance
4544 phenotype. It has been proposed that increased peptidase activity may generate energy
4545 to alleviate costs of metabolic detoxification of drugs (Ahmed et al., 1998). However,
4546 energetic costs have yet to be identified in EMB resistant L. salmonis populations
4547 (Espedal et al., 2013) and costs are not always associated with resistance. For example,
4548 EMB-resistant green lacewing Chrysoperla carnea were reported to have more rapid
4549 development, increased fecundity and other indicators of increased fitness relative to the
4550 sensitive control (Mansoor et al., 2013). Therefore the reason for increased degradative
4551 enzyme expression in resistant populations requires further investigation.
4552 Genes responding to EMB exposure in both populations may also be involved in
4553 EMB protection; it is probable that the two Atlantic lice populations used in this study
4554 are more EMB resistant than a completely sensitive strain (Igboeli et al., 2013), such as
4555 the Pacific population profiled here. Pre-resistant Atlantic L. salmonis incurred 74-
4556 100% mortality from bioassay concentrations of 30-100 ppb EMB (Tribble et al., 2007),
4557 a higher level of sensitivity than that observed in the sensitive population used here (see
4558 Table 4 and (Igboeli et al., 2013). Among the few genes that increased as a result of
4559 EMB exposure, two of the most significant were alpha- and beta-taxilin; which are
4560 involved in calcium-dependent exocytosis of neuroendocrine cells (Nogami et al., 2003)
4561 and potentially in promoting motor nerve regeneration (Itoh et al., 2004). As EMB acts
4562 to disrupt neurotransmission through hyperpolarization, the induction of these
4563 transcripts is noteworthy. The down-regulation by EMB of kynurenine 3-
4564 monooxygenase is of interest because inhibition of this protein leads to an increase in
4565 the concentration of kynurenic acid and a decrease in the concentration of glutamate
231 4566 (Zwilling et al., 2011), the ligand for the target site of EMB (Arena et al., 1995).
4567 However, the fold changes of these transcripts were moderate so this possible effect
4568 would have to be explored further. The identification of these genes previously
4569 unexplored in relation to EMB resistance exemplifies the potential for transcriptomics
4570 in identifying unexpected genes that may be associated with resistance (Pedra et al.,
4571 2004; Vontas et al., 2005).
4572 In Pacific lice, the only identified response to EMB was a down-regulation of
4573 genes at 50 ppb (including an enrichment for peptidase functions). Atlantic lice also
4574 decreased degradative enzymes over the concentrations of EMB, although not to the
4575 same extent. Down-regulation of degradative enzymes in Pacific lice may be due to the
4576 interruption of signals for continued production of these enzymes by EMB, for example,
4577 through disruption of calcium signaling. For example, experimental calcium (Ca2+)
4578 influx into a rat exocrine pancreatic cell line decreased chymotrypsin, amylase, and
4579 carboxypeptidase-a1 expression (but increased trypsin) (Stratowa and Rutter, 1986). It
4580 is also possible that down-regulation is related to EMB-induced molting (Waddy et al.,
4581 2002), as during molting suppression can occur for digestive enzymes trypsin and
4582 chymotrypsin (Klein et al., 1996; Sanchez-Carbayo et al., 2003; Wormhoudt et al.,
4583 1995). However, the presence of many other genes such as transporters in this list
4584 suggests this is not the case. Alternately, EMB may be acting as a antinutritional factor,
4585 which can reduce peptidase activity (e.g. in the cotton pest Heliothis zea; Klocke and
4586 Chan, 1982), or may be reducing available energy stores leading to suppression of
4587 degradative enzymes similar to that which can occur during starvation (e.g. in white
4588 shrimp Penaeus vannamei; (Muhlia-almazan and Garcıa-carreno, 2002). The
232 4589 suppression of a diverse range of transcripts further indicates interrupted signaling, but
4590 more work would need to be done to confirm this.
4591 Elevated p-glycoprotein expression in emamectin benzoate-resistant organisms
4592 has been identified in multiple species, including L. salmonis (Igboeli et al., 2013).
4593 Here, we also identified the highest baseline expression of p-glycoprotein in the most
4594 resistant condition (resistant males). However, here we did not find evidence of pgp
4595 increasing over EMB doses. Our results also confirm the large influence from strain and
4596 low influence of EMB dose in Scottish resistant and sensitive L. salmonis (Carmichael
4597 et al., 2013b). Additionally, in the Scottish populations, down-regulation of degradative
4598 functions were also identified in response to EMB (e.g. hydrolase activity). In the
4599 present study, the highest fold change down-regulation of degradative enzymes from
4600 EMB exposure occurred in the most sensitive population (Pacific L. salmonis), and in
4601 the Scottish L. salmonis this was also identified in the sensitive strain (e.g. matrix
4602 metalloproteinase-9; and metalloproteinase; (Carmichael et al., 2013b). Here we did not
4603 find the same down-regulation trends for neuronal acetylcholine receptor and GABA-
4604 gated chloride channel expression in resistant populations using the primers from the
4605 original study. However, we did identify lower baseline expression of a probe annotated
4606 as gamma-aminobutyric acid receptor subunit beta-like in the resistant population than
4607 the sensitive in both sexes (largest fold change in females), albeit with lower fold
4608 change than many other genes with population differences in the study. These findings
4609 may indicate differences in resistance mechanisms between Atlantic Canada and
4610 Scottish L. salmonis populations.
233 4611 The large number of unknown genes in L. salmonis produces a challenge for the
4612 interpretation of L. salmonis transcriptomics. A potential approach to improving L.
4613 salmonis transcriptome interpretation may be through further characterization of co-
4614 expressed gene clusters noted here and in previous studies (Carmichael et al., 2013b;
4615 Eichner et al., 2008), and using the relation to clusters and responses to environmental
4616 variables for the annotation of unknowns (Pavey et al., 2012). Continued effort in this
4617 regard may improve the interpretation of existing and future salmon lice transcriptome
4618 analysis.
4619 A.4.3 Relevance for aquaculture 4620 The present work provides insights on the evolution of emamectin benzoate resistance
4621 in salmon lice with implications for aquaculture. Specifically, this study provides
4622 further support for the polygenic nature of emamectin benzoate resistance. This may
4623 occur incrementally among those lice exposed to a sub-lethal dose (Ffrench-Constant et
4624 al., 2004). There are several possibilities how this may occur, for example feeding
4625 differences may result in differential ingestion of the parasiticide by the hosts and
4626 different exposure levels to lice (Igboeli et al., 2014). The identification of markers of
4627 resistance development is an important contribution of this work. In addition to the
4628 candidates observed here, the evaluation of single nucleotide polymorphisms (SNPs)
4629 and other genomic changes associated with resistance will be an important next step.
4630 The correlation of the resistance phenotype with elevated expression of
4631 degradative enzymes may have implications on the biology and pathology of lice.
4632 Currently we understand that in lice, degradative enzymes are likely to function in
4633 feeding efficiency, immune evasion, and potentially in pathogenicity (Fast et al., 2003).
4634 However, it will be useful to continue to characterize the specific roles of these
234 4635 enzymes. The possibility that elevated expression of degradative enzymes in the
4636 resistant lice has an impact on the host-parasite interaction is an important avenue for
4637 future work.
4638 A.4.4 Conclusions 4639 Polygenic resistance mechanisms may provide EMB protection in L. salmonis, and the
4640 present study identifies some potential mechanisms, most notably the association
4641 between high expression of degradative enzymes and the resistant phenotype. Induced
4642 transcriptional responses to EMB were minor and had low fold changes in comparison
4643 to baseline differences between populations differing in EMB sensitivity. Sensitive
4644 Pacific lice responded only with down-regulation of enzyme and transporter gene
4645 expression. Higher doses of EMB also resulted in down-regulation of degradative
4646 enzymes in Atlantic lice. Neither subspecies responded to EMB exposure with a cellular
4647 stress response. Future work on single nucleotide polymorphism (SNP) differences
4648 among populations will continue to improve our understanding of EMB resistance in L.
4649 salmonis, in particular, the potential role for target site mutation. The interpretation of L.
4650 salmonis transcriptome responses (in the present study and others) may be improved
4651 with further annotation and characterization of genes and co-expressed gene clusters
4652 through meta-analysis of existing and forthcoming transcriptome studies.
4653 Availability of Data and Materials 4654 Gene expression data has been uploaded to GEO under the accession GSE56024.
4655 Supplementary Information (Additional Files) 4656 Figure S1. RT-qPCR confirmation of microarray expression. 4657 Figure S2. Exploratory RT-qPCR on previously identified targets. 4658 Table S1. Primer table. 4659 Table S2. Differentially expressed genes. 4660 Table S3. Gene Ontology (GO) enrichment
235 4661 All additional files can be accessed online at DOI: 10.1111/eva.12237
4662 Acknowledgements 4663 This work was funded by Genome British Columbia, the Natural Sciences and 4664 Engineering Research Council of Canada, the Province of British Columbia, the 4665 Department of Fisheries and Oceans Canada (DFO), the University of Victoria, Grieg 4666 Seafood, Mainstream Canada, Marine Harvest, Atlantic Canada Opportunities Agency 4667 (ACOA), Novartis Animal Health, and Innovation Prince Edward Island. BJGS was 4668 supported by an NSERC CGS fellowship. Thanks to S Jantzen and D Sanderson for 4669 analysis and sample preparation assistance, E Rondeau for amplicon sequencing, and E 4670 Kim for Pacific lice culturing and sample preparation. Thanks to the members of the 4671 Hoplite lab at Atlantic Veterinary College, Dr. M. Llewellyn, Prof. Louis Bernatchez 4672 and two anonymous reviewers for comments on an earlier version of the manuscript.
236 4673 References
4674 Aaen, S.M., 2016. Chemotherapeutants against salmon lice Lepeophtheirus salmonis - 4675 screening of efficacy. Thesis – Norwegian University of Life Sciences. pgs 20-21. 4676 Aaen, S.M., Helgesen, K.O., Bakke, M.J., Kaur, K., Horsberg, T.E., 2015. Drug 4677 resistance in sea lice: A threat to salmonid aquaculture. Trends Parasitol. 31, 72– 4678 81. 4679 Abbas, R.Z., Arfan, M., Colwell, D.D., Gilleard, J., Iqbal, Z., 2014. Acaricide resistance 4680 in cattle ticks and approaches to its management: The state of play. Vet. Parasitol. 4681 203, 6–20. 4682 Abo-Elghar, G.E., Fujiyoshi, P., Matsumura, F., 2004. Significance of the sulfonylurea 4683 receptor (SUR) as the target of diflubenzuron in chitin synthesis inhibition in 4684 Drosophila melanogaster and Blattella germanica. Insect Biochem. Mol. Biol. 34, 4685 743–752. 4686 Agnew, P., Berticat, C., Bedhomme, S., Sidobre, C., Michalakis, Y., 2004. Parasitism 4687 increases and decreases the costs of insecticide resistance in mosquitoes. 4688 Evolution. 58, 579–586. 4689 Ahmad, M.F., Singh, D., Taiyab, A., Ramakrishna, T., Raman, B., Rao, C.M., 2008. 4690 Selective Cu2+ binding, redox silencing, and cytoprotective effects of the small 4691 heat shock proteins αA- αB-crystallin. J. Mol. Biol. 382, 812–824. 4692 Ahmed, S., Wilkins, R.M., Mantle, D., 1998. Comparison of proteolytic enzyme 4693 activities in adults of insecticide resistant and susceptible strains of the housefly M. 4694 domestica L. Insect Biochem. Mol. Biol. 28, 629–39. 4695 Ahyong, S.T., Lowry, J.K., Alonso, M., Bamber, R.N., Boxshall, G.A., Castro, P., 4696 Gerken, S., Karaman, G.S., Goy, J.W., Jones, D.S., Meland, K., Rogers, D.C., 4697 Svavarsson, J., 2011. In Zhang Z.Q (Ed.) Animal biodiversity: An outline of 4698 higher-level classification and survey of taxonomic richness. Magnolia Press. pgs 4699 165-191. 4700 Albert, S., Bhattacharya, D., Klaudiny, J., Schmitzová, J., Simúth, J., 1999. The family 4701 of major royal jelly proteins and its evolution. J. Mol. Evol. 49, 290–297. 4702 Albert, Š., Klaudiny, J., Šimúth, J., 1999. Molecular characterization of MRJP3, highly 4703 polymorphic protein of honeybee (Apis mellifera) royal jelly. Insect Biochem. Mol. 4704 Biol. 29, 427–434. 4705 Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M., Hooper, J.E., 1996. The Drosophila 4706 smoothened gene encodes a seven-pass membrane protein, a putative receptor for 4707 the hedgehog signal. Cell 86, 221–232. 4708 Andreadis, T.G., 2005. Evolutionary strategies and adaptations for survival between 4709 mosquito-parasitic microsporidia and their intermediate copepod hosts: A 4710 comparative examination of Amblyospora connecticut and Hyalinocysta chapmani 4711 (Microsporidia: Amblyosporidae). Folia Parasitol. (Praha). 52, 23–35. 4712 Appel, L.F., Prout, M., Abu-Shumays, R., Hammonds, A, Garbe, J.C., Fristrom, D., 4713 Fristrom, J., 1993. The Drosophila stubble-stubbloid gene encodes an apparent 4714 transmembrane serine protease required for epithelial morphogenesis. PNAS 90, 4715 4937–4941. 4716 Arakane, Y., Dixit, R., Begum, K., Park, Y., Specht, C.A., Merzendorfer, H., Kramer,
237 4717 K.J., Muthukrishnan, S., Beeman, R.W., 2009. Analysis of functions of the chitin 4718 deacetylase gene family in Tribolium castaneum. Insect Biochem. Mol. Biol. 39, 4719 355–365. 4720 Arakane, Y., Muthukrishnan, S., 2010. Insect chitinase and chitinase-like proteins. Cell. 4721 Mol. Life Sci. 67, 201–216. 4722 Arena, J.P., Liu, K.K., Paress, P.S., Frazier, E.G., Cully, D.F., Arena, J.P., Liu, K.K., 4723 Paress, P.S., Frazier, E.G., Cully, D.F., Mrozik, H., Schaeffer, J.M., 1995. The 4724 mechanism of action of avermectins in Caenorhabditis elegans: Correlation 4725 between activation of glutamate-sensitive chloride current, membrane binding, and 4726 biological activity. J. Parasitol. 81, 286–294. 4727 Atlantic Canada Fish Farmers Association (ACFFA), 2016. New Brunswick annual sea 4728 lice management report. pgs 1-14 4729 Aubin-Horth, N., Renn, S.C.P., 2009. Genomic reaction norms: Using integrative 4730 biology to understand molecular mechanisms of phenotypic plasticity. Mol. Ecol. 4731 18, 3763–3780. 4732 Aufauvre, J., Misme-Aucouturier, B., Viguès, B., Texier, C., Delbac, F., Blot, N., 2014. 4733 Transcriptome analyses of the honeybee response to Nosema ceranae and 4734 insecticides. PLoS One 9, e91686. 4735 Avila, F.W., Sirot, L.K., LaFlamme, B.A., Rubinstein, D.C., Wolfner, M.F., 2011. 4736 Insect seminal fluid proteins: Identification and function. Annu. Rev. Entemology 4737 56, 21–40. 4738 Baer, B., Heazlewood, J.L., Taylor, N.L., Eubel, H., Millar, A. H., 2009. The seminal 4739 fluid proteome of the honeybee Apis mellifera. Proteomics 9, 2085–2097. 4740 Bakowski, M.A., Desjardins, C.A., Smelkinson, M.G., Dunbar, T.A., Lopez-Moyado, 4741 I.F., Rifkin, S.A., Cuomo, C.A., Troemel, E.R., 2014. Ubiquitin-mediated response 4742 to microsporidia and virus infection in C. elegans. PLoS Pathog. 10, e1004200. 4743 Baldwin, W.S., Marko, P.B., Nelson, D.R., 2009. The cytochrome P450 (CYP) gene 4744 superfamily in Daphnia pulex. BMC Genomics 10, 169. 4745 Barker, D.E., Braden, L.M., Coombs, M.P., Boyce, B., 2009. Preliminary studies on the 4746 isolation of bacteria from sea lice, Lepeophtheirus salmonis, infecting farmed 4747 salmon in British Columbia, Canada. Parasitol. Res. 105, 1173–1177. 4748 Bartsch, A., Robinson, S.M.C., Liutkus, M., Ang, K.P., Webb, J., Pearce, C.M., 2013. 4749 Filtration of sea louse, Lepeophtheirus salmonis, copepodids by the blue mussel, 4750 Mytilus edulis, and the Atlantic sea scallop, Placopecten magellanicus, under 4751 different flow, light and copepodid-density regimes. J. Fish Dis. 36, 361–70. 4752 Basha, E., O’Neill, H., Vierling, E., 2012. Small heat shock proteins and α-crystallins: 4753 dynamic proteins with flexible functions. Trends Biochem. Sci. 37, 106–117. 4754 Bauters, L., Naalden, D., Gheysen, G., 2017. The Distribution of lectins across the 4755 Phylum Nematoda: A genome-wide search. Int. J. Mol. Sci. 18, 91. 4756 Belinato, T., Valle, D., 2015. The impact of selection with diflubenzuron, a chitin 4757 synthesis inhibitor, on the fitness of two Brazilian Aedes aegypti field populations. 4758 PLoS One 10, e0130719. 4759 Besnier, F., Kent, M., Skern-Mauritzen, R., Lien, S., Malde, K., Edvardsen, R.B., 4760 Taylor, S., Ljungfeldt, L.E., Nilsen, F., Glover, K.A, 2014. Human-induced 4761 evolution caught in action: SNP-array reveals rapid amphi-atlantic spread of 4762 pesticide resistance in the salmon ecotoparasite Lepeophtheirus salmonis. BMC
238 4763 Genomics 15, 937. 4764 Biron, D.G., Agnew, P., Marché, L., Renault, L., Sidobre, C., Michalakis, Y., 2005. 4765 Proteome of Aedes aegypti larvae in response to infection by the intracellular 4766 parasite Vavraia culicis. Int. J. Parasitol. 35, 1385–1397. 4767 Bogwitz, M.R., Chung, H., Magoc, L., Rigby, S., Wong, W., O’Keefe, M., McKenzie, 4768 J.A., Batterham, P., Daborn, P.J., 2005. Cyp12a4 confers lufenuron resistance in a 4769 natural population of Drosophila melanogaster. PNAS 102, 12807–12. 4770 Boltaña, S., Sanchez, M., Valenzuela, V., Gallardo-Escárate, C., 2016. Density- 4771 dependent effects of Caligus rogercresseyi infestation on the immune responses of 4772 Salmo salar. Fish Shellfish Immunol. 59, 365–374. 4773 Bonizzoni, M., Afrane, Y., Dunn, W.A., Atieli, F.K., Zhou, G., Zhong, D., Li, J., 4774 Githeko, A., Yan, G., 2012. Comparative transcriptome analyses of deltamethrin- 4775 resistant and -susceptible Anopheles gambiae mosquitoes from Kenya by RNA- 4776 Seq. PLoS One 7, e44607. 4777 Boxaspen, K., 2006. A review of the biology and genetics of sea lice. ICES J. Mar. Sci. 4778 63, 1304–1316. 4779 Boxshall, G., 2005. Crustacean parasites, in: Rohde, K. (Ed.), Marine Parasitology. pgs 4780 123–138. 4781 Braden, L.M., Barker, D.E., Koop, B.F., Jones, S.R.M., 2015a. Differential modulation 4782 of resistance biomarkers in skin of juvenile and mature pink salmon, 4783 Oncorhynchus gorbuscha by the salmon louse, Lepeophtheirus salmonis. Fish 4784 Shellfish Immunol. 47, 7–14. 4785 Braden, L.M., Barker, D.E., Koop, B.F., Jones, S.R.M., 2012. Comparative defense- 4786 associated responses in salmon skin elicited by the ectoparasite Lepeophtheirus 4787 salmonis. Comp. Biochem. Physiol. - Part D Genomics Proteomics 7, 100–109. 4788 Braden, L.M., Koop, B.F., Jones, S.R.M., 2015b. Signatures of resistance to 4789 Lepeophtheirus salmonis include a TH2-type response at the louse-salmon 4790 interface. Dev. Comp. Immunol. 48, 178–191. 4791 Braden, L.M., Sutherland, B.J.G., Koop, B.F., Jones, S.R.M., 2017. Enhanced 4792 transcriptomic responses in the Pacific salmon louse Lepeophtheirus salmonis 4793 oncorhynchi to the non-native Atlantic Salmon Salmo salar suggests increased 4794 parasite fitness. BMC Genomics 18, 110. 4795 Brandal, P., Egidius, E., Romslo, I., 1976. Host blood: a major food component for the 4796 parasitic copepod, Lepeophtheirus salmonis Krøyer, 1838 (Crustacea caligidae). 4797 Nor. J. Zool. 24, 341–343. 4798 Branson, E.J., Rùnsberg, S.S., Ritchie, G., 2000. Efficacy of teflubenzuron (Calicide®) 4799 for the treatment of sea lice, Lepeophtheirus salmonis (Krøyer 1838), infestations 4800 of farmed Atlantic salmon (Salmo salar L.). Aquac. Res. 31, 861–867. 4801 Braswell, W.E., Andrés, J.A., Maroja, L.S., Harrison, R.G., Howard, D.J., Swanson, 4802 W.J., 2006. Identification and comparative analysis of accessory gland proteins in 4803 Orthoptera. Genome 49, 1069–1080. 4804 Bravo, S., Sevatdal, S., Horsberg, T.E., 2008. Sensitivity assessment of Caligus 4805 rogercresseyi to emamectin benzoate in Chile. Aquaculture 282, 7–12. 4806 Bricknell, I.R., Dalesman, S.J., O’Shea, B., Pert, C.C., Luntz, A.J.M., 2006. Effect of 4807 environmental salinity on sea lice Lepeophtheirus salmonis settlement success. 4808 Dis. Aquat. Organ. 71, 201–212.
239 4809 Brogdon, W.G., Barber, A.M., 1990. Fenitrothion-deltamethrin cross-resistance 4810 conferred by esterases in Guatemalan Anopheles albimanus. Pestic. Biochem. 4811 Physiol. 37, 130–139. 4812 Bron, J.E., Shinn, A.P., Sommerville, C., 2000. Moulting in the chalimus larva of the 4813 salmon louse Lepeophtheirus salmonis (Copepoda, Caligidae). Contrib. to Zool. 4814 69, 31–38. 4815 Bron, J.E., Sommerville, C., Jones, M., Rae, G.H., 1991. The settlement and attachment 4816 of early stages of the salmon louse, Lepeophtheirus salmonis (Copepoda: 4817 Caligidae) on the salmon host, Salmo salar. J. Zool. 224, 201–212. 4818 Brooke, B.D., 2008. Kdr: Can a single mutation produce an entire insecticide resistance 4819 phenotype? Trans. R. Soc. Trop. Med. Hyg. 102, 524–525. 4820 Brun-Barale, A., Héma, O., Martin, T., Suraporn, S., Audant, P., Sezutsu, H., 4821 Feyereisen, R., 2010. Multiple P450 genes overexpressed in deltamethrin-resistant 4822 strains of Helicoverpa armigera. Pest Manag. Sci. 66, 900–9. 4823 Bruno, D.W., Raynard, R.S., 1994. Studies on the use of hydrogen peroxide as a method 4824 for the control of sea lice on Atlantic salmon. Aquac. Int. 2, 10–18. 4825 Bui, S., Oppedal, F., Stien, L., Dempster, T., 2016. Sea lice infestation level alters 4826 salmon swimming depth in sea-cages. Aquac. Environ. Interact. 8, 429–435. 4827 Burka, J.F., Fast, M.D., Revie, C.W., 2012. Lepeophtheirus salmonis and Caligus 4828 rogercresseyi, in: Woo, P., Buchmann, K. (Eds.), Fish Parasites: Pathobiology and 4829 Protection. CAB International, pp. 360–380. 4830 Burridge, L., Weis, J.S., Cabello, F., Pizarro, J., Bostick, K., 2010. Chemical use in 4831 salmon aquaculture: A review of current practices and possible environmental 4832 effects. Aquaculture 306, 7–23. 4833 Cali, A., Takvorian, P.M., 2014. Developmental morphology and life cycles of the 4834 microsporidia, in: Weiss, L.M., Becnel, J.J. (Eds.), Microsporidia: Pathogens of 4835 opportunity, First Edition. John Wiley & Sons, Inc., pgs. 71–133. 4836 Cárcamo, J.G., Aguilar, M.N., Barrientos, C.A., Carreño, C.F., Quezada, C.A., Bustos, 4837 C., Manríquez, R.A., Avendaño-Herrera, R., Yañez, A.J., 2011. Effect of 4838 emamectin benzoate on transcriptional expression of cytochromes P450 and the 4839 multidrug transporters (Pgp and MRP1) in rainbow trout (Oncorhynchus mykiss) 4840 and the sea lice Caligus rogercresseyi. Aquaculture 321, 207–215. 4841 Carmichael, S.N., Bekaert, M., Taggart, J.B., Christie, H.R.L., Bassett, D.I., Bron, J.E., 4842 Skuce, P.J., Gharbi, K., Skern-Mauritzen, R., Sturm, A., 2013a. Identification of a 4843 sex-linked SNP marker in the salmon louse (Lepeophtheirus salmonis) using RAD 4844 sequencing. PLoS One 8, e77832. 4845 Carmichael, S.N., Bron, J.E., Taggart, J.B., Ireland, J.H., Bekaert, M., Burgess, S.T., 4846 Skuce, P.J., Nisbet, A.J., Gharbi, K., Sturm, A., 2013b. Salmon lice 4847 (Lepeophtheirus salmonis) showing varying emamectin benzoate susceptibilities 4848 differ in neuronal acetylcholine receptor and GABA-gated chloride channel mRNA 4849 expression. BMC Genomics 14, 408. 4850 Carmona-Antoñanzas, G., Humble, J.L., Carmichael, S.N., Heumann, J., Christie, 4851 H.R.L., Green, D.M., Bassett, D.I., Bron, J.E., Sturm, A., 2016. Time-to-response 4852 toxicity analysis as a method for drug susceptibility assessment in salmon lice. 4853 Aquaculture 464, 570–575. 4854 Carmona-Antoñanzas, G Bekaert, M., Humble, J., Boyd, S., Roy, W., Houston, R..,
240 4855 Gharbi, K., Bron, J., Sturm, A., 2017. Maternal inheritance of deltamethrin 4856 resistance in the salmon louse Lepeophtheirus salmonis (Krøyer) is associated with 4857 unique mtDNA haplotypes. PLoS One in press. 4858 Carmona-Antoñanzas, G., Carmichael, S.N., Heumann, J., Taggart, J.B., Gharbi, K., 4859 Bron, J.E., Bekaert, M., Sturm, A., 2015. A survey of the ATP-binding cassette 4860 (ABC) gene superfamily in the salmon louse (Lepeophtheirus salmonis). PLoS 4861 One 10, e0137394. 4862 Carpenter, S.R., Kitchell, J.F., Hodgson, J.R., 1985. Fish predation and herbivory can 4863 regulate lake ecosystems. Bioscience 35, 634–639. 4864 Carpio, Y., Basabe, L., Acosta, J., Rodríguez, A., Mendoza, A., Lisperger, A., 4865 Zamorano, E., González, M., Rivas, M., Contreras, S., Haussmann, D., Figueroa, 4866 J., Osorio, V.N., Asencio, G., Mancilla, J., Ritchie, G., Borroto, C., Estrada, M.P., 4867 2011. Novel gene isolated from Caligus rogercresseyi: A promising target for 4868 vaccine development against sea lice. Vaccine 29, 2810–2820. 4869 Carter, S., 1989. A review of the use of synthetic pyrethroids in public health and vector 4870 pest control. Pestic. Sci. 27, 361–374. 4871 Catalán, A., Hutter, S., Parsch, J., 2012. Population and sex differences in Drosophila 4872 melanogaster brain gene expression. BMC Genomics 13, 654. 4873 Chapman, T., 2001. Seminal fluid-mediated fitness traits in Drosophila. Heredity 4874 (Edinb). 87, 511–521. 4875 Chavez-Mardones, J., Gallardo-Escárate, C., 2014. Deltamethrin (AlphaMaxTM) reveals 4876 modulation of genes related to oxidative stress in the ectoparasite Caligus 4877 rogercresseyi: Implications on delousing drug effectiveness. Aquaculture 433, 4878 421–429. 4879 Cheah, Y., Yang, W., 2011. Functions of essential nutrition for high quality 4880 spermatogenesis. Adv. Biosci. Biotechnol. 2, 182–197. 4881 Chen, H., Chen, X., Zheng, Y., 2013. The nuclear lamina regulates germline stem cell 4882 niche organization via modulation of EGFR signalling. Cell Stem Cell 13, 73–86. 4883 Chintapalli, V.R., Wang, J., Dow, J.T., 2007. Using FlyAtlas to identify better 4884 Drosophila melanogaster models of human disease. Nat. Genet. 39, 715–20. 4885 Chomczynski, P., 1993. A reagent for the single-step simultaneous isolation of RNA, 4886 DNA and proteins from cell and tissue samples. Biotechnique 15, 532–537. 4887 Chomczynski, P., Mackey, K., 1995. Modification of the TRI Reagent® DNA/Protein 4888 isolation procedure for isolation of RNA from polysaccharide – and proteoglycan – 4889 rich sources. Biotechnique 19, 942–945. 4890 Chung, H., Sztal, T., Pasricha, S., Sridhar, M., Batterham, P., Daborn, P.J., 2009. 4891 Characterization of Drosophila melanogaster cytochrome P450 genes. PNAS 106, 4892 5731–5736. 4893 Churchill, G.A., 2002. Fundamentals of experimental design for cDNA microarrays. 4894 Nat. Genet. 32, 490–495. 4895 Clark, J.M., Scott, J.G., Campos, F., Bloomquist, J.R., 1995. Resistance to avermectins: 4896 extent, mechanisms, and management implications. Annu. Rev. Entomol. 40, 1–30. 4897 Clark, K.F., Greenwood, S.J., 2016. Next-Generation Sequencing and the crustacean 4898 immune system: The need for alternatives in immune gene annotation. Integr. 4899 Comp. Biol. 56, 1113–1130. 4900 Clauss, A., Persson, M., Lilja, H., Lundwall, Å., 2011. Three genes expressing Kunitz
241 4901 domains in the epididymis are related to genes of WFDC-type protease inhibitors 4902 and semen coagulum proteins in spite of lacking similarity between their protein 4903 products. BMC Biochem. 12, 55. 4904 Coles, G.C., Jackson, F., Pomroy, W.E., Prichard, R.K., von Samson-Himmelstjerna, 4905 G., Silvestre, A., Taylor, M.A., Vercruysse, J., 2006. The detection of anthelmintic 4906 resistance in nematodes of veterinary importance. Vet. Parasitol. 136, 167–85. 4907 Coors, A., Decaestecker, E., Jansen, M., De Meester, L., 2008. Pesticide exposure 4908 strongly enhances parasite virulence in an invertebrate host model. Oikos 117, 4909 1840–1846. 4910 Cornejo, I., Andrini, O., Niemeyer, M.I., Marabolí, V., González-Nilo, F.D., Teulon, J., 4911 Sepúlveda, F. V, Cid, L.P., 2014. Identification and functional expression of a 4912 glutamate- and avermectin-gated chloride channel from Caligus rogercresseyi, a 4913 southern Hemisphere sea louse affecting farmed fish. PLoS Pathog. 10, e1004402. 4914 Cornman, R.S., Togawa, T., Dunn, W.A., He, N., Emmons, A.C., Willis, J.H., 2008. 4915 Annotation and analysis of a large cuticular protein family with the R & R 4916 Consensus in Anopheles gambiae. BMC Genomics 9, 22. 4917 Costa, A.F.D. V, Gasser, R.B., Dias, S.R.C., Rabelo, E.M.L., 2009. Male-enriched 4918 transcription of genes encoding ASPs and Kunitz-type protease inhibitors in 4919 Ancylostoma species. Mol. Cell. Probes 23, 298–303. 4920 Costello, M.J., 2009. The global economic cost of sea lice to the salmonid farming 4921 industry. J. Fish Dis. 32, 115–8. 4922 Costello, M.J., 2006. Ecology of sea lice parasitic on farmed and wild fish. Trends 4923 Parasitol. 22, 475–83. 4924 Covello, J.M., Friend, S.E., Purcell, S.L., Burka, J.F., Markham, R.J.F., Donkin, A.W., 4925 Groman, D.B., Fast, M.D., 2012. Effects of orally administered immunostimulants 4926 on inflammatory gene expression and sea lice (Lepeophtheirus salmonis) burdens 4927 on Atlantic salmon (Salmo salar). Aquaculture 366–367, 9–16. 4928 Cutter, A.D., Ward, S., 2005. Sexual and temporal dynamics of molecular evolution in 4929 C. elegans development. Mol. Biol. Evol. 22, 178–88. 4930 Dahm, R., Geisler, R., 2006. Learning from small fry : The zebrafish as a genetic model 4931 organism for aquaculture fish species. Mar. Biotechnol. 8, 329–345. 4932 Dalvin, S., Frost, P., Biering, E., Hamre, L.A., Eichner, C., Krossøy, B., Nilsen, F., 4933 2009. Functional characterisation of the maternal yolk-associated protein (LsYAP) 4934 utilising systemic RNA interference in the salmon louse (Lepeophtheirus salmonis) 4935 (Crustacea: Copepoda). Int. J. Parasitol. 39, 1407–1415. 4936 Darwin, C. R. 1871. The descent of man, and selection in relation to sex. London: John 4937 Murray. Volume 1. 1st edition. 4938 David, J.P., Strode, C., Vontas, J., Nikou, D., Vaughan, A., Pignatelli, P.M., Louis, C., 4939 Hemingway, J., Ranson, H., 2005. The Anopheles gambiae detoxification chip: a 4940 highly specific microarray to study metabolic-based insecticide resistance in 4941 malaria vectors. PNAS 102, 4080–4. 4942 Davies, I.M., Rodger, G.K., 2000. A review of the use of ivermectin as a treatment for 4943 sea lice [Lepeophtheirus salmonis (Krøyer) and Caligus elongatus Nordmann] 4944 infestation in farmed Atlantic salmon (Salmo salar L .). Aquac. Res. 31, 869–883. 4945 Davies, T.G.E., Field, L.M., Usherwood, P.N.R., Williamson, M.S., 2007. DDT, 4946 pyrethrins, pyrethroids and insect sodium channels. IUBMB Life 59, 151–62.
242 4947 Dean, P., Hirt, R.P., Embley, T.M., 2016. Microsporidia: Why make nucleotides if you 4948 can steal them? PLOS Pathog. 12, e1005870. 4949 Dean, S.R., Meola, R.W., Meola, S.M., Sittertz-Bhatkar, H., Schenker, R., 1998. Mode 4950 of action of lufenuron on larval cat fleas (Siphonaptera: Pulicidae). J. Med. 4951 Entomol. 35, 720–4. 4952 DeBiasse, M.B., Kelly, M.W., 2015. Plastic and evolved responses to global change: 4953 What can we learn from comparative transcriptomics? J. Hered. 107, 71–81. 4954 Deegan née Clark, J.I., Dimmer, E.C., Mungall, C.J., 2010. Formalization of taxon- 4955 based constraints to detect inconsistencies in annotation and ontology 4956 development. BMC Bioinformatics 11, 530. 4957 Denholm, I., Devine, G.J., Horsberg, T.E., Sevatdal, S., Fallang, A., Nolan, D.V., 4958 Powell, R., 2002. Analysis and management of resistance to chemotherapeutants in 4959 salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae). Pest Manag. Sci. 58, 4960 528–36. 4961 Devonshire, A.L., Moores, G.D., 1982. A carboxylesterase with broad substrate 4962 specificity causes organophosphorus, carbamate and pyrethroid resistance in 4963 peach-potato aphids (Myzus persicae). Pestic. Biochem. Physiol. 18, 235–246. 4964 Dezelee, S., Bras, F., Contamine, D., Lopez-Ferber, M., Segretain, D., Teninges, D., 4965 1989. Molecular analysis of ref(2)P, a Drosophila gene implicated in sigma 4966 rhabdovirus multiplication and necessary for male fertility. EMBO J. 8, 3437– 4967 3446. 4968 DFO, 2017. Managing disease and parasites. Prot. Fish Heal. URL http://www.dfo- 4969 mpo.gc.ca/aquaculture/protect-protege/parasites-eng.html (accessed 9.23.17). 4970 Didier, E.S., Weiss, L.M., 2006. Microsporidiosis: current status. Curr Opin Infect Dis 4971 19, 485–492. 4972 Djimde, A., Doumbo, O., Cortese, J., Kayentao, K., Doumbo, S., Diourte, Y., Dicko, 4973 A., Su, X., Nomura, T., Fidock, D., Wellems, T., Plowe, C., 2001. A molecular 4974 marker for chloroquine-resistant Falciparum Malaria. English J. 344, 257–263. 4975 Djouaka, R.F., Bakare, A., Coulibaly, O.N., Akogbeto, M.C., Ranson, H., Hemingway, 4976 J., Strode, C., 2008. Expression of the cytochrome P450s, CYP6P3 and CYP6M2 4977 are significantly elevated in multiple pyrethroid resistant populations of Anopheles 4978 gambiae s.s. from Southern Benin and Nigeria. BMC Genomics 9, 538. 4979 Donnelly, M.J., Corbel, V., Weetman, D., Wilding, C.S., Williamson, M.S., Black IV, 4980 W.C., 2009. Does kdr genotype predict insecticide-resistance phenotype in 4981 mosquitoes? Trends Parasitol. 25, 213–219. 4982 Dorus, S., Wasbrough, E., Busby, J., Wilkins, E., Karr, T., 2010. Sperm proteomics 4983 reveals intensified sexual selection on mouse sperm membrane and acrosome 4984 genes. Mol. Biol. Evol. 27, 1235–1246. 4985 Douris, V., Steinbach, D., Panteleri, R., Livadaras, I., Pickett, J.A., Van Leeuwen, T., 4986 Vontas, J., 2016. Resistance mutation conserved between insects and mites 4987 unravels the benzoylurea insecticide mode of action on chitin biosynthesis. PNAS 4988 113, 14692–14697. 4989 Drapeau, M.D., Albert, S., Kucharski, R., Prusko, C., Maleszka, R., 2006. Evolution of 4990 the yellow/major royal jelly protein family and the emergence of social behavior in 4991 honey bees. Genome Res. 1385–1394. 4992 Dunn, A.M., Smith, J.E., 2001. Microsporidian life cycles and diversity: The
243 4993 relationship between virulence and transmission. Microbes Infect. 3, 381–388. 4994 Dussaubat, C., Brunet, J.-L., Higes, M., Colbourne, J.K., Lopez, J., Choi, J.-H., Martín- 4995 Hernández, R., Botías, C., Cousin, M., McDonnell, C., Bonnet, M., Belzunces, 4996 L.P., Moritz, R.F., Le Conte, Y., Alaux, C., 2012. Gut pathology and responses to 4997 the microsporidium Nosema ceranae in the honeybee Apis mellifera. PLoS One 7, 4998 e37017. 4999 Eads, B.D., Colbourne, J.K., Bohuski, E., Andrews, J., 2007. Profiling sex-biased gene 5000 expression during parthenogenetic reproduction in Daphnia pulex. BMC Genomics 5001 8, 464. 5002 Edomwande, E.O., Schoeman, A.T.S., Brits, J.A., Vandermerwe, M., 2000. Laboratory 5003 evaluation of lufenuron on immature stages of potato tuber moth (Lepidoptera : 5004 Gelechiidae). Horticultural Entomology 93, 1741–1743. 5005 Edvardsen, R.B., Dalvin, S., Furmanek, T., Malde, K., Mæhle, S., Kvamme, B.O., 5006 Skern-Mauritzen, R., 2014. Gene expression in five salmon louse (Lepeophtheirus 5007 salmonis, Krøyer 1837) tissues. Mar. Genomics 18, 39–44. 5008 Eichner, C., Dalvin, S., Skern-Mauritzen, R., Malde, K., Kongshaug, H., Nilsen, F., 5009 2015a. Characterization of a novel RXR receptor in the salmon louse 5010 (Lepeophtheirus salmonis, Copepoda) regulating growth and female reproduction. 5011 BMC Genomics 16, 81. 5012 Eichner, C., Frost, P., Dysvik, B., Jonassen, I., Kristiansen, B., Nilsen, F., 2008. Salmon 5013 louse (Lepeophtheirus salmonis) transcriptomes during post molting maturation 5014 and egg production, revealed using EST-sequencing and microarray analysis. BMC 5015 Genomics 15, 126. 5016 Eichner, C., Hamre, L.A., Nilsen, F., 2015b. Instar growth and molt increments in 5017 Lepeophtheirus salmonis (Copepoda: Caligidae) chalimus larvae. Parasitol. Int. 64, 5018 86–96. 5019 Eichner, C., Harasimczuk, E., Nilsen, F., Grotmol, S., Dalvin, S., 2015c. Molecular 5020 characterisation and functional analysis of LsChi2 , a chitinase found in the salmon 5021 louse ( Lepeophtheirus ... Exp. Parasitol. 151–152, 39–48. 5022 Eichner, C., Nilsen, F., Grotmol, S., Dalvin, S., 2014. A method for stable gene knock- 5023 down by RNA interference in larvae of the salmon louse (Lepeophtheirus 5024 salmonis). Exp. Parasitol. 140, 44–51. 5025 Eichner, C., Øvergård, A.C., Nilsen, F., Dalvin, S., 2015d. Molecular characterization 5026 and knock-down of salmon louse (Lepeophtheirus salmonis) prostaglandin E 5027 synthase. Exp. Parasitol. 159, 79–93. 5028 Eijkelenboom, A., Burgering, B.M.T., 2013. FOXOs: signalling integrators for 5029 homeostasis maintenance. Nat. Rev. Mol. Cell Biol. 14, 83–97. 5030 Eisen, M., Spellman, P., Brown, P., Botstein, D., 1999. Cluster analysis and display of 5031 genome-wide expression patterns. PNAS 95, 14863–68. 5032 Ellegren, H., Parsch, J., 2007. The evolution of sex-biased genes and sex-biased gene 5033 expression. Nat. Rev. Genet. 8, 689–98. 5034 Elliott, M., 1989. The Pyrethroids: Early Discovery, Reent Advances, and the Future. 5035 Pestic. Sci. 27, 337–351. 5036 Emoto, K., He, Y., Ye, B., Grueber, W.B., Adler, P.N., Jan, L.Y., Jan, Y.N., 2004. 5037 Control of dendritic branching and tiling by the tricornered-kinase/furry signaling 5038 pathway in Drosophila sensory neurons. Cell 119, 245–256.
244 5039 Espedal, P.G., Glover, K.A., Horsberg, T.E., Nilsen, F., 2013. Emamectin benzoate 5040 resistance and fitness in laboratory reared salmon lice (Lepeophtheirus salmonis). 5041 Aquaculture 416–417, 111–118. 5042 European Food Safety Authority (E.F.S.A)., 2010. Annual report on pesticide residues, 5043 EFSA Journal. 5044 European Medicines Agency, 2015. European public MRL assessment report (EPMAR) 5045 Lufenuron (fin fish). 5046 Fan, Z., You, F., Wang, L., Weng, S., Wu, Z., Hu, J., Zou, Y., Tan, X., Zhang, P., 2014. 5047 Gonadal transcriptome analysis of male and female olive flounder (Paralichthys 5048 olivaceus). Biomed Res. Int. 2014, 291067. 5049 FAO, 2016. Global aquaculture production statistics. Glob. Crustac. Cult. 2014. URL 5050 http://www.fao.org/fishery/statistics/global-aquaculture-production/query/en 5051 (accessed 11.4.16). 5052 FAO Fisheries and Aquaculture Department, 2013. Global aquaculture production 5053 statistics for the year 2011. 5054 FAO Fisheries and Aquaculture Department, 2012. World Review of Fisheries and 5055 Aquaculture: Part 1. 5056 Farlora, R., Araya-Garay, J., Gallardo-Escárate, C., 2014. Discovery of sex-related 5057 genes through high-throughput transcriptome sequencing from the salmon louse 5058 Caligus rogercresseyi. Mar. Genomics 15, 85–93. 5059 Fast, A.M.D., Burka, J.F., Johnson, S.C., Ross, N.W., 2003. Enzymes released from 5060 Lepeophtheirus salmonis in response to mucus from different salmonids. Am. Soc. 5061 Parasitol. 89, 7–13. 5062 Fast, M.D., 2014. Fish immune responses to parasitic copepod (namely sea lice) 5063 infection. Dev. Comp. Immunol. 43, 300–12. 5064 Fast, M.D., Johnson, S.C., Eddy, T.D., Pinto, D., Ross, N.W., 2007. Lepeophtheirus 5065 salmonis secretory/excretory products and their effects on Atlantic salmon immune 5066 gene regulation. Parasite Immunol. 29, 179–189. 5067 Fast, M.D., Muise, D.M., Easy, R.E., Ross, N.W., Johnson, S.C., 2006. The effects of 5068 Lepeophtheirus salmonis infections on the stress response and immunological 5069 status of Atlantic salmon (Salmo salar). Fish Shellfish Immunol. 21, 228–241. 5070 Fast, M.D., Ross, N.W., Muise, D.M., Johnson, S.C., 2006. Differential gene expression 5071 in Atlantic salmon infected with Lepeophtheirus salmonis. J. Aquat. Anim. Health 5072 18, 116–127. 5073 Fast, M.D., Ross, N.W., Mustafa, A., Sims, D.E., Stewart, C., Conboy, G.A., Speare, 5074 D.J., Johnson, G., Burka, J.F., 2002. Susceptibility of rainbow trout Oncorhynchus 5075 mykiss, Atlantic salmon Salmo salar and coho salmon Oncorhynchus kisutch to 5076 experimental infection with sea lice Lepeophtheirus salmonis. Dis. Aquat. Organ. 5077 52, 57–68. 5078 Ffrench-Constant, R.H., Daborn, P.J., Le Goff, G., 2004. The genetics and genomics of 5079 insecticide resistance. Trends Genet. 20, 163–70. 5080 Findlay, G.D., Yi, X., Maccoss, M.J., Swanson, W.J., 2008. Proteomics reveals novel 5081 Drosophila seminal fluid proteins transferred at mating. Plos Biol. 6, 1417–1426. 5082 Firth, K.J., Johnson, S.C., Ross, N.W., 2000. Characterization of proteases in the skin 5083 mucus of Atlantic salmon (Salmo salar) infected with the salmon louse 5084 (Lepeophtheirus salmonis) and in whole-body louse homogenate. J. Parasitol. 86,
245 5085 1199–205. 5086 Fitzpatrick, J.M., Johansen, M.V., Johnston, D.A., Dunne, D.W., Hoffmann, K.F., 2004. 5087 Gender-associated gene expression in two related strains of Schistosoma 5088 japonicum. Mol. Biochem. Parasitol. 136, 191–209. 5089 Fitzpatrick, J.M., Johnston, D. a., Williams, G.W., Williams, D.J., Freeman, T.C., 5090 Dunne, D.W., Hoffmann, K.F., 2005. An oligonucleotide microarray for 5091 transcriptome analysis of Schistosoma mansoni and its application/use to 5092 investigate gender-associated gene expression. Mol. Biochem. Parasitol. 141, 1–13. 5093 Fontenele, M., Lim, B., Oliveira, D., Buffolo, M., Perlman, D.H., Schupbach, T., 5094 Araujo, H., 2013. Calpain A modulates toll responses by limited Cactus/IκB 5095 proteolysis. Mol. Biol. Cell 24, 2966–80. 5096 Food and Drug Administration (FDA), 2016. Freedom of information summary for 5097 lufenuron import tolerance. Website: 5098 https://www.fda.gov/AnimalVeterinary/Products/ImportExports/ucm315830.htm 5099 Freeman, M., 2003. A hyperparasitic microsporidian infecting the salmon louse, 5100 Lepeophtheirus salmonis: an rDNA-based molecular phylogentic study. J. Fish 5101 Dis. 26, 667–676. 5102 Freeman, M., Sommerville, C., 2009. Desmozoon lepeophtherii n. gen., n. sp., 5103 (Microsporidia: Enterocytozoonidae) infecting the salmon louse Lepeophtheirus 5104 salmonis (Copepoda: Caligidae). Parasit. Vectors 2, 58. 5105 Freeman, M., Sommerville, C., 2011. Original observations of Desmozoon 5106 lepeophtherii, a microsporidian hyperparasite infecting the salmon louse 5107 Lepeophtheirus salmonis, and its subsequent detection by other researchers. 5108 Parasit. Vectors 4, 231. 5109 Frenzl, B., Stien, L.H., Cockerill, D., Oppedal, F., Richards, R.H., Shinn, A. P., Bron, 5110 J.E., Migaud, H., 2014. Manipulation of farmed Atlantic salmon swimming 5111 behaviour through the adjustment of lighting and feeding regimes as a tool for 5112 salmon lice control. Aquaculture 424–425, 183–188. 5113 Frost, P., Nilsen, F., 2003. Validation of reference genes for transcription profiling in 5114 the salmon louse, Lepeophtheirus salmonis, by quantitative real-time PCR. Vet. 5115 Parasitol. 118, 169–174. 5116 Gangishetti, U., Breitenbach, S., Zander, M., Saheb, S.K., Müller, U., Schwarz, H., 5117 Moussian, B., 2009. Effects of benzoylphenylurea on chitin synthesis and 5118 orientation in the cuticle of the Drosophila larva. Eur. J. Cell Biol. 88, 167–180. 5119 Gautam, R., Vanderstichel, R., Boerlage, A.S., Revie, C.W., Hammell, K.L., 2017. 5120 Evaluating bath treatment effectiveness in the control of sea lice burdens on 5121 Atlantic salmon in New Brunswick, Canada. J. Fish Dis. 40, 895–905. 5122 Gharbi, K., Matthews, L., Bron, J., Roberts, R., Tinch, A., Stear, M., 2015. The control 5123 of sea lice in Atlantic salmon by selective breeding. J. R. Soc. Interface 12, 574. 5124 Gilleard, J.S., Woods, D.J., Dow, J.A.T., 2005. Model-organism genomics in veterinary 5125 parasite drug- discovery. Trends Parasitol. 21, 302–305. 5126 Gleason, L.U., Burton, R.S., 2015. RNA-seq reveals regional differences in 5127 transcriptome response to heat stress in the marine snail Chlorostoma funebralis 5128 24, 610. 5129 Glendinning, S.K., Buckingham, S.D., Sattelle, D.B., Wonnacott, S., Wolstenholme, 5130 A.J., 2011. Glutamate-Gated chloride channels of Haemonchus contortus restore
246 5131 drug sensitivity to ivermectin resistant Caenorhabditis elegans. PLoS One 6. 5132 Glover, K., Stølen, Å., Messmer, A., Koop, B., Torrissen, O., Nilsen, F., 2011. 5133 Population genetic structure of the parasitic copepod Lepeophtheirus salmonis 5134 throughout the Atlantic. Mar. Ecol. Prog. Ser. 427, 161–172. 5135 Godwin, S.C., Dill, L.M., Reynolds, J.D., Krkošek, M., 2015. Sea lice, sockeye salmon, 5136 and foraging competition: lousy fish are lousy competitors. Can. J. Fish. Aquat. 5137 Sci. 72, 1113–1120. 5138 Gong, M., Shen, B., Gu, Y., Tian, H., Ma, L., Li, X., Yang, M., Hu, Y., Sun, Y., Hu, X., 5139 Li, J., Zhu, C., 2005. Serine proteinase over-expression in relation to deltamethrin 5140 resistance in Culex pipiens pallens. Arch. Biochem. Biophys. 438, 53–62. 5141 Gonzalez, E.B., Boer, F. De, 2017. The development of the Norwegian wrasse fishery 5142 and the use of wrasses as cleaner fish in the salmon aquaculture industry. Fish. Sci. 5143 83, 661-670. 5144 Granadino, B., Campuzano, S., Sanchez, L., 1990. The Drosophila melanogaster fl(2)d 5145 gene is needed the female-specific splicing of sex-lethal RNA. EMBO Journal 9, 5146 2597–2602. 5147 Grant, A.N., 2002. Medicines for sea lice. Pest Manag. Sci. 58, 521–527. 5148 Grave, K., Horsberg, T.E., Lunestad, B.T., Litleskare, I., 2004. Consumption of drugs 5149 for sea lice infestations in Norwegian fish farms: Methods for assessment of 5150 treatment patterns and treatment rate. Dis. Aquat. Organ. 60, 123–131. 5151 Greenway, P., 1985. Calcium balance and moulintg in the Crustacea. Biol. Rev. 60, 5152 425–454. 5153 Grimnes, A., Jakobsen, P.J., 1996. The physiological effects of salmon lice infection on 5154 post-smolt of Atlantic salmon. J. Fish Biol. 48, 1179–1194. 5155 Grote, P., Conradt, B., 2006. The PLZF-like protein TRA-4 cooperates with the gli-like 5156 transcription factor TRA-1 to promote female development in C. elegans. Dev. 5157 Cell 11, 561–573. 5158 Gulia-Nuss, M., Nuss, A.B., Meyer, J.M., Sonenshine, D.E., Roe, R.M., Waterhouse, 5159 R.M., Sattelle, D.B., de la Fuente, J., Ribeiro, J.M., Megy, K., Thimmapuram, J., 5160 Miller, J.R., Walenz, B.P., Koren, S., Hostetler, J.B., Thiagarajan, M., Joardar, 5161 V.S., Hannick, L.I., Bidwell, S., Hammond, M.P., Young, S., Zeng, Q., Abrudan, 5162 J.L., Almeida, F.C., Ayllón, N., Bhide, K., Bissinger, B.W., Bonzon-Kulichenko, 5163 E., Buckingham, S.D., Caffrey, D.R., Caimano, M.J., Croset, V., Driscoll, T., 5164 Gilbert, D., Gillespie, J.J., Giraldo-Calderón, G.I., Grabowski, J.M., Jiang, D., 5165 Khalil, S.M.S., Kim, D., Kocan, K.M., Koči, J., Kuhn, R.J., Kurtti, T.J., Lees, K., 5166 Lang, E.G., Kennedy, R.C., Kwon, H., Perera, R., Qi, Y., Radolf, J.D., Sakamoto, 5167 J.M., Sánchez-Gracia, A., Severo, M.S., Silverman, N., Šimo, L., Tojo, M., 5168 Tornador, C., Van Zee, J.P., Vázquez, J., Vieira, F.G., Villar, M., Wespiser, A.R., 5169 Yang, Y., Zhu, J., Arensburger, P., Pietrantonio, P. V., Barker, S.C., Shao, R., 5170 Zdobnov, E.M., Hauser, F., Grimmelikhuijzen, C.J.P., Park, Y., Rozas, J., Benton, 5171 R., Pedra, J.H.F., Nelson, D.R., Unger, M.F., Tubio, J.M.C., Tu, Z., Robertson, 5172 H.M., Shumway, M., Sutton, G., Wortman, J.R., Lawson, D., Wikel, S.K., Nene, 5173 V.M., Fraser, C.M., Collins, F.H., Birren, B., Nelson, K.E., Caler, E., Hill, C.A., 5174 2016. Genomic insights into the Ixodes scapularis tick vector of Lyme disease. 5175 Nat. Commun. 7, 10507. 5176 Guo, H.Z., Zou, P.F., Fu, J.P., Guo, Z., Zhu, B.K., Nie, P., Chang, M.X., 2011.
247 5177 Characterization of two C-type lectin-like domain (CTLD)-containing proteins 5178 from the cDNA library of Chinese mitten crab Eriocheir sinensis. Fish Shellfish 5179 Immunol. 30, 515–24. 5180 Hacker, C., Howell, M., Bhella, D., Lucocq, J., 2014. Strategies for maximizing ATP 5181 supply in the microsporidian Encephalitozoon cuniculi: Direct binding of 5182 mitochondria to the parasitophorous vacuole and clustering of the mitochondrial 5183 porin VDAC. Cell. Microbiol. 16, 565–579. 5184 Hajek, A.E., Delalibera, I., 2010. Fungal pathogens as classical biological control agents 5185 against arthropods. BioControl 55, 147–158. 5186 Hamre, L.A., Eichner, C., Caipang, C.M.A., Dalvin, S.T., Bron, J.E., Nilsen, F., 5187 Boxshall, G., Skern-Mauritzen, R., 2013. The salmon louse Lepeophtheirus 5188 salmonis (Copepoda: Caligidae) life cycle has only two chalimus stages. PLoS One 5189 8, e73539. 5190 Hardstone, M.C., Leichter, C., Harrington, L.C., Kasai, S., Tomita, T., Scott, J.G., 2007. 5191 Cytochrome P450 monooxygenase-mediated permethrin resistance confers limited 5192 and larval specific cross-resistance in the southern house mosquito, Culex pipiens 5193 quinquefasciatus. Pestic. Biochem. Physiol. 89, 175–184. 5194 Hart, J.L., Thacker, J.R.M., Braidwood, J.C., Fraser, N.R., Matthews, J.E., 1997. Novel 5195 cypermethrin formulation for the control of sea lice on salmon (Salmo salar). Vet. 5196 Rec. 140, 179–181. 5197 Hastie, L.C., Wallace, C., Birkett, M. a., Douglas, A., Jones, O., Mordue (Luntz), A.J., 5198 Ritchie, G., Pickett, J.A., Webster, J.L., Bowman, A. S., 2013. Prevalence and 5199 infection intensity of sea lice (Lepeophtheirus salmonis) on Atlantic salmon 5200 (Salmo salar) host is reduced by the non-host compound 2-aminoacetophenone. 5201 Aquaculture 410–411, 179–183. 5202 Hay, N., Sonenberg, N., 2004. Upstream and downstream of mTOR. Genes Dev. 18, 5203 1926–1945. 5204 Haya, K., Burridge, L.E., Davies, I.M., Ervik, A., 2005. A review and assessment of 5205 environmental risk of chemicals used for the treatment of sea lice infestations of 5206 cultured salmon. Handb. Environ. Chem. 5, 305–340. 5207 Hedrick, A. V, Temeles, E.J., 1989. The evolution of sexual dimorphism in animals: 5208 Hypotheses and tests. Trends Ecol. Evol. 4, 136–8. 5209 Heinz, E., Williams, T.A., Nakjang, S., Noel, C.J., Swan, D.C., Goldberg, A. V., Harris, 5210 S.R., Weinmaier, T., Markert, S., Becher, D., Bernhardt, J., Dagan, T., Hacker, C., 5211 Lucocq, J.M., Schweder, T., Rattei, T., Hall, N., Hirt, R.P., Embley, T.M., 2012. 5212 The genome of the obligate intracellular parasite Trachipleistophora hominis: New 5213 insights into microsporidian genome dynamics and reductive evolution. PLoS 5214 Pathog. 8, e1002979. 5215 Helgesen, K., Jansen, P., 2017. Drastic changes in Norwegian salmon lice management 5216 in 2016, Aquaculture Canada and Sea Farmers 2017. pp. 32–33. 5217 Helgesen, K.O., Romstad, H., Aaen, S.M., Horsberg, T.E., 2015. First report of reduced 5218 sensitivity towards hydrogen peroxide found in the salmon louse Lepeophtheirus 5219 salmonis in Norway. Aquac. Reports 1, 37–42. 5220 Helland, I.P., Uglem, I., Jansen, P.A., Diserud, O.H., Bjorn, P.A., Finstad, B., 2015. 5221 Statistical and ecological challenges of monitoring parasitic salmon lice 5222 infestations in wild salmonid fish stocks. Aquac. Environ. Interact. 7, 267–280.
248 5223 Hellemans, J., Mortier, G., De Paepe, A., Speleman, F., Vandesompele, J., 2007. qBase 5224 relative quantification framework and software for management and automated 5225 analysis of real-time quantitative PCR data. Genome Biol. 8, R19. 5226 Hershberg, R., Petrov, D.A., 2008. Selection on codon bias. Annu. Rev. Genet. 42, 287– 5227 299. 5228 Heuch, P.A., Nordhagen, J.R., Schram, T.A., 2000. Egg production in the salmon louse 5229 [Lepeophtheirus salmonis (Krøyer)] in relation to origin and water temperature. 5230 Aquac. Res. 31, 805–814. 5231 Heuch, P.A., Parsons, A., Boxaspen, K., 1995. Diel vertical migration - a possible host- 5232 finding mechanism in salmon louse (Lepeophtheirus-Salmonis) copepodids. Can. J. 5233 Fish. Aquat. Sci. 52, 681–689. 5234 Heumann, J., Carmichael, S., Bron, J.E., Tildesley, A., Sturm, A., 2012. Molecular 5235 cloning and characterisation of a novel P-glycoprotein in the salmon louse 5236 Lepeophtheirus salmonis. Comp. Biochem. Physiol. - C Toxicol. Pharmacol. 155, 5237 198–205. 5238 Higes, M., García-Palenciab, P., Martín-Hernándeza, R., Meanac, A., 2007. 5239 Experimental infection of Apis mellifera honeybees with Nosema ceranae 5240 (Microsporidia). J. Invertebr. Pathol. 94, 211–217. 5241 Holm, L., Ridderstråle, Y., Knutsson, P., 1996. Localisation of carbonic anhydrase in 5242 the sperm storing regions of the domestic hen oviduct. Cells Tissues Organs 156, 5243 253–260. 5244 Holt, H.L., Aronstein, K.A., Grozinger, C.M., 2013. Chronic parasitization by Nosema 5245 microsporidia causes global expression changes in core nutritional, metabolic and 5246 behavioral pathways in honey bee workers (Apis mellifera). BMC Genomics 14, 5247 799. 5248 Horsberg, T.E., 2012. Avermectin use in aquaculture. Curr. Pharm. Biotechnol. 13, 5249 1095–1102. 5250 Hu, A.-K., Chen, R.-J., Zhu, X.-R., Gu, J.-H., Liu, Z.-P., 2015. Immunosuppressive 5251 effect of hypodermin C on complement component 3 in vitro. Cell Biochem. 5252 Biophys. 72, 93–98. 5253 Huang, C.G., Lamitina, T., Agre, P., Strange, K., 2007. Functional analysis of the 5254 aquaporin gene family in Caenorhabditis elegans. Am. J. Physiol. Cell Physiol. 5255 292, 1867–1873. 5256 Huang, D., Sherman, B., Lempick, R., 2009. Bioinformatics enrichment tools: paths 5257 toward the comprehensive functional analysis of large gene lists. Nucleic Acids 5258 Res. 37, 1–13. 5259 Huang, D., Sherman, B., Lempick, R., 2008. Systematic and integrative analysis of 5260 large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57. 5261 Huang, D.W., Sherman, B.T., Tan, Q., Kir, J., Liu, D., Bryant, D., Guo, Y., Stephens, 5262 R., Baseler, M.W., Lane, H.C., Lempicki, R.A., 2007. DAVID Bioinformatics 5263 Resources: Expanded annotation database and novel algorithms to better extract 5264 biology from large gene lists. Nucleic Acids Res. 35, 169–175. 5265 Hull, M.Q., Pike, A.W., Mordue, A. J., Rae, G.H., 1998. Patterns of pair formation and 5266 mating in an ectoparasitic caligid copepod Lepeophtheirus salmonis (Krøyer 5267 1837): implications for its sensory and mating biology. Philos. Trans. R. Soc. B 5268 Biol. Sci. 353, 753–764.
249 5269 Humphrey, M., Ringrose, P., 1986. Peptides and related drugs: A review of their 5270 absorption, metabolism, and excretion. Drug Metab. Rev. 17, 283–310. 5271 Huys, R., Boxshall, G.A., 1991. Copepod Evolution. The Ray Society, London. 5272 Ibrahim, S.S., Ndula, M., Riveron, J.M., Irving, H., Wondji, C.S., 2016. The P450 5273 CYP6Z1 confers carbamate/pyrethroid cross-resistance in a major African malaria 5274 vector beside a novel carbamate-insensitive N485I acetylcholinesterase-1 mutation. 5275 Mol. Ecol. 25, 3436–3452. 5276 Igboeli, O.O., Burka, J.F., Fast, M.D., 2014. Lepeophtheirus salmonis: a persisting 5277 challenge for salmon aquaculture. Anim. Front. 4, 22–32. 5278 Igboeli, O.O., Burka, J.F., Fast, M.D., 2013. Sea lice population and sex differences in 5279 P-glycoprotein expression and emamectin benzoate resistance on salmon farms in 5280 the Bay of Fundy, New Brunswick, Canada. Pest Manag. Sci. 70, 905–14. 5281 Igboeli, O.O., Fast, M.D., Heumann, J., Burka, J.F., 2012. Role of P-glycoprotein in 5282 emamectin benzoate (SLICE®) resistance in sea lice, Lepeophtheirus salmonis. 5283 Aquaculture 344–349, 40–47. 5284 Inaba, K., Dréanno, C., Cosson, J., 2003. Control of flatfish sperm motility by CO2 and 5285 carbonic anhydrase. Cell Motil. Cytoskeleton 55, 174–187. 5286 Ingvarsdóttir, A., Birkett, M.A., Duce, I., Mordue, W., Pickett, J.A., Wadhams, L.J., 5287 Mordue, A.J., 2002. Role of semiochemicals in mate location by parasitic sea 5288 louse, Lepeophtheirus salmonis. J. Chem. Ecol. 28, 2107–2117. 5289 Inoue, H., Ozaki, N., Nagasawa, H., 2001. Purification and structural determination of a 5290 phosphorylated peptide with anti-calcification and chitin-binding activities in the 5291 exoskeleton of the crayfish, Procambarus clarkii. Biosci. Biotechnol. Biochem. 65, 5292 1840–1848. 5293 Ishtiaq, M., Razaq, M., Saleem, M.A., Anjum, F., Noor ul Ane, M., Raza, A.M., 5294 Wright, D.J., 2014. Stability, cross-resistance and fitness costs of resistance to 5295 emamectin benzoate in a re-selected field population of the beet armyworm, 5296 Spodoptera exigua (Lepidoptera: Noctuidae). Crop Prot. 65, 227–231. 5297 Itoh, S., Uyeda, A., Hukuoka, Y., Fujimori, K.E., Matsuda, A., 2004. Muscle-specific 5298 protein MDP77 specifically promotes motor nerve regeneration in rats. Neurosci. 5299 Lett. 360, 175–177. 5300 Jakob, U., Gaestel, M., Engel, K., Buchner, J., 1993. Small heat shock proteins are 5301 molecular chaperones. J. Biol. Chem. 268, 1517–1520. 5302 Jantzen, S.G., Sutherland, B.J., Minkley, D.R., Koop, B.F., 2011. GO Trimming: 5303 Systematically reducing redundancy in large Gene Ontology datasets. BMC Res. 5304 Notes 4, 267. 5305 J Wotton, H., Purcell, S., Covello, J., Koop, B., Fast, M., 2014. Comparison of host 5306 selection and gene expression of adult Lepeophtheirus salmonis and Salmo salar 5307 during a cohabitation of initially infected and uninfected fish. J. Aquac. Res. Dev. 5308 5, 226. 5309 Jodaa Holm, H., Wadsworth, S., Bjelland, A.K., Krasnov, A., Evensen, O., Skugor, S., 5310 2016. Dietary phytochemicals modulate skin gene expression profiles and result in 5311 reduced lice counts after experimental infection in Atlantic salmon. Parasit. 5312 Vectors 9, 271. 5313 Johnson, S., 1993. A comparison of development and growth rates of Lepeophtheirus 5314 salmonis (Copepoda: Caligidae) on naïve Atlantic (Salmo salar) and Chinook
250 5315 (Oncorhynchus tshawytscha) Salmon, in: Boxshall, G., Defaye, D. (Eds.), 5316 Pathogens of Wild Farmed Fish: Sea Lice. Ellis Horwood, pp. 68–82. 5317 Johnson, S., Ewart, K., Osborne, J., Delage, D., Ross, N., Murray, H., 2002. Molecular 5318 cloning of trypsin cDNAs and trypsin gene expression in the salmon louse 5319 Lepeophtheirus salmonis (Copepoda: Caligidae). Parasitol. Res. 88, 789–796. 5320 Johnson, S., Jakob, E., 2012. Sea lice parasitism. American Fisheries Unit Sites. pgs 1- 5321 16 5322 Johnson, S.C., Albright, L.J., 1992. Comparative susceptibility and histopathology of 5323 the response of naive Atlantic, chinook and coho salmon to experimental infection 5324 with Lepeophtheirus salmonis (Copepoda: Caligidae). Dis. Aquat. Organ. 14, 179– 5325 193. 5326 Johnson, S.C., Albright, L.J., 1991. The developmental stages of Lepeophtheirus 5327 salmonis (Krøyer , 1837) (Copepoda : Caligidae). Can. J. Zool. 69, 929–950. 5328 Johnson, S.C., Constible, J.M., Richard, J., 1993. Laboratory investigations on the 5329 efficacy of hydrogen peroxide against the salmon louse Lepeophtheirus salmonis 5330 and its toxicological and histopathological effects on Atlantic salmon Salmo salar 5331 and chinook salmon Oncorhynchus tshawytscha. Dis. Aquat. Organ. 17, 197–204. 5332 Johnson, S.C., Treasurer, J.W., Bravo, S., Nagasawa, K., Kabata, Z., 2004. A review of 5333 the impact of parasitic copepods on marine aquaculture. Zool. Stud. 43, 229–243. 5334 Jones, P.G., Hammell, K.L., Dohoo, I.R., Revie, C.W., 2012. Effectiveness of 5335 emamectin benzoate for treatment of Lepeophtheirus salmonis on farmed Atlantic 5336 salmon Salmo salar in the Bay of Fundy, Canada. Dis. Aquat. Organ. 102, 53–64. 5337 Jones, P.G., Hammell, K.L., Gettinby, G., Revie, C.W., 2013. Detection of emamectin 5338 benzoate tolerance emergence in different life stages of sea lice, Lepeophtheirus 5339 salmonis, on farmed Atlantic salmon, Salmo salar L. J. Fish Dis. 36, 209–220. 5340 Jones, S., 2013. Defence against the dark arts: Mechanisms of resistance among salmon 5341 to the parasitic copepod Lepeophtheirus salmonis. J. Aquac. Res. Dev. 1, 6. 5342 Jones, S.R.M., Fast, M.D., Johnson, S.C., Groman, D.B., 2007. Differential rejection of 5343 salmon lice by pink and chum salmon: disease consequences and expression of 5344 proinflammatory genes. Dis. Aquat. Organ. 75, 229–238. 5345 Jones, S.R.M., Goh, B., Prosperi-Porta, G., 2003. Duration and method of fixation 5346 affects the sensitivity of a digoxygenin-labelled DNA probe in detecting Kudoa 5347 thyrsites in Atlantic salmon skeletal muscle. Aquaculture 220, 157–164. 5348 Jones, S.R.M., Kim, E., Dawe, S., 2006. Experimental infections with Lepeophtheirus 5349 salmonis (Krøyer) on threespine sticklebacks, Gasterosteus aculeatus L., and 5350 juvenile Pacific salmon, Oncorhynchus spp. J. Fish Dis. 29, 489–495. 5351 Jones, S.R.M., Prosperi-Porta, G., 2011. The diversity of sea lice (Copepoda: Caligidae) 5352 parasitic on threespine stickleback (Gasterosteus aculeatus) in coastal British 5353 Columbia. J. Parasitol. 97, 399–405. 5354 Jones, S.R.M., Prosperi-Porta, G., Kim, E., 2012. The diversity of microsporidia in 5355 parasitic copepods (Caligidae: Siphonostomatoida) in the northeast Pacific Ocean 5356 with description of Facilispora margolisi n. g., n. sp. and a new family 5357 Facilisporidae n. fam. J. Eukaryot. Microbiol. 59, 206–217. 5358 Jónsdóttir, H., Bron, J., Wooten, H., Turnbull, J., 1992. The histopathology associated 5359 with the pre-adult and adult stages of Lepeophtheirus salmonis on the Atlantic 5360 salmon, Salmo salar L. J. Fish Dis. 15, 521–527.
251 5361 Jormalainen, V., 1998. Precopulatory mate guarding in crustaceans: Male competitive 5362 strategy and intersexual conflict. Q. Rev. Biol. 73, 275–304. 5363 Joyce, A.R., Palsson, B.Ø., 2006. The model organism as a system: integrating “omics” 5364 data sets. Nat. Rev. Mol. Cell Biol. 7, 198–210. 5365 Kanehisa, M., Goto, S., 2000. KEGG: Kyoto encyclopaedia of genes and genomes. 5366 Nucl. Acids Res. 28, 27–30. 5367 Kanehisa, M., Goto, S., Sato, Y., Kawashima, M., Furumichi, M., Tanabe, M., 2014. 5368 Data, information, knowledge and principle: Back to metabolism in KEGG. 5369 Nucleic Acids Res. 42, D199–D205. 5370 Kaplan, R.M., 2004. Drug resistance in nematodes of veterinary importance: a status 5371 report. Trends Parasitol. 20, 477–481. 5372 Kaplan, R.M., Vidyashankar, A.N., 2012. An inconvenient truth: Global worming and 5373 anthelmintic resistance. Vet. Parasitol. 186, 70–78. 5374 Karami-Mohajeri, S., Abdollahi, M., 2011. Toxic influence of organophosphate, 5375 carbamate, and organochlorine pesticides on cellular metabolism of lipids, 5376 proteins, and carbohydrates: A systematic review. Hum. Exp. Toxicol. 30, 1119– 5377 40. 5378 Karoonuthaisiri, N., Sittikankeaw, K., Preechaphol, R., Kalachikov, S., Wongsurawat, 5379 T., Uawisetwathana, U., Russo, J.J., Ju, J., Klinbunga, S., Kirtikara, K., 2009. 5380 ReproArray(GTS): A cDNA microarray for identification of reproduction-related 5381 genes in the giant tiger shrimp Penaeus monodon and characterization of a novel 5382 nuclear autoantigenic sperm protein (NASP) gene. Comp. Biochem. Physiol. Part 5383 D. Genomics Proteomics 4, 90–9. 5384 Katinka, M.D., Duprat, S., Cornillot, E., Méténier, G., Thomarat, F., Prensier, G., 5385 Barbe, V., Peyretaillade, E., Brottier, P., Wincker, P., Delbac, F., El Alaoui, H., 5386 Peyret, P., Saurin, W., Gouy, M., Weissenbach, J., Vivarès, C.P., 2001. Genome 5387 sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. 5388 Nature 414, 450–453. 5389 Kato, N., Mueller, C.R., Wessely, V., Lan, Q., Christensen, B.M., 2005. Aedes aegypti 5390 phosphohexomutases and uridine diphosphate-hexose pyrophosphorylases: 5391 Comparison of primary sequences, substrate specificities and temporal 5392 transcription. Insect Mol. Biol. 14, 615–624. 5393 Kaur, K., Bakke, M.J., Nilsen, F., Horsberg, T.E., 2015a. Identification and molecular 5394 characterization of two acetylcholinesterases from the salmon louse, 5395 Lepeophtheirus salmonis. PLoS One 10, e0125362. 5396 Kaur, K., Besnier, F., Glover, K.A., Nilsen, F., Aspehaug, V.T., Fjørtoft, H.B., 5397 Horsberg, T.E., 2017. The mechanism (Phe362Tyr mutation) behind resistance in 5398 Lepeophtheirus salmonis pre-dates organophosphate use in salmon farming. Sci. 5399 Rep. 7, 12349. 5400 Kaur, K., Helgesen, K.O., Bakke, M.J., Horsberg, T.E., 2015b. Mechanism behind 5401 resistance against the organophosphate azamethiphos in salmon lice 5402 (Lepeophtheirus salmonis). PLoS One 10, e0124220. 5403 Kaur, K., Jansen, P.A., Aspehaug, V.T., Horsberg, T.E., 2016. Phe362Tyr in AChE: A 5404 major factor responsible for azamethiphos resistance in Lepeophtheirus salmonis in 5405 Norway. PLoS One 11, e0149264. 5406 Keeling, P., 2009. Five questions about microsporidia. PLoS Pathog. 5, e1000489.
252 5407 Keeling, P.J., Fast, N.M., 2002. Microsporidia: biology and evolution of highly reduced 5408 intracellular parasites. Annu.Rev.Microbiol. 56, 93–116. 5409 Kelleher, E.S., Watts, T.D., LaFlamme, B.A., Haynes, P.A., Markow, T.A., 2009. 5410 Proteomic analysis of Drosophila mojavensis male accessory glands suggests 5411 novel classes of seminal fluid proteins. Insect Biochem. Mol. Biol. 39, 366–371. 5412 Kelly, A., Hatcher, M.J., Dunn, A.M., 2003. The impact of a vertically transmitted 5413 microsporidian, Nosema granulosis on the fitness of its Gammarus duebeni host 5414 under stressful environmental conditions. Parasitology 126, 119–124. 5415 Kerman, B.E., Cheshire, A.M., Myat, M.M., Andrew, D.J., 2008. Ribbon modulates 5416 apical membrane during tube elongation through crumbs and moesin. Dev. Biol. 5417 320, 278–288. 5418 Khaitovich, P., Hellmann, I., Enard, W., Nowick, K., Leinweber, M., Franz, H., Weiss, 5419 G., Lachmann, M., Pääbo, S., 2005. Parallel patterns of evolution in the genomes 5420 and transcriptomes of humans and chimpanzees. Am. Assoc. Adv. Sci. 309, 1850– 5421 1854. 5422 Khalturin, K., Hemmrich, G., Fraune, S., Augustin, R., Bosch, T.C.G., 2009. More than 5423 just orphans: are taxonomically-restricted genes important in evolution? Trends 5424 Genet. 25, 404–413. 5425 Khan, M., Dalvin, S., Nilsen, F., Male, R., 2017. Microsomal Triglyceride Transfer 5426 Protein (MTP) in the ectoparasitic crustacean salmon louse (L. salmonis). J. Lipid 5427 Res. 58, 1613–23. 5428 Klein, B., Le Moullac, G., Sellos, D., Van Wormhoudt, A., 1996. Molecular cloning 5429 and sequencing of trypsin cDNAs from Penaeus vannamei (Crustacea, Decapoda): 5430 Use in assessing gene expression during the moult cycle. Int. J. Biochem. Cell 5431 Biol. 28, 551–563. 5432 Klocke, J.A., Chan, B.G., 1982. Effects of cotton condensed tannin on feeding and 5433 digestion in the cotton pest, Heliothis zea. J. Insect Physiol. 28, 911–915. 5434 Koike-Kumagai, M., Yasunaga, K., Morikawa, R., Kanamori, T., Emoto, K., 2009. The 5435 target of rapamycin complex 2 controls dendritic tiling of Drosophila sensory 5436 neurons through the tricornered kinase signalling pathway. EMBO J. 28, 3879–92. 5437 Komisarczuk, A.Z., Grotmol, S., Nilsen, F., 2017. Ionotropic receptors signal host 5438 recognition in the salmon louse (Lepeophtheirus salmonis, Copepoda ). PLOS One 5439 12, e0178812. 5440 Konno, A., Shiba, K., Cai, C., Inaba, K., 2015. Branchial cilia and sperm flagella recruit 5441 distinct axonemal components. PLoS One 10, e0126005. 5442 Konstandi, O. A., Papassideri, I.S., Stravopodis, D.J., Kenoutis, C.A., Hasan, Z., 5443 Katsorchis, T., Wever, R., Margaritis, L.H., 2005. The enzymatic component of 5444 Drosophila melanogaster chorion is the Pxd peroxidase. Insect Biochem. Mol. 5445 Biol. 35, 1043–1057. 5446 Kostaropoulos, I., Papadopoulos, A.I., Metaxakis, A., Boukouvala, E., Papadopoulou- 5447 Mourkidou, E., 2001. Glutathione S-transferase in the defence against pyrethroids 5448 in insects. Insect Biochem. Mol. Biol. 31, 313–319. 5449 Kranthi, K.R., Jadhav, D., Wanjari, R., Kranthi, S., Russell, D., 2001. Pyrethroid 5450 resistance and mechanisms of resistance in field strains of Helicoverpa armigera 5451 (Lepidoptera: Noctuidae). J. Econ. Entomol. 94, 253–263. 5452 Krause, R.M., Buisson, B., Bertrand, S., Corringer, P., Galzi, J., Changeux, J., Bertrand,
253 5453 D., Centre, U.R.A., De, N., 1998. Ivermectin: A positive allosteric effector of the 5454 a7 neuronal nicotinic acetylcholine receptor. Mol. Pharmacol. 53, 283–294. 5455 Krkošek, M., Lewis, M., Volpe, J., 2005. Transmission dynamics of parasitic sea lice 5456 from farm to wild salmon. Proc. Biol. Sci. 272, 689–696. 5457 Kuballa, A. V, Elizur, A., 2008. Differential expression profiling of components 5458 associated with exoskeletal hardening in crustaceans. BMC Genomics 9, 575. 5459 Kuballa, A. V, Holton, T.A., Paterson, B., Elizur, A., 2011. Moult cycle specific 5460 differential gene expression profiling of the crab Portunus pelagicus. BMC 5461 Genomics 147, 147. 5462 Kumar, S., Jones, M., Koutsovoulos, G., Clarke, M., Blaxter, M., 2013. Blobology: 5463 Exploring raw genome data for contaminants, symbionts and parasites using taxon- 5464 annotated GC-coverage plots. Front. Genet. 4, 237. 5465 Kvamme, B.O., Skern, R., Frost, P., Nilsen, F., 2004. Molecular characterisation of five 5466 trypsin-like peptidase transcripts from the salmon louse (Lepeophtheirus salmonis) 5467 intestine. Int. J. Parasitol. 34, 823–832. 5468 Laflamme, B.A., Wolfner, M.F., 2013. Identification and function of proteolysis 5469 regulators in seminal fluid. Mol. Reprod. Dev. 80, 80–101. 5470 Landry, C.R., Aubin-Horth, N., 2007. Ecological anotation of genes and genomes 5471 through ecological genomics. Mol. Ecol. 16, 4419–4421. 5472 Laurell, H., Iacovoni, J.S., Abot, A., Svec, D., 2012. Correction of RT – qPCR data for 5473 genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51. 5474 Lauritano, C., Procaccini, G., Ianora, A., 2012. Gene expression patterns and stress 5475 response in marine copepods. Mar. Environ. Res. 76, 22–31. 5476 Leclercq, E., Davie, A., Migaud, H., 2014. Delousing efficiency of farmed ballan 5477 wrasse (Labrus bergylta) against Lepeophtheirus salmonis infecting Atlantic 5478 salmon (Salmo salar) post-smolts. Pest Manag. Sci. 70, 1274–82. 5479 Lee, M.S.Y., Soubrier, J., Edgecombe, G.D., 2013. Rates of phenotypic and genomic 5480 evolution during the Cambrian explosion. Curr. Biol. 23, 1889–1895. 5481 Lees, F., Baillie, M., Gettinby, G., Revie, C.W., 2008. The efficacy of emamectin 5482 benzoate against infestations of Lepeophtheirus salmonis on farmed Atlantic 5483 salmon (Salmo salar L) in Scotland, 2002-2006. PLoS One 3, e1549. 5484 Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other 5485 multidrug resistance transporters in the pharmacology of anthelmintics: Prospects 5486 for reversing transport-dependent anthelmintic resistance. Int. J. Parasitol. Drugs 5487 drug Resist. 2, 58–75. 5488 Lewis, S.E., Mannion, R.J., White, F.A., Coggeshall, R.E., Beggs, S., Costigan, M., 5489 Martin, J.L., Dillmann, W.H., Woolf, C.J., 1999. A role for HSP27 in sensory 5490 neuron survival. J. Neurosci. 19, 8945–8953. 5491 Liang, P., Amons, R., Clegg, J.S., MacRae, T.H., 1997. Molecular characterization of a 5492 small heat shock/α-crystallin protein in encysted artemia embryos. Mol. Biol. 272, 5493 19051–19058. 5494 Liao, P.C., Lin, H.Y., Yuh, C.H., Yu, L.K., Wang, H.-D., 2008. The effect of neuronal 5495 expression of heat shock proteins 26 and 27 on lifespan, neurodegeneration, and 5496 apoptosis in Drosophila. Biochem. Biophys. Res. Commun. 376, 637–41. 5497 Ligoxygakis, P., Pelte, N., Hoffmann, J.A., Reichhart, J.M., 2002. Activation of 5498 Drosophila Toll during fungal infection by a blood serine protease. Science 297,
254 5499 114–116. 5500 Liu, N., Scott, J., 1995. Genetics of resistance to pyrethroid insecticides in the house fly, 5501 Musca domestica. Pestic. Biochem. Physiol. 52, 116–124. 5502 Liu, N., Yue, X., 2000. Insecticide resistance and cross-resistance in the house fly 5503 (Diptera: Muscidae). Entomol. Soc. Am. 93, 1269–1275. 5504 Liu, Y., Bjelland, H., 2014. Estimating costs of sea lice control strategy in Norway. 5505 Prev. Vet. Med. 117, 469–477. 5506 Ljungfeldt, L., Espedal, P.G., Nilsen, F., Skern-Mauritzen, M., Glover, K.A., 2014. A 5507 common-garden experiment to quantify evolutionary processes in copepods: The 5508 case of emamectin benzoate resistance in the parasitic sea louse Lepeophtheirus 5509 salmonis. BMC Evol. Biol. 14, 108. 5510 Llewellyn, M.S., Leadbeater, S., Garcia, C., Sylvain, F.E., Custodio, M., Ang, K.P., 5511 Powell, F., Carvalho, G.R., Creer, S., Elliot, J., Derome, N., 2017. Parasitism 5512 perturbs the mucosal microbiome of Atlantic Salmon. Sci Rep. 7, 43465. 5513 Lomer, C., Bateman, R., Johnson, D., Langewald, J., Thomas, M., 2001. Biological 5514 control of locusts and grasshoppers. Annu. Rev Entomol 46, 667–702. 5515 Lovdata, 2012. Regulations on combating salmon lice in aquaculture facilities. Website: 5516 https://lovdata.no/ 5517 Lv, Y., Lei, Z., Hong, S., Wang, W., Zhang, D., Zhou, D., Sun, Y., Ma, L., Shen, B., 5518 Zhu, C., 2015. Venom allergen 5 is associated with deltamethrin resistance in 5519 Culex pipiens pallens (Diptera: Culicidae). J. Med. Entomol. 52, 672–82. 5520 Mack, P.D., Kapelnikov, A., Heifetz, Y., Bender, M., 2006. Mating-responsive genes in 5521 reproductive tissues of female Drosophila melanogaster. PNAS 103, 10358– 5522 10363. 5523 Mackinnon, B.M., 1995. The poor potential of cunner, Tautogolabrus adspersus, to act 5524 as a cleaner fish in removing sea lice (caligus elongatus) from farmed salmon in 5525 eastern Canada. Can. J. Fish. Aquat. Sci. 177, 175–177. 5526 Malone, J.H., Hawkins, D.L., Michalak, P., 2006. Sex-biased gene expression in a ZW 5527 sex determination system. J. Mol. Evol. 63, 427–36. 5528 Mann, K., Weiss, I.M., André, S., Gabius, H.J., Fritz, M., 2000. The amino-acid 5529 sequence of the abalone (Haliotis laevigata) nacre protein perlucin. Eur J Biochem 5530 267, 5257–5264. 5531 Mansoor, M.M., Abbas, N., Shad, S.A., Pathan, A.K., Razaq, M., 2013. Increased 5532 fitness and realized heritability in emamectin benzoate-resistant Chrysoperla 5533 carnea (Neuroptera: Chrysopidae). Ecotoxicology 22, 1232–1240. 5534 Mansur, J.F., Figueira-Mansur, J., Santos, A.S., Santos-Junior, H., Ramos, I.B., de 5535 Medeiros, M.N., Machado, E.A., Kaiser, C.R., Muthukrishnan, S., Masuda, H., 5536 Vasconcellos, A.M.H., Melo, A.C.A., Moreira, M.F., 2010. The effect of 5537 lufenuron, a chitin synthesis inhibitor, on oogenesis of Rhodnius prolixus. Pestic. 5538 Biochem. Physiol. 98, 59–67. 5539 Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., 5540 Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, 5541 G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., 5542 Bryant, S.H., 2014. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 5543 43, 222–226. 5544 Marín, S.L., Ibarra, R., Medina, M.H., Jansen, P.A., 2015. Sensitivity of Caligus
255 5545 rogercresseyi (Boxshall and Bravo 2000) to pyrethroids and azamethiphos 5546 measured using bioassay tests -A large scale spatial study. Prev. Vet. Med. 122, 5547 33–41. 5548 Martin, J.W., Davis, G.E., 2001. An updated classification of the recent crustacea. 5549 Natural History Museum of Los Angeles County. Contributions in Science, 5550 Number 39. 5551 Ujihara, K., Mori, T., Matsuo, N., 2011. Recent advances of pyrethroids for household 5552 use. In: Pyrethroids: From Chrysanthemum to modern industrial insecticide. Top 5553 Curr Chem. pgs 31-48. 5554 Mawson, C.A., Fischer, M.I., 1953. Zinc and carbonic anhydrase in human semen. 5555 Biochem. J. 55, 696–700. 5556 Mayack, C., Naug, D., 2009. Energetic stress in the honeybee Apis mellifera from 5557 Nosema ceranae infection. J. Invertebr. Pathol. 100, 185–188. 5558 McAndrew, K.J., Sommerville, C., Wootten, R., Bron, J.E., 1998. The effects of 5559 hydrogen peroxide treatment on different life-cycle stages of the salmon louse, 5560 Lepeophtheirus salmonis (Kreyer, 1837). J. Fish Dis. 21, 221–228. 5561 McEwan, G.F., Groner, M.L., Burnette, D.L., Fast, M.D., Revie, C.W., 2016. Managing 5562 aquatic parasites for reduced drug resistance: Lessons from the land. J. R. Soc. 5563 Interface 13, 20160830. 5564 McGraw, L.A., Gibson, G., Clark, A.G., Wolfner, M.F., 2004. Genes regulated by 5565 mating, sperm, or seminal fluid proteins in mated female Drosophila 5566 mealnogaster. Curr. Biol. 14, 1509–1514. 5567 McIntyre, L.M., Bono, L.M., Genissel, A., Westerman, R., Junk, D., Telonis-Scott, M., 5568 Harshman, L., Wayne, M.L., Kopp, A., Nuzhdin, S. V, 2006. Sex-specific 5569 expression of alternative transcripts in Drosophila. Genome Biol. 7, R79. 5570 Merzendorfer, H., 2013. Chitin synthesis inhibitors: Old molecules and new 5571 developments. Insect Sci. 20, 121–138. 5572 Merzendorfer, H., 2006. Insect chitin synthases: A review. J. Comp. Physiol. B 5573 Biochem. Syst. Environ. Physiol. 176, 1–15. 5574 Merzendorfer, H., Kim, H.S., Chaudhari, S.S., Kumari, M., Specht, C.A., Butcher, S., 5575 Brown, S.J., Robert Manak, J., Beeman, R.W., Kramer, K.J., Muthukrishnan, S., 5576 2012. Genomic and proteomic studies on the effects of the insect growth regulator 5577 diflubenzuron in the model beetle species Tribolium castaneum. Insect Biochem. 5578 Mol. Biol. 42, 264–276. 5579 Messmer, A.M., Rondeau, E.B., Jantzen, S.G., Lubieniecki, K.P., Davidson, W.S., 5580 Koop, B.F., 2011. Assessment of population structure in Pacific Lepeophtheirus 5581 salmonis (Krøyer) using single nucleotide polymorphism and microsatellite genetic 5582 markers. Aquaculture 320, 183–192. 5583 Meyer, F., Moussian, B., 2013. The sulfonylurea receptor Sur is dispensable for chitin 5584 synthesis in Drosophila melanogaster. Pest Manag. Sci. 69, 1136–1140. 5585 Milardi, D., Grande, G., Vincenzoni, F., Messana, I., Pontecorvi, A., De Marinis, L., 5586 Castagnola, M., Marana, R., 2012. Proteomic approach in the identification of 5587 fertility pattern in seminal plasma of fertile men. Fertil. Steril. 97, 67–73. 5588 Mitchell, S.N., Stevenson, B.J., Müller, P., Wilding, C.S., Egyir-Yawson, A., Field, 5589 S.G., Hemingway, J., Paine, M.J.I., Ranson, H., Donnelly, M.J., 2012. 5590 Identification and validation of a gene causing cross-resistance between insecticide
256 5591 classes in Anopheles gambiae from Ghana. PNAS 109, 6147–52. 5592 Mommaerts, V., Sterk, G., Smagghe, G., 2006. Pesticide residues in beeswax samples 5593 collected from honey bee colonies (Apis mellifera L.) in France. Pest Manag. Sci. 5594 62, 752–758. 5595 Mordue, A.J., Birkett, M.A., 2009. A review of host finding behaviour in the parasitic 5596 sea louse, Lepeophtheirus salmonis (Caligidae: Copepoda). J. Fish Dis. 32, 3–13. 5597 Mueller, J.L., Ripoll, D.R., Aquadro, C.F., Wolfner, M.F., 2004. Comparative structural 5598 modeling and inference of conserved protein classes in Drosophila seminal fluid. 5599 PNAS 101, 13542–13547. 5600 Muhlia-almazan, A., Garcia-carreno, F.L., 2002. Influence of molting and starvation on 5601 the synthesis of proteolytic enzymes in the midgut gland of the white shrimp 5602 Penaeus vannamei. Comp. Biochem. Physiol. - B Biochem. Mol. Biol. 133, 383– 5603 394. 5604 Muhlrad, P.J., Ward, S., 2002. Spermiogenesis initiation in Caenorhabditis elegans 5605 involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161, 143–155. 5606 Mukhopadhyay, I., Nazir, A., Saxena, D., Chowdhuri, D., 2002. Toxicity of 5607 cypermethrin:hsp70 as a biomarker of response in transgenic Drosophila. 5608 Biomarkers 7, 501–510. 5609 Muller, H.M., Catteruccia, F., Vizioli, J., Della Torre, A., Crisanti, A., 1995. 5610 Constitutive and blood meal-induced trypsin genes in Anopheles gambiae. Exp. 5611 Parasitol. 81,371-85. 5612 Muse, S. V, 1996. Estimating synonymous and nonsynonymous substitution rates. Mol. 5613 Biol. Evol. 13, 105–114. 5614 Muthusamy, R., Shivakumar, M.S., 2015. Resistance selection and molecular 5615 mechanisms of cypermethrin resistance in red hairy caterpillar (Amsacta albistriga 5616 walker). Pestic. Biochem. Physiol. 117, 54–61. 5617 Núñez-Acuña, G., Gonçalves, A.T., Valenzuela-Muñoz, V., Pino-Marambio, J., 5618 Wadsworth, S., Gallardo-Escárate, C., 2015. Transcriptome immunomodulation of 5619 in-feed additives in Atlantic salmon Salmo salar infested with sea lice Caligus 5620 rogercresseyi. Fish Shellfish Immunol. 47, 450–460. 5621 Nakagawa, Y., Matsumura, F., 1994. Diflubenzuron affects gamma-thioGTP stimulated 5622 Ca2+ transport in vitro in intracellular vesicles from the integument of the newly 5623 molted american cockroach, Periplanet americana L. Insect Biochem. Mol. Biol. 5624 24, 1009–1015. 5625 Nakjang, S., Williams, T.A., Heinz, E., Watson, A.K., Foster, P.G., Sendra, K.M., 5626 Heaps, S.E., Hirt, R.P., Martin Embley, T., 2013. Reduction and expansion in 5627 microsporidian genome evolution: New insights from comparative genomics. 5628 Genome Biol. Evol. 5, 2285–2303. 5629 Nascimento, A.R.B. do, Fresia, P., Cônsoli, F.L., Omoto, C., 2015. Comparative 5630 transcriptome analysis of lufenuron-resistant and susceptible strains of Spodoptera 5631 frugiperda (Lepidoptera: Noctuidae). BMC Genomics 16, 985. 5632 Naurin, S., Hansson, B., Hasselquist, D., Kim, Y.H., Bensch, S., 2011. The sex-biased 5633 brain: Sexual dimorphism in gene expression in two species of songbirds. BMC 5634 Genomics 12, 37. 5635 Netzel-Arnett, S., Bugge, T.H., Hess, R.A., Carnes, K., Stringer, B.W., Scarman, A.L., 5636 Hooper, J.D., Tonks, I.D., Kay, G.F., Antalis, T.M., 2009. The
257 5637 glycosylphosphatidylinositol-anchored serine protease PRSS21 (testisin) imparts 5638 murine epididymal sperm cell maturation and fertilizing ability. Biol. Reprod. 81, 5639 921–932. 5640 Nilsen, A., Nielsen, K.V., Biering, E., Bergheim, A., 2017. Effective protection against 5641 sea lice during the production of Atlantic salmon in floating enclosures. 5642 Aquaculture 466, 41–50. 5643 Nilsen, F., Espedal, P., 2015. Method for detection of pyrethroid resistance in 5644 crustaceans and oligonucleotide sequences useful in detection of pyrethroid 5645 resistance. Patent EP3030674 A1. 5646 Nogami, S., Satoh, S., Nakano, M., Shimizu, H., Fukushima, H., Maruyama, A., 5647 Terano, A., Shirataki, H., 2003. Taxilin; a novel syntaxin-binding protein that is 5648 involved in Ca 2+ -dependent exocytosis in neuroendocrine cells. Genes to cells 8, 5649 17–28. 5650 Novak, C.W., Lewis, D.L., Collicutt, B., Verkaik, K., Barker, D.E., 2016. Investigations 5651 on the role of the salmon louse, Lepeophtheirus salmonis (Caligidae), as a vector in 5652 the transmission of Aeromonas salmonicida subsp. salmonicida. J. Fish Dis. 39, 5653 1165–1178. 5654 Núñez-Acuña, G., Gallardo-Escárate, C., 2015. Two novel male-associated peroxinectin 5655 genes are downregulated by exposure to delousing drugs in Caligus rogercresseyi. 5656 Gene 557, 98–102. 5657 Núñez-Acuña, G., Vera-Bizama, F., Boltaña, S., Hawes, C., Marambio, J.P., 5658 Wadsworth, S., Gallardo-Escárate, C., 2016. In-feed additives modulate ionotropic 5659 receptor genes from the sea louse Caligus rogercresseyi: A comparative analysis in 5660 two host salmonid species. Aquaculture 451, 99–105. 5661 Nylund, S., Andersen, L., Sævareid, I., Plarre, H., Watanabe, K., Arnesen, C.E., 5662 Karlsbakk, E., Nylund, A., 2011. Diseases of farmed Atlantic salmon Salmo salar 5663 associated with infections by the microsporidian Paranucleospora theridion. Dis. 5664 Aquat. Organ. 94, 41–57. 5665 Nylund, S., Nylund, A., Watanabe, K., Arnesen, C.E., Karlsbakk, E., 2010. 5666 Paranucleospora theridion n. gen., n. sp. (Microsporidia, Enterocytozoonidae) 5667 with a life cycle in the salmon louse (Lepeophtheirus salmonis, Copepoda) and 5668 Atlantic Salmon (Salmo salar). J. Eukaryot. Microbiol. 57, 95–114. 5669 O’Donohoe, P., McDermott, T., 2014. Reducing sea lice re-infestation risk from harvest 5670 water at a salmon farm site in Ireland using a bespoke sieving and filtration system. 5671 Aquac. Eng. 60, 73–76. 5672 O’Shea, B., Wadsworth, S., Pino Marambio, J., Birkett, M.A., Pickett, J.A., Mordue 5673 (Luntz), A.J., 2017. Disruption of host-seeking behaviour by the salmon louse, 5674 Lepeophtheirus salmonis, using botanically derived repellents. J. Fish Dis. 40, 5675 495–505. 5676 Økland, A.L., Nylund, A., Øvergård, A.C., Blindheim, S., Watanabe, K., Grotmol, S., 5677 Arnesen, C.E., Plarre, H., 2014. Genomic characterization and phylogenetic 5678 position of two new species in Rhabdoviridae infecting the parasitic copepod, 5679 salmon louse (Lepeophtheirus salmonis). PLoS One 9, e112517. 5680 Olsvik, P.A., Samuelsen, O.B., Agnalt, A.L., Lunestad, B.T., 2015. Transcriptional 5681 responses to teflubenzuron exposure in European lobster (Homarus gammarus). 5682 Aquat. Toxicol.
258 5683 Osorio, D., Bacon, J.P., Whitington, P.M., 1997. The evolution of arthropod nervous 5684 systems. Am. Sci. 85, 244–253. 5685 Øvergård, A.C., Eichner, C., Nilsen, F., Dalvin, S., 2017. Molecular characterization 5686 and functional analysis of a salmon louse (Lepeophtheirus salmonis, Krøyer 1838) 5687 heme peroxidase with a potential role in extracellular matrixes. Comp. Biochem. 5688 Physiol. Part A Mol. Integr. Physiol. 206, 1–10. 5689 Øverli, Ø., Nordgreen, J., Mejdell, C.M., Janczak, A.M., Kittilsen, S., Johansen, I.B., 5690 Horsberg, T.E., 2014. Ectoparasitic sea lice (Lepeophtheirus salmonis) affect 5691 behavior and brain serotonergic activity in Atlantic salmon (Salmo salar L.): 5692 Perspectives on animal welfare. Physiol. Behav. 132, 44–50. 5693 Parsch, J., Ellegren, H., 2013. The evolutionary causes and consequences of sex-biased 5694 gene expression. Nat. Rev. Genet. 14, 83–7. 5695 Pauli, D., Tonka, C., Tissieres, A., Arrigo, A., 1990. Tissue-specific expression of the 5696 heat shock protein HSP27 during Drosophila melanogaster development. J. Cell 5697 Biol. 111, 817–828. 5698 Pavey, S.A., Bernatchez, L., Aubin-Horth, N., Landry, C.R., 2012. What is needed for 5699 next-generation ecological and evolutionary genomics? Trends Ecol. Evol. 27, 5700 673–676. 5701 Peacock, S.J., Krkošek, M., Proboszcz, S., Orr, C., Mark, A., Peacock, S.J., Krkosek, 5702 M., Proboszcz, S., Orr, C., Lewis, M.A., 2013. Cessation of a salmon decline with 5703 control of parasites. Ecol. Appl. 23, 606–620. 5704 Pedra, J.H.F., McIntyre, L.M., Scharf, M.E., Pittendrigh, B.R., 2004. Genome-wide 5705 transcription profile of field- and laboratory-selected 5706 dichlorodiphenyltrichloroethane (DDT)-resistant Drosophila. PNAS 101, 7034– 5707 7039. 5708 Peng, J., Zipperlen, P., Kubli, E., 2005. Drosophila sex-peptide stimulates female innate 5709 immune system after mating via the toll and Imd pathways. Curr. Biol. 15, 1690– 5710 1694. 5711 Pike, A., Wadsworth, S., 1999. Sea lice on salmonids: Biology and control. Adv. 5712 Parasitol. 44, 233–337. 5713 Pilch, B., Mann, M., 2006. Large-scale and high-confidence proteomic analysis of 5714 human seminal plasma. Genome Biol. 7, R40. 5715 Pohanka, M., 2012. Alpha7 nicotinic acetylcholine receptor is a target in pharmacology 5716 and toxicology. Int. J. Mol. Sci. 13, 2219–38. 5717 Poley, J., Purcell, S.L., Igboeli, O.O., Donkin, A., Wotton, H., Fast, M.D., 2013. 5718 Combinatorial effects of administration of immunostimulatory compounds in feed 5719 and follow-up administration of triple-dose SLICE® (emamectin benzoate) on 5720 Atlantic salmon, Salmo salar L., infection with Lepeophtheirus salmonis. J. Fish 5721 Dis. 36, 299–309. 5722 Pope, C., Karanth, S., Liu, J., 2005. Pharmacology and toxicology of cholinesterase 5723 inhibitors: Uses and misuses of a common mechanism of action. Environ. Toxicol. 5724 Pharmacol. 19, 433–446. 5725 Post, L., Vincent, W., 1973. Extraction of uranium from sea water by cultured algae. 5726 Nat. Sci. 60, 431–32. 5727 Post, L.C., de Jong, B.J., Vincent, W.R., 1974. 1-(2,6-disubstituted benzoyl)-3- 5728 phenylurea insecticides: Inhibitors of chitin synthesis. Pestic. Biochem. Physiol. 4,
259 5729 473–483. 5730 Powell, A., Treasurer, J.W., Pooley, C.L., Keay, A.J., Lloyd, R., Imsland, A.K., Garcia 5731 de Leaniz, C., 2017. Use of lumpfish for sea-lice control in salmon farming: 5732 Challenges and opportunities. Rev. Aquac. 1–20. 5733 Powell, J.R., Moriyama, E.N., 1997. Evolution of codon usage bias in Drosophila. 5734 PNAS 94, 7784–7790. 5735 Prichard, R.K., Hall, C.A., Kelly, J.D., Martin, I.C.A., Donald, A.D., 1980. The 5736 problem with anthelmintic resistance in nematodes. Aust. Veterianry J. 56, 239– 5737 250. 5738 Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic 5739 lactone resistance: Prospects for marker development. Parasitology 134, 1123– 5740 1132. 5741 Prichard, R.K., von Samson-Himmelstjerna, G., Blackhall, W.J., Geary, T.G., 2007. 5742 Foreword: Towards markers for anthelmintic resistance in helminths of importance 5743 in animal and human health. Parasitology 134, 1073–6. 5744 Primmer, C.R., Papakostas, S., Leder, E.H., Davis, M.J., Ragan, M.A., 2013. Annotated 5745 genes and nonannotated genomes: Cross-species use of Gene Ontology in ecology 5746 and evolution research. Mol. Ecol. 22, 3216–3241. 5747 Purcell, S.L., Friend, S.E., Covello, J.M., Donkin, A., Groman, D.B., Poley, J., Fast, 5748 M.D., 2013. CpG inclusion in feed reduces sea lice, Lepeophtheirus salmonis, 5749 numbers following re-infection. J. Fish Dis. 36, 229–240. 5750 Ram, K.R., Wolfner, M.F., 2007. Seminal influences: Drosophila Acps and the 5751 molecular interplay between males and females during reproduction. Integr. Comp. 5752 Biol. 47, 427–445. 5753 Ramstad, A., Colquhoun, D.J., Nordmo, R., Sutherland, I.H., Simmons, R., 2002. Field 5754 trials in Norway with SLICE ® (0.2 % emamectin benzoate ) for the oral treatment 5755 of sea lice infestation in farmed Atlantic salmon Salmo salar. Dis. Aquat. Organ. 5756 50, 29–33. 5757 Ranson, H., N’Guessan, R., Lines, J., Moiroux, N., Nkuni, Z., Corbel, V., 2011. 5758 Pyrethroid resistance in African anopheline mosquitoes: What are the implications 5759 for malaria control? Trends Parasitol. 27, 91–98. 5760 Ranz, J.M., Castíuo-davís, C.I., Meiklejohn, C.D., Hartl, D.L., 2003. Sex-dependent 5761 gene expression and evolution of the drosophila transcriptome. Science 300, 1742– 5762 1745. 5763 Rao, V.T.S., Siddiqui, S.Z., Prichard, R.K., Forrester, S.G., 2009. A dopamine-gated ion 5764 channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical 5765 papillae and is associated with macrocyclic lactone resistance. Mol. Biochem. 5766 Parasitol. 166, 54–61. 5767 Ray, R.P., Matamoro-Vidal, A., Ribeiro, P.S., Tapon, N., Houle, D., Salazar-Ciudad, I., 5768 Thompson, B.J., 2015. Patterned anchorage to the apical extracellular matrix 5769 defines tissue shape in the developing appendages of drosophila. Dev. Cell 34, 5770 310–322. 5771 Raynard, R.S., Bricknell, I.R., Billingsley, P.F., Nisbet, A.J., Vigneau, A., Sommerville, 5772 C., 2002. Development of vaccines against sea lice. Pest Manag. Sci. 58, 569–75. 5773 Rebers, J.E., Niu, J., Riddiford, L.M., 1997. Structure and spatial expression of the 5774 Manduca sexta MSCP14.6 cuticle gene. Insect Biochem. Mol. Biol. 27, 229–240.
260 5775 Rebers, J.E., Willis, J.H., 2001. A conserved domain in arthropod cuticular proteins 5776 binds chitin. Insect Biochem. Mol. Biol. 31, 1083–1093. 5777 Regier, J.C., Shultz, J.W., Zwick, A., Hussey, A., Ball, B., Wetzer, R., Martin, J.W., 5778 Cunningham, C.W., 2010. Arthropod relationships revealed by phylogenomic 5779 analysis of nuclear protein-coding sequences. Nature 463, 1079–1083. 5780 Reinhardt, K., Wong, C.H., Georgiou, A.S., 2009. Detection of seminal fluid proteins in 5781 the bed bug, Cimex lectularius, using two-dimensional gel electrophoresis and 5782 mass spectrometry. Parasitology 136, 283–292. 5783 Reinke, V., Gil, I.S., Ward, S., Kazmer, K., 2004. Genome-wide germline-enriched and 5784 sex-biased expression profiles in Caenorhabditis elegans. Development 131, 311– 5785 23. 5786 Reuner, A., Hengherr, S., Mali, B., Förster, F., Arndt, D., Reinhardt, R., Dandekar, T., 5787 Frohme, M., Brümmer, F., Schill, R.O., 2010. Stress response in tardigrades: 5788 differential gene expression of molecular chaperones. Cell Stress Chaperones 15, 5789 423–430. 5790 Rinn, J.L., Snyder, M., 2005. Sexual dimorphism in mammalian gene expression. 5791 Trends Genet. 21, 298–305. 5792 Ritchie, G.., Mordue, A.. J.., Pike, A.. W.., Rae, G.. H.., 1996. Morphology and 5793 ultrastructure of the reproductive system of Lepeophtheirus salmonis. J. Crustac. 5794 Biol. 16, 330–346. 5795 Ritchie, G., Luntz, A.J.M., Pikeb, A.W., Raec, G.H., 1996. Observations on mating and 5796 reproductive behaviour of Lepeophtheirus salmonis, Krøyer (Copepoda : 5797 Caligidae). J. Exp. Mar. Bio. Ecol. 201, 285–298. 5798 Ritchie, G., Rønsberg, S.S., Hoff, K.A., Branson, E.J., 2002. Clinical efficacy of 5799 teflubenzuron (Calicide ®) for the treatment of Lepeophtheirus salmonis 5800 infestations of farmed Atlantic salmon Salmo salar at low water temperatures. Dis. 5801 Aquat. Organ. 51, 101–106. 5802 Rodriguez, M.M., Bisset, J., Ruiz, M., Soca, A., 2002. Cross-resistance to pyrethroid 5803 and organophosphorus insecticides induced by selection with temephos in Aedes 5804 aegypti (Diptera: Culicidae) from Cuba. J. Med. Entomol. 39, 882–888. 5805 Rogers, D.W., Whitten, M.M.A., Thailayil, J., Soichot, J., Levashina, E.A., Catteruccia, 5806 F., 2008. Molecular and cellular components of the mating machinery in Anopheles 5807 gambiae females. PNAS 105, 19390–19395. 5808 Ross, N.W., Firth, K.J., Wang, A., Burka, J.F., Johnson, S.C., 2000. Changes in 5809 hydrolytic enzyme activities of naïve Atlantic salmon Salmo salar skin mucus due 5810 to infection with the salmon louse Lepeophtheirus salmonis and cortisol 5811 implantation. Dis. Aq. Org. 41, 43–51. 5812 Roth, M., Richards, R.H., Sommerville, C., 1993. Current practices in the 5813 chemotherapeutic control of sea lice infestations in aquaculture: a review. J. Fish 5814 Dis. 16, 1–26. 5815 Saksida, S.M., Morrison, D., Mckenzie, P., Milligan, B., Downey, E., Boyce, B., Eaves, 5816 A., 2013. Use of Atlantic salmon, Salmo salar L., farm treatment data and 5817 bioassays to assess for resistance of sea lice, Lepeophtheirus salmonis, to 5818 emamectin benzoate (SLICE®) in British Columbia, Canada. J. Fish Dis. 36, 515– 5819 520. 5820 Sanchez-Carbayo, M., Belbin, T.J., Scotlandi, K., Prystowsky, M., Baldini, N., Childs,
261 5821 G., Cordon-Cardo, C., 2003. Expression Profiling of Osteosarcoma Cells 5822 Transfected with MDR1 and NEO Genes: Regulation of Cell Adhesion, Apoptosis, 5823 and Tumor Suppression-Related Genes. Lab. Investig. 83, 507–517. 5824 Sánchez-Gracia, A., Vieira, F.G., Rozas, J., 2009. Molecular evolution of the major 5825 chemosensory gene families in insects. Heredity 103, 208–16. 5826 Sandlund, L., Nilsen, F., Male, R., Dalvin, S., 2016. The ecdysone receptor (EcR) is a 5827 major regulator of tissue development and growth in the marine salmonid 5828 ectoparasite, Lepeophtheirus salmonis (Copepoda, Caligidae). Mol. Biochem. 5829 Parasitol. 208, 65-73. 5830 Sandlund, L., Nilsen, F., Male, R., Grotmol, S., Kongshaug, H., Dalvin, S., 2014. 5831 Molecular characterisation of the salmon louse, Lepeophtheirus salmonis salmonis 5832 (Krøyer, 1837), ecdysone receptor with emphasis on functional studies of female 5833 reproduction. Int. J. Parasitol. 45, 175–185. 5834 Sangster, N.C., 2001. Managing parasiticide resistance. Vet. Parasitol. 98, 89–109. 5835 Scarman, A.L., Hooper, J.D., Boucaut, K.J., Sit, M. Le, Webb, G.C., Normyle, J.F., 5836 Antalis, T.M., 2001. Organization and chromosomal localization of the murine 5837 Testisin gene encoding a serine protease temporally expressed during 5838 spermatogenesis. Eur. J. Biochem. 268, 1250–1258. 5839 Schmitzová, J., Klaudiny, J., Albert, Š., Schröder, W., Schreckengost, W., Hanes, J., 5840 Júdová, J., Šimúth, J., 1998. A family of major royal jelly proteins of the honeybee 5841 Apis mellifera L. Cell. Mol. Life Sci. 54, 1020–1030. 5842 Schram, T., 1993. Supplementary descriptions of the developmental stages of 5843 Lepeophtheirus salmonis (Krøyer, 1837) (Copepoda:Caligidae), in: Pathogens of 5844 Wild and Farmed Fish: Sea Lice. pp. 29–47. 5845 Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem. Mol. 5846 Biol. 29, 757–777. 5847 Scottish Executive., 2002. Review and synthesis of the environmental impacts of 5848 aquaculture. Edinburgh. 5849 Sevatdal, S., Fallang, A., Ingebrigtsen, K., Horsberg, T.E., 2005. Monooxygenase 5850 mediated pyrethroid detoxification in sea lice (Lepeophtheirus salmonis). Pest 5851 Manag. Sci. 61, 772–8. 5852 Sevatdal, S., Magnusson, A., Ingebrigtsen, K., Haldorsen, R., Horsberg, T.E., 2005a. 5853 Distribution of emamectin benzoate in Atlantic salmon ( Salmo salar L .). J. Vet. 5854 Pharmacol. Ther. 28, 101–107. 5855 Sharma, A.K., Kumar, R., Kumar, S., Nagar, G., Singh, N.K., Rawat, S.S., Dhakad, 5856 M.L., Rawat, A. K.S., Ray, D.D., Ghosh, S., 2012. Deltamethrin and cypermethrin 5857 resistance status of Rhipicephalus (Boophilus) microplus collected from six agro- 5858 climatic regions of India. Vet. Parasitol. 188, 337–345. 5859 Shoop, W.L., Mrozik, H., Fisher, M.H., 1995. Structure and activity of avermectins and 5860 milbemycins in animal health. Veterianry Parasitol. 59, 139–156. 5861 Skern-Mauritzen, R., Frost, P., Dalvin, S., 2009. A trypsin-like protease with apparent 5862 dual function in early Lepeophtheirus salmonis ( Krøyer ) development. BMC Mol. 5863 Biol. 10, 44. 5864 Skern-Mauritzen, R., Torrissen, O., Glover, K.A., 2014. Pacific and Atlantic 5865 Lepeophtheirus salmonis (Krøyer , 1838) are allopatric subspecies: Lepeophtheirus 5866 salmonis salmonis and L . salmonis oncorhynchi subspecies novo. BMC Genetics
262 5867 35, 32. 5868 Skugor, S., Glover, K.A., Nilsen, F., Krasnov, A., 2008. Local and systemic gene 5869 expression responses of Atlantic salmon (Salmo salar L.) to infection with the 5870 salmon louse (Lepeophtheirus salmonis). BMC Genomics 9, 498. 5871 Skugor, S., Jodaa Holm, H., Bjelland, A.K., Pino, J., Evensen, Ø., Krasnov, A., 5872 Wadsworth, S., 2016. Nutrigenomic effects of glucosinolates on liver, muscle and 5873 distal kidney in parasite-free and salmon louse infected Atlantic salmon. Parasit. 5874 Vectors 9, 639. 5875 Slatkin, M., 1984. Ecological Causes of Sexual Dimorphism. Soc. Study Evol. 38, 622– 5876 630. 5877 Sletmoen, S.M., 2016. Design of a mechanical treatment method for salmon lice. Thesis 5878 – Norwegian Univeristy of Life Sciences. 5879 Small, C.M., Carney, G.E., Mo, Q., Vannucci, M., Jones, A.G., 2009. A microarray 5880 analysis of sex- and gonad-biased gene expression in the zebrafish: Evidence for 5881 masculinization of the transcriptome. BMC Genomics 10, 579. 5882 Soderlund, D.M., 2011. Molecular mechanisms of pyrethroid insecticide neurotoxicity: 5883 recent advances. Arch. Toxicol. 86, 165–181. 5884 Sonenshine, D.E., Bissinger, B.W., Egekwu, N., Donohue, K. V., Khalil, S.M., Roe, 5885 R.M., 2011. First transcriptome of the testis-vas deferens-male accessory gland and 5886 proteome of the spermatophore from Dermacentor variabilis (acari: Ixodidae). 5887 PLoS One 6, e24711. 5888 South, a., Sirot, L.K., Lewis, S.M., 2011. Identification of predicted seminal fluid 5889 proteins in Tribolium castaneum. Insect Mol. Biol. 20, 447–456. 5890 Sparks, T.C., Nauen, R., 2015. IRAC : Mode of action classification and insecticide 5891 resistance management. Pestic. Biochem. Physiol. 121, 122–128. 5892 Stavang, J.A., Chauvigné, F., Kongshaug, H., Cerdà, J., Nilsen, F., Finn, R.N., 2015. 5893 Phylogenomic and functional analyses of salmon lice aquaporins uncover the 5894 molecular diversity of the superfamily in Arthropoda. BMC Genomics 16, 618. 5895 Stentiford, G.D., Feist, S.W., Stone, D.M., Bateman, K.S., Dunn, A.M., 2013. 5896 Microsporidia: Diverse, dynamic, and emergent pathogens in aquatic systems. 5897 Trends Parasitol. 29, 567–578. 5898 Stephenson, J.F., 2012. The chemical cues of male sea lice Lepeophtheirus salmonis 5899 encourage others to move between host Atlantic salmon Salmo salar. J. Fish Biol. 5900 81, 1118–23. 5901 Stevenson, B.J., Bibby, J., Pignatelli, P., Muangnoicharoen, S., O’Neill, P.M., Lian, 5902 L.Y., Müller, P., Nikou, D., Steven, A., Hemingway, J., Sutcliffe, M.J., Paine, 5903 M.J.I., 2011. Cytochrome P450 6M2 from the malaria vector Anopheles gambiae 5904 metabolizes pyrethroids: Sequential metabolism of deltamethrin revealed. Insect 5905 Biochem. Mol. Biol. 41, 492–502. 5906 Stien, L.H., Dempster, T., Bui, S., Glaropoulos, A., Fosseidengen, J.E., Wright, D.W., 5907 Oppedal, F., 2016. “Snorkel” sea lice barrier technology reduces sea lice loads on 5908 harvest-sized Atlantic salmon with minimal welfare impacts. Aquaculture 458, 29– 5909 37. 5910 Stone, J., Sutherland, I.H., Sommerville, C., Richards, R.H., Varma, K.J., 2000. 5911 Commercial trials using emamectin benzoate to control sea lice Lepeophtheirus 5912 salmonis infestations in Atlantic salmon Salmo salar. Dis. Aquat. Organ. 41, 141–
263 5913 149. 5914 Stone, J., Sutherland, I.H., Sommerville, C., Richards, R.H., Varma, K.J., 2000. Field 5915 trials to evaluate the efficacy of emamectin benzoate in the control of sea lice , 5916 Lepeophtheirus salmonis (Krøyer) and Caligus elongatus Nordmann, infestations 5917 in Atlantic salmon Salmo salar L . Aquaculture 186, 205–219. 5918 Stone, J., Sutherland, I.H., Sommerville, C.S., Richards, R.H., Varma, K.J., 1999. The 5919 efficacy of emamectin benzoate as an oral treatment of sea lice, Lepeophtheirus 5920 salmonis (Krøyer), infestations in Atlantic salmon, Salmo salar L . J. Fish Dis. 22, 5921 261–270. 5922 Stratowa, C., Rutter, W.J., 1986. Selective regulation of trypsin gene expression by 5923 calcium and by glucose starvation in a rat exocrine pancreas cell line. PNAS 83, 5924 4292–4296. 5925 Stuart, J., Segal, E., Koller, D., Kim, S., 2003. A gene-coexpression network for global 5926 discovery of conserved genetic modules. Science. 302, 249–255. 5927 Sturn, A., Quackenbush, J., Trajanoski, Z., 2002. Genesis: cluster analysis of microarray 5928 data. Bioinformatics 18, 207–8. 5929 Sugawara, H., Kusunoki, M., Kurisu, G., Fujimoto, T., Aoyagi, H., Hatakeyama, T., 5930 2004. Characteristic recognition of N-acetylgalactosamine by an invertebrate C- 5931 type lectin, CEL-I, revealed by x-ray crystallographic analysis. J. Biol. Chem. 279, 5932 45219–45225. 5933 Sun, R., Liu, C., Zhang, H., Wang, Q., 2015. Benzoylurea chitin synthesis inhibitors. J. 5934 Agric. Food Chem. 63, 6847–6865. 5935 Sutherland, B.J., Koczka, K.W., Yasuike, M., Jantzen, S.G., Yazawa, R., Koop, B.F., 5936 Jones, S.R., 2014. Comparative transcriptomics of Atlantic Salmo salar, chum 5937 Oncorhynchus keta and pink salmon O. gorbuscha during infections with salmon 5938 lice Lepeophtheirus salmonis. BMC Genomics 15, 200. 5939 Sutherland, B.J.G., Covello, J.M., Friend, S.E., Poley, J.D., Koczka, K.W., Purcell, 5940 S.L., MacLeod, T.L., Donovan, B.R., Pino, J., González-Vecino, J.L., Gonzalez, J., 5941 Troncoso, J., Koop, B.F., Wadsworth, S.L., Fast, M.D., 2017. Host–parasite 5942 transcriptomics during immunostimulant-enhanced rejection of salmon lice 5943 (Lepeophtheirus salmonis) by Atlantic salmon (Salmo salar). FACETS 2, 477. 5944 Sutherland, B.J.G., Jantzen, S.G., Sanderson, D.S., Koop, B.F., Jones, S.R.M., 2011. 5945 Differentiating size-dependent responses of juvenile pink salmon (Oncorhynchus 5946 gorbuscha) to sea lice (Lepeophtheirus salmonis) infections. Comp. Biochem. 5947 Physiol. - Part D Genomics Proteomics 6, 213–223. 5948 Sutherland, B.J.G., Jantzen, S.G., Yasuike, M., Sanderson, D.S., Koop, B.F., Jones, 5949 S.R.M., 2012. Transcriptomics of coping strategies in free-swimming 5950 Lepeophtheirus salmonis (Copepoda) larvae responding to abiotic stress. Mol. 5951 Ecol. 21, 6000–6014. 5952 Sutherland, B.J.G., Poley, J.D., Igboeli, O.O., Jantzen, J.R., Fast, M.D., Koop, B.F., 5953 Jones, S.R.M., 2015. Transcriptomic responses to emamectin benzoate in Pacific 5954 and Atlantic Canada salmon lice Lepeophtheirus salmonis with differing levels of 5955 drug resistance. Evol. Appl. 8, 133–148. 5956 Swanson, W.J., Vacquier, V.D., 2002. Reproductive protein evolution. Annu. Rev. 5957 Ecol. Syst. 33, 161–179. 5958 Takahashi, K., Ip, W.K.E., Michelow, I.C., Ezekowitz, R.A.B., 2006. The mannose-
264 5959 binding lectin: A prototypic pattern recognition molecule. Curr. Opin. Immunol. 5960 18, 16–23. 5961 Tao, T., Shi, H., Huang, D., Peng, J., 2013. Def functions as a cell autonomous factor in 5962 organogenesis of digestive organs in zebrafish. PLoS One 8, e58858. 5963 Team, R.C., 2016. A language and environment for statistical computing. R Found. 5964 Stat. Comput. Vienna, Austria. ISBN 3-900051-07-0, URL http//www.R- 5965 project.org/. 5966 Teleman, A.A., 2010. Molecular mechanisms of metabolic regulation by insulin in 5967 Drosophila. Biochem. J. 425, 13–26. 5968 Terry, R.S., Smith, J.E., Bouchon, D., Rigaud, T., Duncanson, P., Sharpe, R.G., Dunn, 5969 A.M., 1999. Ultrastructural characterisation and molecular taxonomic 5970 identification of. J. Eukaryot. Microbiol. 46, 492–499. 5971 Terry, R.S., Smith, J.E., Sharpe, R.G., Rigaud, T., Littlewood, D.T.J., Ironside, J.E., 5972 Rollinson, D., Bouchon, D., MacNeil, C., Dick, J.T.A., Dunn, A.M., 2004. 5973 Widespread vertical transmission and associated host sex-ratio distortion within the 5974 eukaryotic phylum Microspora. Proc. Biol. Sci. 271, 1783–9. 5975 Thomassen, J., 1993. Hydrogen peroxide as a delousing agent for Atlantic salmon, in: 5976 Boxshall, G., Defaye, D. (Eds.), Pathogens of Wild and Farmed Fish: Sea Lice. 5977 Ellis Horwood, pp. 290–295. 5978 Todd, C.D., Stevenson, R.J., Reinardy, H., Ritchie, M.G., 2005. Polyandry in the 5979 ectoparasitic copepod Lepeophtheirus salmonis despite complex precopulatory and 5980 postcopulatory mate-guarding. Mar. Ecol. Prog. Ser. 303, 225–234. 5981 Tomita, T., Scott, J.G., 1995. cDNA and deduced protein sequence of CYP6D1: the 5982 putative gene for a cytochrome P450 responsible for pyrethroid resistance in house 5983 fly. Insect Biochem. Mol. Biol. 25, 275–283. 5984 Tootle, T.L., Spradling, A.C., 2008. Drosophila Pxt: a cyclooxygenase-like facilitator of 5985 follicle maturation. Development 135, 839–847. 5986 Treasurer, J.W., Wadsworth, S., Grant, A., 2000. Resistance of sea lice, Lepeophtheirus 5987 salmonis (Krøyer), to hydrogen peroxide on farmed Atlantic salmon, Salmo salar 5988 L . Aquac. Res. 31, 855–860. 5989 Treasurer, J.W., Wadsworth, S.L., 2004. Interspecific comparison of experimental and 5990 natural routes of Lepeophtheirus salmonis and Caligus elongatus challenge and 5991 consequences for distribution of chalimus on salmonids and therapeutant 5992 screening. Aquac. Res. 35, 773–783. 5993 Tribble, N.D., Burka, J.F., Kibenge, F.S.B., 2007. Evidence for changes in the 5994 transcription levels of two putative P-glycoprotein genes in sea lice 5995 (Lepeophtheirus salmonis) in response to emamectin benzoate exposure. Mol. 5996 Biochem. Parasitol. 153, 59–65. 5997 Tröße, C., Kongshaug, H., Dondrup, M., Nilsen, F., 2015. Characterisation of iron 5998 regulatory protein 1A and 1B in the blood-feeding copepod Lepeophtheirus 5999 salmonis. Exp. Parasitol. 157, 1–11. 6000 Tröße, C., Nilsen, F., Dalvin, S., 2014. RNA interference mediated knockdown of the 6001 KDEL receptor and COPB2 inhibits digestion and reproduction in the parasitic 6002 copepod Lepeophtheirus salmonis. Comp. Biochem. Physiol. - B Biochem. Mol. 6003 Biol. 170, 1–9. 6004 Tsai, H.Y., Hamilton, A., Tinch, A.E., Guy, D.R., Bron, J.E., Taggart, J.B., Gharbi, K.,
265 6005 Stear, M., Matika, O., Pong-wong, R., Bishop, S., Houston, R.E., 2016. Genomic 6006 prediction of host resistance to sea lice in farmed Atlantic salmon populations. 6007 Genet. Sel. Evol. 48, 47. 6008 Tucker, C.S., Sommerville, C., Wootten, R., 2000. An investigation into the larval 6009 energetics and settlement of the sea louse Lepeophtheirus salmonis, an 6010 ectoparasitic copepod of Atlantic salmon Salmo salar. Fish Pathol. 35, 137–143. 6011 Turek, M., Bringmann, H., 2014. Gene expression changes of Caenorhabditis elegans 6012 larvae during molting and sleep-like lethargus. PLoS One 9, e113269. 6013 UniProt: A hub for protein information, 2015. Nucleic Acids Res. 43, 204–212. 6014 Urban, S., Lee, J.R., Freeman, M., 2001. Drosophila Rhomboid-1 defines a family of 6015 putative intramembrane serine proteases. Cell 107, 173–182. 6016 Valenzuela-Muñoz, V., Sturm, A., Gallardo-Escárate, C., 2015. Transcriptomic insights 6017 on the ABC transporter gene family in the salmon louse Caligus rogercresseyi. 6018 Parasit. Vectors 8, 209. 6019 Valles, S.M., Dong, K., Brenner, R.J., 2000. Mechanisms responsible for cypermethrin 6020 resistance in a strain of German cockroach, Blattella germanica. Pestic. Biochem. 6021 Physiol. 66, 195–205. 6022 Van Der Giezen, M., Tovar, J., Clark, C.G., 2005. Mitochondrion-derived organelles in 6023 protists and fungi. Int. Rev. Cytol. 244, 175–225. 6024 Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., 6025 Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data 6026 by geometric averaging of multiple internal control genes. Genome Biol. 3, 6027 RESEARCH0034. 6028 Vávra, J., Ronny Larsson, J.I., 2014. Structure of Microsporidia, in: Microsporidia: 6029 Pathogens of Opportunity, First Edition. John Wiley & Sons, Inc., pp. 1–70. 6030 Veldhoen, N., Ikonomou, M.G., Buday, C., Jordan, J., Rehaume, V., Cabecinha, M., 6031 Dubetz, C., Chamberlain, J., Pittroff, S., Vallée, K., van Aggelen, G., Helbing, 6032 C.C., 2012. Biological effects of the anti-parasitic chemotherapeutant emamectin 6033 benzoate on a non-target crustacean, the spot prawn (Pandalus platyceros Brandt, 6034 1851) under laboratory conditions. Aquat. Toxicol. 108, 94–105. 6035 Veselsky, L., Jonakova, V., Cechova, D., 1985. A kunitz type of proteinase inhibitor 6036 isolated from boar seminal vesicle fluid. Andrologia 17, 352–358. 6037 Viñuela, A., Snoek, L.B., Riksen, J.A.G., Kammenga, J.E., 2010. Genome-wide gene 6038 expression analysis in response to organophosphorus pesticide chlorpyrifos and 6039 diazinon in C. elegans. PLoS One 5, e12145. 6040 Vontas, J., Blass, C., Koutsos, A.C., David, J.P., Kafatos, F.C., Louis, C., Hemingway, 6041 J., Christophides, G.K., Ranson, H., 2005. Gene expression in insecticide resistant 6042 and susceptible Anopheles gambiae strains constitutively or after insecticide 6043 exposure. Insect Mol. Biol. 14, 509–521. 6044 Waddy, S.L., Burridge, L.E., Hamilton, M.N., Mercer, S.M., Aiken, D.E., Haya, K., 6045 2002. Emamectin benzoate induces molting in American lobster, Homarus 6046 americanus. Can. J. Fish. Aquat. Sci. 59, 1096–1099. 6047 Wagner, G.N., Fast, M.D., Johnson, S.C., 2008. Physiology and immunology of 6048 Lepeophtheirus salmonis infections of salmonids. Trends Parasitol. 24, 176–83. 6049 Walker, M.J., Rylett, C.M., Keen, J.N., Audsley, N., Sajid, M., Shirras, A.D., Isaac, 6050 R.E., 2006. Proteomic identification of Drosophila melanogaster male accessory
266 6051 gland proteins, including a pro-cathepsin and a soluble gamma-glutamyl 6052 transpeptidase. Proteome Sci. 4, 9. 6053 Wang, M., Shi, J.-L., Cheng, G.-Y., Hu, Y.-Q., Xu, C., 2009. The antibody against a 6054 nuclear autoantigenic sperm protein can result in reproductive failure. Asian J. 6055 Androl. 11, 183–92. 6056 Watson, A.K., Williams, T.A., Williams, B.A.P., Moore, K.A., Hirt, R.P., Embley, 6057 T.M., 2015. Transcriptomic profiling of host-parasite interactions in the 6058 microsporidian Trachipleistophora hominis. BMC Genomics 16, 983. 6059 Westcott, J.D., Stryhn, H., Burka, J.F., Hammell, K.L., 2008. Optimization and field use 6060 of a bioassay to monitor sea lice Lepeophtheirus salmonis sensitivity to emamectin 6061 benzoate. Dis. Aquat. Organ. 79, 119–131. 6062 WHO., 2006. Diflubenzuron in drinking water use for vector control in drinking water 6063 sources and containers. 6064 Whyte, S.K., Westcott, J.D., Byrne, P., Hammell, K.L., 2011. Comparison of the 6065 depletion of emamectin benzoate (SLICE®) residues from skeletal muscle and skin 6066 of Atlantic salmon (Salmo salar), for multiple dietary dose regimens at 10°C. 6067 Aquaculture 315, 228–235. 6068 Whyte, S.K., Westcott, J.D., Elmoslemany, A., Hammell, K.L., Revie, C.W., 2013. A 6069 fixed-dose approach to conducting emamectin benzoate tolerance assessments on 6070 field-collected sea lice, Lepeophtheirus salmonis. J. Fish Dis. 36, 283–92. 6071 Whyte, S.K., Westcott, J.D., Jimenez, D., Revie, C.W., Hammell, K.L., 2014. 6072 Assessment of sea lice (Lepeophtheirus salmonis) management in New Brunswick, 6073 Canada using deltamethrin (Alphamax®) through clinical field treatment and 6074 laboratory bioassay responses. Aquaculture 422–423, 54–62. 6075 Williamson, M., Martinez-Torres, D., Hick, C., Devonshire, A., 1996. Identification of 6076 mutations in the housefly para-type sodium channel gene associated with 6077 knockdown resistance (kdr) to pyrethroid insecticides. Mol. Gen. Genet. 252, 51– 6078 60. 6079 Wilson, T.G., Cryan, J.R., 1997. Lufenuron, a chitin-synthesis inhibitor, interrupts 6080 development of Drosophila melanogaster. J. Exp. Zool. 278, 37–44. 6081 Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the 6082 mode of action of the avermectin/milbemycin anthelmintics. Parasitology 131, 85- 6083 95. 6084 Wormhoudt, A. Van, Sellos, D., Donvap, A., Moullac, G. Le, 1995. Chymotrypsin gene 6085 expression during the intermolt cycle in the shrimp Penaeus vannamei (Crustacea; 6086 Decapoda) immunocytochemical localization of chymotrypsin. Experientia 51, 6087 159–163. 6088 Wu, J.Y., Smart, M.D., Anelli, C.M., Sheppard, W.S., 2012. Honey bees (Apis 6089 mellifera) reared in brood combs containing high levels of pesticide residues 6090 exhibit increased susceptibility to Nosema (Microsporidia) infection. J. Invertebr. 6091 Pathol. 109, 326–329. 6092 Xiong, C., Fang, F., Chen, L., Yang, Q., He, J., Zhou, D., Shen, B., 2014. Trypsin- 6093 catalyzed deltamethrin degradation 9, 1–5. 6094 Yan, W., Ma, L., Burns, K.H., Matzuk, M.M., 2004. Haploinsufficiency of kelch-like 6095 protein homolog 10 causes infertility in male mice. PNAS 101, 7793–7798. 6096 Yang, Q., Zhou, D., Sun, L., 2008. Expression and characterization of two pesticide
267 6097 resistance-associated serine protease genes (NYD-tr and NYD-ch) from Culex 6098 pipiens pallens for metabolism of deltamethrin. Parasitol. Res. 103, 507–516. 6099 Yang, X., Schadt, E.E., Wang, S., Wang, H., Arnold, A.P., Ingram-drake, L., Drake, 6100 T.A., Lusis, A.J., 2006. Tissue-specific expression and regulation of sexually 6101 dimorphic genes in mice. Genome Res. 16, 995–1004. 6102 Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., Speed, T.P., 2002. 6103 Normalization for cDNA microarray data: a robust composite method addressing 6104 single and multiple slide systematic variation. Nucleic Acids Res. 30, e15. 6105 Yasuike, M., Leong, J., Jantzen, S.G., von Schalburg, K.R., Nilsen, F., Jones, S.R.M., 6106 Koop, B.F., 2012. Genomic resources for sea lice: Analysis of ESTs and 6107 mitochondrial genomes. Mar. Biotechnol. 14, 155–166. 6108 Yazawa, R., Yasuike, M., Leong, J., von Schalburg, K.R., Cooper, G.A., Beetz-Sargent, 6109 M., Robb, A., Davidson, W.S., Jones, S.R.M., Koop, B.F., 2008. EST and 6110 mitochondrial DNA sequences support a distinct Pacific form of salmon louse, 6111 Lepeophtheirus salmonis. Mar. Biotechnol. (NY). 10, 741–9. 6112 Yoon, K.S.U.P., Previte, D.J., Hodgdon, H.E., Poole, B.C., Kwon, D.H.O., Abo El- 6113 ghar, G.E., Lee, S.I.H., Clark, J.M., 2014. Knockdown resistance allele frequencies 6114 in North American head louse (Anoplura: Pediculidae) populations. J. Med. 6115 Entomol. 1945, 450–457. 6116 Yu, J.X., Chao, L., Chao, J., 1994. Prostasin is a novel human serine proteinase from 6117 seminal fluid. Purification, tissue distribution, and localization in prostate gland. J. 6118 Biol. Chem. 269, 18843–18848. 6119 Yu, R., Liu, W., Li, D., Zhao, X., Ding, G., Zhang, M., Ma, E., Zhu, K., Li, S., 6120 Moussian, B., Zhang, J., 2016. Helicoidal organization of chitin in the cuticle of 6121 the migratory locust requires the function of the chitin deacetylase 2 enzyme 6122 (LmCDA2). J. Biol. Chem. 291, 24352–24363. 6123 Zhang, Z., Hambuch, T.M., Parsch, J., 2004. Molecular evolution of sex-biased genes in 6124 Drosophila. Mol. Biol. Evol. 21, 2130–9. 6125 Zhao, A.J., Collins, H.L., Li, Y., Mau, R.F.L., Thompson, G.D., Andaloro, J.T., Boykin, 6126 R., Shelton, A.M., 2006. Monitoring of diamondback moth (Lepidoptera: 6127 Plutellidae) resistance to spinosad, indoxacarb, and emamectin benzoate. J. Econ. 6128 Entomol. 99, 176–181. 6129 Zhao, G., Rose, R.L., Hodgson, E., Roe, R.M., 1996. Biochemical mechanisms and 6130 diagnostic microassays for pyrethroid, carbamate, and organophosphate insecticide 6131 resistance/cross-resistance in the tobacco budworm, Heliothis virescens. Pestic. 6132 Biochem. Physiol. 56, 183–195. 6133 Zhu, Q., Arakane, Y., Beeman, R.W., Kramer, K.J., Zhu, Q., Arakane, Y., Beeman, 6134 R.W., Kramer, K.J., Muthukrishnan, S., 2008. Functional specialization among 6135 insect chitinase family genes revealed by RNA interference. PNAS105, 6650– 6136 6655. 6137 Zucchetti, I., De Santis, R., Grusea, S., Pontarotti, P., Du Pasquier, L., 2009. Origin and 6138 evolution of the vertebrate leukocyte receptors: The lesson from tunicates. 6139 Immunogenetics 61, 463–81. 6140 Zwilling, D., Huang, S., Sathyasaikumar, K. V, Notarangelo, F.M., Guidetti, P., Wu, H., 6141 Lee, J., Truong, J., Andrews-zwilling, Y., Hsieh, E.W., Louie, J.Y., Wu, T., 6142 Scearce-levie, K., Patrick, C., Adame, A., Giorgini, F., Moussaoui, S., Laue, G.,
268 6143 Rassoulpour, A., Flik, G., Huang, Y., Muchowski, J.M., Masliah, E., Schwarcz, R., 6144 2011. Kynurenine 3-Monooxygenase inhibition in blood ameliorates 6145 neurodegeneration. Cell 145, 863–874. 6146
269