N-Acetyl-L-Aspartyl-L-Glutamate Peptidase-Like 2 Is Overexpressed in Cancer and Promotes a Pro-Migratory and Pro-Metastatic Phenotype

ORIGINAL ARTICLE N-acetyl-L-aspartyl-L-glutamate peptidase-like 2 is overexpressed in cancer and promotes a pro-migratory and pro-metastatic phenotype

HC Whitaker1,2,8, LL Shiong1,8,JDKay1, H Gro¨ nberg3, AY Warren4,5, A Seipel6, F Wiklund3, B Thomas1, P Wiklund6, JL Miller4,5, S Menon7, A Ramos-Montoya1, SL Vowler7, C Massie1, L Egevad6 and DE Neal1

N-acetyl-L-aspartyl-L-glutamate peptidase-like 2 (NAALADL2) is a member of the glutamate carboxypeptidase II family, best characterized by prostate-specific membrane antigen (PSMA/NAALAD1). Using immunohistochemistry (IHC), we have shown overexpression of NAALADL2 in colon and prostate tumours when compared with benign tissue. In prostate cancer, NAALADL2 expression was associated with stage and Grade, as well as circulating mRNA levels of the NAALADL2 gene. Overexpression of NAALADL2 was shown to predict poor survival following radical prostatectomy. In contrast to PSMA/NAALAD1, NAALADL2 was localized at the basal cell surface where it promotes adhesion to extracellular matrix proteins. Using stable knockdown and overexpression cell lines, we have demonstrated NAALADL2-dependent changes in cell migration, invasion and colony-forming potential. Expression arrays of the knockdown and overexpression cell lines have identified nine genes that co-expressed with NAALADL2, which included membrane proteins and genes known to be androgen regulated, including the prostate cancer biomarkers AGR2 and SPON2. Androgen regulation was confirmed in a number of these genes, although NAALADL2 itself was not found to be androgen regulated. NAALADL2 was also found to regulate levels of Ser133 phosphorylated C-AMP-binding protein (CREB), a master regulator of a number of cellular processes involved in cancer development and progression. In combination, these data suggest that changes in expression of NAALADL2 can impact upon a number of pro-oncogenic pathways and processes, making it a useful biomarker for both diagnosis and prognosis.

Oncogene (2014) 33, 5274–5287; doi:10.1038/onc.2013.464; published online 18 November 2013 Keywords: NAALase; prostate cancer; colon cancer; prognostic; biomarker

INTRODUCTION characterized by mental handicap, growth retardation, distinctive 9 The N-acetyl-L-aspartyl-L-glutamate peptidase I (NAALADase) facial features and limb defects. family, also known as glutamate carboxypeptidase II and Prostate cancer is the most common male solid malignancy 10 N-acetylaspartylglutamate (NAAG) peptidase, are characterized diagnosed in men in the United Kingdom. Risk stratification by their ability to act as M28 membrane metalloproteases and of this heterogeneous disease is currently carried out using catalyse the hydrolysis of NAAG to glutamate and N-acetylaspar- predictive models based on clinical variables such as age, disease tate.1,2 The best characterized member of the NAALADase family stage, Gleason grade and serum prostate-specific antigen (PSA) 11–13 is prostate-specific membrane antigen (PSMA) that was identi- measurements. Although these predictive tools are practical fied in the prostate cancer LNCaP cell line and subsequently and convenient, they may not be able to identify all patients at characterized as a prostate cancer biomarker and drug target.3–5 risk of disease progression, relapse or those low-risk patients most Studies on PSMA/NAALAD1 have shown that NAALADase activity suitable for surveillance. Although there are large numbers of relies upon an active site glutamic acid residue (E424) and zinc potential molecular biomarkers in the literature, only PSA, and to binding for its enzymatic function. However, calcium binding and some extent PCA3, is used routinely to assist in diagnosis despite glycosylation at amino acids distant to the active site have also their sub-optimal sensitivity and specificity.14,15 Unlike PCA3, PSA been shown to maintain the protein structure and regulate has shown some promise in predicting aggressive disease and NAALADase activity.1,6,7 Previously, the NAALADL2-associated relapse following treatment, but this remains an area of prostate rs17531088 risk allele has been linked to Kawasaki disease that research where novel markers could significantly impact on affects the blood vessels and can lead to death.8 NAALADL2 was clinical decisions.16,17 also identified as the site of a break point leading to Cornelia de We describe the expression and oncogenic properties of Lange syndrome, a rare developmental malformation syndrome NAALADL2, the least studied of the NAALADases. We demonstrate

1Uro-Oncology Research Group, Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK; 2Cancer Research UK Biomarker Initiative, Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK; 3Department of Medical Epidemiology and Biostatistics, Karolinska Institute, Stockholm, Sweden; 4Department of Histopathology and ISH Core Facility, Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK; 5Department of Histopathology, Cambridge University Hospitals NHS Foundation Trust, Cambridge, UK; 6Department of Pathology, Karolinska Institute, Stockholm, Sweden and 7Bioinformatics Core Facility, Cancer Research UK Cambridge Institute, University of Cambridge, Robinson Way, Cambridge, UK. Correspondence: Dr HC Whitaker, Cancer Research UK Biomarker Initiative, Cancer Research UK Cambridge Institute, University of Cambridge, Robinson Way, Cambridge CB2 0RE, UK. E-mail: [email protected] 8These authors contributed equally to this work. Received 30 April 2013; revised 27 August 2013; accepted 16 September 2013; published online 18 November 2013 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5275 that NAALADL2 protein is expressed in a number of cancers and benign and tumour tissue (P ¼ 0.05 using a cutoff X weak staining) highly expressed in prostate cancer where it predicts for relapse (Figure 1b). There were insufficient numbers to establish links to following radical prostatectomy. We show that unlike PSMA/ other prognostic factors. NAALAD1,which is expressed at the apical membrane, NAALADL2 NAALADL2 overexpression in prostate cancer was confirmed is localized to the basal membrane where it promotes invasion, using a (Cambridge) TMA, and could distinguish between benign migration and alters the ability of cells to bind to components of and tumour tissue with a high degree of sensitivity and specificity the extracellular matrix. Using expression arrays of stable over- (sensitivity, 86%, specificity 86%, Po0.0001 using a cutoff X expressing and knocked-down NAALADL2, we have shown that moderate staining, Figure 1c). This was supported by an additional NAALADL2 is co-expressed alongside known androgen-regulated radical prostatectomy TMA in collaboration with the Karolinska genes and known prostate cancer biomarkers. We believe that Institute that confirmed that NAALADL2 could differentiate NAALADL2 may have a role in establishing a pro-oncogenic and between benign and tumourigenic prostate tissue (Po0.0001, aggressive tumour microenvironment. Figure 1d). Using the Cambridge TMA, NAALADL2 expression was shown to increase significantly with increasing Gleason grade (P ¼ 0.028, Figure 1e) and pathological stage (P ¼ 0.004, Figure 1f), RESULTS in particular between pT2 (organ confined) and pT3 (locally advanced) disease (P ¼ 0.0018). We also determined the levels of NAALADL2 is overexpressed in cancer tissues circulating NAALADL2 RNA found in the peripheral blood and Using paraffin-embedded cell pellets to establish antibody found a significant increase in patients with biopsy confirmed specificity (Supplementary Figure S1), NAALADL2 IHC was prostate cancer compared with those with a raised PSA but developed and used to stain a multi-tumour/normal tissue negative biopsy who were assumed to be largely benign microarray (TMA) (Table 1). In all tissue types that stained positively, (Figure 1g). NAALADL2 expression was noted at the basal cell surface and in the perinuclear region, consistent with the Golgi (Figures 1a and 3a). The majority of normal tissues showed weak or undetectable NAALADL2 overexpression predicts poor survival NAALADL2 expression with the exception of moderate staining in As NAALADL2 was particularly highly expressed in locally the kidney and stomach. There was low expression in a number of advanced disease compared with organ-confined disease, we tumour tissues, and moderate expression was seen in tongue, investigated whether NAALADL2 expression correlated with pancreas and breast cancers. NAALADL2 was highly overexpressed biochemical recurrence. Using the Cambridge TMA, it was found in colon and prostate cancers. NAALADL2 overexpression in that 38/104 patients had biochemical recurrence but despite tumours was confirmed using commercially available TMAs for showing a trend that higher expression leads to poorer prognosis, colon, breast and pancreatic cancers with only NAALADL2 in colon it was not statistically significant, probably because of the small cancer showing any significant ability to distinguish between cohort size (P ¼ 0.56, Supplementary Figure S2A). Using the

Table 1. Scoring of NAALADL2 expression in the multi-normal/tumour TMA

Tissue Cancer type Normal tissue score Tumour tissue score

Brain Glioblastoma multiforme — À / À Oesophagus Squamous cell carcinoma — 1 þ /1 þ Larynx Invasive squamous cell carcinoma — À / À Hypopharynx Squamous cell carcinoma — À / À Liver Hepatocellular carcinoma 1 þÀ/ À Thyroid Papillary carcinoma 1 þÀ/ À Soft tissue Lymphoma — À / À Skin Squamous cell carcinoma 1 þÀ/ À Tongue Squamous cell carcinoma Missing 2 þ /2 þ Tonsil Squamous cell carcinoma 1 þ 1 þ /1 þ Lung Squamous cell carcinoma 1 þ (macrophages only) À / À Lung Adenocarcinoma 1 þ (macrophages only) 1 þ /1 þ Pancreas Adenocarcinoma 2 þ 2 þ /2 þ Pancreas Adenocarcinoma 1 þ 2 þ /2 þ Colon Adenocarcinoma 1 þ 3 þ /3 þ Colon Adenocarcinoma 1 þ 1 þ /1 þ Stomach Adenocarcinoma 1 þ 1 þ / À Stomach Signet ring cell carcinoma 2 þ 1 þ /1 þ Kidney Renal cell carcinoma 2 þÀ/ À Kidney Renal cell carcinoma 2 þÀ/ À Paratoid Gland Squamous cell carcinoma 1 þÀ/ À Ovary Yolk sac tumour — À /1 þ Cervix Adenocarcinoma — À /1 þ Cervix Squamous cell carcinoma — À / À Breast Ductal cell carcinoma 1 þ 2 þ /2 þ Breast Ductal cell carcinoma 1 þ 1 þ /2 þ Prostate Adenocarcinoma 1 þ 3 þ /3 þ Prostate Adenocarcinoma 1 þ 2 þ /3 þ Testis Seminoma — À / À Thymus Thymoma — À / À

Abbreviations: NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2; TMA, tissue microarrays. No staining ¼À, weak ¼ 1 þ , moderate ¼ 2 þ and strong staining ¼ 3 þ .

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5276 Karolinska TMA that had a larger cohort and longer follow-up this data, Kaplan–Meier curves were generated showing that low leading to greater number of recurrence events (101/252), we NAALADL2 expression, that is, an immunoreactivity product (IRP) demonstrated that increased NAALADL2 expression was able to of o3 79.9% of patients had no relapse at 5 years (Figure 2b). predict for recurrence (P ¼ 0.0021, Figure 2a and Table 2). Using Five-year recurrence-free survival was reduced to 72.5% (IRP

a b 100% 90% 80% 70% 60% Strong 50% Moderate 40% Weak Percentage 30% None p = 0.05 20% Using a cut-off ≥ weak 10% Sensitivity - 91% Specificity - 17% 0% Benign Tumour PPV - 87% NPV - 20% n= 6 43 c 100% d p<0.0001 90% 80% 70% 60% Strong 50% Moderate 40% Weak Percentage 30% None 20% p<0.0001 Using a cut-off ≥ moderate 10% Sensitivity - 86% 0% Specificity - 86% Benign Tumour PPV - 93% n= 28 28 n= 222 511 NPV - 72%

f p=0.018 e 100% 100% 90% 90% 80% 80% 70% 70% 60% Strong 60% Strong 50% Moderate Moderate 40% Weak 50%

Percentage Weak 30% None 40% Percentage None 20% p=0.028 30% p=0.004 10% 20% 0% 10% G3 G4 G5 n= 324168 19 0% pT2 pT3 pT4 n= 224188 5 g p=0.0045

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5277 43o5) and 65.3% (IRP 45), as NAALADL2 expression increased signiﬁcantly lower 5-year survival (93% (low expression) versus and had a hazard ratio (HR) of 1.9 (P ¼ 0.0038). This result was 45% (high expression); P ¼ 0.015) (Figure 2c). signiﬁcant even when the HR was adjusted for age, Gleason score, extraprostatic extension, positive surgical margin, seminal vesicle invasion, clinical stage and preoperative PSA (HR 1.7 (P ¼ 0.036)). NAALADL2 is localized to the basal cell surface and promotes cell Using microarray data published by Taylor et al.18, we examined adhesion, migration and invasion the ability of NAALADL2 to predict poor survival in low-risk The localization of NAALADL2 to the basal cell surface was in patients (all primary T2 tumours with a low Gleason (5–6)) and marked contrast to the apical membrane localization of PSMA/ showed that patients with high NAALADL2 expression had a NAALAD1 (Figure 3a). Using confocal microscopy of the LNCaP

a b 1.0

8 0.8

6 0.6

4 0.4

IRP<3 0.2 3

0.0 0 p=0.011 0 20 40 60 80 100 120 140 Non-recurrence Recurrence Time since operation (months)

c NAALADL2 - NM_207015, p= 0.015 1.0

0.8

0.6

0.4

biochemical recurrence 0.2 Probability of freedom from

NAALADL2 > 8.51 n=10 0.0 NAALADL2 <= 8.51 n=51 p=0.015 0 2 4 6810 Time to biochemical recurrence (years) Figure 2. Overexpression of NAALADL2 predicts for decreased survival. (a) NAALADL2 staining of the Karolinska TMA was correlated with biochemical recurrence or non-recurrence following radical prostatectomy. Box plots represent the 25 and 75% quartile with the line representing the median IRP value. (b) The IRP index was categorized into three groups (0–3, 3–5 and 45) with the lowest category used as reference group and time-to-event analysis used as the outcome to generate Kaplan–Meier curves. (c) NAALADL2 expression was also examined in a previously published data set in low-risk patients (all primary T2 tumours with a low Gleason (5–6))18 and Kaplan–Meier curves generated using Galaxy.

Figure 1. NAALADL2 can distinguish tumour from benign tissue. (a) NAALADL2 IHC shows that the protein is distributed at the basal cell surface in contact with the extracellular matrix in colon tumours. (b) Overexpression of NAALADL2 in colon tumours was confirmed using a small commercial TMA. A cutoff of greater than or equal to weak staining was used to calculate sensitivity, specificity, PPV and NPV. P-values were calculated using a two-tailed t-test. n ¼ the number of cores examined. (c) NAALADL2 expression in prostate tissue was also ascertained by IHC using a TMA made in Cambridge. Sensitivity, specificity, PPV and NPV were calculated using a greater than or equal to moderate cutoff. P-values were calculated using a two-tailed t-test. n ¼ the number of distinct regions examined. (d) Results were confirmed using an independent TMA from the Karolinska Institute. IRP represents IRP. n ¼ the number of patients. P-values were calculated using a two-tailed t-test. (e) Data from the Cambridge TMA was stratified by Gleason grade (G3–G5). n ¼ the number of distinct regions examined. P-values were calculated using a Kruskal–Wallis test. (f) Data from the Cambridge TMA was also stratified by pathological stage pT2 (organ confined), pT3 (localized spread to seminal vesicles), pT4 (spread to adjacent organs, for example, bladder and more distant metastases). N and P-values were calculated as for Gleason grade. (g) Whole blood was collected from patients using the PAXgene system to allow the isolation of circulating RNA that was analysed by qPCR for circulating NAALADL2 RNA. P-values were calculated using a two-tailed t-test.

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5278 prostate cancer cell line stably overexpressing NAALADL2, we NAALADL2 is co-expressed with androgen-regulated genes were able to show that NAALADL2 is localized to the plasma To establish the role of NAALADL2 in prostate cells, the RNA from membrane (Figure 3b, upper panel), and in particular to the LNCaP stable cell lines were analysed using expression arrays leading edge of cellular extensions (Figure 3b, lower panel). The (Figures 4a and b). The LNCaP-NAALADL2-overexpressing cells sub-cellular location of NAALADL2 expression led us to hypothe- showed gene enrichment ligands, kinases and transcription size that NAALADL2 overexpression may encourage cancer factors (Table 3). Pathway analysis showed that the overexpression progression by promoting the interaction and movement of of NAALADL2 led to alterations in pathways including epithelial- tumour cells through the extracellular matrix surrounding to-mesenchyme transition, cell adhesion, cytoskeletal remodelling, tumourigenic prostate glands. immune response and apoptosis (Figure 4b, Table 4). Data from To investigate this hypothesis, two cell lines were generated the LNCaP-siNAALALD2 and LNCaP-NAALAADL2 stable cells was based upon the endogenous expression of NAALADL2; in LNCaP analysed to identify reciprocally differentially regulated genes cells, in which NAALADL2 expression is low, NAALADL2 was stably (which went up in the overexpressing cell lines and down in the overexpressed (LNCaP-NAALADL2 or LNCaP-empty vector (EV)), knockdown cells or vice versa). In total, nine genes were found to and in LNCaP-BIC cells, in which NAALADL2 expression is high, be reciprocally regulated with seven genes that overexpressed NAALADL2 was stably knocked down (LNCaP-BIC-siNAALADL2 or when NAALADL2 was overexpressed, and two genes showed LNCaP-BIC-non-targeting (NT) small interfering RNA (siRNA)). reduced expression when NAALADL2 was overexpressed Changes in expression were confirmed by western blotting, (Figures 4a and c and Table 5). The majority of these genes quantitative PCR (qPCR) and IHC (Supplementary Figure S1). expressed proteins that were secreted or localized to the membrane As NAALADL2 was expressed on the basal cell surface, we (Figure 4d). Of these nine co-expressed genes, the expression investigated if overexpressing or knocking down NAALADL2 of 7/9 could be validated by qPCR (Figure 4e). Of these, AGR2 and expression would alter binding to extracellular matrix proteins Spondin 2 are known as prostate cancer biomarkers.19–23 Using IHC using a cell adhesion assay. When NAALADL2 was overexpressed, on human prostate tissue, we were able to show that AGR2 cells showed significantly increased adhesion to collagen and and NAALADL2 were overexpressed in the same tumour cells fibrinogen but not fibronectin or laminin (Figure 3c, upper panel). (Figure 5a). When NAALADL2 expression was reduced, cells adhered less well Of the reciprocally identified genes identified all those confirmed to fibronectin and fibrinogen, although only fibronectin was by qPCR have been shown to be androgen regulated (Table 5). statistically significant (P ¼ 0.017) (Figure 3c, lower panel). Over- Androgen regulation of the co-expressed genes was confirmed by expression of NAALADL2 significantly enhanced cell migration treating LNCaP cells with the synthetic dihydrotestosterone, R1881, and invasion in LNCaP stable cell lines (Figures 3d and e and performing qPCR after 6, 18, 24 and 28 h (Figure 5b and respectively), whereas knocking down NAALADL2 expression Supplementary Figure S3A). We demonstrated strong upregulation resulted in a significant decrease. of AGR2 in response to androgen, whereas weaker responses were The effect of NAALADL2 in transforming cells using a soft agar seen for SPON2 and HSPA5. HRPDL, MMP7, HN1 and XAGE1B colony-forming assay was also investigated. LNCaP-NAALADL2 cells showed downregulation in response to androgen treatment. These formed significantly more colonies, whereas NAAL-BIC-siNAALADL2 data were supported by previously published data from our group cells had a significant reduction in colony-forming ability (Figure 3f), (Supplementary Figure S3B).24 NAALADL2 showed no evidence of suggesting that NAALADL2 may confer some transforming ability. androgen regulation. The NAALADL2-co-expressed gene, HN1,has

Table 2. Raised NAALADL2 expression in the Karolinska TMA can predict for recurrence following radical prostatectomy

IRP No. No. recurrence (%) HR (95% CI) HRa (95% CI) 5-year recurrence-free survival (95% CI)

o3 56 15 (26.8) 1.0 (ref) 1.0 (ref) 79.9 (69.9 to 91.3) 3–5 72 30 (41.7) 1.6 (0.9, 3.0) 1.5 (0.8, 2.9) 72.5 (62.6 to 83.9) 45 124 56 (45.2) 1.9 (1.1, 3.4) 1.7 (0.9, 3.1) 65.3 (57.1 to 74.7) Trend test 0.0038 0.036

Abbreviations: CI, conﬁdence interval; HR, hazard ratio; IRP, immunoreactivity product; NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2; PSA, prostate-speciﬁc antigen; TMA, tissue microarrays. Each core was scored by intensity and proportion of cancer cells stained on the scale 0–3. Average values of the three intensity and proportion scorings were calculated to give average intensity and proportion values. These values were then multiplied to give the IRP. aHazard ratio adjusted for age, Gleason score, extraprostatic extension, positive surgical margin, seminal vesicle invasion, clinical stage and preoperative PSA.

Figure 3. NAALADL2 overexpression increases cell adhesion, migration, invasion and colony-forming potential. (a) IHC for NAALADL2 (upper panel) and PSMA (lower panel). Black arrowheads indicate tumour glands, whereas white arrowheads indicate benign glands. Staining is shown in brown for both with nuclei counterstained with hematoxylin (blue). (b) LNCaP cells were stained for NAALADL2 (green) and actin (blue), and imaged by confocal microscopy. White arrowheads indicate membranous staining (upper panel) and staining at the cellular extremities (lower panel). (c) Cell adhesion to a number of different extracellular matrix proteins was determined using a cell adhesion assay and stably overexpressing or knockdown cell lines. The upper panel demonstrates cell adhesion in the LNCaP-EV cells (white bars) and LNCaP- NAALADL2-overexpressing cells (grey bars). In the lower panel, LNCaP-BIC-NT siRNA cells (white bars) and LNCaP-BIC-siNAALADL2 cells (grey bars) are shown. (d) Cell migration was determined using a CytoSelect 96-well cell migration fluorometric assay containing Boyden chambers with 8 mm pores. Media containing 10% foetal bovine serum was the chemoattractant. Chambers were loaded with 1.5 Â 105 cells of each stable cell line in serum-free media for 24 h. (e) Cell invasion was assayed using the CytoSelect 96-well cell invasion fluorometric assay using Boyden chambers fitted with an 8-mm pore overlayed with rehydrated extracellular matrix and media containing 10% foetal bovine serum as a chemoattractant. Chambers were loaded with 1.5 Â 105 cells in serum-free media and incubated at 37 1C for 24 h. (f) The ability of the LNCaP stable cell lines to form colonies in soft agar was assayed using the CytoSelect 96-well soft agar colony formation cell transformation Assay was inoculated with 1250 cells and grown for 7 days. Agar was melted and CyQuant GR-stained cells were measured using a 480/520-nm filter. For all assays, P-values were calculated using a two-tailed t-test between control and knockdown or overexpression cell lines.

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5279 been shown to regulate androgen receptor (AR) and activation of array, we looked for changes in members of the MAPK pathway the MAPK pathway.25 Previously, HNRPL has been shown to be (Figure 5c). This identiﬁed an upregulation of Ser133 phospho-CREB, upregulated in castrate-resistant prostate cancer shown to activate a protein known to be involved in cancer cell proliferation, survival the epidermal growth factor receptor.26 Using a MAPK protein and migration, in NAALADL2 overexpressing cells, and the

a NAALADL2 b

e p=0.0078 p=0.048 40000 c 35000 50000 * 30000 45000 * p>0.05 25000 40000 * *** ** p=0.038 35000 ** 20000 30000 *** p=0.021 15000 25000 Empty vector 20000 10000

15000 Fluorescence units 5000 10000 NAALADL2

Fluorescence units 5000 overexpression 0 0

LNCaP LNCaP-BIC 40000 ** * 35000 f p=0.0071 p=0.0017 30000 * * * p>0.05 45000 25000 ** p=0.017 40000 20000 35000 15000 Non-targetting 30000 10000 siNAALADL2 25000 Fluorescence units 5000 20000 0 15000 10000 Fluorescence units 5000 0

d p=0.0009 p=0.0008 200000 175000 LNCaP LNCaP-BIC 150000 125000 100000 75000 50000

Fluorescence units 25000 0

LNCaP LNCaP-BIC

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5280 extracellular matrix proteins (Figure 3c). Cells expressing higher Table 3. Gene enrichment by function was performed using GeneGo levels of NAALADL2 also showed increased invasion and migra- Metacore on expression array data from LNCaP cells stably transfected tion, with reciprocal changes in the knockdown cell line with either empty vector or an NAALADL2 overexpression construct (Figures 3d and e). Similar changes were also seen in colony- Protein class Actual Expected Ratio P-value z-score forming ability, with overexpressing cells more able to have anchorage-independent growth (Figure 3f). Taken together, these Ligands 16 10.52 1.521 0.06499 1.726 results suggest that increases in NAALADL2 expression in tumour Kinases 20 13.2 1.515 0.0444 1.916 cells could promote an interaction with the extracellular matrix Transcription 26 19.36 1.343 0.07957 1.555 surrounding the tumour glands and provides a potential factors mechanism for cells to escape the prostatic capsule and Phosphatases 6 4.643 1.292 0.3207 0.6392 metastasize.33–35 This would be consistent with an increased Proteases 13 11.32 1.148 0.3456 0.5087 recurrence following radical prostatectomy that would have Enzymes 58 55.03 1.054 0.3548 0.4291 Receptors 29 31.87 0.9098 0.3379 À 0.5318 required cells to have breached the surgical margins (Figure 2b and Table 2). Abbreviation: NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2. To elucidate cellular function of NAALADL2 in tumours, Only differentially expressed genes with a P-value of o1 Â 10 À 3 were used expression arrays were performed on LNCaP-overexpressing in the analysis. Actual is the number of network objects in the data set for stable cell lines (LNCaP-NAALADL2), showing changes to epithe- the given protein class. Expected ¼ the mean value for hypergeometric lial-to-mesenchyme transition and cell adhesion pathways distribution. The ratio is (actual/expected). The z-score is ((actual- expected)/sqrt(variance)). (Table 4). Using the LNCaP knockdown and overexpression stable cell lines (LNCaP-BIC-siNAALADL2 and LNCaP-NAALADL2), genes that showed reciprocal changes in expression in the reciprocal decrease in the knockdown cells that was validated by knockdown and overexpression cell lines were identified 27 western blot analysis (Figure 5d). (Figure 4). These genes included a number of androgen-regulated genes and known cancer biomarkers including AGR2 that is known to promote proliferation and metastases in a number of DISCUSSION cancers, including prostate, where blood and urine tests have The NAALADase protein family are therapeutically interesting due been developed for its diagnostic and prognostic use to their ability to act as matrix metalloproteases and alter the (Figure 5b).19–21,36,37 We were able to show that tumour cells tumour microenvironment.1 This is exemplified by PSMA/ overexpressing AGR2 also showed raised levels of NAALADL2, NAALAD1, a prostate cancer biomarker currently under confirming its role as a diagnostic biomarker (Figure 5a). SPON2 investigation as a drug target and imaging tool.5,28–30 We has recently been published as a specific marker of prostate identified NAALADL2 as being overexpressed in a number of cancer that has previously been shown to have diagnostic utility in tissues similar to PSMA/NAALAD1; however, unlike PSMA/ other cancer types, and is also known to promote cell migration NAALAD1, we also saw expression in colon tumours as well as and invasion.22,38 Another highly co-expressed gene was the prostate adenocarcinoma (Table 1 and Figure 1).31 The diagnostic mitochondrial peptidase MIPEP that has been shown to cleave ability of NAALADL2 to distinguish between tumour and benign Notch and promote cell migration and motility.39 cells was confirmed in both colon and prostate cancers Also co-expressed with NAALADL2 was HN1, a known AR (Figures 1b–d). In prostate cancer, an increase in expression of regulator that regulates ubiquitination of the AR while also activating NAALADL2 correlated with increased Gleason grade and patho- the MAP kinase pathway, a proposed mechanism of progression to logical stage (Figures 1e and f). In particular, there was a castrate-resistant prostate cancer.25,40,41 We established that raised significant difference between organ-confined pT2 prostate NAALADL2 expression increased the amount of the CREB-activating cancer and pT3 tumours that had invaded local structures such phosphorylation at Ser133, previously shown to increase cell as the seminal vesicles. This suggests that NAALADL2 might proliferation, migration and invasion27 (Figure 5c). In combination, promote more aggressive disease in which tumour cells are more these NAALADL2-co-regulated genes, and their impact on master likely to metastasize (P ¼ 0.018, Figure 1f). regulators of prostate gene expression such as the AR and CREB, Although clinical markers such as Gleason grade and stage have help to establish a pro-migratory, pro-metastatic tumour microenvir- been shown to have prognostic ability, very few molecular onment when NAALADL2 expression is increased. markers are used for prognosis in clinical practice. Serum PSA at diagnosis can be used as a prognostic indicator but PSA IHC is not prognostic.32 Using an independent TMA, NAALADL2 IHC was MATERIALS AND METHODS shown to be prognostic for recurrence even after correction for TMA and patient cohorts clinical variables (Figure 2 and Table 2). Although there was an Cambridge TMA: Prostate tissue from radical prostatectomies performed at overlap in the confidence intervals, the HRs were significantly Addenbrookes Hospital, Cambridge, UK between 2001 and 2005 were different (P ¼ 0.036), indicating that more sensitive tests, such as used to make TMAs using duplicate 0.6 mm cores taken from paraffin- embedded tissue and a Beecher Manual TMA Arrayer as previously circulating RNA (Figure 1g), might improve the specificity of described.42 Pathological stage and Gleason grade was confirmed by a NAALADL2 to enable it to be used in clinical practice. specialist uro-pathologist (AYW). Unlike the apical location of PSMA/NAALAD1 (Figure 3a), Cambridge mini-TMA: Prostate tissue collected as above was used to make NAALADL2 was consistently localized to the basal membrane of a test array containing 16 Â 6 mm cores including benign and tumour. cells in contact with the extracellular matrix. To study the function Karolinska TMA: Prostate tissue from radical prostatectomies performed at of NAALADL2 in prostate cancer cell lines were made stably Karolinska Hospital, Stockholm, Sweden between 1998 and 2002 was used overexpressing or knocking down NAALADL2 (Supplementary to make TMAs using 31 mm cores taken from paraffin-embedded tissue and Figure S1). Owing to the low expression of NAALADL2 in LNCaP a Beecher Manual Arrayer. In total, tumour tissue from 257 different patients cells, this cell line was used for the overexpression, and the higher was used to generate the TMA. Malignant tissue was identified and obtained from at least one and up to three different tumour foci from each expressing LNCaP-BIC cell line was used for the knockdown cells patient. Pathological stage and Gleason grade was confirmed by a specialist (Supplementary Figure S1A). Although reciprocal changes in cell uro-pathologist (LE) before scoring any IHC staining. Median follow-up was adhesion were not always seen, cells with increased NAALADL2 61 months and based upon prostate cancer-related deaths. expression tended to exhibit increased adhesion, whereas those A multi-tumour/normal TMA (Stretton Scientific, Stretton, UK) containing with reduced NAALADL2 showed reduced adhesion to two tumour and one normal core from prostate, oesophagus, liver, thyroid,

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5281 a b

LNCaP-EV vs LNCaP-NAALADL2 Protein folding Immune Cytoskeletal remodelling Cell adhesion and chemotaxis Apoptosis Cell cycle reguation Signalling EMT and differentiation Metabolism Other

Membranous/secreted Nuclear Mitochondrial

e 4.000

3.500

3.000

2.500 Overexpression 2.000 Knockdown 1.500

Relative expression 1.000

0.500

0.000 HNRPL HSPA5 AGR2 HN1 XAGE1B S1PRE MIPEP MMP7 SPON2 NAALADL2 Gene ID Figure 4. Altering NAALADL2 expression leads to the altered co-expression of a number of genes. (a) A heatmap of genes that exhibit reciprocal alterations in expression when NAALADL2 expression is stably modified. NT, non-targeting siRNA; si, siNAALADL2 both in LNCaP- BIC cells; EV, empty vector; NAAL ¼ NAALADL2 overexpression both in LNCaP cells. Each condition had six technical replicates (1–6). (b) Significant gene changes from LNCaP-EV vs LNCaP-NAALADL2-overexpressing cells were analysed for enriched pathways using Genego Metacore (Thomson Reuters). Pathways were grouped into categories as detailed in Table 6. (c) Following analysis to identify reciprocally expressed genes seven genes were found that were both upregulated in the LNCaP-NAALADL2 cell line (OvExp_UP) and downregulated in the LNCaP-BIC-siNAALADL2 cell line (KD_DN; left diagram). Two genes were found that were downregulated in the LNCaP-NAALADL2 cell line (OvExp_DN) and upregulated in the LNCaP-BIC-siNAALADL2 cell line (KD_UP; right diagram). (d) The majority of reciprocally regulated genes were membranous or secreted (black) with the remainder nuclear (grey) or mitochondrial (white). (e) Co-expressed genes were confirmed by qPCR using SDH1 as a housekeeping gene. All results are shown relative to the EV or NT controls. Black bars represent the LNCaP-NAALADL2 cell line, whereas grey bars represent the LNCaP-BIC-siNAALADL2 cell line.

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5282 Table 4. Pathway analysis was performed using GeneGo Metacore on expression array data from LNCaP cells stably transfected with either empty vector or an NAALADL2 overexpression construct

Category Pathway P-value

Apoptosis Apoptosis and survival_Endoplasmic reticulum stress response pathway 0.002326 Apoptosis and survival_TNFR1 signalling pathway 0.006745 Apoptosis and survival_Role of IAP-proteins in apoptosis 0.01688 Apoptosis and survival_Lymphotoxin-beta receptor signalling 0.03749 Apoptosis and survival BAD phosphorylation 0.03749

Cell adhesion and chemotaxis Cell adhesion_Ephrin signalling 0.007926 Cell adhesion_Alpha-4 integrins in cell migration and adhesion 0.02163 Chemotaxis_Leucocyte chemotaxis 0.04322

Cell cycle Cell cycle_Regulation of G1/S transition (part 1) 0.004318 DNA damage_ATM/ATR regulation of G1/S checkpoint 0.01839 Cell cycle Chromosome condensation in prometaphase 0.05221

Cytoskeleton remodelling Cytoskeleton remodelling_RalA regulation pathway 0.01544 Cytoskeleton remodelling_TGF, WNT and cytoskeletal remodelling 0.04634 Cytoskeleton remodelling_Role of Activin A in cytoskeleton remodelling 0.04778

EMT and differentiation Development_NOTCH-induced EMT 0.000294 Development_TGF-beta-dependent induction of EMT via RhoA, PI3K and ILK. 0.008564 Hypoxia-induced EMT in cancer and ﬁbrosis 0.01027 Development_S1 P2 and S1P3 receptors in cell proliferation and differentiation 0.01041 Some pathways of EMT in cancer cells 0.01226 Development_Keratinocyte differentiation 0.01684 Development_TGF-beta-dependent induction of EMT via SMADs 0.02336 Development Regulation of epithelial-to-mesenchymal transition (EMT) 0.02617

Immune response Immune response_Inhibitory action of Lipoxins on pro-inﬂammatory TNF-alpha signalling 0.008564 Immune response_HSP60 and HSP70/ TLR signalling pathway 0.0149 Immune response_CD40 signalling 0.02751 Immune response_MIF-induced cell adhesion, migration and angiogenesis 0.04713 Immune responseJHistamine H1 receptor signalling in immune response 0.05237

Signalling pathways Development_Notch Signalling Pathway 0.00009731 Development_NOTCH1-mediated pathway for NF-KB activity modulation 0.0002951 Signal transduction_JNK pathway 0.0008054 Development_WNT signalling pathway. Part 2 0.01398 G-protein signalling_Regulation of RAC1 activity 0.02516 Development_A2A receptor signalling 0.03979 Development_VEGF signalling and activation 0.03979 Development_WNT signalling pathway. Part 1. 0.04349 DevelopmentJHedgehog signalling 0.04713 DevelopmentJHGF signalling pathway 0.04972 Development_G-CSF signalling 0.05509

Metabolism Glutathione metabolism 0.02617 Lutathione metabolism / Human version 0.02751 Glycogen metabolism 0.02898 Phospholipid metabolism p.2 0.04972 Abbreviations: Pathway analysis was performed using GeneGo Metacore on expression array data from LNCaP cells stably transfected with either empty vector or an NAALADL2 overexpression construct. Only differentially expressed genes with a p-value of o1 Â 10 À 3 were used in the analysis Only statistically signiﬁcant result are show grouped into functional categories EMT, epithelial-to-mesenchyme transition; NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2. Only differentially expressed genes with a P-value of o1 Â 10 À 3 were used in the analysis. Only statistically signiﬁcant results are shown grouped into functional categories.

tongue, soft tissue lymphoma, breast,colon,stomach,tongue,skin,lung, recovery and rabbit anti-NAALADL2 antibody (1:25, Atlas Antibodies, kidney, ovary, uterus, testes, pancreas and thymus was used to investigate Stockholm, Sweden) diluted in a buffer containing 300 mM Tris-buffered NAALADL2 specificity. Colon, pancreas and breast TMAs (Stretton Scientific) saline, 1% donkey serum (Sigma-Aldrich, St Louis, MO, USA) and 0.05% were used for validation. The breast TMA was composed of two tissue cores Tween. AGR2 was stained using rabbit anti-AGR2 antibody (1:100; Atlas from 30 cases of invasive ductal carcinoma (total 60 cores). The pancreas TMA Antibodies) and 20 min antigen retrieval in citrate buffer. Nuclei were included two tissue cores from 30 cases of pancreatic adenocarcinoma, as counterstained with haematoxylin and slides were coverslipped using DPX. well as eight non-neoplastic cores (total 68 cores). The colon TMA comprised 2 Dual staining of NAALADL2 and AGR2 was completed on sequential mini- spots each of 45 tissue cores and 8 non-neoplastic cores (total 98 cores). TMA sections using the polymer refine Kit for AGR2 and the Leica FDABe- hx protocol with 20 min antigen retrieval in citrate buffer and rabbit anti- AGR2 diluted (1:50) in bond diluent. This was immediately followed by the Immunohistochemistry Leica JJM protocol using a polymer refine red detection for NAALADL2 All IHC was performed using a Leica Bondmax Autostainer (Milton Keynes, with a 10-min pre-treatment with 1.5 M Tris EDTA, pH 8.0 and rabbit ant- UK). NAALADL2 was stained using 1.5 M Tris EDTA, pH 8.0, for antigen NAALADL2 (1:100) diluted in Bond diluent.

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5283 Table 5. Details of genes shown to be reciprocally regulated in LNCaP cell overexpressing NAALADL2 (LNCaP-NAALADL2) and with knocked-down NAALADL2 (LNCaP-BIC-siNAALADL2)

Gene ID Full name Up/down Primary Function Androgen References relative to localization regulated NAALADL2 o/e

HSPA5 Heat shock 70 kDa protein Up ER/membrane Heat shock protein Yes (Bennett et al.50, 5/ glucose-regulated Daneshmand et al.51, protein, 78 kDa Tan et al.52, Whitaker et al48) AGR2 Anterior gradient 2 Up Secreted Proto-oncogene, mucin Yes (Brychtova et al,36 Bu homologue production, cell et al.,19 Ho et al.,20 Kani adhesion/migration et al.,21 Wang et al.37). MMP7 Matrix metallopeptidase 7 Up Secreted Proteolytic degradation Not known NA of extracellular matrix HN1 Hematological and Up Nucleus Regulates AR Not directly, (Varisli et al.25) neurological expressed degradation and AKT regulates AR 1/ARM2 signalling XAGE1B X antigen family, member Up Nucleus Cancer antigen Not known NA 1B/Cancer,testes antigen 12.1 S1PR3 Sphingosine-1-phosphate Up Membrane Binds SP1 that promotes No NA receptor 3 cell division and represses apoptosis MIPEP Mitochondrial intermediate Up Mitochondria Peptidase that matures Associated with (Lee et al.,39 peptidase mitochondrial proteins metastatic PCa Trojan et al.53) SPON2 Spondin 2 Down Secreted Promotes cell adhesion Yes (Liao et al.,38 and motility Qian et al22) HNRPDL Heterogeneous nuclear Down Nucleus/ Transcriptional repressor Associated with (Wu et al.54) ribonucleoprotein cytoplasm of proto-oncogenes metastatic PCa D-like/JKTBP

Abbreviations: AR, androgen receptor; ER, estrogen receptor; NA, not applicable; NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2; PCa, prostate cancer. Details of wheher a gene is up or downregulated relative to NAALADL2 overexpression (o/e) are given.

IHC scoring and data analysis the PAXgene RNA Blood kit (Qiagen, Limburg, The Netherlands). The Cambridge TMA: All regions of each core were scored giving rise to multiple benign men all had raised PSA but negative biopsy, indicating that a scores for adjacent regions in a core (scoring performed by HCW and proportion (B30%) will have undetected cancers. AYW). The TMA was scored as none (no staining), weak (staining was inconsistent and/or weak), moderate (appreciable staining) or strong (very cDNA production and qPCR intense staining). Karolinska TMA: Each core scored (by LE and AS) by intensity and RNA was reverse transcribed using High Capacity cDNA Reverse proportion of cancer cells stained on the scale 0–3. Average values of the Transcription kit (Applied Biosystems, Paisley, UK). Primer sequences are three intensity and proportion scorings were calculated to give average given in Table 6. Reverse transcription-PCR were performed in triplicate in intensity and proportion values. These values were then multiplied to give 10 ml reactions containing 5 ml of SYBR Green PCR Master Mix (Applied the IRP. Biosystems), 2 pmol of primers and 10 ng of cDNA template. Ct values were Sensitivity, specificity, positive predictive values (PPVs) and negative calculated for all conditions and the expression of target genes was predictive values (NPVs) were calculated where possible. All grouped normalized against the expression of SDH1 or UBC housekeeping genes P-values (n ¼ X3) were calculated using a Kruskal–Wallis test. All pairwise using the ddCt method. comparisons were completed using a Mann–Whitney test. Thirty-eight patients in the Cambridge TMA had biochemical recur- Cell lines rences and median follow-up was 86 months (range 0–145 months), hence Kaplan–Meier curves could be created for prognostic information. LNCaP cells, LNCaP-BIC (LNCaP cells that were continuously passaged in The Karolinska TMA had a median follow-up of 61 months (range media supplemented with 1 mM bicalutamide) and PC3 cells were grown in RPMI (Invitrogen, Paisley, UK) supplemented with 10% foetal bovine serum. 1–144 months). For Kaplan–Meier curves for the Karolinska TMA time-to- For the androgen timecourse, cells were incubated for 48 h in phenol red- event analysis was generated using biochemical recurrence as outcome. free RPMI supplemented with charcoal-stripped foetal bovine serum Association between IRP index and biochemical recurrence was assessed (Hyclone, Waltham, MA, USA). Cells were incubated with 1 nM R1881 using Cox regression analysis to estimate HRs with corresponding 95% (Sigma) for 0, 6, 18, 24 and 48 h before harvesting. Data is presented as a confidence intervals as measure for association. The IRP index was timecourse or box and whisker plot of all time points with the median categorized into three groups (0–3, 3–5 and 45) with the lowest category value indicated. Androgen-regulated gene expression was confirmed using used as reference group. Both crude analysis and analysis adjusted for age, the GSE18684 data set available through GEO.24 These data were Gleason score, extraprostatic extension, positive surgical margin, vesicle generated by expression profiling of LNCaP cells grown in the presence invasion, clinical stage and preoperative PSA were carried out. or absence of androgens (1 nM R1881), with 36 samples taken over a 24-h period. Data were normalized and plotted using the R statistical software, with values centred on the triplicate time-zero data points. Extraction of circulating RNA from whole blood Blood (2.5 ml) was collected in a PAXgene tube from patients enrolled in the ProMPT trial (National Institute of Health and Research ID 5837) Stable cell lines with overexpressed and knockdown NAALADL2 and stored according to the manufacturer’s instructions. Samples were For the NAALADL2 overexpressing cell line, NAALADL2 was cloned from collected from patients with various grades of prostate cancer LNCaP cDNA using XbaI and HpaI restriction sites into the pCSC lentiviral (Gleason 3 þ 3, 3 þ 4, 4 þ 3 and 4 þ 4/5). RNA was extracted using vector using the primers shown in Table 6. As a control, empty pCSC vector

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5284 was used. For the NAALADL2 knockdown cells, short hairpin RNA (shRNA) sites.43 NT shRNA were used as a control. HEK293T cells were transfected sequences were created by annealing two oligonucleotides (Table 6) and with pCSC -NAALADL2 (or empty pCSC) and pSICOR-shNAALADL2 (or NT cloned into the pSICOR lentiviral vector using HpaI and XhoI restriction vector) using calcium phosphate, alongside envelope and third-generation

AGR2 NAALADL2 AGR2/NAALADL2

d Empty VectorNAALADL2 overexpressionNon-targetingsiNAALADL2 siRNA c NAALADL2

Phospho - CREB Empty Vector Non-targeting siRNA

Total CREB

Tubulin

NAALADL2 overexpression siNAALADL2

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5285 packaging plasmids VSV-G, POL and D2. The calcium phosphate-DNA (1:10 000, both obtained from Abcam, Cambridge, UK); anti-phospho-CREB precipitate was left on cells for 16 h before the media was replaced. Twenty Ser133 (1:1000) and anti-CREB (1:1000, all obtained from Cell Signaling four hours later, media was centrifuged at 1500 r.p.m. for 3 min and filtered Technologies, Danvers, MA, USA). A phospho-MAPK Protein Profiler Array using a 0.45-mM pore filter. Filtered media was subsequently used to infect (R&D Systems, Abingdon, UK) was blotted overnight with 200 mg fresh cell either LNCaP cells (pCSC-NAALADL2 or pCSC) or LNCaP-BIC cells (pSICOR- lysate and completed according to the manufacturer’s instructions. All shNAALADL2 or pSICOR NT control). Infected clones were selected using blots were visualized using Western Lightening ECL Pro (PerkinElmer, 2 mg/ml puromycin added 24 h later and then throughout. Waltham, MA, USA).

RNA expression array Confocal microscopy 49 Gene expression analysis was carried out on Illumina Human HT12 version The samples were prepared as described previously and stained with anti- 4 arrays (San Diego, CA, USA) using six biological replicates from each cell NAALADL2 antibody (1:200, Atlas Antibodies) and actin (1:500, Abcam). To line (LNCaP-EV, LNCaP-NAALADL2 overexpressing, LNCaP-BIC-NT siRNA, visualize, cells were incubated with 488- or 405-conjugated Alexafluor secondary antibodies (1:10 000, Molecular Probes, Paisley, UK), washed and LNCaP-BIC-siNAALADL2, PC3-NAALADL2 overexpressing and PC3-EV). All 0 analyses were carried out on R using Bioconductor packages.44 Raw mounted with Vectorshield containing 4 ,6-diamidino-2-phenylindole intensity data was processed using the BASH and HULK algorithms as (DAPI) (Vector Laboratories Inc., Peterborough, UK). Images were implemented in the beadarray package.45,46 Log2 transformation and taken using a Nikon eclipse 90i confocal microscope (Nikon, Surrey, UK) quantile normalization of the data was performed across all sample with Â 60 objective. groups. Differential expression analysis was carried out using the limma package.47 Differentially expressed genes were selected using a P-value Cell adhesion assay cutoff o0.05 after application of false discovery rate (FDR) correction for Cell adhesion was measured with CytoSelect 48-well cell fluorometric multiple testing applied globally to correct for multiple contrasts. For extracellular matrix adhesion assay (Cell Biolabs, San Diego, CA, USA) by pathway analysis, Metacore (Thomson Reuters, New York City, NY, USA) seeding 1.5 Â 105 cells in serum-free media and incubating at 37 1C for was used by utilizing data from the LNCaP-EV versus LNCaP-NAALADL2 90 min. After washing, bound cells were lysed with 1 Â lysis buffer/ overexpression and PC3-EV versus PC3-NAALADL2 overexpression arrays. CyQuant GR dye solution and measured using a 480/520-nm filter. All Gene enrichment by function and pathway analysis was completed on P-values are calculated using a two-tailed t-test with Po0.05 being classed both data sets. as significant.

Western blot analysis Cell migration and invasion assay Cell lysates were made and western blots were run as described Cell migration was assayed with CytoSelect 96-well cell migration previously48, and probed using the following antibodies: anti-NAALADL2 ﬂuorometric assay (Cell Biolabs). Each well contained a Boyden chamber antibody (1:100, Atlas Antibodies); anti-tubulin (1:10 000) and anti-actin with a 8-mm pore polycarbonate membrane and media containing 10%

Table 6. Primer sequences used for cloning NAALADL2 into pCSC lentiviral vector for stable cell line production and for qPCR validation of NAALADL2 expression in cell lines Supplementary Figure S1), expression array co-expressed genes (Figure 4d) and gene expression following R1881 treatment (Figure 5b and Supplementary Figure S3)

Gene Forward (50-30) Reverse (50-30)

Cloning primers CGCTCTAGAACCATGGGAGAGAATGAAGCAAGTT TCAATTCTTCCCATCCAAGA shRNA NAALADL2 GAAGCAAGTTTACCTAACATTCAAGAGATGTTAGGT TCGAGAAAAAAGAAGCAAGTTTACCTAACA AAA-CTTGCTTCTTTTTTC TCTCTTGAATGTTAGGTAAACTTGCTTCA shRNA control TGTTCTCCGAACGTGTCACGTTCAAGAGA TCGAGAAAAAAGTTCTCCGAACGTGTCACGTCT CGTGACACGTTCGGAGAACTTTTTTC CTTGAACGTGACACGTTCGGAGAACA NAALADL2 CACCAAAGAGCAATCGCTGCAACT TGAAGATGGAGCATCTGAAGGGCA PSA GCCTTCCCTGTACACCAAG AGTCTTGGCCTGGTCATTTC HSPA5 TAGCGTATGGTGCTGCTGTC TTTGTCAGGGGTCTTTCACC ARG2 AGCACTAGTGGGTGGGATTG GCAAGAATGCTGACACTGGA MMP7 GAGTGCCAGATGTTGCAGAA AAATGCAGGGGGATCTCTTT HN1 CCTTCTTGGTGTTGCCCTAA ATCAGCCAGCCAGTCTTGTT XAGE1B TCTGCAAGAGCTGCATCAGT TTGCGTTGTTTCAGCTTGTC S1PR3 GCTTCAGGAAATGGAAGCTG TCAGGATGCTGTGAAACTGC MIPEP AAGGGACTGCTCTGGTGCTA GGCACTCAGCTCAGGAACTC SPON2 GGCCAAATACAGCATCACCT CCTCGATCTCCTTCATCAGC HNRPDL TGAAGGGGGAGTGAGAATTG CCCCTCCCCAATAAACTTGT SDH1 TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCAT

Abbreviations: NAALADL2, N-acetyl-L-aspartyl-L-glutamate peptidase-like 2; PSA, prostate-speciﬁc antigen; qPCR, quantitative PCR; shRNA, short hairpin RNA.

Figure 5. NAALADL2-co-expressed genes are regulated by CREB and androgens. (a) Sequential sections of the mini-TMA was stained by IHC for AGR2 (brown), NAALADL2 (brown) or AGR2 (brown) and NAALADL2 (red) together. Nuclei were counterstained with hematoxylin (blue). White arrowheads indicate benign glands and black arrowheads indicate tumour glands. (b) Parental LNCaP cells were starved in phenol red- free, charcoal-stripped serum media for 28 h before treatment with the synthetic androgen, R1881, for 0, 6, 18, 24 or 48 h. Cells were harvested and analysed by qPCR for the co-expressed genes and NAALADL2. PSA was used a positive control. Representative results are shown using an average of three technical replicates per time point. Expression at all time points was combined to show overall changes in expression in response to androgen. Changes with time are shown in Supplementary Figure S3. Box plots show the spread of data and mean (bar). (c) Protein Proﬁler MAPK arrays were incubated with 200 mg whole-cell lysate overnight before secondary antibody was added according to manufacturer’s instructions. Arrays were visualized simultaneously with ECL. Black boxes highlight the duplicate spots which represent CREB. (d) Changes in phospho-CREB Ser133 were conﬁrmed by western blotting using anti-Ser133-CREB (1:1000) and total CREB (1:1000). Tubulin (1:10 000) was used a loading control.

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287 NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5286 foetal bovine serum as a chemoattractant. Chambers were loaded with prostatectomy or external-beam radiation therapy for clinically localized prostate 5 1.5 Â 10 cells in serum-free media and incubated at 37 1C for 24 h. Cells cancer. J Clin Oncol 1999; 17: 168–172. within wells were washed away and migratory cells were collected using 12 Kattan MW, Eastham JA, Stapleton AM, Wheeler TM, Scardino PT. A preoperative the cell detachment solution. Cells were stained with CyQuant GR dye and nomogram for disease recurrence following radical prostatectomy for prostate measured as before. Invasion was assayed with CytoSelect 96-well cell cancer. J Natl Cancer Inst 1998; 90: 766–771. invasion fluorometric assay (Cell Biolabs). Each well contained an 8-mm 13 Partin AW, Kattan MW, Subong EN, Walsh PC, Wojno KJ, Oesterling JE et al. pore Boyden chamber overlayed with extracellular matrix and media 5 Combination of prostate-specific antigen, clinical stage, and Gleason score to containing 10% foetal bovine serum. Chambers were loaded with 1.5 Â 10 predict pathological stage of localized prostate cancer. A multi-institutional cells in serum-free media and incubated as before. Cells that passed update. JAMA 1997; 277: 1445–1451. through the membrane were stained with CyQuant GR dye and measured 14 Hessels D, Schalken JA. The use of PCA3 in the diagnosis of prostate cancer. Nat as before. All P-values are calculated using a two-tailed t-test with Po0.05 Rev Urol 2009; 6: 255–261. being classed as significant. 15 Rosario DJ, Lane JA, Metcalfe C, Donovan JL, Doble A, Goodwin L et al. Short term outcomes of prostate biopsy in men tested for cancer by prostate specific anti- Colony formation assay gen: prospective evaluation within ProtecT study. BMJ 2012; 344: d7894. 16 Augustin H, Mayrhofer K, Pummer K, Mannweiler S. Relationship between pros- The ability of cells to form colonies in soft agar was assayed using the tate cancer gene 3 (PCA3) and characteristics of tumor aggressiveness. Prostate CytoSelect 96-well soft agar colony formation cell transformation assay 2012; 73: 203–210. (Cell Biolabs). Each well was inoculated with 1250 cells and incubated for 17 Botchorishvili G, Matikainen MP, Lilja H. Early prostate-specific antigen changes 7 days at 37 1C. Each assay was set up with four biological replicates. and the diagnosis and prognosis of prostate cancer. Curr Opin Urol 2009; 19: Anchorage-independent growth was quantified by melting the agar and 221–226. staining cells with CyQuant GR dye before being measured as before. 18 Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 2010; 18: 11–22. 19 Bu H, Schweiger MR, Manke T, Wunderlich A, Timmermann B, Kerick M et al. CONFLICT OF INTEREST Anterior gradient 2 and 3—two prototype androgen-responsive genes tran- The authors declare no conflict of interest scriptionally upregulated by androgens and by oestrogens in prostate cancer cells. FEBS J 2013; 280: 1249–1266. 20 Ho ME, Quek SI, True LD, Morrissey C, Corey E, Vessella RL et al. Prostate cancer cell phenotypes based on AGR2 and CD10 expression. Mod Pathol 2013; 26: ACKNOWLEDGEMENTS 849–859. We would like to acknowledge the support of The University of Cambridge, Cancer 21 Kani K, Malihi PD, Jiang Y, Wang H, Wang Y, Ruderman DL et al. Anterior gradient Research UK, National Medical Research Council, Singapore and Hutchison Whampoa 2 (AGR2): blood-based biomarker elevated in metastatic prostate cancer asso- Limited; the National Institute of Health Research, which funds the Cambridge Bio- ciated with the neuroendocrine phenotype. Prostate 2013; 73: 306–315. medical Research Centre, Cambridge, UK; the National Cancer Research Prostate 22 Qian X, Li C, Pang B, Xue M, Wang J, Zhou J. Spondin-2 (SPON2), a more prostate- Cancer: mechanisms of Progression and Treatment (PROMPT) collaborative (grant cancer-specific diagnostic biomarker. PLoS One 2012; 7: e37225. code G0500966/75466), which has funded tissue collections in Cambridge. We would 23 Wayner EA, Quek SI, Ahmad R, Ho ME, Loprieno MA, Zhou Y et al. Development of like to thank Prostate Cancer UK for funding a proportion of this work. We are very an ELISA to detect the secreted prostate cancer biomarker AGR2 in voided urine. grateful to the Cancer Research UK Cambridge Institute Genomics Core Facility, Prostate 2012; 72: 1023–1034. Histopathology and ISH Facility, and Bioinformatics and Statistics Core Facility for 24 Massie CE, Lynch A, Ramos-Montoya A, Boren J, Stark R, Fazli L et al. The androgen their assistance with the work in this manuscript. We would also like to thank Erik receptor fuels prostate cancer by regulating central metabolism and biosynthesis. Sahai (Cancer Research UK London Research Institute) and Ian Mills (Centre for EMBO J 2011; 30: 2719–2733. Molecular Medicine Norway) for their helpful discussions in preparing this 25 Varisli L, Gonen-Korkmaz C, Syed HM, Bogurcu N, Debelec-Butuner B, Erbaykent- manuscript. Tepedelen B et al. Androgen regulated HN1 leads proteosomal degradation of androgen receptor (AR) and negatively influences AR mediated transactivation in prostate cells. Mol Cell Endocrinol 2012; 350: 107–117. REFERENCES 26 Tsuchiya N, Kamei D, Takano A, Matsui T, Yamada M. Cloning and characterization 1 Mesters JR, Barinka C, Li W, Tsukamoto T, Majer P, Slusher BS et al. Structure of of a cDNA encoding a novel heterogeneous nuclear ribonucleoprotein-like pro- glutamate carboxypeptidase II, a drug target in neuronal damage and prostate tein and its expression in myeloid leukemia cells. J Biochem 1998; 123: 499–507. cancer. Embo J 2006; 25: 1375–1384. 27 Conkright MD, Montminy M. CREB: the unindicted cancer co-conspirator. Trends 2 Rojas C, Frazier ST, Flanary J, Slusher BS. Kinetics and inhibition of glutamate Cell Biol 2005; 15: 457–459. carboxypeptidase II using a microplate assay. Anal Biochem 2002; 310: 50–54. 28 Barrett JA, Coleman RE, Goldsmith SJ, Vallabhajosula S, Petry NA, Cho S et al. First- 3 Cao KY, Mao XP, Wang DH, Xu L, Yuan GQ, Dai SQ et al. High expression of PSM-E in-man evaluation of 2 high-affinity PSMA-avid small molecules for imaging correlated with tumor grade in prostate cancer: a new alternatively spliced variant prostate cancer. J Nucl Med 2013; 54: 380–387. of prostate-specific membrane antigen. Prostate 2007; 67: 1791–1800. 29 Frigerio B, Fracasso G, Luison E, Cingarlini S, Mortarino M, Coliva A et al. Asingle-chain 4 Liu T, Nedrow-Byers JR, Hopkins MR, Wu LY, Lee J, Reilly PT et al. Targeting fragment against prostate specific membrane antigen as a tool to build theranostic prostate cancer cells with a multivalent PSMA inhibitor-guided streptavidin reagents for prostate cancer. Eur J Cancer 2013; S0959-8049: 00087–00087. conjugate. Bioorg Med Chem Lett 2012; 22: 3931–3934. 30 Hrkach J, Von Hoff D, Mukkaram Ali M, Andrianova E, Auer J, Campbell T et al. 5 Osborne JR, Akhtar NH, Vallabhajosula S, Anand A, Deh K, Tagawa ST. Prostate- Preclinical development and clinical translation of a PSMA-targeted docetaxel specific membrane antigen-based imaging. Urol Oncol 2012; 31: 144–154. nanoparticle with a differentiated pharmacological profile. Sci Transl Med 2012; 4: 6 Barinka C, Mlcochova P, Sacha P, Hilgert I, Majer P, Slusher BS et al. Amino acids at 128ra39. the N- and C-termini of human glutamate carboxypeptidase II are required for 31 Silver DA, Pellicer I, Fair WR, Heston WD, Cordon-Cardo C. Prostate-specific enzymatic activity and proper folding. Eur J Biochem 2004; 271: 2782–2790. membrane antigen expression in normal and malignant human tissues. Clin 7 Barinka C, Sacha P, Sklenar J, Man P, Bezouska K, Slusher BS et al. Identification of Cancer Res 1997; 3: 81–85. the N-glycosylation sites on glutamate carboxypeptidase II necessary for pro- 32 Tradonsky A, Rubin T, Beck R, Ring B, Seitz R, Mair S. A search for reliable mole- teolytic activity. Protein Sci 2004; 13: 1627–1635. cular markers of prognosis in prostate cancer: a study of 240 cases. Am J Clin 8 Burgner D, Davila S, Breunis WB, Ng SB, Li Y, Bonnard C et al. A genome-wide Pathol 2012; 137: 918–930. association study identifies novel and functionally related susceptibility Loci for 33 Chen HC, Appeddu PA, Isoda H, Guan JL. Phosphorylation of tyrosine 397 in focal Kawasaki disease. PLoS Genet 2009; 5: e1000319. adhesion kinase is required for binding phosphatidylinositol 3-kinase. J Biol Chem 9 Tonkin ET, Smith M, Eichhorn P, Jones S, Imamwerdi B, Lindsay S et al. A giant 1996; 271: 26329–26334. novel gene undergoing extensive alternative splicing is severed by a Cornelia de 34 Parsons JT, Martin KH, Slack JK, Taylor JM, Weed SA. Focal adhesion kinase: a Lange-associated translocation breakpoint at 3q26.3. Human Genet 2004; 115: regulator of focal adhesion dynamics and cell movement. Oncogene 2000; 19: 139–148. 5606–5613. 10 Statistics OfN. Cancer Statistics Registrations, England 2010. 35 Zheng DQ, Woodard AS, Fornaro M, Tallini G, Languino LR. Prostatic carcinoma 11 D’Amico AV, Whittington R, Malkowicz SB, Fondurulia J, Chen MH, Kaplan I et al. cell migration via alpha(v)beta3 integrin is modulated by a focal adhesion kinase Pretreatment nomogram for prostate-specific antigen recurrence after radical pathway. Cancer Res 1999; 59: 1655–1664.

Oncogene (2014) 5274 – 5287 & 2014 Macmillan Publishers Limited NAALADL2 promotes an aggressive tumour phenotype HC Whitaker et al 5287 36 Brychtova V, Vojtesek B, Hrstka R. Anterior gradient 2: a novel player in tumor cell 45 Cairns JM, Dunning MJ, Ritchie ME, Russell R, Lynch AG. BASH: a tool for managing biology. Cancer Lett 2011; 304: 1–7. BeadArray spatial artefacts. Bioinformatics 2008; 24: 2921–2922. 37 Wang Z, Hao Y, Lowe AW. The adenocarcinoma-associated antigen, AGR2, pro- 46 Dunning MJ, Smith ML, Ritchie ME, Tavare S. beadarray: R classes and methods for motes tumor growth, cell migration, and cellular transformation. Cancer Res 2008; Illumina bead-based data. Bioinformatics 2007; 23: 2183–2184. 68: 492–497. 47 Smyth GK. in Limma: Linear Models For Microarray Data. (ed. Gentleman VCR, 38 Liao CH, Yeh SC, Huang YH, Chen RN, Tsai MM, Chen WJ et al. Positive regulation Dudoit S, Irizarry W, Huber R). (Springer: NY, USA, 2005). of spondin 2 by thyroid hormone is associated with cell migration and invasion. 48 Whitaker HC, Stanbury DP, Brinham C, Girling J, Hanrahan S, Totty N et al. Labeling Endocr Relat Cancer 2010; 17: 99–111. and identification of LNCaP cell surface proteins: a pilot study. Prostate 2007; 67: 39 Lee SF, Srinivasan B, Sephton CF, Dries DR, Wang B, Yu C et al. Gamma-secretase- 943–954. regulated proteolysis of the Notch receptor by mitochondrial intermediate pep- 49 Thirkettle HJ, Girling J, Warren AY, Mills IG, Sahadevan K, Leung H et al. LYRIC/ tidase. J Biol Chem 2011; 286: 27447–27453. AEG-1 is targeted to different subcellular compartments by ubiquitinylation and 40 Varisli L, Gonen-Korkmaz C, Debelec-Butuner B, Erbaykent-Tepedelen B, intrinsic nuclear localization signals. Clin Cancer Res 2009; 15: 3003–3013. Muhammed HS, Bogurcu N et al. Ubiquitously expressed hematological and 50 Bennett HL, Fleming JT, O’Prey J, Ryan KM, Leung HY. Androgens modulate neurological expressed 1 downregulates Akt-mediated GSK3beta signaling, and autophagy and cell death via regulation of the endoplasmic reticulum chaperone its knockdown results in deregulated G2/M transition in prostate cells. DNA Cell glucose-regulated protein 78/BiP in prostate cancer cells. Cell Death Dis 2010; Biol 2011; 30: 419–429. 1:e72. 41 Powell SM, Brooke GN, Whitaker HC, Reebye V, Gamble SC, Chotai D et al. 51 Daneshmand S, Quek ML, Lin E, Lee C, Cote RJ, Hawes D et al. Glucose-regulated Mechanisms of androgen receptor repression in prostate cancer. Biochem Soc protein GRP78 is up-regulated in prostate cancer and correlates with recurrence Trans 2006; 34(Pt 6): 1124–1127. and survival. Hum Pathol 2007; 38: 1547–1552. 42 Whitaker HC, Kote-Jarai Z, Ross-Adams H, Warren AY, Burge J, George A et al. The 52 Tan SS, Ahmad I, Bennett HL, Singh L, Nixon C, Seywright M et al. GRP78 up- rs10993994 risk allele for prostate cancer results in clinically relevant changes in regulation is associated with androgen receptor status, Hsp70-Hsp90 client pro- microseminoprotein-beta expression in tissue and urine. PLoS One 2010; 5: teins and castrate-resistant prostate cancer. J Pathol 2011; 223:81–87. e13363. 53 Trojan L, Schaaf A, Steidler A, Haak M, Thalmann G, Knoll T et al. Identification of 43 Ventura A, Meissner A, Dillon CP, McManus M, Sharp PA, Van Parijs L et al. Cre-lox- metastasis-associated genes in prostate cancer by genetic profiling of human regulated conditional RNA interference from transgenes. Proc Natl Acad Sci USA prostate cancer cell lines. Anticancer Res 2005; 25: 183–191. 2004; 101: 10380–10385. 54 Wu YY, Li H, Lv XY, Wei Q, Li X, Liu XY et al. Overexpression of JKTBP1 induces 44 Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S et al. androgen-independent LNCaP cell proliferation through activation of epidermal Bioconductor: open software development for computational biology and growth factor-receptor (EGF-R). Cell Biochem Funct 2008; 26: 467–477. bioinformatics. Genome Biol 2004; 5: R80.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)

& 2014 Macmillan Publishers Limited Oncogene (2014) 5274 – 5287