Asian Herpetological Research 2020, 11(1): xxx–xxx ORIGINAL ARTICLE DOI: 10.16373/j.cnki.ahr.190041
A New Species of the Asian Toad Genus Megophrys sensu lato (Anura: Megophryidae) from Guizhou Province, China
Jing LIU1, Shize LI1, 2, Gang WEI3, Ning XU3, Yanlin CHENG1, Bin WANG1, 4* and Jun WU2*
1 Department of Resources and Environment, Moutai Institute, Renhuai 564500, China 2 Nanjing Institute of Environmental Sciences, Ministry of Ecology and Environment of China, Nanjing 210042, China 3 Biodiversity Conservation Key Laboratory, Guiyang College, Guiyang 550002, China 4 Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China
Abstract We describe a new species of the genus Megophrys from Guizhou Province, China. Molecular phylogenetic analyses based on mitochondrial DNA and nuclear DNA sequences all strongly supported the new species as an independent clade nested into the Megophrys clade and sister to M. minor. On morphology, the new species is distinguished from its congeners by a combination of the following characters: (1) small body size with SVL < 39.2 mm in male and SVL < 40.4 mm in female; (2) vomerine teeth absent; (3) tongue not notched behind; (4) a small horn- like tubercle at the edge of each upper eyelid; (5) tympanum distinctly visible, rounded; (6) two or three metacarpal tubercles in hand; (7) relative finger lengths: I < II < V < III; (8) toes without webbing; (9) heels overlapped when thighs are positioned at right angles to the body; (10) tibiotarsal articulation reaching tympanum to eye when leg stretched forward; (11) an internal single subgular vocal sac in male; (12) in breeding male, the nuptial pads with black nuptial spines on the dorsal bases of the first and second fingers.
Keywords Taxonomy, new species, molecular phylogenetic analysis, morphology, China
1. Introduction Tian and Hu, 1983 containing three subgenera (Atympanophrys, Borealophrys Fei, Ye and Jiang, 2016 The Asian Horned toads of the subfamily Megophryinae and Gigantophrys Fei, Ye and Jiang, 2016), Boulenophrys (Amphibia: Anura: Megophryidae) is widely distributed Fei, Ye and Jiang, 2016, Xenophrys Günther, 1864 in tropical and subtropical regions of Asia from India containing two subgenera (Tianophrys Fei and Ye, and Bhutan to China and south to the Sundas and the 2016 and Xenophrys), Ophyrophryne Boulenger, 1908 Philippines (Fei et al., 2012; Frost, 2019). Taxonomic and Brachytarsophrys Tian and Hu, 1983. Chen et al. assignments especially generic arrangements in the group (2017) classified the Asian horned toads into the genera have been controversial (Dubois, 1986; Dubois and Ohler, Atympanophrys, Megophrys Kuhl and Van Hasselt, 1822 1998; Lathrop, 1997; Tian and Hu, 1983; Fei et al., 2009; and Xenophrys, Ophyrophryne, and Brachytarsophrys. Fei et al., 2012). Fei et al. (2016) classified 36 Chinese Mahony et al. (2017) classified all members of species of the subfamily Megophryinae into six genera, Megophryinae into a single genus Megophrys sensu i.e. Liuophrys Fei, Ye and Jiang, 2016, Atympanophrys lato including seven subgenera (Megophrys, Xenophrys, * Corresponding author: Dr. Jun WU, from Nanjing Institute of Envi- Panophrys Rao and Yang, 1997, Atympanophrys, ronmental Sciences, Ministry of Ecology and Environment of China, Ophyrophryne, Pelobatrachus Beddard, 1908 “1907” and Nanjing, China, with his research focusing on consevation management and biodiversity of amphibians; Dr. Bin WANG, from Chengdu Institute Brachytarsophrys) based on molecular phylogenetics and of Biology, Chinese Academy of Sciences, Chengdu, China, with his morphological comparisons. research focusing on taxonomy and biodiversity of amphibians. E-mail: [email protected] (Jun WU); [email protected] (Bin WANG) Megophrys s. l. currently contains 91 species (Frost, Received: 8 August 2019 Accepted: 29 October 2019 2019), and as note, of which, 37 species were described Asian Herpetological Research Vol. 10 in the last decade (Deuti et al., 2017; Fei et al., 2009; in the Kuankuoshui National Nature Reserve, Suiyang Li et al., 2014; Li et al., 2018a; Mahony, 2011; Mahony County, Guizhou Province, China and Fanjing Mountain, et al., 2011; Mahony et al., 2013; Mahony et al., 2017; Jiangkou County, Guizhou Province, China (Figure 1). Mahony et al., 2018; Messenger et al., 2019; Mo et al., Two tadpoles (voucher numbers: CIBKKS20180426001 2010; Munir et al., 2018; Orlov et al., 2015; Tapley et al., and CIBKKS20180426002) of the new taxon were also 2017; Tapley et al., 2018; Wang et al., 2012; Wang et al., collected in a mountain stream where the new taxon 2014; Wang et al., 2017a, b; Wang et al., 2019; Yang et was found in the Kuankuoshui National Nature Reserve. al., 2018; Zhang et al., 2017; Zhao et al., 2014). What’s They were identified as the new taxon because they were more, molecular phylogenetic studies still surprisingly almost identical in morphology and one representative of indicated mass of cryptic species in the group, for them was genetically close to the adult specimens of the example, 20 cryptic species were suggested by Chen et new taxon (see the results). The stages of tadpoles were al. (2017), and 41 cryptic species were proposed just only identified following Gosner (1960). All specimens were in subgenus Megophrys (Panophrys) by Liu et al. (2018). fixed in 10% buffered formalin for one day, and then later Obviously, detailed investigations need to be conducted transferred to 70% ethanol. Tissue samples were taken for describing the cryptic species. and preserved separately in 95% ethanol prior to fixation. During field surveys in the Kuankuoshui National The specimens were deposited in Chengdu Institute of Nature Reserve, Suiyang County, Guizhou Province, Biology, Chinese Academy of Sciences (CIB, CAS). China and Fanjing Mountain, Jiangkou County, Guizhou Province, China, we collected some Megophrys s. l. 2.2. Molecular data and phylogenetic analyses Four specimens from the montane forests. Our molecular adult specimens and one tadpole of the new taxon were phylogenetic analyses and morphological comparisons included in molecular analyses (for voucher information indicated it as a new taxon of Megophrys s. l. Herein, we see Table 1). Total DNA was extracted using a standard describe it as a new species. phenol-chloroform extraction protocol (Sambrook et al., 1989). Two fragments of the mitochondrial genes 2. Materials and Methods encoding 16S rRNA and cytochrome oxidase subunit I (COI) were amplified using the primers in Simon et al. 2.1. Specimen Two adult females and nine adult (1994) and Che et al. (2012), respectively. They were males of the new taxon (for voucher numbers see amplified under the following conditions: 35 cycles at Table S1) were collected from the mountain streams 95 °C for 4 min, 95 °C for 1 min, 52 °C (for 16S rRNA)/
Figure 1 Sampling localities of Megophrys jiangi sp. nov. in this study. The type locality is Kuankuoshui National Nature Reserve, Suiyang County, Guizhou Province, China and another locality is Fanjing Mountain, Jiangkou County, Guizhou Province, China. No. 4 Jing LIU et al. A New Species of Megophrys – – – – – – – – – – – – – BDNF KX811986 KX811984 KX811963 KX811961 KX811970 KX811952 KX811994 KX811973 KX811969 KX811958 KX811967 KX812045 KX812043 KX812044 MN107756 MN107755 MN107754 MN107753 – – – – – – – – – – – – – RAG1 KX812242 KX812203 KX812253 KX812228 KX812226 KX812221 KX812236 KX812232 KX812248 KX812251 KX812258 KX812223 KX812252 MN107760 MN107759 MN107758 MN107757 KX812219 – – – – – – – – COI KX812119 KX812117 KX812115 KX812112 KX812108 KX812094 KX812145 KX812137 KX812131 KX812125 KX812143 KX812129 KX812136 KX812144 MK524142 MN107752 MK524145 MK524129 MK524139 MN107751 MN107750 MN107749 MN107748 GenBank accession number 16S KJ560376 KJ560412 KJ579122 KJ560391 KX811840 KX811838 KX811896 KX811856 KX811852 KX811849 KX811888 KX811864 KX811912 KX811867 KX811894 KX811872 KX811881 KX811884 KX811895 KX856404 MK524111 MK524114 MH514889 MN107747 MH514886 MK524098 MK524108 MN107746 MN107745 MN107744 MN107743 Locality Lao Cai, Sa Pa, Vietnam Lao Cai, Sa Pa, Lao Cai, Sa Pa, Vietnam Lao Cai, Sa Pa, Suichuan, Jiangxi, China Wuyishan, Fujian, China Wuyishan, Jizu Shan, Yunnan, China Yunnan, Jizu Shan, Wuyi Shan, Fujian, China Wuyi Emei Shan, Sichuan, China Dawei Shan, Yunnan, China Yunnan, Dawei Shan, Wawu Shan, Sichuan, China Wawu Fanjingshan, Guizhou, China Fanjingshan, Guizhou, China Huangcaoling, Yunnan, China Yunnan, Huangcaoling, Fanjingshan, Guiz`hou, China Jinggang Shan, Jiangxi, China Leigong Shan, Guizhou, China Guangwu Shan, Sichuan, China Mt. Nankun, Guangdong, China Mt. Yinping, Guangdong, China Yinping, Mt. Qingcheng Shan, Sichuan, China Qingcheng Shan, Sichuan, China Qingcheng Shan, Sichuan, China Chashan Forest Farm, Jiangxi, China Wugongshan Scenic Area, Jiangxi, China Scenic Wugongshan Nanling Nature Reserve, Guangdong, China Pu Hu Nature Reserve, Thanh Hoa, Vietnam Thanh Hoa, Pu Hu Nature Reserve, Kuankuosui Nature Reserve, Guizhou, China Kuankuosui Nature Reserve, Guizhou, China Kuankuosui Nature Reserve, Guizhou, China Badagongshan Nature Reserve, Hunan, China Heishiding Nature Reserve, Guangdong, China Huanglianshan National Nature Reserve, Yunnan, China Yunnan, Huanglianshan National Nature Reserve, KRM18 KIZ07132 KIZ01939 KIZ011603 KIZ045469 KIZ025807 KIZ019441 KIZ016100 KIZ021889 KIZ048997 KIZ046812 KIZ025765 SYS a001579 SYS a001959 SYS a002370 SYS a002610 SYS a002272 SYS a001427 SYS a004498 SYS a001972 VNMN 2018.02 VNMN 2018.01 Voucher number Voucher KIZ-LC0805067 CIBFJS20150720004 CIBFJS20150719009 Tissue Tissue ID: YPX11006 Tissue Tissue ID: YPX37544 Tissue Tissue ID: YPX37545 CIBKKS20180723007 CIBKKS20180426001 CIBKKS20180722006 sp. nov. sp. nov. sp. nov. sp. nov. sp. nov. sp. nov. Species Megophrys lini Megophrys cheni Megophrys obesa Megophrys minor Megophrys minor Megophrys minor Megophrys spinata Megophrys omeimontis Megophrys ombrophila Megophrys kuatunensis Megophrys binlingensis Megophrys nankunensis Megophrys wushanensis Megophrys nanlingensis Megophrys daweimontis Megophrys sangzhiensis Megophrys wugongensis Megophrys fansipanensis Megophrys jinggangensis Megophrys jingdongensis Megophrys binchuanensis Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys jiangi Megophrys hoanglienensis Megophrys dongguanensis Megophrys wuliangshanensis Megophrys palpebralespinosa 30 31 29 28 7 26 25 18 19 24 8 9 10 11 12 6 27 13 14 17 20 23 15 16 21 22 5 4 3 2 Table 1 Information of samples used in the molecular analyses this study. Table Sample Number 1 Asian Herpetological Research Vol. 10 – – – – – – – – – – – – – – – – – BDNF KX811985 KX811983 KX811980 KX811979 KX811998 KX811933 KX811935 KX812037 KX812039 KX812012 KX812017 KX812026 KX812016 MK005314 Continued Table 1 Continued Table – – – – – – – – – – – – – – RAG1 KX812217 KX812279 KX812216 KX812213 KX812209 KX812277 KX812265 KX812169 KX812171 KY022356 KX812184 KX812197 KX812200 KY022355 KX812191 KY022354 MK005318 – – – – – – – – – – COI KX812150 KX812161 KX812107 KX812093 KX812155 KX812104 KX812095 KX812156 KX812153 KX812052 KX812051 KX812054 KX812050 KX812075 KX812082 KX812084 KX812091 MK524130 MK005306 MK524136 MH647528 GenBank accession number 16S KJ579118 KJ831313 KJ831310 KJ831317 KX811897 KX811917 KX811821 KX811813 KX811913 KX811814 KX811823 KX811914 KX811908 KX811922 KX811921 KX811919 KX811918 KX811767 KX811762 KX811765 KX811770 KY022311 KY425379 KY022198 KX894669 KY022310 KX894679 KY022309 MK524099 MK005310 MK524105 – – Locality Malaysia Hong Kong, China Palawan, Philippines Husa, Yunnan, China Husa, Yunnan, Beibeng, Xizang, China Beibeng, Xizang, China Mt. Mufu, Hunan, China Ukhrul dist.,Manipur, IN Ukhrul dist.,Manipur, Zhangmu, Xizang, China Wuyi Shan, Fujian, China Wuyi Mt. Jiulian, Jiangxi, China Huang Shan, Anhui, China Huang Shan, Bintulu, Sarawak, Malaysia Baolong, Chongqing, China Leigong Shan, Guizhou, China O’Reang, Mondolkiri, Cambodia East Siang dist.,Arunachal Pradesh, IN Bidoup Mountain, Lam Dong, Vietnam Vietnam Bidoup Mountain, Lam Dong, West Kameng dist., Arunachal Pradesh, IN Kameng dist., West Xiaoqiaogou Nature Reserve, Yunnan, China Yunnan, Xiaoqiaogou Nature Reserve, Badagongshan Nature Reserve, Hunan, China Nui Chua National Park, Ninh Thuan, Vietnam Thuan, Nui Chua National Park, Ninh Heishiding Nature Reserve, Guangdong, China Gunung Mulu National Park, Sarawak, Malaysia Pasonanca Natural Park, Zamboanga, Philippines Ban Pang Kamphaeng Hin, Chiang Mai, Thailand Ban Pang Kamphaeng Hin, Chiang Mai, Gunung Kinabalu National Park, Sabah, Malaysia Phong Dien Nature Reserve, Thua Thien Hue, Vietnam Thien Hue, Thua Phong Dien Nature Reserve, Gunung Kinabalu National Park, Kogopan Trail, Malaysia Trail, Gunung Kinabalu National Park, Kogopan KIZ06621 KIZ022004 KIZ019216 KIZ010360 KIZ048799 KIZ019419 KIZ010978 KIZ048439 KIZ024336 KIZ014278 ZSIA11799 ZSIA11799 KU 314303 BNHS 6061 ROM 16634 ITBCZ 1108 SYS a001957 SYS a002107 SYS a006391 ZMH A13125 FMNH 262778 FMNH 273694 UNIMAS 8148 UNIMAS 8943 Voucher number Voucher SDBDU2009.75 K5198/ZSI11393 SDBDU2009.133 ZMMU ABV-00454 ZMMU NAP-05015 CIBLS20171101001 Tissue Tissue ID: YPX10987 Tissue Tissue ID: YPXJK033 Species Megophrys gerti Megophrys sanu Megophrys hansi Megophrys elfina Megophrys acuta Megophrys dringi Megophrys nasuta Megophrys zhangi Megophrys ligayae Megophrys synoria Megophrys periosa Megophrys boettgeri Megophrys cf. major Megophrys baluensis Megophrys stejnegeri Megophrys katabhako Megophrys kobayashii Megophrys glandulosa Megophrys cf. periosa Megophrys jiulianensis Megophrys medogensis Megophrys microstoma Megophrys edwardinae Megophrys himalayana Megophrys brachykolos Megophrys leishanensis Megophrys baolongensis Megophrys pachyproctus Megophrys mufumontana Megophrys huangshanensis Megophrys tuberogranulata Sample Number 36 41 32 40 42 43 44 35 37 33 45 38 39 34 49 51 46 47 48 50 52 60 55 53 54 61 62 57 58 59 56 No. 4 Jing LIU et al. A New Species of Megophrys – – – – – – – – – – BDNF KX811938 KX811939 KX811943 KX812025 KX812006 KX812024 KX812048 KX812041 KX812030 KX812046 Continued Table 1 Continued Table – – – – – – – RAG1 KX812269 KX812194 KX812268 KX812181 KY022351 KX812195 KY022352 KX812284 KX812271 KX812274 KX812262 KX812282 MH405011 – – – – – – – COI KX812056 KX812079 KX812057 KX812072 KX812080 KX812163 KX812166 KX812062 KX812060 KX812159 KX812164 MH647536 MH406235 GenBank accession number 16S KX811811 KX811810 KX811790 KX811797 KX811807 KX811780 KX811928 KX811927 KX811902 KX811900 KX811904 KX811925 KX811930 KY679891 HQ588950 KY022307 KY022306 KM504261 KM504251 MH406775 – Locality Hejiang, Sichuan, China Mengyue, Yunnan, China Mengyue, Yunnan, Nanjiang, Sichuan, China Sukabumi, Java, Indonesia Emei Shan, Sichuan, China Emei Shan, Sichuan, China Wawu Shan, Sichuan, China Wawu Dayao Shan, Guangxi, China Wuliang shan, Yunnan, China Yunnan, shan, Wuliang Huangcaoling, Yunnan, China Yunnan, Huangcaoling, West Garo Hills dist., Meghalaya West East Khasi Hills dist., Meghalaya Aural, Kampong Speu, Cambodia U Bo, Phong Nha-Ke Bang NP, Vietnam U Bo, Phong Nha-Ke Bang NP, Liziping Nature Reserve, Sichuan, China Naling Nature Reserve, Guangdong, China Xiaoqiaogou Nature Reserve, Yunnan, China Yunnan, Xiaoqiaogou Nature Reserve, Nanling National Forest Park, Guangdong, China Khao Nan National Park, Nakhon Si Thammarat, Thailand Thammarat, Khao Nan National Park, Nakhon Si KIZ046706 KIZ048508 KIZ016045 KIZ021786 KIZ025799 KIZ014512 KIZ025467 KIZ025778 BNHS 6046 SYSa003933 CIB ZYC517 ZFMK 87596 SYS a000589 NCSM 79599 CIB20050081 LSUMZ 81916 Voucher number Voucher SDBDU2009.297 MZB:Amp:22233 Tissue Tissue ID: YPX20455 Tissue Tissue ID: YPX37539 Species Megophrys feae Megophrys popei Megophrys lancip Megophrys aceras Megophrys montana Megophrys cf. parva Megophrys gigantica Megophrys carinense Megophrys auralensis Leptolalax oshanensis Megophrys intermedia Megophrys wawuensis Megophrys oreocrypta Leptobrachium boringii Megophrys maosonensis Megophrys shapingensis Megophrys flavipunctata Megophrys nankiangensis Megophrys chuannanensis Megophrys mangshanensis 78 79 75 76 77 68 Sample Number 66 63 72 74 67 69 64 65 80 71 73 70 81 82 Asian Herpetological Research Vol. 10
46 °C (for COI) for 40 s, and 72 °C for 1 min followed by position of nuclear genes and the GTR+G +I model as a 10 min extension at 72 °C. The nuclear gene fragments the best model for the other two codon position of RAG1 encoding brain-derived neurotrophic factor (BDNF) and and BDNF genes. For the ML tree, branch supports were recombination activating gene 1 (RAG1) were amplified drawn from 10 000 non-parametric bootstrap replicates. using the primers and protocols in Vieites et al. (2007) In BI analyses, two runs each with four Markov chains and Shen et al. (2013). All primers were presented in were run for 60 million generations with sampling every Table S2. PCR products were purified with spin columns 1000 generations. The first 25% of generations were and then were sequenced with primers same used in PCR. removed as the “burn-in” stage followed by calculation Sequencing was conducted using an ABI3730 automated of Bayesian posterior probabilities and the 50% majority- DNA sequencer in Shanghai DNA BioTechnologies Co., rule consensus of the post burn-in trees sampled at Ltd. (Shanghai, China). All sequences were deposited in stationarity. Finally, pairwise 16S and COI gene sequence GenBank (for GenBank accession numbers see Table 1). divergence with uncorrected p-distance model was For molecular analyses, the available sequence data estimated using MEGA 6.06 (Tamura et al., 2011) to for all related species of the genus Megophrys s. l. were determine the genetic distance between Megophrys downloaded from GenBank, primarily from previous species, respectively. studies (Chen et al., 2017; Liu et al., 2018; for GenBank 2.3. Morphological comparisons All twelve adult accession numbers see Table 1). For phylogenetic specimens and six tadpole specimens of the new taxon analyses, corresponding sequences of one Leptolalax collected in this work were measured. The terminology oshanensis and one Leptobrachium boringii were and methods followed Fei et al. (2009). Measurements downloaded (for GenBank accession numbers see Table were taken with a dial caliper to 0.1 mm. Nineteen 1) and used as outgroups according to Chen et al. (2017). morphometric characters of adult specimens were Sequences were assembled and aligned using the measured: SVL=snout-vent length (distance from Clustalw module in BioEdit 7.0.9.0 (Hall, 1999) with the tip of the snout to the posterior edge of the vent), default settings. Alignments were checked by eye HDL=head length (distance from the tip of the snout to and revised manually if necessary. To avoid bias in the articulation of jaw), HDW=maximum head width alignments, GBLOCKS 0.91.b (Castresana, 2000) with (greatest width between the left and right articulations default settings was used to extract regions of defined of jaw), SL=snout length (distance from the tip of the sequence conservation from the length-variable 16S gene snout to the anterior corner of the eye), ED=eye diameter fragments. Non-sequenced fragments were defined as (distance from the anterior corner to the posterior missing loci. corner of the eye), IOD=interorbital distance (minimum Phylogenetic trees were reconstructed for the distance between the inner edges of the upper eyelids), mitochondrial genes concatenated data and nuclear genes IND=internasal distance (minimum distance between concatenated data, respectively. Phylogenetic analyses the inner margins of the external nares), TYD=maximal were conducted using maximum likelihood (ML) and tympanum diameter, LAL=length of lower arm and hand Bayesian Inference (BI) methods, implemented in PhyML (distance from the elbow to the distal end of the Finger 3.0 (Guindon et al., 2010) and MrBayes 3.12 (Ronquist IV), LW=lower arm width (maximum width of the and Huelsenbeck, 2003), respectively. To avoid under- lower arm), FIL=first finger length (distance from base or over-parameterization (Lemmon and Moriarty, 2004; to tip of finger I), FIIL=second finger length (distance McGuire et al., 2007), the best partition scheme and the from base to tip of finger II); FIIIL=third finger length best evolutionary model for each partition were chosen (distance from base to tip of finger III), FIVL=fourth for the phylogenetic analyses using PARTITIONFINDER finger length(distance from base to tip of finger IV), 1.1.1 (Robert et al., 2012). In the analyses, 16S, each THL=thigh length (distance from vent to knee), TL=tibia codon position of the protein-coding genes were defined, length (distance from knee to tarsus), TW=maximal tibia and Bayesian Inference Criteria (BIC) was used. As a width, TFL=length of foot and tarsus (distance from result, the analyses selected the best partition scheme the tibiotarsal articulation to the distal end of the Toe (i.e. 16S gene/each codon position of COI gene) and the IV), FL=foot length (distance from tarsus to the tip of TrN+I+G model for each partition for mitochondrial DNA fourth toe). A total of ten morphometric characters of dataset, and as well, selected the best partition scheme tadpoles were measured: TOL=total length, SVL=snout- (i.e. each codon position of RAG1 and BDNF genes) vent length, BH=maximum body height, BW=maximum and the TrN+I+G as the best model for the second codon body width, SL=snout length (distance from the anterior No. 4 Jing LIU et al. A New Species of Megophrys corner of the eye to the tip of the snout), SS=snout to (Mahony et al., 2018), M. oropedion (Mahony et al., spiraculum (distance from spiraculum to the tip of the 2013), M. pachyproctus (Huang and Fei, 1981), M. snout), MW=mouth width (distance between two corners palpebralespinosa (Bourret, 1937), M. parallela (Inger of mouth), IOD=interorbital distance (minimum distance and Iskandar, 2005), M. parva (Boulenger, 1893), M. between eyes), TAL=tail length (distance from base of periosa (Mahony et al., 2018), M. popei (Zhao et al., vent to the tip of tail), TH=tail height (maximum height 2014), M. robusta (Mahony et al., 2013), M. rubrimera between upper and lower edges of tail). (Tapley et al., 2017), M. sangzhiensis (Jiang et al., 2008), We compared morphological characters of the new M. serchhipii (Mathew and Sen, 2007), M. shapingensis taxon with other Megophrys s. l. species. Comparative (Liu, 1950), M. shuichengensis (Tian and Sun, 2000), data were obtained from the literature for M. aceras M. spinata (Hu et al., 1973), M. stejnegeri (Taylor, (Boulenger, 1903), M. actuta (Li et al., 2014), M. ancrae 1920), M. synoria (Stuart et al., 2006), M. takensis (Mahony et al., 2013), M. auralensis (Ohler et al., 2002), (Mahony, 2011), M. tuberogranulata (Mo et al., 2010), M. baluensis (Boulenger, 1899a), M. baolongensis (Ye M. vegrandis (Mahony et al., 2013), M. wawuensis (Fei et al., 2007), M. binchuanensis (Ye and Fei, 1995), M. et al., 2001), M. wugongshanensis (Wang et al., 2019), binlingensis (Fei et al., 2009), M. boettgeri (Boulenger, M. wuliangshanensis (Ye and Fei, 1995), M. wushanensis 1899b), M. brachykolos (Inger and Romer, 1961), M. (Ye and Fei, 1995), M. zhangi (Ye and Fei, 1992) and M. carinense (Boulenger, 1889), M. caudoprocta (Shen, zunhebotoensis (Mathew and Sen, 2007). 1994), M. cheni (Wang et al., 2014), M. chuannanensis 2.4. Bioacoustics analyses Ten advertisement calls of (Fei et al., 2001), M. damrei (Mahony, 2011), M. one individual (specimen CIBKKS20180722006) of the daweimontis (Rao and Yang, 1997), M. dongguanensis new taxon were recorded at ambient air temperature of (Wang et al., 2019), M. dringi (Inger et al., 1995), 19.5 °C and air humidity of 85% in a mountain stream M. edwardinae (Inger, 1989), M. elfina (Poyarkov et of Kuankuoshui National Nature Reserve between al., 2017), M. fansipanensis (Taply et al., 2018), M. 22:00–23:00 on 22 July 2018. SONY PCM-D50 digital feae (Boulenger, 1887), M. feii (Yang et al., 2018), M. sound recorder was used to record within 20 cm of the flavipunctata (Mahony et al., 2018), M. gerti (Ohler, calling individuals. The sound files in wave format were 2003), M. gigantica (Liu et al., 1960), M. glandulosa resampled at 48 kHz with sampling depth 24 bits. The (Fei et al.,1990), M. hansi (Ohler, 2003), M. himalayana sonograms and waveforms were generated by WaveSurfer (Mahony et al., 2018), M. hoanglienensis (Taply et al., software (Sjöander and Beskow, 2000) from which all 2018), M. huangshanensis (Fei and Ye, 2005), M. insularis parameters and characters were measured. Ambient (Wang et al., 2017a), M. intermedia (Smith, 1921), M. temperature was taken by a digital hygrothermograph. jingdongensis (Fei and Ye, 1983), M. jinggangensis (Wang et al., 2012), M. jiulianensis (Wang et al., 2019), 3. Results M. kobayashii (Malkmus and Matsui, 1997), M. koui (Mahony et al., 2017), M. kuatunensis (Pope, 1929), M. 3.1. Phylogenetic analyses Aligned sequence matrix of lancip (Munir et al., 2018), M. latidactyla (Orlov et al., 16S+COI and RAG1+BDNF contained 1101 bp and 1614 2015), M. leishanensis (Li et al., 2018a), M. lekaguli bp, respectively. ML and BI trees of the mitochondrial (Stuart et al., 2006), M. liboensis (Zhang et al., 2017), DNA dataset presented almost consistent topology (Figure M. ligayae (Taylor, 1920), M. lini (Wang et al., 2014), M. 2A), and as well, ML and BI trees of the nuclear DNA lishuiensis (Wang et al., 2017b), M. longipes (Boulenger, dataset showed almost identical topology (Figure 2B), 1886), M. major (Boulenger, 1908), M. mangshanensis though relationships of several lineages were unresolved. (Fei et al.,1990), M. maosonensis (Bourret, 1937), M. All phylogenetic analyses strongly supported the new medogensis (Fei et al., 1983), M. megacephala (Mahony taxon as an independent clade nested into the Megophrys et al., 2011), M. microstoma (Boulenger, 1903), M. minor s. l. clade and sister to M. minor. (Stejneger, 1926), M. montana (Kuhl and Van Hasselt, Genetic distance on 16S and COI genes with 1822), M. monticola (Günther, 1864), M. mufumotana uncorrected p-distance model between samples of the new (Wang et al., 2019), M. nankiangensis (Hu et al.,1966), taxon are less than 0.2%, much lower than interspecific M. nankunensis (Wang et al., 2019), M. nanlingensis genetic distances in the genus Megophrys s. l. (Tables (Wang et al., 2019), M. nasuta (Schlegel, 1958), M. S3 and S4). Genetic distance between the new taxon and obesa (Li et al., 2014), M. ombrophila (Messenger et its closely-related species M. minor is 8.3% on COI and al., 2019), M. omeimontis (Liu, 1950), M. oreocrypta 7.3% on 16S, being much higher than that between many Asian Herpetological Research Vol. 10 . A: ML (Maximum likelihood) tree reconstructed based on the 16S rRNA and COI gene sequences. B: ML (Maximum ML B: sequences. COI gene and 16S rRNA on the based reconstructed tree likelihood) (Maximum A: ML genus Megophrys sensu lato . of the relationships 2 Phylogenetic Figure 1–82 node. Samples each beside denoted were support bootstrap ML probability/ posterior Bayesian BNDF genes. of RAG1 and sequences DNA based on the nuclear reconstructed tree likelihood) 1. Table refer to No. 4 Jing LIU et al. A New Species of Megophrys pairs of closely related species in the genus, for example, CIB FJS20150718005 collected on 18 July 2015, five on COI, M. huangshanensis vs. M. boettgeri (1.8%), M. males: CIB FJS20150719006, CIB FJS20150719007 and sangzhiensis vs. M. spinata (3.8%), M. spinata vs. M. CIB FJS20150719009 collected on 19 July 2015, CIB binlingensis (7.7%), M. sangzhiensis vs. M. binlingensis FJS20150720003 and CIB FJS20150720004 collected on (6.8%) and M. wushanensis vs. M. tuberogranulata 20 July 2015, respectively. (7.0%); and on 16S, M. sangzhiensis vs. M. spinata Diagnosis Megophrys jiangi sp. nov. is assigned to (1.7%), M. spinata vs. M. binlingensis (1.7%) and M. the genus Megophrys based on molecular phylogenetic minor vs. M. spinata (6.0%). analyses and the following generic diagnostic characters: 3.2. Description of the new species snout shield-like; snout projecting beyond the lower jaw; Megophrys jiangi sp. nov. canthus rostralis distinct; chest gland small and round, Holotype CIBKKS20180722006 (Figure 3), adult male, closer to the axilla than to midventral line; femoral gland from Kuankuoshui National Nature Reserve (28°13′14″ on rear of thigh; vertical pupils. N, 107°09′47″ E, 1521 m a. s. l.), Suiyang County, The new species could be identified from its congeners Guizhou Province, China, collected by Shize LI on 22 by a combination of the following morphological July 2018. characters: (1) small body size with SVL < 39.2 mm Paratype three adult males and one adult females in male and SVL < 40.4 mm in female; (2) vomerine from Kuankuoshui National Nature Reserve, Suiyang teeth absent; (3) tongue not notched behind; (4) a small County, Guizhou Province, China, collected by Shize horn-like tubercle at the edge of each upper eyelid; (5) LI and Jing LIU. One female CIBKKS20180723003 tympanum distinctly visible, rounded; (6) two metacarpal collected by Jing LIU on 23 July 2018, three adult tubercles in hand; (7) relative finger lengths: I < II < V < males CIBKKS20180723001, CIBKKS20180723002 III; (8) toes with rudimentary webbing at bases; (9) heels and CIBKKS20180723007 collected by Shize LI on 23 overlapped when thighs are positioned at right angles to July 2018. Five adult males and one adult female from the body; (10) tibiotarsal articulation reaching tympanum Fanjing Mountain collected by Shize LI. One male: to eye when leg stretched forward; (11) an internal single
Figure 3 The holotype specimen (CIBKKS20180722006) of Megophrys jiangi sp. nov. A: dorsal view. B: ventral view. C: lateral view. D: dorsal view of hand. E: ventral view of hand. F: ventral view of foot. Asian Herpetological Research Vol. 10 subgular vocal sac in male; (12) in breeding season, in brown speckle between the eyes; two V-shaped ridges on male, the black nuptial pads without nuptial spines on the the dorsum of body, three transverse bands on the dorsal dorsal bases of the first and second fingers. surface of the thigh and shank separately; several dark Description of holotype (Figure 3) SVL 38.2 mm; head brown and white vertical bars on the lower and upper lip; width larger than head length ( HDW/HDL ratio about the venter purple grey, some big dark spots on the ventral 1.2); snout obtusely pointed, protruding well beyond the surface, ventral surface of limbs with some white spots; margin of the lower jaw in ventral view; loreal region the posterior of ventral surface of body, inner of thigh and vertical and concave; canthus rostralis well-developed; upper of tibia jacinth; palms and soles uniform purple top of head flat on in dorsal view; an small horn-like grey, tip of digits pink; pectoral and femoral glands white tubercle at the edge of the upper eyelid; eye large and (Figure 4A–E). convex, eye diameter 43.2% of head length; pupils Preserved holotype coloration Dorsal surface dark vertical; nostril orientated laterally, closer to snout than brown; the inverted triangular brown speckle between eye; tympanum distinct, TYP/EYE ratio 0.60 (Figure 3A, the eyes, inverted triangular between eyes, V-shaped B, C); vomerine ridges and vomerine teeth absent; margin ridges on dorsum and transverse bands on limbs and of tongue smooth, not notched behind. digits distinct; ventral surface greyish white; creamy- Forelimbs slender, the length of lower arm and hand white substitutes the pinkish in metatarsal tubercles; the 40.8% of SVL; fingers slender, relative finger lengths: I < posterior of ventral surface of body, inner of thigh and II < V < III; tips of digits globular, without lateral fringes; upper of tibia fade to light red (Figure 3). subarticular tubercle distinct at the base of each finger; Variation Morphometric variations of the new species three metacarpal tubercles, inner and outer metacarpal were small in adults (Table 2 and Table S1). In some tubercles prominent, the outer one long and thin the adult individuals the marking on back of trunk is irregular inner one and middle one oval-shaped, and the inner one like network (Figure 5A); in some adult individuals the distinctly larger than middle one (Figure 3D, E). marking on back of trunk consists by X-shaped ridge Hindlimbs slender (TL/SVL = 0.49); heels overlapped (Figure 5B); the marking on back of trunk consists by when thighs are positioned at right angles to the body, X-shaped ridge and the skin rough distinct by numerous tibiotarsal articulation reaching tympanum to eye when granules(Figure 5C); in some adult individuals the whole leg stretched forward; tibia length longer than thigh ventral purplish grey except the posterior belly with white length; relative toe lengths: I < II < V < III < IV; tips of blotches(Figure 5D); in some adult individuals the throat toes round, slightly dilated; subarticular tubercle absent; and anterior belly atropurpureus, and some with spots toes without webbing; no lateral fringe; inner metatarsal mixed black spots on the posterior belly (Figure 5E); in tubercle oval-shaped; no outer metatarsal tubercle (Figure some adult individuals the ventral surface purple and 3F). some with spots mixed purple spots on the belly (Figure Dorsal skin rough, with numerous granules; several 5F). large warts scattered on flanks; an small horn-like tubercle Advertisement calls The call description is based on at the edge of each upper eyelid; tubercles on the dorsum recordings of the holotype CIBKKS20180722006 (Figure forming an V-shaped and an inverted V-shaped weak 6) from the rock of the streamlet. Each call consists of ridge, the V-shaped ridges disconnect; two discontinuous 7–11 (9 ± 1.5, n = 10) notes. Call duration was 2.15–4.15 s dorsolateral parallel ridges on either side of the V-shaped (3.23 ± 0.63, n = 10). Call interval was 0.38–0.53 s (0.45 ridges; an inverted triangular brown speckle between two ± 0.06, n = 9). Each note had a duration of 0.17–0.37 upper eyelids; the skin of posterior sides of abdomen and second (0.24 ± 0.05, n = 90) and the intervals between inner side of thigh with orange; several tubercles on the notes 0.07–0.23 second (0.14 ± 0.05, n = 80). Amplitude flanks and dorsal surface of thighs and tibias and forming modulation within note was apparent, beginning with three transverse tubercle rows; supratympanic fold moderately high energy pulses, increasing slightly to a distinct (Figure 3A). maximum, and then decreasing towards the end of each Ventral surface smooth; chest gland small and round, note. The average dominant frequency was 5838.1 ± closer to the axilla than to midventral line; femoral gland 111.1 (5662–5995 Hz, n = 10). on rear of thigh; posterior end of the body protrudes Tadpole description All measurements of tadpoles were distinct and appears as an arc-shaped swelling, upper the presented in Table 3. The following tadpole description anal region (Figure 3B). was based on specimen CIBKKS20180426001 at Stage Coloration of holotype in life An inverted triangular 26 (Figure 7), the tadpole was confirmed as Megophrys No. 4 Jing LIU et al. A New Species of Megophrys
Figure 4 Views of the holotype (CIBKKS20180722006) of Megophrys jiangi sp. nov. in life. A: dorsolateral view. B: ventral view. C: ventral view of hand. D: dorsal view of hand showing nuptial pads on the first and second fingers (1). E: ventral view of foot.
Table 2 Basic statistics for measurements of the adult specimens of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.
Male (n = 9) Female (n = 2) Ranging Mean ± SD Ranging SVL 34.4–39.2 36.9±1.80 39.5–40.4 HDL 10.2–11.8 10.9±0.54 10.8–11.4 HDW 11.7–13.0 12.5±0.52 13.5–14.1 SNT 4.0–5.1 4.5±0.43 4.6–5.0 IND 4.2–5.0 4.6±0.25 4.8–5.0 IOD 2.5–3.8 3.0±0.38 3.0–3.2 ED 4.0–4.8 4.5±0.25 4.5–4.7 TYD 2.2–3.0 2.6±0.26 2.6–2.7 LAL 14.7–17.5 16.0±0.86 18.2–18.2 LW 3.0–3.8 3.4±0.29 3.1–3.6 FIL 3.0–4.3 3.6±0.46 3.7–3.8 FIIL 3.2–4.4 3.8±0.45 4.1–4.3 FIIIL 5.0–6.5 5.6±0.46 6.2–6.7 FIVL 3.8–4.8 4.3±0.29 4.6–4.6 THL 15.8–18.6 16.9±0.94 17.3–17.7 TL 17.1–20.2 18.1±0.96 18.4–20.4 TW 4.0–4.7 4.4±0.22 4.8–5.1 TFL 22.9–26.7 25.0±1.31 26.2–27.8 FL 15.9–18.5 17.0±0.84 18.1–18.8 Asian Herpetological Research Vol. 10
Figure 5 Color variation in Megophrys jiangi sp. nov. in life. A: dorsolateral view of the male specimen CIBKKS20180723001. B: dorsolateral view of the male specimen CIBKKS20180723002. C: dorsal view of the male specimen CIBFJS20150719009. D: ventral view of the female specimen CIBFJS20150718005. E: ventral view of the male specimen CIB FJS20150720004. F: ventral view of the female specimen CIB KKS20180723003. jiangi sp. nov. by molecular analyses. Body slender, edwardinae, M. feae, M. flavipunctata, M. gigantica, body and tail yellow-brown; tail height greater than body M. glandulosa, M. himalayana, M. intermedia, M. height; dorsal fin arising, behind the origin of the tail, jingdongensis, M. kobayashii, M. lekaguli, M. liboensis, height near mid-length, tapering gradually to narrow, M. ligayae, M. longipes, M. major, M. mangshanensis, tip pointed; tail 2.4 times as long as snout-vent length; M. maosonensis, M. medogensis, M. megacephala, tail height 16.9% of tail length; body width longer than M. omeimontis, M. oreocrypta, M. periosa, M. popei, body height; tail fins lightly colored; eyes large, lateral, M. sangzhiensis, M. shapingensis, M. shuichengensis, interorbital distance is 37.4% of snout-vent length; nostril M. spinata and M. takensis by having small body near eyes; spiracle on the left side of the body and not size (maximum SVL < 42.3 mm in the new species distinct; oral disk terminal, lips expanded and directed vs. minimum SVL > 45 mm in the latter). By lacking upwardly into a umbelliform oral disk; transverse width vomerine teeth, Megophrys jiangi sp. nov. differs from of expanded funnel 49.4% of snout-vent length. M. aceras, M. ancrae, M. carinense, M. baluensis, Secondary sexual characteristics Adult females with M. caudoprocta, M. chuannanensis, M. damrei, M. SVL 39.5–40.4 mm, larger than adult males with 34.4– daweimontis, M. dongguanensis, M. fansipanensis, 39.2 mm. Adult males have a single subgular vocal sac. In M. flavipunctata, M. glandulosa, M. hoanglienensis, breeding male, the nuptial pads on the dorsal bases of the M. himalayana, M. insularis, M. intermedia, M. first finger and second fingers with black nuptial spines jingdongensis, M. jinggangensis, M. jiulianensis. M. obvious under microscope (Figure 3 D). kobayashii, M. lancip, M. latidactyla, M. lekaguli, M. Morphological comparisons (Table S5) By having liboensis, M. ligayae, M. major, M. mangshanensis, small body size, Megophrys jiangi sp. nov. differs from M. maosonensis, M. medogensis, M. megacephala, M. M. aceras, M. auralensis, M. binlingensis, M. carinense, montana, M. nasuta, M. nankunensis, M. nanlingensis, M. caudoprocta, M. chuannanensis, M. damrei, M. M. omeimontis, M. oropedion, M. oreocrypta, M. No. 4 Jing LIU et al. A New Species of Megophrys
Figure 6 Advertisement call of a male Megophrys jiangi sp. nov., CIBKKS20180722006, holotype. A: waveform showing one syllable. B: sonogram showing one syllable. C: waveform showing nine syllables of one strophe. D: sonogram showing nine syllables of one strophe.
Table 3 Measurements of the tadpoles of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.
Voucher Gosner’s stage TOL SVL IOD BW SS SL MW TL TH CIBKKS20180426001 26 26.0 7.7 2.88 3.8 4.5 2.2 3.8 18.3 3.1 CIBKKS20180426002 26 25.5 8.0 3.0 3.6 4 2.7 4.0 16.7 3.0 palpebralespinosa, M. parallela, M. parva, M. periosa, binlingensis, M. boettgeri, M. carinense, M. cheni, M. M. popei, M. robusta, M. rubrimera, M. sangzhiensis, M. chuannanensis, M. damrei, M. dringi, M. fansipanensis, stejnegeri, M. takensis, M. zhangi and M. zunhebotoensis M. feae, M. feii, M. flavipunctata, M. gerti, M. glandulosa, (vs. present in the latter). M. hoanglienensis, M. huangshanensis, M. insularis, By having an small horn-like tubercle at the edge M. jiulianensis. M. jingdongensis, M. kuatunensis, of each upper eyelid, Megophrys jiangi sp. nov. M. liboensis, M. mangshanensis, M. maosonensis, differs from M. binchuanensis, M. binlingensis, M. M. medogensis, M. minor, M. nankiangensis, M. damrei, M. gigantica, M. minor, M. nankiangensis, M. nanlingensis, M. omeimontis, M. oropedion, M. oropedion, M. pachyproctus, M. spinata, M. takensis, M. pachyproctus, M. parallela, M. popei, M. robusta, M. wuliangshanensis, M. wushanensis, M. zhangi and M. sangzhiensis, M. shapingensis, M. shuichengensis, M. zunhebotoensis (vs. tubercle lacking in the latter). spinata, M. vegrandis, M. wawuensis, M. zhangi and M. By having an small horn-like tubercle at the edge of zunhebotoensis (vs. tongue notched behind in the latter). each upper eyelid, Megophrys jiangi sp. nov. differs By lacking lateral fringe in toes, Megophrys jiangi from M. carinense, M. feae, M. gerti, M. hansi, M. sp. nov. differs from M. actuta, M. auralensis, M. intermedia, M. koui, M. latidactyla, M. liboensis, M. baolongensis, M. binchuanensis, M. boettgeri, M. microstoma, M. nasuta, M. palpebralespinosa, M. popei, carinense, M. cheni, M. chuannanensis, M. dringi, M. shuichengensis, M. stejnegeri and M. synoria (vs. M. elfina, M. feae, M. feii, M. flavipunctata, M. having a prominent and elongated tubercle at the edge of gigantica, M. glandulosa, M. hansi, M. intermedia, each upper eyelid in the latter). M. jingdongensis, M. jinggangensis, M. kuatunensis, By tongue not notched behind, Megophrys jiangi M. latidactyla, M. lini, M. major, M. maosonensis, M. sp. nov. differs from M. ancrae, M. baolongensis, M. nankiangensis, M. omeimontis, M. palpebralespinosa, Asian Herpetological Research Vol. 10
Based on molecular phylogenetic analyses, Megophrys jiangi sp. nov. was clustered as a sister taxon to M. minor. The new species could be identified from M. minor distinctly by having a small horn-like tubercle at the edge of each upper eyelid (vs. absent in the latter), tongue not notched behind (vs. notched in the latter), tibiotarsal articulation reaching the level between tympanum to eye when leg stretched forward (vs. tibiotarsal articulation reaching the level between eye and tip of snout in the
Figure 7 The tadpole of Megophrys jiangi sp. nov. Dorsal view (A) latter), having two or three metatarsal tubercles in each and lateral view (B) of specimen CIBKKS20180426001 in life. hand (vs. absent of metatarsal tubercle in hand in the latter), and having an small horn-like tubercle at the edge M. popei, M. rubrimera, M. sangzhiensis, M. serchhipii, of each upper eyelid (vs. lacking in the latter). M. shapingensis, M. shuichengensis, M. spinata, M. Two species of Megophrys, i.e. M. spinata and M. vegrandis, M. zhangi and M. zunhebotoensis (vs. present shuichengensis were recorded to be sympatric with in the latter). Megophrys jiangi sp. nov. The new species could be By toes without webs at bases, Megophrys jiangi identified from these two species by having small body sp. nov. differs from M. brachykolos, M. carinense, size (maximum SVL < 42.3 mm in the new species vs. M. flavipunctata, M. jingdongensis, M. jinggangensis, minimum SVL > 45 mm in the latter), tongue not notched M. lini, M. major, M. palpebralespinosa, M. popei, behind (vs. notched in the latter), lacking lateral fringe in M. shuichengensis, M. spinata (vs. at least one-fourth toes (vs. present in the latter), toes without webs at bases webbed in the latter). (vs. at least one-fourth webbed in the latter), having an By heels overlapping when thighs are positioned at internal single subgular vocal sac in male (vs. nuptial pads right angles to the body, Megophrys jiangi sp. nov. differs and nuptial spines lacking in male M. shuichengensis), from M. acuta, M. brachykolos, M. dongguanensis, tibiotarsal articulation reaching forward to the region M. nankunensis, M. obesa, M. ombrophila and M. between tympanum and eye when hindlimb is stretched wugongensis by (vs. heels not meeting when thighs are along the side of the body (vs. reaching posterior corner positioned at right angles to the body in the latter). of the eye in M. shuichengensis). By tibiotarsal articulation reaching forward to the Distribution and habitats Megophrys jiangi sp. nov. region between tympanum and eye when hindlimb is is known from the type locality, Kuankuoshui National stretched along the side of the body, Megophrys jiangi sp. Nature Reserve (28°06′–28°19′ N, 107°02′–107°14′ E), nov. differs from M. baolongensis, M. nankiangensis, M. Suiyang county, Fanjing Mountain (27°49′–28°01′ N, pachyproctus, M. shuichengensis and M. tuberogranulatus 108°45′–108°48′ E), Jiangkou County, Guizhou Province, (vs. reaching posterior corner of the eye in the latter); China at elevations between 1 270–1704 m a. s. l. in differs from M. daweimontis, M. glandulosa, M. lini, M. Kuankuoshui Nature National Reserve and Fanjing major, M. medongensis, M. obesa, M. sangzhiensis (vs. Mountain, and from Chen et al. (2017), this new species reaching the anterior corner of the eye or beyond eye is also distributed in Jianba Town, Suiyang County, or nostril and tip of snout in the latter); differs from M. Guizhou Province and Qinghua Forest Farm, Chongqing leishanensis (vs. reaching middle part of eye); differs City, China. from M. mufumontana (reaching tympanum in males and Both in the Kuankuoshui National Nature Reserve and to the eye in females). Fanjing Mountain , the new species are frequently found By having an internal single subgular vocal sac in bamboo forests nearby the streams (Figure 8 A, B), and in male, Megophrys jiangi sp. nov. differs from M. five sympatric amphibian species, i.e. Megophrys spinata, caudoprocta, M. shapingensis and M. shuichengensis (vs. Odorrana margaratae, Rhacophorus omeimontis and vocal sac absent in the latter). Rana zhenhaiensis were found in the two localities. By having nuptial pads and nuptial spines on the dorsal Etymology The specific epithet “jiangi” is in honor base of the first and second fingers in breeding male, of Professor Jian-Ping Jiang from Chengdu Institute of Megophrys jiangi sp. nov. differs from M. acuta, M. feii, Biology, Chinese Academy of Sciences, in recognition of M. shapingensis and M. shuichengensis (vs. nuptial pads his contributions to the systematic studies and biodiversity and nuptial spines lacking in the latter). conservation of amphibians in China. No. 4 Jing LIU et al. A New Species of Megophrys
Figure 8 Habitats of Megophrys jiangi sp. nov. in the type locality Kuankuoshui National Nature Reserve, Suiyang County, Guizhou Province, China. A: landscape of montane forests in the type locality. B: a mountain stream in the type locality (insert a male of the new species calling on the stone).
4. Discussion the region between these two localities, just in these two years, our group has described three new frog species, i.e. In the genus Megophrys, due to the superficial Megophrys jiangi sp. nov., Microhyla fanjingshanensis similarities in morphologies (e.g. drab colorations, (Li et al., 2019) and Odorrana kweichowensis (Li et complicated markings and even changeable colorations al., 2018b), and this region was also indicated as the and skin markings of the same individual under various overlap region of many related species and/or clades (Li environments), related species is often considered to be et al., 2018b). Hence, more detailed investigations will difficult to be distinguished from each other especially contribute to determining the distribution range of the in field identification, which would cause confusion in species and exploring systematic profiles of the related taxonomic arrangements (Fei et al., 2009). Megophrys taxa in this region. minor was recorded in a wide distributional range in Acknowledgements We are grateful to editors and the provinces of Sichuan, Guizhou, Chongqin, Yunnan, reviewers for their working on the manuscript. Collections Guangxi, Jiangxi in China and north of Vietnam (Fei in field were permitted by Administration of Kuankuoshui et al., 2012, 2016). The species has been recorded in National Nature Reserve (No. KKS20040348). This Kuangkuoshui National Nature Reserve and Fanjing study was approved by the animal ethical committee Mountain for many years (Wu et al., 1986; Fei et al., of Chengdu Institute of Biology, Chinese Academy 2012, 2016), but we just found Megophrys jiangi sp. of Sciences, and animal experiments were carried nov. in these two regions though with many surveys in out following the institutional guidelines (No. recent years. Therefore, we suggested that the populations 2017CIBAEC0344). This work was supported by Project in these areas ever identified as M. minor were under Supported by the Biodiversity Investigation, Observation misidentification and should be Megophrys jiangi sp. and Assessment Program (2019-2023) of Ministry of nov. In consideration of much underestimated species Ecology and Environment of China, the Strategic Priority diversity in the genus Megophrys s. l. (Liu et al., 2018), Research Program of the Chinese Academy of Sciences it is expected that there still be cryptic species whose (Grant No. XDPB0202), National Natural Sciences populations had possibly been identified as M. minor, Foundation of China (NSFC-31960099), Biodiversity probably corresponding to several cryptic species Conservation Key Laboratory of Guizhou Province suggested in Chen et al. (2017) and Liu et al. (2018). Education Department, Guiyang College, The laboratory This need deep field investigations and comprehensive on biodiversity conservation and applied ecology of comparisons in the related regions. Guiyang college, Guizhou Provincial Department Geographical distances between Kuankuoshui National of Education Youth Science and Technology Talents Nature Reserve and Fanjing Mountain were about 153 Growth Project (Nos. KY[2018]455, KY[2018]468 and km, and the new species is much probably distributed KY[2018]469), The Specialty Food Resource Utilization in the region between the two localities. Moreover, in Talent Base of Moutai University. Asian Herpetological Research Vol. 10
References Dubois A. 1987 “1986”. Miscellanea taxinomica batrachologica (I). Alytes, 5: 7–95 Beddard F. E. 1908 “1907”. Contributions to the knowledge of the Dubois A., Ohler A. 1998. A new species of Leptobrachium anatomy of the batrachian family Pelobatidae. Proc Zool Soc (Vibrissaphora) from northern Vietnam, with a review of Lond, 1907: 871–911 the taxonomy of the genus Leptobrachium (Pelobatidae, Boulenger G. A. 1886 “1885”. Description of a new frog of the Megophryinae). Dumerilia, 4: 1–32 genus Megalophrys. Proc Zool Soc Lond, 1885: 850 Fei L., Hu S. Q., Ye C. Y., Huang. Y. Z. 2009. Fauna Sinica. Boulenger G. A. 1887. Description of a new frog of the genus Amphibia. Volume 2. Anura. Chinese Academy of Science. Beijing, China: Science Press. (In Chinese) Megalophrys. Annali del Museo Civico di Storia Naturale di Fei L., Ye C. Y., Huang Y. Z. 1983. Two new subspecies of Genova. Serie 2, 4: 512–513 Megophrys omeimontis Liu from China (Amphibia, Pelobatidae). Boulenger G. A. 1889. Description of a new batrachian of the genus Acta Herpetologica Sinica. New Series, Chengdu, 2(2): 49–52 Leptobrachium, obtain by M. L. Fea in the Karens Mountains (In Chinese with English abstract) Burma. Ann Mus Civ Stro Nat Genova, 7(2): 748–750 Fei L., Ye C. Y., Huang Y. Z. 1990. Key to Chinese Amphibians. Boulenger G. A. 1893. Concluding report on the reptiles Chongqing, China: Publishing House for Scientific and andbatrachians obtained in Burma by Signor L. Fea dealing with Technological (In Chinese) the collection made in Pegu and the Karin Hills in 1887–1888. Fei L., Ye C. Y., Huang Y. Z. 2001. Colour Handbook Amph. Annali del Museo Civico di Storia Naturale di Genova, Serie 2, Sichuan, Beijing: Science Press (In Chinese) 13: 304–347 Fei L. Ye C. Y. 2005. Two new species of Megophryidae from Boulenger G. A. 1899a. Descriptions of three new reptiles and a China. In: Fei et al. (Ed.), The Key and Illustration of Chinese. new batrachian from Mount Kina Balu, North Borneo. Ann Nat Chongqing, China: Sichuan Publishing House of Science and Hist, Series 7, 4: 453 Technology (In Chinese) Boulenger G. A. 1899b. On a collection of reptiles and batrachians Fei L., Hu S. Q., Ye C. Y., Huang. Y. Z. 2009. Fauna Sinica. made by Mr. J. D. La Touche in N.W. Fokien, China. Proc Zool Amphibia. Volume 2. Anura. Chinese Academy of Science. Soc Lond, 159–172 + pls. XVI-XIM Beijing, China: Science Press (In Chinese) Boulenger G. A. 1903. Report on the batrachians and reptiles. Fei L., Ye C. Y., Jiang J. P. 2012. Colored atlas of Chinese Annandale N., Robinson H. C., eds. Fasciculi Malayenses. Amphibians and their distributions. Chengdu, China: Sichuan Anthropological and Zoological Results of an Expedition to Publishing House of Science and Technology (In Chinese) Perak and the Siamese Malay States 1901–1903 undertaken by Fei L., Ye C. Y., Jiang J. P. 2016. Genus Liuophrys Fei, Ye and Nelson Annandale and Herbert C. London, Longmans, Green Jiang, new genus; Subgenus Atympanophrys (Borealophrys) & Co.: Robinson under the auspecies of the University of Fei, Ye and Jiang, new subgenus; Subgenus Atympanophrys Edinburgh and the University of Liverpool. Volume 2, Zoology, (Gigantophrys) Fei, Ye and Jiang, new subgenus; Genus Part 1: 131–176 Boulenophrys Fei, Ye and Jiang, 2016, new genus; Subgenus Boulenger G. A. 1908. A revision of the oriental pelobatid Xenophrys (Tianophrys) Fei, Ye and Jiang, new subgenus. In batrachians (genus Megophrys). Proc Zool Soc Lond, 78 (2): Fei L, Ye C. Y. 2016 Amphibians of China. Volume (I). Beijing, 407–430 China: Science Press。 Bourret R. 1937. Notes herpétologiques sur l’Indochine française. Frost D. R. 2019. Amphibian Species of the World Version 6.0, an XIV. Les batraciens de la collection du Laboratoire des Sciences Oline Reference: Names assigned to genus Megophrys. American Naturelles de l’Université. Descriptions de quinze especes ou Museum of Natural History, New York, USA. Available from: variétés nouvelles. Annexe au Bulletin Général de l’Instruction http://research.amnh.org/vz/herpetology/amphibia/Amphibia/ Publique Hanoi, 1937: 5–56 Anura/Megophryidae/Megophrys (accessed 20 June 2019). Castresana J. 2000. Selection of conserved blocks from multiple Günther A. C. L. G. 1864. The Reptiles of British India. London: alignments for their use in phylogenetic analysis. Mol Biol Evol, Ray Society by R. Hardwicke. 17: 540–552 Guindon S, Dufayard J. F., Lefort V., Anisimova M., Hordijk Che J., Chen H. M., Yang J. X., Jin J. Q., Jiang K., Yuan Z. Y., W., Gascuel O. 2010. New algorithms and methods to estimate Murphy R. W., Zhang Y. P. 2012. Universal COI primers for maximum-likelihood phylogenies: assessing the performance of DNA barcoding amphibians. Mol Ecol Resour, 12: 247–258 PhyML 3.0. Syst Biol, 59(3): 307–321 Chen J. M., Zhou W. W., Nikolay A., Poyarkov Jr., Stuart B. Hall T. A. 1999. BIOEDIT: a user-friendly biological sequence L., Brown R. M., Lathrop A., Wang Y. Y., Yuan Z. L., Jiang alignment editor and analysis program for Windows 95/98/NT. K., Hou M., Chen H. M., Suwannapoom C., Nguyen S. N., Nucleic Acids Symp Ser, 41: 95–98 Duong T. V., Papenfuss T. J., Murphy R. W., Zhang Y. P., Hu S. X., Zhao E. M., Liu C. Z. 1966. A herpetological survey Che J. 2017. A novel multilocus phylogenetic estimation reveals of the Tsinling and Ta-pa shan region. Acta Zool Sinica, 18(1): unrecognized diversity in Asia toads, genus Megophrys sensu 57–89 (In Chinese) lato (Anura: Megophryidae). Mol Phylogenet Evol, 106: 28–43 Hu S. X., Zhao E. M., Liu C. Z. 1973. A survey of amphibians Deuti K., Grosjean S., Nicolas V., Vasudevan K., Ohler A. 2017. and reptiles in Kweichow province, including a herpetofauna Nomenclatural puzzle in early Megophrys nomina (Anura, analysis. Acta Zool Sinica, 19(2): 149–171 (In Chinese) Megophryidae) solved with description of two new species from Huang Y. Z., Fei L. 1981. Two new species of amphibians from India (Darjeeling hills and Sikkim). Alytes, 34: 20–48 Xizang. Acta Zootaxonomica Sin, 6: 211–215 No. 4 Jing LIU et al. A New Species of Megophrys
Inger R. F. 1989. Four new species of frogs from Borneo. Malayan 3722(2): 143–169 Nat J, Kuala Lumpur, 42: 229–243 Mahony S., Nicole M. F., Biju S.D., Teeling E. C. 2017. Inger R. F., Romer J. D. 1961. A new pelobatid frog of the genus Evolutionary history of the Asian Horned Frogs (Megophryinae): Megophrys from Hong Kong. Fieldiana Zool, 39(46): 533–538 integrative approaches to timetree dating in the absence of a Inger R. F., Stuebing R. B., Lian T. F. 1995. New species and new fossil record. Mol Biol Evol, 34(3): 744–771 records of Anurans from Boreno. Raff Bull Zool, 43(1): 115–131 Mahony S., Kamei R. G., Teeling E.C., Biju S. D. 2018. Cryptic Inger R. F., Iskandar D. T. 2005. A collection of amphibians from diversity within the Megophrys major species group (Amphibia: west Sumatra, with description of a new species of Megophrys Megophryidae) of the Asian Horned Frogs: Phylogenetic (Amphibia: Anura). Raffles B Zool, 133–142 perspectives and a taxonomic revision of South Asian taxa, with Jiang J. P, Ye C. Y., Fei L. 2008. A New Horn Toad Megophrys descriptions of four new species. Zootaxa, 4523: 1–96 sangzhiensis from Hunan, China (Amphibia, Anura). Zool Res Malkmus R., Matsui M. 1997. Megophrys kobayashii, ein neuer 29(2): 219–222 (In Chinese) pelobatider Frosch vom Mount Kinabalu. Sauria. Berlin, 19: Kuhl H., Van Hasselt J. C. 1822. Uittreksels uit breieven van de 31–37 Heeren Kuhl en van Hasselt, aan de Heeren C. J. Temminck, Mathew R., Sen N. 2007. Description of two new species of Th. van Swinderen en W. de Haan. Algemeene Konst-en Letter- Megophrys (Amphibia: Anura: Megophryidae) from North-east Bode, 7: 99–104 India. Cobra, 1: 18–28 Lathrop A. 1997. Taxonomic review of the megophryid frogs McGuire J. A., Witt C. C., Altshule D. L., Remsen J. V. 2007. (Anura: Pelobatoidea). Asian Herpetol Res, 7: 68–79 Phylogenetic systematics and biogeography of hummingbirds: Lemmon A. R., Moriarty E. C. 2004. The importance of proper Bayesian and maximum likelihood analyses of partitioned data model assumption in Bayesian phylogenetics. Syst Biol, 53: and selection of an appropriate partitioning strategy. Syst Biol, 265–277 56: 837–856 Li Y. L., Jin M. J., Zhao J., Liu Z. Y., Wang Y. Y., Pang H. Messenger K. R., Dahn H. A., Liang Y. R., Xie P., Wang Y., Lu 2014. Description of two new species of the genus Megophrys C. H. 2019. A new species of the genus Megophrys Gunther, (Amphibia: Anura: Megophryidae) from Heishiding Natural 1864 (Amphibia: Anura: Megophryidae) from Mount Wuyi, Resreve, Fengkai, Guangdong, China, based on molecular and China. Zootaxa, 4554 (2): 561–583 morphological data. Zootaxa, 3795(4): 449–471 Mo M. Y., Shen Y. H., Li H. H., Wu M. S. 2010. A new species Li S. Z., Xu N., Liu J., Jiang J. P., Wei G., Wang B. 2018a. A of Megophrys (Amphibia: Anura: Megophryidae) from the New Species of the Asian Toad Genus Megophrys sensu lato northwestern Hunan Province, China. Curr Zool, 56(4): 432–436 (Amphibia: Anura: Megophryidae) from Guizhou Province, Munir M., Hamidy A., Farajallah A., Smith E. N. 2018. A new China. Asian Herpetol Res, 9(4): 224–239 Megophrys Kuhl and Van Hasselt (Amphibia: Megophryidae) Li S. Z., Xu N., Lv J. C., Jiang J. P., Wei G., Wang B. 2018b. A from southwestern Sumatra, Indonesia. Zootaxa, 4442: 389–412 new species of the odorous frog genus Odorrana (Amphibia, Ohler A., Swan S. R., Daltry J. C. 2002. A recent survey of the Anura, Ranidae) from southwestern China. PeerJ, 6: e5695 amphibian fauna of the Cardamom Mountains, Southwest Li S. Z., Zhang M. H., Xu N., Lv J. C., Jiang J. P., Liu J., Wei Cambodia with descriptions of three new species. Raffles B G., Wang B. 2019. A new species of the genus Microhyla Zool, 50(2): 465–481 (Amphibia: Anura: Microhylidae) from Guizhou Province, Ohler A. 2003. Revision of the genus Ophryophryne Boulenger, China. Zootaxa, 4624 (4): 551–575 1903 (Megophryidae) with description of two new species. Liu C. Z. 1950. Amphibians of Western China. Fieldiana, America Alytes, 23–44 Zool Mem, Chicago, 2: 1–400 Orlov N. L., Pyarkov Jr N. A., Nguyen T. T. 2015. Taxonomic Liu C. Z., Hu S. Q., Yang H. H. 1960. Amphibian of Yunnan notes on Megophrys frogs (Megophryidae, Anura) of Vietnam, collected in 1958. Acta Zool Sinca, 12(2): 149–174 (In Chinese with description of a new species. Russian Herpetol, 22: 206– with English abstract) 218 Liu Z. Y., Zhu T. Q., Zeng Z. C., Lyu Z. T., Wang J., Messenger Pope C. H. 1929. Four new frogs from Fukien Province, China. K., Greenberg A. J., Gou Z. X., Yang Z. H., Shi S. H., Wang Amer Mus Nov, 352: 1–5 Y. Y. 2018. Prevalence of cryptic species in morphologically Poyarkov N. A., Duong Jr., T. V., Orlov N. L., Gogoleva S. I., uniform taxa–Fast speciation and evolutionary radiation in Asian Vassilieva A. B., Nguyen L. T., Nguyen V. D. H., Nguyen frogs. Mol Phylogenet Evol, 127: 723–731 S. N., Che J., Mahony S. 2017. Molecular, morphological Mahony S. 2011. Two new species of Megophrys Kuhl & van and acoustic assessment of the genus Ophryophryne (Anura, Hasselt (Amphibia: Megophryidae), from western Thailand and Megophryidae) from Langbian Plateau, southern Vietnam, with southern Cambodia. Zootaxa, 2734: 23–39 description of a new species. ZooKeys, 672: 49–120 Mahony S., Sengupta S., Kamei R. G., Biju S. D. 2011. A Rao D. Q., Yang D. T. 1997. The karyotypes of Megophryinae new low altitude species of Megophrys Kuhl and van Hasselt (Pelobatidae) with a discussion on their classification and (Amphibia: Megophryidae), from Assam, Northeast India. phylogenetic relationships. Asian Herpetol Res, 7: 93–102 Zootaxa, 3059: 36–46 Robert L., Brett C., Simon Y. W. H., Stephane G. 2012. Mahony S., Teeling E. C., Biju S. D. 2013. Three new species PartitionFinder: Combined Selection of Partitioning Schemes of horned frogs, Megophrys (Amphibia: Megophryidae), from and Substitution Models for Phylogenetic Analyses. Mol northeast India, with a resolution to the identity of Megophrys Phylogenet Evol, 29(6): 1695–1701 boettgeri populations reported from the region. Zootaxa, Ronquist F. R., Huelsenbeck J. P. 2003. MrBayes3: Bayesian Asian Herpetological Research Vol. 10
phylogenetic inference under mixed models. Bioinformatics, with descriptions of two genera. Acta Herpetol Sinica, 2: 41–48 19(12): 1572–1574 (In Chinese). Sambrook J., Fritsch E. F., Maniatis T. 1989. Molecular Cloning: Vieites D. R., Min M. S., Wake, D. B. 2007. Rapid diversification A Laboratory Manual. New York, America: Cold Spring Harbor and dispersal during periods of global warming by plethodontid Laboratory Press salamanders. Proc Natl Acad Sci USA, 104: 19903–19907 Schlegel H. 1858. Handleiding tot de Beoefening der Dierkunde. Wang J., Liu Z. Y., Lyu Z. T., Wang Y. Y. 2017a. A new species of Volume 2. Breda: Koninklijke Militaire Akademie the genus Megophrys (Amphibia: Anura: Megophryidae) from Shen M. M., Liang D., Feng Y. J., Chen M. Y., Zhang P. 2013. an offshore island in Guangdong Province, southeastern China. A versatile and highly efficient toolkit including 102 nuclear Zootaxa, 4324(3): 541–556 markers for Vertebrate phylogenomics, tested by resolving the Wang Y. E., Liu B.Q., Jiang K., Jin,W., Xu J. N., Wu C. H. higher level relationships of the Caudata. Mol Biol Evol, 30(10): 2017b. A new species of the Horn Toad of the genus Xenophrys 2235–2248 from Zhejiang, China (Amphibia: Megophryidae). Chin J Zool, Shen Y. H. 1994. A new pelobatid toad of the genus Megophrys 52: 19–29 (In Chinese) from China (Anura: Pelobatidae). Collection of Articles for the Wang Y. Y., Zhang T. D., Zhao J., Sung Y. H., Yang J. H., Pang 60th Anniversary of the Foundation of the Zoological Society of H., Zhang Z. 2012. Description of a new species of the genus China, Nanking: Zool Soc, 603–606 (In Chinese) Megophrys Guenther, 1864 (Amphibia: Anura: Megophryidae) Simon C., Frati F., Beckenbach A., Crespi B., Liu H. Flook from Mount Jinggang, China, based on molecular and P. 1994. Evolution, weighting and phylogenetic utility of morphological data. Zootaxa, 3546: 53–67 mitochondrial gene sequences and a compilation of conserved Wang Y. Y., Zhao J., Yang J. H., Zhou Z. M., Chen G. L., Liu polymerase chain reaction primers. Ann Entomol SOC Amer, 87: Y. 2014. Morphology, molecular genetics, and bioacoustics 651–701 support two new sympatric Megophrys (Amphibia: Anura Sjöander K., Beskow J. 2000. Wavesurfer (Anura: Pelobatidae). Megophryidae) species in Southeast China. Plos ONE, 9: e93075 Collection of Articles for the International Conference on Wang J., Lyu Z. T., Liu Z. Y., Liao C. K., Zeng Z. C., Li Y. L., Spoken Language Processing, Beijing, China, 464–467 Wang Y. Y. 2019. Description of six new species of the subgenus Smith M.A. 1921. New or little-known reptiles and batrachians Panophrys within the genus Megophrys (Anura, Megophryidae) from southern Annam (Indo-China). Proc Zool Soc London, from southeastern China based on molecular and morphological 423–440 data. ZooKeys, 851: 113–164 Stejneger L. 1926. Two new tailless amphibians from western Wu L., Dong Q., Xu R. H. 1986. Amphibians of Guizhou province. China. Proc Biol Soc Wash, 39: 53–54 Guiyang, China: Guizhou People Press (In Chinese) Stuart B. L., Chuaynkern Y., Chan-ard T., Inger R. F. 2006. Yang J. H., Wang J., Wang Y. Y. 2018. A new species of the genus Three new species of frogs and a new tadpole from eastern Megophrys (Anura: Megophryidae) from Yunnan Province, Thailand. Fieldiana Zool, 111: 1–19 China. Zootaxa, 4413: 325–338 Tamura K, Stecher G, Peterson D, Fiipski A, Kumar S. 2011. Ye C. Y., Fei L. 1992. A new Pelobatid toda of the genus Megophrys MEGA6: molecular evolutionary genetics analysis using from Xizang, China. Acta Herpetol Sinica, 1–2: 50–52 (In evolutionary distance. Mol Biol Evol, 28: 2725–2729 Chinese) Tapley B., Cutajar T., Mahony S., Nguyen C. T., Dau V. Q., Ye C. Y., Fei L. 1995. Taxonomic studies on the small type Nguyen T. T., Luong H. V., Rowley J. J. L. 2017. The Megophrys in China including descriptions of the new species Vietnamese population of Megophrys kuatunensis (Amphibia: (subspecies) (Pelobatidae: genus Megophrys). Acta Herpetol Megophryidae) represents a new species of Asian horned frog Sinica, 4–5: 72–81 (In Chinese) from Vietnam and southern China. Zootaxa, 4344(3): 465–492 Ye C. Y., Fei L., Xie F. 2007. A new species of Megophryidae Tapley B., Cutajar T. P., Mahony S., Nguyen C. T., Dau V. Q., Megophrys baolongensis from China (Amphibia, Anura). Acta Luong A. M., Le D. T., Nguyen T. T., Nguyen T. Q., Portway Herpetol Sinica, 11: 38–41 C., Luong H. V., Rowley J. J. L. 2018. Two new and potentially Zhang Y., Li G., Xiao N., Li J., Pan T., Wang H., Zhang B., Zhou highly threatened Megophrys Horned frogs (Amphibia: J. 2017. A new species of the genus Xenophrys (Amphibia: Megophryidae) from Indochina’s highest mountains. Zootaxa, Anura: Megophryicae) from Libo County, Guizhou, China. 4508: 301–333 Asian Herpetol Res, 8: 75–85 Taylor E. H. 1920. Philippine Amphibia. Philipp J Sci, 16: 213–359 Zhao J., Yang J. H., Chen G. L., Chen C. Q., Wang Y. Y. 2014. Tian Y. Z., Gu M. M., Sun A. Q. 2000. A new species Description of a new species of the genus Brachytarsophrys of Megophrys in China (Amphibia: Pelobatidae). Acta Tian and Hu, 1983 (Amphibia: Anura: Megophryidae) from Zootaxonomica Sin, 25: 462–466 (In Chinese) Southern China based on molecular and morphological data. Tian W. S., Hu Q. X. 1983. Taxonomic study on genus Megophrys, Asian Herpetol Res, 5(3): 150–160 Appendix
Table S1 Measurements of the adult specimens of Megophrys jiangi sp. nov. Unit: mm. See abbreviations for the morphological characters in Materials and Methods section.
Voucher Sex SVL HDL HDW SNT IND IOD ED TYD LAL LW FIL FIIL FIIILFIVL THL TL TW TFL FL CIBFJS20150718005 female 39.5 10.8 14.1 5 5 3.2 4.5 2.6 18.2 3.6 3.8 4.3 6.2 4.6 17.3 18.4 5.1 26.2 18.1 CIBFJS20150719006 male 36.1 11.1 12.9 5 4.7 3.1 4.5 2.7 15.4 3.6 3.5 3.7 5.6 4.8 15.9 17.7 4.4 25.1 17.5 CIBFJS20150719007 male 34.8 10.2 11.7 4.3 4.5 2.9 4 2.3 15.1 3.1 3.1 3.2 5.3 3.8 16.6 17.1 4.3 23 16.2 CIBFJS20150719009 male 34.4 10.3 12 4.3 4.4 3 4.6 2.5 16.7 3 3 3.3 5.6 4.4 16.3 17.2 4 22.9 15.9 CIBFJS20150720003 male 38 10.4 13 4 4.2 2.5 4.3 2.2 16.3 3.6 3.6 3.7 5.9 3.9 16.7 17.6 4.4 24.7 16.1 CIBFJS20150720004 male 38.3 11.8 12.1 4.6 5 3.3 4.6 2.6 16.4 3.1 4.3 4.4 5 4.3 17 18.4 4.4 26.3 17.6 CIBKKS20180723003 female 40.4 11.4 13.5 4.6 4.8 3 4.7 2.7 18.2 3.1 3.7 4.1 6.7 4.6 17.7 20.4 4.8 27.8 18.8 CIBKKS20180722006 male 38.2 11.1 12.9 5.1 4.9 3.8 4.8 2.9 15.6 3.8 4 4.2 5.8 4.4 17.9 18.7 4.4 25.3 16.5 CIBKKS20180723001 male 38.1 10.6 13 4.1 4.6 2.7 4.6 2.8 17.5 3.6 4.2 4.2 6.5 4.4 18.6 20.2 4.7 26.7 18.5 CIBKKS20180723002 male 35.2 11.3 12.4 4.3 4.4 3 4.2 2.8 16 3.4 3.5 4.2 5.1 4.3 15.8 17.6 4.7 25.8 17.3 CIBKKS20180723007 male 39.2 11.2 13 5.1 4.7 3 4.6 3 14.7 3.6 3.4 3.5 5.4 4.3 17.6 18.1 4.5 24.9 17
Table S2 Primers used in this study.
Locus Primer name Sequence (5′–3′) Source P7 CGCCTGTTTACCAAAAACAT 16S rRNA Simon et al., 1994 P8 CCGGTCTGAACTCAGATCACGT Chmf4 TYTCWACWAAYCAYAAAGAYATCGG COI Che et al., 2012 Chmr4 ACYTCRGGRTGRCCRAARAATCA Rag1_1F GCMTTGCTSCCRGGGTATCA RAG1 Shen et al., 2013 Rag1_2R TCAATGGACGGAAGGGTTTCAATAA BDNF-F ACCATCCTTTTCCTKACTATGG BDNF Vieites et al., 2007 BDNF-R CTATCTTCCCCTTTTAATGGTC Table S3 Uncorrected p-distance between Megophrys sensu lato species based on COI gene sequences.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
Megophrys jiangi 1 sp. nov.
2 Megophrys minor 0.083
3 Megophrys spinata 0.141 0.136
Megophrys 4 0.129 0.130 0.038 sangzhiensis Megophrys 5 0.121 0.120 0.077 0.068 binlingensis Megophrys 6 0.125 0.116 0.093 0.086 0.070 binchuanensis Megophrys 7 0.132 0.116 0.113 0.111 0.096 0.102 palpebralespinosa Megophrys 8 0.151 0.122 0.116 0.116 0.101 0.095 0.109 jingdongensis Megophrys 9 0.146 0.111 0.118 0.109 0.088 0.096 0.120 0.099 daweimontis Megophrys 10 0.145 0.114 0.107 0.100 0.093 0.080 0.116 0.097 0.102 wuliangshanensis Megophrys 11 0.138 0.120 0.109 0.100 0.082 0.088 0.123 0.122 0.111 0.105 omeimontis Megophrys 12 0.173 0.159 0.177 0.170 0.154 0.154 0.179 0.155 0.182 0.157 0.164 nankunensis Megophrys 13 0.168 0.152 0.163 0.159 0.141 0.150 0.152 0.147 0.171 0.150 0.170 0.071 dongguanensis Megophrys 14 0.150 0.136 0.141 0.145 0.136 0.143 0.163 0.139 0.148 0.134 0.155 0.100 0.111 wugongensis
15 M.nanlingensis 0.152 0.132 0.157 0.146 0.134 0.145 0.159 0.137 0.154 0.141 0.159 0.102 0.107 0.084
Megophrys 16 0.150 0.136 0.157 0.152 0.143 0.145 0.166 0.135 0.150 0.145 0.145 0.114 0.111 0.105 0.089 jinggangensis Megophrys 17 0.134 0.113 0.138 0.129 0.111 0.116 0.132 0.111 0.121 0.111 0.129 0.107 0.113 0.088 0.089 0.086 wushanensis Megophrys 18 0.146 0.120 0.155 0.150 0.127 0.136 0.150 0.143 0.145 0.139 0.139 0.114 0.123 0.121 0.113 0.125 0.063 baolongensis Megophrys 19 0.143 0.129 0.143 0.134 0.114 0.136 0.152 0.126 0.143 0.127 0.129 0.130 0.134 0.105 0.107 0.120 0.070 0.089 tuberogranulata Megophrys 20 0.138 0.129 0.157 0.139 0.125 0.138 0.145 0.139 0.148 0.132 0.127 0.134 0.134 0.118 0.111 0.113 0.070 0.093 0.095 leishanensis Megophrys 21 0.145 0.127 0.161 0.150 0.136 0.143 0.154 0.145 0.146 0.129 0.150 0.134 0.138 0.116 0.121 0.120 0.080 0.098 0.104 0.105 jiulianensis Megophrys 22 0.145 0.123 0.150 0.130 0.121 0.129 0.154 0.135 0.138 0.127 0.152 0.127 0.116 0.111 0.096 0.105 0.089 0.113 0.098 0.102 0.093 huangshanensis Megophrys 23 0.146 0.121 0.157 0.134 0.125 0.129 0.150 0.135 0.138 0.125 0.152 0.132 0.120 0.116 0.104 0.107 0.088 0.111 0.100 0.104 0.089 0.018 boettgeri Megophrys 24 0.161 0.120 0.163 0.154 0.134 0.143 0.145 0.145 0.138 0.130 0.152 0.134 0.123 0.118 0.111 0.113 0.100 0.104 0.111 0.113 0.114 0.098 0.091 mufumontana Megophrys 25 0.146 0.132 0.164 0.168 0.146 0.159 0.161 0.151 0.159 0.157 0.182 0.136 0.132 0.118 0.123 0.134 0.132 0.148 0.129 0.150 0.146 0.136 0.138 0.130 brachykolos
26 Megophrys gerti 0.189 0.180 0.182 0.184 0.186 0.186 0.193 0.177 0.198 0.193 0.195 0.205 0.213 0.204 0.198 0.198 0.184 0.189 0.195 0.188 0.193 0.182 0.188 0.195 0.214
27 Megophrys hansi 0.193 0.182 0.196 0.188 0.188 0.196 0.196 0.176 0.191 0.202 0.204 0.198 0.189 0.188 0.196 0.184 0.170 0.195 0.186 0.180 0.191 0.180 0.179 0.182 0.195 0.175
Megophrys 28 0.155 0.164 0.191 0.179 0.168 0.171 0.180 0.172 0.180 0.177 0.186 0.193 0.193 0.184 0.191 0.198 0.182 0.179 0.188 0.179 0.189 0.182 0.191 0.175 0.182 0.189 0.143 microstoma Megophrys 29 0.157 0.150 0.179 0.184 0.161 0.163 0.166 0.145 0.180 0.157 0.161 0.161 0.170 0.155 0.161 0.163 0.146 0.161 0.154 0.155 0.168 0.166 0.170 0.168 0.163 0.205 0.200 0.163 pachyproctus Megophrys 30 0.186 0.189 0.196 0.195 0.191 0.198 0.225 0.193 0.193 0.198 0.191 0.196 0.205 0.189 0.184 0.188 0.179 0.207 0.193 0.189 0.191 0.196 0.193 0.195 0.207 0.209 0.200 0.207 0.200 stejnegeri
31 Megophrys ligayae 0.182 0.193 0.209 0.204 0.193 0.195 0.216 0.198 0.198 0.195 0.198 0.211 0.220 0.207 0.216 0.209 0.198 0.209 0.205 0.195 0.196 0.195 0.193 0.200 0.214 0.220 0.191 0.193 0.213 0.170 Continued Table S3
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
32 Megophrys nasuta 0.189 0.205 0.204 0.202 0.193 0.186 0.213 0.198 0.195 0.196 0.196 0.227 0.229 0.216 0.207 0.193 0.202 0.213 0.214 0.198 0.205 0.220 0.218 0.205 0.223 0.218 0.207 0.180 0.191 0.171 0.180
Megophrys 33 0.173 0.193 0.202 0.191 0.193 0.180 0.202 0.193 0.193 0.182 0.200 0.207 0.207 0.195 0.205 0.200 0.196 0.196 0.196 0.205 0.196 0.200 0.191 0.196 0.191 0.221 0.198 0.200 0.198 0.164 0.152 0.177 edwardinae Megophrys 34 0.168 0.170 0.179 0.168 0.164 0.168 0.182 0.172 0.168 0.166 0.164 0.170 0.173 0.166 0.180 0.173 0.171 0.175 0.159 0.141 0.157 0.168 0.170 0.170 0.182 0.202 0.198 0.161 0.173 0.209 0.204 0.209 0.218 periosa
35 Megophrys zhangi 0.171 0.171 0.184 0.180 0.164 0.168 0.182 0.172 0.177 0.177 0.159 0.180 0.186 0.177 0.188 0.179 0.177 0.163 0.157 0.155 0.166 0.173 0.171 0.171 0.188 0.214 0.207 0.159 0.173 0.196 0.200 0.189 0.200 0.088
Megophrys 36 0.175 0.155 0.171 0.175 0.157 0.163 0.175 0.160 0.155 0.157 0.173 0.186 0.184 0.177 0.166 0.182 0.180 0.173 0.159 0.168 0.171 0.163 0.168 0.154 0.182 0.193 0.214 0.171 0.171 0.195 0.229 0.202 0.214 0.096 0.096 glandulosa Megophrys 37 0.162 0.152 0.177 0.177 0.177 0.164 0.171 0.160 0.159 0.161 0.177 0.184 0.181 0.171 0.168 0.184 0.175 0.177 0.162 0.161 0.170 0.168 0.166 0.164 0.177 0.200 0.200 0.166 0.164 0.213 0.215 0.186 0.206 0.101 0.108 0.094 medogensis Megophrys cf. 38 0.198 0.175 0.214 0.202 0.177 0.180 0.189 0.155 0.171 0.177 0.175 0.180 0.193 0.195 0.189 0.193 0.182 0.175 0.163 0.170 0.186 0.186 0.188 0.170 0.179 0.220 0.211 0.170 0.173 0.214 0.223 0.198 0.227 0.113 0.118 0.113 0.114 major Megophrys 39 0.171 0.170 0.179 0.175 0.155 0.163 0.184 0.158 0.157 0.157 0.173 0.195 0.191 0.171 0.175 0.179 0.168 0.177 0.163 0.150 0.180 0.168 0.173 0.166 0.179 0.182 0.177 0.145 0.171 0.196 0.193 0.186 0.213 0.095 0.107 0.102 0.110 0.109 flavipunctata Megophrys 40 0.164 0.152 0.180 0.180 0.179 0.161 0.173 0.168 0.173 0.164 0.164 0.171 0.170 0.170 0.166 0.171 0.168 0.180 0.168 0.155 0.188 0.175 0.173 0.157 0.186 0.200 0.198 0.161 0.155 0.196 0.211 0.184 0.198 0.111 0.113 0.116 0.105 0.120 0.104 maosonensis Megophrys 41 0.170 0.161 0.182 0.179 0.170 0.166 0.184 0.162 0.166 0.168 0.157 0.180 0.179 0.184 0.168 0.179 0.171 0.175 0.161 0.168 0.188 0.179 0.175 0.170 0.193 0.207 0.211 0.177 0.163 0.200 0.213 0.188 0.205 0.098 0.107 0.111 0.096 0.114 0.098 0.043 mangshanensis Megophrys cf. 42 0.179 0.170 0.193 0.182 0.170 0.170 0.177 0.158 0.155 0.179 0.170 0.173 0.177 0.161 0.171 0.182 0.164 0.182 0.171 0.168 0.180 0.179 0.171 0.168 0.180 0.200 0.189 0.163 0.170 0.200 0.198 0.196 0.220 0.136 0.143 0.130 0.132 0.141 0.121 0.127 0.123 parva Megophrys 43 0.144 0.139 0.186 0.178 0.157 0.168 0.164 0.158 0.171 0.168 0.164 0.171 0.173 0.155 0.171 0.157 0.144 0.155 0.148 0.150 0.162 0.166 0.160 0.150 0.184 0.178 0.184 0.159 0.175 0.191 0.193 0.182 0.198 0.148 0.139 0.164 0.151 0.164 0.142 0.132 0.144 0.150 shapingensis Megophrys 44 0.171 0.161 0.186 0.182 0.152 0.168 0.171 0.153 0.175 0.175 0.170 0.173 0.171 0.168 0.177 0.166 0.157 0.179 0.163 0.177 0.164 0.179 0.173 0.168 0.195 0.184 0.182 0.173 0.188 0.207 0.196 0.195 0.202 0.159 0.171 0.175 0.162 0.170 0.152 0.150 0.152 0.154 0.067 gigantica Megophrys 45 0.152 0.148 0.180 0.175 0.161 0.159 0.168 0.153 0.179 0.163 0.159 0.171 0.173 0.163 0.164 0.150 0.139 0.159 0.150 0.152 0.161 0.170 0.164 0.159 0.171 0.188 0.166 0.155 0.159 0.195 0.191 0.186 0.182 0.146 0.146 0.171 0.150 0.159 0.141 0.139 0.143 0.132 0.074 0.091 wawuensis Megophrys 46 0.177 0.184 0.198 0.198 0.193 0.202 0.205 0.197 0.202 0.200 0.195 0.184 0.179 0.182 0.189 0.186 0.184 0.198 0.200 0.182 0.173 0.196 0.196 0.189 0.179 0.211 0.200 0.173 0.188 0.184 0.207 0.202 0.195 0.171 0.168 0.188 0.173 0.180 0.171 0.182 0.184 0.182 0.175 0.175 0.155 carinense
47 Megophrys feae 0.193 0.184 0.191 0.189 0.189 0.195 0.207 0.189 0.186 0.198 0.195 0.175 0.175 0.180 0.177 0.177 0.171 0.195 0.184 0.189 0.171 0.177 0.175 0.179 0.193 0.214 0.202 0.193 0.186 0.179 0.205 0.193 0.196 0.173 0.168 0.168 0.153 0.180 0.170 0.173 0.180 0.179 0.166 0.164 0.154 0.091
Megophrys 48 0.213 0.211 0.214 0.205 0.200 0.225 0.207 0.202 0.204 0.223 0.211 0.221 0.214 0.220 0.221 0.220 0.225 0.227 0.216 0.220 0.216 0.220 0.218 0.214 0.209 0.221 0.213 0.209 0.218 0.202 0.213 0.229 0.198 0.198 0.205 0.205 0.208 0.204 0.193 0.211 0.205 0.188 0.216 0.207 0.211 0.188 0.202 montana
49 Megophrys aceras 0.194 0.173 0.211 0.209 0.195 0.184 0.207 0.183 0.195 0.188 0.184 0.175 0.186 0.177 0.156 0.180 0.173 0.177 0.177 0.177 0.190 0.190 0.190 0.175 0.199 0.188 0.179 0.169 0.162 0.175 0.211 0.182 0.188 0.197 0.201 0.197 0.186 0.197 0.192 0.179 0.179 0.179 0.169 0.175 0.164 0.180 0.186 0.207 Table S4 Uncorrected p-distance between Megophrys sensu lato species based on 16S gene sequences.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
Megophrys jiangi 1 sp. nov.
2 Megophrys minor 0.073
3 Megophrys spinata 0.105 0.060
Megophrys 4 0.109 0.068 0.017 sangzhiensis Megophrys 5 0.096 0.058 0.011 0.017 binlingensis Megophrys 6 0.094 0.058 0.033 0.037 0.025 binchuanensis Megophrys 7 0.105 0.062 0.045 0.055 0.041 0.037 palpebralespinosa Megophrys 8 0.098 0.062 0.033 0.039 0.025 0.031 0.045 jingdongensis Megophrys 9 0.092 0.054 0.031 0.033 0.027 0.029 0.041 0.025 daweimontis Megophrys 10 0.091 0.055 0.039 0.045 0.035 0.033 0.047 0.029 0.027 wuliangshanensis Megophrys 11 0.096 0.054 0.025 0.035 0.021 0.025 0.037 0.021 0.023 0.029 omeimontis Megophrys 12 0.094 0.058 0.041 0.043 0.041 0.047 0.062 0.041 0.048 0.047 0.031 fansipanensis Megophrys 13 0.087 0.054 0.031 0.037 0.027 0.033 0.051 0.041 0.037 0.045 0.025 0.025 hoanglienensis Megophrys 14 0.094 0.070 0.053 0.055 0.049 0.055 0.062 0.053 0.045 0.051 0.043 0.054 0.051 nankunensis Megophrys 15 0.100 0.068 0.056 0.058 0.053 0.055 0.070 0.064 0.047 0.060 0.049 0.060 0.051 0.025 dongguanensis
16 Megophrys cheni 0.113 0.074 0.052 0.052 0.049 0.049 0.068 0.051 0.046 0.054 0.043 0.057 0.052 0.023 0.033
Megophrys 17 0.096 0.077 0.064 0.066 0.064 0.062 0.070 0.064 0.055 0.060 0.053 0.058 0.058 0.047 0.049 0.038 ombrophila
18 Megophrys obesa 0.135 0.097 0.078 0.081 0.081 0.081 0.099 0.071 0.060 0.068 0.063 0.078 0.078 0.048 0.051 0.031 0.039
Megophrys 19 0.092 0.056 0.041 0.047 0.045 0.047 0.066 0.045 0.041 0.049 0.041 0.043 0.041 0.043 0.045 0.033 0.051 0.057 wugongensis
20 Megophrys lini 0.096 0.066 0.047 0.058 0.054 0.051 0.051 0.051 0.045 0.056 0.043 0.056 0.056 0.043 0.043 0.038 0.056 0.051 0.047
Megophrys 21 0.101 0.066 0.053 0.060 0.055 0.062 0.066 0.066 0.058 0.066 0.051 0.060 0.058 0.053 0.053 0.049 0.066 0.068 0.049 0.039 nanlingensis Megophrys 22 0.125 0.073 0.065 0.065 0.057 0.057 0.076 0.065 0.054 0.054 0.051 0.060 0.054 0.035 0.035 0.028 0.057 0.045 0.057 0.041 0.059 kuatunensis Megophrys 23 0.072 0.052 0.047 0.054 0.043 0.045 0.055 0.051 0.043 0.049 0.039 0.054 0.039 0.045 0.051 0.038 0.049 0.063 0.039 0.039 0.047 0.051 jinggangensis Megophrys 24 0.090 0.065 0.045 0.047 0.039 0.041 0.051 0.045 0.037 0.041 0.033 0.039 0.037 0.037 0.041 0.038 0.045 0.060 0.041 0.048 0.056 0.041 0.035 wushanensis Megophrys 25 0.085 0.064 0.043 0.045 0.037 0.045 0.051 0.043 0.041 0.045 0.041 0.041 0.039 0.031 0.041 0.033 0.051 0.068 0.043 0.049 0.058 0.041 0.039 0.021 baolongensis Megophrys 26 0.085 0.052 0.033 0.035 0.027 0.035 0.047 0.033 0.033 0.035 0.033 0.039 0.033 0.031 0.039 0.023 0.043 0.051 0.033 0.039 0.047 0.030 0.027 0.015 0.015 tuberogranulata Megophrys 27 0.077 0.056 0.037 0.043 0.035 0.037 0.045 0.039 0.037 0.039 0.033 0.039 0.037 0.039 0.047 0.033 0.043 0.057 0.037 0.039 0.047 0.041 0.031 0.023 0.023 0.015 leishanensis Megophrys 28 0.092 0.064 0.045 0.051 0.043 0.051 0.064 0.053 0.049 0.047 0.041 0.039 0.033 0.043 0.047 0.044 0.056 0.069 0.035 0.048 0.056 0.046 0.039 0.031 0.029 0.023 0.023 jiulianensis Megophrys 29 0.090 0.054 0.039 0.049 0.041 0.045 0.053 0.047 0.037 0.045 0.039 0.048 0.041 0.043 0.047 0.038 0.049 0.054 0.039 0.039 0.052 0.041 0.035 0.031 0.031 0.019 0.019 0.027 huangshanensis Megophrys 30 0.081 0.047 0.039 0.045 0.037 0.041 0.053 0.043 0.035 0.041 0.035 0.043 0.037 0.039 0.043 0.033 0.047 0.051 0.037 0.035 0.047 0.035 0.027 0.027 0.027 0.015 0.015 0.023 0.008 boettgeri Megophrys 31 0.083 0.058 0.049 0.053 0.043 0.047 0.062 0.049 0.045 0.047 0.041 0.047 0.041 0.045 0.054 0.046 0.058 0.078 0.051 0.052 0.058 0.046 0.039 0.033 0.033 0.025 0.029 0.033 0.031 0.025 mufumontana
32 Megophrys acuta 0.139 0.104 0.097 0.100 0.094 0.087 0.093 0.097 0.081 0.103 0.094 0.107 0.085 0.097 0.087 0.085 0.106 0.094 0.097 0.075 0.088 0.087 0.075 0.088 0.078 0.075 0.075 0.088 0.075 0.075 0.093
Megophrys 33 0.107 0.075 0.073 0.079 0.070 0.060 0.070 0.070 0.068 0.068 0.060 0.062 0.064 0.058 0.062 0.062 0.066 0.078 0.066 0.039 0.060 0.057 0.054 0.054 0.053 0.049 0.052 0.054 0.056 0.052 0.062 0.081 brachykolos
34 Megophrys gerti 0.147 0.133 0.130 0.130 0.128 0.123 0.119 0.128 0.121 0.126 0.112 0.116 0.112 0.128 0.123 0.137 0.128 0.146 0.116 0.130 0.121 0.149 0.119 0.122 0.125 0.121 0.121 0.123 0.124 0.121 0.121 0.170 0.123
35 Megophrys elfina 0.143 0.121 0.123 0.119 0.112 0.114 0.112 0.105 0.110 0.114 0.108 0.114 0.114 0.121 0.117 0.131 0.119 0.135 0.116 0.126 0.123 0.140 0.117 0.110 0.114 0.105 0.114 0.121 0.121 0.114 0.114 0.167 0.117 0.035
36 Megophrys synoria 0.190 0.171 0.161 0.152 0.146 0.143 0.146 0.140 0.152 0.142 0.137 0.158 0.155 0.164 0.158 0.157 0.158 0.160 0.154 0.167 0.167 0.160 0.152 0.153 0.158 0.149 0.167 0.167 0.165 0.161 0.158 0.179 0.174 0.101 0.092
37 Megophrys hansi 0.135 0.126 0.116 0.109 0.114 0.109 0.120 0.107 0.112 0.116 0.105 0.102 0.107 0.125 0.127 0.130 0.122 0.141 0.113 0.120 0.141 0.139 0.123 0.114 0.109 0.107 0.113 0.123 0.120 0.116 0.118 0.158 0.122 0.096 0.090 0.111
Megophrys 38 0.144 0.116 0.113 0.113 0.109 0.120 0.107 0.113 0.111 0.113 0.107 0.111 0.115 0.122 0.127 0.121 0.125 0.134 0.120 0.116 0.118 0.130 0.111 0.116 0.113 0.106 0.113 0.120 0.113 0.109 0.111 0.172 0.120 0.103 0.096 0.134 0.063 microstoma Megophrys 39 0.148 0.110 0.096 0.101 0.096 0.098 0.098 0.101 0.098 0.101 0.094 0.108 0.101 0.112 0.110 0.128 0.107 0.150 0.089 0.107 0.108 0.140 0.099 0.097 0.099 0.090 0.103 0.096 0.101 0.099 0.094 0.175 0.126 0.152 0.150 0.162 0.144 0.144 pachyproctus Megophrys 40 0.171 0.157 0.132 0.142 0.129 0.136 0.136 0.134 0.139 0.129 0.137 0.150 0.139 0.147 0.147 0.159 0.165 0.188 0.147 0.137 0.139 0.159 0.142 0.135 0.137 0.132 0.142 0.132 0.142 0.142 0.137 0.174 0.142 0.175 0.173 0.204 0.185 0.156 0.150 baluensis Continued Table S4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
Megophrys 41 0.159 0.154 0.130 0.137 0.135 0.137 0.137 0.130 0.125 0.123 0.132 0.140 0.142 0.154 0.152 0.153 0.149 0.174 0.142 0.137 0.140 0.159 0.142 0.145 0.150 0.140 0.145 0.145 0.147 0.147 0.145 0.191 0.145 0.164 0.157 0.206 0.168 0.151 0.166 0.083 stejnegeri
42 Megophrys ligayae 0.162 0.147 0.129 0.141 0.129 0.139 0.141 0.132 0.136 0.139 0.132 0.137 0.137 0.156 0.158 0.184 0.166 0.198 0.141 0.149 0.146 0.187 0.147 0.140 0.142 0.135 0.142 0.139 0.142 0.142 0.139 0.209 0.146 0.157 0.147 0.187 0.154 0.132 0.131 0.072 0.105
Megophrys 43 0.164 0.136 0.131 0.136 0.131 0.136 0.119 0.128 0.119 0.138 0.121 0.141 0.129 0.129 0.133 0.138 0.141 0.153 0.139 0.119 0.129 0.135 0.127 0.129 0.129 0.127 0.136 0.134 0.134 0.129 0.129 0.153 0.131 0.147 0.143 0.181 0.170 0.141 0.150 0.077 0.096 0.089 kobayashii
44 Megophrys nasuta 0.174 0.147 0.147 0.166 0.152 0.159 0.130 0.149 0.147 0.154 0.147 0.164 0.164 0.159 0.149 0.185 0.159 0.203 0.154 0.140 0.147 0.185 0.149 0.155 0.155 0.152 0.149 0.152 0.152 0.152 0.157 0.191 0.151 0.173 0.158 0.212 0.189 0.159 0.153 0.083 0.093 0.095 0.078
Megophrys 45 0.180 0.147 0.132 0.144 0.134 0.139 0.144 0.134 0.139 0.141 0.132 0.142 0.137 0.144 0.156 0.188 0.171 0.210 0.144 0.142 0.144 0.177 0.147 0.135 0.140 0.133 0.137 0.130 0.137 0.137 0.128 0.210 0.151 0.180 0.173 0.214 0.172 0.156 0.122 0.081 0.103 0.071 0.093 0.097 edwardinae
46 Megophrys dringi 0.137 0.117 0.107 0.124 0.112 0.116 0.112 0.105 0.107 0.116 0.095 0.103 0.112 0.124 0.119 0.134 0.119 0.128 0.117 0.103 0.117 0.127 0.117 0.103 0.108 0.105 0.108 0.115 0.103 0.103 0.103 0.159 0.110 0.158 0.149 0.167 0.153 0.145 0.128 0.123 0.134 0.117 0.119 0.132 0.120
Megophrys cf. 47 0.156 0.118 0.112 0.127 0.117 0.120 0.127 0.117 0.110 0.118 0.113 0.125 0.118 0.123 0.130 0.132 0.128 0.144 0.105 0.113 0.110 0.123 0.120 0.116 0.110 0.105 0.110 0.115 0.110 0.108 0.116 0.168 0.128 0.188 0.174 0.192 0.175 0.169 0.144 0.160 0.179 0.168 0.142 0.147 0.155 0.111 periosa
48 Megophrys periosa 0.151 0.108 0.103 0.118 0.108 0.110 0.125 0.107 0.105 0.108 0.103 0.116 0.108 0.120 0.120 0.121 0.118 0.131 0.103 0.103 0.098 0.112 0.111 0.106 0.106 0.096 0.101 0.111 0.101 0.098 0.108 0.158 0.123 0.185 0.171 0.192 0.167 0.161 0.150 0.163 0.171 0.171 0.145 0.155 0.163 0.111 0.019
Megophrys 49 0.136 0.096 0.098 0.113 0.103 0.103 0.105 0.110 0.093 0.101 0.096 0.111 0.096 0.101 0.103 0.109 0.101 0.118 0.096 0.091 0.089 0.095 0.094 0.094 0.091 0.086 0.096 0.098 0.089 0.086 0.096 0.144 0.106 0.177 0.166 0.189 0.167 0.153 0.137 0.163 0.166 0.171 0.132 0.150 0.165 0.101 0.028 0.021 himalayana
50 Megophrys sanu 0.193 0.154 0.117 0.130 0.124 0.133 0.133 0.140 0.123 0.130 0.120 0.148 0.127 0.134 0.144 0.131 0.140 0.131 0.134 0.130 0.124 0.114 0.124 0.118 0.115 0.111 0.114 0.131 0.124 0.121 0.128 0.154 0.150 0.209 0.198 0.201 0.200 0.170 0.166 0.169 0.195 0.175 0.166 0.176 0.179 0.121 0.060 0.057 0.042
51 Megophrys zhangi 0.139 0.113 0.091 0.104 0.095 0.100 0.099 0.104 0.093 0.098 0.091 0.109 0.096 0.100 0.106 0.118 0.109 0.131 0.100 0.098 0.093 0.103 0.093 0.089 0.087 0.085 0.087 0.098 0.093 0.091 0.096 0.154 0.111 0.163 0.156 0.186 0.160 0.143 0.128 0.146 0.161 0.137 0.146 0.137 0.144 0.100 0.048 0.046 0.037 0.000
Megophrys 52 0.177 0.163 0.136 0.149 0.136 0.152 0.149 0.149 0.126 0.136 0.136 0.164 0.146 0.157 0.160 0.153 0.157 0.147 0.153 0.150 0.143 0.136 0.143 0.144 0.137 0.133 0.136 0.147 0.140 0.136 0.140 0.171 0.164 0.208 0.201 0.212 0.203 0.174 0.183 0.182 0.176 0.196 0.166 0.173 0.193 0.128 0.074 0.074 0.065 0.048 0.048 katabhako Megophrys 53 0.143 0.113 0.093 0.106 0.102 0.101 0.106 0.104 0.097 0.102 0.097 0.113 0.102 0.115 0.111 0.123 0.111 0.140 0.102 0.100 0.100 0.117 0.097 0.102 0.102 0.093 0.093 0.104 0.093 0.093 0.104 0.158 0.124 0.166 0.171 0.199 0.167 0.152 0.132 0.166 0.163 0.163 0.151 0.149 0.160 0.116 0.050 0.039 0.041 0.053 0.041 0.062 glandulosa Megophrys 54 0.141 0.111 0.099 0.111 0.097 0.102 0.115 0.104 0.099 0.102 0.093 0.109 0.102 0.106 0.106 0.115 0.106 0.134 0.093 0.098 0.091 0.106 0.095 0.091 0.098 0.089 0.093 0.102 0.093 0.091 0.100 0.175 0.111 0.168 0.161 0.202 0.165 0.152 0.130 0.148 0.152 0.156 0.143 0.137 0.151 0.112 0.052 0.041 0.045 0.060 0.045 0.077 0.047 medogensis Megophrys cf. 55 0.134 0.123 0.104 0.113 0.104 0.109 0.106 0.100 0.100 0.100 0.106 0.109 0.096 0.106 0.115 0.130 0.118 0.148 0.102 0.109 0.107 0.121 0.100 0.098 0.093 0.089 0.104 0.102 0.100 0.100 0.100 0.168 0.118 0.164 0.159 0.189 0.150 0.138 0.126 0.141 0.152 0.146 0.161 0.152 0.146 0.114 0.054 0.059 0.050 0.072 0.054 0.081 0.052 0.056 major Megophrys 56 0.167 0.130 0.117 0.132 0.122 0.122 0.127 0.122 0.115 0.117 0.120 0.138 0.125 0.132 0.137 0.144 0.135 0.161 0.125 0.118 0.118 0.129 0.113 0.123 0.120 0.115 0.120 0.128 0.118 0.115 0.125 0.168 0.135 0.208 0.205 0.214 0.200 0.172 0.160 0.163 0.188 0.190 0.161 0.169 0.184 0.123 0.054 0.056 0.045 0.068 0.057 0.086 0.054 0.059 0.057 flavipunctata Megophrys 57 0.149 0.130 0.103 0.112 0.107 0.116 0.121 0.103 0.100 0.100 0.107 0.110 0.110 0.114 0.128 0.147 0.121 0.157 0.108 0.121 0.119 0.134 0.114 0.103 0.103 0.101 0.110 0.107 0.107 0.105 0.112 0.177 0.128 0.170 0.170 0.174 0.149 0.146 0.147 0.154 0.155 0.152 0.173 0.165 0.152 0.120 0.055 0.064 0.057 0.072 0.054 0.084 0.062 0.069 0.043 0.066 maosonensis Megophrys 58 0.147 0.128 0.096 0.107 0.100 0.114 0.123 0.103 0.107 0.107 0.109 0.114 0.107 0.119 0.128 0.140 0.126 0.156 0.105 0.119 0.112 0.128 0.112 0.105 0.105 0.098 0.103 0.105 0.105 0.103 0.105 0.170 0.125 0.172 0.170 0.184 0.147 0.142 0.145 0.147 0.160 0.149 0.173 0.160 0.149 0.120 0.062 0.066 0.066 0.075 0.056 0.081 0.062 0.069 0.048 0.062 0.019 mangshanensis Megophrys 59 0.157 0.134 0.118 0.118 0.118 0.116 0.123 0.128 0.103 0.121 0.121 0.139 0.129 0.126 0.121 0.127 0.118 0.151 0.121 0.116 0.121 0.115 0.113 0.114 0.106 0.106 0.113 0.124 0.111 0.106 0.114 0.161 0.142 0.181 0.173 0.201 0.169 0.160 0.150 0.170 0.161 0.194 0.144 0.162 0.186 0.126 0.077 0.080 0.066 0.096 0.080 0.109 0.077 0.087 0.082 0.080 0.085 0.093 oreocrypta Megophrys 60 0.148 0.115 0.102 0.108 0.097 0.106 0.115 0.106 0.104 0.102 0.099 0.115 0.104 0.120 0.117 0.133 0.122 0.158 0.109 0.109 0.122 0.124 0.109 0.107 0.104 0.098 0.109 0.113 0.111 0.104 0.102 0.189 0.122 0.168 0.151 0.189 0.150 0.128 0.125 0.146 0.152 0.146 0.141 0.147 0.151 0.107 0.084 0.089 0.082 0.102 0.074 0.105 0.087 0.094 0.087 0.106 0.094 0.088 0.092 auralensis Megophrys cf. 61 0.149 0.112 0.101 0.103 0.098 0.100 0.109 0.105 0.096 0.105 0.098 0.103 0.108 0.116 0.114 0.131 0.112 0.150 0.110 0.108 0.103 0.125 0.105 0.101 0.103 0.101 0.103 0.117 0.112 0.107 0.105 0.186 0.126 0.165 0.153 0.194 0.159 0.137 0.124 0.141 0.142 0.136 0.122 0.125 0.129 0.110 0.075 0.078 0.075 0.088 0.069 0.110 0.072 0.070 0.083 0.092 0.095 0.089 0.080 0.056 parva Megophrys 62 0.101 0.085 0.074 0.078 0.068 0.070 0.066 0.072 0.066 0.074 0.064 0.074 0.074 0.083 0.092 0.095 0.092 0.125 0.078 0.074 0.081 0.104 0.070 0.075 0.074 0.070 0.081 0.087 0.081 0.076 0.075 0.122 0.092 0.121 0.119 0.153 0.125 0.122 0.099 0.123 0.117 0.124 0.112 0.131 0.122 0.082 0.114 0.106 0.092 0.121 0.091 0.134 0.102 0.091 0.094 0.118 0.112 0.114 0.109 0.096 0.088 shapingensis Megophrys 63 0.113 0.095 0.081 0.083 0.075 0.079 0.077 0.077 0.072 0.085 0.070 0.079 0.081 0.090 0.099 0.104 0.094 0.136 0.083 0.085 0.088 0.113 0.081 0.081 0.081 0.077 0.088 0.094 0.088 0.083 0.081 0.139 0.099 0.129 0.127 0.163 0.128 0.128 0.102 0.129 0.127 0.125 0.110 0.132 0.123 0.076 0.107 0.107 0.092 0.119 0.090 0.135 0.101 0.088 0.088 0.119 0.106 0.108 0.112 0.096 0.082 0.012 gigantica Megophrys 64 0.112 0.094 0.080 0.085 0.078 0.078 0.072 0.082 0.076 0.085 0.074 0.081 0.083 0.092 0.100 0.107 0.096 0.139 0.087 0.078 0.085 0.115 0.079 0.083 0.083 0.079 0.089 0.096 0.090 0.085 0.083 0.135 0.096 0.133 0.131 0.168 0.130 0.129 0.102 0.125 0.128 0.126 0.112 0.133 0.127 0.082 0.114 0.111 0.096 0.125 0.094 0.141 0.107 0.096 0.094 0.121 0.112 0.114 0.116 0.100 0.088 0.013 0.008 nankiangensis Megophrys 65 0.108 0.089 0.080 0.085 0.074 0.076 0.074 0.078 0.072 0.080 0.070 0.078 0.081 0.089 0.098 0.104 0.094 0.135 0.085 0.081 0.083 0.113 0.076 0.081 0.081 0.077 0.087 0.094 0.087 0.083 0.081 0.132 0.094 0.130 0.128 0.165 0.130 0.129 0.104 0.126 0.129 0.126 0.114 0.133 0.127 0.080 0.111 0.109 0.094 0.122 0.092 0.138 0.105 0.092 0.092 0.118 0.110 0.112 0.114 0.098 0.086 0.010 0.006 0.004 wawuensis Megophrys 66 0.125 0.094 0.093 0.093 0.089 0.091 0.089 0.076 0.082 0.097 0.076 0.089 0.093 0.098 0.102 0.112 0.102 0.138 0.091 0.096 0.098 0.121 0.094 0.092 0.096 0.087 0.098 0.107 0.100 0.096 0.087 0.158 0.102 0.132 0.121 0.146 0.130 0.143 0.112 0.139 0.135 0.123 0.117 0.133 0.128 0.091 0.113 0.113 0.103 0.137 0.102 0.153 0.102 0.100 0.113 0.133 0.114 0.119 0.136 0.111 0.094 0.064 0.062 0.070 0.066 carinense
67 Megophrys popei 0.168 0.121 0.121 0.118 0.115 0.115 0.118 0.100 0.109 0.129 0.100 0.115 0.121 0.130 0.130 0.115 0.133 0.141 0.121 0.124 0.127 0.121 0.124 0.122 0.127 0.115 0.130 0.143 0.134 0.127 0.109 0.162 0.133 0.162 0.150 0.147 0.151 0.167 0.134 0.147 0.140 0.149 0.120 0.150 0.156 0.098 0.127 0.127 0.118 0.134 0.121 0.150 0.127 0.124 0.139 0.148 0.137 0.140 0.148 0.129 0.119 0.082 0.079 0.090 0.085 0.010
68 Megophrys feae 0.121 0.096 0.102 0.097 0.097 0.095 0.097 0.080 0.082 0.097 0.082 0.091 0.098 0.104 0.109 0.118 0.109 0.134 0.095 0.093 0.094 0.127 0.096 0.100 0.109 0.098 0.109 0.116 0.107 0.102 0.091 0.168 0.102 0.135 0.130 0.152 0.134 0.138 0.112 0.142 0.130 0.130 0.123 0.152 0.135 0.093 0.120 0.118 0.106 0.154 0.116 0.160 0.115 0.109 0.116 0.133 0.121 0.125 0.141 0.124 0.105 0.057 0.056 0.064 0.060 0.031 0.041
Megophrys 69 0.146 0.112 0.124 0.121 0.118 0.112 0.127 0.118 0.112 0.135 0.106 0.118 0.118 0.136 0.142 0.112 0.136 0.144 0.112 0.121 0.118 0.124 0.113 0.134 0.142 0.121 0.136 0.143 0.134 0.127 0.118 0.172 0.136 0.162 0.159 0.157 0.151 0.154 0.137 0.159 0.155 0.142 0.135 0.169 0.156 0.116 0.133 0.136 0.127 0.157 0.142 0.167 0.138 0.136 0.145 0.161 0.159 0.156 0.154 0.150 0.125 0.073 0.071 0.081 0.076 0.049 0.049 0.036 chuannanensis Megophrys 70 0.114 0.098 0.102 0.111 0.098 0.100 0.100 0.091 0.085 0.093 0.085 0.100 0.102 0.100 0.116 0.127 0.115 0.137 0.096 0.102 0.102 0.130 0.091 0.096 0.102 0.096 0.104 0.105 0.100 0.096 0.094 0.161 0.109 0.135 0.126 0.146 0.134 0.133 0.118 0.144 0.144 0.141 0.133 0.155 0.132 0.100 0.125 0.133 0.113 0.147 0.111 0.146 0.126 0.111 0.115 0.138 0.109 0.116 0.144 0.131 0.116 0.064 0.064 0.070 0.066 0.068 0.090 0.066 0.084 intermedia
71 Megophrys lancip 0.187 0.153 0.143 0.155 0.148 0.140 0.129 0.145 0.146 0.135 0.148 0.151 0.153 0.166 0.168 0.182 0.179 0.215 0.141 0.145 0.161 0.188 0.153 0.156 0.163 0.151 0.151 0.151 0.151 0.153 0.154 0.237 0.163 0.180 0.177 0.197 0.190 0.176 0.157 0.182 0.166 0.178 0.172 0.172 0.183 0.161 0.173 0.176 0.171 0.212 0.158 0.227 0.160 0.165 0.161 0.181 0.164 0.164 0.180 0.140 0.162 0.156 0.165 0.163 0.163 0.156 0.178 0.158 0.188 0.150
Megophrys 72 0.144 0.130 0.112 0.123 0.116 0.128 0.119 0.116 0.112 0.121 0.116 0.133 0.126 0.135 0.130 0.165 0.151 0.188 0.119 0.130 0.135 0.172 0.124 0.135 0.124 0.126 0.126 0.133 0.126 0.123 0.124 0.192 0.149 0.157 0.158 0.178 0.157 0.166 0.129 0.187 0.178 0.172 0.158 0.163 0.183 0.148 0.150 0.163 0.153 0.191 0.135 0.184 0.137 0.144 0.139 0.163 0.150 0.146 0.157 0.135 0.133 0.123 0.129 0.135 0.132 0.132 0.165 0.132 0.175 0.127 0.142 montana
73 Megophrys aceras 0.160 0.152 0.137 0.142 0.132 0.139 0.149 0.137 0.132 0.140 0.132 0.140 0.135 0.140 0.150 0.169 0.150 0.204 0.133 0.133 0.152 0.179 0.126 0.129 0.140 0.131 0.138 0.140 0.143 0.138 0.135 0.203 0.157 0.192 0.185 0.197 0.184 0.181 0.148 0.157 0.155 0.160 0.157 0.155 0.136 0.145 0.150 0.153 0.142 0.170 0.130 0.173 0.137 0.133 0.121 0.158 0.133 0.129 0.156 0.114 0.101 0.106 0.109 0.115 0.110 0.119 0.144 0.133 0.156 0.130 0.169 0.150 Table S5 Diagnostic characters separating Megophrys jiangi sp. nov. from other 91 species of the Megophrys sensu lato.
SVL "Toes. at least Horn-like one-fourth tubercle at webbed (+++), at "Tongue. notched edge of upper Lateral fringes most one-fourth Vomerine teeth. (++), feebly eyelidlong. point on toes. wide webbed (++), No. Species present (+), or notched Male Female (+++); slightly (++), narrow (+), with absent (–) (+), or not large (++), small lacking (–) rudimentary notched (–)" (+), absent or webbing (+), or indistinct (–) without webbing (–)" Megophrys 1 27.1–33.0 (10) 28.1–33.6 (4) ++ – – + + aceras Megophrys 2 27.1–33.0 28.1–33.6 ++ – – + + acuta Megophrys 3 39.1–45.0 48.9 + + + or – + + or ++ ancrae Megophrys 4 76.7 / + – – + + auralensis Megophrys 5 41–45 54–70 + + / + + baluensis Megophrys 6 42.0–45.0 (5) / + – + – – baolongensis Megophrys 7 32.0–36.0 (4) 40.2–42.5 (2) – – + or – ++ + binchuanensis Megophrys 8 45.1–51.0 (3) / – – + / + binlingensis Megophrys 9 34.5–37.8 (20) 39.7–46.8 (10) + – + ++ + boettgeri Megophrys 10 33.7–39.3 (5) 33.9–45.9 (2) + – – – + brachykolos Megophrys 11 92–123 137 ++ + ++ carinense Megophrys 12 81.3 (1) / ++ + – / + caudoprocta Megophrys 13 26.2–29.5 31.8–34.1 + – ++ ++ + cheni Megophrys 14 91–109 / ++ + / ++ + chuannanensis Megophrys 15 57.1 69.1 – + ++ – + damrei Megophrys 16 34.0–37.0 (18) 40.0–46.0 (3) + + / – – daweimontis Megophrys 17 30.2–39.3 (9) / + + – – + dongguanensis Megophrys 18 26.2–29.5 (15) 31.8–34.1 (3) + – ++ ++ + dringi Megophrys 19 39–42 69–82 + – / / / edwardinae Megophrys 20 26.9–33.9 (29) 35.1–36.5 (6) + – – + + elfina Megophrys 21 30.9–44.3 (13) 41.7–42.5 (2) + + + – – fansipanensis Megophrys 22 78–102 91–1114 ++ + / – + feae
23 Megophrys feii 24.3–25.1 (4) 28.2–28.9 (2) + – + ++ +
Megophrys 24 56.9–68.4 (4) 68.0–74.6 (3) + + ++ + + flavipunctata Continued Table S5
SVL "Toes. at least Horn-like one-fourth tubercle at webbed (+++), at "Tongue. notched edge of upper Lateral fringes most one-fourth Vomerine teeth. (++), feebly eyelidlong. point on toes. wide webbed (++), No. Species present (+), or notched Male Female (+++); slightly (++), narrow (+), with absent (–) (+), or not large (++), small lacking (–) rudimentary notched (–)" (+), absent or webbing (+), or indistinct (–) without webbing (–)"
25 Megophrys gerti 32–34.8 (2) 41.4–45.8 (2) ++ – / / –
Megophrys 26 80.5–107.0 110.4–115.4 – – ++ ++ + gigantica Megophrys 27 76.0–81.0 77.0–100.0 + + + ++ + glandulosa Megophrys 28 35.3–43 (8) 53.5 ++ – – / – hansi Megophrys 29 68.0–73.5 (7) 83.9 + + / – ++ himalayana Megophrys 30 37.4–47.6 (11) 59.6 + + + – – hoanglienensis Megophrys 31 36.0–41.6 (4) 44.2 + – + – – huangshanensis Megophrys 32 36.8–41.2 (5) 47.1 + + + – + insularis Megophrys 33 / / ++ + / ++ / intermedia Megophrys 34 53.0–56.5 (3) 63.5 + + + ++ +++ jingdongensis Megophrys 35 35.1–36.7 (2) 38.4–41.6 (3) ++ + – + + jinggangensis Megophrys 36 30.4–33.9 (9) 34.1–37.5 (2) + + + – + jiulianensis Megophrys 37 99 109 / + / / / kobayashii
38 Megophrys koui / / ++ / / – –
Megophrys 39 26.2–29.6 (13) 37.4 + – + + – kuatunensis Megophrys 40 37.9–47.7 (2) 38.7–82.5 (4) ++ + – / + lancip Megophrys 41 38.9 (1) / ++ + – ++ + latidactyla Megophrys 42 30.4–38.7 (10) 42.3 (2) + – – – + leishanensis Megophrys 43 55.6–66.6 71.8–94.0 + + – – + lekaguli Megophrys 44 34.7–67.7 (5) 60.8–70.6 (8) +++ + + ++ + liboensis Megophrys 45 60 90 + + / / / ligayae
46 Megophrys lini 34.1–39.7 (20) 37.0–39.9 (4) + – – ++ +
Megophrys 47 30.7–34.7 (13) 36.9–40.4 (3) + – – – – lishuiensis Megophrys 48 47.0 65.0 + + + / + longipes Continued Table S5
SVL "Toes. at least Horn-like one-fourth tubercle at webbed (+++), at "Tongue. notched edge of upper Lateral fringes most one-fourth Vomerine teeth. (++), feebly eyelidlong. point on toes. wide webbed (++), No. Species present (+), or notched Male Female (+++); slightly (++), narrow (+), with absent (–) (+), or not large (++), small lacking (–) rudimentary notched (–)" (+), absent or webbing (+), or indistinct (–) without webbing (–)"
49 Megophrys major 34.5–41.2 (4) / – – + – +
Megophrys 50 62.5 73 + + + – – mangshanensis Megophrys 51 / / / + + + / maosonensis Megophrys 52 57.2–68.0 / + + + – + or – medogensis Megophrys 53 45.9–53.4 64.4 – + – – + megacephala Megophrys 54 28–36 47–49 ++ – / – – microstoma
55 Megophrys minor 32.2–40.5 42.0–48.2 + – + – +
Megophrys 56 38.1–53.9 45.7–99.5 ++ + / / / montana Megophrys 57 / 40.5 / / / / / monticola Megophrys 58 30.1–30.8 (2) 36.3 (2) + – – + + mufumontana Megophrys 59 / 44.0–52.9 – – + + + nankiangensis Megophrys 60 29.9–34.9 (11) 39.4–41.9 (2) + + – – + nankunensis Megophrys 61 30.5–37.3 (10) / + + + + + nanlingensis
62 Megophrys nasuta 69.3–97.5 45.9–134.6 ++ + / / /
63 Megophrys obesa 35.6 (1) 37.5–41.2 (6) + – – – +
Megophrys 64 27.4–34.5 (5) 32.8–35.0 (4) + – – – – ombrophila Megophrys 65 56.0–59.5 (10) 68.0–72.5 (3) + + + + + omeimontis Megophrys 66 / 94.9 + + / – ++ oreocrypta Megophrys 67 32.8–39.2 44.1–48.7 – + + – – oropedion Megophrys 68 35.3–36.2 35.8 – + + – – pachyproctus Megophrys 69 36.2–38.0 (2) / ++ + – ++ +++ palpebralespinosa Megophrys 70 37.7–46.3 (6) 35.5–58.3 (2) + + – / parallela
71 Megophrys parva 37.0–44.0 45.0–54.0 + + – – + or –
Megophrys 72 71.3–93.8 (12) 112 (1) + + / – + periosa Continued Table S5
SVL "Toes. at least Horn-like one-fourth tubercle at webbed (+++), at "Tongue. notched edge of upper Lateral fringes most one-fourth Vomerine teeth. (++), feebly eyelidlong. point on toes. wide webbed (++), No. Species present (+), or notched Male Female (+++); slightly (++), narrow (+), with absent (–) (+), or not large (++), small lacking (–) rudimentary notched (–)" (+), absent or webbing (+), or indistinct (–) without webbing (–)"
73 Megophrys popei 70.7–83.5 (13) 86.2 ++ + ++ + +++
Megophrys 74 / 114.0 / + + / + robusta Megophrys 75 26.7–30.5 (8) / + + + + – rubrimera Megophrys 76 54.7 (1) / + + + + + sangzhiensis Megophrys 77 37.1 / / + / / + serchhipii Megophrys 78 66.0–84.0 77.0–104.0 – – + ++ +++ shapingensis Megophrys 102.0–118.3 79 99.8–115.6 (6) ++ – + ++ +++ shuichengensis (7) Megophrys 80 47.2–54.4 (18) 54.0–55.0 (2) – – + ++ +++ spinata Megophrys 81 / / ++ + / / / stejnegeri Megophrys 82 / / ++ / / / / synoria Megophrys 83 47.3–53.0 72.9 – + – – + takensis Megophrys 84 33.2–39.6 (9) 50.5 + or – – – – + tuberogranulata Megophrys 85 27.5–30.6 / + – + + + vegrandis Megophrys 86 34.4–42.8 47.0–49.8 – – + – + wawuensis Megophrys 87 31.0–34.1 (4) 38.5–42.8 (9) + – – – + wugongensis Megophrys 88 27.3–31.6 (10) 41.0–41.5 (2) – – + or – – – wuliangshanensis Megophrys – (in female), 89 30.4–35.5 (10) 38.4 – – – + wushanensis ++ (in male) Megophrys 90 32.5–37.2 / – + + + – zhangi Megophrys 91 30.0 39.0 / + / / / zunhebotoensis