Characterization of VPS33B and VPS16B in Megakaryocyte and Platelet Α-Granule Biogenesis

Characterization of VPS33B and VPS16B in Megakaryocyte and Platelet α-granule Biogenesis

Chang Hua Chen

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto

Characterization of VPS33B and VPS16B in Megakaryocyte and Platelet α-granule Biogenesis

Chang Hua Chen Master of Science Department of Biochemistry University of Toronto

2016

Abstract

Platelets play a key role in vascular homeostasis by triggering platelet adhesion, aggregation, and release of cargo from secretory granules. Inherited defects in α-granule cargo sorting and packaging in platelet precursor megakaryocytes (MKs) include arthrogryposis, renal dysfunction and cholestasis (ARC) syndrome, which is characterized by mutations in VPS33B or VPS16B. In this study, components of the multisubunit tethering complex, GARP/EARP, and an endosomal transport complex, CCC, were identified as potential interacting partners for VPS33B/VPS16B using a BioID screen and mass spectrometry. These interactions were confirmed and characterized via immunoprecipitation experiments, and immunofluorescence microscopy studies of megakaryocytic cell lines (Dami, imMKCL) revealed that subunits of the GARP/EARP and CCC complexes co-localize with markers of the trans-Golgi Network, late endosomes and α-granules. These findings suggest a role for previously unsuspected interactions of GARP/EARP, CCC and VPS33B/VPS16B complexes in α-granule biogenesis by regulating intracellular membrane fusion in a coordinated nature.

Acknowledgements I would like to express my deepest gratitude to my supervisor, Dr. Walter Kahr, for his guidance, encouragement, support, and conscious optimism that helped me through some challenging times. I would also like to thank my committee members, Dr. William Trimble and Dr. Greg Fairn for their mentorship and guidance. I am also grateful to all members of the Kahr lab, Richard Lo, Marko Drobac, Kevin To, and Dr. Fred Pluthero for helpful advice, support, and entertainment. Special thanks to members of the Trimble lab for constructive criticism and helpful suggestions during lab meetings, as well as allowing the occasional borrowing of reagents. I thank Dr. Brian Raught and Dr. Étienne Coyaud for their assistance in BioID protein purification and mass spectrometry analysis. I also thank Dr. Juan Bonifacino for the generous gift, anti-VPS52 antibody, and Dr. Ezra Burstein for donating the homemade anti-COMMD1, 2, 3, 4, and 6 antibodies. My project would have not been possible without the help and support of my colleagues in the lab. I am especially thankful to Dr. Ling Li, who consistently guided, inspired, and supported me throughout my MSc study. Lastly, I would also like to express my appreciation to members of the SickKids Imaging Facility for their invaluable assistance.

iii

Table of Contents

Abstract ...... ii Acknowledgements ...... iii Table of Contents ...... iv List of Figures ...... vi List of Tables ...... viii List of Abbreviations ...... ix Chapter 1: Introduction ...... 1 1.1 Platelets and megakaryocytes ...... 1 1.2 Platelet structure and function ...... 1 1.3 α-granule biogenesis and transport into platelets ...... 5 1.4 Molecular machinery of α-granule vesicle trafficking and protein sorting ...... 6 1.4.1 Characterization of the Sec1/Munc18 protein family ...... 7 1.4.2 Characterization of golgin tethering proteins ...... 9 1.4.3 Characterization of the multisubunit tethering complex: HOPS/CORVET complex ...... 10 1.4.4 VPS16B-VPS33B complex in mammalian cells ...... 14 1.4.5 Arthrogryposis renal dysfunction and cholestasis (ARC) syndrome and the VPS33B/VPS16B complex ...... 15 1.5 Rationale and Hypothesis ...... 20 Chapter 2: Materials and Methods ...... 21 2.1 Antibodies and plasmids ...... 21 2.2 Cloning ...... 21 2.3 Cell cultures and transfections...... 22 2.4 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting ..... 24 2.5 BioID assay ...... 24 2.6 Protein identification by mass spectrometry ...... 25 2.7 Blue native PAGE (BN-PAGE) and sample preparation ...... 25 2.8 Immunoprecipitation ...... 26 2.9 Immunofluorescence microscopy ...... 26 2.10 Sequence of siRNA and CRISPR oligos ...... 27 Chapter 3: Results ...... 29 3.1 BioID screen of VPS33B and VPS16B potential interacting proteins ...... 29 3.1.1 BioID cloning and the generation of BioID stable cell lines ...... 29

3.1.2 BioID mass spectrometry results ...... 32 3.2 Confirmation of BioID identified potential interactions ...... 36 3.2.1 GARP subunits interact with VPS33B and VPS16B ...... 36 3.2.2 CCC complex subunits, COMMDs and CCDC22, interact with VPS33B and VPS16B ...... 39 3.2.3 Atg2B is a potential binding partner of VPS33B ...... 40 3.3 Examination of HEK293 cells treated with siRNA against GARP/EARP and CCC complex components ...... 41 3.4 Examination of GARP/EARP and CCC complexes in megakaryocytic cell lines ...... 42 3.4.1 GARP/EARP complex components co-localizes with VPS33B and VPS16B in Dami cells ...... 43 3.4.2 GARP/EARP complex component co-localize with markers of the α-granule biogenesis pathway in Dami cells ...... 45 3.4.3 CCC complex components co-localizes with VPS33B in Dami cells ...... 49 3.4.4 CCC complex components co-localize with markers of the α-granule biogenesis pathway in Dami and imMKCL cells ...... 51 3.5 Characterization of the GARP-VPS33B/VPS16B interactions (Domain mapping) ...... 60 Chapter 4: Discussion ...... 62 4.1 Further understanding of VPS33B/VPS16B requires the identification of its interactions with other multisubunit complexes ...... 62 4.2 Identification of interactions in the VPS33B/VPS16B complex using proximity-dependent BioID assay ...... 63 4.3 The GARP/EARP complex may act as a regulator of retrograde and anterograde trafficking of VPS33B/VPS16B complex ...... 64 4.4 The GARP/EARP complex may crosstalk with VPS33B/VPS16B complex in promoting MVB maturation in MK α-granule biogenesis ...... 66 4.5 The CCC complex may act as a regulator for VPS33B/VPS16B trafficking ...... 68 4.6 Autophagy related protein, ATPase associated proteins and the actin cytoskeleton as putative novel interactors with VPS33B/VPS16B complex ...... 72 Chapter 5: Conclusions and Future Directions ...... 75 References ...... 80 Appendices ...... 89 A.1 BioID constructs ...... 89 A.2 Wildtype VPS51 and VPS53 constructs ...... 90 A.3 Wildtype CCDC22 construct ...... 90 A.4 VPS33 domain mapping constructs ...... 90

List of Figures Figure 1: Electron microscopy of a resting platelet ...... 2 Figure 2. Function of platelets in blood ...... 3 Figure 3. Platelet biogenesis by bone marrow resident megakaryocytes ...... 4 Figure 4. The current model of α-granule biogenesis in megakaryocytes ...... 6 Figure 5. Model of SNARE complex assembly via VPS33 templated folding ...... 8 Figure 6: Golgin coiled-coil proteins contribute to specificity in membrane traffic ...... 10 Figure 7. Core components of the HOPS and CORVET complexes ...... 12 Figure 8: Function of CORVET and HOPS complexes in the endo-lysosomal pathway ...... 13 Figure 9. VPS33B/VPS16B complex is functionally distinct from the CORVET/HOP complex ...... 15 Figure 10. Platelets from patients with ARC syndrome are morphologically abnormal in blood films ...... 16 Figure 11. ARC mutations disrupt VPS33B/VPS16B interactions or complex recruitment to LEs by RILP ...... 17 Figure 12. VPS16B is required for α-granule biogenesis ...... 17 Figure 13. VPS33B/VPS16B (VIPAR) acts as a cargo regulator in alpha-granule biogenesis .... 19 Figure 14. Model of BioID stable cell generation ...... 29 Figure 15. Proximity-dependent promiscuous biotinylation by BioID-VPS33B and BioID- VPS16B...... 30 Figure 16. BirA* tag does not disrupt VPS33B/VPS16B complex formation ...... 31 Figure 17. Co-immunoprecipitation of 3xFLAG-VPS51 and 3xFLAG-VPS53 with GFP- VPS16B...... 36 Figure 18. Co-immunoprecipitation of endogenous GARP/EARP subunits with 3xFLAG- VPS16B...... 37 Figure 19. Co-immunoprecipitation of endogenous GARP/EARP subunits with 3xFLAG- VPS33B...... 37 Figure 20. Co-immunoprecipitation of endogenous CCDC22 and COMMD proteins with 3xFLAG-VPS33B ...... 38 Figure 21. Co-immunoprecipitation of endogenous CCDC22 with 3xFLAG-VPS16B ...... 39 Figure 22. Co-immunoprecipitation of endogenous Atg2B with 3xFLAG-VPS33B...... 39

Figure 23. siRNA-mediated knockdown of VPS33B in HEK293 cells ...... 40 Figure 24. Co-immunoprecipitation of endogenous GARP/EARP subunits with PIRES-GFP- VPS16B in Dami cells ...... 41 Figure 25. 3xFLAG tagged VPS51 and VPS53 partially co-localizes with GFP-VPS16B within megakaryocytic Dami cells stably expressing GFP-VPS16B ...... 42 Figure 26. 3xFLAG tagged VPS51 and VPS53 partially co-localizes with GFP-VPS33B within megakaryocytic Dami cells stably expressing GFP-VPS33B ...... 43 Figure 27. Localization of 3xFLAG tagged VPS51 within megakaryocytic Dami cells stably expressing GFP-VPS16B ...... 44 Figure 28. Localization of 3xFLAG tagged VPS53 within megakaryocytic Dami cells stably expressing GFP-VPS16B ...... 46 Figure 29. DDK tagged COMMD1, DDK tagged COMMD6, and 3xFLAG tagged CCDC22 partially co-localized with GFP-VPS33B within megakaryocytic Dami cells stably expressing GFP-VPS33B ...... 49 Figure 30. Localization of DDK tagged COMMD1 within megakaryocytic Dami cells stably expressing GFP-VPS33B ...... 51 Figure 31. Localization of DDK tagged COMMD6 within megakaryocytic Dami cells stably expressing GFP-VPS33B ...... 53 Figure 32. Localization of GFP tagged CCDC22 within megakaryocytic Dami cells ...... 55 Figure 33. VPS51 and CCDC22 are present in imMKCL ...... 57 Figure 34. Localization of endogenous COMMD1 within immortalized megakaryocyte progenitor cell lines (imMKCLs)...... 58 Figure 35. Co-immunoprecipitation of Myc-VPS16B truncations with 3xFLAG-VPS53...... 60 Figure 36. Co-immunoprecipitation of HA-VPS33B truncations with 3xFLAG-VPS53 ...... 60 Figure 37. imMKCLs form proplatelets and α-granule like structures ...... 70 Figure 38. An emerging model for platelet α-granule biogenesis ...... 78

vii

List of Tables

Table 1. siRNA sequence utilized ...... 27 Table 2. CRISPR oligo sequences synthesized...... 28 Table 3: VPS33B BioID data profile of polypeptides with a SAINT score > 0.8 ...... 32 Table 4: VPS16B BioID data profile of polypeptides with a SAINT score > 0.8 ...... 33 Table 5. Categorization of candidate binding proteins identified by BioID ...... 34 Table 6. Colocalization quantification ...... 43 Table 7. Colocalization quantification ...... 47 Table 8. Colocalization quantification ...... 50 Table 9. Colocalization quantification ...... 56 Table 10. Colocalization quantification ...... 59 Table 11. Protein interactions identified by Human Interactome study ...... 63

viii

List of Abbreviations AMP: Adenosine monophosphate ARC: Arthrogryposis, renal dysfunction, and cholestasis AP: adaptor protein AP-MS: Affinity purification mass spectrometry AP3: Adaptor protein complex 3 ATP: Adenosine-5'-triphosphate ATPase: Adenosine-5'-triphosphatase ATP6AP2: V-ATPase 6 lysosomal accessory protein 2 BLOC: Biogenesis of lysosome related organelle complex BN-PAGE: Blue Native polyacrylamide gel electrophoresis BSA: Bovine serum albumin CATCHR: Complexes associated with tethering containing helical rods CCC: COMMD/CCDC22/CCDC93 CCDC: Coiled-coil domain containing cDNA: complementary DNA CIP: Calf-intestinal phosphatase COG: Conserved oligomeric Golgi complex COMMD: Copper Metabolism (MURR1) domain containing CORVET: Class C core vacuole/endosome tethering DMEM: Dulbecco’s modification Eagle’s medium DMSO: Dimethyl sulfoxide DNA: Deoxyribonucleic acid DTT: dithiothreitol EARP: Endosme associated recycling protein ECL: Enhanced chemiluminescence EDTA: Ethylenediaminetetraacetic acid EM: Electron microscopy ER: Endoplastic reticulum FBS: Fetal bovine serum GAP: GTPase activating protein GAPDH: glyceraldehyde 3-phosphate dehydrogenase GARP: Golgi associated retrograde proteins GFP: Green fluorescent protein GPI: Glycosylphosphatidylinositol GTPase: Guanosine-5'-triphosphatase HA: Haemagglutinin HAUS: human Augmin complex HEPES: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HOPS: Homotypic fusion and protein sorting HRP: Horseradish peroxidase HS: Horse serum Hsp: Heat Shock Protein IB: Immunoblot IF: Immunofluorescence

imMKCL: Immortalized megakaryocytic cell line IMS: invaginated membrane ILV: intraluminal vesicles IP: Immunoprecipitation LAMP-1: Lysosomal-associated membrane protein 1 LB: Lysogeny broth LDLR: Low-density lipoprotein receptor LE: late endosome LRO: Lysosome-related organelle MK: Megakaryocyte MS: Mass spectrometry MTC: multisubunit tethering complex MVB: Multivesicular body NSF: N-ethylmaleimide sensitive factor NudC: nuclear distribution gene C NUDCD2: NudC domain containing protein 2 NUDCD3: NudC domain containing protein 3 OCS: Open canalicular system PBS: Phosphate-buffered saline PCC2: progressive cerebello-cerebral atrophy type 2 (PCC2) PCR: Polymerase chain reaction PFA: Paraformaldehyde PIH1D1: Protein interacting with Hsp90 (PIH1) domain containing protein 1 PIP: phosphoinositide PMA: phorbol-12-myristate-13-acetate PVDF: Polyvinylidene fluoride R2TP: Rvb1-Rvb2-Tah1-Pih1 Rab: Member RAS oncogene family RILP: Rab interacting lysosomal protein RPAP3: RNA polymerase II-associated protein 3 RNA: Ribonucleic acid siRNA: small interfering RNA SBP: streptavidin-binding peptide SDS-PAGE: Sodium dodecyl sulphate polyacrylamide gel electrophoresis SM: Sec1/Munc18 SNAP: synaptosome-associated protein SNARE: Soluble N-ethylmaleimide-sensitive factor attachment protein receptor TBS: Tris-buffered saline TBS-T: tris buffered saline supplemented with 0.05% Tween TGN: Trans-Golgi network TMEM: Transmembrane protein TPO: thrombopoietin t-SNARE: target SNARE VAMP: vesicle-associated membrane protein VPS: Vacuolar protein sorting v-SNARE: vesicle SNARE

VWF: von Willebrand Factor WASH: Wiskott-Aldrich syndrome protein and SCAR homologue Y3H: Yeast three hybrid

Chapter 1: Introduction 1.1 Platelets and megakaryocytes Platelets are small (2-5 μm in diameter) anucleate cells derived from bone marrow resident megakaryocytes (Italiano Jr et al. 1999). Individual human platelets circulate for 7-10 days in the bloodstream, (Walsh et al. 2015) where they play critical roles in maintaining vascular integrity and promoting hemostasis at vessel wound sites. Platelets have also been linked to other aspects of physiology (e.g. inflammatory responses) and pathology (e.g. atherosclerosis).

1.2 Platelet structure and function Platelets have a unique discoid shape that is maintained by an extensive cytoskeleton and circumferential microtubule ring (Figure 1). The platelet surface membrane is enriched with receptors and lipid rafts, and is contiguous with the open canalicular system (OCS) that acts as an internal membrane reservoir (Ghoshal and Bhattacharyya 2014) that is mobilized during platelet adhesion and granule cargo secretion (Heijnen and van der Sluijs 2015). Platelets respond to their hemodynamic environment via surface receptor stimulation and signaling events leading to aggregation, procoagulant activation and secretory granule secretion. The release of protein factors and other small molecules can lead to fibrin clot formation and preserve the integrity of the vascular system. These responses can also be triggered in pathological states such as arteriosclerosis, where platelet activation is involved in the formation of thrombi causing acute coronary events and strokes (Italiano Jr et al. 1999; Blair and Flaumenhaft 2009).

Platelets modulate immune and inflammatory responses via pro-adhesion surface receptors, interactions with endothelial and immune cells, and the release of immune mediators and inflammatory factors such as cytokines and chemokines (Figure 2) (Bustos M, Saadi S 2001; Angelica and Fong 2008; Boilard et al. 2010). They participate in angiogenesis by secreting pro- and anti-angiogenic proteins that support endothelial cell activation (Kisucka et al. 2006; Italiano et al. 2008; Walsh et al. 2015; Huang et al. 2016). Platelet adhesion and secretion have also been shown to promote cancer cell survival (Ho-tin-noé et al. 2009) and metastasis (Leblanc and Peyruchaud 2016). Platelets influence these processes by releasing a wide range of molecules contained in 3 classes of secretory granules: α-granules, δ-granules and lysosomes (Blair and

Flaumenhaft 2009). Elucidating the mechanisms by which granule cargo is sorted, packaged into granules and released is an active area of research.

Figure 1: Electron micrograph of resting platelets. Platelets have a discoid shape that is maintained by a circumferential coil of microtubules (MT). Specialized membrane structures include the open canalicular system (OCS) and the reticular membrane network of the dense tubular system (DTS). Also present in the cytoplasm are abundant secretory organelles: α- granules (G) and δ-granules (DB), as well as mitochondria (M), glycogen particles (Gly) and

coated vesicles (CV). Reprinted by permission from Platelets (White 1999). Permission conveyed through Copyright Clearance Center, Inc.

Figure 2. Varied roles of platelets. Platelets are crucial for modulating a broad range of physiological and pathophysiological processes, including hemostasis, thrombosis, angiogenesis and atherosclerosis Reprinted by permission from Platelets (Walsh et al. 2015). Permission conveyed through Copyright Clearance Center, Inc.

Platelets are derived from megakaryocytes resident in the bone marrow (Figure 3). During megakaryopoiesis, pluripotent hematopoietic stem cells differentiate into progenitor cells that give rise to immature megakaryocytes (Ru et al. 2015) that undergo endomitosis (DNA replication without cell division) to create polyploid nuclei (Machlus and Italiano 2013). As they mature, megakaryocytes form an extensive and highly invaginated membrane system (IMS) that likely functions as membrane reservoir for platelet formation, and they also synthesize large amounts of cargo proteins that are sorted and trafficked to nascent secretory granules (Ru et al. 2015). Terminal megakaryocyte development is featured by the formation of long branching extensions known as proplatelets that protrude through the bone marrow sinusoidal endothelium into the bloodstream via cytoskeleton reorganization (Poulter and Thomas 2015). Proplatelet elongation is coupled with the transport and distribution of granules/organelles to proplatelets

and budding platelets (Jennifer L. Richardson et al. 2005; Pertuy et al. 2014). Fluid shear force has been proposed to accelerate and/or induce intravascular release of nascent platelets (Machlus and Italiano 2013). The megakaryocyte transitional and development process is driven and regulated by numerous transcription factors and proteins that cause thrombocytopenia upon deficiency and/or impairment (Ru et al. 2015).

Figure 3. Platelet production by bone marrow resident megakaryocytes. (1) Megakaryocytes derived from hematopoietic stem cells go through a series of developmental stages before releasing nascent platelets into the bloodstream. (2) During maturation, megakaryocytes undergo endomitosis to generate polyploid nuclei without cell division, and (3) the IMS that functions as membrane reservoir for proplatelet production develop. (4) Fully mature megakaryocytes produce proplatelet extensions that trail into the bloodstream where they release proplatelets, (5) that can undergo further divisions as mature platelets form (6) under the influence of blood shear forces. Reprinted with permission from J. Cell Biology (Machlus and Italiano 2013). Copyright 2013.

1.3 α-granule biogenesis and transport into platelets α-granules are 200 – 500 nm in diameter and are the most abundant secretory organelles in platelets, ranging in number from 50 – 80 per platelet (Frojmovic and Milton 1982). α-granules contain a wide variety of proteins that are crucial for platelet function. The α-granule cargo proteins are derived from both clathrin- and adaptor protein-associated regulated secretory (P- selectin, von Willebrand factor) and endocytic pathways (fibrinogen) in megakaryocytes (Morgenstern et al. 1992; Heijnen et al. 1998). The development of these granules continues in circulating platelets via clathrin-dependent endocytosis. The clathrin coat assembly around vesicles is retained throughout trafficking and for a period following fusion with α-granules (Blair and Flaumenhaft 2009). Ultrastructural analysis of developing megakaryocytes suggests that small vesicles budded from either the trans-Golgi network (TGN) or the plasma membrane are transported to immature MVBs (MVB I), characterized by the sole presence of internal vesicles, to mature MVBs (MVB II) containing both internal vesicles and an electron dense matrix, to α-granules (Heijnen et al. 1998). MVBs in specialized cells can give rise to heterogenous pools of cargo proteins packaged into the intraluminal vesicles (ILVs) of distinct granules (Piper and Katzmann 2010). Disruption in megakaryocyte MVB protein content is coupled with a reduction in α-granule production (Bem et al. 2015). The mechanisms underlying cargo sorting and MVB development into distinct granules, however, require further investigation.

α-granules in maturing megakaryocytes are transported to proplatelet extensions during megakaryopoiesis (Pertuy et al. 2014). The protein content of secretory granules is heterogeneous in nature (Jennifer L Richardson et al. 2005). Myosin IIA has been shown to be required for proper granule redistribution and positioning during megakaryocyte maturation prior to proplatelet formation (Pertuy et al. 2014). Whether distinct α-granule subpopulations are differentially regulated and sorted into nascent platelets and MVBs remains unknown. Recent studies have indicated that organelles are delivered to the tip of proplatelet extensions and disperse individually and bidirectionally from the megakaryocyte cell body, rather than migrating as organized clusters (Jennifer L Richardson et al. 2005; Pertuy et al. 2014). The motility of α-granules is low through the length of proplatelet microtubule bundles, with a migration rate of approximately 0.2 μm/min and a frequency of about 28% of α-granules being in

motion at any given time (Jennifer L Richardson et al. 2005). The granules that are captured at the proplatelet tip continue their slow movement by circling along the microtubule coils (Jennifer L Richardson et al. 2005). These observations indicate that the distribution of granules inside nascent platelets may be partially achieved via dynamic shuffling along the circumferential microtubule track.

Figure 4. The current model of α-granule biogenesis in megakaryocytes. α-granule cargo proteins derived from both clathrin-mediated endocytic and biosynthetic pathways are directed to MVBs containing intraluminal vesicles, which function as sorting centres and α-granule precursors. Reprinted with permission from Blood (Flaumenhaft 2012). Copyright 2012.

1.4 Molecular machinery of α-granule vesicle trafficking and protein sorting Insights into the regulation and formation of α-granules at the molecular level came from studying patients with inherited bleeding disorders characterized by a deficiency in

megakaryocyte and platelet α-granules. A number of SNAREs and SNARE interacting proteins have been proposed to play a role in intracellular trafficking of α-granule proteins in megakaryocytes and platelets (Lemons et al. 2000; Polgár et al. 2003; Gissen et al. 2004; Urban et al. 2012). Further studies on the mechanisms underlying α-granule membrane fusion, cargo sorting, and transport may lead to potential therapeutic development for the associated bleeding syndromes.

1.4.1 Characterization of the Sec1/Munc18 protein family The molecular machinery of membrane fusion requires the coordination of membrane-associated soluble N-ethylmaleimide-sensitive fusion (NSF) attachment protein receptors (SNAREs), Rab Guanosine-5'-triphosphatase (GTPases), Sec1/Munc18 (SM) proteins, and other tethering proteins containing long coiled-coil domains (Wurmser 2000; Behrendorff et al. 2011; Rizo and Südhof 2012). Upon activation, Rab GTPases at the interface recruit tethering complexes, promoting vesicular docking (Søgaard et al. 1994; Savina et al. 2005; Stenmark 2009). Membrane fusion is then followed by SNARE complex assembly promoted by SM proteins (Nickerson et al. 2009).

Each SNARE protein contains a SNARE motif that interacts with three other SNARE motifs to form a four helix bundle. The carboxyl-terminal transmembrane domain allows the SNARE subunits to be anchored onto the target- and vesicle-membrane, which are subsequently brought into the vicinity for fusion to occur (Baker et al. 2015). The absence of either the SNAREs or the respective SM proteins disrupts intracellular membrane fusion events (Behrendorff et al. 2011; Weber-Boyvat et al. 2016). Despite the known essentiality of SM proteins and SNAREs for vesicular fusion, the functional role of the SM-SNARE interaction remains to be determined.

VPS33B is a member of the SM protein family that participates in intracellular vesicle trafficking (Lo et al. 2005). SM grooves are known to bind tightly with members of the SNAREs of the syntaxin subfamily (Peplowska et al. 2007) and regulate SNARE complex formation (Weber-Boyvat et al. 2016). Several SM-SNARE interaction surfaces have been proposed to date, with each interaction interface regulating SNARE complex formation in a distinct manner. The interaction between SM domain 1 and N-terminal of syntaxin homologues holds the syntaxins in an open conformation facilitating SNARE complex assembly (Burkhardt et al. 2008), whereas the SM domain 1 and 2 interacts with syntaxins in a closed conformation

inhibiting SNARE complex formation (Colbert et al. 2013). Moreover, the yeast SM Sec1p groove is known to interact with SNARE complex component Sec9p, regulating membrane targeting of the exocytic SNARE proteins; this interaction is conserved between mammalian SM Munc18 and t-SNARE SNAP-25 (Weber-Boyvat et al. 2016).

Various modes of binding have been observed between SM proteins and their cognate SNAREs. Biochemical and structural studies have revealed that the binding of yeast SM VPS33 to the C- terminal regions of SNARE motifs orients and aligns the SNARE subunits, forming an intermediate that promotes the “zippering” of SNARE complexes by coupling the two opposed vesicular membranes together for fusion to occur (Figure 5). This supports the speculation that VPS33 is able to catalyze SNARE-mediated membrane fusion by acting as a template platform for the complementary SNAREs to be properly and efficiently folded (Baker et al. 2015). Functional studies performed both in vitro and in vivo on VPS33-SNARE motif interactions further support the direct role of VPS33 in facilitating SNARE complex assembly and preventing premature disassembly essential for vacuolar fusion (Seals et al. 2000; Weber-Boyvat et al. 2016). More work is required to clarify the association of VPS33 to SNAREs throughout the intracellular docking/fusion processes.

Figure 5. Model of SNARE complex assembly via VPS33 templated folding. Prior to SNARE assembly, the VPS33 groove on the HOPS complex initiates templated zippering of complementary v- and t-SNAREs. Partially assembled SNARE complex intermediate is generated on the surface of VPS33. Numbers on the SNARE subunits refer to SNARE complex core layers. Reprinted by permission from Science (Baker et al. 2015). Permission conveyed through Copyright Clearance Center, Inc.

1.4.2 Characterization of golgin tethering proteins Prior to SNARE-mediated membrane fusion, transport vesicles are linked to the target membrane by tethering proteins. Recent studies suggest that the vesicular tethering and fusion events can be coupled by the interactions among tethering factors, SM proteins and SNAREs (Pérez-Victoria and Bonifacino 2009; Sohda et al. 2010; Balderhaar and Ungermann 2013). Tethering factors play a role in SNARE complex formation by stabilizing SNARE subunits or assembled SNARE complex (Lürick et al. 2015), recruiting t-SNAREs on the target membrane (Pérez-Victoria and Bonifacino 2009) and/or promoting SNARE assembly through protein-protein interactions with SNARE co-factors (Sinka et al. 2008; Sohda et al. 2010). Two classes of tethering factors have been identified in the membrane trafficking pathway: homodimeric long coiled-coil proteins and multisubunit tethering complexes (MTCs). Long tether golgins localize largely to the Golgi apparatus, and they are characterized by a highly conserved coiled-coil domain (Gillingham and Munro 2016). Some golgins can also be associated with retrograde transport vesicles (Sohda et al. 2010; Wong and Munro 2014). Similar to the different modes of interaction between SM proteins and SNAREs, golgins also display specificity in vesicle capturing by recognizing the unique features of transport vesicles containing different cargos and coming from different origins, including ER-to-Golgi, intra-Golgi and endocytic carriers (Figure 6) (Wong and Munro 2014). The long coiled-coil region enables golgins to capture carrier vesicles from both anterograde and retrograde transport pathways over a long distance. The golgin rod-like extension connected to the incoming vesicle provides a platform for other coiled-coil proteins, MTCs or regulatory proteins to bind and thus stabilizing and facilitating vesicle docking and fusion processes in conjunction with golgin (Sohda et al. 2007; Sohda et al. 2010). The cooperation among regulators that function upstream to SNARE-mediated fusion events contribute to target membrane specificity (Hong and Lev 2014). Taken together, accumulating evidence indicates that golgins are key to the initial tethering of incoming vesicles to the Golgi apparatus; the vesicles are likely to manoeuver through a hierarchy of interactions between the different tethers, regulatory proteins, SNARE co-factors, and SNAREs that contribute to the downstream fusion event. Whether proteins containing golgin-like long coiled-coil domains, for example VPS16B, adopt a similar tethering role on other organelles or in specialized cell types remains to be elucidated.

Figure 6: Golgin coiled-coil proteins contribute to specificity in membrane traffic. Golgins located at different Golgi cisternae tether sets of vesicles originating from distinct cellular compartments, including the ER, recycling vesicles and endosomes. The golgins are mostly anchored to the membrane via C-terminal domains. They also encompass Rab GTPase binding domains that may contribute to specificity in vesicle capturing. Reprinted with permission from Trends in Cell Biology (Gillingham and Munro 2016). Permission conveyed through Copyright Clearance Center, Inc.

1.4.3 Characterization of the multisubunit tethering complex: HOPS/CORVET complex In contrast to the long coiled-coil tethers, MTCs implicated in vesicular tethering events are able to link vesicle and target membranes over shorter distances. Hence MTC-driven tethering events may function downstream of initial long-distance vesicle capture mediated by coiled-coil proteins. Two major families of proteins are classified as MTCs: complexes associated with tethering containing helical rods (CATCHR) and Class C vacuolar protein-sorting (VPS) protein complexes. A number of protein complexes belong to the CATCHR family, for example the Golgi-associated retrograde complex (GARP), the endosome-associated recycling protein

complex (EARP) and the conserved oligomeric Golgi (COG) complex. The class C core vacuole/endosome tethering factor (CORVET) and homotypic fusion and vacuole protein sorting (HOPS) complexes that drive endo/endo-lysosomal fusion and maturation belong to the VPS complexes (Hong and Lev 2014).

HOPS/CORVET complex acts as a tethering complex required in regulating vesicular fusion among Golgi, endosomes and vacuoles by stimulating Rab GTPase activity and subsequently facilitating SNARE assembly (Peplowska et al. 2007; Balderhaar and Ungermann 2013). The core proteins Vps11, Vps16, Vps18 and Vps33 are shared between the HOPS and CORVET complexes (Peplowska et al. 2007; Ostrowicz et al. 2010; Lobingier and Merz 2012; Rizo and Südhof 2012; Solinger and Spang 2013), and elimination or alteration of core subunits leads to defective vacuolar biogenesis (Herman and Emr 1990; Raymond et al. 1992; Peterson and Emr 2001). Vps33 mutations that abrogate the Vps33-HOPS interaction produce impairments in yeast growth, vacuole function, vesicular cargo trafficking and sorting (Lobingier and Merz 2012). These data are in agreement with the findings that Vps33 ensures specificity of SNARE interactions (Baker et al. 2015).

The HOPS complex differs from the CORVET complex by containing HOPS-specific Vps39 and Vps41 which interact with Rab7 on LEs/MVBs, instead of CORVET-specific Vps3 and Vps8 that interact with Rab5 on EEs (Figure 7) (Ostrowicz et al. 2010; Plemel et al. 2011). These evolutionarily conserved differences allow the complexes to interact with distinct endo/endo-lysosomal compartments. A recent study of mammalian CORVET and HOPS complexes suggests that the core subunit Vps11 functions as a molecular switch that binds either the mammalian homologue of yeast CORVET-specific Vps3, TGFBRAP1, or HOPS-specific Vps39. This switch is triggered by intracellular signalling events leading to conformational changes of the complexes that are important for their binding specificity to early endosomal or late endosomal compartments during vesicular maturation (Van Der Kant et al. 2015). This finding is consistent with a yeast study that proposed the integrating function of Vps11 in CORVET and HOPS complex conversion (Plemel et al. 2011).

Figure 7. Core components of the HOPS and CORVET complexes. The HOPS and CORVET tethering complexes are similar in structure, and the core components that interact with SNARE complexes and maintain complex integrity are identical. The two complexes differ in their Rab binding subunits, with HOPS-specific and CORVET-specific subunits highlighted in red and blue respectively. Reprinted with permission from Journal of Cell Science (Balderhaar and Ungermann 2013). Copyright 2013.

In mammalian cells there are two functionally distinct homologues of Vps33: VPS33A and VPS33B (Gissen et al. 2005). This non-redundancy between the two homologues is also observed in Drosophila dVPS33A and dVPS33B, which distinctly interact with dVPS16A and dVPS16B respectively (Pulipparacharuvil et al. 2005). The study of Hermansky-Pudlak syndrome, a genetic disorder in which the formation of lysosome-related organelles (LRO) is impaired in various cell types including melanosomes in pigment cells and δ-granules in platelets (Witkop et al. 1987), using Drosophila as a model system demonstrated that dVPS16A is essential for lysosomal fusion events and lysosome delivery. Knockdown of dVPS16A resulted in an accumulation of autophagosomes and disruption of pigment granule biogenesis (Pulipparacharuvil et al. 2005).

Similar to yeast Vps33 and Vps16, VPS33A and VPS16A are also major constituents of CORVET/HOPS complex (Gissen et al. 2005). Structural study identified that VPS33A is recruited to the human HOPS complex by interacting with VPS16A (Graham et al. 2013; Wartosch et al. 2015); this recruitment is essential for HOPS-mediated endosome-lysosome and autophagosome-lysosome fusion (Figure 8) (Wartosch et al. 2015). All mammalian HOPS proteins, including VPS33A and VPS16A, are required in endocytic-associated endosomal, endo-lysosomal, and lysosomal fusions (Wartosch et al. 2015); mutations in VPS33A induced the clustering of melanosomes in melanoma cells (Gissen et al. 2005). Despite the requirement of VPS33A and VPS16A in the endo-lysosomal trafficking pathway, the function of their homologues VPS33B and VPS16B in intracellular trafficking or cargo sorting remains unknown.

Figure 8: Function of CORVET and HOPS complexes in the endo-lysosomal pathway. The CORVET complex is responsible for tethering Rab5-positive vesicles that mostly associate with early to late endosomes. The HOPS complex associates with Rab7-positive vesicles that traffic among late endosomal compartments and lysosomes/vacuoles. The CORVET and HOPS specific subunits are coloured in blue and red respectively. Reprinted with permission from Journal of Cell Science (Balderhaar and Ungermann 2013). Copyright 2013.

1.4.4 VPS16B-VPS33B complex in mammalian cells Although VPS33B and VPS16B (also known as VIPAS39 or VIPAR) are not components of the HOPS/CORVET complex, they are essential for LE-lysosomal fusion, degradation of endocytosed cargos and endosomal recycling as a subcomplex (Figure 9) (Galmes et al. 2015). Upon VPS33B depletion, accumulation of late endosomal and lysosomal compartments was observed (Galmes et al. 2015). Moreover, VPS33B deficiency leads to an increase in LE number, suggesting an abrogation to homotypic late endosomal fusion (Galmes et al. 2015). The function of VPS33B/VPS16B complex at the LE is also supported by a study that investigates the effect of ARC mutations on VPS33B interaction with RILP, which recruits the VPS16B-VPS33B complex to Rab7-positive late endosomal compartments (Van Der Kant et al. 2015). This VPS33B-Rab interacting lysosomal protein (RILP) interaction was also found to be independent on the VPS33B/VPS16B interaction (Van Der Kant et al. 2015). A decreased level of lysosomal degradation was also detected when VPS33B is depleted. The observation that neither the delivery of lysosomal enzyme nor lysosomal enzymatic activity was affected indicates a correlation between VPS33B deficiency and a delay in endocytosed cargo delivery to lysosomal compartments (Van Der Kant et al. 2015). The differential function of VPS16B-VPS33B complex in endosomal recycling and LE-lysosomal fusion is evident in data showing that none of the phenotypes observed in VPS33B-deficient cells could be rescued by overexpressing VPS33A (Cullinane et al. 2010; Smith et al. 2012; Galmes et al. 2015).

In addition to the discriminating functions of VPS33B to VPS33A, VPS16B is also distinct from VPS16A in containing a unique golgin A5 domain that is absent from its homologue. Thus it is clear that the functions of VPS33A and VPS33B, as well as VPS16A and VPS16B, are conserved in membrane fusion and trafficking despite their modular restructuring for target specificity.

Figure 9. VPS33B/VPS16B complex is functionally distinct from the CORVET/HOPS complex. VPS33B/VPS16B (here designated VIPAS39) is recruited to late endosomes in the presence of RILP. This interaction is putatively essential for endo-lysosomal fusion that is independent of fusion events mediated by the HOPS complex containing VPS16A and VPS33A. VPS33B/VPS16B complex is also recruited to recycling endosomes in polarized cells, whereas VPS16A and VPS33A are also part of the CORVET complex. Reprinted with permission from Traffic (Galmes et al. 2015). Permission conveyed through Copyright Clearance Center, Inc.

1.4.5 Arthrogryposis renal dysfunction and cholestasis (ARC) syndrome and the VPS33B/VPS16B complex Inherited defects in α-granule biogenesis cause bleeding disorders, including gray platelet syndrome (Gunay-Aygun et al. 2011; Kahr et al. 2013) and arthrogryposis, renal dysfunction, and cholestasis (ARC) syndrome (Lo et al. 2005; Urban et al. 2012; Bem et al. 2015). ARC syndrome is a rare autosomal recessive multisystem disorder presenting with renal tubular abnormalities, cholestasis, cerebral malformations, hypotonia, ichthyosis, dysmorphic features, congenital heart disease and bleeding diathesis (Gissen et al. 2004; Smith et al. 2012; Zhou and Zhang 2014). Intracellular protein trafficking and membrane fusion events in the nervous system,

liver, kidneys and platelets are also defective (Gissen et al. 2004). Mutations in VPS33B (Gissen et al. 2004; Lo et al. 2005) and VPS16B (Cullinane et al. 2010; Urban et al. 2012) have been identified to cause ARC syndrome (Figure 10).

Figure 10. Platelets from patients with ARC syndrome are morphologically abnormal in blood films. Neonatal platelets deficient in VPS16B appear large, homogenous, non-granular, and pale (A) compare to the neonatal control (B). Reprinted with permission from Blood (Urban et al. 2012). Copyright 2012.

To examine the molecular machinery affected by ARC, the function of VPS33B and VPS16B in polarized cargo sorting and trafficking was studied. In addition to the finding that several apical membrane proteins were mislocalized in ARC liver biopsy specimens, epithelial cells that lack VPS33B or VPS16B were discovered to be similarly affected (Cullinane et al. 2010). The VPS33B/VPS16B complex was also observed to interact with RILP (Figure 11) (Galmes et al. 2015) and Rab11a (Cullinane et al. 2010), known to be responsible in regulating protein degradation and recycling membrane/junction proteins, respectively. These data suggest the role of VPS33B/VPS16B complex in protein sorting and trafficking events associated with endo- lysosomal compartments that can be implicated in the phenotype of α-granule deficiency in ARC megakaryocytes and platelets.

Figure 11. ARC mutations disrupt VPS33B/VPS16B (VIPAS39) interactions or complex recruitment to LEs by RILP. VPS33B interacts with RILP and VPS16B (VIPAS39) through different domains. ARC mutations in the N-terminus (L30P) abrogates the VPS33B/VPS16B (VIPAS39) complex to the late endosome by RILP; ARC mutations in the C-terminus affect the assembly of the VPS33B/VPS16B (VIPAS39) complex. Both membrane targeting via RILP and VPS16B binding are required for proper VPS33B function. Reprinted with permission from Journal of Biological Chemistry (Van Der Kant et al. 2015). Copyright 2015.

Platelets isolated from ARC patients with VPS33B or VPS16B mutations display a complete loss of α-granules and their cargo proteins (Figure 12) with a slight increase in δ-granules, confirming the involvement of VPS33B and its binding partner VPS16B in α-granule formation and/or maturation processes (Lo et al. 2005; Urban et al. 2012; Bem et al. 2015). Immunofluorescence microscopy analysis showed that VPS16B possibly acts along the vesicular trafficking pathway by interacting with the TGN, LEs and α-granules during the process of α- granule biogenesis in megakaryocytes (Urban et al. 2012).

Figure 12. VPS16B is required for α-granule biogenesis. Normal control platelets contain numerous α-granules (A). Platelets from VPS16B null patients are characterized by an absence of α-granules (B). Reprinted by permission from Blood (Urban et al. 2012). Copyright 2012.

Recently a VPS33B-knockout mice study has proposed a regulatory role for VPS33B and VPS16B in sorting cargo proteins newly synthesized from the TGN to α-granule-destined MVB I and promoting their maturation into MVB II (Figure 13) (Bem et al. 2015). Immuno-electron microscopy data reveals a reduction in mature MVBs and α-granules, as well as an accumulation of empty vacuoles and MVBs containing aberrant and electron dense materials following the excision of VPS33B post-developmentally in mouse bone marrow megakaryocytes (Bem et al. 2015). Despite the ultrastructural alterations in VPS33B knockout megakaryocytes, the expression level of α-granule cargo protein Von Willebrand factor (VWF) in the VPS33B knockout megakaryocytes is not significantly different from controls (Bem et al. 2015). This provides evidence against a defect in megakaryocyte protein synthesis when VPS33B is deficient. Moreover, as flow cytometry experiments revealed similar levels of fibrinogen uptake between controls and megakaryocytes lacking VPS33B (Bem et al. 2015), VPS33B does not appear to be the direct mediator of megakaryocyte endocytosis. However, fibrinogen is not delivered to any α-granules or precursor vesicles; in fact, platelets from ARC patients with VPS33B mutations do not contain fibrinogen in their platelets (Lo et al. 2005). Therefore, the true role of VPS33B in α-granule protein endocytosis requires further investigation. Consistent with ARC syndrome, platelet aggregation and adhesion were affected in VPS33B-deficient mice (Bem et al. 2015). This phenomenon can be explained by the impaired cargo trafficking and formation of α-granules containing critical adhesion molecules. A role for VPS33B-containing complex in MVB maturation is supported by a related Drosophila study where the VPS16B homologue, full-of-bacteria (fob), was found to be a key factor for phagosome maturation (Akbar et al. 2011).

Figure 13. VPS33B/VPS16B (VIPAR) acts as a cargo regulator in alpha-granule biogenesis. VPS33B/VPS16B (VIPAR) complex is proposed to function in sorting α-granule cargo from the TGN to MVB compartments, and subsequently to mature α-granules. VPS16A and VPS33A containing complex is involved in selecting cargo destined for δ-granules. Aberrant MVB structures, small granules and empty vacuoles were observed with VPS33B deficiency. Reprinted with permission by Blood (Bem et al. 2015). Copyright 2015.

Remarkably, another recent VPS33B knockout mice study suggested that the VPS33B containing complex also contributes to integrin function modification, platelet integrin-mediated endocytosis, thrombosis and hemostasis (Xiang et al. 2015). Studies of platelets derived from VPS33B knockout mice identified a notable intersection in the role of VPS33B/VPS16B complex in trafficking/sorting α-granule cargo proteins and facilitating the transport of endocytosed protein (Xiang et al. 2015). The molecular mechanisms underlying these processes have not been identified; further work on delineating other proteins or complexes that interact with VPS33B and VPS16B containing complex is required to unveil the mystery.

1.5 Rationale and Hypothesis Molecular mechanisms of α-granule biogenesis are poorly understood, largely because few proteins have been identified that specifically function in this process. In recent years the VPS33B/VPS16B complex has emerged as a major regulator of α-granule cargo sorting and trafficking. However, it is unclear how this complex functions to promote MVB maturation and sort α-granule contents in megakaryocytes and platelets. Although a few small regulatory proteins have been previously reported to functionally interact with VPS33B, VPS33B/VPS16B has not yet been identified to interact with other multi-protein complexes that may participate in the α-granule formation pathway.

In this study I investigated the role of the VPS33B/VPS16B complex in α-granule biogenesis by identifying and examining potential binding proteins that may facilitate megakaryocyte and platelet α-granule trafficking or formation. I hypothesize that VPS33B/VPS16B complex facilitates membrane sorting and promotes vesicle tethering and fusion by interacting with other multi-protein complexes involved in intracellular vesicle trafficking pathways. By determining and characterizing additional components involved in the generation of α-granules, my research will provide new insights into the development of α-granule formation in megakaryocytes and platelets.

Chapter 2: Materials and Methods 2.1 Antibodies and plasmids Antibodies used for immunoprecipitation, immunoblotting and immunofluorescence experiments include: α-Atg2B (rabbit polyclonal, Sigma); α-GFP (rabbit polyclonal, Sigma); α-FLAG (mouse monoclonal M2, Sigma; rabbit monoclonal, Sigma); α-myc (mouse monoclonal 9E10, Covance); α-HA (Rabbit polyclonal, Bethyl); α-CCDC22 (rabbit polyclonal, Proteintech); α-CCDC132 (mouse monoclonal, Abnova); α-VPS51 (rabbit polyclonal, Sigma); α-VPS52 (rabbit polyclonal, gift from Dr. Juan Bonifacino); α-VPS53 (rabbit polyclonal, Sigma); α-COMMD1 (rabbit polyclonal, gift from Dr. Ezra Burstein; mouse monoclonal, Abnova); α-COMMD2 (rat polyclonal, gift from Dr. Ezra Burstein); α-COMMD3 (rat polyclonal, gift from Dr. Ezra Burstein); α-COMMD4 (rabbit polyclonal, gift from Dr. Ezra Burstein); α-COMMD6 (rabbit polyclonal, gift from Dr. Ezra Burstein); α-VPS16B (rabbit polyclonal, Abcam); α-VPS33B (rabbit polyclonal, Sigma); α-AP-1 (mouse monoclonal 100/3, Sigma-Aldrich); α-Lamp-1 (mouse monoclonal H4A3, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA); α-VWF (rabbit polyclonal, DakoCytomation; α-EEA1 (rabbit monoclonal C45B10, Cell Signalling Technology); α-Rab 7 (rabbit polyclonal, Cell signaling Technology); and α- CD63 (mouse monoclonal H5C6, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA).

Plasmids used for BioID experiments were pcDNA5/FRT/TO (Invitrogen Life Technologies) and pOG44 (Invitrogen Life Technologies). Plasmids used for co-immunoprecipitation experiments were pCMV-Myc and pCMV-HA (BD biosciences), pEGFP-C1 (BD biosciences), and p3xFLAG-CMV-14 (Sigma).

2.2 Cloning All cloning was performed using the same protocol; for each reaction, different restriction enzymes and buffers were used accordingly. The inserts were amplified via polymerase chain reaction (PCR) using Pfu Ultra II Fusion HS DNA polymerase (Agilent Technologies) from cDNAs ordered from Origene or constructs previously generated in the lab. Taq DNA polymerase (NEB) was specifically used for colony PCR reactions. The primers used for the

PCR reactions were designed and ordered from IDT Integrated DNA Technologies. PCR products were purified using the DNA purification kit (Macherey-Nagel) according to the protocol for gel extraction (10% agarose gel) or PCR clean up stated in the manufacture’s user manual. Following purification, the PCR products and vectors were digested with restriction enzymes (NEB) in the corresponding buffer for 2 hours and dephosphorylated with calf intestinal phosphatase (CIP) (NEB) for 30 minutes. The digested vectors were again purified using the DNA purification kit. Ligation reaction between the digested inserts and vectors were catalyzed by T4 DNA ligase (NEB) in T4 DNA ligase reaction buffer for 2-3 hours at room temperature. The ligation products were then transformed into competent DH5α E.coli cells, which were plated on Lysogeny Broth (LB) plates containing the required antibiotic for selection and left in the 37°C incubator overnight. Selected colonies were grown in liquid LB containing the required antibiotic overnight in the 37°C incubator. DNA was extracted using the Presto Mini Plasmid kit (Geneaid) according to the user manual.

The coding sequence of full length human HA-VPS33B and HA-VPS16B were amplified by PCR and each subcloned from pCMV-HA using EcoRI and NotI restriction sites into pcDNA5/FRT/TO-FLAG-BirA* and pcDNA5/FRT/TO-BirA*-FLAG expression vectors (Invitrogen Life Technology) obtained from Dr. Ling Li. The coding sequence of full length human VPS51 and VPS53 were amplified by PCR and each subcloned from pCMV6-AC and pCMV6-XL5 respectively using EcoRI and KpnI restriction sites into p3xFLAG-CMV expression vector. The coding sequence of full length pCMV6-XL4-CCDC22 was amplified by PCR and subcloned from pCMV-LX4 using EcoRI and KpnI restriction sites into p3xFLAG- CMV14 and peGFP-C1 expression vector. The coding sequence of VPS33B fragments were amplified by PCR from full length eGFP-VPS33B and subcloned into pCMV-HA using EcoRI and KpnI.

2.3 Cell cultures and transfections All cells were maintained in 37ºC and 5% CO2. Human embryonic kidney (HEK293) cells, Flp- In HEK293 cells, HEK293 expressing stable amount of 3xFLAG tagged VPS16B, VPS33B, VPS51 or VPS53 were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Wisent Bioproducts), supplemented with 8% v/v fetal bovine serum (FBS) (Wisent Bioproducts). The media of stable cell lines were also supplemented with 2 mg/mL of G418. Transfection of

plasmids in HEK293 cells was performed with jetPRIME reagents (Polyplus Transfection) when the cells reached 90% confluency in 6-well plates, using 1μg of DNA and 3μl of reagent (1:3 ratio) and 200μL of jetPRIME buffer. GFP tagged VPS16B and VPS33B stable expressing Dami cells were cultured in Iscove’s Modification of DMEM (Wisent Bioproducts) supplemented with 10% horse serum (Wisent Bioproducts). The media of stable cell lines were also supplemented with 2mg/mL of G418. Transfection of plasmids in Dami cells were performed by electroporation using Amaxa Nucleofector kits and devices as described by the manufacturer (Lonza). Dami cells were induced by supplementing growth media for 3 days with 1μM of phorbol 12-myristate 13-acetate (PMA; Invitrogen) and 50ng/μL thrombopoietin (TPO; Kirin) post-transfection for localization/co-localization experiments. siRNA transfection against VPS51, VPS52, VPS53, CCDC22, and COMMD1 in HEK293 cells was performed with jetPRIME siRNA transfection reagents when cells plated were at approximately 50% confluency in 6-well plates, using 22pmol siRNA in the presence of and 4μl of reagent and 200μL of jetPRIME buffer. All transfected cells were harvested and lysed 48-72 hours after transfection.

Stable HEK293 cells expressing 3xFLAG-VPS53 were generated by transfecting the p3xFLAG- VPS53 construct as described above. The transfected cells were treated with 10 mg/mL of G418. Isolated G418 resistant colonies were selected from 96 well plates. Individual clones were assayed through immunoblotting with anti-FLAG antibody.

FLP-ln HEK293 cell line stably expressing FLAG-BirA*-VPS33B, VPS33B-BirA*-FLAG, FLAG-BirA*-VPS16B, and VPS16B-BirA*-FLAG were generated using the Flp-In system (Invitrogen). For each constructs (pcDNA5/FRT/TO-FLAG-BirA*-VPS33B, pcDNA5/FRT/TO- VPS33B-BirA*-FLAG, pcDNA5/FRT/TO-FLAG-BirA*-VPS16B or pcDNA5/FRT/TO- VPS16B-BirA*-FLAG), 1μg of DNA of pcDNA5 FRT/TO plasmid and 2μg of pOG44 were mixed in 2μL of jetPRIME reagent and 200μL of jetPRIME buffer. The transfection mix was added to the cell wells dropwise following 10 minutes of incubation at room temperature. Transfected cells were incubated for 48 hours and then passed into 10cm dishes. Hygromycin B (200μL/mL) was added to the culture media 24 hours following incubation and cells were incubated until massive cell death was observed. The media was then replaced every 3-4 days until the antibiotic resistant colonies grew until approximately 3mm in diameter. The

Hygromycin B resistant cells were then trypsinized, spread homogenously, and maintained on 10cm dishes.

2.4 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE) and Western blotting HEK293 or Dami cell lysates were boiled in SDS-sample buffer (20% v/v glycerol, 1% v/v β- mercaptoethanol, 2% w/v SDS, 65 mM Tris-HCl, pH 6.8, 0.001% Bromophenol Blue) at 95°C for 10 minutes at 200V, separated by SDS-PAGE and transferred to nitrocellulose membrane at 100V for 1 hour or 30V overnight.

Immunoblotting was performed with nitrocellulose membranes blocked with 5% bovine serum albumin (BSA) or 5% skim milk powder in tris buffered saline (TBS) (20 mM Tris-HCl, pH 7.6, 137 mM NaCl) with 0.05% Tween-20 (TBS-T) for 1 hour, followed by incubation with primary antibody for either one hour at room temperature or overnight at 4°C. The blots were then washed 3 times in TBS-T at 5 minutes intervals, and then incubated in blocking buffer containing appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at room temperature. The blots were again washed for three times, 10 minutes each. Prior to imaging using the LI-COR Odyssey Infrared imaging system (LI-COR, Biosciences, Lincoln, NE, USA), the blots were treated with enhanced chemiluminescence (ECL) reagents for 1 minute. Quantitative analysis of western blot data was performed using LI-COR image studio software v5.2 (SickKids Imaging Facility).

Biotinylated proteins of the Flp-In HEK293 cells were detected similarly with the following modification. Membranes were blocked in 5% bovine serum albumin in TBS-T and incubated in the same blocking buffer with HRP-conjugated streptavidin following primary antibody incubation and washes (1:40000; Invitrogen).

2.5 BioID assay

Flp-In HEK293 cells were treated with 1 μg/ml tetracycline and 50μM biotin 24 hours prior harvesting. Flp-In HEK293 cells collected from 10 cm plate were scraped down in their media; the cells collected were kept on ice. The cells were centrifuged at 1500rpm for 5 minutes and the pellets were washed with 4°C Phosphate-buffered saline (PBS) for 3 times. The washed dry

pellets were then snap frozen and stored at -80°C. Cell lysis, solubilization, and affinity purification of biotinylated proteins were performed by Dr. Brian Raught’s lab. The eluted protein peptides were analyzed by mass spectrometry (MS).

2.6 Protein identification by mass spectrometry Liquid chromatography (LC)-MS/MS was conducted by Dr. Etinne Coyaud from Dr. Brian Raught’s lab. Untransfected HEK293 Flp-In Cells were used as negative controls. Two technical replicates, each with 14 runs, were conducted on the untransfected cells and the cells expressing the protein of interest. MS data were analyzed with the X! Tandem database search algorithm using the ProHits system. The identified peptides were then validated by ProteinProphet analysis. The potential protein interactors identified were subjected to Significance Analysis of INTeractomes (SAINT). Only the polypeptides with a SAINT score > 0.8 are listed in Table 3 and studied.

2.7 Blue native PAGE (BN-PAGE) and sample preparation Cell samples were prepared in NativePAGE lysis buffer (25 mM HEPES pH 7.4, 0.25 M sucrose, 1 mM EDTA, 1 mM DTT, 1x protease inhibitor cocktail). Following immunoprecipitation, M2 Affinity Gel beads (Sigma A2220) bound proteins were eluted by the addition of lysis buffer containing 100μg/mL 3xFLAG peptides (Sigma). The eluted samples in lysis buffer were added to spin desalting columns (Thermo Fisher Scientific) for desalting and buffer exchange as per the manufacture’s specifications. The protein samples, collected in NativePAGE sample buffer (50 mM BisTris, 6 N HCl, 50 mM NaCl, 10% w/v Glycerol, pH 7.2), were then loaded in the 4-16% Bis-Tris Gel (NativePAGE Novex, Invitrogen Life Technology) wells that were rinsed with 1x running buffer (50 mM BisTris, 50 mM Tricine, pH 6.8). A Blue Native gel ladder was used to determine the approximate size of the protein complex (NativeMark Unstained Protein Standard, Invitrogen). The upper buffer chamber (inner) was filled with 200mL of dark 1x cathode buffer (1x running buffer, 0.04% Coomassie G-250) and the lower buffer chamber (outer) was filled with 600mL of the 1x anode buffer (1x running buffer) before performing electrophoresis. The dark 1x cathode buffer was replaced with the light 1x cathode buffer (1x running buffer, 0.004% Coomassie G-250) when the dye front migrated to 1/3 of the gel. Electrophoresis was performed at room temperature at 150V for 120- 150 minutes. The proteins were then transferred onto PVDF membrane for 1 hour in transfer

buffer (25 mM Bicine, 25 mM Bis-Tris, 1 mM EDTA, pH 7.2). The ladder was stained separately in Coomassie R-250 following electrophoresis. The NativePAGE gel was fixed in fix solution (40% methanol, 10% acetic acid) and microwaved for 45 seconds. The gel was then placed on an orbital shaker for 15-30 minutes before the step was repeated. Following fixation, the gel was stained (0.02% Coomassie R-250, 30% methanol, 10% acetic acid) and microwaved for 45 seconds. The gel was again left in the staining solution for 15-30 minutes on an orbital shaker. Then, the gel was destained in destain solution (8% acetic acid) and microwaved for 45 seconds. The gel was then left in the solution on the orbital shaker until the desired background was obtained. 2.8 Immunoprecipitation HEK293 and Dami cells were grown in 6-well plate, harvested 48-72 hours post-transfection in non-denaturing lysis buffer (50 mM Tris HCl, pH 7.4, with 150 mM NaCl, 1 mM EDTA and 1% NP-40, supplemented with 1x Protease inhibitor cocktail (Sigma)). Lysates collected from centrifugation were pre-cleared with appropriate IgG beads for 1 hour at 4°C on an end-over-end rotator. The pre-cleared lysates were then added to washed protein G beads bound to appropriate antibodies or M2 Affinity Gel beads (Sigma A2220) for FLAG pulldown on an end-over-end rotator for 2 hours at 4°C. Beads were pelleted by centrifugation and washed for three times with lysis buffer; a final wash was performed using PBS. The proteins bound to beads were eluted by the addition of 2x SDS-sample buffer followed by 10 minutes boiling.

2.9 Immunofluorescence microscopy Dami cells stably expressing GFP-VPS16B or GFP-VPS33B transiently transfected with 3xFLAG tagged VPS51, 3xFLAG-VPS53, myc-DDK-COMMD1, myc-DDK-COMMD6, or 3xFLAG-CCDC22 were grown on glass coverslip. Cells were fixed in 4% paraformaldehyde (PFA) for 30 minutes at room temperature, followed by three consecutive washes with PBS. The fixed cells were then permeabilized with 0.1% Triton X-100 for 30 minutes, again followed by three washes with PBS. The cells were blocked (1% BSA, 2% HS, in PBS) for 40-60 minutes. Cover slips were then incubated in primary antibody solution (1% BSA) for 1 hour at room temperature or 4°C overnight, followed by three washes with PBS. This was then followed by secondary antibody incubation in the blocking solution containing appropriate fluorophore tagged secondary antibody for 1 hour at room temperature. Cover slips were treated with DAPI

solution (% DAPI), and washed three times in PBS, 20 minutes each time. The fixed samples were mounted on microscope slides in a drop of DAKO fluorescence mounting medium (DakoCytomation). Laser fluorescence images were acquired on a Quorum spinning-disk confocal microscope, equipped with an SD 60X oil objective (Olympus), using Volocity acquisition software. Serial optical sections were set at 0.3 μm intervals and the Iterative Restoration function of Volocity 6.3 was utilized to deconvolve images. Statistical co- localization analysis was performed on multiple images using Volocity 3D imaging software as well (SickKids Imaging Facility).

2.10 Sequence of siRNA and CRISPR oligos The sequence of siRNA targeted against VPS50, VPS51, VPS52, VPS53, CCDC22, and COMMD1 are given below. siRNA sequences Gene target (human) Oligo sequence VPS50 AGAACAGAUGUACGGUUAA VPS51 GCUAUUCUCUGAACGUAUU VPS52 GUAGAUCUCCGUCACUAUUUU VPS53 GGAUGUAAGUCUGAUUGAAUU VPS54 CCAGAUCUCUCUUACGUUCAUU CCDC22 CCAAGACUGGUGCUCCUAA COMMD1 AAGUCUAUUGCGUCUGCAGAC Negative control UUCUCCGAACGUGUCACGUTT

Table 1. siRNA sequence utilized. The sequence of the CRISPR oligos used are given below; the sequences are designed using online tools developed by Feng Zhang and colleagues (http://crispr.mit.edu/). The sense oligos are listed for each reaction.

CRISPR oligo sequences Gene target (human) Oligo sequence VPS51 CACCGGGGTGGCTCGGGAGCGTCGG CACCGGAAGCTTTACTACGGCCTCT CACCGGGGATGCTGAAGCTTTACTA VPS52 CACCGGGCCCGGGTTCTCCTGTTGCC CACCGGGCCGCCGCTGCGACCATGG CACCGCGGGAACTGGTGTTGCGGGC VPS53 CACCGGCACACGCCCGTCCTGCAGC

CACCGCGTGCTGCAGCTCACGCCCG CACCGGGAGGAACTGGAGTTCGTGG VPS54 CACCGGAGGCACTGGTGTTGTTCTG CACCGGGACACACTAGTCCCAGTGA CACCGACTGCCAGATGTGTGTCCCA CCDC22 CACCGCCTCATCCATTCGCTGCGCC CACCGATCCATTCGCTGCGCCAGGC CACCGCCTGGCGCAGCGAATGGATG COMMD1 CACCGATGGCGGCGGGCGAGCTTGA CACCGCGCATTCAGCAGCCCGCTCA CACCGCGGGTACCCCGGCATCACAG

Table 2. CRISPR oligo sequences synthesized.

Chapter 3: Results 3.1 BioID screen of VPS33B and VPS16B potential interacting proteins The structural nature of the VPS33B/VPS16B complex suggests that the proteins may interact with other transport machineries to achieve its putative cargo sorting and trafficking functions in megakaryocyte α-granule biogenesis. In order to further characterize the role of VPS33B/VPS16B complex in α-granule formation, BioID screen linked to mass spectrometry was conducted to identify potential VPSS33B and/or VPS16B interacting proteins that are endogenously expressed in HEK293 Flp-In cells.

3.1.1 BioID cloning and the generation of BioID stable cell lines VPS33B and VPS16B were each cloned into the pcDNA5/FRT/TO-FLAG-BirA* and pcDNA5/FRT/TO- BirA*-FLAG vectors expressing the mutant form of BirA. BirA mutant is harnessed to prevent the stringent selectivity of wildtype BirA by prematurely releasing labile bioAMP that reacts with adjacent primary amines. These constructs were transfected into HEK293 Flp-In cells to generate stable cell lines (Figure 14).

Figure 14. Model of BioID stable cell generation. To identify candidate proteins that associate with VPS33B or VPS16B, I used HEK293 Flp-In cells stably expressing inducible FLAG- BirA*-VPS33B, BirA*-FLAG-VPS33B, FLAG-BirA*-VPS16B, and BirA*-FLAG-VPS16B.

To validate the expression of BioID fusion proteins and to determine whether BirA* could be used as a tool to identify vicinal proteins in vivo, stable expressing Flp-In HEK293 cells were induced by 50 μM of biotin for 48 hours and tetracycline for 24 hours before harvesting. Nontransfected Flp-In HEK293 cells, processed in parallel, were used as a control. The expression of both N-terminal and C-terminal tagged VPS33B and VPS16B, in the presence of tetracycline, were detected by Western blots probed with mouse anti-FLAG antibody (Figure 15A). Western blots showed that the fusion proteins were only expressed when tetracycline was treated and VPS33B fusion protein has a higher expression than VPS16B fusion protein in Flp-In HEK293. Interestingly, BirA*-FLAG-VPS16B appears to be smaller than VPS16B-FLAG- BirA* on the membrane (Figure 15A), post-translational modification of the tagged protein could be a contributing factor for this discrepancy. The biotinylation of endogenous proteins in cells expressing the fusion protein, in the presence of exogenous biotin, was monitored on western blots probed with streptavidin-HRP (Figure 15B). These results suggest that BirA* is able to biotinylate endogenous proteins when biotin is available in the media.

(A) 130

90 IB: Anti-FLAG (B)

250 130 90 72

55 IB: Anti: Streptavidin-HRP

Figure 15. Proximity-dependent promiscuous biotinylation by BioID-VPS33B and BioID- VPS16B. Flp-In HEK293 cells inducibly expressing BioID fusion proteins and nontransfected control cells, were analyzed 48 hours after induction with excess biotin (50 μM) and 24 hours after tetracyclin (1 μg/ml) treatment. By immunoblot analysis the VPS33B and VPS16B fusion proteins are detected with anti-FLAG (A). The expression of BioID fusion proteins leads to biotinylation of endogenous proteins. Whole cell lysates were subjected to SDS-PAGE and immunoblotted with streptavidin-HRP (horseradish peroxidase; B).

In addition, the ability of the BirA* tagged VPS33B and VPS16B fusion proteins to form VPS33B/VPS16B complex in the stable cells was also examined. Mass spectrometry and purification studies previously done in our lab (Anson Chen) revealed that VPS33B and VPS16B together form an unique 480 kDa complex. Therefore, the affinity captured BirA* fusion proteins were ran on Blue native PAGE. The results showed that the BirA* tag does not interfere with the 480 kDa complexes forming ability of both VPS33B and VPS16B (Figure 16).

1236 1048

720

480

242 IB: Anti-FLAG

146

Figure 16. BirA* tag does not disrupt VPS33B/VPS16B complex formation. Lysates from HEK293 Flp-In cell lines stably expressing BirA* fusion VPS33B or VPS16B were resolved on BN-PAGE. Western blotting was performed using antibody against FLAG. The 480 kDa complex was not disrupted by the presence of BirA* tag. The two blots were cut from the same nitrocellulose membrane.

3.1.2 BioID mass spectrometry results To identify potential VPS33B and VPS16B binding proteins, I performed a BioID screen by stably expressing a BioID-fusion protein, along with nonexpressing control cells, to perform large-scale BioID pull-down experiments. Biotinylated endogenous proteins were isolated and analysed by mass spectrometry (MS). MS data were analysed with the X!Tandem database search algorithm using the ProHits system. The identified peptides were validated by ProteinProphet analysis. Two technical replicates, each with 14 runs, were performed for each BirA* fused interactor. The data were subjected to Significance Analysis of INTeractomes (SAINT) to identify potential interacting partners. Only the polypeptides with a SAINT score > 0.8 are listed in Table 3 and Table 4.

Table 3: VPS33B BioID data profile of polypeptides with a SAINT score > 0.8. Data are presented as spectral counts detected for each prey protein. Two technical replicates of mass spectrometry analysis, each with 14 runs, were performed on each bait protein (N- and C-terminal FLAG-BirA* tagged VPS33B). The SAINT score compares the experimental samples with the BirA* only control (3 highest peptide counts among 14 runs for each given interactors are shown).

Table 4: VPS16B (C14orf133) BioID data profile of polypeptides with a SAINT score > 0.8. Data are presented as spectral counts detected for each prey protein. Two technical replicates of mass spectrometry analysis, each with 14 runs, were performed on each bait protein (N- and C-terminal FLAG- BirA* tagged VPS16B). The SAINT score compares the experimental samples with the BirA* only control (3 highest peptide counts among 14 runs for each given interactors are shown).

Proteins from coiled-coil domain containing family, golgin subfamily, GARP and EARP complexes were identified as potential interactors of VPS33B and/or VPS16B (Table 5).

Subgroup VPS33B VPS16B Vesicular sorting CCC complex CCDC22 and trafficking COMMD1 COMMD2 COMMD3 COMMD4 COMMD6 COMMD8 GARP/EARP CCDC132 (VPS50) complex C11orf2 (VPS51) VPS53 Golgin GOLGA5 C14orf133/VPS16B SM protein VPS33B KDELR1 Antophagy related ATG2B CAPNS1 proteins Actin cytoskeleton NudC family NUDC regulator NUDCD3 NUDCD2 NDC80 SPC24 kinetochore complex HAUS complex HAUS4 SUGT1 (SGT1) SUGT1 (SGT1) SKA1 SKA1 RAE1 UNC45A FKBP4 UXT AAA + family R2TP complex WDR92 ATPases associated PIH1D1 proteins RPAP3 Phosphoinositide MIS18A NISCH Regulators IRS4 Ubiquitination BIRC6 URI1 regulators TBK1 BAG2 EGLN1 GTPase ABR

Miscellaneous PSMC2 POLR2E SUPT16H GLMN LOC649330 DPCD SSRP1 ELOVL5 TOP2B CAD CES1 PDRG1 ASCC3 KIAA1279 SIRT2 AIP PRKAB1 PRKAB1 ILF2 USMG5 PDCL EIF2AK2 RALY PSMD12 PTBP3 MKL1 USMG5 DNAJA1 DNAJA2

Table 5. Categorization of candidate binding proteins identified by BioID.

3.2 Confirmation of BioID identified potential interactions From the interactions identified by the BioID screening, several potential interactors were selected for further experiments. The selection was based on the function of the proteins in intracellular trafficking based on the information revealed in published literatures. The hits identified were also compared with the screening results obtained from a previous graduate students in our laboratory using a different screening assay.

3.2.1 GARP subunits interact with VPS33B and VPS16B A yeast three hybrid assay (Y3H) done by a previous graduate student identified VPS52 as a potential binding partner of VPS33B or VPS16B using VPS16B as the bait and VPS33B as the bridge. Since VPS51, VPS52, and VPS53 are core components of GARP and EARP complexes, I decided to confirm the interaction between VPS16B and its putative interactors, C11orf2 (VPS51) and VPS53, by co-immunoprecipitation experiments. The GFP tagged VPS16B and 3xFLAG tagged VPS51 or VPS53 were transiently expressed in HEK293 cells by transfection. The cell lysates were collected 48 hours after transfection and immunoprecipitated using M2 FLAG affinity gel beads. Anti-FLAG immunoprecipitation followed by anti-GFP immunoblotting showed binding of VPS16B to VPS51 and VPS53 (Figure 17). In addition,

immunoprecipitation may have pulled down post-translationally modified proteins, which may be the reason why the IP bands appear to be higher than the input bands.

FLAG IP FLAG

FLAG IP FLAG IP FLAG

- -

Input IP mIgG anti Input IP mIgG anti Input IP mIgG Anti

3xFLAG-VPS53 3xFLAG-VPS51 nontransfected + GFP-VPS16B + GFP-VPS16B HEK293

IP: Anti-FLAG IB: Anti-GFP

IB: Anti-FLAG

Figure 17. Co-immunoprecipitation of 3xFLAG-VPS51 and 3xFLAG-VPS53 with GFP- VPS16B. 3xFLAG VPS fusion proteins and GFP-VPS16B were transiently expressed in HEK293 cells. Cells were harvested 48 hours after transfection. Immunoprecipitation was performed using anti-FLAG antibody and elutions were probed with rabbit anti-GFP antibody. Both VPS51 and VPS53 appear to interact with VPS16B.

To further examine the specificity of the interaction I identified from co-immunoprecipitation experiments of transiently transfected GFP-VPS16B and 3xFLAG tagged VPS51 or VPS53 in HEK293 cells, I performed endogenous Co-IP experiments on 3xFlag tagged VPS16B or VPS33B stable expressing HEK293 cells. The cell lysates were immunoprecipitated using M2 FLAG affinity gel beads. Anti-FLAG IP followed by anti-VPS51, VPS52, and VPS53 immunoblotting showed specific binding of VPS16B (Figure 18) and VPS33B (Figure 19) to the GARP/EARP subunits. The interactions, however, appear to be weak and possibly transient in nature. In addition, the interaction between the 3xFLAG tagged VPS16B or VPS33B and EARP-specific subunit VPS50 (also known as CCDC132 or syndetin) was not detected (Figure 18, 19). More studies are required to examine the interactions between VPS16B or VPS33B and VPS50.

3xFLAG-VPS16B 293 Stable IP: Anti-FLAG

Input IP mIgG Input IP mIgG

IB: Anti-VPS51 IB: Anti-VPS52

IB: Anti-FLAG IB: Anti-FLAG

Input IP mIgG Input IP mIgG IB: Anti-VPS53 IB: Anti-VPS50

IB: Anti-FLAG IB: Anti-FLAG

Figure 18. Co-immunoprecipitation of endogenous GARP/EARP subunits with 3xFLAG- VPS16B. Immunoprecipitations were performed using anti-FLAG antibody and elutions were probed with rabbit anti-VPS51, anti-VPS52, anti-VPS53, and anti-VPS50 antibodies. VPS51, VPS52, and VPS53 appear to interact with VPS16B.

3xFLAG-VPS33B 293 Stable IP: Anti-FLAG

Input IP mIgG

IB: Anti-VPS51

IB: Anti-VPS52 IB: Anti-VPS50

IB: Anti-VPS53 IB: Anti-FLAG

IB: Anti-FLAG

Figure 19. Co-immunoprecipitation of endogenous GARP/EARP subunits with 3xFLAG- VPS33B. Immunoprecipitations were performed using anti-FLAG antibody and elutions were probed with rabbit anti-VPS51, anti-VPS52, anti-VPS53, and anti-VPS50 antibodies. VPS51, VPS52, and VPS53 appear to interact with VPS33B.

3.2.2 CCC complex subunits, COMMDs and CCDC22, interact with VPS33B and VPS16B Affinity purification studies done by Burstein et al. discovered the early endosome-associated CCC complex that is essential for regulating protein recycling. Therefore, from the potential interactions identified by the BioID screen, CCDC22, COMMD1, 2, 3, 4, and 6 were selected for confirmation by co-immunoprecipitation experiments. The lysate of HEK293 cells stably expressing 3xFLAG VPS33B were collected and immunoprecipitated using M2 FLAG affinity gel beads. Anti-FLAG IP followed by anti-CCDC22, COMMD1, 2, 3, 4, and 6 immunoblotting showed specific binding of VPS33B to CCDC22, COMMD1, and COMMD6 (Figure 20). The same co-immunoprecipitation experiment was conducted on lysate of HEK293 cells stably expressing 3xFLAG VPS16B; CCDC22 also appeared to interact with VPS16B (Figure 21).

3xFLAG-VPS33B 293 Stable IP: Anti-FLAG

Input IP mIgG

IB: Anti-CCDC22

IB: Anti-COMMD1

IB: Anti-COMMD2

IB: Anti-COMMD3

IB: Anti-COMMD4

IB: Anti-COMMD6

IB: Anti-FLAG

Figure 20. Co-immunoprecipitation of endogenous CCDC22 and COMMD proteins with 3xFLAG-VPS33B. Immunoprecipitations were performed using anti-FLAG antibody and elutions were probed with rabbit anti-CCDC22, anti-COMMD1, 2, 3, 4, and 6 antibodies. CCDC22, COMMD1, and COMMD6 all appear to interact with VPS33B.

3xFLAG-VPS16B 293 Stable IP: Anti-FLAG

Input IP mIgG

IB: Anti-CCDC22

IB: Anti-FLAG

Figure 21. Co-immunoprecipitation of endogenous CCDC22 with 3xFLAG-VPS16B. Immunoprecipitations were performed using anti-FLAG antibody and elutions were probed with rabbit anti-CCDC22, anti-COMMD1, 2, 3, 4, and 6 antibodies. CCDC22 appears to interact with VPS16B.

3.2.3 Atg2B is a potential binding partner of VPS33B From the potential interaction identified by the BioID screen, Atg2B was also selected for confirmation by co-immunoprecipitation experiment. The lysate of HEK293 cells stably expressing 3xFLAG VPS33B were collected and immunoprecipitated using M2 FLAG affinity gel beads. Anti-FLAG IP followed by anti-Atg2B immunoblotting showed specific binding of VPS33B to Atg2B (Figure 22).

3xFLAG-VPS33B 293 Stable IP: Anti-FLAG

Input IP mIgG

IB: Anti-Atg2B

Figure 22. Co-immunoprecipitation of endogenous Atg2B with 3xFLAG-VPS33B. Immunoprecipitations were performed using anti-FLAG antibody and elutions were probed with rabbit anti-Atg2B antibody. Atg2B appears to interact with VPS33B.

3.3 Examination of HEK293 cells treated with siRNA against GARP/EARP and CCC complex components Given that GARP/EARP and CCC complex deficiency in mammalian cells show alteration in intracellular anterograde and/or retrograde trafficking, the question arises of whether GARP/EARP and CCC complexes are required for proper transport or recycling of VPS33B/VPS16B complex in megakaryocytes.

To address this question, a siRNA approach was employed to deplete GARP/EARP and CCC subunits in HEK293 cells. A number of siRNA sequences were screened, however knockdown effect could not be achieved (Figure 23). Studies were conducted with sequences purchased from Shanghai GenePharma.

Scramble siRNA Scramble siRNA

IB: rabbit-VPS51 IB: rabbit-CCDC22

IB: mouse-GAPDH IB: mouse-β-actin

Scramble siRNA Scramble siRNA

IB: rabbit-VPS52 IB: rabbit-COMMD1

IB: mouse-GAPDH IB: mouse-β-actin

Scramble siRNA

IB: rabbit-VPS53

IB: mouse-GAPDH

Figure 23. siRNA-mediated knockdown of VPS33B in HEK293 cells. Cells were harvested 48h post-transfection. All siRNA knockdown of target proteins were inadequate.

3.4 Examination of GARP/EARP and CCC complexes in megakaryocytic cell lines Studies in our laboratory have demonstrated the presence of VPS16B and VPS33B in the proximity of TGN, late endosomal, and α-granule markers (Lo et al. 2005; Urban et al. 2012). Due to the lack of anti-VPS33B and anti-VPS16B antibodies for IF microscopy, Dami cell lines expressing stable levels of GFP-VPS33B or GFP-VPS16B (generated by Dr. Denisa Urban) were used to determine the co-localization pattern between the interactions identified by the BioID assay. The interactions between VPS16B and GARP/EARP component, VPS52 and VPS53, in Dami cells were verified by co-immunoprecipitation experiment (Figure 24). Dami and imMKCL cells were used to determine the localization of the GARP/EARP and CCC complexes in megakaryocytic cell lines.

PIRES-GFP-VPS16B DAMI stable

Input IP IgG

IB: VPS53

IB: VPS52

IB: GFP

Figure 24. Co-immunoprecipitation of endogenous GARP/EARP subunits with PIRES- GFP-VPS16B in Dami cells. Immunoprecipitations were performed using anti-GFP antibody and elutions were probed with rabbit anti-VPS52 and anti-VPS53 antibodies. VPS52 and VPS53 appear to interact with VPS16B in Megakaryocytic Dami cells.

VPS16B

3.4.1 GARP/EARP complex components co-localizes with VPS33B and VPS16B in Dami cells Since our anti-VPS51 and anti-VPS53 antibodies were not adequate for IF microscopy, 3xFLAG tagged VPS51 and VPS53 were transiently expressed in Dami (megakaryocytic cell line) cells expressing stable levels of GFP tagged VPS16B or VPS33B to determine the localization of VPS51 and VPS53 in megakaryocytes and platelets. These studies were done in triplicate where multiple cells were examined and representative images were taken. Consistent partial co- localization of GFP-VPS16B and 3xFLAG tagged VPS51 and VPS53 (Figure 25) were observed. GFP-VPS33B also appeared to partially co-localize with 3xFLAG tagged VPS51 and VPS53 (Figure 26). The Pearson co-localization coefficients are indicated in Table 6.

VPS16B VPS51 Merge

VPS16B VPS53 Merge

Figure 25. 3xFLAG tagged VPS51 and VPS53 partially co-localizes with GFP-VPS16B within megakaryocytic Dami cells stably expressing GFP-VPS16B. Merged (yellow) images are shown on the right of each row. Partial co-localization (merge) of GFP-VPS16B (green) and 3xFLAG-VPS51 (red) or GFP-VPS16B and 3xFLAG-VPS53 (red) were observed. Representative z-stack images are shown.

VPS33B VPS51 Merge

VPS33B VPS53 Merge

Figure 26. 3xFLAG tagged VPS51 and VPS53 partially co-localizes with VPS33B within megakaryocytic Dami cells stably expressing GFP-VPS33B. Merged (yellow) images are shown on the right of each row. Partial co-localization (merge) of GFP-VPS33B (green) and 3xFLAG-VPS51 (red) or GFP-VPS33B and 3xFLAG-VPS53 (red) were observed. Representative z-stack images are shown.

Dami stably expressing GFP-VPS16B Protein n Pearson’s correlation coefficient (PCC),

mean ± SD (range) VPS51 20 0.503±0.13* (0.204-0.691) VPS53 20 0.563±0.105* (0.383-0.765) Dami stably expressing GFP-VPS33B Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) VPS51 20 0.454±0.14* (0.247-0.666) VPS53 20 0.493±0.10* (0.266-0.700)

Table 6. Co-localization quantification. Proteins are red and GFP-VPS16B/GFP-VPS33B green as shown in Figures 25 and 26. n = number of cells analyzed. *PCC representing co- localization.

3.4.2 GARP/EARP complex component co-localize with markers of the α-granule biogenesis pathway in Dami cells Studies from previous research have demonstrated the presence of GARP complex in the proximity of TGN and EARP complex in the proximity to recycling endosomes in mammalian cells (Pérez-Victoria and Bonifacino 2009; Schindler et al. 2015). Co-localization studies with intracellular vesicular marker proteins revealed that VPS51 (Figure 27) and VPS53 (Figure 28) partially co-localized with the TGN marker AP-1, the late endosomal marker Rab7, the α-granule marker VWF, but not the LE/lysosomal marker LAMP-1 or the δ-granule/lysosome marker CD63. The Pearson co-localization coefficients are indicated in Table 7.

VPS51 AP-1 Merge

Dami + 3xFLAG-

VPS51 Rab7 Merge

VPS51 VWF Merge

VPS51 LAMP-1 Merge

VPS51 CD63 Merge

Figure 27. Localization of 3xFLAG tagged VPS51 within megakaryocytic Dami cells stably expressing GFP-VPS16B. Dami cells transfected with 3xFLAG-VPS51 (red) were co-stained with different intracellular markers (green) as indicated. Partial co-localization (merge) of 3xFLAG VPS51 is observed with the TGN (AP-1), late endosomes (Rab7), α-granules (VWF) but not late-endosomes/lysosomes (LAMP-1) and δ-granules (CD63). Representative z-stack images are shown.

VPS53 AP-1 Merge

VPS53 Rab7 Merge

VPS53 VWF Merge

VPS53 LAMP-1 Merge

VPS53 CD63 Merge

Figure 28. Localization of 3xFLAG tagged VPS53 within megakaryocytic Dami cells stably expressing GFP-VPS16B. Dami cells transfected with 3xFLAG-VPS53 (red) were co-stained with different intracellular markers (green) as indicated. Partial co-localization (merge) of 3xFLAG VPS53 is observed with the TGN (AP-1), late endosomes (Rab7), α-granules (VWF) but not late-endosomes/lysosomes (LAMP-1) and δ-granules (CD63). Representative z-stack images are shown.

Dami transfected with 3xFLAG-VPS51

Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) AP-1 20 0.435±0.092* (0.347-0.767) Rab 7 20 0.392±0.127* (0.336-0.588) VWF 20 0.407±0.027* (0.351-0.453) LAMP-1 20 0.106±0.026 (0.066-0.172) CD63 20 0.088±0.015 (0.065-0.12) Dami transfected with 3xFLAG-VPS53 Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) AP-1 20 0.482±0.059* (0.374-0.556) Rab 7 20 0.38±0.049* (0.316-0.453) VWF 20 0.379±0.096* (0.226-0.578) LAMP-1 20 0.0355±0.016 (0.006-0.058) CD63 20 0.0922±0.06 (0.012-0.15)

Table 7. Co-localization quantification. Proteins are green and 3xFLAG-VPS51/3xFLAG- VPS53 red as shown in Figures 25 and 26. n = number of cells analyzed. *PCC representing co- localization.

3.4.3 CCC complex components co-localizes with VPS33B in Dami cells To determine the localization of COMMD1, COMMD6, and CCDC22 in megakaryocytes and platelets, DDK tagged COMMD1, COMMD6 and 3xFLAG tagged CCDC22 were transiently expressed in Dami cells expressing stable levels of GFP tagged VPS33B. These studies were done in triplicate where multiple cells were examined and representative images were taken. Consistent partial co-localization of GFP-VPS33B with DDK tagged COMMD1 (Figure 29 A- C), DDK tagged COMMD6 (Figure 29 D-F), and 3xFLAG tagged CCDC22 (Figure 29 G-I) were observed. The Pearson co-localization coefficients are indicated in Table 8.

COMMD1 VPS33B Merge

COMMD6 VPS33B Merge

CCDC22 VPS33B Merge

Figure 29. DDK tagged COMMD1, DDK tagged COMMD6, and 3xFLAG tagged CCDC22 partially co-localized with GFP-VPS33B within megakaryocytic Dami cells stably expressing GFP-VPS33B. Merged images are shown on the right of each row. Partial co- localization (merge) of GFP-VPS33B (green) and DDK-COMMD1 (red) (A-C), or GFP- VPS33B and DDK-COMMD6 (red) (D-F), or GFP-VPS33B and 3xFLAG-CCDC22 (G-I) were observed. Representative z-stack images are shown.

Dami stably expressing GFP-VPS33B Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) COMMD1 20 0.445±0.084* (0.306-0.561) COMMD6 20 0.448±0.053* (0.349-0.537) CCDC22 20 0.420±0.106* (0.237-0.62)

Table 8. Co-localization quantification. Proteins are red and GFP-VPS33B green as shown in Figures 29. n = number of cells analyzed. *PCC representing co-localization.

3.4.4 CCC complex components co-localize with markers of the α-granule biogenesis pathway in Dami and imMKCL cells

To determine the localization of COMMD1, COMMD6, and CCDC22 in megakaryocytes and platelets, DDK tagged COMMD1, COMMD6 and 3xFLAG tagged CCDC22 were transiently expressed in Dami cells. These studies were done in triplicate where multiple cells were examined and representative images were taken. Studies from previous research have demonstrated the presence of CCC complex in the proximity of the endosomal trafficking system. Co-localization studies with intracellular vesicular marker proteins revealed that COMMD1 (Figure 30), COMMD6 (Figure 31), and CCDC22 (Figure 32) partially co-localized with the TGN marker AP-1, the late endosomal marker Rab7, the α-granule marker VWF, but not the LE/lysosomal marker LAMP-1 or the δ-granule/lysosome marker CD63 in Dami. The Pearson co-localization coefficients are indicated in Table 9.

In addition, to reinforce the significance of GARP/EARP and CCC complexes in MKs, the expression of GARP/EARP core component VPS51 and CCC core subunit CCDC22 were analyzed and confirmed in imMKCLs (Figure 33). Similar co-localization patterns between endogenous COMMD1 and early endosomal marker EEA1, late endosmal marker Rab7, and α- granule marker VWF were observed in immortalized megakaryocyte progenitor cell lines (imMKCLs) (Figure 34). The Pearson co-localization coefficients are indicated in Table 10.

COMMD1 AP-1 Merge

COMMD1 Rab7 Merge

COMMD1 VWF Merge

COMMD1 LAMP-1 Merge

COMMD1 CD63 Merge

Figure 30. Localization of DDK tagged COMMD1 within megakaryocytic Dami cells stably expressing GFP-VPS33B. Dami cells transfected with DDK-COMMD1 were co-stained with different intracellular markers (green) as indicated. Partial co-localization (merge) of DDK- COMMD1 is observed with the TGN (AP-1), late endosomes (Rab7), α-granules (VWF), but not late endosomes/lysosomes (LAMP-1) and δ-granules (CD63). Representative z-stack images are shown.

COMMD6 AP-1 Merge

COMMD6 Rab7 Merge

COMMD6 VWF Merge

COMMD6 LAMP-1 Merge

LAMP-1

COMMD6 CD63 Merge

Figure 31. Localization of DDK tagged COMMD6 within megakaryocytic Dami cells stably expressing GFP-VPS33B. Dami cells transfected with DDK-COMMD6 were co-stained with different intracellular markers (green) as indicated. Partial co-localization (merge) of DDK- COMMD6 is observed with the TGN (AP-1), late endosomes (Rab7), α-granules (VWF), but not late endosomes/lysosomes (LAMP-1) and δ-granules (CD63). Representative z-stack images are shown.

CCDC22 AP-1 Merge

CCDC22 Rab7 Merge

CCDC22 VWF Merge

CCDC22 LAMP-1 Merge

CCDC22 CD63 Merge

Figure 32. Localization of GFP tagged CCDC22 within megakaryocytic Dami cells. Dami cells transfected with GFP-CCDC22 were co-stained with different intracellular markers (green) as indicated. Partial co-localization (merge) of GFP-CCDC22 is observed with the TGN (AP-1), late endosomes (Rab7), α-granules (VWF), but not late endosomes/lysosomes (LAMP-1) and δ- granules (CD63). Representative z-stack images are shown.

Dami transfected with DDK-COMMD1

Protein N Pearson’s correlation coefficient (PCC), mean ± SD (range) AP-1 20 0.402±0.062* (0.309-0.521) Rab 7 20 0.412±0.046* (0.334-0.479) VWF 20 0.452±0.130* (0.217-0.663) LAMP-1 20 0.0761±0.055 (0.019-0.171) CD63 20 0.117±0.053 (0.053-0.24) Dami transfected with DDK-COMMD6 Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) AP-1 20 0.382±0.077* (0.213-0.566) Rab 7 20 0.385±0.089* (0.221-0.499) VWF 20 0.404±0.087* (0.286-0.595) LAMP1 20 0.133±0.05 (0.046-0.266) CD63 20 0.115±0.045 (0.055-0.185) Dami transfected with GFP-CCDC22 Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) AP-1 20 0.445±0.092* (0.332-0.542) Rab 7 20 0.378±0.106* (0.208-0.532) VWF 20 0.425±0.113* (0.221-0.577) LAMP-1 20 0.136±0.052 (0.032-0.247) CD63 20 0.219±0.062 (0.07-0.283)

Table 9. Co-localization quantification. Intracellular marker proteins are green and DDK- COMMD1/DDK-COMMD6 red as shown in Figures 30 and 31. Proteins are red and GFP- CCDC22 green as shown in Figures 32. n = number of cells analyzed. *PCC representing co- localization.

Platelet immKCL Dami Dami Stimulated Stimulated unstimulated

IB: VPS51

IB: CCDC22

Figure 33. VPS51 and CCDC22 are present in imMKCL. Platelets, imMKCL stimulated with TPO, Dami stimulated with TPO, and unstimulated Dami were compared for their VPS51 and CCDC22 expression.

immKCL

COMMD1 EEA1 COMMD1 EEA1 DAPI

COMMD1 Rab7 COMMD1 Rab7 DAPI

COMMD1 VWF COMMD1 VWF DAPI

Figure 34. Localization of endogenous COMMD1 within immortalized megakaryocyte progenitor cell lines (imMKCLs). imMKCL cells were co-stained with COMMD1 and different intracellular markers (green) as indicated. Partial colocalization (merge) of COMMD1 is observed with the early endosomes (EEA1), late endosomes (Rab7), and α-granules (VWF). Representative z-stack images are shown.

imMKCL

Protein n Pearson’s correlation coefficient (PCC), mean ± SD (range) EEA1 20 0.378±0.073* (0.269-0.467) Rab 7 20 0.408±0.059* (0.323-0.527) VWF 20 0.381±0.069* (0.279-0.46)

Table 10. Co-localization quantification. Intracellular marker proteins are green and COMMD1 red as shown in Figures 34. n = number of cells analyzed. *PCC representing co- localization.

3.5 Characterization of the GARP-VPS33B/VPS16B interactions (Domain mapping) To further elucidate the mechanism mediating the GARP/EARP-VPS33B/VPS16B interaction, constructs encompassing different domains of VPS33B and VPS16B were generated for domain mapping experiments. The lysate of HEK293 cells co-transfected with 3xFLAG tagged VPS53 and Myc tagged VPS16B or HA tagged VPS33B truncations were collected and immunoprecipitated using M2 FLAG affinity gel beads. Anti-FLAG IP followed by anti-Myc immunoblotting showed specific binding of VPS16B to VPS53 at 1-268 amino acids (Figure 35). This region of interaction coincides with the VPS16B-VPS33B binding interface (amino acid residues 122-268) delineated by the co-immunoprecipitation experiments conducted by a previous lab member using Myc-tagged VPS16B truncations. Anti-HA immunoblotting results suggested that VPS33B binds to VPS53 at amino acid residues 350-618 (Figure 36).

HEK293 co-transfected with 3xFLAG-VPS53 and Myc-VPS16B truncations

IP: Anti-FLAG 1 122 268 493 Input mIgG IP Input mIgG IP Myc-VPS16B

Myc-VPS16B-A (1-122)

Myc-VPS16B-B (1-268)

Myc-VPS16B-C (122-268)

Myc-VPS16B-D (122-493)

Myc-VPS16B-E (268-493) IB: Anti-Myc IB: Anti-FLAG Figure 35. Coimmunoprecipitation of Myc-VPS16B truncations with 3xFLAG-VPS53. 3xFLAG-VPS53 and Myc-VPS16B truncations were transiently expressed in HEK293 cells. Cells were harvested 48 hours after transfection. Immunoprecipitation was performed using M2FLAG beads and elutions were probed with mouse anti-Myc. The critical region within VPS16B for binding to VPS53 stretches between residues 1 and 268.

HEK293 co-transfected with 3xFLAG-VPS53 and Myc-VPS33B truncations

IP: Anti-FLAG 1 305 350 562 618 mIgG IP mIgG IP Myc-VPS33B

Myc-VPS33B-A (1-350)

Myc-VPS33B-B (350-618)

Myc-VPS33B-C (305-562) IB: Anti-HA IB: Anti-FLAG Figure 36. Coimmunoprecipitation of HA-VPS33B truncations with 3xFLAG-VPS53. 3xFLAG-VPS53 and HA-VPS33B truncations were transiently expressed in HEK293 cells. Cells were harvested 48 hours after transfection. Immunoprecipitation was performed using M2FLAG beads and elutions were probed with rabbit anti-HA antibody. The critical region within VPS33B for binding to VPS53 stretches between residues 350 and 618.

Chapter 4: Discussion 4.1 Further understanding of VPS33B/VPS16B requires the identification of its interactions with other multisubunit complexes ARC syndrome is a severe multisystem bleeding disorder caused by mutations in VPS33B or VPS16B; children with ARC have difficulty surviving past the first year of birth. One of the cardinal phenotypes of these mutations is the reduction in MK and platelet α-granule number and cargo proteins (Smith et al. 2012). Many studies have shown that VPS33B and VPS16B function as a multisubunit complex together in facilitating intracellular protein trafficking (Cullinane et al. 2010; Smith et al. 2012; Urban et al. 2012; Bem et al. 2015). The involvement of VPS33B/VPS16B complex in α-granule biogenesis is still poorly understood.

Many studies have been done on the VPS33B and VPS16B yeast homologues, Vps33 and Vps16 respectively. In yeast, Vps16 and Vps33, together with other VPS family proteins, form multiprotein complexes, CORVET and HOPS, which interact with other multisubunit complexes, such as SNARE complex, in facilitating membrane tethering and fusion events (Seals et al. 2000; Ostrowicz et al. 2010; Lobingier and Merz 2012; Baker et al. 2015). Mammalian equivalents of CORVET and HOPS complexes have also been reported (Pulipparacharuvil et al. 2005; Graham et al. 2013; Wartosch et al. 2015). Although there are two homologues for each VPS33 and VPS16 in metazoans, only VPS33A and VPS16A are reported as core components of the CORVET and HOPS complexes. Our lab had previously shown that VPS33B and VPS16B do not interact with VPS16A (Urban et al. 2012) and other HOPS subunits (unpublished data); this is also evident by other groups (Smith et al. 2012; Wartosch et al. 2015). Other studies have also indicated both the functional and structural distinctions among the homologues (Galmes et al. 2015; Van Der Kant et al. 2015; Wartosch et al. 2015). In addition, since VPS33A is required for δ-granule formation, the minimal effects that ARC mutations or VPS33B deficiency have on δ-granule biogenesis in megakaryocytes (Lo et al. 2005; Bem et al. 2015) provide evidence that VPS33B/VPS16B complex is a separate complex that likely acts independently to the CORVET and/or HOPS complexes.

In general in mammalian cells, VPS33B/VPS16B complex is required for the transport of endocytosed proteins to lysosomes by interacting with RILP that associates with late endosomal compartments (Galmes et al. 2015). Thus, it is highly possible that VPS33B/VPS16B also

associates with other protein complexes to mediate cargo sorting and membrane targeting specificity in specialized blood cells, megakaryocytes and platelets. Identification of other interacting protein complexes required for α-granule cargo sorting and trafficking is key for further understanding the role of VPS33B/VPS16B in promoting α-granule maturation. Therefore, it seemed a reasonable starting point to investigate whether VPS33B/VPS16B interacts with other multisubunit protein complexes.

4.2 Identification of interactions in the VPS33B/VPS16B complex using proximity-dependent BioID assay Based on the results of the BioID screen (Table 3 and 4), several VPS33B/VPS16B neighbouring and potentially interacting multisubunit complexes from different protein families have been identified. This method is advantageous over other screening methods, such as Y2H or affinity purification mass spectrometry, by utilizing a promiscuous form of a prokaryotic biotin ligase harbouring a mutation (Roux et al. 2012). This mutant (R118G) has reduced affinity to biotinoyl-5’-AMP (bioAMP) than the wildtype BirA, resulting in a premature and nonspecific release of bioAMP onto vicinal primary amines (Roux et al. 2012). Since biotinylation is not a common protein modification in mammalian cells, proteins that are in close proximity to the protein of interest fused with BirA* in vivo can be isolated and identified by mass spectrometry. This assay captures potential interacting partners at the physiological level over a period of time. Unlike the traditional affinity complex purification that is limited by the strength of the interaction, as well as the intrinsic solubility of the complexes, BioID resolves those complications through biotinylation, selective isolation, and solubilization of all captured proteins. The BioID mechanism permits detection of both transient and stable interactions, and thus it is beneficial in screening for potential interactors or vicinal proteins.

Despite the advantages, BioID also has its own intrinsic limitations. The primary concern for BioID is the addition of the BirA* tag onto the protein of interest. BirA* is a relatively big protein (35kDa) that could potentially hinder interactions, alter the folding or function of the protein it fuses with. The stability of the VPS33B/VPS16B complex was examined by resolving all four affinity purified BirA* fused VPS33B and VPS16B on Blue native gels (Figure 16); the complex did not appear to be affected by the BirA* tag. Moreover, the mass spectrometry results that revealed the known interaction between VPS33B and VPS16B confirm normal targeting and

proper folding of the fused proteins (Table 3 and 4). In addition, several interesting hits identified by the BioID assay is confirmed by a recent human interactome study (Huttlin et al. 2015). This study used a high-throughput affinity purification mass spectrometry to build a BioPlex network that depicts the cellular localization, biological functions, and molecular characterization of many known complexes. As seen in Table 11, the interactions between VPS33B and CCDC22, COMMD1, as well as COMMD6 identified by BioID were verified by the AP-MS experiments conducted by Huttlin et al. These findings reinforce the power of the BioID approach in probing interactions in the VPS33B/VPS16B complex.

Out of the BioID list of hits, the GARP/EARP and CCC complex components were selected for further study. This selection was based on the known role these complexes play in vesicular sorting and trafficking, as well as their ability to function as multiprotein complexes.

Bait protein Interacting protein VPS33B LYG2 SSFA2 KIF1B MATN4 GLT25D2 CCDC22 COMMD1 COMMD6 VPS16B/VIPAR LYG2 KIF1B MATN4 GLT25D2 CCDC22

Table 11. Protein interactions identified by Human Interactome study. The bolded protein interactions were also identified by my BioID screen and confirmed by immunoprecipitation experiments. Data adopted from Huttlin et al. 2015.

4.3 The GARP/EARP complex may act as a regulator of retrograde and anterograde trafficking of VPS33B/VPS16B complex Based on the results of the BioID screen (Table 4) and the co-immunoprecipitation experiments (Figure 17-19), it can be seen that VPS51, VPS52, and VPS53 all interact with VPS16B, as well as VPS33B. The interaction between VPS52 and VPS33B or VPS16B is also supported by Y3H experiment done by our lab (Anson Chen); this supports the biological importance of this interaction. Although VPS50 was identified as one of the positive hits, the interaction between

VPS50 and VPS16B or VPS33B could not be readily confirmed by immunoprecipitation experiment (Figure 18-19). This suggests that the interaction is possibly weak or transient in nature.

GARP complex is composed of VPS51, VPS52, VPS53, and a GARP specific subunit VPS54. It is known to be essential in tethering transport vesicles derived from the endosomes and SNARE complex assembly at the TGN (Pérez-Victoria and Bonifacino 2009); the two functions have been shown to act independently of each other (Abascal-Palacios et al. 2013). In addition to GARP, EARP is a structurally related tethering complex, containing VPS51, VPS52, VPS53, and VPS50 (also known as CCDC132 or syndetin) (Schindler et al. 2015). Although the two complexes share similar tethering functions, they are not redundant in nature. The intracellular localization of GARP and EARP is determined by VPS54 and VPS50, respectively. VPS50 is highly conserved among metazoans from C. elegans to H. Sapiens; the EARP complex primarily localizes at Rab 4 positive recycling endosomes and functions to promote endocytic recycling back to the plasma membrane through membrane fusion events by interacting with endosomal SNAREs (Schindler et al. 2015). On the other hand, VPS33B, a SM protein, also directly interacts with SNAREs and promotes templated assembly of the SNARE complex (Gissen et al. 2004; Baker et al. 2015). Despite the lack of data depicting the molecular function of VPS16B in the literature, VPS16B can be postulated to function as a tether due to the presence of the coiled coil golgin A5 domain.

Previous research in yeast and mammalian cells have both provided evidence to support the possibility that long coiled coil proteins and MTCs can cooperate together during vesicle tethering, docking and fusion (Sohda et al. 2007; Sohda et al. 2010). Similarly, it is possible that VPS33B/VPS16B work in conjunction with GARP and/or EARP complex in coordinating and regulating membrane fusion events. The crosstalk between MTCs could confer an increased level of specificity, both spatial and temporal, to vesicle transport at different steps. The long coiled coil tether is likely participate in early, transient, and reversible vesicle capturing or docking stages (Wong and Munro 2014), whereas the oligomeric complexes, such as the GARP/EARP or the VPS33B/VPS16B complex, may function in later, higher affinity tethering and fusion events by associating with SNAREs. The multiple subunits that the different transport components contain allow them to simultaneously interact with each other. This is further

supported by the finding that the interaction between GARP/EARP subunit VPS53 and VPS16B coincides with the VPS16B-VPS33B binding interface (Figure 35), implying that GARP/EARP may regulate SNARE subunit recruitment and complex formation together with VPS33B/VPS16B in close proximity. It is also possible that the interaction between GARP/EARP and the VPS33B/VPS16B complex act as a trigger to enter the following step of vesicle tethering and fusion to the target compartment. Further experiments are required to investigate the biological significance of the crosstalk between GARP/EARP and VPS33B/VPS16B complex in vesicular trafficking.

4.4 The GARP/EARP complex may crosstalk with VPS33B/VPS16B complex in promoting MVB maturation in MK α-granule biogenesis Our lab has previously demonstrated the localization of VPS33B and VPS16B in human MKs and megakaryocytic Dami cells. VPS33B has been reported to associate with markers of the LE and α-granule markers, but not the cis-Golgi or δ-granule compartments (Lo et al. 2005); VPS16B overexpressed in Dami cells were found to partially co-localize with markers of the TGN, LEs, and α-granules (Urban et al. 2012). The unavailability of adequate primary anti- VPS51, VPS52, VPS53, and VPS50 antibodies for immunofluorescence microscopy studies did not permit examination of native intracellular distribution in MKs. Consequently, to determine whether GARP/EARP subunits are present in similar intracellular compartments to VPS33B and VPS16B, co-localization studies using Dami cells expressing stable GFP tagged VPS33B or VPS16B were performed (Figure 27-28). Co-localization of GFP-VPS16B and GFP-VPS33B to 3xFLAG-VPS51 and 3xFLAG-VPS53, as well as 3xFLAG-VPS51 and 3xVPS53 to markers of the TGN (AP-1), LEs (Rab7), and α-granule (VWF) was observed. In comparison, the relative co-localization of 3xFLAG-VPS51 and 3xFLAG-VPS53 to markers of δ-granule/lysosomes (CD63) and lysosomes (LAMP-1) was much reduced. Furthermore, GFP-VPS33B, 3xFLAG- VPS51, and 3x-FLAG-VPS53 appear to localize slightly different among several samples (Figure 27-28). Some factors that may potentially lead to this inconsistency include the morphology, cell size, as well as the multinucleated nature of Dami cells.

Previous research has indicated the importance of GARP in modulating lipid balance and regulate retrograde sorting and trafficking of TGN, endosomal, and lysosomal proteins (Perez- Victoria et al. 2008; Pérez-Victoria and Bonifacino 2009; Fröhlich et al. 2015). The endosomal

system acts as a central traffic sorting and signaling centre that guides and routes incoming endocytic and biosynthetic cargo to various destinations. It can be predicted that GARP may also function in the retrieval of VPS33B and VPS16B, along with SNAREs, from MVBs or early endosomes back to the TGN in MKs. Similar recycling mechanisms from early, recycling, or late endosomes to the TGN have been widely observed in mammalian cells (Meyer et al. 2000; Rutherford et al. 2006; Scott et al. 2006; Scott et al. 2014). Further insights into the requirement of GARP for cellular processes have been reported from GARP knockout studies. The requirement of GARP-dependent endosome to TGN retrograde transport on post-TGN anterograde transport of plasma membrane anchored protein has been reported (Hirata et al. 2015). Upon GARP knockout, the transport machineries including membrane cargo receptors and v-SNAREs possibly accumulate in endosomal compartment, leading to defective sorting and post-Golgi anterograde transport due to the lack of available transport machineries (Hirata et al. 2015). It can be proposed that GARP-dependent retrograde transport may also affect the anterograde transport of α-granule cargo proteins from the TGN by recycling the VPS33B/VPS16B and other related transport machineries essential for α-granule biogenesis.

Furthermore, worm and murine studies on dense-core vesicle biogenesis in neurons have demonstrated that VPS50 is essential for V-ATPase complex sorting or assembly critical for vesicular acidification during the process of dense-core vesicle maturation (Paquin et al. 2016). Mutating other EARP subunits also displayed a reduced level of dense-core vesicle contents, suggesting that EARP complex is critical in dense-core vesicle cargo sorting and/or protein trafficking through the endosomal system (Topalidou et al. 2016). The involvement of EARP in the MK α-granule formation pathway implies that an endosomal compartment could play a sorting role during MVB maturation process by constantly trafficking cargos to endosomes and retrieving cargos back to the MVB intraluminal vesicles. Taken together, my results suggest that GARP/EARP subunits act along the TGN to late endosomes to α-granule vesicular trafficking pathway during α-granule biogenesis in MKs. The question of how GARP/EARP complexes may contribute to the regulatory or sorting mechanism of VPS33B/VPS16B complex in MK and platelet α-granule biogenesis remains to be determined by knockout studies. Figure 38 depicts a speculative model of GARP/EARP function α-granule formation pathway. During the process of α-granule maturation, EARP and other interacting proteins may regulate the trafficking of cargo and sorting factors, such as the VPS33B/VPS16B complex, through or from endosomal

compartments. GARP, on the other hand, possibly acts in a distinct endosome to TGN trafficking pathway.

4.5 The CCC complex may act as a regulator for VPS33B/VPS16B trafficking COMMD proteins (1, 2, 3, 4, 6, and 8) and CCDC22 were identified as the top VPS33B hits in the BioID screen (Table 3). Although I was not able to confirm all the interactions between VPS33B and COMMDs on the list, COMMD1, COMMD6, and CCDC22 were co- immunoprecipitated with VPS33B and VPS16B endogenously in HEK293 cells stably expressing 3xFLAG tagged VPS33B and VPS16B (Figure 20-21). The COMMD family is a highly conserved protein group containing the C-terminal homology domain (C. a. Phillips- Krawczak et al. 2015). COMMD1, the founder of the COMMD family that includes 10 identified proteins in eukaryotes, was initially discovered to bind phosphatidylinositol 4,5- bisphosphate (PI4,5P2) on the endocytic membranes with high specificity forming oligomeric complexes, suggesting the role of COMMD1 in membrane transport and/or protein sorting (Burkhead et al. 2009). COMMD1 has also been widely implicated in inflammatory responses (Burstein et al. 2005; Bartuzi et al. 2013; Yeh et al. 2016), hypoxia regulation (van de Sluis et al. 2007), and intracellular electrolyte transport (Burstein et al. 2005; Narindrasorasak et al. 2007; Sommerhalter et al. 2007; Ke et al. 2010). Similarly, mutations in CCDC22 have also been reported to cause various developmental disorders (Voineagu et al. 2012; Bartuzi et al. 2013; Starokadomskyy et al. 2013). Although the role of COMMD family in the trafficking and sorting of vesicles in the endo/lysosomal system remains to be delineated, it is not surprising that COMMD1 may also be responsible in regulating the transport machineries or sorting factors essential for α-granule biogenesis in MKs.

Recently, several studies have proposed COMMDs’ potential role in regulating endosomal sorting and trafficking by interacting with other coiled-coil CCDC proteins: CCDC22 and CCDC93 (Li et al. 2015; C. a. Phillips-Krawczak et al. 2015). CCDC22 has been suggested to play a critical role in controlling the cellular distribution of the COMMD complexes composed of different COMMD proteins; distinct CCC compositions appear to mediate unique functions in cargo selectively trafficking (Burstein et al. 2005). This provides a putative explanation to why COMMD1 and COMMD6 interact more strongly with VPS33B than the other COMMD proteins

identified by the BioID screen (Figure 20). It is important to note that although the other COMMD proteins identified by mass spectrometry did not co-immunoprecipitate with 3xFLAG- VPS33B, their potential to regulate protein trafficking in α-granule formation cannot be overlooked.

Previous research has shown that both the COMMD/CCDC22/CCDC93 (CCC) and retromer complexes are required to regulate Notch signaling, and copper and cholesterol homeostasis by facilitating the intracellular retrograde movement of Notch proteins, copper transporter ATP7A, and low-density lipoprotein receptor (LDLR) together with the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complex known to promote actin polymerization (Li et al. 2015; C. a. Phillips-Krawczak et al. 2015; Bartuzi et al. 2016). The multisubunit nature of these complexes leads to the speculation that the CCC complex may act more broadly over WASH- or retromer- dependent trafficking pathways. An interaction map between CCC complex components and other cellular complexes, the exocyst and BLOC-1 complex, has been shown (C.A. Phillips-Krawczak et al. 2015). Studies on Hermansky-Pudlak syndrome have revealed the interconnection between the WASH and the biogenesis of lysosome related organelle -1 (BLOC- 1) complex. Interestingly, BLOC-1 has been discovered to be essential in MK δ-granule formation (Meng et al. 2012). Thus, it is highly possible that CCC interacts with VPS33B/VPS16B complex in MKs and together they participate in α-granule biogenesis.

To determine whether CCC subunits, CCDC22, COMMD1, and COMMD6, are present in the α- granule biogenesis pathway, co-localization studies using Dami and imMKCL cells were performed (Figure 30-34). imMCKL is a novel megakaryocytic cell line derived from human pluripotent stem cells (Nakamura et al. 2014). Platelets that are functionally comparable to native human platelets could be generated from imMKCLs upon stimulation (Nakamura et al. 2014). Although imMKCLs are smaller in size compared to Dami and native megakaryocytes, imMKCLs appear to form proplatelets and contain true α-granule-like compartments that resemble those observed in human megakaryocytes (Figure 37). The number of α-granule-like structures also exceeds that found in Dami cells. Therefore, imMKCL is a good model cell line for the study of MK and platelet α-granule biogenesis. From the immunofluorescence study (Figure 30-34), CCDC22, COMMD1, and COMMD6 were found to partially co-localize with markers of the TGN (AP-1), EE (EEA1, Figure), LEs (Rab7), and α-granule (VWF), but not δ-

granule/lysosomes (CD63) and lysosomes (LAMP-1). Together, the CCC components are present in similar compartments with VPS33B and VPS16B; co-localization between CCC subunits and VPS33B/VPS16B was also observed (Figure 29). As seen in Figure 38, CCC complex is anticipated to play a role in cargo selection and trafficking through the endosomal and MVB compartments in MKs and platelets. Each COMMD protein or CCC complex composition can differentially regulate the specificity and subcellular localization of the α- granule cargo proteins. An additional level of complexity in α-granule cargo sorting and trafficking can be achieved by both the interdependence among COMMDs that have a tendency to heterodimerize, and the interconnection among CCC and other multisubunit complexes, for instance the VPS33B/VPS16B complex. Further investigation on the interaction between CCC and VPS33B/VPS16B complex may reveal the critical role of CCC in endosomal sorting of other membrane proteins.

A B

C D VWF DAPI CD61

Figure 37. imMKCLs form proplatelets and α-granule like structures. (A) Dami cell (B) imMKCL (C) human megakaryocyte (D) imMKCL producing proplatelets containing α-granule cargo VWF. The membrane of the cell is marked by the membrane protein CD61 (Integrin β3) (Green: VWF; Red: CD61; Blue: DAPI). EM images were taken by Richard Leung; IF image was taken by Dr. Ling Li.

4.6 Autophagy related protein, ATPase associated proteins and the actin cytoskeleton as putative novel interactors with VPS33B/VPS16B complex The BioID results suggest that many other players in the endocytic and biosynthetic pathway interact with VPS33B/VPS16B. Intriguingly, a great number of signaling, trafficking and ubiquitination regulators may coordinate VPS33B/VPS16B mediated vesicular docking and fusion events (Table 5). An autophagy related protein (Atg), Atg2B, appeared to be the top VPS33B interacting candidate; the interaction was confirmed by co-immunoprecipitation (Figure 22). Atg2B is a unique Atg protein that has dual and independent roles in autophagosome formation and lipid droplet morphology regulation (Velikkakath et al. 2012). In addition, studies in Drosophila discovered the requirement of other Atg proteins, Atg1 and Atg6 in salivary gland glue granule synthesis as the mutants exhibit defects in secretion and produce small granules (Shravage et al. 2013). More specifically, autophagy is linked to megakaryocyte maturation and differentiation, platelet function in hemostasis and thrombosis (Cao et al. 2015; Ouseph et al. 2015; You et al. 2016). Platelets deficient in Atg7 exhibit a modest defect in α- granule cargo packaging as the level of platelet factor 4 (PF4) in knocked out platelets was slightly yet significantly reduced in α-granules; serotonin level in δ-granules was also affected (Ouseph et al. 2015). Moreover, Atg7 knockout mice displayed aberrant megakaryopoiesis and platelet production. Similar to the ARC platelets, the platelets from Atg7 deficient mice appear large in size (You et al. 2016). Hence, it is possible that Atg2B can regulate α-granule protein sorting and/or vesicular fusion processes in conjunction with VPS33B/VPS16B complex.

Another family of VPS33B/VPS16B interactors is the AAA + family ATPase associated proteins. The BioID data suggest that WDR92 (Monad), PIH1 domain containing protein 1 (PIH1D1) and RNA polymerase II-associated protein 3 (RPAP3) may also contribute to α- granule maturation in MKs and platelets. PIH1D1 and RPAP3 form the R2TP complex with the two closely related AAA + family ATPases, Pontin and Reptin; this is highly conserved from yeast to human (Yoshida et al. 2013). In addition, WDR92 has been reported to interact with the R2TP complex, which was found to be required in many biological processes, including apoptosis, RNA polymerase II assembly, and phosphatidylinositol-3 kinase-related protein kinase signaling (Kakihara and Houry 2012). The general role of R2TP appears to be promoting

and/or stabilizing the assembly of multiprotein complexes. Although the mechanisms underlying these regulations has not been thoroughly explored, the wide variety of roles AAA+ proteins play in regulating cellular functions, including organelle biogenesis and membrane trafficking (Erdmann 2012), lead to the speculation that the putative interaction between the VPS33B/VPS16B complex and the R2TP complex may be biologically significant. It is also intriguing to note that our lab has also identified a V-ATPase lysosomal accessory protein 2 (ATP6AP2) as a potential VPS33B/VPS16B interactor by Y3H (Anson Chen). Previous research has advocated that the VPS33B mediated endo-lysosomal fusion is regulated by the transient interaction between V-ATPase and VPS33B (Wong et al. 2011). Surprisingly, VPS50, the EARP specific subunit that can potentially interact with VPS16B, has also been reported to interact with V-ATPase; this interaction is crucial for the assembly of the V-ATPase complex that is responsible for dense-core vesicle acidification and maturation (Paquin et al. 2016). This function of VPS50 in regulating vesicle acidification is conserved in mammals (Paquin et al. 2016). Further elucidation and confirmation on the interaction is required to determine the molecular activity and function of R2TP on VPS33B/VPS16B complex.

Several multiprotein complexes that play roles in regulating cytoskeleton dynamics were also identified by BioID. Interestingly, all three vertebrate NudC homologues, nuclear distribution gene C (NudC), NudC domain containing protein 2 (NUDCD2) and NudC domain containing protein 3 (NUDCD3) appear to be in the vicinity of VPS16B in HEK293 cells. NudC family proteins are known to exhibit chaperone activities by stabilizing the cytoplasmic dynein-Heat Shock Protein (Hsp90) complex; disruption of this complex substantially inhibits the ATPase activity of Hsp90 (Yang et al. 2010). Moreover, NudC has been found to regulate actin dynamics by interacting with actin cytoskeleton regulators (Zhang et al. 2016). In addition to NudC, other actin or microtubule associated proteins, such as the NDC80 kinetochore complex and the human Augmin (HAUS) complex, have also been identified to act in close proximity to VPS33B/VPS16B (Table 5). In fact, many members of the Golgin family are found to interact with small GTPases in tethering membranes in intracellular trafficking steps, linking vesicles to cytoskeletons (Short, Haas et al., 2005). Recent work focusing on cytoskeletal assembly and dynamics have suggested that actin microtubules are modulated by both the membrane and membrane associated factors (Tsujita et al. 2006; Saarikangas et al. 2010; Bezanilla et al. 2015).

As a result, VPS33B/VPS16B can be predicted to take a part in cytoskeletal dynamics with unclear mechanistic links. The relationship between VPS33B and actin remodeling has been previously discovered in platelets (Xiang et al. 2015). This group showed that VPS33B potentiates cell spreading through the RhoA and Rac1 pathway by directly interacting with integrin. Furthermore, MK cytoplasmic morphogenesis and proplatelet formation are dependent on actin polymerization and organization. Disturbances in MK actin cytoskeleton impair MK spreading, organelle distribution, proplatelet generation and morphology (Sui et al. 2015). Aberrant granule content was also observed in platelets released from MKs with defective actin polymerization and insufficient IMS formation (Sui et al. 2015). As a result, it is possible that VPS33B/VPS16B and other actin or microtubule associated protein complexes play a role in vesicular trafficking or intercellular signaling via cytoskeleton reorganization.

Chapter 5: Conclusions and Future Directions Our laboratory has previously shown VPS33B and VPS16B form a multiprotein complex that is essential for α-granule biogenesis in megakaryocytes and platelets (Lo et al. 2005; Urban et al. 2012). A recent study presented a first ARC mouse model that provides solid evidences for the role of VPS33B/VPS16B complex in the cargo sorting process of α-granule formation (Bem et al. 2015). These observations lead to the foundation of the work presented here: to gain insights into the role VPS33B/VPS16B complex plays in vesicular trafficking and investigate its contribution to α-granule biogenesis. Following a BioID screen using VPS33B and VPS16B, numerous proteins were identified as potential interacting partners of either or both proteins (Table 3-5). Among the candidate interactors, the components of GARP/EARP and CCC complexes were chosen for further study due to the biological functions of these proteins in vesicle tethering and cargo transportation respectively.

Despite the functional nature of the GARP/EARP and CCC subunits, their ability to form multiprotein complexes was another criterion underlying the interacting candidate selection process. VPS33B/VPS16B complex has been broadly proposed to mediate cargo selection and membrane fusion events through its interaction with other multiprotein complexes. This speculation is based on the nature of VPS33B and VPS16B homologues, VPS33A and VPS16A, which together interact with other proteins forming multisubunit tethering complexes, CORVET and HOPS complexes. The CORVET/HOPS complexes are also known to interact with SNARE proteins and promote SNARE complex assembly (Stroupe et al. 2006; Lobingier and Merz 2012; Lürick et al. 2015). Similar to the CORVET/HOPS complex, recent work has shown that VPS33B/VPS16B complex also binds with RILP for specific transport to endosomal and lysosomal compartments (Galmes et al. 2015; Van Der Kant et al. 2015). Therefore, it is clear that VPS33B/VPS16B most likely interacts with other MTCs, either simultaneously or sequentially, to integrate different transport components necessary for protein sorting, vesicular tethering and fusion events to occur.

Co-immunoprecipitation experiments under transient expression have further confirmed interactions between VPS33B/VPS16B and GARP/EARP, as well as CCC subunits, to be genuine but weak or transient in nature (Figure 17-21). All these interactions were verified again in HEK293 cells stably expressing 3xFLAG tagged VPS16B or VPS33B using endogenous

antibodies against the GARP/EARP (VPS51, VPS52 and VPS53) and CCC components (COMMD1, COMMD6, and CCDC22). In addition, all the VPS33B/VPS16B-CCC interactions identified by co-immunoprecipitation experiments were validated by a high-throughput human protein interaction mapping study that utilized affinity purification-mass spectrometry to identify protein interactions (Table 11) (Huttlin et al. 2015). Although the putative interaction between VPS16B and VPS50 (CCDC132/syndetin) was not detected by the endogenous co- immunoprecipitation experiment (Figure 18-19), the potential of VPS50 as a VPS16B interactor is still possible, as affinity purification approaches have limitations in detecting weak interactions.

To further examine the mechanisms mediating the identified interactions, co- immunoprecipitation experiments using the VPS16B and VPS33B truncations were performed to delineate the regions of VPS16B and VPS33B that interact with GARP/EARP complex components. Remarkably, the VPS33B/VPS16B interaction interface coincides with that of the VPS16B-VPS53 interaction (Figure 35). This result supports the hypothesis that VPS33B/VPS16B complex likely cooperates with other MTCs or transport machineries in regulating trafficking events. Similar domain mapping experiments could be performed to reveal the domain of VPS33B that binds to the CCC complex.

In order to unveil the biological significance of these observed interactions in VPS33B/VPS16B mediated trafficking and α-granule biogenesis, knock down experiments were designed to diminish the expression of the GARP/EARP and CCC proteins using RNA interference. If the knocked down cells exhibit defects in α-granule formation, abnormal cargo accumulation, and/or VPS33B/VPS16B mislocalization, then the function of those interactions can be concluded. Unfortunately, none of the designed siRNAs were able to knockdown the expression of the target protein (Figure 23). To overcome the obstacle encountered by the siRNA experiment, a CRISPR/Cas9 knockout system could be established in HEK293 and imMKCL cells to elucidate the function of GARP/EARP and CCC complex in VPS33B/VPS16B trafficking and α-granule formation. The newly developed imMKCL is probably the most applicable and appropriate cell line to study the development of α-granules as it is able to produce proplatelets as well as intracellular structures that closely resemble α-granules (Figure 37). Both lentiviral transduction and mammalian expression vector transfection approaches could be adopted for this study; each

approach is characterized by its own advantages. The lentiviral transduction approach is advantageous for its stable expression in cells that are difficult to transfect, such as the imMKCLs. The mammalian expression vector approach, on the other hand, is useful for both transient and stable expression in mammalian cells with high transfection efficiency. Electron microscopy will be utilized to observe the sorting of α-granule cargo protein VWF and the number of α-granules in the knocked out (KO) cells in comparison to the wildtype (WT) cells. In addition, the localization of VPS16B/VPS33B complex and the protein contents of α-granules will also be examined by immunofluorescence in both the KO and WT cells. If deficiency of certain α-granule proteins is observed in the KO cells, the involvement of the protein being knocked down in α-granule biogenesis can be confirmed. Subsequently, the knocked out protein can be re-introduced into the cell by transient transfection. To confirm the proposed function of GARP/EARP and CCC, the transfected cells will be examined for rescue effects.

Given that megakaryocytes are specialized blood cells that are replete with membrane structures and secretory granules for platelet production critical in maintaining homeostasis, intracellular protein composition and vesicular trafficking mechanisms may also differ from those seen in general mammalian cells. In megakaryocytes, both the biosynthetic and endocytic cargos are directed to MVBs which matures from MVB I, containing only ILVs, to MVB II, containing both ILVs and electron dense materials. MVB II can subsequently get delivered and further sorted into mature α-granules. Although the biogenesis of MVBs may be critical among all cell models, MVBs mostly represent a step in the endocytic degradation destined to the vacuole in yeast or to the lysosome in general mammalian cells (Katzmann et al. 2001), whereas MVBs act as a developmental stage in α-granule production. Thus, it is essential to examine the localization of GARP/EARP and CCC complex in megakaryocytic cell lines to decipher their roles in VPS33B/VPS16B mediated α-granule cargo sorting and trafficking.

An immunofluorescence study showed that GARP/EARP and CCC subunits partially co-localize to compartments involved in the α-granule formation pathway (Figure 30-32). According to this analysis VPS51 and VPS53, core components of GARP/EARP complexes, localize to the TGN, LEs and α-granule-like structures in Dami cells, but not the lysosomes and δ-granules. GARP also likely functions similarly but independently to EARP in different cellular compartments. The lack of antibodies against VPS50 and VPS54 makes it difficult to distinguish the localization

of the two complexes. The differential localization of VPS50 and VPS54 could be observed by the introduction of constructs containing tagged version of the complex specific proteins into imMKCLs. Furthermore, to determine whether it is GARP or EARP (or both) that is required for α-granule biogenesis, immunofluorescence and electron microscopy studies on CRISPR/Cas9 KO imMKCL cells lacking VPS50 and VPS54 could be performed. In addition, immunofluorescence analysis on CCDC22, COMMD1, and COMMD6, components of the CCC complex, discovered that they localize largely to TGN, EEs, LEs, and α-granule-like compartments in both Dami and imMKCLs, but not the lysosomes and δ-granules. These data provide promising indications of the involvement of the MTCs, GARP and EARP, and the endosomal transport complex, CCC, in α-granule protein organization and trafficking that are critical for proper α-granule production.

As it is still unclear how GARP/EARP and CCC complex contribute to anterograde and/or retrograde transport of α-granule cargo proteins, transport assays of cargo proteins in cells deficient in GARP/EARP or CCC can be conducted to examine the amount of protein that reaches different cellular compartment in a given time frame. The results can potentially indicate the requirement of the complexes for anterograde/retrograde transport of proteins. In addition, it would also be interesting to understand how VPS33B/VPS16B complex promote α-granule maturation through its interaction with other multiprotein complexes. As research on dense core vesicle maturation in C. elegans has shown, VPS50 functions in vesicle maturation and acidification by triggering the assembly of V-ATPase complex (Paquin et al. 2016). V-ATPase acidification activity is tightly linked to neurotransmitter loading and processing in dense-core vesicles. Therefore, VPS33B/VPS16B could interact with other complexes to promote cargo sorting and MVB maturation by regulating the MVB internal environment. Any BioID identified interactions with VPS33B/VPS16B could be important during the process of α-granule biogenesis in MKs and platelets. Future determination and characterization of those interactions will be useful in gaining further insights into α-granule formation.

Moreover, it is also worthwhile to investigate the specificity and function of different COMMD compositions in the CCC complex. Despite the fact that only COMMD1 and COMMD6 were pulled down by 3xFLAG tagged VPS33B, the involvement of other COMMD proteins identified by BioID screen in α-granule biogenesis should not be neglected. As COMMDs are known to

have nonredundant functions (Bartuzi et al. 2016), different COMMD composition in the subcomplex could exhibit unique sorting and selective trafficking functions in MKs and platelets. As a result, it would be interesting to investigate the cellular mechanism underlying preferential binding among certain COMMD proteins and how do those subcomplexes contribute differently in α-granule biogenesis.

In conclusion, my Master’s thesis identified and examined the function of candidate interaction partners of VPS33B and VPS16B, which are known to be involved in platelet α-granule biogenesis. This project provided new insights into the process of secretory granule formation in megakaryocytes and platelets, which is relevant to important physiological functions such as hemostasis, inflammation and angiogenesis, and to pathological events such as thrombosis.

Figure 38. An emerging model of platelet α-granule biogenesis. Indirect evidences derived from the study on VPS33B/VPS16B functions and recent mouse models suggest that VPS33B/VPS16B complex cooperates with CCC and GARP/EARP complexes in sorting and trafficking α-granule proteins through the endosomal pathway.

References Abascal-Palacios G, Schindler C, Rojas AL, Bonifacino JS, Hierro A. 2013. Structural basis for the interaction of the golgi-associated retrograde protein complex with the t-SNARE Syntaxin 6. Structure 21:1698–1706. Akbar MA, Tracy C, Kahr WHA, Krämer H. 2011. The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila. J. Cell Biol. 192:383–90. Angelica MD, Fong Y. 2008. Platelet Induction of the Acute Phase Response Is Protective in Murine Experimental Cerebral Malaria. J. Immunol. 141:520–529. Baker RW, Jeffrey PD, Zick M, Phillips BP, Wickner WT, Hughson FM. 2015. A direct role for the Sec1/Munc18-family protein Vps33 as a template for SNARE assembly. Science 349:1111– 1114. Balderhaar HJK, Ungermann C. 2013. CORVET and HOPS tethering complexes - coordinators of endosome and lysosome fusion. J. Cell Sci. 126:1307–1316. Bartuzi P, Billadeau DD, Favier R, Rong S, Dekker D, Fedoseienko A, Fieten H, Wijers M, Levels JH, Huijkman N, et al. 2016. CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL. Nat. Commun. 7:10961. Bartuzi P, Hofker MH, Van de Sluis B. 2013. Tuning NF-κB activity activity: A touch of COMMD proteins. Mol. Basis Dis. 1832:2315–2321. Behrendorff N, Dolai S, Hong W, Gaisano HY, Thorn P. 2011. Vesicle-associated membrane protein 8 (VAMP8) is a SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) selectively required for sequential granule-to-granule fusion. J. Biol. Chem. 286:29627–34. Bem D, Smith H, Banushi B, Burden JJ, White IJ, Hanley J, Jeremiah N, Rieux-Laucat F, Bettels R, Ariceta G, et al. 2015. VPS33B regulates protein sorting into and maturation of α-granule progenitor organelles in mouse megakaryocytes. Blood 126:133–43. Bezanilla M, Gladfelter AS, Kovar DR, Lee W-L. 2015. Cytoskeletal dynamics: a view from the membrane. J. Cell Biol. 209:329–37. Blair P, Flaumenhaft R. 2009. Platelet alpha-granules: basic biology and clinical correlates. Blood Rev. 23:177–89. Boilard E, Nigrovic PA, Larabee K, Watts GFM, Jonathan S, Weinblatt ME, Massarotti EM, Donnell ER, Farndale W, Ware J, et al. 2010. Platelets Amplify Inflammation in Arthritis via Collagen- Dependent Microparticle Production. Science 327:580–583. Burkhardt P, Hattendorf DA, Weis WI, Fasshauer D. 2008. Munc18a controls SNARE assembly through its interaction with the syntaxin N-peptide. EMBO J. 27:923–33. Burkhead JL, Morgan CT, Shinde U, Haddock G, Lutsenko S. 2009. COMMD1 forms oligomeric complexes targeted to the endocytic membranes via specific interactions with phosphatidylinositol 4,5-Bisphosphate. J. Biol. Chem. 284:696–707.

Burstein E, Hoberg JE, Wilkinson AS, Rumble JM, Csomos RA, Komarck CM, Maine GN, Wilkinson JC, Mayo MW, Duckett CS. 2005. COMMD Proteins, a Novel Family of Structural and Functional Homologs of MURR1. J. Biol. Chem. 280:22222–22232. Bustos M, Saadi S PJ. 2001. Platelet-mediated activation of endothelial cells: implications for the pathogenesis of transplant rejection. Transplantation:72(3):509–515. Cao Y, Cai J, Zhang S, Yuan N, Li X, Fang Y, Song L, Shang M, Liu S, Zhao W, et al. 2015. Loss of autophagy leads to failure in megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis in mice. Exp. Hematol. 43:488–494. Colbert KN, Hattendorf D a, Weiss TM, Burkhardt P, Fasshauer D, Weis WI. 2013. Syntaxin1a variants lacking an N-peptide or bearing the LE mutation bind to Munc18a in a closed conformation. Proc. Natl. Acad. Sci. U. S. A. 110:12637–42. Cullinane AR, Straatman-Iwanowska A, Zaucker A, Wakabayashi Y, Bruce CK, Luo G, Rahman F, Gürakan F, Utine E, Ozkan TB, et al. 2010. Mutations in VIPAR cause an arthrogryposis, renal dysfunction and cholestasis syndrome phenotype with defects in epithelial polarization. Nat. Genet. 42:303–12. Erdmann R. 2012. AAA ATPases: structure and function. Biochim. Biophys. Acta 1823:1. Flaumenhaft R. 2012. Α-Granules: a Story in the Making. Blood 120:4908–9. Fröhlich F, Petit C, Kory N, Christiano R, Hannibal-Bach H-K, Graham M, Liu X, Ejsing CS, Farese R V, Walther TC. 2015. The GARP complex is required for cellular sphingolipid homeostasis. Elife 4:1–21. Frojmovic M, Milton J. 1982. Human platelet size, shape, and related functions in health and disease. Physiol Rev. 62:185–261. Galmes R, ten Brink C, Oorschot V, Veenendaal T, Jonker C, van der Sluijs P, Klumperman J. 2015. Vps33B is required for delivery of endocytosed cargo to lysosomes. Traffic 16:1288– 1305. Ghoshal K, Bhattacharyya M. 2014. Overview of platelet physiology: Its hemostatic and nonhemostatic role in disease pathogenesis. Sci. World J. 2014:781857. Gillingham AK, Munro S. 2016. Finding the Golgi: Golgin Coiled-Coil Proteins Show the Way. Trends Cell Biol. 26:399–408. Gissen P, Johnson C a, Morgan N V, Stapelbroek JM, Forshew T, Cooper WN, McKiernan PJ, Klomp LWJ, Morris A a M, Wraith JE, et al. 2004. Mutations in VPS33B, encoding a regulator of SNARE-dependent membrane fusion, cause arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome. Nat. Genet. 36:400–4. Gissen P, Johnson C a., Gentle D, Hurst LD, Doherty AJ, O’Kane CJ, Kelly D a., Maher ER. 2005. Comparative evolutionary analysis of VPS33 homologues: Genetic and functional insights. Hum. Mol. Genet. 14:1261–1270. Graham SC, Wartosch L, Gray SR, Scourfield EJ, Deane JE, Luzio JP, Owen DJ. 2013. Structural basis of Vps33A recruitment to the human HOPS complex by Vps16. Proc. Natl.

Acad. Sci. 110:13345–13350. Gunay-Aygun M, Falik-Zaccai TC, Vilboux T, Zivony-Elboum Y, Gumruk F, Cetin M, Khayat M, Boerkoel CF, Kfir N, Huang Y, et al. 2011. NBEAL2 is mutated in gray platelet syndrome and is required for biogenesis of platelet α-granules. Nat. Genet. 43:732–4. Heijnen H, van der Sluijs P. 2015. Platelet secretory behavior As diverse as the granules ……or not? J. Thromb. Haemost. 13:2141–2151. Heijnen HFG, Debili N, Vainchencker W, Breton-gorius J, Geuze HJ, Jan J, Heijnen BHFG, Sixma JJ. 1998. Multivesicular Bodies Are an Intermediate Stage in the Formation of Platelet α - Granules. Blood 91:2313–2325. Herman PK, Emr SD. 1990. Characterization of yeast Vps33p, a protein required for vacuolar protein sorting and vacuole biogenesis. Mol. Cell. Biol. 10:6742–6754. Hirata T, Fujita M, Nakamura S, Gotoh K, Motooka D, Parton RG. 2015. Post-Golgi anterograde transport requires GARP-dependent endosome-to-TGN retrograde transport. MBoC 26:3071– 3084. Hong W, Lev S. 2014. Tethering the assembly of SNARE complexes. Trends Cell Biol. 24:35– 43. Ho-tin-noé B, Goerge T, Cifuni SM, Duerschmied D, Wagner DD. 2009. Platelet granule secretion continuously prevents intratumor hemorrhage. Cancer 68:6851–6858. Huang Z, Miao X, Patarroyo M, Nilsson GP, Pernow J, Li N. 2016. Tetraspanin CD151 and integrin α6β1 mediate platelet-enhanced endothelial colony forming cell angiogenesis. J. Thromb. Haemost. 14:606–618. Huttlin EL, Ting L, Bruckner RJ, Gebreab F, Gygi MP, Szpyt J, Tam S, Zarraga G, Colby G, Baltier K, et al. 2015. The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell 162:425–440. Italiano Jr JE, Lecine P, Shivdasani RA, Hartwig JH. 1999. Blood platelets are assembled principally at the ends of proplatelet processes produced by differentiated megakaryocytes. J. Cell Biol. 147:1299–1312. Italiano JE, Richardson JL, Patel-Hett S, Battinelli E, Zaslavsky A, Short S, Ryeom S, Folkman J, Klement GL. 2008. Angiogenesis is regulated by a novel mechanism: pro- and antiangiogenic proteins are organized into separate platelet alpha granules and differentially released. Blood 111:1227–33. Kahr WH a, Lo RW, Li L, Pluthero FG, Christensen H, Ni R, Vaezzadeh N, Hawkins CE, Weyrich AS, Di Paola J, et al. 2013. Abnormal megakaryocyte development and platelet function in Nbeal2(-/-) mice. Blood 122:3349–58. Kakihara Y, Houry WA. 2012. The R2TP complex: discovery and functions. Biochim. Biophys. Acta 1823:101–7. Van Der Kant R, Jonker CTH, Wijdeven RH, Bakker J, Janssen L, Klumperman J, Neefjes J. 2015. Characterization of the mammalian CORVET and HOPS complexes and their modular

restructuring for endosome specificity. J. Biol. Chem. 290:30280–30290. Katzmann DJ, Babst M, Emr SD. 2001. Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 106:145–55. Ke Y, Butt AG, Swart M, Liu YF, Mcdonald FJ. 2010. COMMD1 downregulates the epithelial sodium channel through Nedd4 – 2. Am. J. Physiol. Renal Physiol. 298:1445–1456. Kisucka J, Butterfield CE, Duda DG, Eichenberger SC, Saffaripour S, Ware J, Ruggeri ZM, Jain RK, Folkman J, Wagner DD. 2006. Platelets and platelet adhesion support angiogenesis while preventing excessive hemorrhage. Proc. Natl. Acad. Sci. U. S. A. 103:855–60. Leblanc R, Peyruchaud O. 2016. Metastasis: new functional implications of platelets and megakaryocytes. Blood. Lemons PP, Chen D, Whiteheart SW. 2000. Molecular mechanisms of platelet exocytosis: requirements for alpha-granule release. Biochem. Biophys. Res. Commun. 267:875–80. Li H, Koo Y, Mao X, Sifuentes-Dominguez L, Morris LL, Jia D, Miyata N, Faulkner RA, van Deursen JM, Vooijs M, et al. 2015. Endosomal sorting of Notch receptors through COMMD9- dependent pathways modulates Notch signaling. J. Cell Biol. 211:605–617. Lo B, Li L, Gissen P, Christensen H, McKiernan PJ, Ye C, Abdelhaleem M, Hayes J a, Williams MD, Chitayat D, et al. 2005. Requirement of VPS33B, a member of the Sec1/Munc18 protein family, in megakaryocyte and platelet alpha-granule biogenesis. Blood 106:4159–66. Lobingier BT, Merz AJ. 2012. Sec1/Munc18 protein Vps33 binds to SNARE domains and the quaternary SNARE complex. Mol. Biol. Cell 23:4611–22. Lürick A, Kuhlee A, Bröcker C, Kümmel D, Raunser S, Ungermann C. 2015. The Habc domain of the SNARE Vam3 interacts with the HOPS tethering complex to facilitate vacuole fusion. J. Biol. Chem. 290:5405–13. Machlus KR, Italiano JE. 2013. The incredible journey: From megakaryocyte development to platelet formation. J. Cell Biol. 201:785–96. Meng R, Wang Y, Yao Y, Zhang Z, Harper DC, Heijnen HFG, Sitaram A, Li W, Raposo G, Weiss MJ, et al. 2012. SLC35D3 delivery from megakaryocyte early endosomes is required for platelet dense granule biogenesis and is differentially defective in Hermansky-Pudlak syndrome models. Blood 120:404–14. Meyer C, Zizioli D, Lausmann S, Eskelinen EL, Hamann J, Saftig P, von Figura K, Schu P. 2000. mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6- phosphate receptors. EMBO J. 19:2193–203. Morgenstern E, Ruf A, Patscheke H. 1992. Transport of anti-glycoprotein IIb/IIIa-antibodies into the alpha-granules of unstimulated human blood platelets. Thromb. Haemost. 67:121–5. Nakamura S, Takayama N, Hirata S, Seo H, Endo H, Ochi K, Fujita KI, Koike T, Harimoto KI, Dohda T, et al. 2014. Expandable megakaryocyte cell lines enable clinically applicable generation of platelets from human induced pluripotent stem cells. Cell Stem Cell 14:535–548.

Narindrasorasak S, Kulkarni P, Deschamps P, She YM, Sarkar B. 2007. Characterization and Copper Binding Properties of Human COMMD1 (MURR1). Biochemistry 46:3116–3128. Nickerson DP, Brett CL, Merz AJ. 2009. Vps-C complexes: gatekeepers of endolysosomal traffic. Curr. Opin. Cell Biol. 21:543–51. Ostrowicz CW, Bröcker C, Ahnert F, Nordmann M, Lachmann J, Peplowska K, Perz A, Auffarth K, Engelbrecht-Vandré S, Ungermann C. 2010. Defined Subunit Arrangement and Rab Interactions Are Required for Functionality of the HOPS Tethering Complex. Traffic 11:1334– 1346. Ouseph MM, Huang Y, Banerjee M, Joshi S, MacDonald L, Zhong Y, Liu H, Li X, Xiang B, Zhang G, et al. 2015. Autophagy is induced upon platelet activation and is essential for hemostasis and thrombosis. Blood 126:1224–1233. Paquin N, Murata Y, Froehlich A, Omura DT, Ailion M, Pender CL, Constantine-Paton M, Horvitz HR. 2016. The Conserved VPS-50 Protein Functions in Dense-Core Vesicle Maturation and Acidification and Controls Animal Behavior. Curr. Biol. 26:862–871. Peplowska K, Markgraf DF, Ostrowicz CW, Bange G, Ungermann C. 2007. The CORVET tethering complex interacts with the yeast Rab5 homolog Vps21 and is involved in endo- lysosomal biogenesis. Dev. Cell 12:739–50. Pérez-Victoria FJ, Bonifacino JS. 2009. Dual roles of the mammalian GARP complex in tethering and SNARE complex assembly at the trans-golgi network. Mol. Cell. Biol. 29:5251– 5263. Perez-Victoria FJ, Mardones GA, Bonifacino JS. 2008. Requirement of the Human GARP Complex for Mannose 6-phosphate-receptor-dependent Sorting of Cathepsin D to Lysosomes. Mol. Biol. Cell 19:2350–2362. Pertuy F, Eckly A, Weber J, Proamer F, Rinckel J-Y, Lanza F, Gachet C, Eon C. 2014. Myosin IIA is critical for organelle distribution and F-actin organization in megakaryocytes and platelets. Blood 123:1261–1269. Peterson MR, Emr SD. 2001. The class C Vps complex functions at multiple stages of the vacuolar transport pathway. Traffic 2:476–486. Phillips-Krawczak C a., Singla a., Starokadomskyy P, Deng Z, Osborne DG, Li H, Dick CJ, Gomez TS, Koenecke M, Zhang J-S, et al. 2015. COMMD1 is linked to the WASH complex and regulates endosomal trafficking of the copper transporter ATP7A. Mol. Biol. Cell 26:91–103. Phillips-Krawczak CA, Singla A, Starokadomskyy P, Deng Z, Osborne DG, Li H, Dick CJ, Gomez TS, Koenecke M, Zhang J-S, et al. 2015. COMMD1 is linked to the WASH complex and regulates endosomal trafficking of the copper transporter ATP7A. Mol. Biol. Cell 26:91–103. Piper RC, Katzmann DJ. 2010. NIH Public Access. Cell Dev Biol 23:519–547. Plemel RL, Lobingier BT, Brett CL, Angers CG, Nickerson DP, Paulsel A, Sprague D, Merz AJ. 2011. Subunit organization and Rab interactions of Vps-C protein complexes that control endolysosomal membrane traffic. Mol. Biol. Cell 22:1353–63.

Polgár J, Lane WS, Chung S-H, Houng AK, Reed GL. 2003. Phosphorylation of SNAP-23 in activated human platelets. J. Biol. Chem. 278:44369–76. Poulter NS, Thomas SG. 2015. Cytoskeletal regulation of platelet formation: Coordination of F- actin and microtubules. Int. J. Biochem. Cell Biol. 66:69–74. Pulipparacharuvil S, Akbar MA, Ray S, Sevrioukov E a, Haberman AS, Rohrer J, Krämer H. 2005. Drosophila Vps16A is required for trafficking to lysosomes and biogenesis of pigment granules. J. Cell Sci. 118:3663–73. Raymond CK, Howald-Stevenson I, Vater CA, Stevens TH. 1992. Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3:1389–402. Richardson JL, Shivdasani R a, Boers C, Hartwig JH, Italiano JE. 2005. Mechanisms of organelle transport and capture along proplatelets during platelet production. Blood 106:4066– 75. Richardson JL, Shivdasani RA, Boers C, Hartwig JH, Italiano JE. 2005. Mechanisms of organelle transport and capture along proplatelets during platelet production. Blood 106:4066– 4075. Rizo J, Südhof TC. 2012. The Membrane Fusion Enigma: SNAREs, Sec1/Munc18 Proteins, and Their Accomplices—Guilty as Charged? Annu. Rev. Cell Dev. Biol. 28:279–308. Roux KJ, Kim DI, Raida M, Burke B. 2012. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J. Cell Biol. 196:801–10. Ru Y-X, Zhao S-X, Dong S-X, Yang Y-Q, Eyden B. 2015. On the maturation of megakaryocytes: a review with original observations on human in vivo cells emphasizing morphology and ultrastructure. Ultrastruct. Pathol. 39:79–87. Rutherford AC, Traer C, Wassmer T, Pattni K, Bujny M V, Carlton JG, Stenmark H, Cullen PJ. 2006. The mammalian phosphatidylinositol 3-phosphate 5-kinase (PIKfyve) regulates endosome-to-TGN retrograde transport. J. Cell Sci. 119:3944–57. Saarikangas J, Zhao H, Lappalainen P. 2010. Regulation of the actin cytoskeleton-plasma membrane interplay by phosphoinositides. Physiol. Rev. 90:259–89. Savina A, Fader CM, Damiani MT, Colombo MI. 2005. Rab11 promotes docking and fusion of multivesicular bodies in a calcium-dependent manner. Traffic 6:131–43. Schindler C, Chen Y, Pu J, Guo X, Bonifacino JS. 2015. EARP is a multisubunit tethering complex involved in endocytic recycling. Nat. Cell Biol. 17:639–649. Scott CC, Vacca F, Gruenberg J. 2014. Endosome maturation, transport and functions. Semin. Cell Dev. Biol. 31:2–10. Scott GK, Fei H, Thomas L, Medigeshi GR, Thomas G. 2006. A PACS-1, GGA3 and CK2 complex regulates CI-MPR trafficking. EMBO J. 25:4423–35. Seals DF, Eitzen G, Margolis N, Wickner WT, Price A. 2000. A Ypt/Rab effector complex containing the Sec1 homolog Vps33p is required for homotypic vacuole fusion. Proc. Natl.

Acad. Sci. 97:9402–9407. Shravage B V, Hill JH, Powers CM, Wu L, Baehrecke EH. 2013. Atg6 is required for multiple vesicle trafficking pathways and hematopoiesis in Drosophila. Development 140:1321–9. Sinka R, Gillingham AK, Kondylis V, Munro S. 2008. Golgi coiled-coil proteins contain multiple binding sites for Rab family G proteins. J. Cell Biol. 183:607–15. van de Sluis B, Muller P, Duran K, Chen A, Groot AJ, Klomp LW, Liu PP, Wijmenga C. 2007. Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice. Mol. Cell. Biol. 27:4142–4156. Smith H, Galmes R, Gogolina E, Straatman-Iwanowska A, Reay K, Banushi B, Bruce CK, Cullinane AR, Romero R, Chang R, et al. 2012. Associations among genotype, clinical phenotype, and intracellular localization of trafficking proteins in ARC syndrome. Hum. Mutat. 33:1656–64. Søgaard M, Tani K, Ye RR, Geromanos S, Tempst P, Kirchhausen T, Rothman JE, Söllner T. 1994. A rab protein is required for the assembly of SNARE complexes in the docking of transport vesicles. Cell 78:937–948. Sohda M, Misumi Y, Yamamoto A, Nakamura N, Ogata S, Sakisaka S, Hirose S, Ikehara Y, Oda K. 2010. Interaction of Golgin-84 with the COG Complex Mediates the Intra-Golgi Retrograde Transport. Traffic 11:1552–1566. Sohda M, Misumi Y, Yoshimura SI, Nakamura N, Fusano T, Ogata S, Sakisaka S, Ikehara Y. 2007. The interaction of two tethering factors, p115 and COG complex, is required for golgi integrity. Traffic 8:270–284. Solinger J a., Spang A. 2013. Tethering complexes in the endocytic pathway: CORVET and HOPS. FEBS J. 280:2743–2757. Sommerhalter M, Zhang Y, Rosenzweig AC. 2007. Solution structure of the COMMD1 N- terminal domain. J. Mol. Biol. 365:715–21. Starokadomskyy P, Gluck N, Li H, Chen B, Wallis M, Maine GN, Mao X, Zaidi IW, Hein MY, McDonald FJ, et al. 2013. CCDC22 deficiency in humans blunts activation of proinflammatory NF-κB signaling. J. Clin. Invest. 123:2244–56. Stenmark H. 2009. Rab GTPases as coordinators of vesicle traffic. Nat. Rev. Mol. Cell Biol. 10:513–25. Stroupe C, Collins KM, Fratti RA, Wickner W. 2006. Purification of active HOPS complex reveals its affinities for phosphoinositides and the SNARE Vam7p. EMBO J. 25:1579–89. Sui Z, Nowak RB, Sanada C, Halene S, Krause DS, Fowler VM. 2015. Regulation of actin polymerization by tropomodulin-3 controls megakaryocyte actin organization and platelet biogenesis. Blood 126:520–530. Topalidou I, Cattin-Ortolá J, Pappas AL, Cooper K, Merrihew GE, MacCoss MJ, Ailion M. 2016. The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense- Core Vesicles. PLOS Genet. 12:e1006074.

Tsujita K, Suetsugu S, Sasaki N, Furutani M, Oikawa T, Takenawa T. 2006. Coordination between the actin cytoskeleton and membrane deformation by a novel membrane tubulation domain of PCH proteins is involved in endocytosis. J. Cell Biol. 172:269–79. Urban D, Li L, Christensen H, Pluthero FG, Chen SZ, Puhacz M, Garg PM, Lanka KK, Cummings JJ, Kramer H, et al. 2012. The VPS33B-binding protein VPS16B is required in megakaryocyte and platelet α-granule biogenesis. Blood 120:5032–40. Velikkakath AKG, Nishimura T, Oita E, Ishihara N, Mizushima N. 2012. Mammalian Atg2 proteins are essential for autophagosome formation and important for regulation of size and distribution of lipid droplets. Mol. Biol. Cell 23:896–909. Voineagu I, Huang L, Winden K, Lazaro M, Haan E, Nelson J, McGaughran J, Nguyen LS, Friend K, Hackett A, et al. 2012. CCDC22: a novel candidate gene for syndromic X-linked intellectual disability. Mol. Psychiatry 17:4–7. Walsh TG, Metharom P, Berndt MC. 2015. The functional role of platelets in the regulation of angiogenesis. Platelets 26.3:199–211. Wartosch L, Günesdogan U, Graham SC, Luzio JP. 2015. Recruitment of VPS33A to HOPS by VPS16 Is Required for Lysosome Fusion with Endosomes and Autophagosomes. Traffic 16:727–742. Weber-Boyvat M, Chernov KG, Aro N, Wohlfahrt G, Olkkonen VM, Jäntti J. 2016. The Sec1/Munc18 Protein Groove Plays a Conserved Role in Interaction with Sec9p/SNAP-25. Traffic 17:131–153. White JG. 1999. Platelet membrane interactions. Platelets 10:368–81. Witkop CJ, Krumwiede M, Sedano H, White JG. 1987. Reliability of absent platelet dense bodies as a diagnostic criterion for Hermansky-Pudlak syndrome. Am. J. Hematol. 26:305–11. Wong D, Bach H, Sun J, Hmama Z, Av-Gay Y. 2011. Mycobacterium tuberculosis protein tyrosine phosphatase (PtpA) excludes host vacuolar-H+-ATPase to inhibit phagosome acidification. Proc. Natl. Acad. Sci. U. S. A. 108:19371–6. Wong M, Munro S. 2014. Membrane trafficking. The specificity of vesicle traffic to the Golgi is encoded in the golgin coiled-coil proteins. Science 346:1256898. Wurmser A. 2000. New Component of the Vacuolar Class C-Vps Complex Couples Nucleotide Exchange on the Ypt7 GTPase to SNARE-dependent Docking and Fusion. J. Cell Biol. 151:551– 562. Xiang B, Zhang G, Ye S, Zhang R, Huang C, Liu J, Tao M, Ruan C, Smyth SS, Whiteheart SW, et al. 2015. Characterization of a novel integrin binding protein, vps33b, which is important for platelet activation and in vivo thrombosis and hemostasis. Circulation 132:2334–2344. Yang Y, Yan X, Cai Y, Lu Y, Si J, Zhou T. 2010. NudC-like protein 2 regulates the LIS1/dynein pathway by stabilizing LIS1 with Hsp90. Proc. Natl. Acad. Sci. U. S. A. 107:3499–504. Yeh D-W, Chen Y-S, Lai C-Y, Liu Y-L, Lu C-H, Lo J-F, Chen L, Hsu L-C, Luo Y, Xiang R, et al. 2016. Downregulation of COMMD1 by miR-205 promotes a positive feedback loop for

amplifying inflammatory- and stemness-associated properties of cancer cells. Cell Death Differ. 23:841–852. Yoshida M, Saeki M, Egusa H, Irie Y, Kamano Y, Uraguchi S, Sotozono M, Niwa H, Kamisaki Y. 2013. RPAP3 splicing variant isoform 1 interacts with PIH1D1 to compose R2TP complex for cell survival. Biochem. Biophys. Res. Commun. 430:320–4. You T, Wang Q, Zhu L. 2016. Role of autophagy in megakaryocyte differentiation and platelet formation. Int J Physiol Pathophysiol Pharmacol. 8:28–34. Zhang C, Zhang W, Lu Y, Yan X, Yan X, Zhu X, Liu W, Yang Y, Zhou T. 2016. NudC regulates actin dynamics and ciliogenesis by stabilizing cofilin 1. Cell Res. 26:239–53. Zhou Y, Zhang J. 2014. Arthrogryposis¿renal dysfunction¿cholestasis (ARC) syndrome: from molecular genetics to clinical features. Ital. J. Pediatr. 40.1:1–7.

Appendices A.1 BioID constructs The following primers were used to create the BirA fused VPS33B and VPS16B constructs for cloning into pcDNA5/FRT/TO-FLAG-BirA* between EcoRI and NotI:

VPS33B: Forward primer: 5’ TATAGGCGCGCCAATGGCTTTTCCTCACCGACCG 3’

Reverse primer: 5’ AAGTAAAATAGCGGCCGCATCATGCTTTCACCTCACTCATGGCTTCCAT 3’

VPS16B: Forward primer: 5’ TATAGGCGCGCCAATGAATCGGACAAAGGGTGATGAGGAG 3’

Reverse primer: 5’ AAGGAAAAAAGCGGCCGCATCAATTCTTCCATCGAATCTGAGA 3’

The following primers were used to create the BirA fused VPS33B and VPS16B constructs for cloning into pcDNA5/FRT/TO- BirA*-FLAG between EcoRI and NotI:

VPS33B: Forward primer: 5’ TATAGGCGCGCCATGGCTTTTCCTCACCGACCAGAC 3’

Reverse primer: 5’ AAGGAAAAGAGCGGCCGCGGTTGCTTTCACCTCACTCATGGCTTCCAT 3’

VPS16B: Forward primer: 5’ TATAGGCGCGCCATGAATCGGACAAAGGGTGATGAGGAG 3’

Reverse primer: 5’ TTAAGCGGCCGCGGTATTCTTCCATCTAACTTACGA 3’

A.2 Wildtype VPS51 and VPS53 constructs The following primers were used to create the 3xFLAG tagged VPS51 and VPS53 for cloning into p3xFLAG-CMV between EcoRI and KpnI:

VPS51: Forward primer: 5’ TAAAGAATTCAATGGCTGCTGCAGCTGCTGCCGGGCCTA 3’

Reverse primer: 5’ AATGGTACCAAGCCGCGCTCGCAGATGACCTCAA 3’

VPS53: Forward primer: 5’ TGCCCGAATTCAATGATGGAGGAGGAGGAACTG 3’

Reverse primer: 5’ ATCGGTACCAACGTCCATCTCACCTGTTCTGCTCC 3’

A.3 Wildtype CCDC22 construct The following primers were used to create the eGFP tagged or 3xFLAG tagged CCDC22 for cloning into p3xFLAG-CMV and peGFP-C1 between EcoRI and KpnI:

Forward primer: 5’AAAGAATTCGATGGAGGAGGCGGAC 3’

Reverse primer: 5’ AATGGTACCTTGGCCTCCCGGACCCGRCCTA 3’

A.4 VPS33 domain mapping constructs The following primers were used to create the VPS33B fragments for cloning into pCMV-HA between EcoRI and KpnI:

1-1050 AA Forward primer: 5’ GGCGAATTCAAATGGCTTTTCCTCATCGG 3’

Reverse primer: 5’ AAAAGGTACCTCAGGATTCACAGGCCCC 3’

1048-End Forward primer: 5’ GCCGAATTCCCTCCATCATGAAGAAGAAA 3’

Reverse primer: 5’ GAACGGTACCTCAGGCTTTCACCTCACT 3’

913-1695 AA Forward primer: 5’ GAAGAATTCTCGCTCGGAACTTGCAGGCC 3’

Reverse primer: 5’ AAAGGGTACCTCATAGGGACTCACTGAAGC 3’