The Journal of Immunology

EBF1 Is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors1

Sasan Zandi,2* Robert Mansson,2*‡ Panagiotis Tsapogas,* Jenny Zetterblad,* David Bryder,† and Mikael Sigvardsson3*‡

Development of B-lymphoid cells in the bone marrow is a process under strict control of a hierarchy of transcription factors. To understand the development of a B-lymphoid-restricted functional network of transcription factors, we have investigated the cell autonomous role of the transcription factor EBF1 in early B cell development. This revealed that even though transplanted EBF1-deficient fetal liver cells were able to generate common lymphoid progenitors (CLPs) as well as B220؉CD43؉AA4.1؉ candidate precursor B cells, none of these populations showed signs of B lineage priming. The isolated CLPs were able to generate T lymphocytes in vitro supporting the idea that the phenotype of EBF1-deficient mice is restricted to the development of the B lineage. Furthermore, EBF deficient CLPs displayed a reduction in Ig H chain recombination as compared with their wild-type counterpart and essentially lacked transcription of B-lineage-associated genes. Among the genes displaying reduced expression in the EBF1 deficient CLPs were the transcription factors Pax5, Pou2af1 (OcaB), and FoxO1 that all appear to be direct genetic targets for EBF1 because their promoters contained functional binding sites for this factor. This leads us to suggest that EBF1 regulates a transcription factor network crucial for B lineage commitment. The Journal of Immunology, 2008, 181: 3364–3372.

roduction and development of B lineage cells is a precisely B-lymphoid cells as well as dramatic disturbances of several im- controlled process originating from rare hematopoietic mature B-lineage progenitor populations in the bone marrow (4). P stem cells. Lineage commitment of stem cells to the B The observed block in differentiation appears to be earlier than lineage involves a stepwise process progressing through a series of what is found in PAX5-deficient mice (5) because, in contrast to intermediate progenitor stages. Studies of knockout (KO)4 mice the EBF1 mutants (4), expression of multiple B-lineage-restricted models and gain of function experiments has revealed indispens- genes can be found in the bone marrow of PAX5 KO mice (6). able functions for transcription factors such as Pax5, E2A, PU.1, EBF1 deficiency rather resembles that observed in mice deficient and Ebf1 in this process, but the exact developmental stage as well of the E2A-encoded E47 and E12 proteins (7, 8). It has been shown as the genetic networks surrounding these factors is still under that expression of EBF1 and E2A is crucial for initiation of B cell investigation. The Helix loop helix protein EBF1 (1), within the development and these factors have been shown to directly col- hematopoietic system expressed in lymphoid progenitors and B- laborate with in the regulation of target genes (9–12). Further- lineage cells (2, 3), has been suggested to be one of the key reg- more, mice transheterozygous for mutations in the Ebf1 and E2A ulators of early B cell development (4). Disruption of EBF1 func- genes display an enhanced block of B-lineage development as tion in mice leads to complete block in the formation of peripheral compared with the single heterozygote mice (13). Several lines of investigations have revealed genetic targets directly regulated by *Department for Biomedicin and Surgery, Linko¨ping University, †Department for EBF1 (12–15), leading to the idea that EBF1 acts as a pleiotropic Immunology, Lund University, and ‡Lund Strategic Center for Stem Cell Biology, activator of B-lineage genes. Additionally, studies on the CD79a Sweden promoter suggest that EBF1 acts as a pioneer transcription factor Received for publication February 5, 2008. Accepted for publication June 20, 2008. with crucial roles in the establishment of the epigenetic program in The costs of publication of this article were defrayed in part by the payment of page the developing B lymphocyte (16). EBF1 has also been shown able charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. to rescue B cell development in the absence of E2A (17), Pu.1 1 These studies were generously supported by grants from the Swedish Cancer So- (18), or Il-7Ra (19, 20) and been suggested to restrict the devel- ciety, the Swedish Research Council, Tobias Stiftelsen, the Swedish Childhood Can- opment potential of hematopoietic progenitors (21). However, cer Foundation, The Swedish Foundation for Strategic Research, and the faculty of Medicine at Linko¨ping University. even though EBF1 has an undisputable role in B cell development, the exact function of this transcription factor remains unclear. The R.M. and D.B. performed transplantation experiments and cell sorting while genom- ics and RNA analysis work was performed by S.Z. and R.M., S.Z., P.T., J.Z., and presence of candidate pre-pro-B cells in an EBF1-deficient M.S. performed promoter analysis and transfection experiments. All authors contrib- mouse bone marrow suggested that the initial phases of B lin- uted to the experimental design and were involved in the writing of the manuscript. eage commitment is not contingent upon EBF1 activity (4). 2 S.Z. and R.M. contributed equally to this study. However, the lack of expression of B cell-restricted genes and 3 Address correspondence and reprint requests to Dr. Mikael Sigvardsson, Stemcell Center, Lund University, Laboratory for Cellular Differentiation, BMC B12, Lund, IgH recombination (4) argued against the formation of the pre- Sweden. E-mail address: [email protected] pro-B cell compartment in the absence of EBF1. Furthermore, 4 Abbreviations used in this paper: KO, knockout; FL, fetal liver; PI, propidium even though a number of target genes have been identified, a iodine; BM, bone marrow; WT, wild type; CLP, common lymphoid progenitors; complete explanation of the phenotype found in the EBF1-de- LMPP, lympho myeloid primed progenitors; Q-PCR, real-time quantitative PCR. ficient mice is still lacking. In vitro differentiation experiments Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 suggested that the developmental block in EBF1-deficient www.jimmunol.org The Journal of Immunology 3365 pre-pro-B cells is cell autonomous (18), however the identifi- basically 2(Ct GOI-Ct Hprt), where Ct GOI is the mean of Cts for gene of cation of EBF1 proteins in other bone marrow populations (22, interest. To validate the data with regard to significant differences, values 23) also opens for alternative and more or less complex expla- are subjected to Student’s t test. nations of the phenotype observed in the absence of EBF1. In vitro evaluation of B- and T-lymphoid potential by We report in this study that EBF1-deficient hematopoietic cells OP9/OP9⌬L1-coculture display a cell autonomous block of B cell priming already at the For evaluating B cell and T cell potential, cells were respectively seeded common lymphoid progenitors (CLP) stage. Reduced expression (using a FACSAria) onto preplated OP9 (supplemented with 10 ng/ml of genes associated with B-lineage development was observed in FLT3L Amgen and 10 ng/ml IL7 PeproTech) and OP9⌬1 (supplemented EBF1-deficient CLPs both at the population and single cell level. with 10 ng/ml FLT3L) stroma layers for 14 days. Cultures were substituted Global gene expression analysis also revealed a reduced expres- with new cytokines every 7 days. OP9 cocultures were evaluated by FACS staining with CD19 (1D3) PE, sion of the transcription factors Pou2af1 (OcaB) and Foxo1 in Gr1 (RB6-8C5) PE-Cy5, CD11b (M1/70) PE-Cy5, B220 (RA3-6B2) allo- EBF1-deficient CLPs and analysis of the promoter elements flank- phycocyanin and PI. OP9DL1 cocultures were evaluated by FACS staining ing these genes support the idea of them being direct targets for with CD25 (7D4) FITC, CD19 (1D3) PE, CD90.2/Thy1.2 (53-2.1) allo- EBF1. Thus, we conclude that EBF1 deficiency results in a prom- phycocyanin and PI. inent block of B cell development already at the CLP stage and Samples were analyzed on a BD FACSCalibur (BD Biosciences). that EBF is directly involved in the establishment of a B-lineage- Affymetrix gene expression and data analysis restricted transcription factor network. RNA was extracted from purified adult BM subsets as described for Q-RT- PCR. RNA was labeled and amplified according to the Affymetrix Gene- Materials and Methods Chip Expression Analysis Technical Manual. Chips were scanned using a In vivo reconstitution assay GeneChip Scanner 3000 and scaled to a median intensity of 100. RNA from cells sorted on separate occasions was separately hybridized for each Animal procedures were performed with consent from the local ethics investigated population. Probe level expression values were calculated us- committee at Lund University (Lund, Sweden). To obtain E14.5 fetal livers ing RMA and further analysis was done using dChip (http:// (FLs), heterozygous EBF-KO mice (on C57BL/6 background, CD45.2) biosun1.harvard.edu/complab/dchip/). Array data will be deposited in Geo were mated early evening and females checked the following morning for upon acceptance of the report for publication. the presence of a vaginal plug designated as embryonic day 0.5 (E0.5). Principal component analyses was performed using the online NIA Mi- Embryos were collected from pregnant mice at E14.5 and feta liver dis- croarray analysis tools provided by national institute for aging (http:// sected. Recipient mice (C57SJL, CD45.1) were lethally irradiated2hbe- lgsun.grc.nia.nih.gov/ANOVA) (24). fore transplantation of 2.5 ϫ 106 unfractionated FL cells and 0.25 ϫ 106 unfractionated bone marrow (BM) support cells (C57SJL, CD45.1). Trans- Ig recombination PCR analysis planted mice were analyzed at least 16 wk after transplantation. BM B- cells, BM CLPs, and thymocytes from respective tissues were stained as Genomic DNA was prepared using TRIzol (Life Technologies) according follows: B cell staining: purified Ter119 (Ter119), Gr1 (RB6-8C5) and to the manufacturer’s instructions. IgH D-J rearrangements were amplified CD11b (M1/70) (visualized with GAR-QD605), subsequently followed by by 38 cycles (94°C, 30 s; 60°C, 45 s; and 72°C, 1 min) using the DH and ϩ Fc-Block (CD16/CD32, 2.4G2) and CD45.1 (A20) FITC, CD43 (S7) PE, J3 primer at 1 ␮M. The PCR products were blotted onto Hybond N nylon CD3 (145-2c11) PE-Cy5, CD45.2 (104) PE-Cy5.5, B220 (RA3-6B2) PE- membranes (Amersham Biosciences) using capillary blotting. Membranes Cy7, CD19 (1D3) allophycocyanin, CD4 (RM4-5) allophycocyanin-Al- were prehybridized in 5 ϫ Denhardts (Ficoll 10g/L, polyvinylpyrridol exa750, Nk1.1 (PK136) Pacific Blue, AA4.1 (AA4.1) biotin (visualized 10g/L, BSA 10g/L), 6 ϫ saline sodium phosphate EDTA, 0.1% SDS, and with Streptavidin QuantumDot (QD) 655), and propidium iodine (PI); CLP 100 ␮g/ml salmon sperm DNA, at 45°C for 60 min and hybridized with a staining: Fc-Block (CD16/32, 2.4G2) followed by CD45.1 (A20) FITC, specific ␥32[P]-labeled oligonucleotide for 12 h at 45°C in the same solu- FLT3 (A2F10) PE, TER119 (Ter119) PECy5, CD3 (145-2c11) PECy5, tion. Membranes were washed at room temperature in 2 ϫ SSC (0.015M Gr1 (RB6-8C5) PECy5, CD11b (M1/70) PE-Cy5, CD45.2 (104) PE-Cy5.5, Na citrate (pH 7.0) containing 0.15 M NaCl) supplemented with 0.1% SDS B220 (RA3-6B2) PE-Cy7, CD19 (1D3) allophycocyanin, KIT (2B8) allo- for 15 min and 0.1 ϫ SSC with 0.1% SDS for 5–10 min. The hybridized phycocyanin-Cy7, SCA1 (D7) Pacific Blue, IL7r (A7R34) biotin (visual- membrane was subjected to autoradiography. ized with Streptavidin QD655), and PI; and Thymocyte staining: CD45.2 The following oligonucleotides were used for PCR: DH: 5Ј-GGAATT (104) Alexa488, CD45.1 (A20) PE, CD8a (53-6.7) PE-Cy5.5, CD4 CG(A/C)TTTTTGT(C/G)AAGGGATCTACTACTGTG-3Ј, J3: 5Ј-GTC (RM4-5) allophycocyanin-Alexa750, and PI. TAGATTCTCACAAGAGTCCGATAGACCCTGG-3Ј. The following Analysis and cell sorting was done on a FACSAria (BD Biosciences). oligonucleotide was used for hybridization: JH3: 5Ј-AGACAGTGAC For isolation of B cell progenitors and CLPs, BM cells were subjected to CAGAGTCCCTTGG-3Ј. lineage depletion and enrichment of Kitϩ cells respectively as previously The OPN promoter or a part of the HPRT gene was amplified as control described (53). for that the samples contained amplifiable material. Quantitative RT-PCR Gene expression analysis of single cells by multiplex RT-PCR Cells were sorted directly into buffer-RLT and frozen at Ϫ80°C. RNA Multiplex single-cell RT-PCR analysis was performed as previously de- extraction and DNase treatment was performed with the RNeasy Micro scribed (25, 26). In brief, single cells were deposited into 96-well PCR Kit (Qiagen) according to the manufacturer’s instructions for samples plates containing 4 ␮l lysis buffer and frozen at Ϫ80°C. Cell lysates were containing Յ105 cells. Eluted RNA samples were reverse transcribed reverse-transcribed using gene-specific reverse primers and 50 U using SuperScript III and random hexamers (Invitrogen) according to MMLV-RT (Invitrogen) in a final volume of 10 ␮l. First-round PCR was protocol supplied by the manufacturer. Real-time quantitative PCR (Q- performed by the addition of 40 ␮l PCR mix containing 1.25 U Taq poly- PCR) reactions were performed by mixing 2 ϫ TaqMan universal PCR merase (TaKaRa Bio) and gene-specific forward primers to the RT reaction ϫ ␮ master mix, 20 TaqMan primer/probe mix, RNase-free H20 and 5 lof and the mix subsequently subjected to 35 cycles of PCR. One-microliter cDNA for a final reaction volume of 20 ␮l. Assays-on-Demand probes aliquots of first-round PCRs were further amplified for 35 cycles using used were: Pax5; Mm00435501_m1, Hprt; Mm00446968_m1, Ebf11; nested gene-specific primers. Second-round PCR products were subjected Mm00432948_m1, Cd79a; Mm00432423_m1, Cd79b; Mm00434143_m1, to gel electrophoresis and visualized by ethidium bromide staining. Primers Cd19; Mm00515420_m1, Foxo1; Mm00490672_m1, Pou2af1; sequencesasfollows:Hprt;1)5ЈGGGGGCTATAAGTTCTTTGC;2)5ЈGTT Mm00448326_m1, Rag1; Mm01270936_m1, Rag2; Mm00501300_m1, CTTTGCTGACCTGCTGG; 3) 5ЈTGGGGCTGTACTGCTTAACC; 4) Sequences for the Assay-by-Design probe used for ␭5 (Igll1) detection 5ЈTCCAACACTTCGAGAGGTCC. Rag1; 1) 5ЈCCAAGCTGCAGACAT were: forward 5ЈGGAACAACAGGCCTAGCTATGG, reverse 5ЈCTCCCC TCTAGCACTC; 2) 5ЈCAGACATTCTAGCACTCTGG; 3) 5ЈGCTTGA GTGGGATGATCTG, probe 5ЈCCGGCAGCTCCTGTTC and sterile IgH: CTTCCCATCAGCATGGA; 4) 5ЈCAACATCTGCCTTCACGTCGA forward 5ЈGGACTTTGGGATGGGTTTGGTT, reverse 5ЈCCCTGGTCC TCC. Pax5; 1) 5ЈCTACAGGCTCCGTGACGCAG; 2) 5ЈATGGCCACT TAGACATCAGAGTAAT, prob 5ЈCCCAGATGAAGGGCTAC. CACTTCCGGGC, 3) 5ЈGTCATCCAGGCCTCCAGCCA; 4) 5ЈTCTCGG All experiments were performed in triplicates and differences in cDNA CCTGTGACAATAGG. IgII1 (␭5); 1) 5ЈAGTTCTCCTCCTGCTGCTGC; input were compensated by normalizing against Hprt expression levels. 2) 5ЈGGGTCTAGTGGATGGTGTCC; 3) 5ЈCAAAACTGGGGCTTAGA Values shown in figures are arbitrary numbers calculated as ⌬Ct, which is TGG; 4) 5ЈCCCACCACCAAAGACATACC. Ebf1; 1) 5ЈCCCTCTTATCT 3366 ROLE OF EBF1 IN B-LYMPHOPOIESIS

GGAACATGC; 2) 5ЈCTACTCCCTGTATCAAAGCC; 3) 5ЈTGTACG serum free medium, incubated for 30 min in room temperature, mixed with ACAGTGTGACTTCC; 4) 5ЈTAAGGATCACTTCCTTTGGC. Cd79a the diluted DNA, and then incubated for another 15 min at room temper- (Mb-1); 1) 5ЈCCTCCTCTTCTTGTCATACG; 2) 5ЈAAACAATGGCAG ature. Meanwhile, the complete RPMI medium was replaced with 300 ␮l GAACCC; 3) 5ЈTGATGATGCGGTTCTTGG; 4) 5ЈGAACAGTCATCA of serum-free medium, and the DNA plus lipofectamin mixture was added Ј Ј AGGTTCAGG. Foxo1: 1) 5 TCATCACCAAGGCCATCGA; 2) 5 TGT to the cells that then were incubated at 37°C in 5% CO2 for 3 h, after which CGCAGATCTACGAGTGGAT; 3) 5ЈGTTCCTTCATTCTGCACTC each well was supplemented with 1 ml complete RPMI. Cells were har- GAA; 4) 5ЈGTGATTTTCCGCTCTTGCCTC; Pou2af1: 1) 5ЈACGCCC vested 48 h after transfection and protein extracts were prepared directly in AGTCACATTAAAGAAG 2) 5ЈAGCCAGTGAAGGAGCTACTGAG 3) the 24-well plates by adding 100 ␮l cell lysis buffer. 5ЈATGTTCCCTCCTCTGTCACTGT 4) 5ЈTTAGGAAGAAAGGAAGCC TGTG; Sterile IgH: 1) 5ЈGCTAGCCTGAAAGATTACC; 2) 5ЈTGAGTT Statistics Ј Ј TCTGAGGCTTGG 3) 5 AGTAGCACAGTCTCTGTTCTGC; 4) 5 AAG All statistical analyses have been done either in Microsoft Excel and GACTGACTCTCTGAGG Primers 1 plus 4 and 2 plus 3 are outer and GraphPad Prism or appropriate software for microarray analysis (dChip inner primer pairs respectively. and NIA microarray analyses). Tissue culture conditions and cell lines Results BaF/3 cells and transduced Baf/3 lines (12) as well as HeLa cells were Lack of EBF1 results in a cell autonomous and grown at 37°C and 5% CO2 in RPMI 1640 supplemented with 10% FCS, lineage-restricted block of B cell development 10 mM HEPES, 2 mM pyruvate, 50 ␮M 2-ME, and 50 ␮g/ml gentamicin (all purchased from Life Technologies). The medium for the BaF/3 cells Expression of EBF1 is within the hematopoietic system closely was supplemented with 10% of conditioned medium from confluent related to B lineage development (3). However, when comparing ⌷⌸ ⌬ WEHI3 cells as a source of IL-3. 9/OP9 1 cells were grown in the changes in global gene expression patterns between multipo- OPTIMEM supplemented with 10% (v/v) FCS, 50 ␮M 2-ME, and 50 ␮ tent lympho myeloid primed progenitors (LMPPs) (28) and the g/ml gentamicin (Invitrogen) at 37°C and 5% CO2. more developmentally restricted CLPs (29) by microarray analy- Protein extracts and EMSA sis, we noted a striking difference in the expression levels of Ebf1 Nuclear extracts were prepared according to Schreiber et al. (27) DNA (53). These experiments suggested that the multipotent CLP ex- ϩ ϩ probes were labeled with ␥ [32P] ATP by incubation with T4 polynucle- pressed ϳ20% of the mRNA level observed in Cd19 B220 otide kinase (Roche), annealed with the complementary strand and purified CD43ϩ pro-B cells, opening the possibility that EBF1 may be on a microspin column (Roche). Five to ten micrograms of nuclear extract involved in the development of CLPs. Due to a high early lethality was incubated with the labeled probe (20,000 cpm, 3 fmol) for 30 min at room temperature in binding buffer (10 mM HEPES (pH 7.9); 70 mM KCl; of EBF1 deficient mice, and due to the reported function and ex-

1 mM DTT; 1 mM EDTA; 2,5 mM MgCl2; 5% glycerol, 1 mM ZnCl2) pression of EBF1 proteins in bone marrow stroma cells (22), we with 0.75 ␮g Poly dI/dC (Amersham Biosciences). DNA competitors were investigated the ability of EBF1-deficient day 14.5 FL hematopoi- added 10 min before addition of the labeled probe. The samples were etic progenitor cells to generate hematopoietic cells after trans- separated on a 6% acrylamide TBE gel, which was dried and subjected to plantation (Fig. 1, A–D). In mice analyzed 16 wk or more post- autoradiography. Competitors based on synthetic oligo-nucleotides were ϩ added at molar excesses indicated in the respective figure legends. Super transplantation, the overall reconstitution of CD45.2 cells out of ϩ shifts were performed under the same conditions but with additional pres- the total CD45 BM cells in mice receiving wild-type (WT) FL ence of 2 ␮l polyclonal anti-EBF (SC-15333) or anti-actin (SC-1616) cells was Ͼ95% while in those transplanted with the EBF-deficient (Santa Cruz Biotechnology) as a negative control. FL cells, it was between 75 and 95% (Fig. 1A). Among the Oligo-nucleotides used for EMSAs were: Cd79a sense: AGCCACCTC ϩ Cd79a CD45.2 cells, the fraction of early progenitors including the TCAGGGGAATTGTGG; antisense: CCACAATTCCCCTGAGAG Ϫ GTGGCT; mutated Cd79a sense: AGCCACCTCTCAGCCGTTTTGTGG; Lin ScaIϩKitϩ (LSK) and the CLPs (Fig. 1B) was comparable as mutated Cd79a antisense: CCACAAAACGGCTGAGAGGTGGCT; was the distribution of the major T cell subpopulations in the thy- Pou2af1 EBF sense: ATAGTGACCCCTGGGAATCGCAT; Pou2af1 an- mus (Fig. 1C), suggesting that EBF is not crucial for early lym- tisense: ATGCGATTCCCAGGGGTCACTAT; Foxo1 EBF1 sense: TGC CGCCTCCCGAGGGAAGGCAGC; Foxo1 EBF1 antisense: GCTGCC phoid development or thymopoiesis. Investigations of early bone TTCCCTCGGGAGGCGGCA; Foxo1 EBF2 sense: CACCGACTTCCC marrow B cell compartments, however, revealed a complete lack GAGAGCTGCGCGA; Foxo1 EBF1 antisense: TCGCGCAGCTCTCGG of pre- or pro-B cells derived from EBF1 deficient cells. In con- GAAGTCGGTG; Rag-E sense: ACAATGCTAAGCCCTCGGGTTCT trast, we detected slightly increased numbers of B220ϩCD43ϩ GTCTAA; Rag-E antisense: TTAGACAGAACCCGAGGGCTTAGC AA4.1ϩ cells, reported to represent the pre-pro-B cell compart- ATTGA. ment (Fig. 1D), (30, 31) supporting the previously raised idea that Plasmids and cloning of promoter elements deficiency in EBF1 results in a lineage restricted early block in B The EBF-1 expression plasmid has been described before (11). The re- cell differentiation. To verify the apparently normal ability of porter plasmids were based on the luciferase reporter plasmid pGl-3 (Pro- EBF1-deficient fetal liver cells to generate CLPs with lymphoid mega). The FoxO1 and Pou2af1 promoter reporter plasmids were gener- potential,weculturedCLPs(lineagenegative,Il7RϩFLT3ϩSCA1low ated by blunt end cloning of PCR amplified promoter elements into the KITlow, sorted from the FL transplanted mice) on either OP9 or SmaI site of pGl-3. All constructs were verified by sequencing. The PCR OP9⌬1 stroma cells (see Materials and Methods). This revealed products were generated using the following primers: Pou2af1 Ϫ560sense: TCAGACGCGTGGAGCCGTTACATTTTAAAGTGG; Pou2af1 anti- that T cell development of EBF1-deficient CLPs progressed nor- ϩ sense: TCGACTCGAGGAACCACCGTTTACTCTGAGG; Foxo1 Ϫ499 mally in vitro while development of CD19 cells was completely sense: TCGAACGCGTCCCACCGACTTCCCGAGAGCTGC; Foxo1 an- abrogated (Fig. 1E). These data suggest that EBF1-deficient he- tisense: AGCTCTCGAGGACTGAAGCGACTCCGCAGACTCC. matopoietic progenitor cells have a B-lineage-specific cell auton- Transient transfections and luciferase assays omous defect and suggest that a CLP compartment forms inde- pendently of EBF1. HeLa cells were seeded into a 24-well tissue culture plate so that they reached 60–80% confluence for transfection. A total of 400 ng of DNA EBF1-deficient CLPs display defective transcription of was used to transfect the cells in each well. In brief, 50 ng of each reporter B-lineage-associated genes construct was cotransfected with 600 ng expression vector and all trans- fections included 50 ng pRL-0 Renilla luciferase, received from Dr. Bjo¨rn The apparent block of B cell development in fraction A, according Olde (Lund University, Sweden), as internal control, and used for normal- to the Hardy nomenclature (30, 31) would suggest that EBF1 is ization of the luciferase activities. The DNA was first added to 50 ␮lof serum free medium OPTIMEM (Invitrogen), mixed with 7 ␮l of PLUS involved in regulating critical genes in the pre-pro-B cell compart- Reagent (Invitrogen), and incubated for 15 min at room temperature. In ment defined by expression of B220, CD43, and AA4.1 on the cell brief, 0.75 ␮l of Lipofectamin reagent (Invitrogen) was diluted in 25 ␮lof surface. To identify potential target genes of EBF1, we performed The Journal of Immunology 3367

FIGURE 1. Lack of functional EBF1 results in a cell autonomous deficiency in B cell development in vivo. A–D, The panel shows data from individual mice (represented by dots) transplanted with 2.5 ϫ 106 E14.5 EBF1-KO or WT FL donor cells (from CD45.2ϩ mice) transplanted together with 2.5 ϫ 105 unfractionated BM support (from CD45.1ϩ mice) to lethally irradiated mice. The mean value in an experimental group (indicated by a horizontal line) as well as representative FACS plots from the generated BM cells. A, Graph containing the obtained overall reconstitution levels (percentage of CD45.2ϩ cells of total CD45ϩ cells in the BM). B, Percentage of LSKs and CLPs of total CD45.2ϩ cells and representative FACS plots from WT or EBF1-deficient mice as indicated. C, CD4/CD8 thymocytes subpopulations and D displays B cell progenitor populations. The diagrams show the percentage of CD45.2ϩ donor cells. E, Representative FACS plots of resulting cells when 50 CLPs (purified from transplanted mice of indicated genotype 16 wk posttransplantation) were cocultured for 14 days on OP9 or OP9⌬1 stroma cells (see Materials and Methods). The data are representative of at least two independent sorting experiments (KO; Ebf1 KO mice, WT; wild-type C57BL/6 mice, HT; heterozygote Ebf1 KO mice, DN; double negative, DP; double positive, SP; single positive, n ϭ 5). microarray gene expression analyses on sorted CD45.2ϩ CLPs and however, we could detect reductions of gene expression of B- B220ϩCD43ϩAA4.1ϩ cells from mice reconstituted with either lineage-associated genes including Pou2af (OcaB), Pax5, WT or EBF1-KO FL cells (Fig. 2A). To place the gene expression Vpreb1, and Blnk, in the cells generated from EBF1-deficient patterns observed into a context, expression data from LMPPs as fetal livers. To verify a reduced expression of B-lineage-asso- well as CD19ϩCD43lowAA4.1ϩ pro B cells, B220ϩCD43Ϫ ciated genes in the EBF1-deficient CLPs from transplanted CD19ϩIgMϪ pre-B cells and IgMϩB220ϩ spleen B cells sorted mice, we performed Q-PCR analysis that supported reductions from WT mice were included in the analysis. These experiments in Cd79a, Pou2af, Pax5, and Igll1 (␭5) expression (Fig. 2B). suggested that WT and EBF1 KO B220ϩCD43ϩAA4.1ϩ cells, We could also detect reductions in the levels of Cd79b and generated in vivo in mice reconstituted with FL cells, expressed Foxo1 message, suggesting that normal expression of these very low levels of B-lineage-associated transcripts, indicating genes were dependent of functional EBF1. To investigate these that in this setting and from the gene expression point of view, alterations in gene expression patterns at a single cell level, WT this population of cells cannot be linked to progressive B and EBF1-KO CLPs (sorted from FL reconstituted mice), were lineage development. This was also supported by a global prin- analyzed for gene expression patterns with multiplex single cell cipal component analysis because CLPs displayed a higher PCR (Fig. 2C). This revealed that while a small subpopulation overall similarity to pro-B cells than the B220ϩCD43ϩAA4.1ϩ of the WT CLPs coordinately expressed Mb-1, Pax-5, and population (data not shown). The principal component analysis Pou2af ( p Ͻ 0.03), these cells are absent in the CLPs from also supported the idea that the EBF1-deficient cells displaying EBF1-deficient mice (Fishers exact test, p Ͻ 0.03). We were a CLP surface phenotype indeed represent a CLP population also able to detect transcripts from the WT as well as the mu- (data not shown). The microarray data suggested that there were tated Ebf1 gene in a large number of the cells. These findings no significant alterations in the expression of TCF3, Id, or support the idea that in the absence of EBF1, B cell develop- Ikaros proteins in WT or EBF-deficient CLPs (Data not shown), ment is blocked already at the level of the CLP. 3368 ROLE OF EBF1 IN B-LYMPHOPOIESIS

FIGURE 2. EBF1 deficient CLPs display reduced expression of B-lineage genes in global expression analysis and single cell level. A, dCHIP analysis of WT and EBF1 deficient CLPs and pre-pro-B cells in the context of LMPPs and other stages of B cell development. Clustering shows genes being expressed in either pro-B cells or LMPPs (100ϩ expression units in either) and being down-regulated 1.5-fold from WT to KO CLPs. Data represents a mean of the measurements and are collected from at least two different sorting experiments. Red represents high and blue low expression. Expression values are shown in the cluster. B, Quantitative RT-PCR analysis of B-lineage associated genes in CLPs sorted from mice transplanted with either WT or EBF1-deficient FL (data are collected from one representative WT and two EBF1-KO reconstituted mice, error bars indicate experimental SE). C, The result of multiplex single cell PCR of CLPs from mice reconstituted with WT or KO fetal liver. Each dot represent detectable expression of a given gene and each horizontal line of dots indicate gene expression pattern in a given cell (KO; EBF1 KO mice, WT; wild type C57BL/6 mice).

Absence of EBF1 results in reduced IgH D-J recombination cells. To approximate the differences in recombination efficiency, in CLPs we performed a semiquantitative PCR (Fig. 3A). This suggested It has been reported that a fraction of the CLPs in the mouse BM that the difference was in the order of 2–4 cycles, or 12.5–25% of has undertaken the first steps of the IgH recombination process by WT values. To further investigate whether D-J recombination oc- ϩ joining D segments to J segments (31). To investigate whether curs in the absence of EBF1, we sorted CD3 cells generated by EBF1 has a direct role in recombination of the IgH genes, we transplantation of WT or EBF1 KO fetal liver cells as above and extracted genomic DNA from WT as well as EBF1-deficient CLPs investigated IgH recombination in this compartment (Fig. 3B). obtained by transplantation as above, and investigated the presence This indicated that IgH D-J recombination could be detected sup- of IgH D-J recombination in these cells (Fig. 3A). Recombination porting the idea that IgH D-J recombination occur, at least in the events were easily detected in the WT CLPs,while they appeared developing T cell compartment, in the absence of EBF1. Thus, to be dramatically reduced in CLPs generated from EBF1 deficient even though DJ recombination may occur in the absence of EBF1, The Journal of Immunology 3369

FIGURE 3. Reduction of IgH D-J rearrangement in CLP compartment in absence of EBF1. A, Autoradiograms of blotted PCR products from the D-J recombined IgH locus or ethidium bromide stained agarose gels with a PCR product generated by the amplification of the osteopontin promoter (OPN) or the Hprt gene as a control for the presence of amplifiable DNA. Each lane in the left panel represents one independent sort from different transplanted mice (LMPPs was generated by sorting directly from WT mice and not from transplanted animals.). The semiquantitative experiment in the right panel displays autoradiograms of PCR products generated by two cycle intervals as indicated. The data show one representative of two independent experiments from different sorts. B, D-J PCR analysis of sorted thymic CD3ϩ cells. OP9 represents OP9 stroma cells and serves as a negative control for recombination. C, Quantitative RT-PCR analysis of Rag1, Rag2, and sterile IgH expression in WT and EBF1 KO reconstituted CLP populations (data are collected from one representative WT and two EBF KO reconstituted mice, error bars indicate experimental SE). The left autoradiogram in D shows EMSAs using nuclear extract isolated from 230 to 238 pre-B cell line and the potential EBF1 binding site in the E-Rag enhancer. ACTIN or EBF1.Abs are included as indicated. Right panel, EMSAs using nuclear extracts from 230 to 238 and the EBF1 bidning site from the Cd79a promoter. Complex formation s competed for by the addition of a 500-fold excess of unlabelled Cd79a or mutated CD79aM oligo or 150 and 500-fold excess of E-Rag enhancer EBF1 site. The gels have been cut to display only the EBF/DNA complex. (EMSA; EMSA, Ab; Ab, Com; competitor, Cd79aM; mutated Cd79a prob).

this event is largely reduced even at the level of the CLP. The EBF activates a network of B-lineage-associated transcription global gene expression analysis suggested that EBF1-deficient factors in the CLP Rag1 CLPs expressed a lower level of essential for IgH recombi- Knowing that the expression of Pou2af and Foxo1 is reduced in nation. To verify this finding and expand the analysis, we inves- EBF-deficient CLPs, we wanted to examine a potential direct role tigated the expression levels of Rag1, Rag2, and sterile IgH tran- of EBF1 in the regulation of these genes. Because expression of scripts in EBF1 deficient CLPs (Fig. 3C). We found that the Rag1 the EBF gene is not perfectly correlated to the expression of its expression was only ϳ25% of that in the WT cells while the ex- target genes (Fig. 2C, 53), we sorted CLPs from mice carrying an pression of Rag2 and sterile IgH transcripts were only marginally Igll1 promoter-controlled human CD25 gene (33). The Igll1 pro- reduced. Because the single cell PCR analysis suggested that a moter is a direct target for EBF and these mice can therefore be comparable number of CLPs express Rag1 either in the absence or used to identify early cells that have initiated the B lineage pro- presence of EBF1 (Fig. 2C), this differential level is likely to be gram (53). Q-PCR analysis suggested that the increased expression reflected in a reduction of transcription rather than a loss of a given of Igll1 was correlated to that of Pax5, Pou2af1, Foxo1, and population. This could indicate that Rag1 would be a direct target for EBF1, but we were unable to identify any EBF binding sites in Ebf1supporting the idea that these genes are coordinately regulated the published Rag1 promoter. To investigate whether an alterna- in early B cell development (Fig. 4A). In addition, we were able to tive promoter was used in the CLP, we performed 5Ј RACE anal- detect low but significant amounts of both Pou2af1 and FoxO1 ysis using CLP mRNA. This did, however, result in identification transcripts in Ba/F3 progenitor cells after stable ectopic expression of the identical promoter region arguing against this explanation. of the combination of EBF and E2A (12) (Fig. 4B). These data Another possibility would be a direct involvement of EBF in the suggest that EBF1 might be directly involved in the regulation of regulation of the E-Rag enhancer (32). Targeted deletion of this both the Pou2af1 and Foxo1 genes. RACE analysis supported the element has a rather dramatic effect on the transcription of Rag1 idea that the published promoter sequences (Ref. 34, 35 and NCBI- while the effect on Rag2 transcription is comparably small (32). Gene) were valid also in immature cells (data not shown) and Investigation of the E-Rag enhancer sequence revealed a potential inspection of the 5Ј flanking regions revealed two potential EBF1 EBF binding site, and using EMSA we were able to show that this sites in the Foxo1 and one potential site in the Pou2af1 promoters site had the ability to compete for binding of an CD79a promoter (Fig. 4C). To investigate whether these sites were able to interact EBF site to EBF1 in nuclear extracts from a mouse pre-B cell line with EBF1, we performed EMSA experiments using nuclear ex- (Fig. 3D). Furthermore, upon incubation with nuclear extracts, this tracts from a mouse pre-B cell line and competed for complex site was able to form a complex that could be supershifted with formation between EBF1 and the high affinity binding site from the anti-EBF Ab (Fig. 3D). Therefore, we conclude that EBF1 is of Cd79a promoter (Fig. 4C). This revealed that both the Foxo1 and large importance for IgH D-J recombination in the CLP and that Pou2af1 promoters contained high affinity binding sites able to lack of EBF1 is associated with a reduced expression of Rag1, compete for EBF1 binding. To verify the ability of these binding possibly as a direct result of EBF activity at the E-rag enhancer or sites to interact with EBF1 in a nuclear extract from a pre-B cell via reduced levels of Fox proteins acting at the same element (see line, we performed a second round of EMSAs using labeled below). Foxo1 or Pou2af1 EBF binding sites. Both gave rise to one 3370 ROLE OF EBF1 IN B-LYMPHOPOIESIS

FIGURE 4. Foxo1 and Pou2af1 genes are direct targets for EBF. A, Quantitative RT-PCR analysis of Igll1 Foxo1, Pax5, Pou2af1, and EBF1 in subpopulation of CLPs with or without activated expression of Igll1 as indicated by transgenic expression of a human CD25 reporter gene. B, Q-PCR analysis of Ebf1, Pou2af1, and Foxo1 expression in stably transfected Baf3 cell lines expressing EBF1 and E2A (12) (Error bars indicate experimental SE of representative experiments in both panels, significance for differences T-student p Ͻ 0.01). C, The sequence of putative EBF1 binding sites in the Foxo1 and Pou2af1 promoters and the position relative to the transcritptional start site. The left autoradiogram display and EMSAs generated with nuclear extracts from 230 to 238 pre-B cells and labeled binding sites from the Pou2af1 and Foxo1 promoters. Anti-actin and EBF Abs are added as indicated. The right panel shows EMSAs where the binding of EBF1 from 230 to 238 extracts to the Cd79a promoter EBF site is competed for by the addition of a 500-fold excess of Cd79a, mutated Cd79aM, or 150- and 500-fold excess of Foxo1 and Pou2af1 promoter binding sites. The gels have been cut to display only the EBF/DNA complex. The diagrams in D display the resulting luciferase activity when reporter constructs controlled by the Foxo1, Pou2af1 or the control promoter prl0 was transfected into epithelial HeLa cells with either empty or EBF1 encoding expression plasmids. The data are normalized against the expression of a cotransfected CMV renilla construct and generated from three transfections from one representative experiment of at least two different experiments with three transfections in each. The error bars indicate SD.

major complex that was supershifted by the addition of anti- line with the finding that while TCF3 target genes can be detected EBF Ab (Fig. 4C). To investigate the ability of EBF1 to directly in LMPPs, these cells lack transcription of EBF target genes (28). activate the Foxo1 and Pou2af1 promoters, we cloned these reg- However, even though CLP like cells were generated from EBF1- ulatory elements in front of a luciferase reporter gene and trans- deficient fetal liver cells, they lacked the transcription of B-lineage fected them either with empty or EBF1 encoding expression vector associated genes normally found in the CLP compartment. Even into epithelial HeLa cells lacking endogenous expression of EBF1. though we were able to detect cells with surface expression of This revealed that both promoter elements responded to the ectopic AA4.1, B220, and CD43, indicative of pre-pro-B cells, we were expression of EBF1, supporting the idea that the Foxo1 and unable to obtain evidence that these cells would represent a ho- Pou2af1 genes are direct targets for EBF1. mogenous population of B-lineage cells and we conclude that EBF1-deficient progenitors are severely compromised in their abil- Discussion ity to take on B lineage fate. A role for EBF1 in lineage commit- In this article, we present data suggesting that even though EBF1 ment is also supported by the finding that the factor restricts the expression is dramatically increased in the transition from the mul- lineage choices of PAX5 deficient progenitor cells (37). The find- tipotent LMPP stage to the lymphoid-restricted CLP stage, the ing that EBF1-deficient CLPs lack expression of B-lineage genes transcription factor is not critical for the development of cells with found in normal CLPs supports the notion that EBF1 is a key a general CLP phenotype. The presence of surface proteins and coordinator of the transcriptional program that drives B-lympho- general gene expression patterns as well as preserved potential for cyte development already in the CLP. This activity could be ex- development into T-lineage cells in vitro all support this conclu- plained by the apparent ability of EBF1 to pioneer transcription by sion. This appears to be in contrast to what has been reported for mediation of epigenetic changes (18) but it could also be contrib- TCF3 (TCFe2a) because mice lacking this factor display a rather uted to EBF1s ability to directly activate a set of B-lineage asso- dramatic reduction in the number of CLPs (36). This would indi- ciated transcription factors (Fig. 5). EBF1 has previously been re- cate that even though EBF1 and TCF3 act in synergy in the earliest ported to be involved in the activation of the Pax5 gene (13) stages of B cell development (9, 13), TCF3 might have an EBF1- coding for a key transcription regulator in early B cell develop- independent function in the generation of CLPs. This would be in ment. PAX5 has in turn been suggested to regulate a large set of The Journal of Immunology 3371

rectly linked to the transcription of the Ebf1 gene itself. A majority of the CLPs express Ebf1 message, while only a small percentage of the cells express known target genes. We have investigated this in more detail using mice transgenic for a Igll1 promoter-con- trolled reporter gene, and it appears as if the activation of EBF1 target genes is linked to a 4-fold increase in Ebf1 message in a B cell committed subpopulation of the CLPs (53). We believe these data indicate that transcription of the Ebf1 gene is a precommit- ment process, crucial for but nor directly coupled to activation of the B-lineage program. This could be a result of a direct dose- dependent function, translational inhibition by inhibitory RNA or posttranslational modifications, for instance due to active Notch signaling (52). Regardless, because we find expression of Ebf1 even in the absence of the expression of other B-lineage genes, this provides strong support to the idea of a defined precommitment stage of B cell development represented by the expression of Ebf1. Because Ebf1 expression is low in LMPPs (53), a cell type that contains Tdt, sterile Ig, and Rag1 transcripts (28), this could indi- cate that the pathway to B cell commitment is achieved at least at three different levels. In the LMPP, lymphoid priming is estab- lished, represented by expression of genes common for B and T lymphoid cells. Upon transition into the CLP compartment, Ebf1 is up-regulated, making the cell competent to develop into B-lineage, but as the full function of EBF1 would be regulated at a posttran- scriptional level, cells still remain uncommitted even though they FIGURE 5. Ebf1 plays a central role in transcription regulatory network undergo Ig DJ recombination, facilitated by a low EBF1 activity of B-Cell development. The diagram shows some of the functional inter- incapable of activating B cell specific target genes. The final step actions of selected transcription factors with Ebf1 based on the current is then associated with the functional activation of EBF1 resulting knowledge about transcription regulatory networks in B cell development. in the transcription of a set of B lineage specific genes, including Solid arrowheads represent stimulatory and the open diamond end shows Pax5, Foxo1, and Pou2af1. inhibitory effect. Dashed lines show the hypothetical or controversial in- Thus, it may be so that there is no single crucial target gene for teractions. The diagram designed in yEd-Java Graph Editor available at EBF1 but rather that EBF1 is the key regulator of the B-lineage http://www.yworks.com/en/products_yed_about.html. transcriptional program and commitment through its ability to ac- tivate B-lineage genes as well as a set of transcription factors ca- genes including the expression of the transcription factor Lef1 (38) pable to strengthen the B cell identity, possibly already at the level and Ebf1 itself (3). PAX5 has also been suggested to positively of CLP. regulate expression of Cd19, Cd79a, and Rag2 (38–40) and to repress expression of Notch1 (41). In addition, we report in this Acknowledgments study that EBF1 is directly involved in the regulation of Pou2af1 We thank R. Grosschedl for the gift of EBF deficient mice, transcription. This protein was originally identified as a regulator R. A. Cumano and J. C. Zuniga-Pflu¨cker for providing the OP9 and OP9⌬1 of OCT protein activity in B-lymphoid cells and even though the stromal cell lines, and expert advice regarding the usage of these, Ragnar effect of targeted mutation of the Pou2af1 gene is most pronounced Mattson for help with investigations of EBF1 deficient embryos. The ex- in late stages of B cell differentiation (42–44), reduced levels of pert advice and assistance of Liselotte Lenner and Gerd Sten, and the SweGene affymetrix facility in assistance with the micro arrays is highly POU2AF1 have been reported to result disturbances also in early appreciated. B cell development (45). In addition, POU2AF1 has been reported to regulate the expression of the Ets transcription factor SpiB (46) Disclosures as well as of other genes encoding proteins involved in signaling The authors have no financial conflict of interest. and cell cycle regulation (47). EBF1 also appear to be directly involved in the regulation of the Foxo1 gene that might act in a References large network of redundant FOXO family transcription factors 1. Hagman, J., C. Belanger, A. Travis, C. W. Turck, and R. Grosschedl. 1993. (48). Among other FOX proteins, Foxp1 has been shown to be Cloning and functional characterization of early B-cell factor, a regulator of lym- important for early B cell development (49), to some degree pos- phocyte-specific gene expression. Genes Dev. 7: 760–773. 2. Igarashi, H., S. C. Gregory, T. Yokota, N. Sakaguchi, and P. W. Kincade. 2002. sibly via its ability to modulate Rag1 transcription though a direct Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in interaction with the E-Rag enhancer. Several of the FOX family bone marrow. Immunity 17: 117–130. 3. Roessler, S., I. Gyory, S. Imhof, M. Spivakov, R. R. Williams, M. Busslinger, members also share binding sites, and it is possible that there exist A. G. Fisher, and R. Grosschedl. 2007. Distinct promoters mediate the regulation a large redundancy among these proteins similar to what has been of Ebf1 gene expression by interleukin-7 and Pax5. Mol. Cell. Biol. 27: 579–594. reported for basic-helix-loop-helix transcription factors (50, 51). 4. Lin, H., and R. Grosschedl. 1995. Failure of B-cell differentiation in mice lacking the transcription factor EBF. Nature 376: 263–267. Thus, it is possible that the link between EBF1 and the FOX-factor 5. Urbanek, P., Z. Q. Wang, I. Fetka, E. F. Wagner, and M. Busslinger. 1994. network is mediated via FOXO1. Using available information Complete block of early B cell differentiation and altered patterning of the pos- about target genes for this network of transcription factors allows terior midbrain in mice lacking Pax5/BSAP. Cell 79: 901–912. 6. Nutt, S. L., C. Thevenin, and M. Busslinger. 1997. Essential functions of Pax-5 for the creation of a scheme where several genes known to define (BSAP) in pro-B cell development. Immunobiology 198: 227–235. the B lineage can be incorporated (Fig. 5). 7. Zhuang, Y., P. Soriano, and H. Weintraub. 1994. The helix-loop-helix gene E2A is requreid for B cell formation. Cell 79: 875–884. It is also notable that with the possible exception of Ig H chain 8. Bain, G., E. C. R. Maandag, D. J. Izon, D. Amsen, A. M. Kruisbeek, DJ recombination, the activation of EBF1 target genes is not di- B. C. Weintraub, I. Kroop, M. S. Schlissel, A. J. Feeney, M. van Roon, et al. 3372 ROLE OF EBF1 IN B-LYMPHOPOIESIS

1994. E2A proteins are required for proper B cell development and initiation of 31. Rumfelt, L. L., Y. Zhou, B. M. Rowley, S. A. Shinton, and R. R. Hardy. 2006. immunoglobulin gene rearrangements. Cell 79: 885–892. Lineage specification and plasticity in CD19- early B cell precursors. J. Exp. 9. Sigvardsson, M., M. O’Riordan, and R. Grosschedl. 1997. EBF and E47 collab- Med. 203: 675–687. orate to induce expression of the endogenous immunoglobulin surrogate light 32. Hsu, L. Y., J. Lauring, H. E. Liang, S. Greenbaum, D. Cado, Y. Zhuang, and chain genes. Immunity 7: 25–36. M. S. Schlissel. 2003. A conserved transcriptional enhancer regulates RAG gene 10. Sigvardsson, M., D. R. Clark, D. Fitzsimmons, M. Doyle, P. Akerblad, T. Breslin, expression in developing B cells. Immunity 19: 105–117. S. Bilke, R. Li, C. Yeamans, G. Zhang, and J. Hagman. 2002. Early B-cell factor, 33. Martensson, I. L., F. Melchers, and T. H. Winkler. 1997. A transgenic marker for E2A, and Pax-5 cooperate to activate the early B cell-specific mb-1 promoter. mouse B lymphoid precursors. J. Exp. Med. 185: 653–661. Mol. Cell. Biol. 22: 8539–8551. 34. Massa, S., S. Junker, K. Schubart, G. Matthias, and P. Matthias. 2003. The OBF-1 11. Sigvardsson, M. 2000. Overlapping expression of early B-cell factor and basic gene locus confers B cell-specific transcription by restricting the ubiquitous ac- helix-loop- helix proteins as a mechanism to dictate B-lineage-specific activity of tivity of its promoter. Eur. J. Immunol. 33: 2864–2874. the lambda5 promoter. Mol. Cell. Biol. 20: 3640–3654. 35. Stevens, S., L. Wang, and R. G. Roeder. 2000. Functional analysis of the OCA-B 12. Mansson, R., P. Tsapogas, M. Akerlund, A. Lagergren, R. Gisler, and promoter. J. Immunol. 164: 6372–6379. M. Sigvardsson. 2004. Pearson correlation analysis of micro-array data allows for 36. Borghesi, L., J. Aites, S. Nelson, P. Lefterov, P. James, and R. Gerstein. 2005. the identification of genetic targets for early B-cell factor. J. Biol. Chem. 279: E47 is required for V(D)J recombinase activity in common lymphoid progenitors. 17905–17913. J. Exp. Med. 202: 1669–1677. 37. Pongubala, J. M., D. L. Northrup, D. W. Lancki, K. L. Medina, T. Treiber, 13. O’Riordan, M., and R. Grosschedl. 1999. Coordinate regulation of B cell differ- E. Bertolino, M. Thomas, R. Grosschedl, D. Allman, and H. Singh. 2008. Tran- entiation by the transcription factors EBF and E2A. Immunity 11: 21–31. scription factor EBF restricts alternative lineage options and promotes B cell fate 14. Akerblad, P., and M. Sigvardsson. 1999. Early B cell factor is an activator of the commitment independently of Pax5. Nat. Immunol. 9: 203–215. B lymphoid kinase promoter in early B cell development. J. Immunol. 163: 38. Nutt, S. L., A. M. Morrison, P. Dorfler, A. Rolink, and M. Busslinger. 1998. 5453–5461. Identification of BSAP (Pax-5) target genes in early B-cell development by loss- 15. Akerblad, P., M. Rosberg, T. Leanderson, and M. Sigvardsson. 1999. The B29 and gain-of-function experiments. EMBO J. 17: 2319–2333. ␤ (immunoglobulin -chain) gene is a genetic target for early B-cell factor. Mol. 39. Schebesta, A., S. McManus, G. Salvagiotto, A. Delogu, G. A. Busslinger, and Cell. Biol. 19: 392–401. M. Busslinger. 2007. Transcription factor Pax5 activates the chromatin of key 16. Maier, H., R. Ostraat, H. Gao, S. Fields, S. A. Shinton, K. L. Medina, T. Ikawa, genes involved in B cell signaling, adhesion, migration, and immune function. C. Murre, H. Singh, R. R. Hardy, and J. Hagman. 2004. Early B cell factor Immunity 27: 49–63. cooperates with Runx1 and mediates epigenetic changes associated with mb-1 40. Cobaleda, C., W. Jochum, and M. Busslinger. 2007. Conversion of mature B cells transcription. Nat. Immunol. 5: 1069–1077. into T cells by dedifferentiation to uncommitted progenitors. Nature 449: 17. Seet, C. S., R. L. Brumbaugh, and B. L. Kee. 2004. Early B cell factor promotes 473–477. B lymphopoiesis with reduced interleukin 7 responsiveness in the absence of 41. Souabni, A., C. Cobaleda, M. Schebesta, and M. Busslinger. 2002. Pax5 pro- E2A. J. Exp. Med. 199: 1689–1700. motes B lymphopoiesis and blocks T cell development by repressing Notch1. 18. Medina, K. L., J. M. Pongubala, K. L. Reddy, D. W. Lancki, R. Dekoter, Immunity 17: 781–793. M. Kieslinger, R. Grosschedl, and H. Singh. 2004. Assembling a gene regulatory 42. Schubart, D. B., A. Rolink, M. H. Kosco-Vilbois, F. Botteri, and P. Matthias. network for specification of the B cell fate. Dev. Cell 7: 607–617. 1996. B-cell-specific coactivator OBF-1/OCA-B/Bob1 required for immune re- 19. Kikuchi, K., A. Y. Lai, C. L. Hsu, and M. Kondo. 2005. IL-7 receptor signaling sponse and germinal centre formation. Nature 383: 538–542. is necessary for stage transition in adult B cell development through up-regulation 43. Kim, U., X. F. Qin, S. Gong, S. Stevens, Y. Luo, M. Nussenzweig, and of EBF. J. Exp. Med. 201: 1197–1203. R. G. Roeder. 1996. The B-cell-specific transcription coactivator OCA-B/OBF- 20. Dias, S., H. Silva, Jr., A. Cumano, and P. Vieira. 2005. Interleukin-7 is necessary 1/Bob-1 is essential for normal production of immunoglobulin isotypes. Nature to maintain the B cell potential in common lymphoid progenitors. J. Exp. Med. 383: 542–547. 201: 971–979. 44. Nielsen, P. J., O. Georgiev, B. Lorenz, and W. Schaffner. 1996. B lymphocytes 21. Zhang, Z., C. V. Cotta, R. P. Stephan, C. G. deGuzman, and C. A. Klug. 2003. are impaired in mice lacking the transcriptional co- activator Bob1/OCA-B/ Enforced expression of EBF in hematopoietic stem cells restricts lymphopoiesis OBF1. Eur. J. Immunol. 26: 3214–3218. to the B cell lineage. EMBO J. 22: 4759–4769. 45. Brunner, C., D. Marinkovic, J. Klein, T. Samardzic, L. Nitschke, and T. Wirth. 22. Lagergren, A., R. Mansson, J. Zetterblad, E. Smith, B. Basta, D. Bryder, 2003. B cell-specific transgenic expression of Bcl2 rescues early B lymphopoiesis P. Akerblad, and M. Sigvardsson. 2007. The Cxcl12, periostin, and Ccl9 genes but not B cell responses in BOB. 1/OBF. 1-deficient mice. J. Exp. Med. 197: are direct targets for early B-cell factor in OP9 stroma cells. J. Biol. Chem. 282: 1205–1211. 14454–14462. 46. Bartholdy, B., C. Du Roure, A. Bordon, D. Emslie, L. M. Corcoran, and 23. Kieslinger, M., S. Folberth, G. Dobreva, T. Dorn, L. Croci, R. Erben, P. Matthias. 2006. The Ets factor Spi-B is a direct critical target of the coactivator G. G. Consalez, and R. Grosschedl. 2005. EBF2 regulates osteoblast-dependent OBF-1. Proc. Natl. Acad. Sci. USA 103: 11665–11670. differentiation of osteoclasts. Dev. Cell 9: 757–767. 47. Kim, U., R. Siegel, X. Ren, C. S. Gunther, T. Gaasterland, and R. G. Roeder. 2003. Identification of transcription coactivator OCA-B-dependent genes in- 24. Sharov, A. A., D. B. Dudekula, and M. S. Ko. 2005. A web-based tool for volved in antigen-dependent B cell differentiation by cDNA array analyses. Proc. principal component and significance analysis of microarray data. Bioinformatics Natl. Acad. Sci. USA 100: 8868–8873. 21: 2548–2549. 48. Paik, J. H., R. Kollipara, G. Chu, H. Ji, Y. Xiao, Z. Ding, L. Miao, Z. Tothova, 25. Adolfsson, J., R. Mansson, N. Buza-Vidas, A. Hultquist, K. Liuba, C. T. Jensen, J. W. Horner, D. R. Carrasco, et al. 2007. FoxOs are lineage-restricted redundant D. Bryder, L. Yang, O. J. Borge, L. A. Thoren, et al. 2005. Identification of Flt3ϩ tumor suppressors and regulate endothelial cell homeostasis. Cell 128: 309–323. lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised 49. Hu, H., B. Wang, M. Borde, J. Nardone, S. Maika, L. Allred, P. W. Tucker, and road map for adult blood lineage commitment. Cell 121: 295–306. A. Rao. 2006. Foxp1 is an essential transcriptional regulator of B cell develop- 26. Hu, M., D. Krause, M. Greaves, S. Sharkis, M. Dexter, C. Heyworth, and ment. Nat. Immunol. 7: 819–826. T. Enver. 1997. Multilineage gene expression precedes commitment in the he- 50. Zhuang, Y., R. J. Barndt, L. Pan, R. Kelley, and M. Dai. 1998. Functional re- mopoietic system. Genes Dev. 11: 774–785. placement of the mouse E2A gene with a human HEB cDNA. Mol. Cell. Biol. 18: 27. Schreiber, E., P. Matthias, M. Mu¨ller, and W. Schaffner. 1989. Rapid detection of 3340–3349. octamer binding proteins with “mini-extracts,” prepared from a small number of 51. Bain, G., E. C. R. Maandag, H. P. J. te Riele, A. J. Feeney, A. Sheehy, cells. Nucleic Acids Res. 17: 6419–6420. M. Schlissel, S. A. Shinton, R. R. Hardy, and C. Murre. 1997. Both E12 and E47 28. Mansson, R., A. Hultquist, S. Luc, L. Yang, K. Anderson, S. Kharazi, allow commitment to the B cell lineage. Immunity 6: 145–154. S. Al-Hashmi, K. Liuba, L. Thoren, J. Adolfsson, et al. 2007. Molecular evidence 52. Smith, E. M., P. Akerblad, T. Kadesch, H. Axelson, and M. Sigvardsson. 2005. for hierarchical transcriptional lineage priming in fetal and adult stem cells and Inhibition of EBF function by active Notch signaling reveals a novel regulatory multipotent progenitors. Immunity 26: 407–419. pathway in early B-cell development. Blood 106: 1995–2001. 29. Kondo, M., I. L. Weissman, and K. Akashi. 1997. Identification of clonogenic 53. Mansson, R., S. Zandi, K. Andersson, I. L. Martensson, S. E. Jacobsen, common lymphoid progenitors in mouse bone marrow. Cell 91: 661–672. D. Bryder, and M. Sigvardsson. 2008. B-lineage commitment prior to surface 30. Li, Y. S., R. Wasserman, K. Hayakawa, and R. R. Hardy. 1996. Identification of expression of B220 and CD19 on hematopoietic progenitor cells. Blood In the earliest B lineage stage in mouse bone marrow. Immunity 5: 527–535. press.