PLEASE READ THIS PAGE

I have uploaded my MSc thesis so that anyone interested can read it (it’s nice to think someone other than the examiners and my parents will). A couple of important points:

Two papers summarizing the most important results of this thesis have been published:

Veale A.J., Lavery S.D. (2011) Phylogeography of the snakeskin chiton Sypharochiton pelliserpentis (Mollusca: Polyplacophora) around New Zealand: are seasonal near-shore upwelling events a dynamic barrier to gene flow? Biological Journal of the Linnean Society, 2011, 104, 552–563.

Veale A.J., Lavery S.D. (2012) The population genetic structure of the intertidal waratah anemone (Actinia tenebrosa) around New Zealand. New Zealand Journal of Marine and Fresh-water Research 46:4 523-536

These are more up to date, more succinct and generally improved due to the peer review process. In terms of citations, it would be preferential for me that you cite these papers in your research, rather than citing my thesis because I gain more scientific prestige from paper citations.

That said, the thesis contains information not in the papers (it’s a lot larger and I provide a more thorough review of the background, methods, other things I have tried etc). Also, as I received a high mark (A+) it could be useful as a template to help write an MSc. Don’t necessarily feel you have to replicate the size, exact structure or methods, but it’s always useful to know what others have done as an example.

If I were researching a similar area, I would look both at the papers and the thesis, and if the information is in the papers cite these, however if it is only in the thesis then great, cite that. I really hope it is useful.

Please contact me ([email protected]) if you have any questions or would like a copy of the papers; I’m always keen to talk about my work and assist others wanting to work in similar areas.

Enjoy Andrew

Phylogeography of two intertidal benthic marine invertebrates around New Zealand

The Waratah Anemone (Actinia tenebrosa)

The Snakeskin Chiton (Sypharochiton pelliserpentis)

Andrew James Veale

A thesis submitted in partial fulfilment of the requirements for the degree of Master of Science in Biology

The University of Auckland 2007 - II -

There was a sea anemone, Enthralled by pornography, All the grinding and moaning, Just set him off cloning, Disrupting Hardy-Wein equillibrilie.

- III -

The University of Auckland

Thesis Consent Form

This thesis may be consulted for the purpose of research or private study provided that due acknowledgement is made where appropriate and that the author’s permission is obtained before any material from the thesis is published.

I agree that the University of Auckland Library may make a copy of this thesis for supply to the collection of another prescribed library on request from that Library; and

I agree that this thesis may be photocopied for supply to any person in accordance with the provisions of Section 56 of the Copyright Act 1994

Signed:…………………………………………………………………….

Date: 2nd of April, 2007.

- IV -

Abstract

New Zealand is an elongate continental group of islands, north-south in orientation, spanning over 13 º of latitude which contains a diverse range of marine environments and current systems. In recent years, phylogeographic studies on New Zealand’s benthic marine invertebrate taxa have highlighted some geographic areas that show restricted gene flow and hypothesized hydrological causes of these. However, few studies have examined the generality of these ‘barriers to dispersal’ among species, and most studies have investigated organisms with long pelagic larval phases. In order to investigate the comparative phylogeographic structure of coastal marine taxa around New Zealand's coastline, and to investigate the processes that may contribute toward this genetic structure, I conducted a New Zealand wide phylogeographic study of two benthic marine invertebrates with differing dispersal abilities and strategies – the snakeskin chiton (Sypharochiton pelliserpentis) and the waratah anemone (Actinia tenebrosa). S. pelliserpentis individuals were sampled from 28 populations around the coast of New Zealand. The mitochondrial COI locus was analysed, both through RFLP and sequence analysis. This analysis incorporated mitochondrial COI sequences (approximately 700bp) from 217 individuals. These individuals were classified into 6 haplogoups defined by RFLP patterns, which were also determined for a further 232 individuals, giving a total of 449 S. pelliserpentis individuals classified into RFLP haplogroups. Strong population structuring was evident, consistent with a north/south phylogrographic disjunction across central New Zealand (among group genetic variance ΦST = 0.445 p<0.001). This potential barrier to gene flow has been described previously, but the present study defines the location at which it occurs with far greater resolution – Cloudy Bay on the South Island’s east coast, and Farewell Spit on the South Island’s west coast. An additional significant barrier to coastal dispersal was found at the northern tip of New Zealand across Cape Reinga. - V -

For the population genetic analysis of A. tenebrosa, I used a combination of four variable microsatellite markers. This analysis was conducted using the combined microsatellite frequencies from 429 A. tenebrosa individuals from 26 populations from around New Zealand, and from two Australian populations. I detected high levels of genetic differentiation among populations of A. tenebrosa around New Zealand. Unlike S. pelliserpentis, there was no strong north/south disjunction evident, and instead an isolation-by-distance pattern of divergence was detected, similar to that observed among Australian populations. There were some deviations from a strict relationship between genetic and geographic distance among A. tenebrosa populations, and these appeared to be related to localised restrictions to gene flow, such as absence of suitable habitat. A. tenebrosa is partially clonal, and higher clonal frequencies were detected on the east coast of the South Island. This may be related to the lower survival of sexually produced larvae in colder waters. The boundaries of the north/south disjunction observed in S. pelliserpentis coincide with intense nearshore upwellings that have previously been suggested as a causative agent in the observed disjunction of marine invertebrate populations. A comparative phylogeographic analysis of the population structuring of all organisms so far studied across this barrier implicates time of spawning as important in predicting the strength of this disjunction within a species. The strength of this barrier may vary seasonally (having a stronger affect in late summer/autumn). This coincides with the variation in strength of the upwelling in this region. This study has revealed considerable population structure around New Zealand’s coastline within two species with differing dispersal abilities and strategies. Both fine-scale and broad-scale patterns of population structure were evident. Each of these two species appears to be somewhat representative of different classes of connectivity pattern found within New Zealand coastal marine invertebrates. It appears that these different patterns may be driven by interactions between regional and local-scale hydrological factors on the one hand, and larval dispersal ability and timing on the other. This points the way for future studies investigating the processes driving connectivity among New Zealand marine communities. - VI -

Acknowledgements

During the past two years I have been helped, supported and befriended by a large number of talented and kind people, without whom this thesis would not have been written. I owe to all of them my sincerest gratitude.

First and foremost I would like to thank my supervisor Dr. Shane Lavery, who I cannot thank enough for his tireless support, patience and kindness. Your exceptional knowledge and ability to communicate it and inspire others are rare skills. This research has been one of the most memorable and enjoyable experiences of my life and this you can take full credit for. My greatest hope for this thesis is that it is something you can be proud of too. I wish you even more success and look forward to opportunities to collaborate in the future.

Everyone in the Molecular Ecology Lab deserves praise for going out of the way to train me, help me and make sure I knew how much more work I always had to do. Debbie Steel and Murdoch Vant in particular so often went beyond the call of duty to assist me, and help me understand the laboratory procedures and analysis. There is no way I could have gotten through it all without you.

There were several dear friends that sojourned with me sampling, and had no idea what they were getting into when I asked if they wanted to come road- tripping. Thanks to David Rotherham, Parvati Prema and Sarah Milton for your patience, assistance, and taking me to the hospital when required - good times. It was an amazing adventure and hopefully something akin to the holiday you hoped for. Also my deepest gratitude goes out to Micah Jensen who helped locate anemones by brail at night with me at Castle Point, and to Gill Molony who helped me collect samples by means of interpretive dance in chest deep mud near Whakatane.

- VII -

My sampling could not have been as comprehensive without the kind support of several people that obtained samples from places I simply could not in the time given. Thanks to Jen Jackson who was able to pick up samples from Stewart Island, and to Dave Houston and Antje Leseberg from DoC for their sampling in the Chathams. Two schools kindly assisted in obtaining samples, my gratitude goes out to Catherine Smart-Simpson and the budding marine ecologists from Karamea Area School and to Dave Slater from Collingwood Area School.

Wilma Blom and Margaret Morley from the Auckland War Memorial Museum assisted in trying to identify my mystery chitons, and helped me look through the vast historical collections. Also Margaret Morley and Bruce Hayward obtained some S. sinclari samples for me, and Hamish Spencer and Jon Waters kindly supplied me with S. sinclari sequence. To you all I owe the highest gratitude.

My family have been so supportive and kind, always willing to go out to help me sample and get scraped along the rocks by the waves. Your love and support throughout this period has kept me going, I am very lucky to have you. Thankyou Mum, Dad, Robert, Anne and Kevin.

- VIII -

Table of Contents

Abstract...... IV

Acknowledgements...... VI

List of Figures...... XII

List of Tables ...... XIV

List of Appendices ...... XV Appendix I – Laboratory Protocols ...... XV A1.1 DNA extraction XV A1.2 PCR reagents, primers and thermal cycle XV Appendix II – Phylogenetic Data ...... XV A2.1 Sypharochiton pelliserpentis XV A2.2 Actinia tenebrosa XV A2.3 Isactinia olivacea XV Appendix III – Population Site Details ...... XV

1 General Introduction...... 1 1.1 Phylogeography...... 1 1.2 Dispersal Mechanisms ...... 3 1.3 Marine Dispersal Barriers ...... 4 1.4 Molecular markers ...... 7 1.4.1 Allozymes 7 1.4.2 Nuclear microsatellite markers 8 1.4.3 Mitochondrial DNA markers 9 1.5 Phylogeography in New Zealand...... 10 1.6 New Zealand’s Oceanic Conditions ...... 11 1.7 Study Species ...... 16 1.7.1 Sypharochiton pelliserpentis 16 1.7.2 Actinia tenebrosa 16 1.7.3 Isactinia olivacea 17 - IX -

1.8 Aims ...... 18 1.9 Thesis Outline ...... 20

2 The Phylogeographic Structure of the Snakeskin Chiton (Sypharochiton pelliserpentis) around New Zealand...... 22 2.1 Introduction ...... 22 2.1.1 Sypharochiton pelliserpentis 24 2.1.2 Review of Sypharochiton 24 2.1.3 Reproduction 26 2.1.4 Population Studies 27 2.1.5 Summary 28 2.2 Methods ...... 29 2.2.1 Collection of Specimens 29 2.2.2 DNA Extraction and Amplification 30 2.2.3 Purification and Sequencing 30 2.2.4 Restriction Fragment Length Polymorphism 31 2.2.5 Data Analysis 33 2.2.6 Phylogeographic Structure 33 2.3 Results ...... 35 2.3.1 Sequence Analysis 35 2.3.2 Population Subdivision 37 2.4 Discussion...... 48

3 The Phylogeographic Structure of the Waratah Anemone (Actinia tenebrosa) Around New Zealand.56 3.1 Introduction ...... 56 3.1.1 Geographic and intertidal distribution 58 3.1.2 Reproduction 59 3.1.3 Dispersal capabilities 60 3.1.4 Local Adaptation 62 3.1.5 Population Connectivity of A. tenebrosa 62 3.1.6 Loci 63 3.2 Summary...... 64 3.3 Methods ...... 64 3.3.1 Collection of Specimens 64 3.3.2 DNA Extraction and Amplification 66 - X -

3.3.3 Microsatellite Genotyping 67 3.3.4 Data Analysis 68 3.4 Results ...... 70 3.4.1 Molecular Marker Variability 70 3.4.2 Genetic Variation 71 3.4.3 Genotype Diversity 74 3.4.4 Population Subdivision 76 3.5 Discussion...... 85 3.5.1 Population Subdivision 85 3.5.2 Spatial Autocorrelation 88 3.5.3 Genotype Diversity 90 3.5.4 Molecular Markers in Anthozoa 92 3.5.5 Microsatellite Amplification Methodology 93

4 General Discussion...... 95 4.1 Introduction ...... 95 4.2 Previous studies ...... 96 4.3 Geographic concordance...... 98 4.3.1 North/South genetic structuring 98 4.4 Life history concordance ...... 102 4.5 Phylogeographic Process...... 107 4.5.1 Western Greater Cook Strait 107 4.5.2 Eastern Cook Strait 109 4.6 North/South Dispersive Boundary Summary...112 4.7 Conclusions ...... 113

5 References...... 114

Appendix I – Laboratory Protocols...... 140 A1.1 DNA extraction ...... 140 A1.1.1 DNA Extraction (PCI) 140 A1.1.2 DNA Extraction (Chelex) 141 A1.2 PCR reagents, primers and thermal cycle 141 Appendix II – Phylogenetic Data ...... 142 A2.1 Sypharochiton pelliserpentis 143 A2.2 Actinia tenebrosa 143 A2.3 Isactinia olivacea 145 - XI -

Appendix III – Population Site Details ...... 147

- XII -

List of Figures

Figure 1.1 Sea Surface currents and continental shelf area around New Zealand...... 12 Figure 1.2 Map showing the variable trajectories of the principle hydrogeographic features of central New Zealand on the east coast...... 15 Figure 2.1 Map showing the collection sites for S. pelliserpentis around New Zealand, and the respective number of individuals sampled at each location ...... 29 Figure 2.2 Restriction Fragment Length Polymorphisms (RFLPs) of S. pelliserpentis ...... 31 Figure 2.3 Definitions of the six S. pelliserpentis COI haplogroups as defined by RFLPs...... 32 Figure 2.4 S. pelliserpentis COI RFLP banding pattern shown for three of the five restriction enzymes...... 33 Figure 2.5 Haplogroup frequencies for each population as defined by RFLPs 36 Figure 2.6 MDS of DXY for S. pelliserpentis populations based on A) COI sequence data, and B) COI RFLP data...... 38 Figure 2.7 The two groups as defined using SAMOVA as having the lowest possible FCT value using both COI sequence data, and COI RFLP data for S. pelliserpentis...... 39 Figure 2.8 The distribution of variance within S. pelliserpentis populations around New Zealand compared between the number groups of New Zealand populations defined in SAMOVA...... 40 Figure 2.9 Dendogram showing the genetic relationships between populations of S. pelliserpentis in New Zealand ...... 44 Figure 2.10 Pairwise FST values between adjacent populations of S. pelliserpentis based on COI RFLP data...... 46 Figure 2.11 Pairwise FST values between adjacent populations of S. pelliserpentis based on COI sequence data...... 46 Figure 2.12 Pairwise ΦST values between adjacent populations of S. pelliserpentis around the North Island based on COI RFLP data...... 47 Figure 2.13 Pairwise ΦST values between adjacent populations of S. pelliserpentis around the North Island based on COI RFLP data...... 47 Figure 2.14 Sea surface isotherms (ºc) January 1972 showing the intense upwelling at Cape Reinga ...... 51 Figure 2.15 Map of New Zealand coastline highlighting long sand, shingle or sand/gravel mixed beaches...... 53 Figure 2.16 Map showing the northward extension of the WC...... 55 Figure 3.1 Maps showing the collection sites for A. tenebrosa around New Zealand and Australia ...... 65 Figure 3.2 The expected number of individuals with the identical genotype for increasing locus combinations within each of the 28 populations of Actinia tenebrosa sampled...... 74 - XIII -

Figure 3.3 The percentage of unique multilocus haplotypes sampled in each location for Actinia tenebrosa individuals compared with the latitude of sampling location...... 765 Figure 3.4 MDS of genetic distance (Nei, 1978) for populations of A. tenebrosa from around New Zealand...... 76 Figure 3.5 Map showing linearized FST values (Slatkin, 1995) between geographically adjoining populations of A. tenebrosa around New Zealand ...... 78 Figure 3.6 Spatial correlogram of the relationship between Moran’s Index and the geographic distance between populations of Actinia tenebrosa around New Zealand...... 80 Figure 3.7 Spatial correlogram of the relationship between Geary’s Index and the geographic distance between populations of Actinia tenebrosa around New Zealand...... 80 Figure 3.8 Relationship between genetic differentiation (Nei, 1978) and geographic distance between populations of Actinia tenebrosa around New Zealand...... 81 Figure 3.9 Relationship between genetic differentiation (Nei, 1978) and geographic distance between populations of Actinia tenebrosa around New Zealand ...... 81 Figure 3.10 The distribution of variance within four microsatellite loci for A. tenebrosa compared between the number groups of New Zealand populations defined in SAMOVA...... 82 Figure 3.11 Population groupings as defined in SAMOVA for eight groups of A. tenebrosa populations ...... 83 Figure 3.12 Dendogram showing the genetic relationships among A. tenebrosa populations in New Zealand and two Australian populations (Queensland & Western Australia)...... 84 Figure 3.13 Map of North Island showing place names discussed in text...... 86 Figure 3.14 Sea surface temperature (ºC) around southern New Zealand. ... 91 Figure 3.15 Chromatogram trace morphologies for the AT38 locus from Genotyper...... 93 Figure 4.1 Map of the greater Cook Strait region showing the north/south split evident in marine invertebrate populations...... 100 Figure 4.2 Geographic Map of the Greater Cook Strait area showing place names discussed in text...... 101 Figure 4.3 Relationships between larval duration and ФST values across the north/south division ...... 102 Figure 4.4 Period of larval release compared with ΦST value for marine invertebrate species in New Zealand exhibiting a North/South disjunction in population connectivity south of Cook Strait...... 104 Figure 4.5 Contours of sea surface temperature (ºC) in the Kahurangi-Golden Bay area showing the cold upwelling observed north of Cape Farewell during south-westerly or westerly winds...... 109 Figure 4.6 Map showing the variable trajectories of the principle hydrogeographic features of central New Zealand on the east coast ..... 110 Figure 4.7 Contours of sea surface temperature (ºC) of the Cook Strait region showing the pluming of cold water south-east from Cloudy Bay...... 112 - XIV -

List of Tables

Table 2-1 Population location and sample size for S. pelliserpentis showing the two data types used in this study...... 35 Table 2-2 Population groupings as defined in SAMOVA of S. pelliserpentis ... 39 Table 2-3 Population groupings within the northern grouping as defined in SAMOVA of S. pelliserpentis COI RFLP data...... 41 Table 2-4 Φ Statistics from AMOVA of S.pelliserpentis where North and South Island populations were partitioned into two groups...... 42 Table 2-5 Φ Statistics from AMOVA of S.pelliserpentis where Kaiteriteri and Ocean Beach were included with North Island populations while the remainder of the South Island populations were partitioned into a separate group...... 42 Table 2-6 Levels of significance for pairwise ΦST comparisons between S. pelliserpentis populations using COI sequence data ...... 43 Table 2-7 Levels of significance for pairwise ΦST comparisons between S. pelliserpentis populations using COI RFLP data...... 43 Table 3-1 Primer sequences for the microsatellite loci used in this study...... 67 Table 3-2 The level of success obtained for each locus investigated in this study for I. olivacea and A. tenebrosa...... 71 Table 3-3 Allele frequencies for the collections of Actinia tenebrosa from 26 populations around New Zealand and two populations from Australia. .. 72 Table 3-4 Allele frequencies using only unique multilocus haplotypes for the collections of Actinia tenebrosa from 26 populations around New Zealand and two populations from Australia...... 73 Table 3-5 Levels of significance for pairwise FST comparisons between A. tenebrosa populations using combined microsatellite loci...... 78 Table 3-6 Population groupings as defined in SAMOVA for A. tenebrosa ...... 82 Table 3-7 Private alleles located for the four microsatellite loci in all populations of A. tenebrosa investigated...... 85 Table 4-1 Summary of marine invertebrate population genetics studies around New Zealand...... 97 Table 4-2 Summary of habitat, life history and phylogeography of all New Zealand coastal marine invertebrate species studied across both North and South Islands...... 98

- XV -

List of Appendices

In order to save space and paper, some parts of the appendices have only been included in electronic form. These can be located on a CD at the back of this thesis. An electronic copy of the entire thesis is also provided in pdf format.

Appendix I – Laboratory Protocols

A1.1 DNA extraction

A1.2 PCR reagents, primers and thermal cycle

Appendix II – Phylogenetic Data

A2.1 Sypharochiton pelliserpentis

A2.2 Actinia tenebrosa

A2.3 Isactinia olivacea

Appendix III – Population Site Details

- 1 -

1 General Introduction

1.1 Phylogeography

The term ‘phylogeography’ was introduced by Avise (1987) as the study of the geographic distributions of phylogenetic lineages, and the interpretation of these in terms of evolutionary process. Phylogeography ‘seeks to test the congruence between the evolutionary, demographic and distributional histories of taxa against the geological and ecological settings of a region’ (Berhmingham & Moritz, 1998). Through the analysis of the structuring of lineages, population dynamic patterns both historical and contemporary can be assessed. Patterns indicating vicariance, migrational events, population bottlenecks or expansions, hybridization and refugia are all discernable through these means, and this analysis provides hypotheses as to the grounds of these patterns. When Avise (1998) reviewed the first decade of phylogeography as a research area, 150 papers had been written with phylogeography as a term in the title or as a key word. The field has been expanding exponentially since its inception now with over 2,600 phylogeographic papers currently listed on the ISI Web of Science.

The principal foci for phylogeographic research can be assembled into three broad categories – the evolutionary effects of historical events, the effects of demographic factors and investigations into putative dispersal barriers. Historical events have been both a target for investigation via phylogeographic analysis and the rationale supplied for phylogeographic patterns. The closure of straits, changes in sea levels and glaciation events have all left their mark on the genetic lineages - isolating them, or bringing together previously isolated branches of the populations of creatures that occupied adjacent regions during these events (Gopurenko &Hughes, 2002; Kelly et al., 2006) - 2 -

A second area of focus of phylogeographic research has been on the effects of demographic factors such as the life history variation in dispersive abilities (Bohonak, 1999). With dispersal mechanisms and the true potential of dispersive abilities of propagules difficult to assess (Cowan et al., 2006), it is left to phylogeographic comparisons such as those of (Ayre & Hughes, 2000) on a number related of species encompassing varying dispersal abilities to shed light on the population level effects of these demographic factors. Other phylogeographic studies have focused on putative dispersal barriers such as the Point Conception biogeographic barrier (Burton et al., 1998) and population connectivity over different dispersive environments such as varying hydrological conditions (Baus et al., 2005). For these studies of specific hypothetical dispersive barriers, a comparative phylogeographic investigation across a range of groups is vital to the understanding of the processes involved allowing full ecological landscapes to have meaningful examination and generalizations and predictions to be made (Bermingham & Moritz, 1998).

The benefits of phylogeographic studies for conservation have also begun to be realized. Evolutionary Significant Units (ESU)’s have been identified using phylogeographic techniques. These ESU’s are groups of organisms at a subspecific, geographic race or population level which are treated as distinct from a conservation standpoint, having substantial reproductive isolation and unique, phylogenetically distinct history from other populations (Waples, 1991). A New Zealand example of this was this distinction of the Maui’s dolphin subspecies of Hector’s dolphin with a differing geographic range and substantial genetic isolation (Baker et al., 2002). The conservation benefits of analyzing the phylogeography of invasive species have also been investigated. For instance the source of invasive colonizers can be determined, the number of invasions (and if they are ongoing) and the effects of human mediated transport can all be monitored through phylogeographic analysis (Herborg et al., 2007; Neilsen & Wilson, 2005). Not only can phylogeography play a role in conservation with invasive species, threatened species and ecosystems may also benefit. An understanding of the direction and magnitude of larval transport processes are vital to marine reserve network design. Marine reserves can only be self sustaining if - 3 - recruitment exceeds mortality and emigration, and for non-migratory species larval transport is the major source of recruitment. It has been suggested that marine reserve size must be equal to or exceed the average larval dispersal distance for any given species (Botsford et al., 2003). Theoretical larval transport models and hence population connectivity based on marine currents are often a poor predictors of true population connectivity (Cowan et al., 2000). Through population genetic and phylogeographic studies it is possible to measure the effects of these processes and empirically test predictions; therefore aiding in decisions on the placement, size and linkages of marine protected areas (Palumbi, 2003).

1.2 Dispersal Mechanisms

All marine invertebrates pass through larval stages and it is this stage of development that most influences dispersal potential. The effect of larval period is believed to be especially profound for sedentary and sessile benthic marine invertebrates which have no alternative means of habitat colonisation. The most influential aspect of larval development is whether they are pelagic or non-pelagic. The pelagic larval forms drift in the water column for long periods from days to months. These can either be planktotrophic (feeding larva), which usually hatch from smaller eggs, or lecithotrophic (non-feeding larva), which hatch from larger eggs (Mileikovsky, 1971). Of these two kinds the planktotrophic larvae generally have longer planktonic periods and are therefore potentially more dispersive. Non-pelagic larvae do not enter the water column but become bottom dwelling juveniles. This direct development often is related to some form of brooding behaviour of a parent (Mileikovsky, 1971).

For marine invertebrates, the deduction is commonly made that the inclusion of a planktonic larva in the life cycle provides for greater larval transport and gene flow between populations allowing genetic homogenisation between them, thus creating larger panmictic populations (Baus et al., 2005). This link between larval behavior and population connectivity has been shown empirically with a review of population subdivision across a wide range of organisms, with dispersal potential negatively correlated with measured population subdivision - 4 -

(FST) (Shulman, 1998; Bohonak, 1999; Levin, 2006). A positive relationship typically exists between propagule duration (planktonic larval duration [PLD]) and dispersive distance (Shanks et al., 2003); and correspondingly a negative relationship exists between PLD and genetic distance (Siegel et al., 2003). This relationship has been demonstrated for a wide range of marine invertebrate groups: sea cucumbers (Arndt & Smith, 1998), corals (Ayre & Hughes, 2000; Hellberg, 1996), polychaetes (Breton et al., 2003), gastropods (Collin, 2001), sea anemones (Edmands & Potts, 1997), nudibranch molluscs (Todd et al., 1998) and bryozoans (Goldson et al., 2001). These studies have largely been comparisons between larval types (direct development, lecithotrophic or planktotrophic) with a great disparity between the larval durations compared. The links between precise larval duration within each category and population subdivision have been less correlated, hinting that a number of other factors such as larval behaviors also influence population connectivity strongly (Bay et al., 2006; Bowen et al., 2006). Research currently underway at the University of Auckland using accurately measured PLDs of triplefin fish has not found correlation between PLD and population connectivity (Yair Kohn, MSc thesis in progress 2007).

The length of spawning season is another life history trait that has been suggested to effect the dispersal of marine organisms. If currents vary seasonally, effective genetic barriers could appear that would otherwise not be present (Hohenlohe, 2004). Patterns of larval recruitment have been seen to be strongly effected by seasonal current patterns for species with extended breeding (McCulloch & Shanks, 2003; Wing et al., 2003).

1.3 Marine Dispersal Barriers

Despite its physical continuity, the marine environment is heterogeneous ecologically which is attributable to both biotic and abiotic factors (Briggs, 1961). There is growing evidence that widespread marine organisms are more genetically structured than expected given their high dispersal potential and apparent lack of barriers to dispersal within ocean systems (Palumbi 1997, Benzie 1999, Riginos & Nachman 2001). Only in recent years through - 5 - population genetic studies, linked with studies of hydrology, larval behaviour and historical events have we really begun to understand the processes that constitute barriers to dispersal in the marine environment.

There are multiple factors that determine gene-flow patterns among marine populations and an understanding of these is still developing. The most easily understood is that of classical Darwinian historical vicariance. This has been hypothesized as an explanation to observed disjunction of the widespread asteriid sea-star Coscinasterias muricata in Australia where the repeated opening and closing of Bass Strait during interglacial periods has been linked to population disjunction and possibly cryptic allopatric speciation (Waters & Roy, 2003). Similar vicariant events have been shown for the formation of the Panama Isthmus, the historical closure of Torres Strait (Jackson et al., 1993; Gopurenko & Hughes, 2002) and the repeated closing and opening of the Indo- Malay archipelago (Lavery et al., 1995, 1996; Chenoweth, 1998). Mechanisms of marine historical vicariance other than land barriers are also possible such as the historical glacial regions leading to population disjunction for the amphipod Gammarus tigrinus in North America (Kelly et al., 2006), and hypothesized historical circulation patterns linked with genetic structuring of the giant clam Tridacna maxima (Benzie & Williams, 1997). An interesting comparative example of phylogeography involving historical vicariance was the study of Marko (2004) which found a disparate population structure between two benthic marine gastropods – one of which (Nucella lamellosa) was shown to have survived partially in refugia within the glacial environment, whilst the other (Nucella ostrina), is a recent invader of the area which occurred subsequent to the glacial decline.

Habitat discontinuity is another hypothesis used to explain some situations such as reef species not physically or behaviourally able to cross stretches of sand (Bernardi, 2000). Similarly habitat discontinuity of sand between reefs has been shown to cause an ‘isolation by distance’ pattern in the eastern oyster, Crassostrea virginica, in Chesapeake Bay (Rose et al., 2006). It has also been suggested that local adaptation such as to salinity or temperature may play a part in how connected populations appear to be (Palumbi, 2004). - 6 -

The greatest probable cause for contemporary ongoing population disjunction in marine environments however is the local water circulation system. In studies using the Lusitanian sea-star Asterina gibbosa, observed population subdivision was much higher within the Mediterranean with its’ low amplitude tidal currents and common local eddies than on the Atlantic coast which has stronger tides and currents (Baus et al. 2005). A similar situation was observed for the abalone Haliotis asinine in the Indo-Malay Archipelago, where gene flow amongst geographical populations was shown to be notably higher when associated with major ocean currents (Jeffrey et al., 2007).

Various ocean current systems have also been proposed as barriers to dispersal for marine populations. Sharp genetic breaks over otherwise continuous habitat have been attributed to both convergent currents (flowing together from two directions) and divergent currents (flowing apart from a central area) (Kittiwattanawong, 1997; Rocha-Olivares & Vetter, 1999), as well as tidal fronts (Goldson et al., 2001; DeWolf et al., 2000; Wares et al., 2001). One of the best studied examples of converging currents is that of Conception Point in the USA where a number of species have been shown to have a disjunct population structure across this feature (Miller and Emlet, 1997; Burton 1998; Connolly et al., 2001; Dawson, 2001; Hohenlohe, 2004). Here the converging currents cause upwelling and offshore flow, and it is this that is hypothesized as the probable mechanism limiting larval transport across the area.

The aforementioned Point Conception phylogeographic barrier is also the boundary between biogeographic zones (Burton et al 1998). Biogeographic zones are defined using species assemblages, and have some features that presumably limit the range extension of these organisms. This coupling of biogeographic zonation has also been observed in other regions (Jeffrey et al., 2007) indicating that those forces that restrict species movement may also restrict lineages of more widespread species. This suggests that biogeographic boundaries should be further investigated as hypothetical dispersive boundaries. - 7 -

Hydrological factors need not be constant throughout the year to serve as boundaries. Seasonal upwelling due to meteorological factors have been shown to change patterns of larval recruitment (McCouloch & Shanks, 2003; Wing et al., 2003) and have been hypothesized as barriers to larval dispersion for organisms that spawn during these periods resulting in population genetic structure (Apte & Gardner, 2002).

1.4 Molecular markers

Over the last 25 years considerable progress has been made in the use of genetic tools to investigate population structuring. There are now many different classes of molecular markers employed today in population genetic, and phylogeographic studies. These including, but are not limited to: allozymes, mitochondrial DNA, chloroplast DNA, nuclear genes, RAPDs and AFLPs (Avise, 2004). Each method provides slightly different genetic information allowing different analyses and investigations to be undertaken.

1.4.1 Allozymes

Protein electrophoretic techniques were introduced in the 1960’s, and remain a popular method for generating mendelian nuclear markers for ecological and evolutionary applications (Avise, 2004). The majority of early marine invertebrate population genetic studies in New Zealand such as that of Smith (1980) on rock lobsters - Jasus edwarsii and Jasus novaehollandiae have used allozyme markers. This technique uses protein electrophoresis which involves running stained proteins through a supporting media such as acrylimide gel or cellulose acetate strip with an applied electric field. Proteins with different net charges migrate differently and are thus able to be separated into bands. Variation in this banding pattern between individuals is scored, yielding discrete characters. Allozymes have the advantage that they are of low cost, and many loci can be quickly screened for variability with more than one hundred allozyme stains available (Avise, 2004).

There are several disadvantages of allyzome techniques however. The raw data of allozyme analyses are discrete, with the similarity (number of changes) - 8 - between alleles undetermined. Because of this, population connectivity can be assessed but the evolutionary history of the alleles cannot. A further problem relating to allozyme analysis is that population genetics relies on the markers used being selectivity neutral and this assumption of neutrality does not always hold true for allozymes (Hedgecock, 1986). Clines in environmental factors such as temperature or salinity can select for certain enzyme forms, perhaps resulting in misleading results. Furthermore, only genetic changes that alter amino-acid sequence are detectable, significantly lowering the potential resolution. This lower resolution failed to detect significant population structuring in New Zealand sea urchins E. chloroticus (Mladenov et al., 1997) that was later observed using microsatellite markers (Perrin, 2002). Similarly, significant population structure was not detected using allozyme markers for greenlipped mussels - Perna canaliculus around New Zealand (Gardner et al., 1996) but was subsequently revealed using mitochondrial DNA sequence (Apte & Garnder, 2002).

1.4.2 Nuclear microsatellite markers

Microsatellites – also known as ‘short tandem repeats’ (STRs), consist of reiterated short sequences that are tandemly arrayed at a particular chromosomal location with variation in repeat copy number, which often gives a profusion of distinguishable alleles (Avise, 2004). These alleles can be distinguished by size using acrylamide gel or capillary electrophoresis without the need for arbitrary binning, as similar sized alleles generally differ in readily detectable increments. The discrete genotypic data provided by microsatellites are in several ways analogous to those provided by allozymes. Population variation however is typically much higher at STR loci due to the high mutation rate of microsatellites – from 10-3 to 10-4 per locus per gamete per generation (Primmer et al., 1996; Schug et al., 1997; Weber & Wong 1993). Due to this higher variability, STRs are able to detect finer scale genetic differentiation among populations than allozyme markers (Perrin, 2002; Sherman, 2006). Many but not all mutations in STRs result in alleles of the adjacent size classes, so that mutational process tends to be imperfectly stepwise or ladder-like (Avise, 2004). - 9 -

A disadvantage shared between allozyme and microsatellite markers is that evolutionary trees cannot be readily constructed from the alleles. Analysis of these markers principally involve comparisons of allele presence/absence or frequency. This means that they are most effective in studies of clonality, parentage, population differentiation and gene flow. Because phylogenetic trees cannot be constructed without using calculations of genetic distance (e.g. Nei’s D), it can be more difficult to assess historical evolutionary patterns and interspecific relationships using these markers rather than DNA sequence markers.

1.4.3 Mitochondrial DNA markers

Mitochondrial DNA has a number of positive characteristics that facilitate its use in population genetic studies (Maynard-Smith, 1998). It has uniparental inheritance, predominantly through the maternal line in most species (Birky, 1995), though there are rare exceptions such as the ‘doubly uniparental’ transmission of mitochondria in the bivalve mollusc Mytilus (Zouros, 2000). Along with this, most individual animals are homoplasmic meaning that a single mtDNA sequence predominates in all cells and tissues (Avise, 2004). Because of these factors, the phylogeny of mtDNA is not biased by recombination events and the inferred evolutionary relationships are interpreted as estimates of ‘matriarchal phylogeny’ (Avise et al., 1979). Furthermore, its haploid, sex linked inheritance implies that the effective population size will be smaller than for nuclear genes, making it more sensitive to genetic drift (Ferguson et al., 1995), founder events and bottlenecks (Moritz et al., 1987, Maynard-Smith, 1998). Mitochondrial DNA also evolves rapidly at the sequence level due in part to inefficient mutation repair mechanisms (Brown et al., 1979; Wilson et al., 1985). These factors often lead to abundant intraspecific polymorphism levels which then allow high resolution analysis of even shallow (recent) population structure. From the construction and analysis of phylogeneic trees based on this data, information on historical evolutionary processes can be easily ascertained. Because of all of these positive traits recent work on New Zealand - 10 - marine invertebrate phylogeography have generally moved towards using mtDNA markers (Apte & Garnder, 2002; Apte et. al., 2003; Waters & Roy, 2004; Ayres & Waters, 2005; Goldstein et al., 2006).

A disadvantage to mitochondrial markers is that, because of the predominantly maternal inheritance, only the migration of females is assessed, and sex biased dispersal will not be visible if mtDNA is used alone. This can potentially imply potentially a misleading view of population structure if mtDNA is used alone, but has the benefit of providing details on social behaviour if combined with nuclear markers. This pattern of sex biased dispersal has generally been noted in mobile vertebrate species such as whales (e.g. Escorza-Trevino & Dizon, 2000). This complication is however unlikely to effect sessile marine invertebrates as they have minimal adult movement.

1.5 Phylogeography in New Zealand

The study of population genetics of New Zealand’s marine organisms commenced in the early 1980’s focusing primarily on commercial fish stocks. Fisheries zones were used in these studies to investigate the connectivity between stocks (Smith, 1980; Smith et al., 1986; Smith et al., 1987; Ovenden, 1992; Smolenski, 1993; Smith & McVeagh, 1996, Smith & Benson, 1997; Hauser & Adcock, 2002; Smith & McMillan, 2002; Smith et al., 2003; Bernal- Reynolds et al., 2003).

Over the last 25 years considerable progress has been made in the use of genetic tools to investigate population structuring. Using these new technologies, phylogeographic studies looking at phylogeographic processes such as the influence of New Zealand’s hydrological environment have initiated. There have now been twenty one studies over sixteen taxa of coastal marine invertebrates around New Zealand. Some of these studies have focused on structure within the fiords (Miller, 1997; Miller et al., 2004; Mladenov et al., 1997; Perrin, 2002). Others have been more wide-ranging across the entire - 11 - coastline. A detailed review of coastal marine invertebrate studies is given in Chapter 4.

A common feature of several wide-ranging studies has been a north/south split in the population structure inferring the presence of a dispersive barrier south of Cook Strait (Apte & Gardner 2002; Star et al., 2003; Ayres & Waters, 2004; Goldstein et al., 2006). The precise placement of this barrier on each coast is still speculative, and likewise the cause uncertain. One proposed causative agent of this genetic structuring is the influence of nearshore current systems and upwelling events, whilst others argue for vicariance and allopatric fragmentation.

1.6 New Zealand’s Oceanic Conditions

New Zealand’s elongate north-south orientation over 13º of latitude straddling the Subtropical Front – the meeting of subtropical water with cold subantarctic water - contributes to a diverse range of marine environments and current systems. These present current systems have been well described (Heath, 1985; Uddstrom & Oien, 1999) and regional ocean circulation models have begun to be developed (Chiswell & Rickards, 2006). A summary of the major surface currents discussed is shown in figure 1.1.

The main factor driving surface currents affecting New Zealand is the East Australian Current (EAC), although the Trade Wind Drift also affects the north east coast (Lange et al., 2003). Fluctuations in the EAC have been shown to affect the New Zealand current systems, particularly in the North Island (Lange et al., 1998; Roemmich & Sutton, 1998).

A broad zonal flow – the Tasman Front (TF) flows across the southern Tasman Sea and is split in two by the Challenger plateau with the majority passing north of this to meet the north of the North Island. From this the primary current systems of the North Island originate – the East Auckland Current (EAUC) and the East Cape Current (ECC).

- 12 -

Figure 1-1 Sea Surface currents and continental shelf area around New Zealand. Abbreviations: Tasman Front (TF), East Auckland Current (EAUC) North Cape Eddie (NC), East Cape Eddie (ECE), Wairarapa Eddie (WE), West Auckland Current (WAUC), East Cape Current (ECC), D’Urville Current (DC), Westland Current (WC) Southland Current (SC) Subtropical Front (STF), SubAntarctic Front (SAF) Antarctic Circumpolar Current (ACC). Modified from a map drawn by the National Institute of Water and Atmosphereic Research (1998).

- 13 -

The East Auckland Current (EAUC) flows south east along the continental slope from North Cape to East Cape. It is quite warm and saline and contributes a more tropical assortment of marine organisms along the north east coast (Harris, 1985). It interacts with at least two persistent eddies – the North Cape Eddy (NCE) and the East Cape Eddy (ECE). These eddies mix in water supplied directly from the equator by the Trade Wind Drift (Stanton et al., 1997) The EAUC mean transport is ~9 Sv (1 Sverdrup (Sv) = 106 m3 s–1), with a further 10 Sv recirculating within the NC and ECE (Roemmich and Sutton, 1998). The surface currents within the EAUC have been measured up to 45cm- s (Stanton & Sutton, 2003).

The EAUC splits at East Cape into two approximately equal branches, one moving offshore linked with the ECE and the other branch continuing southwards as the ECC. Both of these branches vary in strength depending on the West Wind Drift (Heath, 1985). The ECC flows south to a point of deflection eastwards north of the Chatham Rise. The position of this eastward movement is dependant on the relative strength of the Southland Current with interactions between these two current systems forming complex eddies (Lange et al., 2003).

North of the Chatham Rise off the Wairarapa Coast is a permanent anti- cyclonic eddy – the Wairarapa Eddy (WE) with a diameter of 180km (Chiswell & Stanton 1998; Chiswell, 2000; Chiswell, 2003). Satellite data show periodic shedding of the Wairarapa Eddie from near East Cape at the rate of about two to three per year. The generally observed location of the WE is thus believed to be the region where eddies tend to stall or merge rather than a permanent stationary eddy (Chiswell, 2005). The Wairarapa Eddie has important biological consequences in that it allows the retention of the larvae of the New Zealand rock lobster (Jasus edwardsii). This species has a larval life of one to two years and the species must metamorphose within 200km of the coast (Jeffs et al., 2001). Without an entrainment mechanism, larvae would be advected well outside this limit. Booth (1994), Chiswell & Roemmich (1998), and Chiswell & Booth (1999) have shown through computational modelling and measurements - 14 - of larval concentration that if it were it not for the presence of the eddy, this species would probably not exist on the east coast of New Zealand.

The other current that originates in the North Island is the West Auckland Current (WAUC). This is a weak branch of the EAUC that separates from it north of Cape Reinga and moves south along the western coast towards the Taranaki Bight. The strength of the WAUC is strongly wind dependant with south-westerly winds causing the Westland Current to extend north into the Taranaki Bight and causing the WAUC to reverse while north-westerly winds strengthen the WAUC (Harris, 1990).

The main current system that operates around the South Island is the Southland Current (SC). This originates in the south-west flank of the Challenger Plateau and is primarily Subantarctic Water (SAW) mixed with around 10% Subtropical Water (STW) (Sutton, 2003). Due to this it is the coldest surface current around New Zealand. The transport rate is highly variable between 3.4 and 12.9Sv with a mean of 8.3Sv (Sutton, 2003). It moves around the south of the South Island and then north, close to shore on the eastern side of the South Island. Near Pegasus Bay some of the SC is forced through the deep Mernoo Saddle of the Chatham Rise (Laing et al., 2003). Most of the SC turns east along the STF south of the Chatham Rise, but some water continues north close to shore (Figure 1.2). This extension of the SC, bolstered by waters from Cook Strait may reach Cape Turnagain as a distinct current known as the Wairarapa Coastal Current (Chiswell, 2000; Chiswell & Shiel, 2001). This can be seen in Figure 1.1 as the weak northerly flow just west of the Wairarapa Eddie. On the eastern coast just south of Cape Campbell upwelling has been observed, related to north-easterly winds (Heath, 1973; Murdoch et al., 1987; Chiswell & Shiel, 2001).

- 15 -

Figure 1-2 Map showing the variable trajectories of the principle hydrogeographic features of central New Zealand on the east coast modified from Bradford et al. (1986) SC: Southland Current, SCP: Southland Current primary flow, SCS: Southland Current secondary flow, ECC: East Cape Current, WC: Westland Current, DC: D’Urville Current.

On the north-west coast of the South Island the Westland Current moves northwards following the coast. This is a highly variable current with variation primarily due to wind direction. North-westerly winds can cause the WC to reverse and flow southwards down the West Coast while south-westerly winds strengthen its flow to north of the Taranaki Bight (Harris, 1990). The offshore Ekman transport generated by south-westerly winds also creates a semi- permanent upwelling of deep water along the coast. Upwelling centers have been shown to vary from just north of Kahurangi Point to extend completely along Farewell Spit at times (Bradford et al., 1986). This deep cold water is incorporated into the WC, forming a northward flowing Kahurangi plume consisting of a series of 30km diameter eddies (Harris, 1990; Heath & Gilmour, 1987; Moore et al., 1990). Near Kahurangi on the West Coast, the WC separates from the coast and flows across a shallow region (Kahurangi shoals). This produces a complex system of vortices that disrupt the Kahurangi plume into a series of smaller eddies (<20km diameter) that get transported into Cook - 16 -

Strait as the D’ Urville Current (DC) (Lange et al., 2003). This current enters Cook Strait from the west and is also strongly influenced by wind conditions. This moves through Cook Strait, where it is strongest at French Pass, though a branch causes anticlockwise current in both Golden and Tasman Bays (Tuckey et al., 2006).

1.7 Study Species

1.7.1 Sypharochiton pelliserpentis

The snakeskin chiton (Sypharochiton pelliserpentis) is one of the most common and widespread of all shore molluscs in New Zealand (Knox, 1953). It has a country-wide distribution – including the Chatham Islands (Suter, 1913; Dell, 1951; Powell, 1979) and is common on most rocky shores (Iredale & Hull, 1932). Its distribution also extends to Australia, where it is found on the coasts of Tasmania, Victoria and New South Wales. S. pelliserpentis is often extremely numerous on New Zealand shores, reaching densities of 228m-2 and it has been shown to occupy a wide range of shore levels wherever there is a solid substrate available – from inner esturies to high energy surf beaches (Boyle 1970). Generally it is located on rock surfaces rather than under stones, and is often found above neap high water mark (Iredale & Hull, 1927; Boyle, 1970).

S. pelliserpentis is a broadcast spawner, spawning in February into March (Johns, 1960). The PLD of these larvae are not known, however studies of other chiton species have indicated that it is probably lecithotrophic and that they seldom spend more than 4 days in the plankton (Pearse, 1979).

1.7.2 Actinia tenebrosa

The waratah anemone Actinia tenebrosa is up to 5cm in diameter with a red- black column and bright red tentacles that gives it the appearance of the warratah flower. It is present throughout Southern Australia from Shark Bay Western Australia to Heron Island Queensland, including Tasmania, and throughout the three main islands of New Zealand. It occupies the mid – high tidal range, generally hanging in sheltered rock crevices. - 17 -

A. tenebrosa is capable of both asexual and sexual reproduction and these have been shown to have distinct roles in colonisation. Studies of Australian populations of A. tenebrosa, indicate that populations appear to be founded by widely dispersed sexual recruits, while asexually brooded juveniles represent the main source of recruits into established populations (Ayre, 1983b; 1984b; Ayre et al., 1991a; Sherman, 2006). The dispersive ability for the asexually brooded juveniles is extremely low, with the majority settling within 50cm of the parent, and it is unlikely that dispersion from asexual propagules is effective over distances greater than 500m without intermediate successive steps (Ayre, 1984). The dispersive potential of adults is even lower with passive transport of detached adults having never been observed (Ottaway 1978; 1979a, Ayre, 1983). Long distance dispersal through sexual recruits has been inferred from population genetic structure (Ayre, 1984) however recruitment of sexual propagules appears to be exceedingly infrequent (Sherman, 2006). Localized adaptation has been demonstrated for A. tenebrosa using reciprocal transplant experiments between habitats (Sherman, 2006) and over varying distances (Ayre, 1995). In these experiments native anemones were consistently fitter than imported anemones and these differences were greatest amongst distant rather than adjacent sources. Isolation by distance has been shown to be a significant mechanism of population differentiation of this species in Australia.

1.7.3 Isactinia olivacea

While this species was collected in a similar regime to A. tenebrosa for use in this study, variable loci were not elucidated therefore analysis of questions relating population connectivity could not be performed. Information on the loci investigated, results of this, and a brief discussion of these results can be found within chapter three.

The olive anemone Isactinia olivacea inhabits rock pools and water-filled crevices from low to quite high in the inter-tidal and are common throughout the - 18 - three main islands of New Zealand. Specimens range in colour from emerald green to olive green to tan brown.

The reproduction patterns of Isactinia olivacea are probably quite similar to the mixed asexual/sexual reproduction displayed by A. tenebrosa (see above). I. olivacea is viviparous brooding juveniles within the enteron. The size of these brooded juveniles averages 0.5cm though some as large as 0.9cm diameter have been observed. I. olivacea broods a significantly smaller average number of juveniles than A. tenebrosa (2-3 compared with 7-10) (Milligan, 1973).These juveniles appear to often settle close to the parent (and within the same rock- pool) and are unlikely to be dispersive. The main settlement period of juveniles is the same as that of A. tenebrosa (Late November to late April). There are circa-annular gonad development cycles (Milligan, 1973).

The fact that colour morphs form clusters within rock pools – and that separate rock pools at the same location often contain differing colour morphs (pers.. observation), leads to the probable conclusion that the juveniles that are brooded are probably clonally related to the brood parent. This has never been investigated through genetic means, nor has it been shown if males, females and juveniles all brood young. Without further analyses including molecular studies, observations on the mechanisms of reproduction in I. olivacea remain speculative.

1.8 Aims

This study is an investigation and assessment of the phylogeography of sessile coastal benthic marine invertebrates in classes not previously studied in New Zealand. Sampling was performed with as wide a spread as practicable to evaluate population continuity throughout New Zealand, and was designed to encompass specific areas of interest highlighted by previous studies. The initial aim was to investigate two quite different phyla for this task with two species in each which exhibit different larval durations. This would allow assessments of the effects of these hypothetical barriers on organisms with differing life history traits. This was found to be impracticable due to the location of the organisms - 19 - in the intertidal (O. neglectus) (see Chapter 2.) and the availability of variable markers (I. olivacea) (see Chapter 3.). The specific questions asked using the two remaining species the Waratah Anemone (A. tenebrosa) and the Snakeskin Chiton (S. pelliserpentis) were:

• What level of genetic differentiation/population connection is present between sites/populations?

There is growing evidence that marine populations have lower gene-flow between areas than theory would predict. Within a New Zealand setteing, no studies have been done to answer questions of gene-flow and population connectivity on any species within the entire Anthozoa phylum, or Polyplachophora class. Without estimates of gene-flow and population units, management decisions such as those on marine reserve design may not function to potential.

• Where are restrictions to dispersal present around New Zealand’s coasts, and they in common with other species? Do they support previously hypothesized boundaries?

Phylogeographic studies of New Zealand’s benthic marine invertebrates have shown regional populations separated by areas with restricted gene flow. Of particular note is the North/South population split in the vicinity of Greater Cook Strait, which has been indicated for a number of species. The generality of this restriction in gene flow, and the exact location of it geographically are still relatively unknown. A multispecies phylogeographic study with extensive sampling around hypothetical general barriers to dispersal, would enable this question to be assessed.

• What hydrological or historical factors are potential causes of population disjunction?

There are multiple factors that determine gene-flow patterns among marine populations and an understanding of these is still developing. New Zealand - 20 - has a diverse range of marine environments and current systems. Assessments of population connectivity of marine organisms through phylogenetic methods around New Zealand, with specific attention around hydrological factors that have been proposed as population structing mechanisms are required to investigate this. A comparative approach is needed using a diverce range of taxa in order to draw meaningful conclusions on this complex issue.

• How does reproductive strategy affect the levels of population connectivity for New Zealand’s marine invertebrate fauna?

Very few phylogeographic studies have been performed on New Zealand’s marine invertebrate taxa and most have been on organisms that have a planktotrophic pelagic larval stage. Studies of A. tenebrosa, with its complex bimodal reproduction, and S. pelliserpentis with its comparatively short larval duration would further our knowledge in this area. Comparisons of spawning time and larval duration between organisms phylogenetically studied in New Zealand may shed light on the processes that structure their populations.

1.9 Thesis Outline

Chapter II is an investigation into the phylogeographic structure of the snakeskin chiton (Sypharochiton pelliserpentis) in New Zealand. Comparisons of geneflow among local populations and regions are assessed and the hypothesis that a restriction or barrier marine dispersal is influencing the genetic structure of S. pelliserpentis in the vicinity of Greater Cook Strait is tested.

Chapter III is an investigation of the large-scale population genetic structure of the waratah anemone - Actinia tenebrosa around the coast of New Zealand. Comparisons of the genotypic diversity and geneflow among local populations and regions are assessed.

- 21 -

Chapter IV presents a general discussion in which intraspecific studies of marine invertebrate phylogeography in New Zealand are reviewed. Phylogeographic concordance across studies is investigated, specifically looking at the geographic and life history concordance of phylogeographic patterns.

- 22 -

2 The Phylogeographic Structure of the Snakeskin Chiton (Sypharochiton pelliserpentis) around New Zealand

2.1 Introduction

There is growing evidence that widespread marine organisms are often more genetically structured than expected given their high dispersal potential and apparent lack of barriers to dispersal within ocean systems (Palumbi, 1997; Benzie, 1999; Riginos & Nachman 2001). In recent years through population genetic studies; linked with studies of hydrology, larval behaviour and historical - 23 - events, have we really begun to understand the processes that constitute barriers to dispersal in the marine environment. Various ocean current systems have also been proposed as barriers to dispersal for marine populations. Sharp genetic breaks over otherwise continuous habitat have been attributed to both convergent currents (flowing together from two directions) and divergent currents (flowing apart from a central area) (Kittiwattanawong, 1997; Rocha-Olivares & Vetter, 1999), as well as tidal fronts (Goldson et al., 2001; DeWolf et al., 2000; Wares et al., 2001). One of the best studied examples of converging currents is that of Conception Point in the USA where a number of species have been shown to have a disjunct population structure across this feature (Miller and Emlet, 1997; Burton 1998; Connolly et al., 2001; Dawson, 2001; Hohenlohe, 2004). Here the converging currents cause upwelling and offshore flow, and it is this that is hypothesized as the probable mechanism limiting larval transport across the area. Within the New Zealand coastal environment, putative dispersal barriers have also been identified. A common feature of several wide-ranging studies has been a north/south split in the population structure inferring the presence of a dispersive barrier south of Cook Strait (Apte & Gardner 2002; Star et al., 2003; Ayres & Waters, 2004; Goldstein et al., 2006). This dispersal barrier was first suggested in a study of the greenlipped mussel Perna canaliculus, with the proposed causative agent being the combination of present day nearshore current systems, and wind induced upwelling events (Apte & Gardner, 2002). This putative dispersal barrier has since been investigated using the cushion star - Patriella regularis (Ayres & Waters, 2004), and three limpet species in the genus Cellana (Goldstien et al., 2006). Despite these subsequent studies, the precise placement of this barrier on each coast is still speculative, due to a lack of intensive sampling around the hypothetical disjunction points. The hydrological factors that cause this disjunction are likewise uncertain. It has been argued that the phylogeographic pattern displayed by these organisms is more likely the result of allopatric speciation due to habitat fragmentation than intermittent upwelling events (Goldstien et al., 2006). Comparative phylogeographic studies in a range of taxa with varying life history strategies - 24 - are needed to come to meaningful conclusions in this hydrologically complex area.

While there have been twenty one phylogeographic studies over sixteen taxa of marine invertebrate populations around New Zealand, very few have had wide ranging and comprehensive sampling regimes. This handful of species which have been studied around the coastline represent a minute fraction of the plethora of marine invertebrate classes, reproductive tactics and larval dispersal abilities present in the New Zealand waters.

2.1.1 Sypharochiton pelliserpentis

New Zealand has an extensive chiton fauna, both in absolute numbers and the variety of species. (Morton & Miller, 1968). One of these – the snakeskin chiton (Sypharochiton pelliserpentis) is one of the most common and widespread of all shore molluscs (Knox, 1953). It has a country-wide distribution – including the Chatham Islands (Suter, 1913; Dell, 1951; Powell, 1979) and is common on most rocky shores (Iredale & Hull, 1932). Its distribution also extends to Australia, where it is found on the coasts of Tasmania, Victoria and New South Wales. S. pelliserpentis is often extremely numerous on New Zealand shores, reaching densities of 228m-2 and it has been shown to occupy a wide range of shore levels wherever there is a solid substrate available – from inner esturies to high energy surf beaches (Boyle 1970). Generally it is located on rock surfaces rather than under stones, and is often found above neap high water mark (Iredale & Hull, 1927; Boyle, 1970).

2.1.2 Review of Sypharochiton

The taxonomy of the genus Sypharochiton is confusing with a number of names used in the literature inadvisable (Bullock, 1988) and the true configuration of the genus still unresolved and debated. Sypharochiton pelliserpentis has been variously split into up to four separate species or synonymised down to one. The names used in the literature include: S. pelliserpentis (Quoy & Gaimard), S. - 25 - sinclari (Gray, 1843) S. maugeanus (Iredale & May, 1916) and S. septentriones (Ashby, 1924).

The current taxonomic consensus is that S. maugeanus and S. septentriones are junior synonyms for S. pelliserpentis. Cotton & Godfrey (1940) and Cotton (1964) stated of S. maugeanus, “This is the Tasmanian representative of the New Zealand shell Sypharochiton pelliserpentis and depends upon geographical locality for status.” The black second valve which was considered a diagnostic character of S. maugeanus has been shown to have a clinal variation within S. pelliserpentis with 25-40% in the northern portion of its’ range compared to 80-90% in the South (Johns 1960). In a similar way, S. septentriones have been defined by its’ location New South Wales. The review of the morphology used to differentiate these three species by Johns (1960) concludes that S. pelliserpentis in all locations were highly variable in morphology, but that there are no firm differences between S. maugeanus, S. septentriones and S. pelliserpentis, and that living intermediates between all forms exist therefore they should all be synonomized down to S. pelliserpentis.

The taxonomic distinction is less clear-cut in the debate over S. pelliserpentis and S. sinclari. These two forms are largely morphologically distinct and separable by colour alone for 75% of individuals. The adult colour variation is the presence of white flecked zigzag bars longitudinally on a dark background and it has been noted that this is generally associated with weakly developed ribbing, absence of longitudinal plural riblets and a reduction in the number and size of plural grooves (Johns, 1960). Furthermore, these two varieties can be separated with 99% accuracy based on the radula ratio (Johns, 1960). The radula ratio is defined as the length of the radula, divided by the length of the body. Along with this, it is reported that these two groups occupy different stations – S. pelliserpentis is found generally on top of rocks above mid tide while S. sinclari is located under stones and in rock pools over the lower tidal and sub-tidal region (Powell, 1979). They also have different ranges – with the S. sinclari variety significantly absent from the Chatham Islands (Powell, 1979). Juvenile forms of both kinds are always found subtidally; and have been purported to differ in colour, sculpture (Johns, 1960) and radula ratio (Johns, - 26 -

1960; Horn, 1982). As these two forms mature, the S. pelliserpentis form migrates high into the intertidal while the S. sinclari form remains low-tidal and sub-tidal. Homing behaviour has only ever been observed in the S. pelliserpentis form (Johns, 1960; Luckens, 1974). These factors would make it seem that the two forms should be seen as two separate species; however examination of shell and girdle morphology has shown a spectrum of intermediate forms of any given character (Johns, 1960; Boyle, 1970; Bullock, 1988). The reproductive cycle and spawning times for the two forms show no difference, both in the lab and field (Johns, 1960) and cross fertilization experiments have achieved apparently normal eggs capable of development to at least second division which progressed at a similar rate to controls (Johns, 1960). The observations of homing behaviour can be explained in that sub-tidal individuals of either type have never been seen to exhibit this behaviour so for S. sinclari it would not be expected in its low-tidal location. Similarly the differences in radula ratio can be explained by environmental effects rather than genetic. A similar radula ratio variation has been shown in the limpet Patella vulgate to be related to position within the inter-tidal (Brian & Owen, 1952). Given all of this knowledge, Johns (1960), Boyle (1970) and Bullock (1988) concluded synonymy of these two kinds based on the spectrum of variation between them and on the reproductive evidence.

2.1.3 Reproduction

The reproductive biology of S. pelliserpentis has been investigated over several seasons both in the field and within a laboratory environment by Johns (1960). Spawning was found to take place for a variable length of time during February, March and April, the sexual products being freely ejected into the surrounding water. Spawning was also observed in the laboratory at the same time. This occurs over a short time beginning somewhere between February 8th to 13th and the cycle is repeated three to four times – each with fifteen days between spawning. All spawning events were mirrored in laboratory animals. In all cases spawning took place in the early evening for a period of 1 – 3 hours. - 27 -

This corresponded to the period of high tide at the study locations. Males begin spawning just before females, and so may trigger it. Spawning always occurs in the evening when the high tide is in the evening. Spawning was found to take place throughout the whole population rather than in zones. The S. sinclairi variety was found to show no marked difference in reproductive cycle and spawning time to S. pelliserpentis.

While no information on the duration of the larval life of S. pelliserpentis is available, studies of other chiton species have indicated that spawned eggs are viable for less than 2 days and that developing larvae are lecithotrophic (non- feeding), seldom spending more than 4 days in the plankton (Pearse, 1979). Generally, the egg capsules of non-brooding chiton such as S. pelliserpentis are equipped with cupules which decrease sinking rates – they are made more buoyant by these cupules acting in a similar way to parachutes (Buckland- Nicks, 1993).

2.1.4 Population Studies

The only study to look at population connectivity of S. pelliserpentis was that of Freeth & Sin (1986). In this study, six allozyme loci were used to assess similarity between populations of S. pelliserpentis in three different habitats – estuarine, sheltered coastal and exposed high energy coastal population. The sheltered and exposed marine sites were located on the Kaikoura peninsula, and the estuarine site was in the Avon-Heathcote Estuary roughly 175km to the south.

All alleles observed were found in all three populations however significant differences in allele frequencies were detected between the sheltered and exposed populations at the Est-2 locus and between females of the marine and estuarine populations at the Mdh-1 locus. Marine population sub-samples from high-shore and low-shore levels showed no significant differences in allele frequencies.

- 28 -

These results confirmed that there is no difference between high-shore and low shore populations as would be expected, though are inconclusive regarding population connectivity. A significant difference in allele frequency between marine and estuarine sites was only observed at one locus Mdh-1, and only for females. Another locus hinted at being effected by selection pressure showing a difference in allele frequency between sheltered and exposed sites (though not between either of these and the estuarine). There was an associated heterozygote deficiency at the exposed site. Overall the results of Freeth and Sin (1986) tentatively hint at some level of division of populations.

2.1.5 Summary

The few population genetic studies on New Zealand’s coastal marine invertebrates have highlighted some interesting hypothetical barriers to dispersal, however the generality of these needs testing. Whilst there is strong evidence that a dispersive barrier exists south of Cook Strait, its exact location particularly on the West Coast remains speculative, and hence so does its cause. The aim of this chapter is to investigate the population connectivity of the chiton S. pelliserpentis around New Zealand. More specificially I hope to test if a dispersive barrier exists in the vicinity of Greater Cook Strait, and through comprehensive sampling in this area, define its precise location. Beyond this hypothesis, I hope to determine if there are other points on the coast with restricted gene flow for S. pelliserpentis, and investigate the factors that alter population connectivity for this organism. - 29 -

2.2 Methods

Figure 2-1 Map showing the collection sites for S. pelliserpentis around New Zealand, and the respective number of individuals sampled at each location

2.2.1 Collection of Specimens A sample size of 3 - 22 S. pelliserpentis individuals were collected from each location (Figure 2.1). Of these samples listed, 20 individuals were obtained from Ellice Point, Chatham Island which have not yet to be analyzed. Sample collection occurred over a year from November 2005 to August 2006. Collections were made walking parallel to the shore, generally with increasing distance between each sample. Thus the distance between the first and second individuals sampled at a location was often low ≈ 50cm, however subsequent distances increased to tens or even hundreds of meters, and if available multiple headlands were sampled from. Sampling was generally performed in the mid-high inter-tidal. Chitons were either levered from the substratum using a butter-knife, or a sliver of mantle was cut from them, and these samples were then preserved in 95% ethanol. Each sample was labeled and estimates of the distances between each individual were recorded. - 30 -

2.2.2 DNA Extraction and Amplification

A small amount of tissue (≈5mm2) was taken from each sample from the mantle using flame-sterilized forceps and scissors. The DNA was initially extracted following the phenol chloroform isoamyl alcohol (PCI) protocol (modified from Protocol 2. in Hoelzel & Green, 1992). Once PCR amplification protocols and the variability of potential markers were established, Chelex DNA extraction methods (modified from Walsh et al., 1991) were used. This method was most successful when the hard mantle tissue was macerated for several minutes until it became a paste. The resulting DNA was stored in the freezer (at approximately -20°C) to await amplification via the polymerase chain reaction (PCR). (Birt & Baker, 2000; McPherson & Møller, 2000)

A partial sequence of the mitochondrial Cytochrome Oxidase subunit 1 (COI) was amplified via PCR using the primer set LCO1490 and HCO2198 developed by Folmer et al. (1994). Amplification via the Polymerase Chain Reaction (PCR) was carried out in a total volume of 23µl containing reaction buffer (10µM of each primer, 20µM dNTPs, 2.5mM of Mg2+, 10x PCR buffer (PCRII - ABI) and 0.5µl Taq Polymerase (Platinum Taq – Invitrogen), and ~20ng DNA template. PCR amplification were carried out with cycling conditions of 94°C for 3 minutes, 35 cycles of 94°C for 30 s, 50°C for 1 min and 72°C for 1 min.

2.2.3 Purification and Sequencing

Prior to sequencing, the PCR products were purified from nucleotides and primers in the PCR reaction mixture. This was achieved via digestion with SAP (shrimp alkaline phosphatase) and Exo-I (exonuclease-I). The protocol involves addition of a SapEx solution, centrifugation and incubation at 37°C for 30 min, 80°C for 15 min and 20°C for 15 min (Werle et al., 1994)

The COI PCR products from 217 individuals were then sequenced. Each cycle sequencing reaction was carried out in a 10µl reaction containing 2µl of Big Dye, 1µl of primer (5pmol/µl), 4ng/100bp of PCR product, 2µl 5x CSB Buffer - 31 - and dH2O to 10µl. The final clean up for the products was performed using CleanSEQ® (Agentcourt) according to the basic protocol (Protocol 000600v031), supplied by the manufacturer. Capillary separation and analysis was then performed using an automated ABI prism 3130XL capillary sequencer following the basic ABI cycle sequencing protocol.

2.2.4 Restriction Fragment Length Polymorphism

An alignment of COI sequences from around the country was examined manually for variable restriction sites in Sequencher version 4.7. Five restriction enzymes were located with useful variable restriction sites that defined major intraspecific clades (Figures 2.2)

Figure 2-2 Restriction Fragment Length Polymorphisms (RFLPs) of S. pelliserpentis COI PCR products with fragment size (in base pairs) shown.

- 32 -

Figure 2-3 Definitions of the six S. pelliserpentis COI haplogroups as defined by RFLPs. Restriction enzyme cut sites are shown (R=RsaI, H=HphI, N=NlaIII, M=MboI, A=AclI).

Restriction digests using these five enzymes were performed on the COI amplified fragments for a further 232 individuals, and the original 217 for which sequence data was available were classified in sequencher to determine their restriction pattern. The restriction digest for each enzyme was performed separately on each sample allowing easy visual scoring – an example of this is shown in figure 2.4. This was done using 4µl of PCR product and performed to the manufacturers recommendations. These digestions were then run on a 1.6% agarose gel with a 123bp ladder, stained using ethidium bromide, and the resultant RFLP pattern photographed. These were then scored manually. The combination of restriction enzymes yielded 6 haplogroups into which each sample was classified (Figure 2.3). - 33 -

Figure 2-4 S. pelliserpentis COI RFLP banding pattern shown for three of the five restriction enzymes flanked by a 123bp sizing ladder. The sizes of these fragments are shown in figure 2.1.

2.2.5 Data Analysis

The average genetic diversity was estimated using Nei's (1987) gene diversity (h) and nucleotide diversity (π) measures in Arlequin v. 3.1 (Schneider et al., 2005). These two measures of genetic diversity are simple measures of heterozygosity deemed appropriate for single locus sequences of low diversity (Nei and Kumar, 2000).

2.2.6 Phylogeographic Structure

Genetic differentiation between populations was calculated using Nei's (1987) uncorrected measure of nucleotide differentiation (DXY). This was done using both the COI sequence and COI RFLP datasets. This measure of differentiation represents the average number of nucleotide substitutions per site between haplotypes from two populations (Nei and Kumar, 2000). These calculations were performed in Arlequin v. 3.1 (Schneider et al., 2005) and - 34 - visualized using a Multi-Dimensional Scaling (MDS) in the program Genalex v.6.

Spatial Analyses of Molecular Variance (SAMOVA) were performed to assess the location, magnitude and number of population subdivisions for S. pelliserpentis in New Zealand. This technique uses a simulated annealing procedure that maximizes the proportion of total genetic variance explained by differences between groups (Dupanloup et al., 2002). It does not use predefined sample groupings, but combined geographically adjacent samples to achieve this. This was done both using the COI sequence and COI RFLP datasets. Population partitioning was performed hierarchically using two to eight groups. When the major groupings had been defined, further SAMOVA were performed within each grouping separately.

The hierarchical distribution of genetic variation among populations was tested using an Analysis of Molecular Variance (AMOVA) (Excoffier et al., 1992) in Arlequin v. 3.1 (Schneider et al., 2005). Groupings defined in these AMOVAs were defined apriori to test specific hypotheses. This technique quantifies levels of population and regional subdivision using a hierarchical analysis of standardised genetic variance (F) (Wright 1978). From this, the total genetic variation can be explained by showing the contribution of different data partitions: among groups (ФST); among populations within groups (ФSC) and within populations (ФCT). Pairwise ФST values were also calculated in Arlequin v. 3.1 between all populations to enable finer scale inter population relationships to be ascertained.

To further investigate the relationship between S. pelliserpentis populations around New Zealand UPMGA analysis of Nei’s (1978) genetic distance based on the RFLP dataset were performed. This was done using the program TFPGA (Miller 1997b). - 35 -

2.3 Results

2.3.1 Sequence Analysis

A partial fragment of the mitochondrial Cytochrome Oxidase I (COI) gene was sequenced for a total of 217 S. pelliserpentis individuals from 28 populations (Table 2.1). This fragment was 706bp long when amplified though not all samples could be sequenced for the entirety of this length. From these sequences 71 haplotypes were identified and aligned, and a parsimony tree was constructed. The substitutions that define the major clades of this tree were identified and investigated for variability in restriction sites. From this five variable restriction sites yielding six haplogroups. A total of 449 S. pelliserpentis were delineated into these 6 haplogroups, including the 217 individuals for which sequence data were available (Table 2.1). The frequence of these haplogroups in each population is shown in figure 2.5.

Table 2-1 Population location and sample size for S. pelliserpentis showing the two data types used in this study.

- 36 -

Figure 2-5 Haplogroup frequencies for each population as defined by RFLPs (definitions in Figure 2.3) - 37 -

2.3.2 Population Subdivision

2.3.2.1 Multidimensional Scaling

Multi-Dimensional Scaling (MDS) of DXY showed a clear division between northern and southern populations. This division was not between North and South Islands. The populations from Kaiteriteri and Ocean Beach located in the northern South Island clustered with the North Island populations. They were particularly linked with populations from the North Island’s east coast. The remaining South Island populations were tightly clustered showing high similarity in both sequence and RFLP makeup. Using the RFLP data, the North Island populations show a moderate disjunction between the east and west coasts. Smaller sample sizes in the North Island sequence dataset and for Stewart Island (# 28) probably increase variance in their grouping. - 38 -

Figure 2-6 MDS of DXY for S. pelliserpentis populations based on A) COI sequence data, and B) COI RFLP data. Red = South Island, Orange = Northern South Island (Kaiteriteri & Ocean Beach), Light Blue = North Island east coast, Dark Blue = North Island west coast. Population numbering is from table 2.1.

Spatial Analyses of Molecular Variance (SAMOVA) were performed to assess the location, magnitude and number of population subdivisions for S. pelliserpentis in New Zealand. This was done both using the COI sequence and the COI RFLP datasets. Population partitioning was performed using two to eight groups (Tables 2.7 & 2.8). The initial division into two groups explained 44.5% of variance for the sequence data and 71.4% for the RFLP data. The two population groupings defined in the SAMOVA of the RFLP data and the sequence data were identical. Less than 2.5% (sequence data) and 1.5% (RFLP data) of variation was among populations within these two groups and - 39 - this was not substantially lowered by further subdivision (Figures 2.3 & 2.4). These results indicate a two group population structure is most appropriate within the New Zealand populations of S. pelliserpentis. The division defined using SAMOVA between the two groups bisects the country into northern and southern populations (Figure 2.7). This division does not divide the North Island from South Island. Instead, two populations sampled in the north of the South Island (Kaiteriteri and Ocean Beach) are linked with the North Island populations.

Figure 2-7 The two groups as defined using SAMOVA as having the lowest possible FCT value using both COI sequence data, and COI RFLP data for S. pelliserpentis.

Table 2-2 Population groupings as defined in SAMOVA of S. pelliserpentis based on A) COI sequence data and B) COI RFLP data. Northern and southern groups are shown in figure 2.7.

- 40 -

Figure 2-8 The distribution of variance within S. pelliserpentis populations around New Zealand compared between the number groups of New Zealand populations defined in SAMOVA using A) COI sequence data and B) COI RFLP data.

Further SAMOVA were performed within each grouping separately (northern and southern). In the northern population, several west-coast populations (Shipwreck Bay, Piha, Opunake, Kapiti Coast) were isolated as group number increased, followed by the northern south island populations (Ocean Beach, Kaiteriteri). These results suggest that additional geographic subdivision of the northern population does not provide much greater power in explaining the - 41 - overall genetic variance. However, it does appear that some of the west coast and northern South Island locations are each somewhat distinct from the other northern sampling locations (Table 2.3).

Table 2-3 Population groupings within the northern grouping as defined in SAMOVA of S. pelliserpentis COI RFLP data.

No significant structuring was observed when the southern population was analysed independently through SAMOVA. All ΦST values were below 0.01 both using sequence and RFLP data and non-significant.

Analysis of Molecular Variation (AMOVA) was conducted on both RFLP and sequence data for the S. pelliserpentis populations, in order to compare the SAMOVA results (above) with an a priori partition into North and South Island sites. A significant proportion of total genetic variation was attributable to between group variation for both sequence data (37.33%) and RFLP (58.12%) data (Table 2.4), but these values are substantially less than those from the SAMOVA partition (Table 2.5).

- 42 -

Table 2-4 Φ Statistics from AMOVA of S.pelliserpentis where North and South Island populations were partitioned into two groups. Note: AMOVA were run using pairwise differences. Φ statistics were estimated and tested with 1023 random permutations. ** p < 0.01 in Arlequin (Schneider et al., 2005).

Table 2-5 Φ Statistics from AMOVA of S.pelliserpentis where Kaiteriteri and Ocean Beach were included with North Island populations while the remainder of the South Island populations were partitioned into a separate group. Note: AMOVA were run using pairwise differences. Φ statistics were estimated and tested with 1023 random permutations. ** p < 0.01 in Arlequin (Schneider et al., 2005).

Haplotype diversity (h), and nucleotide diversity (π) were calculated for each population (northern and southern) separately (Table 2.6). These were highly significantly lower in the southern population (p< 0.001) when these differences were tested using a t-test.

Table 2-6 Genetic diversity compared between the northern and southern populations of S. pelliserpentis

Pairwise ΦST values between each individual population were also calculated to assess finescale structure. These showed significant dissimilarity between almost all northern populations with all southern populations (Tables 2.7 & 2.8). Very little significant variation was noted between populations within either of these two groupings. Both the Kapiti Coast and Shipwreck Bay populations exhibited some significant differentiation based on RFLP data from other North Island populations – primarily east coast populations. Stewart Island had low levels of significance in its pairwise ΦST scores and was different statistically to some populations of the South Island, though this may be an artefact of the small sample size. - 43 -

Table 2-7 Levels of significance for pairwise ΦST comparisons between S. pelliserpentis populations using COI sequence data. – p > 0.05, + p < 0.05, ++ p < 0.01. The midline separates the northern and southern groupings used in table 2.2 for group Φ statistics.

Table 2-8 Levels of significance for pairwise ΦST comparisons between S. pelliserpentis populations using COI RFLP data. – p > 0.05, + p < 0.05, ++ p < 0.01. The midline separates the northern and southern groupings used in table 2.2 for group Φ statistics.

To further investigate the relationship between S. pelliserpentis populations around New Zealand UPMGA analysis of Nei’s (1978) genetic distance based on RFLP were performed. This indicated again the distinct division between the northern and southern groups (Figure 2.7) as previously suggested using SAMOVA and MDS techniques. Alternative clusterings of some populations - 44 - are possible, but some consistent groupings were of the populations in the Bay of Plenty – Gisbourne (Whakatane, Mount Maunganui, Waihau Bay and Tatapouri). A second grouping always observed was that of the east coast of the far north (Spirits Bay, Henderson Bay and Cape Brett). The two South Island populations with affinities to the North Island also are seen to cluster together. With the low resolution of the RFLP markers in the southern grouping, relationships here are less obvious. Stewart Island remains distinct, however this is may be due to the low sample size. Differences between

Stewart Island and the South Island were mostly non-significant in pairwise FST probabilities (tables 2.7 & 2.8).

Figure 2-9 Dendogram showing the genetic relationships between populations of S. pelliserpentis in New Zealand based on RFLP data from the COI gene.

The pairwise ΦST values between adjacent populations around each main island were plotted graphically to indicate levels of connection around the coastline (Figures 2.10 & 2.11). The most significant features shown by these adjacent pairwise ΦST values are the low connections between Ward Beach and Ocean Beach, and between Wharariki Beach and Kaiteriteri. These two northern South Island populations are the two previously shown to exhibit North Island affinities. A third significant disjunction is indicated between Shipwreck - 45 -

Bay and Spirits Bay populations of S. pelliserpentis. High connectivity appears on the north eastern coast of the North Island – particularly in the two regions previously highlighted using UPGMA analysis. Diminished connectivity appears between most populations on the west coast and south eastern coast of the North Island including a significant disjunction between coasts. In the South Island, diminished connectivity is exhibited between Timaru & Christchurch, Christchurch and Kaikoura, and Jackson Bay and Cape Foulwind.

The pairwise ΦST values between adjacent populations around the North and South Islands were also graphed to allow comparison between connectivity and the coastal current systems (Figures 2.12 & 2.13). This was done using RFLP data for the North Island and sequence data for the South Island. RFLP data will most likely have the greater resolution in the North Island as the number of samples is significantly higher, whilst in the South Island sequence data will probably have the higher resolution as the proportion sequenced is higher, and the RFLP markers had low resolution amongst SI haplotypes. The transition between current zones is coincident with an increase in ΦST at the WAUC/EAUC, SC1/WC, WC/DC and DC/SC2 transitions. This correlation was notably not however observed at the EAUC/ECC current boundary. High connectivity is a feature of the North Island populations within the two major coastal currents – the EAUC and ECC. - 46 -

Figure 2-10 Pairwise FST values between adjacent populations of S. pelliserpentis based on COI RFLP data. * p < 0.05

Figure 2-11 Pairwise FST values between adjacent populations of S. pelliserpentis based on COI sequence data. * p < 0.05 - 47 -

Figure 2-12 Pairwise ΦST values between adjacent populations of S. pelliserpentis around the North Island based on COI RFLP data. The dominant coastal current of the region is displayed below (EAUC: East Auckland Current, ECC: East Cape Current, WRC: Wairarapa Current, CS: Cook Strait Narrows, DC: D’Urville Current, WAUC: West Auckland Current)

Figure 2-13 Pairwise ΦST values between adjacent populations of S. pelliserpentis around the North Island based on COI RFLP data. The dominant coastal current of the region is displayed below (SC1: Southland Current 1, SC2: Southland Current 2, WC: Westland Current, DC: D’Urville Current. - 48 -

2.4 Discussion

The primary feature of genetic structuring in S. pelliserpentis around New Zealand is the strong disjunction between northern and southern populations. This disjunction between northern and southern populations is very significant and does not occur between the two islands. Instead populations in the north of the South Island (Kaiteriteri & Ocean Beach) are linked to the northern population. A similar north/south divergence with populations in the north of the South Island linked to the North Island has recently been established for several marine invertebrate taxa – greenlipped mussels - P. canaliculus (Apte & Gardner, 2002; Apte et al., 2003) cushion stars - P. regularis (Ayres & Waters, 2004) and three limpet species – C. ornata, C. radians and C. flava (Goldstein et al., 2006). A weakness of previous studies across this boundary has been that sampling has not been intensive around hypothetical disjunction points, leading to a wide area of uncertainty, and therefore the potent cause being less certain. Sampling in this study was designed to be as close as possible to hypothetical disjunction points enabling more precise definitions of boundaries if indeed they existed. The northernmost S. pelliserpentis populations of the southern grouping were at Wharariki beach on the west coast near Cape Farewell, and Ward Beach just south of Cape Campbell on the east coast. This leaves the disjunction between populations to occur within the space of Farewell Spit/Golden Bay on the west coast, and Cloudy and Clifford Bays on the east coast.

Populations were not sampled within Golden Bay which could further narrow down the position of the split, however water circulation patterns in Tasman and Golden Bays are well characterized (Tuckey et al., 2006) and it is unlikely that Golden Bay populations are distinct from Kaiteriteri at the north of Tasman Bay. On the east coast, the gap between northern and southern groupings was less than 40km, and only populations at Cape Campbell itself would enable a better definition of the location of population. Attempts were made to sample here, but no S. pelliserpentis were found, though search time was limited by the tides and potentially they are present here. - 49 -

The location of the boundaries shown in S. pelliserpentis are exactly the locations of upwelling and associated offshore currents believed to be the cause of population disjunction suggested by Apte & Gardner (2002), and reinvoked by Ayres and Waters (2004). The population disjunction observed in the present study is more significant than in these two studies, and of a similar level to that observed for Cellana ornata (Goldstein et al., 2006), which also had strong population subdivision around these locations. The sampling regime employed in this study was specifically designed so that if this previously hypothesized general barrier to dispersal existed for S. pelliserpentis, its location would be defined with the greatest accuracy. This was achieved successfully with a very narrow area highlighted. The generality and potential cause of this north/south barrier is reviewed in chapter 4 along with a review of all coastal marine invertebrate phylogeographic studies of New Zealand. Unlike the previous organisms studied in this area, a unique haplogroup was seen in the Greater Cook Strait area for the S. pelliserpentis populations in the northern South Island. This indicates that perhaps this area has an uneven direction of recruitment – it is a recruitment sink. Thus while it may receive some level of recruitment from the North Island, it does not contribute recruits back. In this case it would seem that the northern south island was a more closed system.

Johns (1960) noted a latitudinal cline in the frequency of a completely black second valve S. pelliserpentis. The locations from which samples were obtained in his study were: Sydney, Hobart, Wanganui, Kaikoura, Diamond Harbour, Portobello and Stewart Island. Within New Zealand the frequency ranged from Wanganui 30%, Kaikoura 58%, Diamond Harbour 78%, Portobello 72%, and Stewart Island 90%. Only one of these populations (Wanganui) is from the northern population of S. pelliserpentis which has been demonstrated to exist in the present study. A future avenue of investigation would be to see if this morphological trait does show a latitudinal cline in frequency or alternatively, if it presents a clear distinction between northern and southern populations. The chiton samples obtained in the present study from a number of sites were of whole chiton, and thus could be used to begin to look at this possibility. This morphological character has not yet been demonstrated to be - 50 - heritable; however it is likely that if it was, it would be autosomal in nature. This would give it a differing heritability pattern than the mitochondrial COI locus assessed in this study.

Along with the significant barriers on each coast at the top of the South Island, a third significant barrier to dispersal was highlighted between Spirits Bay and Shipwreck Bay on the west coast of the far north island. Pairwise ΦST’s at this location are as significant as those at the top of the South Island. Samples from Spirits Bay were more precisely from Taputupoto Bay less than 2km east of Cape Reinga. This population is closely linked with those from Henderson Bay and Cape Brett on the east coast, but not linked with populations on the west coast. Shipwreck Bay is significantly different from most sites on the east coast of the north island, including Spirits Bay, only 100km to the north. There is also an overall west-east split for populations around the North Island indicated by MDS (figure 2.6b).

Cape Reinga is famous for being the “meeting of the oceans” (the Tasman & Pacific) and the hydrology of the area is complex. There are several possible causes for the observed disjunction at this location. There is some evidence of a surface flow southwards along the coast of the northern western North Island with this current termed the West Auckland Current (WAUC) (Brodie, 1960; Garner, 1961). There is however conflicting data (Heath, 1974; Stanton, 1973; Hedgway, 1980) showing that at least sometimes there is a northwards flow in the area. Stanton’s (1973) study and review of the currents in the area concluded that a northerly flow is predominant in this area during the summer period. Monthly current charts of the Tasman Sea from ship drift information show that during January and February, the Tasman Current divides in the coastal waters between Reef Point (just east of Shipwreck Bay), and Hokianga Harbour to form a northward and a southward coastal current. In March and April, northerly currents along the whole coast north of Cape Egmont predominate (Wyrtki, 1960). As it is February to March that S. pelliserpentis spawns (Johns, 1960) it can be assumed that the flow at Shipwreck Bay is northerly during spawning. This north-west flow on the west coast provides one explanation for population disjunction at Cape Reinga. Brodie's (1960) summer - 51 - drift card returns show no evidence of the West Auckland Current in this season and the nil recovery of cards from the Cape Reinga area suggest that cards were swept north or east away from New Zealand (Stanton, 1973). If larvae from west coast populations are also swept away to the north-east then they too will not make their way to Spirits Bay, and given the northwards flow on the west coast, and eastward flow from Cape Reinga, Spirits Bay larvae are unlikely to make it south-west to Shipwreck Bay.

Figure 2-14 Sea surface isotherms (ºc) January 1972 showing the intense upwelling at Cape Reinga adapted from (Paul & Roberts, 1978).

A strong near-shore cold upwelling is also regularly observed between the Three Kings and Cape Reinga (Garner, 1959; Garner, 1961; Stanton, 1969; Garner, 1970; Stanton & Hill, 1972; Stanton, 1973; Roberts & Paul, 1978; Ridgway, 1980). An example of this is shown in figure 2.14. Garner (1961) noted that the upwelling region off Cape Reinga may become particularly pronounced during the summer months due to a divergence of flow in a surface subtropical current at the northern end of the Northland Peninsula. Studies in March (the spawning period of S. pelliserpentis) over consecutive years by Stanton (1973) showed the upwelling to be persistent and centred just to the east of Cape Reinga. It has further been observed that these regular upwellings may persist for 6-8 weeks (Roberts & Paul, 1978). Garner (1959 - 52 - cited Stanton (1973)) reviewed biological and hydrological observations in the Three Kings upwelling zone, noting that the fauna shows distinct cooler and deeper water components in this region, consistent with the upwelling. Stanton (1973) suggests the upwelling area is wind-induced by winds from the south east – (which he notes as occurring 34% of the time) and locally intensified by the shape of the shelf in this vicinity. He goes on to note the similarity between this upwelling and that occurring at Cape Farewell which has been implicated in population subdivision of greenlipped mussels (Apte & Gardner, 2002), sea stars (Ayres & Waters, 2004) and S. pelliserpentis in the present study.

It must be conceded that more information and experimentation is required in this area to show conclusively whether these upwellings do indeed contribute to population subdivision. That all three significant population disjunctions around New Zealand’s coastline of S. pelliserpentis occur at points of near-shore upwelling and current movement offshore does make a good case for them being causative to a degree in population structuring.

Beyond these three strong barriers to dispersal, connectivity is variable amongst populations both in the southern and northern populations. There are several factors that may increase or decrease connectivity between populations. These include the distance between them, intermediary habitat, the magnitude and direction of currents and the selection forces at each site.

The New Zealand coast arguably contains a greater range of beach and nearshore environments within close proximity than any other coastline in the world (Brander et al., 2003). Sypharochiton pelliserpentis is common at all environments from low energy estuarine to high energy coastal habitats, wherever solid substrate is available. Along the New Zealand coastline there are however long stretches of beach with no solid substrate and these may act as barriers to dispersal. The distribution of these long sand or gravel beaches are shown in figure 2.15. Correlation is observed between where these long beaches are located, and apparent decreases in connectivity (cf. figs 2.10 and 2.11). The west coast of the North Island is dominated by long sandy barrier beaches (Shepherd & Hesp, 2003). These long sandy beaches divide small - 53 - rocky ‘habitat islands’ suitable for S. pelliserpentis. Of the populations of S. pelliserpentis in the north, west coast populations at Kapiti Coast, Shipwreck Bay and Opunake were found to be the most isolated genetically. These all are separated from other populations by these long sandy barrier beaches. Connectivity is comparatively high on the east coast particularly in the north- eastern half. This area has far more regular rocky headlands which could aid in linking populations.

In the southern population, the highest ΦST values were obtained between populations separated by long shingle beaches – between Timaru, Christchurch and Kaikoura, and between Jackson Bay and Cape Foulwind. These long shingle beaches are thought to limit dispersal of rocky shore organisms across them, and as a result of this, are potentially the buffer zones between the Cookian and Fosterian biogeographic zones (Powell, 1961).

Figure 2-15 Map of New Zealand coastline highlighting long sand, shingle or sand/gravel mixed beaches. Place names are rocky areas within or adjacent to these beaches as discussed in the text. (Data from Shepherd & Hesp, 2003)

- 54 -

The coastal currents are also correlated with some observed population connectivity. Along with the long shingle beach on the west coast north of Jackson Bay, the Southland Current and Westland Current diverge in this area. The most significant break in connectivity around the coastline is that previously mentioned between Spirits Bay and Shipwreck Bay. As discussed, Spirits Bay is linked to the EAUC, while Shipwreck bay is in a separate current zone affected by both the southward flowing WAUC and a northward flowing current.

The north-eastern coast of the North Island not only has closely spaced rocky habitat, it is also adjacent to the highest stream function of any coastal current system in New Zealand - the EAC and the ECC (Richard et al., 2005). This area exhibits comparatively high inter-population connectivity and these results are congruent with the explanation of pelagic larval transport via coastal currents facilitating population connectivity. The EAC primarily moves around the north of Great Barrier I. and down the east coast of the Coromandel Peninsula. The shelter provided within the Hauraki Gulf and lower stream function therein would be a possible explanation for a slight decease in population mixing between the far north and Bay of Plenty.

Interestingly there does not appear to be any barrier to dispersal at East Cape. Biogeographic studies have indicated a strong break at this point for a range of taxa (Powell, 1961; Pawson, 1965; Moore, 1961; Nelson, 1994; Francis, 1996). The primary hypothesis as to the cause of this barrier has been the movement offshore of the EAUC and the effects of this movement on the plankton in this area. The movement of S. pelliserpentis larvae across this region homogenizing adjacent populations indicates this is not a general barrier and that possibly larval behaviour and buoyancy are important in this area.

The increased frequency in the ‘A’ haplogroup (the primary haplogroup present in the South Island) at Piha and Raglan is worth noting. While this haplogroup was detected at a low frequency in a number of sites in the North Island, it is at a higher frequency in this area of the west coast. There are two possible explanations for this. The first is that dispersal is low, and through genetic drift or founding effects this haplogroup has stochastically increased in this area. - 55 -

Assuming a low level of connectivity due to varying currents and long stretches of sandy beach, this seems feasible.

o Figure 2-16 Isohalines ( /oo) of difference between surface salinity and subsurface salinity maximum found in February-March 1974 modified from Ridgway (1980). This shows the northward extension of the WC.

A second possibility is that there is, or has been some level of recruitment originating from the South Island’s west coast. During southwesterly winds the Westland Current extends north into the Taranaki Bight (Harris, 1990). South- westerly winds are prevalent on the west coast therefore a branch of the WC will often extend north beyond 38ºN particularly in summer (Ridgway, 1980). This hypothesis requires further testing, potentially by sequencing more of the COI fragments obtained from Wharariki Beach, Raglan and Piha.

An intriguing area of future investigation is to extend this study into Australia. The COI sequence obtained from genbank from an individual from Sydney Harbour is identical to sequences obtained from the North Island. Given the believed short larval duration it would seem unlikely that there is a great extent of gene transfer across the Tasman Sea. - 56 -

3 The Phylogeographic Structure of the Waratah Anemone (Actinia tenebrosa) Around New Zealand.

3.1 Introduction

A sophistication of the reproductive patterns of many marine organisms is the inclusion of asexual reproduction. Whilst asexual reproduction of some sort is common place, few clonal or parthenogenic organisms are exclusively asexual, performing at least occasional sexual recombination (Bell, 1982; Hughes, 1989). It is often observed that this bimodal reproduction pattern is linked to a - 57 - bimodal pattern of larval dispersal with different larval types exhibiting differing competency and dispersal abilities. Theory predicts that genetically similar (asexually produced) juveniles should be optimised for local recruitment – preserving the successful parental genotype, and thus non-dispersive – whilst genetically varied recruits (sexually produced) should be optimized for long distance colonization to new and/or unpredictable habitats (Williams, 1975; Shields, 1982; Knowlton & Jackson, 1993). This has largely been the observed pattern amongst a wide range of benthic marine organisms (Jackson & Coates, 1986; Grosberg, 1987; Richmond, 1987; Raimondi & Keough, 1990; Coffroth & Lasker, 1998; Ayre & Hughes, 2000; Krug, 2001; Miller & Mundy, 2003; Sherman, 2006; Baums et al., 2006a). The proportion of asexual to sexual reproduction has even been shown to vary within some species depending on the heterogeneity of its habitat (Zilberberg et al., 2006).

This bimodal reproductive pattern has the potential to heighten population subdivision and genetic differentiation through several factors. Firstly, episodes of sexual reproduction appear rare in many partially clonal species (Shick & Lamb, 1977; Ayre & Miller, 2004; Whitaker, 2006; Sherman, 2006). These being the dispersive propagules, so too inter-population dispersive events must also be rare. As asexual fecundity is usually high, each population is generally a small collection of highly replicated clonal types. This situation lowers the effective population size, reducing the potential diversity of sexually produced offspring, further increasing genetic subdivision. In these small populations, cases of strong selective pressures on the limited sexually produced colonists may consequently lower the effective population size further (Frankham, 1995).

Marine propagule dispersal is difficult to quantify directly, which has led to a scarcity of quantitative data (Kinlan, 2005, Levin 2006). The handful of species studied in this manner have been mostly those of short larval durations with very low dispersal distances – giving a snapshot of dispersal representing only one dispersal scenario (Cowan et al., 2006). Owing to these difficulties, population connectivity assessments tend to be examined by computer models based on currents (which have often proved dissimilar to observed population connectivity e.g. Cowan et al., 2000), or through phylogeographic analysis. - 58 -

All species so far studied phylogeographically around the New Zealand archipelago reproduce only through sexual reproduction; and most have had a pelagic larval phase. The exceptions to this are the Brooding Brittle-Star Amphipholis squamata – investigated by Sponer & Roy (2002) and the corophiid amphiphods P. excavatum and P. lucasi studied by Stevens and Hogg (2004). Each of these three species lacking in a pelagic larval phase have been shown to exhibit an alternative mechanism to interpopulation dispersal than having pelagic larvae. As pointed out, A. squamata have been found rafting on macroalgae – Macrocystispyrifera - which likely facilitates transportation around the coast and would allow homogenisation of gene pools Sponer and Roy (2002). Juveniles of the corophiid amphipods have been shown to be abundant in the water column, and are commonly flushed out of bays during tidal flows (Ford, Thrush & Probert, 1999; Stevens et al., 2002) potentially allowing the exchange of these waterborne juveniles between populations. Whilst these dispersive mechanisms may seem to provide only infrequent opportunities for migration, very few migrants between populations are required to erase signs of disjunction. Assuming no selection, as few as between 1–10 effective migrants per generation will eliminate genetic differences between populations with 95% confidence (Shulman, 1998).

3.1.1 Actinia Tenebrosa – Geographic and intertidal distribution

The waratah anemone Actinia tenebrosa is up to 5cm in diameter with a red- black column and bright red tentacles that gives it the appearance of the warratah flower. It is present throughout Southern Australia from Shark Bay Western Australia to Heron Island Queensland, including Tasmania, and throughout the three main islands of New Zealand (Ayre 1984b; Ottaway, 1979). It occupies the mid – high tidal range, generally hanging in sheltered rock crevices.

- 59 -

3.1.2 Reproduction

The reproductive biology of sea anemones in the genus Actinia has gained considerable interest and disagreement over the years. These sea anemones are viviparous – they give birth to live young. These brooded juveniles are free- swimming within the enteron of the brood parent and are of a large size (up to 13mm by the time they are released (Ottaway, 1979). With the species in this genus being dioecious (having separate sexes), early researchers believed that these brooded juveniles were of sexual origin (Stephenson, 1929; 1935; Chia & Rostron, 1970). With the observation that in populations containing colour polymorphism the brooded young always maintained the phenotype of the brood parent (Stephenson, 1935; Chia & Rostron, 1970; Cain, 1974) this began to be questioned. A number of hypotheses were suggested such as re-entry of larvae at planula stage into genotypically similar adults (Chia & Rostron, 1970); colour being determined environmentally within the brood parent (Lubbock & Allbut, 1981) and parthenogenetic processes such as cross-fertilizing labile gonochorism, in which adults change from one sex to the other within each breeding season (Ottaway, 1979). Further evidence against sexual reproduction of these juveniles was the observation that males, females and juveniles all brood young (Ottaway, 1979).

The genetic basis for sex determination, along with the absence of any hermaphrodite individuals in a large sample size both within and between breeding seasons (Ayre, 1988), denies the possibility of parthenogenesis as the origin of these juveniles. Further empirical evidence now shows that brooded juveniles are genetically identical to their brood parent. This has been shown both with allozyme studies (Black & Johnson 1979, Orr et al., 1982; Monteiro et al., 1998; Yanagi et al., 1999) and with highly variable microsatellite loci (Sherman et al., 2007). This observation was noted even when the parent was heterozygous at multiple loci. This situation is completely contrary to parthenogenesis, inbreeding, or sexual outcrossing, and can only be attributed to asexual cloning. As yet, no species of Actinia has conclusively been shown to use sexual reproduction to produce brooded larvae (Carter and Thorp, 1979; Orr et al., 1982; Monteiro et al., 1998; Sherman, 2006). - 60 -

Within Australian populations of A. tenebrosa, site allele frequencies differ significantly from Hardy-Weinberg predictions if each individual is included. When replicate genotypes are removed however, populations confirm well to Hardy-Weinberg equilibrium predictions (Ayre, 1983; Sherman, 2006). Theoretically, these genotype frequencies are almost impossible to generate except through sexual recombination. Pooled clonal genotypes have been shown to conform to Hardy-Weinberg expectations from 23 sites over 1,400 km of Western Australian shoreline – apparently showing that they belong to a single, sexually inter-breeding population and almost all gene-flow between colonies must involve the planktonic dispersal of sexually produced juveniles (Ayre, 1984b).

3.1.3 Dispersal capabilities

3.1.3.1 Adults Adult A. tenebrosa have been shown to have high longevity and have extremely limited dispersal capabilities. Some adults remain stationary for periods in excess of 2 years and major movements are normally made only by individuals that have lost aggressive encounters or received injuries (Ottaway, 1978), or in response to environmental change such as the erection of artificial shades (Underwood, 1980). These ‘rapid’ movements have not been shown to exceed 5cm and subsequent movements over 4 – 7 months have not been observed to be greater than 10cm (Ayre, 1983). Rare cases of movement up to 1.6m have been reported on relatively smooth areas of shore (Ottaway, 1978). Even these exceptional movements are minute on a population scale and are obviously of no consequence to population connectivity. More importantly, passive transport of detached adults has never been observed despite intensive two year long studies of populations in New Zealand (Ottaway 1978, 1979) and at Rottnest Island (Ayre, unpublished cited Ayre, 1983). With the preference for hard stable rock substratum, ‘rafting’ on macroalgae seems unlikely and has not been reported. - 61 -

3.1.3.2 Juveniles The dispersal abilities of the brooded juveniles have been shown to be extremely limited. They are of a large size when released, averaging 4mm in diameter (Milligan, 1960) though some as large as 13mm column diameter have been observed (Ottaway, 1979) which have been brooded for up to a year. It has been estimated that 95% of all juveniles settle within 50cm of the brood parent (Ottaway, 1979). An allozyme study in Australia only found juveniles less than 10 meters from the nearest genotypically identical adult (Ayre, 1983). The low dispersive ability of juveniles has been further shown by genetic structuring within colonies - comparisons of pairs of sites within colonies were shown to be more likely to share at least one rare multilocus genotype if the rocky habitat was continuous rather than discontinuous (Ayre, 1984a). Clones may be spread over hundreds of meters of shore, but this is likely the product of a number of successive short distance dispersal episodes and asexual reproduction does not appear to be effective over distances greater than 500m (Ayre, 1984a).

As can be seen by population studies showing Hardy-Weinberg equilibrium over populations throughout Western Australia (Ayre, 1984b), and varying levels of population connectivity throughout Eastern Australia (Sherman, 2006), the sexually produced larvae have the potential to disperse great distances. This argument is also supported by the fact that most isolated colonies are multi-clonal and that it has been noted that A. tenebrosa is an excellent colonist of isolated areas of shore (Ottaway 1979; Ayre 1983). Despite the species wide circa-annular gonad development in November – March (Ottaway, 1979; Ayre, 1984a), colonisation appears a rare event for sexually produced young. A three-year recruitment study in Western Australia failed to detect sexual recruitment from an area cleared of A. tenebrosa over three years (Ayre, 1984a), and lack of recruitment has indeed still not been detected over the subsequent 22 years (Ayre unpublished cited Sherman, 2006). There are also present numerous manmade breakwaters up to 100 years old in Western Australia that have yet to be colonized by A. tenebrosa (Ayre, 1983). - 62 -

3.1.4 Local Adaptation

Population connectivity may further be lessened by local adaptation, which has been shown to occur over varying geographical and environmental levels in Australia. Reciprocal transplantation experiments have been performed between adjacent headlands (2-3 kilometers distance) and over larger regional scales (1000’s of kilometers) (Ayre, 1995). This study demonstrated localized adaptation, where native anemones were consistently fitter than imported anemones and these differences were greatest amongst distant rather than adjacent sources. Fine-scale adaptation has similarly been demonstrated looking at A. tenebrosa individuals from the same geographic location, but from varying habitats (boulders compared with stable rock platforms) (Sherman, 2006). Between habitat types, foreign anemones were shown to be significantly less viable compared with native or undisturbed anemones, asexual fecundity was significantly increased in native anemones and growth rates also showed an advantage for native anemones (Sherman, 2006).

3.1.5 Population Connectivity of A. tenebrosa

The population connectivity of A. tenebrosa in Australia has been assessed on different scales through allozyme studies (Ayre, 1984b; Ayre et al., 1991) and more recently combining these with microsatellite markers (Sherman, 2006). In these studies it was shown that the Western Australian populations – whilst connected amongst themselves – were largely distinct from those in eastern Australia (NSW, Victoria & Tasmania). Australian individuals were significantly different to those in South Africa (Ayre, 1984b). Within the eastern Australian populations, a significant disjunction in population connectivity was hypothesized (Ayre, 1991) and since verified (Sherman, 2006) at approximately the Victoria/New South Wales border. The dispersive barrier coincides with the presence of a 200km stretch of sandy beach and the off-shore movement of the East Australian Current near this region and these have been factors have been hypothesized to be causative. - 63 -

3.1.6 Loci

A number of loci were investigated for their efficacy in investigating population connectivity around New Zealand for both A. tenebrosa and I. olivacea. These were as follows:

1. Ribosomal Internal Transcribed Spacer (ITS) – which has previously been used by Stoletzki & Shierwater (2005) to assess population connectivity of the tropical sea anemone Condylactis gigantea and was able to detect significant population structuring in this species. 2. Mitochondrial Cytochrome Oxidase I (COI) – which is commonly used in studies of invertebrate opulation structure. 3. Mitochondrial Cytochrome Oxidase I Intron (COI intron) – A large mitochondrial intron discovered by Beagley et al. (1996) in the sea anemone Mitridium senile containing the open reading frame for a homing endonuclease along with two non-coding regions of size 153 and 28bp. This intron has been shown to be present throughout Cnidaria (Goddard et al., 2006) 4. NADH Dehydrogenase Subunit 5 Intrron (ND5 intron) – A second large mitochondrial intron identified in the mitochondrial genome of the sea anemone Metridium senile (Beagley et al., 1996) which contains subunits for ND1 and ND3 and two non-coding regions of size 225 and 111bp. 5. Argenine Kinase Intron (AK intron) – which has previously been used to elucidate life cycle evolution and the phylogenies of closely related species in the sea anemone genus Anthopleura (Geller et al., 2005) 6. G-Protein Coupled Receptor Intron (GPCR intron) – which has also previously been used to on investigations into life cycle evolution and the phylogenies of closely related species in the sea anemone genus Anthopleura (Geller et al., 2005) 7. Four Microsatellite Markers - recently developed for the Australasian sea anemone A. tenebrosa (Mitchellson and Ayre, unpublished; cited Sherman, 2006). These have been found to be significantly more variable than the allozyme markers previously used to study the Actinia - 64 -

genus (Sherman, 2006), and have been used with high statistical significance for studies of A. tenebrosa in Australia focusing on their reproductive patterns across habitats (Sherman et al., 2007), connectivity between habitats, and long distance population connectivity over New South Wales, Victoria and Tasmania (Sherman, 2006).

3.2 Summary

The waratah anemone (Actinia tenebrosa) has a complex bimodal reproduction including both asexually and sexually produced young that each have distinct roles in colonisation. This reproductive strategy, combined with strong local adaptation and intergenotipic aggression, is likely to create a very different pattern of genetic structuring among A. tenebrosa populations than that seen for other organisms studied phylogeographically around New Zealand. In this chapter I aim to investigate the population connectivity and phylogeography of A. tenebrosa around New Zealand. Specifically I aim to investigate the effects of currently hypothesized barriers to dispersal, and explore the mechanisms that isolate Actinia tenebrosa populations. Also I hope to compare and contrast the patterns of population connectivity between A. tenebrosa populations in New Zealand with previous studies of this species done in Australia.

3.3 Methods

3.3.1 Collection of Specimens I collected a total of 429 adult A. tenebrosa individuals from 26 New Zealand populations and 2 Australian populations (Caloundra in Queensland, and Perth in Western Australia – collected by S. Lavery) (Figure 3.1). This sampling regime covered most of the known distribution of A. tenebrosa in New Zealand. Samples were collected from rock platforms, except for Whangara and roughly half the samples at Shipwreck Bay and Christchurch, where anemones were instead located on the underside of large boulders. Samples collected at Oriental Bay were from a man-made boulder-bank.

- 65 -

Figure 3-1 Maps showing the collection sites for A. tenebrosa around New Zealand and Australia and the respective number of individuals sampled at each location.

The key goal of this study was to assess the large scale phylogeographic variation of A. tenebrosa around New Zealand. Assessments of inter- population genetic variation may be biased by multiple copies of a single genotype due to clonal replication (e.g. Ayre, 1984b; Hoffmann, 1986; Stoddart, 1988). The brooded juveniles of A. tenebrosa are asexually produced (Black and Johnson, 1979; Sherman 2006), and typically settle within a few centimetres from their brood parent (Ottaway, 1979; Ayre, 1983; 1984a; Sherman, 2006). Owing to this, sampling was underaken with the intention of minimizing the number of clonal. This was done by attempting to maximize the distance between individuals sampled.

Collections were made walking parallel to the shore, generally with increasing distance between each sample. Thus the distance between the first and second individuals sampled at a location was often low ≈ 50cm, however subsequent distances increased to tens or even hundreds of meters, and if - 66 - available multiple headlands were sampled. In those cases where anemones occurred in large continuous aggregations with no visible boundaries, I collected samples that were separated >50cm. Anemones were levered from the substratum using a butter-knife, or by hand, and placed in 95% ethanol. Each sample was labeled and estimates of the distances between each individual were recorded.

3.3.2 DNA Extraction and Amplification

A small amount of tissue (≈5mm2) was taken from each sample from the pedal disc or body wall using flame-sterilized forceps and scissors. The DNA was initially extracted following the phenol chloroform isoamyl alcohol (PCI) protocol (modified from Protocol 2. in Hoelzel & Green, 1992). Once PCR amplification protocols and the variability of potential markers were established, Chelex DNA extraction methods (modified from Walsh et al., 1991) were used. The resulting DNA was stored in the freezer (at approximately -20°C) to await amplification via the polymerase chain reaction (PCR) (Birt & Baker, 2000; McPherson & Møller, 2000).

The ITS, COI, COI intron, ND5 intron, AK intron and GPCR introns were amplified via PCR for a number of individuals from both coasts of both islands and from both populations sampled in Australia (PCR protocols and primer sets in Appendix A1.2). These were then sequenced using the same sequencing protocol as that used in Chapter 2. They were then aligned and viewed in Sequencher 3.7 to explore for sequence variability.

All A. tenebrosa individuals were genotyped at all four microsatellite loci. The primer sets for these are shown in table 3.1. The Polymerase Chain Reaction (PCR) was carried out in a total volume of 23µl containing reaction buffer (10µM of each primer, 20µM dNTPs, 2.5mM of Mg2+, 10x PCR buffer (PCRII - ABI) and 0.5µl Taq Polymerase (Platinum Taq – Invitrogen), and ~20ng DNA template. The PCR amplification was carried out for these with cycling conditions of 94°C for 3 minutes, 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min. One of each primer set was fluorescently labeled. These - 67 - labels were: At1 – NED, At5 – HEX, At21a – 6FAM, AT38 – 6FAM. PCRs were carried out for each primer set separately. For the amplification of the At38 locus, the original primer (table 3.1) was used for some individuals, and then these same individuals were repeated with a primer to which GTT had been added to the 5’ end. This was done in an attempt to minimize the problems posed by the adenylation of PCR fragment ends by Taq polymerase (Brownstein et al., 1996). The partial adenylation of PCR products can be a significant problem in accurately sizing fragments, particularly in single base repeat microsatellites

Post PCR the amplified products were multiplexed for each individual and the fragment sizes for each locus were determined by a Genescan analysis on a 3130XL capillary DNA sequencer (Applied Biosystems) with a ROX 400HD sizing ladder.

Table 3-1 Primer sequences for the microsatellite loci used in this study. All loci developed by Mitchellson & Ayre, unpublished cited Sherman, 2006)

3.3.3 Microsatellite Genotyping

Genescan Analysis version 3.7 (Applied Biosystems) and Genotyper V.2 were used to determine microsatellite sizing. Peaks were called automatically, and these were then corrected manually. For At1, there was a double peak trace for all single alleles. The larger of these two peaks was arbitrarily chosen to ensure consistency. The results of these analyses were automatically binned and then these were each subsequently checked manually to ensure accuracy.

- 68 -

3.3.4 Data Analysis

3.3.4.1 Allele Frequency

Allele frequencies were calculated for each locus within each population. This was done both including data from all individuals sampled, and was recalculated excluding all clonal haplotypes within each population.

3.3.4.2 Genotypic Diversity

Within each local population the probability of identity, PID, was calculated for increasing locus combinations (Waits et al. 2001) using the program GenAlex

(V6) (Peakall and Smouse, 2005). This identification (PID) estimator calculates the probability that two individuals drawn at random from a population will have the same genotype at multiple loci and is used to assess the statistical confidence for individual identification. The PID was calculated for each locus using the allele frequencies in the population, and then multiplied across loci to give an overall PID (Waits et al. 2001). The overall PID was then multiplied by the sample size giving the probable number of identical multi-locus haplotypes in each population sample. This was compared with the number of different multi-locus genotypes present in each population to evaluate if these were the product of sexual or asexual reproduction.

Genotypic diversity within each population was assessed by comparing the number of individuals sampled (N) to the number of unique multi-locus genotypes (Ng) detected. The ratio of Ng/N provides a maximum estimate of the contribution of asexual reproduction to local populations.

3.3.4.3 Population Subdivision

A number of analyses were used to characterise the genetic relationships between populations. As assessments of inter-population genetic variation may be biased by multiple copies of a single genotype due to clonal replication (e.g. Ayre, 1984b; Hoffmann, 1986; Stoddart, 1988), all calculations of inter- - 69 - population relationships were performed using only unique muti-locus haplotypes from each local population. Genetic differentiation between populations was calculated using Nei's (1987) uncorrected measure of nucleotide differentiation (DXY). This was done using the combined microsatellite frequencies. These calculations were performed in Arlequin v. 3.1 (Schneider et al., 2005) and visualized using a Multi- Dimensional Scaling (MDS) in the program Genalex v.6 (Peakall & Smouse, 2005).

Spatial Analyses of Molecular Variance (SAMOVA) were performed to assess the location, magnitude and number of population subdivisions for A. tenebrosa in New Zealand. This technique uses a simulated annealing procedure that maximizes the proportion of total genetic variance explained by differences between groups (Dupanloup et al., 2002). It does not use predefined sample groupings, but combined geographically adjacent samples to achieve this. The hierarchical distribution of genetic variation among populations was tested using an Analysis of Molecular Variance (AMOVA) (Excoffier et al., 1992) in Arlequin v. 3.1 (Schneider et al., 2005). Groupings defined in these AMOVAs were defined apriori to test specific hypotheses. This technique quantifies levels of population and regional subdivision using a hierarchical analysis of standardised genetic variance (F) (Wright, 1978). From this, the total genetic variation can be explained by showing the contribution of different data partitions: among groups (FST); among populations within groups (FSC) and within populations (FCT). Pairwise FST values were also calculated in Arlequin v. 3.1 between all populations to enable finer scale inter population relationships to be ascertained.

To further investigate the relationship between A. tenebrosa populations an UPMGA analysis of Nei’s (1978) genetic distance was performed using the program TFPGA (Miller, 1997b). The robustness of each node was then evaluated by bootstrapping allele frequencies 1000 times.

Isolation by distance was tested for using the correlation of matrices of pairwise genetic distance values (Nei, 1978) and geographic distances between - 70 - samples (km) (Mantel test, 10 000 permutation; Rousset, 1997). Geographic distances were calculated as the shortest distance connecting the populations by sea. This was done in Genalex v.6 (Peakall and Smouse, 2005). Two indicies of spatial autocorrelation - Moran’s and Geary’s indices (Sokal & Wartenberg, 1983), were also calculated to investigate isolation by distance, in the program Spatial Genetic Software (SGS) (Degen, 2003). These were calculated over a range of distance classes, and these were then assembled into a correlogram.

3.4 Results

3.4.1 Molecular Marker Variability

Of the loci investigated for this study of population connectivity, only the four microsatellite loci developed by Mitchellson & Ayre (unpublished; cited Sherman et al., 2007) were useful, and these were only useful for A. tenebrosa. Due to this, no information on the population connectivity of I. olivacea was obtainable.

All mitochondrial genes for both species were invariant, despite the wide- ranging sampling of these genes including both coasts of both islands, and for A. tenebrosa, both coasts of Australia. The Internal Transcribed Spacer (ITS) region which has been successfully used in phylogeographic studies for the Caribbean coral Montastraea annularis (Medina et al., 1999), and the tropical sea anemone Condylactis gigantea (Stoletzki & Shierwater, 2005) was also too invariant for use in this study. ITS variation was minimal for A. tenebrosa, with only one variable site detected, while no variation was detected for I. olivacea The multiple primer sets developed by Geller et al. (2005) to amplify the Arginine Kinase intron and G-protein coupled receptor gave a number of products of a similar size to the desired product, however it was found after these had been separated and sequenced that none of them bore any homology with the desired loci, nor was variation present in the unknown sequences amplified.

- 71 -

Table 3-2 The level of success obtained for each locus investigated in this study for I. olivacea and A. tenebrosa. Product indicates that a PCR product was successfully amplified, homology indicates whether the DNA sequence of this product was homologous to the desired locus, and variability shows if these sequences were variable. Variability was assessed across a minimum of eight individuals from both coasts from both north and south islands for both A. tenebrosa and I. olivacea and also both coasts of Australia for A. tenebrosa.

3.4.2 Genetic Variation

The total number of alleles per locus ranged from 2 to 17, with two microsatellite loci, At1 and At5, showing the highest levels of polymorphism (17 and 9 alleles respectively) (Table 3.3). Levels of polymorphism for the remaining two microsatellite loci (At21a and At38) were much lower, with only 2 and 3 alleles detected for each of these loci respectively (Table 3.3). - 72 -

Table 3-3 Allele frequencies for the collections of Actinia tenebrosa from 26 populations around New Zealand and two populations from Australia. The number of individuals sampled is given in brackets. Waus: Perth, Qaus: Caloundra, GB: Haratonga, SB: Spirits Bay, HE: Henderson Bay, CB: Cape Brett, NN: Narrow Neck Beach, MT: Mount Maunganui, WH: Whakatane, LO: Lottin Point, WR: Whangara, SH: Shipwreck Bay, PH: Piha, RA: Raglan, OP: Opunake, KP: Kapiti Coast, WE: Oriental Bay, CP: Castle Point, OB: Ocean Beach, WD: Ward, KK: Kaikoura, CH: Christchurch, BP: Banks Peninsula, JA: Jackson Bay, CF: Cape Foulwind, FS: Wharariki Beach, KA: Kaiteriteri

- 73 -

Table 3-4 Allele frequencies using only unique multilocus haplotypes for the collections of Actinia tenebrosa from 26 populations around New Zealand and two populations from Australia. The number of individuals sampled is given in brackets. Waus: Perth, Qaus: Caloundra, GB: Haratonga, SB: Spirits Bay, HE: Henderson Bay, CB: Cape Brett, NN: Narrow Neck Beach, MT: Mount Maunganui, WH: Whakatane, LO: Lottin Point, WR: Whangara, SH: Shipwreck Bay, PH: Piha, RA: Raglan, OP: Opunake, KP: Kapiti Coast, WE: Oriental Bay, CP: Castle Point, OB: Ocean Beach, WD: Ward, KK: Kaikoura, CH: Christchurch, BP: Banks Peninsula, JA: Jackson Bay, CF: Cape Foulwind, FS: Wharariki Beach, KA: Kaiteriteri

- 74 -

3.4.3 Genotype Diversity

The combination of the four microsatellite markers allowed a high degree of discrimination among genotypes within each population. The probability that two individuals drawn at random from a population will share by chance the four locus genotype was low for all populations ranging from 0.141 to <0.001 (Appendix A2.2). The expected number of individuals with the same four locus haplotype was therefore also low (<1) except for one population (figure 3.2) indicating that discriminatory power of these four loci combined was high. This one population – Christchurch had five out of eight individuals identical and the predicted number of one, a situation almost certainly due to asexual reproduction. The number of identical haplotypes in each population was consistently higher than the PID, often markedly, leading to the conclusion that these identical haplotypes are of clonal origin.

Figure 3-2 The expected number of individuals with the identical genotype for increasing locus combinations within each of the 28 populations of Actinia tenebrosa sampled.

- 75 -

Levels of genotypic diversity varied greatly among populations, with several showing a high proportion of distinct genotypes (Haratonga, Henderson Bay, Spirits Bay, Piha etc.), while others were dominated by only a small number of highly replicated genotypes (e.g. Christchurch, Banks Peninsula, Dunedin, Kaikoura, Ward Beach and Oriental Bay). A strong geographic trend was present in the levels of genotypic diversity, with all of populations on the South Island’s east coast being dominated by highly replicated clonal genotypes compared with the rest of the country (Figure 3.3).

Figure 3-3 The percentage of unique multilocus haplotypes sampled in each location for Actinia tenebrosa individuals compared with the latitude of sampling location. Locations on the east coast of the South Island are shown in blue, the rest of the country in red. R2 = 0.37.

A comparison of the number of genotypes shared among populations showed that 72 genotypes were represented by more than one individual of the 429 individuals sampled. 86% of genotypes were confined to a single population with the remaining 14% common to more than one population. Of those clones common to more than one population, I found that 48% of these putative clones were only shared between neighbouring populations and only two genotypes were common to more than two populations. - 76 -

3.4.4 Population Subdivision

3.4.4.1 Multi-dimensional Scaling of Genetic Distance

Multidimensional scaling was performed using Nei’s genetic distance (Nei, 1978) based only on unique haplotypes within each population. The initial MDS contained populations which were highly divergent to the remaining group (Haratonga & Caloundra); and these lowered the ability to resolve relationships between the other populations. Because of this, both populations from Australia (Perth and Caloundra), and both populations with very low sampling numbers (Haratonga & Wharariki Beach) were eliminated from the MDS (Figure 3.4a).

Figure 3-4 A) MDS of genetic distance (Nei, 1978) for populations of A. tenebrosa from around New Zealand. This was derived using only distinct multi-locus genotypes for each population. Populations with low sampling (Haratonga & Wharariki Beach) and from Australia are excluded to aid resolution. B) The geographic locations of these populations.

There is strong concordance between the MDS plot and the geographic map – figures 3.4a and 3.4b. The colouring of each population is for illustrative purposes rather than to show the distinctiveness of each of these groups. Each coloured group is a geographical grouping that is also a grouping present seen in the MDS, however other groupings are equally viable. For instance, #17 – - 77 -

Ocean Beach, could just have easily been coloured orange, or #18 Opunake could have been coloured green, and this would still be appropriate in both respects. What this is indicating therefore, is that these are not necessarily distinct groups, but that populations that are geographically close to each other are genetically more similar, and that isolation by distance is probable. There are two outlying populations which appear more isolated – Shipwreck Bay and Whangara, and do not quite fit the isolation by distance pattern.

3.4.4.2 Pairwise FST

Pairwise FST comparisons between each individual population were also calculated. These showed highly significant dissimilarity between the majority of populations (table 3.5). Populations that are adjacent geographically are generally not significantly dissimilar genetically, hinting again at an ‘isolation by distance’ population structure.

Linearized FST values between adjacent populations were displayed graphically around the coastline to highlight areas of low population connectivity (figure 3.5). The most significantly diminished population connectivity was in the East Cape area, followed by the South Taranaki Bite near Cook Strait, and the west coast of the North Island north of Auckland. - 78 -

Table 3-5 Levels of significance for pairwise FST comparisons between A. tenebrosa populations using combined microsatellite loci. – p > 0.05, + p < 0.05, ++ p < 0.01. Values derived from the combined four microsatellite loci using only distinct multi-locus genotypes for each population.

Figure 3-5 Map showing linearized FST values (Slatkin, 1995) between geographically adjoining populations of A. tenebrosa around New Zealand based on data from the four microsatellite loci using gene frequencies derived from genotype frequences using only distinct multi-locus genotypes. - 79 -

3.4.4.3 Spatial Autocorrelation

Moran’s index (I) and Geary’s index (c) were calculated and correlograms created of these to assess spatial autocorrelation. Both measures showed a strong significant autocorrelation. Moran’s index is positive if that spatial class is more similar than a random sample of varying distances, and negative if a spatial class is less similar than a random sample of varying distances. Similarly Geary’s index is below 1 when that spatial class is more similar than a random sample of varying distances, and above 1 if a spatial class is less similar than a random sample of varying distances. A strong linear relationship is present for both indices indicating that populations of A. tenebrosa are significantly more similar genetically when they are geographically near, and significantly less similar genetically when geographically distant.

A Mantel test on the regression of Nei’s 1978 genetic distance against geographical distance in kilometres, confirmed this relationship, showing a significant positive correlation (P < 0.0001) between genetic and geographical distance (Figure 3.8). This correlation whilst highly significant was low (R2=0.12), compared with that of (Sherman, 2006) in eastern Australia (R2=0.66). A second regression and test was performed, with the three populations that appeared individually divergent (Shipwreck Bay, Haratonga & Whangara) excluded, yielding a higher correlation for the regression (R2=0.21) (Figure 3.9.).

- 80 -

Figure 3-6 Spatial correlogram of the relationship between Moran’s Index and the geographic distance between populations of Actinia tenebrosa around New Zealand.

Figure 3-7 Spatial correlogram of the relationship between Geary’s Index and the geographic distance between populations of Actinia tenebrosa around New Zealand.

- 81 -

Figure 3-8 Relationship between genetic differentiation (Nei, 1978) and geographic distance between populations of Actinia tenebrosa around New Zealand. Genetic distances calculated using only unique multilocus haplotypes. Correlation co-efficient (R2) = 0.12. P < 0.0001

Figure 3-9 Relationship between genetic differentiation (Nei, 1978) and geographic distance between populations of Actinia tenebrosa around New Zealand excluding populations at Shipwreck Bay, Haratonga & Whangara. Genetic distances calculated using only unique multilocus haplotypes. Correlation co-efficient (R2) = 0.21. P < 0.0001

3.4.4.4 SAMOVA

Spatial Analyses of Molecular Variance (SAMOVA) were performed to assess the location, magnitude and number of population subdivisions for A. tenebrosa in New Zealand. This was done using only the unique haplotypes present at each location (Figure 3.10 & table 3-6). - 82 -

Figure 3-10 The distribution of variance within four microsatellite loci for A. tenebrosa compared between the number groups of New Zealand populations defined in SAMOVA.

Table 3-6 Population groupings as defined in SAMOVA for A. tenebrosa based on data for four microsatellite loci using gene frequencies derived from genotypes of all adults using only distinct multi-locus genotypes. NE represents the populations on the north-eastern coast of the North Island from Spirits Bay to Lottin Point inclusive.

- 83 -

Figure 3-11 Population groupings as defined in SAMOVA for eight groups of A. tenebrosa populations based on data for four microsatellite loci using gene frequencies derived from genotypes of all adults using only distinct multi-locus genotypes.

The majority of variance seen in the SAMOVA analysis was attributable to within population variation. The SAMOVA up until seven groups removed single populations at a time, and then at seven, it grouped populations on the north-east of the North Island together to form a distinct group from the other populations. At eight groups (Figure 3.11) a very similar grouping is observed to the earlier somewhat arbitrary grouping (Figure 3.3) from the MDS analysis. No large-scale grouping of A. tenebrosa populations is clearly shown, and these results correspond well with the interpretation of an ‘isolation by distance’ genetic structure for A. tenebrosa around New Zealand.

3.4.4.5 UPGMA UPMGA analysis of Nei’s (1978) genetic distance indicated the strong division of Caloundra and Haratonga from the other populations. This is unsurprising for both, as Caloundra is in the north of Australia significantly displaced from all other populations, and Haratonga had an extremely low sample number (three unique haplotypes), and is therefore subject to high stochastic sampling error in - 84 - allele frequency estimation. The most significantly distinct grouping here was again the north east of the North Island.

Figure 3-12 Dendogram showing the genetic relationships among A. tenebrosa populations in New Zealand and two Australian populations (Queensland & Western Australia). Nei’s genetic distance (1978) was calculated based on data for four microsatellite loci using gene frequencies derived from genotypes of all adults using only distinct multi-locus genotypes. Clustering determined by UPGMA with bootstrapped values over 20% (based on 1000 randomisations) shown next to corresponding nodes.

Surprisingly the Western Australia population groups with those from the north- east of the North Island. It is extremely unlikely that there is any gene flow between these populations and this is probably an artefact of low sample number and high microsatellite variability. The distinct nature of the Perth (Western Australia) population can be seen in the frequency and number of private alleles contained within it (Table 3-7). Three New Zealand populations each have one private allele, and these alleles are at a low frequency in the population. Caloundra in Queensland, Australia has two private alleles, and Perth has three private alleles and these are all at a comparatively high frequency in the population. - 85 -

Table 3-7 Private alleles located for the four microsatellite loci in all populations of A. tenebrosa investigated.

3.5 Discussion

3.5.1 Population Subdivision

I detected high levels of genetic differentiation among populations of A. tenebrosa around New Zealand. This is a very similar pattern to that shown along the east coast of mainland Australia and Tasmania (Sherman, 2006).

If a significant regional grouping could be discerned, it would be the north east of the North Island being somewhat distinct from the rest of the country. This distinctness of the north east – from Cape Rienga to East Cape has long been recognised biogeographically (Powell, 1961; Pawson, 1965; Moore, 1961; Nelson, 1994; Francis, 1996). It has also been indicated in the phylogeographic studies of the amphipod P. excavatum (Stevens & Hogg, 2004). The distinctiveness of the north-east for A. tenebrosa is however unconvincing without larger samples in the adjacent regions. The two populations sampled adjacent to this north-eastern grouping were distinct from all other populations, and the distance from these to the next nearest populations sampled is considerable. Because of this, an ‘isolation by distance’ model could still account for the marginal grouping of populations from Cape Reinga to East Cape – as they are separated from other sampled populations by a large distance.

There are at least two potential reasons that Shipwreck Bay and Whangara may appear to be divergent from other populations. These are that both populations are quite isolated physically from other populations with which - 86 - recruits may be exchanged, and that current systems in the area may not be effectual in moving recruits between populations.

The distribution record compiled by Ottaway (1979) of A. tenebrosa, whilst obviously not exhaustive, does not mention any sites south of East Cape on the North Island’s east coast. During sampling it was difficult to locate any populations of A. tenebrosa along this stretch of coast. Unsuccessful attempts to locate A. tenebrosa were made at Tokamaru Bay, Tolaga Bay, Tatapouri, Mahia Peninsula and Tangoio Bluff (Figure 3.13). At times this species can be difficult to find due to the special niche requirements, so it cannot be ruled out that they were present at these sites but not located.

Figure 3-13 North Island showing place names discussed in text. Closed circles indicate locations where A. tenebrosa were found during sampling, Open cicles indicate locations where A. tenebrosa was looked for but not found.

This coastline south of East Cape is dominated by soft sandstone, mudstone and sandy limestone (Thornton, 1988). A. tenebrosa has a strong preference for hard substrates such as volcanic rock (personal observation) and the particular soft sedimentary rock present along this coast appeared unsuitable or marginal habitat for them. It should be noted that A. tenebrosa were located at - 87 -

Whangara on a boulder bank made of harder stone than that generally found along this coast. This isolation from potential nearby sources may be a reason for the observed distinctiveness of this population.

A second possibility as to why the Whangara population is genetically more isolated from other populations is that the current movement of the EAUC moves the pelagic larvae of A. tenebrosa offshore at East Cape. Biogeographic studies have indicated a strong break at this point for a range of taxa (Powell, 1961; Pawson, 1965; Moore, 1961; Nelson, 1994; Francis, 1996). A barrier to dispersal at East Cape has been suggested for P. excavatum (Stevens & Hogg, 2004). The primary hypothesis as to the cause of this barrier has been the movement offshore of the EAUC and the effects of this movement on the plankton in this area. The warm water of the EAUC splits at East Cape into two approximately equal branches, one moving offshore linked with the East Cape Eddie and the other branch continuing southwards as the ECC (Heath, 1985). If East Cape were a barrier to dispersal for one of these reasons, it may mean that the north east of the North Island is actually isolated from the rest of the country to a degree.

Shipwreck Bay – at the southern end of Ninty Mile Beach on the North Island’s west coast, is also relatively isolated from other potential populations with which it could exchange larvae. To the north there is a single rocky outcropping called ‘The Bluff’ before Cape Reinga, on which A. tenebrosa has been recorded (Ottaway, 1979). To the south, the only rock with potential habitat for A. tenebrosa is Maunganui Bluff, until the rocks of the Waitakere ranges such as those at Piha. The intervening coast is comprised of sandy barrier beaches with no suitable substrate.

Stanton’s (1973) study and review of the currents in the area concluded that a northerly flow is predominant in this area during the summer period. As it is in December that A. tenebrosa spawns (Milligan, 1973), it can be assumed that the flow at Shipwreck Bay is northerly during spawning. This north-west flow on the west coast provides a further explanation for population isolation at Shipwreck Bay. Brodie's (1960) summer drift card returns show no evidence of - 88 - the West Auckland Current in this season and the nil recovery of cards from the Cape Reinga area suggest that cards were swept north or east away from New Zealand (Stanton, 1973). If larvae from west coast populations are also swept away to the north-wast then they too will not make their way to Spirits Bay, and given the northwards flow on the west coast, and eastward flow from Cape Reinga, Spirits Bay larvae are unlikely to make it south-west to Shipwreck Bay. There is also good evidence as discussed in chapter two for a near-shore upwelling that may also move larvae away from the coast at Cape Reinga (Garner 1959; Garner, 1961; Stanton, 1969; Garner, 1970; Stanton & Hill, 1972; Stanton, 1973; Roberts & Paul, 1978; Ridgway, 1980). This phenomenon of relative isolation at Shipwreck Bay was also seen in the phylogeographic structure of S. pelliserpentis (Chapter 2.) and may be a general feature to other organisms of the area.

The North/South Split that has been observed in S. pelliserpentis (Chapter 2) and several recent studies of coastal marine invertebrates (Apte & Garner, 2002; Apte et al., 2003; Ayres & Waters, 2005; Goldstein et al., 2006) was not in evidence for A. tenebrosa. This is a surprising result, as episodes of sexual reproduction appear rare in A. tenebrosa (Ayre, 1984b; Sherman, 2006) and theoretically the effective population size is lower in partially clonal organisms thus increasing chances to see population subdivision. The effects this North/South Barrier has on marine organisms including A. tenebrosa is reviewed in Chapter 4.

3.5.2 Spatial Autocorrelation

Through both the Mantel tests on genetic distance (Nei, 1978), and Moran’s and Geary’s indicies, significant spatial autocorrelation was shown. The patterns observed in the MDS and UPGMA trees are also indicative of an ‘isolation by distance’ pattern for A. tenebrosa in New Zealand. This IBD population structure is also the primary structure observed on the east coast of Australia (Sherman, 2006). The correlation of genetic distance to geographic distance was lower than than in Sherman’s (2006) study though still highly significant (P<0.001). There are several potential reasons for this lower correlation. In the Australian study, six allozyme loci were used giving added - 89 - resolution. Due to sampling methods (the use of ethanol to preserve the anemones) this could not be untaken in the present study. Also, within my study, the sample sizes were limited by time constraints on sampling, and so a number of populations had low numbers of individuals. These sample numbers were further reduced by the elimination of identical haplotypes so that on average only 11.3 unique haplotypes per population were used. High within population heterozygosity and variability in microsatellite loci can reduce FST estimates and make genetic divergence more difficult to detect (Avise, 2004). With these highly variable loci, larger sample sizes are required to obtain accurate allele frequencies with which calculations are based. This is the probable major reason for the lower observed correlation. Lastly the New Zealand coastline is more complex than that studied in Sherman’s (2006) study. The east coast of Australia is relatively linear, compared with the more irregularly shaped islands of New Zealand which lie next to each other. All distance calculations were the minimum distances between points via the sea, but this is far from an ideal estimate of the distance larvae would actually have to travel.

The pattern shown by the two spatial correlation indicies were very similar to other studies in which isolation by distance has been shown (e.g. Cassens et al., 2000). The distances calculated in SGS (Degen, 2003) for Moran’s and Geary’s indices could only be ‘as the crow flies’ rather than reflecting the route larvae must take around land. Because of this, this program is not ideal for organisms in a coastal setting around islands and this flaw does lower the distances between sites and erroneously links populations between coasts. This would proportionally bias the lower distance classes the more, and this probably explains the shallowing of the gradient observed in Geary’s index at low distances. This failing in the applicability of the program to this task lowers the statistical significance of results. Despite this problem these results are both still statistically significant. A modification to SGS to allow direct inputting of a distance matrix would be beneficial to its future use particularly for non- terrestrial organisms.

- 90 -

3.5.3 Genotype Diversity

The total amount of genotypic diversity within a local population should represent a balance between the addition of novel genotypes through sexually derived recruits and the subsequent decline of genotypic diversity through the removal of less fit genotypes through natural selection (Sherman, 2006). For an organism with a bimodal reproductive pattern like A. tenebrosa, the relative contributions of asexual and sexual recruits should similarly be determined by the habitat heterogeneity, the direction of transport of each propagule type and the strength of selective forces on these recruits.

There are two reasons why clonal haplotypes may become more predominant in a given population rather than another. Firstly the relative reproductive output of individuals could be shifted more towards asexual reproduction than sexual reproduction, thus giving a higher relative frequency of asexual recruits. This could be the result of physiologic adaptation to an environmental stimulus, or it could be heritable and the product of selection or genetic drift. Alternatively, the survival of sexually produced recruits could be lower due to an increase in selective pressures.

It has been demonstrated that A. tenebrosa is very sensitive to the local environment and local adaptation has been observed at scales from habitat type on the same beach to between adjacent headlands, and over large regional scales (Ayre, 1995; Sherman 2006). Physical habitat heterogeneity of the locations sampled on the east coast of the South Island did not appear dissimilar to other areas sampled, and sampling regimes employed were identical inasmuch as is possible. With the strong grouping however, there does appear to be a broad-scale trend of high clonal proportions observed on the South Island’s east coast, which is probably the result of environmental factors. - 91 -

Figure 3-14 Sea surface temperature (ºC) around southern New Zealand. Overlayed on this are the A. tenebrosa populations with a high percentage (≥45%) of clonal haplotypes in white, and those with a low percentage (<45%) of clonal haplotypes shown in black. Figure modified from Vincent et al. 1991

The range of A. tenebrosa includes southern Australia on both coasts, and New Zealand. The South Island of New Zealand is the southern-most range of A. tenebrosa in the world, and as can be seen in figure 3.14, the east coast of the South Island contains the coldest water that A. tenebrosa encounters anywhere in its range. This cold SC water of subantarctic origin is a possible selective pressure that limits the survival of sexual recruits. All the populations within this colder water exhibit a higher proportion of clonal types sampled than those outside it. While breeding in A. tenebrosa occurs in December, settlement occurs mainly from March to October – over the colder winter months (Ayre 1984b, Ottaway, 1979). Moreover, Ayre (1984b) notes that mortality is higher for the smaller, newly settled juveniles. Asexually produced brooded juveniles are adapted like their brood parent to local conditions and are most likely larger - 92 - than the sexually produced young. It is cogent to hypothesise that the cold extreme encountered in this area is a selective pressure which causes a decrease in the survival of sexually produced recruits, and consequently leads to an increase in the percentage of clonal haplotypes in these populations. The other option that explains this observation is that the local environment alters reproductive output physiologically, biasing this towards asexual reproduction. There are other potential factors that co-vary with the cold water such as the salinity of the SC. Further investigation into this hypothesis is required before firm conclusions can be made.

3.5.4 Molecular Markers in Anthozoa

A high rate of nucleotide substitution is generally present in animal mitochondrial DNA (Brown et al., 1979), which is one of the reasons mitochondrial genes have been used extensively in population genetic and phylogeographical analyses. However the group Anthozoa (sea anemones, corals and sea pens) often exhibits unexpectedly low mitochondrial sequence diversity, with mitochondrial genes that are virtually invariant among conspecifics, even at third codon positions of protein-coding sequences (see review Shearer et al., 2002). It has been shown that this is due to mtDNA mutation rates of Anthozoa being 50 - 100 times lower than rates typical for most animals (Hellberg, 2006). One explanation for this highlights the discovery of a homologue to a mismatch repair gene for the mtDNA in Anthozoans (Pont-Kingdom et al., 1997). Because of this, mtDNA markers are of limited use for population-level studies in these organisms (Shearer et al., 2002; Wörheide, 2006). In the present study, I found no sequence variation in COI, or within two mitochondrial introns in the COI and ND5 genes, despite these containing large non-coding regions for both I. olivacea and A. tenebrosa. This is even with sequences being compared between a number of A. tenebrosa individuals from both coasts of both the North and South Island of New Zealand, and both coasts of Australia. This startling result highlights the lack of utility mtDNA markers have within Anthozoa for population genetic and phylogeographic studies, and emphasizes the need for alternate markers.

- 93 -

3.5.5 Microsatellite Amplification Methodology

Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3’end of PCR-amplified products giving a ‘plus A’ product. This presents a potential source of error in genotyping studies based on short tandem repeat (STR) markers (Brownstein et al., 1996). In the present study, the reiterated repeat unit of the STRs were 7bp (AT1), 2bp (AT5 & AT21a) and 1bp (AT38). The size of the repeat unit, and peak morphology seen in genotyper (Applied Biosystems) allowed binning to occur with a high degree of certainty for the first three of these. For AT38, there was the concern that non-template additions of adenosine could alter the observed size, or peak morphology to give a greater uncertainty in sizing.

Figure 3-15 Chromatogram trace morphologies for the AT38 locus from Genotyper comparing the amplification using the original primer on the left, with the amplification using the modified +GTT primer on the right. Each comparison is between the same A. tenebrosa individual.

- 94 -

Brownstein et al. (1996) found that it was difficult to modify the sequence of primers to consistently protect against extra adenylation, but that the addition of various sequences at the 5’end of primers resulted in almost 100% adenylation. Because of this, two variants were ordered for the AT38R primer (one as originally described, the other with GTT added to the 5’ end. Amplification and sizing for several individuals was performed using both primers. Consistently for these individuals, the product was 4bp larger when using the primer with the additional GTT, showing that almost complete adenylation occurred (Figure 3.15). The chromatograms appeared as mirror images with a minority of ‘plus A’ when using the unmodified primer, compared with a minority without ‘plus A’ using the modified primer. After this, all amplifications were done using the GTT+ primer, and then the final sizing was reduced by 4bp. The necessity of this step is difficult to assess, as few individuals were amplified using both primer sets. For this locus it does not appear to make much difference in the ability to score sizes accurately. In the future a larger sample including various known heterozygotes will be repeated to enable a proper comparison to be made as to the necessity of this step.

- 95 -

4 General Discussion

4.1 Introduction

Investigations into phylogeographic concordance between a range of taxons is vital to the proper assessment of the processes that structure populations. Investigations of phylogeographic concordance can include the concordance within a species across multiple unlinked loci, concordance in the geographic position of genetic discontinuities across co-distributed species, and or the concordance of genetic partitions with geographical boundaries (Avise, 1998, 2000, 2004). Without this comparative work between taxa, generalizations on the factors effecting population connectivity - such as environment, behaviour and physiology, cannot be made. In previous chapters, I have undertaken the phylogeographic analysis of two co-distributed organisms from different phyla, with differing life history traits to investigate processes acting on marine intertidal species around New Zealand. The first of these – the snakeskin chiton (S. pelliserpentis) is from the class Polyplachophora – a class that has not before been studied phylogeographically in New Zealand. It has lecithotrophic larvae with the shortest pelagic larval period of any species so far studied in New Zealand. The second species - the waratah anemone (A. tenebrosa), is from the phylum Cnidaria from which no member has not been studied in a New Zealand-wide phylogeograpic context before. Its bimodal reproductive strategy is also quite unlike that of any previously studied organism in New Zealand. Comparisons between the phylogeography of these two species and the other sixteen marine invertebrate taxa so far studied around New Zealand, may allow some level of clarification as to the effects life history traits, and generality of barriers to dispersal.

- 96 -

4.2 Previous studies

There have now been twenty two studies (including the present one), over eighteen taxa of coastal marine invertebrates around New Zealand. The species used, methodologies, sampling ranges and results of these studies are summarized in table 4.1. In several of these studies, a limited geographical scope restricts the capacity for broadscale phylogeographic comparisons. Both the studies of the black nerita (Nerita atramentosa) by Waters et al. (2005), and the pea crab (Pinnotheres atrinicola) by Stevens (1991) were limited to the northern part of the North Island. Neither of these studies showed any strong boundaries to dispersal. Population differentiation was however noted in a clinal fashion for P. atrinicola. (Stevens, 1991). Another area where numerous phylogegraphic studies have been concentrated is in the fiords of the South Island’s south-west coast (Miller, 1997; Miller et al., 2004; Mladenov et al., 1997; Perrin, 2002, Perrin et al., 2004). Various connectivity patterns have been shown within this complex area such as a north/south cline of connection exhibited by the the eleven armed sea star populations (Coscinasterias muricata) (Skold et al., 2003; Perrin, 2004) or the differentiation of inner and outer fiords for the sea urchin Evichinus chloroticus (Perrin, 2002)

A number of studies have been replications of previous work with larger sample sizes and more comprehensive sampling regimes, often using newer, more variable markers. The primary examples of this replication are the six studies on the greenlipped mussel - Perna. canaliculus (Smith 1986, 1988; Gardner et al., 1996, Apte & Gardner 2001, 2002; Star et al., 2003). As the earlier studies have been surpassed by the more recent ones in both sampling size and resolution, only the more recent ones are useful for examinations of phylogeographic concordance. This leaves ten studies including the present one, with which broadscale phylogeographic concordance can be assessed. - 97 -

Table 4-1 Summary of marine invertebrate population genetics studies around New Zealand. NE: North I. east coast, NW: North I. west coast, C:Greater Cook Strait, SE: South I. east coast, SW: South I. west coast, ST: Stewart I., CH: Chatham Islands, F: Fiords, Aus: Australia.

- 98 -

4.3 Geographic concordance

4.3.1 North/South genetic structuring around Cook Strait

Of the ten marine invertebrate species studied phylogeographically around New Zealand (with a wide ranging sampling regime across both main islands), seven show significant patterns of genetic differentiation between northern and southern populations (Table 4.2).

Table 4-2 Summary of habitat, life history and phylogeography of all New Zealand coastal marine invertebrate species studied across both North and South Islands. Species above the midline have observed North/South structuring. “Structure” is defined as the percentage of population structure explainable by this North/South grouping. References in table 4.1.

The studies by Perrin (2002) and Sköld et al. (2003) that indicated a difference between northern and southern populations of two of these species the sea urchin – E. chloroticus and the eleven armed sea star - C. muricata, were primarily designed to investigate population structure within the fiords. Due to this, sampling was limited for the rest of the country. For both studies of C. muricata, the northern population was defined by a single population on the North Island’s west coast, and this was significantly different from those in the South Island. Similarly, E. chloroticus was only sampled at two sites in the North Island - one on each coast. Owing to this low number of sampling sites, and specifically a lack of sampling in the central region of the country, the detailed population structure for these two species remains uncertain. Isolation by distance is a possibility for both, though this was not indicated to occur within the fiords. A second option is - 99 - that there is north/south population structuring with a more distinct boundary. This seems likely particularly for E. chloroticus as both populations sampled from the North Island for E. chloroticus are similar to each other despite the large distance between them, and both are significantly different to South Island populations. Further investigation is needed to define exactly what population structure exists for these species.

For the other five species studied that show significant north-south genetic structuring, the break between distinct populations occurs in the vicinity of the Greater Cook Strait region. This correlation strongly suggests a common phylogeographic break and barrier to dispersal in this region. A link between the top of the South Island and the North Island has been genetically determined for each of these five species, showing that Cook Strait itself is not the barrier. Due to a lack of sampling sites along the north- east and north-west coasts of the South Island in earlier studies, the exact location of this phylogeographic boundary has previously only been suggested through links with possible hydrographic processes. Correlations between studies have been made more complex by the varying sampling locations employed; nevertheless strong similarities are present. The detailed sampling scheme in the present study of S. pelliserpentis has finally been able to pinpoint where the common boundaries may be. - 100 -

Figure 4-1 Map of the greater Cook Strait region showing the north/south split evident in marine invertebrate populations. Data summarized from the present study and (Apte & Garnder, 2002; Star et. al., 2003; Waters & Roy, 2004; Ayres & Waters, 2005; Goldstein et al., 2006) There appears to be a correlation of the geographic area of the boundary between northern and southern populations of these species exists (Figure 4.1). Greater Cook Strait itself does not appear to be a boundary to dispersal for any of the species studied; rather a boundary is indicated south of Cook Strait on both coasts of the South Island. Within these studies, all the species were sampled from at least two sites within the northern coast of the South Island - this being defined in this paper as the area between Farewell Spit, and Cape Campbell, and these sites were consistently shown to be linked with the North Island population. From these results, the boundaries between northern and southern populations lie just north of Cape Campbell on the east coast, and coincide with Farewell Spit on the west coast.

- 101 -

Figure 4-2 Geographic Map of the Greater Cook Strait area showing place names discussed in text. The highlighted area defines the boundary area between northern and southern populations as shown in Figure 4.1. Within the highlighted areas no population genetic studies have been undertaken. Map modified from (Bradford et al., 1986)

A caveat must be made that while there appears to be a strong geographic concordance between these five species in the location of the north/south population disjunction, the boundaries to a greater or lesser degree for each of the species. This leaves open the possibility that the location of this boundary varies between species. With the strong similarity between observed structure and probable similar causation this seems unlikely, but cannot as yet be ruled out.

- 102 -

4.4 Life history concordance

For marine invertebrates the inclusion of a planktonic larva in the life cycle potentially provides for greater larval transport and gene flow between populations, allowing genetic homogenisation between them, and thus creating larger panmictic populations. A positive relationship typically exists between propagule duration (planktonic larval duration [PLD]) (Shanks et al., 2003) and dispersive distance; and correspondingly a negative relationship exists between PLD and genetic distance (Siegel et al., 2003). The longer the PLD is, the further the larva can potentially disperse and hence homogenize distant populations. Within the New Zealand studies a negative relationship does exist between larval duration and population subdivision across this area south of Greater Cook Strait, as would be predicted by theory (Figure 4.3). The biological significance of this is however dubious.

Figure 4-3 Relationships between larval duration and ФST values across the north/south division for the five marine invertebrate species that have been shown to exhibit population disjunction at this location. R2 = 0.3286

While a negative trend exists there are incongruities which suggest that pelagic larval durations are not the primary determinate of population connectivity in this case. The observed negative trend is caused by two species (S. - 103 - pelliserpentis and C. ornata) both having low PLDs and high genetic structuring however the other three (C. radians, P. canaliculus and P. regularis) have similar moderate levels of subdivision while having vastly different larval periods. This relationship is therefore potentially an artefact of the small number of studies. Importantly there is a large difference in genetic structuring observed between the two limpet species C. ornata and C. radians, despite suggested similarity in larval duration and morphology (Goldstein et al., 2006).

These observations lead to the conclusion that factors other than larval dutation play a significant role in determining population structure in the Greater Cook Strait area. Some potential larval characteristics other than PLD that may alter population connectivity are larval behaviour, and the reproductive periods of the organism.

The timing and length of the spawning seasons of marine organisms varies widely (Morgan, 1995), and these factors strongly influence what ocean currents and other hydrological factors are encountered by the larvae, and as such, the distance and direction of dispersal. Spawning in S. pelliserpentis occurs over a short time beginning in mid-February, with three to four subsequent spawning events into March, each separated by approximately fifteen days (Johns, 1960). During March and into early April C. ornata also spawns (Dunmore & Schiel, 2000). C. radians in contrast has multiple spawning events throughout the year (Creese & Ballantine, 1983), and P. canaliculus and P. regularis both spawn in Spring and early summer (Pike, 1970; Byrne & Baker, 1991) (Figure 4.4). E. chloroticus has variable spawning probably depending on food supply but is generally in mid-summer (Keogh & Mladenov, 1994 cited Mladenov et al., 1997). The only species studied across this boundary that does have a pelagic larval phase but does not exhibit genetic structuring here is A. tenebrosa, which has peak gonad development in December (Ottaway, 1979), indicating that this is probably the period when sexual reproduction takes place.

- 104 -

Figure 4-4 Period of larval release compared with ΦST value for marine invertebrate species in New Zealand exhibiting a North/South disjunction in population connectivity south of Cook Strait. While no firm conclusions can be drawn with such a small sample size, there does appear to be a relationship between spawning period and population connectivity. Both species (S. pelliserpentis and C. ornata) that exhibit a strong genetic north/south structure spawn at the same time of year - in March, while the other species with moderate genetic structuring either spawn in spring or have multiple spawning events. A hypothesis of seasonal variability in barrier strength would explain the incongruence shown within the two limpet species that in all other respects appear to have identical larval properties. Modelling of larval dispersal at the Point Conception phylogeographic barrier has shown that an extended spawning season can eliminate gene flow barriers when currents vary seasonally (Hohenlohe, 2004). While the population structure of C. radians does indicate a barrier to gene flow, it is of a far milder nature than that observed in C. ornata with its strong structuring and restricted spawning season.

These results suggest that the hydrological factors that are responsible for the north/south barrier to dispersal vary in strength seasonally. This is a similar situation as that proposed at Mona Passage in the Caribbean (Baums et al., - 105 -

2006b). Here, both current direction and eddy formation appear to be seasonal. Through modelling, drift card data and recruitment, it was shown that seasonal spawning powerfully affects larval dispersal (Baums et al., 2006b). In that location, it appears that self recruitment changes dramatically throughout the year, and a significant dispersive barrier forms on a seasonal basis. Baums et al. (2006b) describe this as a ‘dynamic filter’ rather than a boundary, allowing dispersion only during limited periods of the year. To investigate this hypothesis further, additional studies of organisms across central New Zealand, with varying spawning periods would be necessary, along with investigations into the hydrological causes of this disjunction and their seasonal patterns.

The relationship shown in Figure 4.3 is only based on those species exhibiting a north/south disjunction at this location. Converse to theory, all species with directly developing juveniles (P. excavatum, A. squamata and A. tenebrosa) do not exhibit any genetic structuring around Greater Cook Strait. It has been suggested that directly developing species almost exclusively rely on drifting or rafting on macro-algae for eggs, juveniles or adults to achieve sporadic long- distance dispersal, and that it is expected that they are more sensitive to natural barriers, such as those imposed by marine currents, during dispersal (Baus et al., 2005). The data presented here suggests that this is not the situation in this case.

While each of these three species above does have directly developed brooded young, it would be incorrect to immediately link this with an inability to disperse. Each of these species exhibits an alternative method of dispersal which does not appear to be effected sufficiently by the factors causing the north-south division in other species to give rise to population genetic structuring.

A bimodal reproductive system exists in the waratah anemone - A. tenebrosa, with clonal brooded young used for local proliferation and sexually produced young for long distance dispersal and colonisation of heterogeneous habitats (Sherman, 2006). This has been shown to allow interbreeding between distantly located populations (Ayre, 1984b), although colonisation appears a rare event for sexually produced young (Ayre, 1984a). The duration and - 106 - characteristics of these pelagic dispersive larvae are unknown. The requirements of these pelagic larvae are very different to those of the other species studied. Larval retention and larval exchange rates must be in balance with each other to allow sufficient recruitment in each given population for it to survive. Due to diffusion and current direction, marine organisms will often show mechanisms for local larval retention which limit long distance larval exchange (Cowan et al., 2000). With the bimodal reproduction system, A. tenebrosa has separated local retention requirements from long distance dispersal requirements. Possibly this allows a longer larval duration, and/or other mechanisms such as a change in larval behaviour that make it ideal for long distance colonisation, and enable the crossing of potential barriers.

A potential alternative dispersal mechanism also exists within the brooding brittle star - A. squamata. This species has been found rafting on macroalgae – Macrocystispyrifera - which possibly facilitates considerable dispersal between populations. This dispersal mechanism of rafting on floating substrata has been suggested for a number of other supposedly non-dispersive groups (Worcester, 1994; Highsmith, 1985; Theil & Gutow, 2005) and rafting on macroalgae has been shown to bestow the highest motility of rafting organisms (Theil & Gutow, 2005). Sponer & Roy (2002) discovered several distinct lineages within A. squamata and postulated that these may represent cryptic species. They believe these distinct lineages arise from separate sporadic interoceanic colonization events of New Zealand – most likely via rafting on macroalgae.

The other species studied across this apparent disjunction is P. excavatum, which are small amphipods whose juveniles have been shown to be abundant in the water column, and are commonly flushed out of bays during tidal flows (Ford, Thrush & Probert, 1999; Stevens et al., 2002). This exchange of waterborne juveniles is the probable mechanism for population connectivity though their ability to survive for long periods within the water column is unknown.

- 107 -

The comparison of organisms affected or not affected by the dispersive barrier south of Cook Strait stuggests that a general barrier to the movement of most pelagic larvae is present on each coast. These dispersive barriers are located at Farewell Spit and in Clifford/Cloudy Bays and are based on hydrological factors that possibly have a seasonal pattern.

4.5 Phylogeographic Process

With the north/south phylogeographic boundary clearly defined in location; phylogeographic processes can be investigated. That populations of these organisms were panmictic during the last glaciation (when Cook Strait was closed) is highly probable, given the the estimates of divergence times calculated for northern and southern haplotypes of the greenlipped mussel and limpet species (Apte & Garnder, 2002; Goldstein et al., 2006). Since the opening of Cook Strait, a change in coastal geography and hydrology has led to a barrier to dispersal forming and this barrier almost certainly remains today. It is unlikely to be merely a matter of distance in that there are populations of some of these species (S. pelliserpentis) exhibiting a sharp genetic break over less than 40km here while many other populations are separated by larger distances of uninhabitable coast (such as Timaru and Christchurch), yet are comparatively well connected. Given this, hydrological features present in the Cloudy Bay/Clifford Bay area and Cape Farewell regions must be the foundation for the dispersive barrier separating northern and southern populations. These areas are the southern limits of Greater Cook Strait and contain a complex hydrography including strong tidal movement and mixing, turbulence, eddies and upwelling.

4.5.1 Western Greater Cook Strait – Cape Farewell

Among the possible hydrographic factors that may limit larval dispersal on the west coast, Apte & Gardner (2002) highlighted wind induced upwelling north of Kahurangi Point. The first published observations indicating upwelling of subsurface water in the Cape Farewell region were those of Garner (1954) - 108 - using surface temperature measurements from commercial ships. Further investigations were performed by Garner (1959) which showed a band of cold water upwelling to the north of Cape Farewell. The first detailed study of the hydrology of the area was conducted in 1969 by Stanton (1971). In this study upwelling was noted to occur along much of the coast however it intensified at certain points. The origin of the primary upwelling plume has been identified as inshore of Kahurangi Shoals; where deep water rises to the surface, before flowing northwards (Moore et al., 1990). Local wind conditions are the underlying cause of these upwelling events. Westerly or south-westerly winds lasting several days will establish a sea surface slope which travels downwards from about Steep Point to Cape Farewell. This accelerates the Westland Current locally and a small intensification of this slope over the shelving region south of Kahurangi Shoals then enables deep water to flow up and over the saddle inshore of the Shoals (Moore et al., 1990). This causes intense near- shore upwellings that form a distinct northward plume into the Taranaki Bite (Figure 4.5). It is important to note that this upwelling appears to occur very close to the shore in this location (Fig. 4.5), unlike many coastal upwellings reported.

Upwelling, whilst often observed, is not constant in this region and may not be present during periods of calm (Stanton, 1974). When the westerly wind declines, the coastal jet can still flow, but upwelling is possible only from shallower depths. The predominant wind direction on this stretch of coastline is south-westerly and occurs 33% of the time (as measured at Westport, Stanton, 1971) thus intense upwelling is a regular feature of the region. Bradford-Grieve et al., (1993) noted specifically that this upwelling is a persistent summer feature of this area possibly due to seasonal wind patterns. - 109 -

Figure 4-5 Contours of sea surface temperature (ºC) in the Kahurangi-Golden Bay area showing the cold upwelling observed north of Cape Farewell during south-westerly or westerly winds (Moore et al., 1990)

The effects of this upwelling plume on the movement and distribution and movement of plankton have been explored by Bradford-Grieve et al., (1993). In this study it was shown that as water near the source of the upwelling plume is advected from west to east into greater Cook Strait, inshore and coastal zooplankton decrease and oceanic species were introduced to the nearshore water. This movement of coastal plankton offshore is precisely the mechanism invoked by Apte & Gardner (2002) to explain the observed disjunction in P. canaliculus.

4.5.2 Eastern Cook Strait – Cloudy Bay & Clifford Bay

The primary current system active off the north-east of the South Island is a branch of the Southland Current (SC) which is forced north through the Mernoo Saddle (Lange et al., 2003). This cold SC stream flows up the north-eastern coast of the South Island then past Cape Campbell whence it appears to loop across Cook Strait, then flow south-eastwards (Barnes, 1985 see Figure 4.6). After performing this loop it enters one of a number of eddies located to the south east (Barnes, 1985; Vincent, 1991). The water of this region has a - 110 - complex three dimensional composition as it is also the meeting point of the ECC down the Wairarapa Coast, and the D’Urville Current through Cook Strait.

Figure 4-6 Map showing the variable trajectories of the principle hydrogeographic features of central New Zealand on the east coast from (Barnes, 1985) SC: Southland Current, SCP: Southland Current primary flow, SCS: Southland Current secondary flow, ECC: East Cape Current, Westland Current (WC), D’Urville Current (DC). This observed looping of the SC from Cook Strait south-east into eddies provides one potential isolating mechanism. Larvae can become trapped in eddies, as has been demonstrated in the East Cape Eddie, and Wairarapa Eddie (Chiswell & Roemmich, 1998; Chiswell & Booth, 1999). The interplay between the SC, ECC and DC is complex, and varies with wind velocity adding the potential seasonal variation suggested by the spawning period comparison.

One of the mechanisms suggested by Apte & Gardner (2002), and reiterated by Ayres and Waters (2005) as the potential basis for the observed population structuring in P. canaliculus and P. regularis, were upwelling events around Cape Campbell. Two areas of upwelling have been observed regularly in this region. Firstly, upwelling occurs just south of Cape Campbell induced by strong - 111 - north-easterly winds creating a plume of nitrate-rich water extending south-east well beyond the continental slope (Heath, 1972; Bradford et al., 1986). Moreover upwelling has been noted consistently on the eastern side of the Narrows in Cloudy and Clifford Bays (Heath 1971, 1972; Bowman et al., 1983; Barns, 1985; Bradford et al., 1986; Murdoch et al., 1987). This water upwells from depths of around 200m from within the Cook Strait Canyon (Bowman 1983; Murdoch et al., 1987). It is colder, has elevated nutrients and low chlorophyll (Bradford et al., 1986); and is therefore easily visible through satellite imagery. Upwelling in this region is recorded as a persistent feature within the satellite imagery analysed by Barnes (1985). Heath (1972) observed that while the surface flow at kaikoura was consistently northwards, it varied seasonally at Cape Campbell with wind derived upwelling likely to mainly occur in summer (December – March). During various wind conditions upwelling in the Cloudy Bay/Clifford Bay area has been recorded, therefore it is unlikely to be solely wind related (Bradford et al., 1986). While this upwelling in Cloudy & Clifford Bays is not wind driven, it can be intensified by it, forming a distinct south-easterly tongue (Figure 4.7), and the upwelling south of Cape Campbell is believed to be wind derived.

- 112 -

Figure 4-7 Contours of sea surface temperature (ºC) of the Cook Strait region showing the pluming of cold water south-east from Cloudy Bay in north-easterly winds modified from Bradford et al., (1986).

4.6 North/South Dispersive Boundary Summary

An investigation into the comparative phylogeographic structure of coastal marine taxa across central New Zealand indicates that general barriers to the dispersal of pelagic larvae exists on both coasts of the South Island, separating northern and southern populations. These barriers to dispersal are located along Farewell Spit on the west coast, and in Cloudy Bay on the east coast. These locations coincide with intense nearshore upwellings that have previously been suggested as a causative agent in the observed disjunction of marine invertebrate populations. A comparative phylogeographic analysis of the population structuring of all organisms so far studied across this barrier implicates time of spawning as important in predicting the strength of this disjunction within a species. The strength of this barrier may vary seasonally (having a stronger affect in late summer/autumn). This coincides with the variation in strength of the upwelling in this region.

- 113 -

4.7 Conclusions

This study has revealed considerable population structure around New Zealand’s coastline within two species with differing dispersal abilities and reproductive strategies. Through wide-ranging sampling regimes, designed specifically to permit tests of hypotheses presented by previous studies, both fine-scale and broad-scale patterns of population structure were evident. These two very different species each appears to be somewhat representative of different classes of connectivity pattern found within New Zealand coastal marine invertebrates. It appears that these different patterns may be driven by interactions between regional and local-scale hydrological factors on the one hand, and larval dispersal ability and timing on the other. This points the way for future studies investigating the processes driving connectivity among New Zealand marine communities. - 114 -

5 References

Apte S, Gardner JPA (2001) Absence of population genetic differentiation in the New Zealand greenshell mussel Perna canaliculus (Gmelin, 1791) as assessed by allozyme variation. Journal of Experimental Marine Biology and Ecology 258, 173-194. Apte S, Gardner JPA (2002) Population genetic subdivision in the New Zealand greenshell mussel (Perna canaliculus) inferred from single-strand conformation polymorphism analysis of mitochondrial DNA. Molecular Ecology 11, 1617-1628. Apte S, Star B, Gardner JPA (2003) A comparison of genetic diversity between cultured and wild populations, and a test for genetic introgression in the New Zealand greenshell mussel Perna canaliculus (Gmelin, 1791). Aquaculture 219, 193-220. Arndt A, Smith MJ (1998) Genetic diversity and population structure in two species of sea cucumber: differing patterns according to mode of development. Molecular Ecology 7, 1053-1064. Avise JC (1998) The history and purview of phylogeography: a personal reflection. Molecular Ecology 7, 371-379. Avise JC (2000) MPhylogeography: The History and Formation of Speices Harvard University Press, Cambridge Avise JC (2004) Molecular markers, natural history and evolution. Chapman and Hall, London. Avise JC, Arnold J, Ball RM, et al. (1987) Intraspecific Phylogeography - the Mitochondrial-DNA Bridge between Population-Genetics and Systematics. Annual Review of Ecology and Systematics 18, 489-522. Avise JC, Giblin-Davidson C, Laerm J, Patton JC, Lansman RA (1979) Mitochondrial DNA Clones and Matriarchal Phylogeny within and among Geographic Populations of the Pocket Gopher, Geomys pinetis. PNAS 76, 6694-6698. Ayers KL, Waters JM (2005) Marine biogeographic disjunction in central New - 115 -

Zealand. Marine Biology 147, 1045-1052. Ayre DJ (1983) The effects of asexual reproduction and inter-genotypic aggression on the genotypic structure of populations of the sea anemone Actinia tenebrosa. Oecologia 57, 158-165. Ayre DJ (1984a) Effects of environment and population density on the sea anemone Actinia tenebrosa. Australian Journal of Marine and Freshwater Research 35, 735-746. Ayre DJ (1984b) The effects of sexual and asexual reproduction on geographic variation in the sea anemone Actinia tenebrosa. Oecologia 62, 222-229. Ayre DJ (1985) Localized adaptation of clones of the sea anemone Actinia tenebrosa. Evolution 39, 1250-1260. Ayre DJ (1988) Evidence for genetic determination of sex in Actinia tenebrosa. Journal of Experimental Marine Biology & Ecology 116, 23-34. Ayre DJ (1995) Localized Adaptation of Sea Anemone Clones: Evidence from Transplantation Over Two Spatial Scales. Journal of Animal Ecology 64, 186-196. Ayre DJ, Hughes TP (2000) Genotypic diversity and gene flow in Brooding and Spawning corals along the Great Barrier Reef, Australia. Evolution 54, 1590-1605. Ayre DJ, Miller KJ (2004) Where do clonal coral larvae go? Adult genotypic diversity conflicts with reproductive effort in the brooding coral Pocillopora damicornis. Marine Ecology-Progress Series 277, 95-105. Ayre DJ, Read J, Wishart J (1991) Genetic subdivision within the eastern Australian population of the sea anemone Actinia tenebrosa. Marine Biology (Historical Archive) 109, 379-390. Baker AN, Smith ANH, Pichler FB (2002) Geographical variation in Hector's dolphin: recognition of new subspecies of Cephalorhynchus hectori. Journal of the Royal Society of New Zealand 32, 713-727. Baker CS, Perry A, Chambers GK, Smith PJ (1995) Population Variation in the Mitochondrial Cytochrome-B Gene of the Orange Roughy Hoplostethus- Atlanticus and the Hoki Macruronus-Novaezelandiae. Marine Biology 122, 503-509. Barber PH, Palumbi SR, Erdmann MV, Moosa MK (2002) Sharp genetic breaks among populations of Haptosquilla pulchella (Stomatopoda) indicate - 116 -

limits to larval transport: patterns, causes, and consequences. Molecular Ecology 11, 659-674. Barnes EJ (1985) Eastern Cook Strait region circulation inferred from satellite- derived, sea-surface, temperature data. New Zealand Journal of Marine and Freshwater Research 19, 405-411. Baums IB, Miller MW, Hellberg ME (2006) Geographic variation in clonal structure in a reef-building Caribbean coral, Acropora palmata. Ecological Monographs 76, 503-519. Baums IB, Paris CB, Cherubin LM (2006) A bio-oceanographic filter to larval dispersal in a reef-building coral. Limnology and Oceanography 51, 1969-1981. Baus E, Darrock DJ, Bruford MW (2005) Gene-flow patterns in Atlantic and Mediterranean populations of the Lusitanian sea star Asterina gibbosa. Molecular Ecology 14, 3373-3382. Bay LK, Crozier RH, Caley MJ (2006) The relationship between population genetic structure and pelagic larval duration in coral reef fishes on the Great Barrier Reef. Marine Biology 149, 1247-1256. Beagley CT, N. A. Okada, & D. R. Wolstenholme (1996) Two mitochondrial group I introns in a metazoan, the sea anemone Metridium senile: One intron contains genes for subunits 1Ýand 3Ýof NADH dehydrogenase. PNAS 93, 5619-5623. Beagley CT, Okimoto R, Wolstenholme DR (1998) The Mitochondrial Genome of the Sea Anemone Metridium senile (Cnidaria): Introns, a Paucity of tRNA Genes, and a Near-Standard Genetic Code. Genetics 148, 1091- 1108. Bell G (1982) The Masterpiece of Nature: The Evolution and Genetics of Sexuality Croom Helm, London. Benzie JAH (1999) Genetic structure of coral reef organisms: Ghosts of dispersal past. American Zoologist 39, 131-145. Benzie JAH, Williams ST (1997) Genetic structure of giant clam (Tridacna maxima) populations in the west Pacific is not consistent with dispersal by present-day ocean currents. Evolution 51, 768-783. Bermingham, Moritz (1998) Comparative phylogeography: concepts and applications. Molecular Ecology 7, 367-369. - 117 -

Bernal-Reynolds JH, Adcock GJ, Hauser L, Carvalho GR, Smith PJ (2003) Temporal stability of genetic population structure in the New Zealand snapper, Pagrus auratus, and relationship to coastal currents. Marine Biology 142, 567–574. Bernardi G (2000) Barriers to gene flow in Embiotoca jacksoni, a marine fish lacking a pelagic larval stage. Evolution 54, 226-237. Billingham M, Ayre DJ (1996) Genetic subdivision in the subtidal, clonal sea anemone Anthothoe albocincta. Marine Biology (Historical Archive) 125, 153-163. Birky CW (1995) Uniparental Inheritance of Mitochondrial and Chloroplast Genes - Mechanisms and Evolution. Proceedings of the National Academy of Sciences of the United States of America 92, 11331-11338. Birt TP, Baker AJ (2000) Polymerase chain reaction. In: Molecular Methods in Ecology (ed. Baker AJ), pp. 50-64. Blackwell Science Ltd, Oxford. Black R, Johnson MS (1979) Asexual viviparity and population genetics of Actinia tenebrosa. Marine Biology 53, 27-31. Bohonak AJ (1999) Dispersal, gene flow, and population structure. Quarterly Review of Biology 74, 21-45. Booth JD, Ovenden JR (2000) Distribution of Jasus spp. (Decapoda : Palinuridae) phyllosomas in southern waters: implications for larval recruitment. Marine Ecology-Progress Series 200, 241-255. Bossart JL, Pashley Prowell D (1998) Genetic estimates of population structure and gene flow: Limitations, lessons and new directions. Trends in Ecology & Evolution 13, 202-206. Botsford LW, Micheli F, Hastings A (2003) Principles for the design of marine reserves. Ecological Applications 13, S25-S31. Bowen BW, Bass AL, Muss A, Carlin J, Robertson DR (2006) Phylogeography of two Atlantic squirrelfishes (Family Holocentridae): exploring links between pelagic larval duration and population connectivity. Marine Biology V149, 899-913. Bowman MJ, Kibblewhite AC, Murtagh RA, Chiswell SM, Sanderson BG (1983) Circulation and Mixing in Greater Cook Strait, New-Zealand. Oceanologica Acta 6, 383-391. Boyle PR (1970) Aspects of the ecology of a littoral chiton, Sypharochiton - 118 -

pelliserpentis (Mollusca: Polyplacophora. N.Z. Journal of Marine and Freshwater Research 4, 364-384. Boyle PR (1976) The aethetes of chitons. Cell Tissue Research 172, 379-388. Bradford JM, Lapennas PP, Murtagh RA, Chang FH, Wilkinson V (1986) Factors controlling summer phytoplankton production in greater Cook Strait, New Zealand. New Zealand Journal of Marine and Freshwater Research 20, 253-279. Bradford-Grieve JM, Murdoch RC, Chapman BE (1993) Composition of macrozooplankton assemblages associated with the formation and decay of pulses within an upwelling plume in greater Cook Strait, New Zealand. New Zealand Journal of Marine and Freshwater Research 27, 1-22. Breton S, Dufresne F, Desrosiers G, Blier PU (2003) Population structure of two northern hemisphere polychaetes, Neanthes virens and Hediste diversicolor (Nereididae), with different life-history traits. Marine Biology 142, 707-715. Briggs JC (1961) East Pacific Barrier and Distribution of Marine Shore Fishes. Evolution 15, 545-&. Brodie JW (1960) Coastal surface currents around New Zealand. New Zealand Journal of Geology and Geophysics 3, 235-252. Brown WM, George M, Wilson AC (1979) Rapid Evolution of Animal Mitochondrial-DNA. Proceedings of the National Academy of Sciences of the United States of America 76, 1967-1971. Brownstein MJ, Carpten JD, Smith JR (1996) Modulation of non-templated nucleotide addition by tag DNA polymerase: Primer modifications that facilitate genotyping. Biotechniques 20, 1004-&. Bullock RC (1988) The systematics of the southern hemisphere chiton genera Radsia (Gray, 1847), and Sypharochiton (Thiele, 1893) (Mollusca: Polyplacophora: Chitonidae). Proceedings of the Biological Society of Washington 101, 280-299. Burridge CP (2000) Biogeographic history of geminate cirrhitoids (Perciformes : Cirrhitoidea) with east-west allopatric distributions across southern Australia, based on molecular data. Global Ecology and Biogeography 9, 517-525. - 119 -

Burridge CP, Smolenski AJ (2003) Lack of genetic divergence found with microsatellite DNA markers in the tarakihi Nemadactylus macropterus. New Zealand Journal of Marine and Freshwater Research 37, 223-230. Burton RS (1998) Intraspecific phylogeography across the Point Conception biogeographic boundary. Evolution 52, 734-745. Byrne M, Barker MF (1991) Embryogenesis and larval development of the asteroid Patiriella regularis viewed by light and scanning microscopy. Biological Bulletin 180, 332–345. Cain AJ (1974) Breeding system of a sessile animal. Nature 247, 289-290. Carr MH, Neigel JE, Estes JA, et al. (2003) Comparing marine and terrestrial ecosystems: Implications for the design of coastal marine reserves. Ecological Applications 13, S90-S107. Carter MA, Thorp CH (1979) Reproduction of Actinia-Equina var Mesembry- Anthemum. Journal of the Marine Biological Association of the United Kingdom 59, 989-&. Cassens I, Tiedeman R, Suchentrunk F, Hartle G (2000) Brief communication. Mitochondrial DNA variation in the European otter (Lutra lutra) and the use of spatial autocorrelation analysis in conservation. J Hered 91, 31- 35. Chenoweth SF, Hughes JM, Keenan CP, Lavery S (1998) When oceans meet: a teleost shows secondary intergradation at an Indian-Pacific interface. Proceedings of the Royal Society of London Series B-Biological Sciences 265, 415-420. Chia FS, Rostron MA (1970) Some aspects of reproductive biology of Actinia equina. (Cnidaria : Anthozoa). Journal of the Marine Biological Association of the United Kingdom 50. Chiswell SM, Roemmich, D., (1998) The East Cape Current and two eddies: a mechanism for larval retention? N.Z. Journal of Marine and Freshwater Research 32, 385-397. Chiswell SM, Booth, J. D., (1999) Rock lobster Jasus edwardsii larval retention by the Wairarapa Eddy off New Zealand. Marine Ecology-Progress Series 183, 227-240. Chiswell SM (2003) Circulation within the Wairarapa Eddy, New Zealand. New

Zealand Journal of Marine and Freshwater Research 37, 691–704. - 120 -

Chiswell SM (2005) Mean and variability in the Wairarapa and Hikurangi Eddies, New Zealand. New Zealand Journal of Marine and Freshwater Research 39, 121–134. Chiswell SM, Bowman MJ (1985) Correlation between shelf sediments near Cape Farewell and a numerical simulation of the Westland Current. New Zealand Journal of Marine and Freshwater Research 19, 553-562. Chiswell SM, Rickard GJ (2006) Comparison of model and observational ocean circulation climatologies for the New Zealand region. Journal of Geophysical Research-Oceans 111. Chiswell SM, Schiel DR (2001) Influence of along-shore advection and upwelling on coastal temperature at Kaikoura Peninsula, New Zealand. New Zealand Journal of Marine and Freshwater Research 35, 307-317. Coffroth MA, Lasker HR (1998) Population structure of a clonal gorgonian coral: The interplay between clonal reproduction and disturbance. Evolution 52, 379-393. Collin R (2001) The effects of mode of development on phylogeography and population structure of North Atlantic Crepidula (Gastropoda: Calyptraeidae). Molecular Ecology 10, 2249-2262. Connolly SR, Menge BA, Roughgarden J (2001) A latitudinal gradient in recruitment of intertidal invertebrates in the northeast Pacific Ocean. Ecology 82, 1799-1813. Cowen RK, Lwiza KMnM, Sponaugle S, Paris CB, Olson DB (2000) Connectivity of Marine Populations: Open or Closed? Science 287, 857- 859. Cowen RK, Paris CB, Srinivasan A (2006) Scaling of Connectivity in Marine Populations. Science 311, 522-527. Creese RG (1986) Brooding Behavior and Larval Development in the New- Zealand Chiton, Onithochiton-Neglectus Derochebrune (Mollusca, Polyplacophora). New Zealand Journal of Zoology 13, 83-91. Creese RG, Ballantine WJ (1983) An assessment of breeding in the intertidal limpet, Cellana radians (Gmelin). Journal of Experimental Marine Biology & Ecology 67, 43-59. Dawson MN (2001) Phylogeography in coastal marine animals: a solution from California? Journal of Biogeography 28, 723-736. - 121 -

Degen B (2003) Spatial Genetic Software (SGS) Computer software distributed by author. Dell RK (1968) Composition and distribution of New Zealand Brachyuran Fauna. Transactions of the Royal Society of New Zealand 10, 225-240. Dell WH (1951) Key to the common chitons of New Zealand. Tuatara 4, 4-12. DeWolf H, Verhagen R, Backeljau T (2000) Large scale population structure and gene flow in the planktonic developing periwinkle, Littorina striata, in Macronesia (Mollusca: Gastropoda). Journal of Experimental Marine Biology and Ecology 246, 69–83. Douek J, Barki Y, Gateno D, Rinkevich B (2002) Possible cryptic speciationwithin the sea anemone Actinia equina complex detected byAFLP markers. Zoological Journal of the Linnean Society 136, 315- 320. Dunmore RA, Schiel DR (2000) Reproduction in the intertidal limpet Cellana ornata in southern New Zealand. New Zealand Journal of Marine and Freshwater Research 34, 653-660. Dupanloup I, Schneider S, Excoffier L (2002) A simulated annealing approach to define the genetic structure of populations. Molecular Ecology 11, 2571-2581. Edmands S, Potts DC (1997) Population genetic structure in brooding sea anemones (Epiactis spp.) with contrasting reproductive modes. Marine Biology 127, 485-498. Eernisse DJ (1988) Reproductive Patterns in Six Species of Lepidochitona (Mollusca: Polyplacophora) from the Pacific Coast of North America. Biol Bull 174, 287-302. Escorza-Trevino S, Dizon AE (2000) Phylogeography, intraspecific structure and sex-biased dispersal of Dall's porpoise, Phocoenoides dalli, revealed by mitochondrial and microsatellite DNA analyses. Molecular Ecology 9, 1049-1060. Excoffier L, Smouse, P. E., Quattro, J. M., (1992) Analysis of Molecular Variance inferred from metric distances among DNA haplotypes: application to human mitochondria1 DNA restriction data. Genetics 131, 479-491. Ferguson A, Taggart JB, Prodohl PA, et al. (1995) The application of molecular - 122 -

markers to the study and conservation of fish populations, with special reference to Salmo. Journal of Fish Biology 47, 103-126. Fishback AG, Danzmann RG, Sakamoto T, Ferguson MM (1999) Optimization of semi-automated microsatellite multiplex polymerase chain reaction systems for rainbow trout (Oncorhynchus mykiss). Aquaculture 172, 247- 254. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biololgy & Biotechnology 3, 294-299. Ford RB, Thrush SF, Probert PK (1999) Macrobenthic colonisation of disturbances on an intertidal sandflat: the influence of season and buried algae. Marine Ecology Progress Series 120, 163–174. Francis MP (1996) Geographic Distribution of marine reef fishes in the New Zealand region. N.Z. Journal of Marine and Freshwater Research 30, 35- 55. Frankham R (1995) Conservation genetics. Annual Review of Genetics 29, 305-327. Freeth AL, Sin FYT (1986) Enzyme variation in marine and esturine populations of the chiton Sypharochiton pelliserpentis. New Zealand Journal of Marine and Freshwater Research 20, 561-568. Fu Y-X (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 17, 915-925. Gardner JPA, Pande A, Eyles RF, Wear RG (1996) Biochemical genetic variation among populations of the greenshell musesel Perna canaliculus, from New Zealand: preliminary findings. Biochem. Syst. Ecol. 24, 763-774. Garner DM (1954) Sea surface temperature in the South West Pacific Ocean from 1949 to 1952. New Zealand journal of science and technology series B 36, 285-230. Garner DM (1959) The Subtropical Convergence in New Zealand surface waters. New Zealand Journal of Geology and Geophysics 2, 315-337. Garner DM (1961) Hydrology of New Zealand coastal waters, 1955. N.Z. Department of Scientific and Industrial Research Bulletin, 138. - 123 -

Garner DM (1970) Hydrological studies in the New Zealand region 1966 and 1967. Oceanic hydrology north-west of New Zealand. Hydrology of the north-east Tasman Sea. N.Z. Department of Scientific and Industrial Research Bulletin 202, 49. Gauldie RW, Jones JB (2000) Stocks, or geographically separated populations of the New Zealand orange roughy, Hoplostethus atlanticus, in relation to parasite infestation, growth rate, and otolith shape. Bulletin of Marine Science 67, 949-971. Gleeson DM, Howitt RLJ, Ling N (1999) Genetic variation, population structure and cryptic species within the black mudfish, Neochanna diversus, an endemic galaxiid from New Zealand. Molecular Ecology 8, 47-57. Goddard MR, Leigh J, Roger AJ, Pemberton AJ (2006) Invasion and Persistence of a Selfish Gene in the Cnidaria. PloS One 1, e3. Goffredo S, Mezzomonaco L, Zaccanti F (2004) Genetic differentiation among populations of the Mediterranean hermaphroditic brooding coral Balanophyllia europaea (Scleractinia : Dendrophylliidae). Marine Biology 145, 1075-1083. Goldson AJ, Hughes RN, Gliddon CJ (2001) Population genetic consequences of larval dispersal mode and hydrography: a case study with bryozoans. Marine Biology 138, 1037-1042. Goldstien SJ (2005) Phylogeography of the Cellana limpets of New Zealand: Investigating Barriers to Marine Dispersal and Historical Biogeography PhD, University of Canterbury. Goldstien SJ, Schiel DR, Gemmell NJ (2006) Comparative phylogeography of coastal limpets across a marine disjunction in New Zealand. Molecular Ecology 15, 3259-3268. Gopurenko D, Hughes JM (2002) Regional patterns of genetic structure among Australian populations of the mud crab, Scylla serrata (Crustacea : Decapoda): evidence from mitochondrial DNA. Marine and Freshwater Research 53, 849-857. Greve M, Gremmen NJM, Gaston KJ, Chown SL (2005) Nestedness of Southern Ocean island biotas: ecological perspectives on a biogeographical conundrum. Journal of Biogeography 32, 155-168. Grosberg RK (1987) Limited dispersal and proximity dependent mating success - 124 -

in the colonial ascidian Botryllus schlosseri. Evolution 41, 372-384. Haag CR, Ebert D (2004) A new hypothesis to explain geographic parthenogenesis. Annales Zoologici Fennici 41, 539-544. Heads M (2005) Towards a panbiogeography of the seas. Biological Journal of the Linnean Society 84, 675-723. Heath RA (1973) Meteorological effects on the surface circulation and hydrology of Tasman Bay, New Zealand. N.Z. Journal of Marine and Freshwater Research 7, 111-123. Heath RA (1985) A review of the physical oceanography of the seas around New Zealand. New Zealand Journal of Marine and Freshwater Research 19, 79-124. Hedgecock D (1986) Is Gene Flow from Pelagic Larval Dispersal Important in the Adaptation and Evolution of Marine-Invertebrates. Bulletin of Marine Science 39, 550-564. Hellberg ME (1996) Dependence of gene flow on geographic distance in two solitary corals with different larval dispersal capabilities. Evolution 50, 1167-1175. Hellberg ME (2006) No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation. Bmc Evolutionary Biology 6. Hellberg ME, Burton RS, Neigel JE, Palumbi SR (2002) Genetic assessment of connectivity among marine populations. Bulletin of Marine Science 70, 273-290. Herborg L-M, Weetman D, Van Oosterhout C, Hanfling B (2007) Genetic population structure and contemporary dispersal patterns of a recent European invader, the Chinese mitten crab, Eriocheir sinensis. Molecular Ecology 16, 231-242. Hesp PA, Shepherd MJ, Parnell K (1999) Coastal geomorphology in New Zealand, 1989-99. Progress in Physical Geography 23, 501-524. Highsmith RC (1985) Floating and Algal Rafting as Potential Dispersal Mechanisms in Brooding Invertebrates. Marine Ecology-Progress Series 25, 169-179. Hoelzel AR, Green A (1992) Analysis of population level variation by sequencing PCR-amplied DNA. In: Molecular genetic analysis of populations: a practical approach. (ed. AR H), pp. 159-187. Oxford - 125 -

Universtiy Press, Oxford. Hoffmann RJ (1986) Variation in contributions of asexual reproduction to the genetic structure of populations of the sea anemone Metridium senile. Evolution 40, 357-365. Hohenlohe P (2004) Limits to gene flow in marine animals with planktonic larvae: models of Littorina species around Point Conception, California. Biological Journal of the Linnean Society 82, 169-187. Horn PL (1986) Adaptations of the chiton Sypharochiton pelliserpentis to rocky and estuarine habitats. N.Z. Journal of Marine and Freshwater Research 16, 253-261. Hughes RN (1989) A functional biology of clonal animals Chapman and Hall, New York. Iredale T, Hull AFB (1927) A monograph on the Australian Loricates Part 7. Australian Journal of Zoology 4, 256 - 276. Iredale T, Hull AFB (1932) The Loricates of the Neozealandic Region. Australian Journal of Zoology 7, 119-164. Jackson JBC, Coates (1986) Modes of dispersal of clonal benthic invertebrates: consequences for species distributions and genetic structure of local populations. Bulletin of Marine Science 39, 588-606. Jeffrey B, Hale P, Degnan BM, Degnan SM (2007) Pleistocene isolation and recent gene flow in Haliotis asinina, an Indo-Pacific vetigastropod with limited dispersal capacity. Molecular Ecology 16, 289-304. Jeffs AG, Chiswell SM, Booth JD (2001) Distribution and condition of pueruli of the spiny lobster Jasus edwardsii offshore from north-east New Zealand. Marine and Freshwater Research 52, 1211-1216. Johns PM (1960) Chiton pelliserpentis (Mollusca, Amphineura). A study in the taxonomy of a species in relation to its breeding biology and ecology. MSc, University of Canterbury. Johnson MS, Black R (2005) Effects of a larval stage on isolation of populations of the trochid Austrocochlea constricta in tidal ponds. Marine Biology 147, 189-195. Kelly DW, MacIsaac HJ, Heath DD (2006) Vicariance and dispersal effects on phylogeographic structure and speciation in a wisepread esturine invertebrate. Evolution, 257-267. - 126 -

Keogh JA, Mladenov PV (1994) Aspects of the fisheries biology of the kina, Evichinus chloroticus. Unpublished Report to MAF Fisheries. Kinlan BP, Gaines SD, Lester SE (2005) Propagule dispersal and the scales of marine community process. Diversity & Distributions 11, 139-148. Kittiwattanawong K (1997) Genetic structure of giant clam, Tridacna maxima, in the Andaman Sea, Thailand. In: Proceedings of the seventh workshop of the Tropical Marine Mollusc Programme TMMP on Central and West Java, Indonesia. (ed. Hylleberg J). Phuket Marine Biological Center, Phuket, Thailand. Knowlton N, Jackson JBC (1993) Inbreeding and Outbreeding in Marine Invertebrates University of Chicago Press, Chicago, IL. Knox GA (1953) The intertidal ecology of Taylor's Mistake. Transactions of the Royal Society of New Zealand 81, 189 - 220. Knox GA (1975) The marine benthic ecology and biogeography. In: Biogeography and ecology in New Zealand (ed. Kuschel G), pp. 353- 403. Dr W. Junk b.v. Publishers the Hague, Auckland. Krug PJ, Zimmer RK (2004) Developmental dimorphism: Consequences for larval behavior and dispersal potential in a marine gastropod. Biological Bulletin 207, 233-246. Kyle CJ, Boulding EG (2000) Comparative population genetic structure of marine gastropods (Littorina spp.) with and without pelagic larval dispersal. Marine Biology 137, 835-845. Lange Wd, Bell R, Gorman R, Reid S (2003) Physical oceanography of New Zeland waters. In: The New Zealand coast - Te Tai o Aotearoa (eds. Goff JR, Nichol SL, Rouse HL). Dunmore Press, Palmerston North. Lavery S, Moritz, C., Fielder, D. R., (1996) Indo-Pacific population structure and evolutionary history of the coconut crab Birgus latro. Molecular Ecology 5, 557-570. Lavery S, Moritz C, Fielder DR (1995) Changing Patterns of Population- Structure and Gene Flow at Different Spatial Scales in Birgus-Latro (the Coconut Crab). Heredity 74, 531-541. Lavery S, Moritz C, Fielder DR (1996) Indo-Pacific population structure and evolutionary history of the coconut crab Birgus latro. Molecular Ecology 5, 557-570. - 127 -

Lessios HA, Kessing BD, Pearse JS (2001) Population structure and speciation in tropical seas: Global phylogeography of the sea urchin Diadema. Evolution 55, 955-975. Levin LA (2006) Recent progress in understanding larval dispersal: new directions and digressions. Integr. Comp. Biol. 46, 282-297. Lourie SA, Vincent ACJ (2004) Using Biogeography to Help Set Priorities in Marine Conservation. Conservation Biology 18, 1004-1020. Lubbock R, Allbut C (1981) The sea anemone Actinia equina tolerates allogeneic juveniles but alters their phenotype. Nature 293, 474-475. Marko PB (2004) 'What's larvae got to do with it?' Disparate patterns of post- glacial population structure in two benthic marine gastropods with identical dispersal potential. Molecular Ecology 13, 597-611. Maynard-Smith J (1998) Evolutionary Genetics Oxford University Press, Oxford. McCulloch A, Shanks AL (2003) Topographically generated fronts, very nearshore oceanography and the distribution and settlement of mussel larvae and barnacle cyprids. J. Plankton Res. 25, 1427-1439. McGovern T (2003) Plastic reproductive strategies in a clonal marine invertebrate. Proceedings of the Royal Society B: Biological Sciences 270, 2517-2522. McPherson MJ, Møller SG (2000) PCR BIOS Scientific Publishers Ltd., Oxford. Medina M, Weil E, Szmant AM (1999) Examination of the Montastraea annularis species complex (Cnidaria : Scleractinia) using ITS and COI sequences. Marine Biotechnology 1, 89-97. Menge BA, Daley BA, Lubchenco J, et al. (1999) Top-Down and Bottom-Up Regulation of New Zealand Rocky Intertidal Communities. Ecological Monographs 69, 297-330. Menge BA, Lubchenco J, Bracken MES, et al. (2003) Coastal oceanography sets the pace of rocky intertidal community dynamics. Proceedings of the National Academy of Sciences of the United States of America 100, 12229-12234. Mileikovsky SA (1971) Types of larval development in marine bottom invertebrates, their distribution and ecological significance: a re- evaluation. Marine Biology (Historical Archive) 10, 193-213. - 128 -

Miller BA, Emlet RB (1997) Influence of nearshore hydrodynamics on larval abundance and settlement of sea urchins Strongylocentrotus franciscanus and S. purpuratus in the Oregon upwelling zone. Marine Ecology-Progress Series 148, 83-94. Miller KJ (1997a) Genetic structure of black coral populations in New Zealand's fiords. Marine Ecology-Progress Series 161, 123-132. Miller KJ, Mundy C (2003) Rapid settlement in broadcast spawning corals: implications for larval dispersal. Coral Reefs 22, 99-106. Miller KJ, Mundy CN, Chadderton WL (2004) Ecological and genetic evidence of the vulnerability of shallow-water populations of the stylasterid hydrocoral Errina novaezelandiae in New Zealand's fiords. Aquatic Conservation: Marine and Freshwater Ecosystems 14, 75 - 94. Miller MP (1997b) Tools for population genetic analysis (TFPGA) 1.3: A Windows program for the analysis of allozyme and molecular population genetic data. Computer software distributed by author. Milligan CJ (1973) The Ecology of Intertidal Sea Anemones Master of Science, University of Auckland. Mladenov PV, Allibone RM, Wallis GP (1997) Genetic differentiation in the New Zealand sea urchin Evechinus chloroticus (Echinodermata: Echinoidea). New Zealand Journal of Marine and Freshwater Research 31, 261-269. Monteiro FA, Russo CAM, Solé-Cava AM (1998) Genetic eveidence for the asexual origin of small individuals found in the coelenteron of the sea anemone Actinia bermudensis Mcmurrich. Bulletin of Marine Science 63, 257-264. Moore LB (1961) Distributional patterns of New Zealand seaweeds. Tuatara 9, 18-23. Moore MI, Shirtcliffe TGL, Cole AG, et al. (1990) Dynamics of the Cape Farewell upwelling plume, New Zealand. New Zealand Journal of Marine and Freshwater Research 24, 555-568. Mora C, Sale PF (2002) Are populations of coral reef fish open or closed? Trends in Ecology & Evolution 17, 422-428. Moritz C, Dowling TE, Brown WM (1987) Evolution of Animal Mitochondrial- DNA - Relevance for Population Biology and Systematics. Annual Review of Ecology and Systematics 18, 269-292. - 129 -

Murdoch RC, Quanguo R, McCrone A (1990) Distribution of hoki (Macruronus novaezelandiae) eggs and larvae in relation to hydrography in eastern Cook Strait, September 1987. New Zealand Journal of Marine and Freshwater Research 24, 529-539. Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583-590. Neilson ME, Wilson RR (2005) mtDNA singletons as evidence of a post- invasion genetic bottleneck in yellowfin goby Acanthogobius flavimanus from San Francisco Bay, California. Marine Ecology-Progress Series 296, 197-208. Nelson WA (1994) Distribution of macroalga in New Zealand - an archipelago in space and time. Bot Mar 37, 221-223. Nicole M (1987) Some Aspects of the Ecology of Two Sea Anemones Anthopleura aureoradiata (Stuckey) and Isactinia olivacea (Hutton) MSc, University of Auckland. Nishikawa A, Sakai K (2003) Genetic Variation and Gene Flow of Broadcast Spawning and Planula Brooding Coral, Goniastrea aspera (Scleractinia) in the Ryukyu Archipelago, Southern Japan. Zoological Science 20, 1032-1038. Orr J, Thorpe JP, Carter MA (1982) Biochemical genetic confirmation of the asexual reproduction of brooded offspring in the sea anemone Actinia equina. Marine Ecology-Progress Series 7, 227-229. Ottaway JR (1975) Review of Actinia, Isactinia and Cnidopus (Cnidaria: Anthozoa) in New Zealand. N.Z. Journal of Marine and Freshwater Research 9, 53-61. Ottaway JR (1978) Population ecology of the intertidal anemone Actinia tenebrosa .I. Pedal locomotion and intraspecific aggression. Australian Journal of Marine and Freshwater Research 29, 787-802. Ottaway JR (1979) Population Ecology of the Inter-Tidal Anemone Actinia- Tenebrosa .2. Geographical-Distribution, Synonymy, Reproductive-Cycle and Fecundity. Australian Journal of Zoology 27, 273-290. Ovenden JR, Brasher DJ, White RWG (1992) Mitochondrial DNA analyses of the red rock lobsterJasus edwardsii supports an apparent absence of population subdivision throughout Australasia. Marine Biology V112, - 130 -

319-326. Palsson S (2004) Isolation by distance, based on microsatellite data, tested with spatial autocorrelation (spaida) and assignment test (spassign). Molecular Ecology Notes 4, 143-145. Palumbi SR (1997) Molecular biogeography of the Pacific. Coral Reefs 16, S47- S52. Palumbi SR (2003) Population genetics, demographic connectivity, and the design of marine reserves. Ecological Applications 13, S146-S158. Pawson DL (1961) Distribution patterns of New Zealand echinoderms. Tuatara 9, 9-23. Pawson DL (1965) The distribution of Echinoderms along the east coast of the North Island of New Zealand. Transactions of the Royal Society of New Zealand 24, 245-252. Peakall, R. and Smouse, P.E. (2005) GenAlEx V6: Genetic analysis in Excel. Populations genetic software for teaching and research. Australian National University, Canberra, Australia. Pearse JS (1979) Polyplocophora. In: Reproduction of Marine Invertebrates, Vol 5, Molluscs: Pelecypods and lesser classes. (ed. Pearse JS, Giese, A.C.), pp. 27-85. Academic Press, London. Perrin C (2002) Mechanisms of evolution in the sea urchin Evechinus chlorolicus and the sea star Coscinasterias muricata: the effect of fiord hydrography and environment on two marine invertebrates with high dispersal potential found in New Zealand PhD, University of Otago. Pichler FB, Dawson SM, Slooten E, Baker CS (1998) Geographic isolation of Hector's dolphin populations described by mitochondrial DNA sequences. Conservation Biology 12, 676-682. Pike RB (1970) Report on mussel farming and mussel biology for the Fishing Industry Board. FIB. FIB Technical Report no. 71.1. Fishing Industrial Board, Wellington, New Zealand. Pont-Kingdom G, Okada NA, Macfarlane JL, et al. (1997) Mitochondrial DNA of the coral Sarcophyton glaucum contains a gene for a homologue of bacterial MutS: a possible case of gene transfer from the nucleus to the mitochondria. Journal of Molecular Evolution 46, 419-431. Powell AWB (1961) New Zealand biotic provinces. Tuatara 9, 1 - 8. - 131 -

Powell AWB (1979) New Zealand Mollusca. Marine, Land and Freshwater shells William Collins Publishers Ltd, Auckland. Primmer CR, Ellegren H, Saino N, Moller AP (1996) Directional evolution in germline microsatellite mutations. 13, 391-393. Quinn TP, Kinnison MT, Unwin MJ (2001) Evolution of chinook salmon (Oncorhynchus tshawytscha) populations in New Zealand: pattern, rate, and process. Genetica 112, 493-513. Reynolds-Fleming JV, Fleming JG (2005) Coastal circulation within the Banks Peninsula region, New Zealand. New Zealand Journal of Marine and Freshwater Research 39, 217–225. Richards VP, Thomas JD, Stanhope MJ, Shivji MS (2007) Genetic connectivity in the Florida reef system: comparative phylogeography of commensal invertebrates with contrasting reproductive strategies. Molecular Ecology 16, 139-157. Richmond RH (1987) Energetics, competence, and long-distance dispersal of planula larvae of the coral Pocillopora damicornis. Marine Biology 93, 527-533. Rickard GJ, Hadfield MG, Roberts MJ (2005) Development of a regional ocean model for New Zealand. New Zealand Journal of Marine and Freshwater Research 39, 1171–1191. Ridgway NM (1977) Currents and hydology in Tasman and Golden Bays, South Island, New Zealand. N.Z. Journal of Marine and Freshwater Research 11, 95-109. Ridgway NM (1980) Hydrological conditions and circulation off the west coast of the North Island, New Zealand. New Zealand Journal of Marine & Freshwater Research 14, 155-167. Riginos C, Nachman MW (2001) Population subdivision in marine environments: the contributions of biogeography, geographical distance and discontinuous habitat to genetic differentiation in a blennioid fish, Axoclinus nigricaudus. Molecular Ecology 10, 1439-1453. Roberts CM (1997) Connectivity and Management of Caribbean Coral Reefs. Science 278, 1454-1457. Roberts PE, Paul LJ (1978) Seasonal hydrological changes in continental shelf waters off the west coast, North Island, New Zealand, and comments on - 132 -

fish distributions. New Zealand Journal of Marine & Freshwater Research 12, 323-339. Rocha-Olivares A, Vetter RD (1999) Effects of oceanographic circulation on the gene flow, genetic structure, and phylogeography of the rosethorn rockfish (Sebastes helvomaculatus). Canadian Journal of Fisheries and Aquatic Sciences 56, 803-813. Roemmich D, Sutton P (1998) The mean and variability of ocean circulation past northern New Zealand: Determining the representativeness of hydrographic climatologies. Journal of Geophysical Research-Oceans 103, 13041-13054. Rose CG, Paynter KT, Hare MP (2006) Isolation by Distance in the Eastern Oyster, Crassostrea virginica, in Chesapeake Bay. Journal of Heredity 97, 158-170. Rousset, F. (1997) Genetic differentiation and estimation of gene flow from F- statistics under isolation by distance. Genetics 145, 1219-1228. Russo CAM, Sole-Cava AM, Thorpe JP (1994) Population structure and genetic variation in two tropical sea anemones (Cnidaria, Actinidae) with different reproductive strategies. Marine Biology 119, 267-276. Schama R, Sole-Cava AM, Thorpe JP (2005) Genetic divergence between east and west Atlantic populations of Actinia spp. sea anemones (Cnidaria: Actiniidae). Marine Biology 146, 435-443. Schiel DR (2004) The structure and replenishment of rocky shore intertidal communities and biogeographic comparisons. Journal of Experimental Marine Biology and Ecology 300, 309-342. Schlichting CD (1986) The Evolution of Phenotypic Plasticity in Plants. Annual Review of Ecology and Systematics 17, 667-693. Schneider S, Roessli, D., Excoffier, L., (2005) Arlequin ver. 3.1: A software for population genetics data analysis. Schug MD, Mackay TFC, Aquadro CF (1997) Low mutation rates of microsatellite loci in Drosophila melanogaster. Nature Genetics 15, 99- 102. Shanks AL, Grantham BA, Carr MH (2003) Propagule dispersal distance and the size and spacing of marine reserves. Ecological Applications 13, S159-S169. - 133 -

Sharples J, Greig MJN (1998) Tidal currents, mean flows, and upwelling on the north-east shelf of New Zealand. New Zealand Journal of Marine and Freshwater Research 32, 215-231. Shaw AGP, Vennell R (2000) Variability of water masses through the Mernoo Saddle, South Island, New Zealand. New Zealand Journal of Marine and Freshwater Research 34, 103-116. Shearer TL, C. Gutierrez-Rodriguez, and M. A. , Coffroth (2005) Generating molecular markers from zooxanthellate cnidarians. Coral Reefs 24, 57- 66. Shearer TL, van Oppen MJH, Romano SL, Worheide G (2002) Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular Ecology 11, 2475-2487. Shepherd M, Hesp P (2003) Sandy barriers and coastal dunes. In: The New Zealand Coast - Te Tai o Aotearoa (eds. Goff JR, Nichol SL, Rouse HL), pp. 163-191. Dunmore Press, Palmerston North. Sherman CDH (2006) The Importance of Fine-Scale Environmental Heterogeneity in Determining Levels of Genotypic Diversity and Local Adaptation PhD, UNIVERSITY OF WOLLONGONG. Sherman CDH, Peucker AJ, Ayre DJ (2007) Do reproductive tactics vary with habitat heterogeneity in the intertidal sea anemone Actinia tenebrosa? Journal of Experimental Marine Biology and Ecology 340, 259-267. Shick JM, Lamb AN (1977) Asexual reproduction and genetic population structure in the colonizing sea anemone Haliplanella luciae. Biological Bulletin 153. Shields WM (1982) Philopatry, Inbreeding and the Evolution of Sex State University of New York Press, Albany, NY. Shulman MJ (1998) What can population genetics tell us about dispersal and biogeographic history of coral-reef fishes? Australian Journal of Ecology 23, 216-225. Siegel DA, Kinlan BP, Gaylord B, Gaines SD (2003) Lagrangian descriptions of marine larval dispersion. Marine Ecology-Progress Series 260, 83-96. Skold M, Wing SR, Mladenov PV (2003) Genetic subdivision of a sea star with high dispersal capability in relation to physical barriers in a fjordic seascape. Marine Ecology-Progress Series 250, 163-174. - 134 -

Smith PJ, McKoy, J. L., Machin, P. J., (1980) Genetic variation in the rock lobsters Jasus edwardsii and Jasus novaehollandiae. N.Z. Journal of Marine and Freshwater Research 14, 55-63. Smith PJ, Ozaki, H., Fujio, Y., (1986) No evidence for reduced genetic variation in the accidentally introduced oyster Crassostrea gigas in New Zealand. N.Z. Journal of Marine and Freshwater Research 20, 569-574. Smith PJ (1988) Biochemical-genetic variation in the green-lipped mussel Perna canaliculus around New Zealand and possible implications for mussel farming. N.Z. Journal of Marine and Freshwater Research 22, 85-90. Smith PJ, MacArthur, F., Michael, K., (1989) Regional variation in electromorph frequencies in the tuatua, Paphies subtriangulata, around New Zealand. N.Z. Journal of Marine and Freshwater Research 23, 27-33. Smith PJ, McVeagh, S. M., Ede, A. (1996) Genetically isolated stocks of orange roughy (Hoploslethus atlanticus) but not of hoki (Macruronus novaezelandiea), in the Tasman Sea and southwest Pacific Ocean around New Zealand. Marine Biology 125, 783-793. Smith PJ, Benson PG (1997) Genetic diversity in orange roughy from the east of New Zealand. Fisheries Research 31, 197-213. Smith PJ, Benson PG, McVeagh SM (1997) A comparison of three genetic methods used for stock discrimination of orange roughy, Hoplostethus atlanticus: allozymes, mitochondrial DNA, and random amplified polymorphic DNA. Fishery Bulletin 95, 800-811. Smith PJ, Mattlin RH, Roeleveld MA, Okutani T (1987) Arrow Squids of the Genus Nototodarus in New Zealand Waters Systematics Biology and Fisheries. New Zealand Journal of Marine & Freshwater Research 21, 315-326. Smith PJ, McMillan PJ, Bull B, et al. (2002) Genetic and meristic variation in black and smooth oreos in the New Zealand Exclusive Economic Zone. New Zealand Journal of Marine and Freshwater Research 36, 737-750. Smith PJ, McVeagh SM, Ede A (1996) Genetically isolated stocks of orange roughy (Hoplostethus atlanticus), but not of hoki (Macruronus novaezelandiae), in the Tasman Sea and southwest Pacific ocean around New Zealand. Marine Biology 125, 783-793. - 135 -

Smith PJ, Robertson SG, Horn PL, et al. (2002) Multiple techniques for determining stock relationships between orange roughy, Hoplostethus atlanticus, fisheries in the eastern Tasman Sea. Fisheries Research 58, 119-140. Snelder TH, Leathwick JR, Dey KL, et al. (2007) Development of an Ecologic Marine Classification in the New Zealand Region. Environmental Management V39, 12-29. Sokal RR, Wartenberg DE (1983) A test of spatial autocorrelation analysis using an isolation by distance model. Genetics 105, 219-237. Sotka EE, Wares JP, Barth JA, Grosberg RK, Palumbi SR (2004) Strong genetic clines and geographical variation in gene flow in the rocky intertidal barnacle Balanus glandula. Molecular Ecology 13, 2143-2156. Sponer R, Roy MS (2002) Phylogeographic analysis of the brooding brittle star Amphipholis squamata (Echinodermata) along the coast of New Zealand reveals high cryptic genetic variation and cryptic dispersal potential. Evolution 56, 1954-1967. Stanton B, Sutton P (2003) Velocity measurements in the East Auckland Current north-east of North Cape, New Zealand. New Zealand Journal of Marine and Freshwater Research 37. Stanton BR (1969) HydrologLcal observations across the Tropical Convergence north of New Zealand. New Zealand Journal of Marine & Freshwater Research 3, 124-146. Stanton BR (1971) Hydrology of the Karamea Bight, New Zealand. N.Z. Journal of Marine and Freshwater Research 5, 141-163. Stanton BR (1973) Hydrological investigations around northern New Zealand. N.Z. Journal of Marine and Freshwater Research 7, 85 - 110. Stanton BR (1976) Circulation and hydrology off the West Coast of the South Island of New Zealand. N.Z. Journal of Marine and Freshwater Research 10, 445-467. Stanton BR (2001) Estimating the East Auckland Current transport from model winds and the Island Rule. New Zealand Journal of Marine and Freshwater Research 35, 531-540. Stanton BR, Hill PJ (1972) Topographic influence on the winter mid-Tasman Convergence. New Zealand Journal of Marine & Freshwater Research 6, - 136 -

645 - 648. Stephenson TA (1929) On methods of reproduction as specific characters. Journal of the Marine Biological Association of the United Kingdom 16, 131-172. Stephenson TA (1935) The British sea anemones, Vol 2 The Ray Society, London. Stevens M, Hogg ID (2004) Population genetic structure of New Zealand's endemic corophiid amphipods: evidence for allopatric speciation. Biological Journal of the Linnean Society 81, 119-133. Stevens MI, Hogg ID, Chapman MA (2002) Corophiid amphipods in Tauranga Harbour, New Zealand: evidence of an Australian crustacean invader. Hydrobiologia 474, 147–154. Stevens PM (1991) A genetic analysis of the pea crabs (Decapoda: Pinnotheridae) of New Zealand. Marine Biology (Historical Archive) 108, 403-410. Stoddart JA (1988) Coral populations fringing islands larval connections. Australian Journal of Marine and Freshwater Research 39, 109-116. Stoletzki N, and B. Schierwater (2005) Genetic and color morph differentiation in the Caribbean sea anemone Condylactis gigantea. Marine Biology 147, 747-754. Suter H (1913) Manual of New Zealand Mollusca Government Printer, Wellington. Sutton PJH (2003) The Southland Current: a subantarctic current. New Zealand Journal of Marine and Freshwater Research 37, 645–652. Suzuki T, Yamamoto Y (2000) Gene structure of two-domain arginine kinases from Anthopleura japonicus and Pseudocardium sachalinensis. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 127, 513-518. Thiel M, Gutow L (2005) The ecology of rafting in the marine environment. II. The rafting organisms and community. In: Oceanography and Marine Biology - an Annual Review, Vol. 43, pp. 279-418. Thiel M, Haye PA (2006) The ecology of rafting in the marine environment. III. Biogeographical and evolutionary consequences. In: Oceanography and Marine Biology - an Annual Review, Vol 44, pp. 323-429. - 137 -

Thornton J (1988) Field Guide to New Zealand Geology Heinemann Reed, Auckland, NZ. Todd CD, J. Lambert W, Thorpe JP (1998) The genetic structure of intertidal populations of two species of nudibranch molluscs with planktotrophic and pelagic lecithotrophic larval stages: are pelagic larvae "for" dispersal? Journal of Experimental Marine Biology and Ecology 228, 1- 28. Triantafillos L, Adams M (2001) Allozyme analysis reveals a complex population structure in the southern calamary Sepioteuthis australis from Australia and New Zealand. Marine Ecology Progress Series 212, 193- 209. Tuckey BJ, Gibbs MT, Knight BR, Gillespie PA (2006) Tidal circulation in Tasman and Golden Bays: implications for river plume behaviour. New Zealand Journal of Marine and Freshwater Research 40, 305–324. Tzeng T-D, Yeh S-Y, Hui C-F (2004) Population genetic structure of the kuruma prawn (Penaeus japonicus) in East Asia inferred from mitochondrial DNA sequences. ICES Journal of Marine Science 61, 913-920. Uddstrom MJ, Oien NA (1999) On the use of high-resolution satellite data to describe the spatial and temporal variability of sea surface temperatures in the New Zealand region. Journal of Geophysical Research-Oceans 104, 20729-20751. Underwood AJ (1980) The effects of grazing by gastropods and physical factors on the upper limits of distribution of intertidal macroalgae. Oecologia 46, 201-213. Vennell (1992) Acoustic Doppler Current Profiler measurements of tidal phase and amplitude in Cook Strait, New Zealand. Continental Shelf Research 14, 353-364. Vianna P, Schama R, Russo CAM (2003) Genetic divergence and isolation by distance in the West Atlantic sea anemone Actinia bermudensis (McMurrich, 1889). Journal of Experimental Marine Biology and Ecology 297, 19-30. Vincent WF, Howard-Williams C, Tldesley P, Butler E (1991) Distribution and biological properties of oceanic water masses around the South Island, New Zealand. New Zealand Journal of Marine and Freshwater Research - 138 -

25, 21-42. Waits, L.P., Luikart, G., and Taberlet, P. (2001) Estimating the probability of identity among genotypes in natural populations: cautions and guidelines. Molecular Ecology 10, 249-256. Walsh S, Metzger D, Higuchi R (1991) Chelex 100 as a Medium for Simple Extraction of DNA for PCR-Based Typing from Forensic Material. BioTechniques 10, 506-513. Waples RS (1991) Genetic Interactions between Hatchery and Wild Salmonids - Lessons from the Pacific-Northwest. Canadian Journal of Fisheries and Aquatic Sciences 48, 124-133. Ward RD, Elliott NG, Grewe PM, et al. (1998) Allozyme and mitochondrial DNA variation in three species of oreos (Teleostei : Oreosomatidae) from Australasian waters. New Zealand Journal of Marine and Freshwater Research 32, 233-245. Wares JP, Gaines SD, Cunningham CW (2001) A comparative study of asymmetric migration events across a marine biogeographic boundary. Evolution 55, 295–306. Waters JM, King TM, Loughlin PM, Spencer HG (2005) Phylogeographical disjunction in abundant high-dispersal littoral gastropods. Molecular Ecology 14, 2789-2802. Waters JM, Roy MS (2003) Marine biogeography of southern Australia: phylogeographical structure in a temperate sea-star. Journal of Biogeography 30, 1787-1796. Waters JM, Roy MS (2004) Phylogeography of a high-dispersal New Zealand sea-star: does upwelling block gene-flow? Molecular Ecology 13, 2797- 2806. Weber JL, Wong C (1993) Mutation of Human Short Tandem Repeats. Human Molecular Genetics 2, 1123-1128. Whalan S, Johnson MS, Harvey E, Battershill C (2005) Mode of reproduction, recruitment, and genetic subdivision in the brooding sponge Haliclona sp. Marine Biology 146, 425-433. Whitaker K (2006) Genetic evidence for mixed modes of reproduction in the coral Pocillopora damicornis and its effect on population structure. Marine Ecology-Progress Series 306, 115-124. - 139 -

Williams GC (1975) Sex and Evolution Princeton University Press, Princeton. Williams ST, Reid DG, Littlewood DTJ (2003) A molecular phylogeny of the Littorininae (Gastropoda: Littorinidae): unequal evolutionary rates, morphological parallelism, and biogeography of the Southern Ocean. Molecular Phylogenetics and Evolution 28, 60-86. Wilson AC, Cann RL, Carr SM, et al. (1985) Mitochondrial-DNA and 2 Perspectives on Evolutionary Genetics. Biological Journal of the Linnean Society 26, 375-400. Wing SR, Botsford LW, Morgan LE, Diehl JM, Lundquist CJ (2003) Inter-annual variability in larval supply to populations of three invertebrate taxa in the northern California Current. Estuarine, Coastal and Shelf Science 57, 859-872. Wirth T, Meyer A, Achtman M (2005) Deciphering host migrations and origins by means of their microbes. Molecular Ecology 14, 3289-3306. Worcester SE (1994) Adult Rafting Versus Larval Swimming - Dispersal and Recruitment of a Botryllid Ascidian on Eelgrass. Marine Biology 121, 309-317. Wörheide G (2006) Low variation in partial cytochrome oxidase subunit I (COI) mitochondrial sequences in the coralline demosponge Astrosclera willeyana across the Indo-Pacific. Marine Biology 148, 907-912. Wyrtki K (1960) The surface circulation in the Coral and Tasman Seas. Division of Fisheries and Oceanography CSIRO Australia, Technical Paper 8, 44. Yanagi K, Segawa S, Tsuchiya K (1999) Early development of young brooded in the enteron of the beadlet sea anemone Actinia equina (Anthozoa : Actiniaria) from Japan. Invertebrate Reproduction & Development 35, 1- 8. Zilberberg C, Sole-Cava AM, Klautau M (2006) The extent of asexual reproduction in sponges of the genus Chondrilla (Demospongiae : Chondrosida) from the Caribbean and the Brazilian coasts. Journal of Experimental Marine Biology and Ecology 336, 211-220. Zouros E (2000) The exceptional mitochondrial DNA system of the mussel family Mytilidae. Genes & Genetic Systems 75, 313-318. - 140 -

Appendix I – Laboratory Protocols

A1.1 DNA extraction

A1.1.1 DNA Extraction (PCI) (modified from Protocol 2. in Hoelzel & Green, 1992)

Solutions: RSB Buffer 10mM Tris, 25mM EDTA, 10mM NaCl pH 7.4 1.21g Tris, 9.3g EDTA, 0.59g NaCl in 1000mls 10% (w/v) SDS 5M NaCl 29.22g in 100mls PCI 25mls Phenol, 24mls Chloroform, 1ml Isoamyl alcohol CI 48mls Chloroform, 2mls Isoamyl alcohol 7.5M Ammonium Acetate 57.81g in 100mls TLE Buffer 10mM Tris, 0.1mM EDTA

Preparations: Set up a large glass plate working surface. Clean with 95% EtOH. The bench can also be wiped with 15% bleach. Flame sterilise all instruments.

1. Thoroughly macerate 0.01gm of tissue. 2. Add macerated sample to 330µl of RSB buffer in a 1.5ml tube. 3. Add 40µl of 10%SDS (final concentration 1%) and vortex briefly. 4. Add 20µl Proteinase K (20mg/ml – final concentration 1mg/ml) 5. Incubate at 55oC for 2–3hrs. Ensure tubes are tightly sealed when using Hybaid. Check the tubes after 2hrs and if chunks of tissue are still present add a further 10µl of ProK to the mix. Leave for a further 1-2hrs. 6. Add 20µl of 5M NaCl and mix (not necessary if tissue was stored in DMSO) 7. In the fume hood, add approximately 500µl Phenol and rock for 10- 15mins 8. Centrifuge for 10mins at 13,000rpm 9. Transfer supernatant to a new tube taking care too minimise uptake of interface. If the interface is difficult to avoid repeat Phenol step. 10. Add approximately 500µl PCI and rock for 10-15mins 11. Centrifuge at 13,000rpm for 10mins and transfer supernatant to a new tube. 12. Add 500µl of CI and repeat above. 13. Add approximately ½ volume of 7.5M Ammonium Acetate and mix. 14. Add 2 ½ volumes of cold 95-99% EtOH and mix. Store this overnight at -20oC. 15. Centrifuge at 13,000rpm for 15mins to pellet DNA - 141 -

16. Remove the EtOH with a pipette taking care not to dislodge the pellet. If you spin with the hinges out take EtOH from opposite side of tube. 17. Resuspend DNA in 1ml of 70% EtOH. 18. Centrifuge at 13,000rpm for 10mins. 19. Remove EtOH as before. Invert tubes on a paper towel and leave to air dry for 2hrs. Cover the tubes to prevent dust from entering. 20. Resuspend DNA in TE, rough guidelines – barely visible pellets = 50µl, small pellets = 100µl, medium pellets = 200µl, large pellets or spooled DNA = 300µl. 21. Leave for an hour or so for DNA to go fully into solution, then leave overnight at 4oC. 22. Store in freezer for short term or –80oC for long term.

A1.1.2 DNA Extraction (Chelex) (modified from Walsh et al., 1991)

Solutions 10% chelex in water

1. Cut a 2mm cubed piece of tissue from the mantle (Chiton) or base of column (Antemone) 2. Pâté the piece 3. Place in a 500µl tube filled with 90µl of 10% chelex 4. Boil the tube in PCR machine at 97oC for 20mins 5. Bring the block down to 37oC before opening lid 6. Spin tubes briefly to bring chelex to the bottom of the tube 7. Use 2-5µl of supernatant for PCR.

If a product was not obtained first time, re-boil for 10 minutes then repeat PCR

A1.2 PCR reagents, primers and thermal cycle

Amplification via the Polymerase Chain Reaction (PCR) was carried out for each loci in a total volume of 23µl containing reaction buffer (10µM of each primer, 20µM dNTPs, 2.5mM of Mg2+, 10x PCR buffer (PCRII - ABI) and 0.5µl Taq Polymerase (Platinum Taq – Invitrogen), and ~20ng DNA template.

The thermocycling paramaters are as follows: - 142 -

The primers for the microsatellite loci are mentioned in the Chapter 3 methodology. The other primers mentioned in the text are as follows:

Appendix II – Phylogenetic Data

A large amount of sequence data was gathered in the process of this research. I present this here for potential use in future phylogenetic research.

- 143 -

A2.1 Sypharochiton pelliserpentis

Due to the large size, the assembly of S. pelliserpentis COI haplotypes has been left as a separate text file in nexus format (S. pelliserpentis COI.txt). This is included on the CD. A second text file (S. sincliari COI.txt) also in nexus format contains the COI haplotypes of Sypharochiton sinclari, which were collected in the belief they were S. pelliserpentis.

A2.2 Actinia tenebrosa

Table 2.2a comparing the number of individuals sampled (N) to the number of unique multi- locus genotypes (Ng) detected within each population of A. tenebrosa.

- 144 -

Cytochrom Oxidase 1 (COI)

CCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAGTTATCTGCCCCTGGTACTATGTTAGG GGACGACCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTTTTCCTAGTAATGCCA GTAATGATAGGAGGGTTTGGTAATTGGTTAGTGCCACTATATATTGGCGCCCCCGATATGGCCTTCCCAC GACTAAACAATATTAGTTTTTGGTTACTTCCTCCCGCGCTTATACTATTATTAGGCTCTGCCTTTGTTGA GCAAGGAGTAGGAACAGGGTGGACAGTTTATCCTCCTCTTTCTGGCATTCAAACGCACTCGGGAGGGGCG GTCGACATGGCCATCTTTAGTCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAA CAACCATATTTAATATGAGAGCCCCGGGATTAACGATGGATAGACTCCCACTATTTGTGTGGTCCATTTT AATCACTGCCTTTTTATTATTACTCTCCCTACCAGTTTTAGCGGGTGGAATAACCATGCTTTTAACAGAT AGGAATTTTAATACAACTTTCTTTGACCCAGCAGGGGGTGGAGATCCCATCTTATTCCAACATTTATTTT GATTTTTTGGTCACCC

Cytochrom Oxidase 1 (COI) intron

TTCTTCAGGATTTGGATGGTATCTCAAATTATACCAACCTTTTCTGCTAAAAATCAAATTTTTGGATATT TAGGCATGGTATATGCCATGTTATCTATTGGAATATTAGGCTTTATTGTGTGGGCACATCACATGTTTAC GGTAAATTTCAGCCGCCGAAGGCAGCAATGTCTTCGTTTATTATCTCGCTATATGCTGGAAAAACCCTTT TTAAAAAATAAGTGCTCGTCTAAGGTTAAGGCAGCTAAAATCTTATTTTTATGGGGTTTACTAGCCGGAA ATTAAAATTGGGATTAAGCTGTTTACTACAACGACTCAAATTTTAAGATCCTCAGAGACTGCACGCGAGA AATCCTGACAATGGTTAATTGGGTTTATTGAAAGCCAGGGCCGCTTAGGAATAGCTCGAAAACCTCATGG CGCGGAATGTCTTTCTCTTTCCATTTCTCGCCCTCTTAAAGACACCCAAATTCTCTATCACATAAAATGT CTATTAGGGCATGGCCATGTCAAACTTTCAATGGTTGGGAAATATTATGTTGCAAACAGGAAGGTCTTAG TTGATATTTGCCCGCTTGAATGTTCGAGTGGCGGAGCTTGGTTAACAGGATTAATGGATGGGAAAGGGGC CTTCCTTGTTTCTCTAAAACATAACCCTAATGCCCCAGAAAAAAAGGACATAAGTTTTTCCTTAGCCATA TTACAAGCGGAGGGGTTTGTTTTAAGACCATTTTTTGATAAATTAGGGGGAAGCATAAGAAAAAATGAAA AGGATCACACTTTCATATGAGAGGTGAGAGAGAAAAAGGCTTTAATTCGAGCTATGCGCCTTCTTAAAAA ACATTCGTTACGAACAAAGAAACGGGTTGATTTTTTGAAATGGTGTCGGGCATTAGAGTTAATTAATTAT AATTCAGGATTAAGGTACAGTCCGAACCGCGGCGAAAGCCTCGGCTGGAAAACGCTTCGCTTATTGAAAC GTTTTTAAACACATTAGTGGAATGGATGTTGACACAAGGGCTTACTTCACTGCAGCGACTATGATTATAG CTGTTCCAACTGGGATAAAGGTGTTTAGTTGATTAGCCACCATTTATGGTGGGGCTATTAGGCTAGACAC ACCTATGCTTTGGGCCATAGGGTTTGTCTTTCTTTTTACAATAGGAGGCTTAACCGGGGTAATTTAGCTA ATAGT

NADH Dehydrogenase Subunit 5 Intrron (ND5 intron)

TTGAGGCAATAAGGCAGGTATAAAGGCCATGTTGGTTAATCGAGTGGGGGATATTGGATTTGTCTTAGCT ATGTTGGCAATTTGGGATCAATTTGGGTGCTTAGATTTTGCTTCTATTTTTAATACCGTGGCACTATCCC CCTCTAATAACACCACCCTAATATGTTTATTTTTATTTATAGGTGCTGTCGGTAAATCTGCGCAGTTAGG GTTACACACTTGGTTACCGGATGCAATGGAAGGTTGGCGTTGGGCCGTCTTGTCTAAGTAATTAGCCTTG ATTATAAATACACTATATGCTGAAAAGACCTAGCGGGTTAATCAGCCGGTAACAAAGTTAGAAGTTAGAA ATACCACTTAATAAATTGGTTTATGAGGTGGTTGGGCTTATGCCTTTCTTCGCTGTTGGTACCTCAGAGA CTTTATGTGAATCCACTCCGAATTTTATGAGAAAGCTCGTTTTCTTGATGGTCGTTGAAACAATTCATTT AATCTTAAAAATTTTAATAATAGTTATTCCGTTACTTGTAGCAGTGGCTTATTTAACTTTGGCCGAACGG AAGGTTTTAGGATATATGCAAGCTAGGAAAGGGCCCAATGTAGTAGGTGTTTATGGGCTGTTACAACCTC TTGCTGATGGTATAAAACTATTTACTAAAGAATTGGTGATTCCTCACTACGCTAATTTGTTTATATATGT GGCGGCGCCAGTCTTTTCATTTACTTTAGCCCTAATTGCTTGGGGAGTTATTCCTTATGATAGAGGGGTT GTTATAAGTGATCTGAAAATAGGAATTTTGTTTACATTGGCCGTATCTTCCATTAGTGTTTATGCTATTT TGATGTCCGGTTGGGCAAGTCAGTCTAAGTATGCTTTTTTAGGAGCTATTAGGGCGGCCGCTCAGATGAT TAGTTATGAAGTTTCAATTGGACTAATAATAATAGCGGTCATCTTGTGTGTCGGTTCTTTGAATATTACT GAAATAGTGCTAGCTCAAAGTAGTGGTATTTGATTTTTCTTTC

Ribosomal Internal Transcribed Spacer (ITS) - 145 -

AGGTGAACCTGCGGAAGGATCATTACCGATCACGTTCTTCCCAAACGTAGAACACCGCGAACCGTATGGA GAGTTGGGGGTCGCCCCGTCGAGGGCGTCAAACGATGAGAGCCAGCGCCGACATTCCCTACATGGGGGTT CGGTCGATTCTCACGGCCCCCACGTTTATTTTTTTCTACCCCAAAACACCTTTCCAGCAGAAAAACTTGT CCCGTACAAGGGACAAAAAAATTCAAAAGTTCATAACTTTTAACGGTGGATCTCTTGGCTCGTGCATCGA TGAAGAACGCAGCCAGGTGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG CAAATGGCGCTCTTGGGTTTTCCCAGGAGCACGTCTGTCTGAGTGTCGGTTTCCAAAACCAGCGCACGCT CGCGTGCGGTCTTGAGGTGTCGCGGCCCCCCTCCATCCATCGCAGGGAGGCCTCGTCCCTTGAAATGGAG CACGACCGATCTGTGCGGCCAGCGTTCGCCACTTCGGGAAGGCCAAAAGCTTCTTTGCCCTTTCCCGAGG CGTCGCCTGACCGCCGGTGCGGCCGGAGTTCGGCAGGTAGGCAGCCCTCGTGGCTGCTCACCCATCCATT CTTGACCTCAGATCAGGCGAGATTACCCGCTGAATTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAA CAAGGATTCCCCTAGTAATGGCGAATGAAGCGGG

A2.3 Isactinia olivacea

Cytochrom Oxidase 1 (COI)

CTTTTAGGCATGTGGTCTGCAATAGTGGGGATTAGATTGAGAATGATTATTCGTATTGAGCTTGGTCGAC CTGGGAGGTTCCTAGGAGACGATCAACTATACAACACTATTGTAACTGCTCATGCTTTAATTATAATTTT TTTTATAGTAATGCCCCTTATAGTGGGGGGGTTTGGTAATTGATTACTCCCCCTTATGATGGGTTCTTTA GATATGGTATTTCCTCGTTTAAACAACCTAAGTTTTTGGTTCATACCAGCATCTTTATATATGTTGTTAA GTTCTATGTTTATTGAAAACGGAAGAGGGACCGGATGGACTTTGTACCCTCCTTTGTCTTCTTATAATGG TCATAGAGGCCCAGCGGTGGACATATCTTTGTTTGCTTTACATTTAGCTGGTGCGTCTTCTATTGGAGGC TCTATTAACTTTTTAACTAGTATTAAAAATCTTCCAGTAGAAGGGATGCGAGGGGAGCGCATAAGTCTTT TTATCTGGTCTATGTCTGTTACGGCAGTGTTACTTTTAGTGTCTTTGCCGGTGTTAGCCGGAGGGATTAC TATGCTAATTTTTGATCGTCACTTTAATACTTCTTTTTATGACCCTTCTGGGGGGGGAGACCCTGTTCTT TATCAGCATTTGTTCTGATTTTTTGGTCACCC

Cytochrom Oxidase 1 (COI) intron

ACTATTAGCTAAATAACCCCGGTTAATCCTCCTATTGTAAAAAGAAAGACAAACCCTATGGCCCAAAGCA TAGGTGTATCTAACCTAATGGCCCCACCATAAATGGTAGCCAATCAACTAAACACCTTAATCCCAGTTGG AACAGCTATAATCATAGTAGCTGCAGTGAAGTAAGCTCTTGTGTCAACATCCATTCCACTAATGTGTTTA AAAACGCTTCAATAAGCGAAGCGTTTTCCAGCCGAGGCTTTCGCCGCGGTTCGGACTGTACCTTAATCCT GACTTATAATTAATTAACTCTAATGCCCGACACCATTTCAAAAAATCAACCCGCTTCTTTGTTCGTAACG AATGTTTTTTAAGAAGACGTATGGCTCGAATTAAAGCCTTTTTCTCTCTCACCTCTCATATGAAAGTGTG ATCCTTTTCATTTTTTCTTATGCCCCCCCCTAATTTATCAAGGAATGGTCTTAAAACGAACCCCTCTACC TGAAATATGGCTAAGGAAAAACTTACGTCCCTTGGGGGTGAGGTCTTAGGGTTATGCTTTAGAGAAACAA GGAAGGCGCCTTCCCCATCCATTAGTCCGACTAACCGAGCTCCGCCACTCGAACACTCAAGCGGGCAAAT ATTAACTAAGGCCTCCCTGTTTGCAACATAATATTTCCCAATCATTGAAAGTTTTACGTGGCCATACCCT AATAAACATTTTATGTGATAGAGAATTTGGGTATCTTTAAGGGGGCGAGAAATGGAAAGAGAAAGACATT CCGCGCCATGGGGTTTTCGAGCTACGCCTAAGCGGCCCTGAGTTTCTATAAACCCAATTAATCATTGCCA GGATTTCTCGCGTGCAGTCTCTGAGGATCCTAAAACTTGGGTAGTCGTAAAAAACACTTTAATCCCAGTT TTAATTTCCGGCTGGGGAACCCCATAAAAATAAGATTTTAGCTGCCTTAACCTTAGACGAGCACCTATTT TTAAGAAGGGTCTTTCCAGCATATAGCGAGATAATAAACGAAGACATTGCTGCCTCCGACGGCTGAAGTT TACCGTAAACATGTGATGTGCCCACACAATAAAGCCTAATATTCCAATAGATAACATGGCATACACCATG CCTAAATATCCAAAAATTTGATTTTTAGCAGAAAAAGTTGGTATAATTTGAGATATCATCCAAACCTGAA GAAT

- 146 -

NADH Dehydrogenase Subunit 5 Intrron (ND5 intron)

AGTGGGGGATATAGGGTTTGTCTTAGCTATGTTGGCAATTTGGGATCAATTTGGGTGTTTAGACTTTGCC TCTATTTTTAATACAGTGGCACTATTCCCCTCTAATAACACTACTTTAATATGTTTGTTTTTATTCATAG GTGCAGTCGGTAAGTCTGCACAATTGGGATTACACACTTGGTTGCCGGATGCAATGGAAGGTTGGCGTTG GGCCGTCTTGTCTAAGTAATTAGCCTTGATTATAAATCCACTATATGCTGGAAAGACCTTGAGGGTCTAT CAGCCGGTAACAAAGCTGGGAGTTAGATATGCCACTTAATAAATTGGTTTAGGCGGTGGCTAGGGCCTAT GCTCTTCTTCGCTGTTGGTACCTCCGAGACTTTATGTGAATCCACTTCGGATCTTATGAGGAAGCTGATT CTTTGATGATCGTTGTAACAATCCACTTAATCTTAAAAATTTTAATAATAGTTATCCCGTTACTTGTAGC AGTGGCTTATTTAACTTTAGCCGAACGGAAAGTCTTAGGTTATATGCAAGCTAGGAAGGGGCCCAATGTA GTAGGTGTTTACGGGCTGTTACAACCTCTTGCTGATGGTATAAAATTATTTACTAAGGAGCTGGTGATTC CTCATCATGCTAATTTGTTTATTTATGTGGCGGCCCCGGTTTTTTCATTCACTTTAGCTTTAATTGCTTG AGGGGTTATTCCTTATGACAAAGGGGTTATGATAAGTGACCTAAAAATAGGCATTTTGTTTACATTAGCC G

Ribosomal Internal Transcribed Spacer (ITS)

TTTCTTTTCCTCCGCTTATTAATATGCTTAAATTCAGCGGGTAGTCTCGCCTGATCTGAGGTCGAGGTTG GAATGTTGGCCGACCGCGACCGGTTTGGACGGCTCGGCGCTGCCTTCGGTGCAGGGCAAATTGAATTTTT TTGGCCTGGCCGAGGTGGCAACGCGGGCCGCCCGGATCGGTCGTGCTCCATTTCGAGGGACGAGGCCGCC TAGTGATAGATAGAGGGGCCGCGACTCCTCAAGACCGCGCCGCAGCGCGTGGTTGATTTTGGAAACCGAC ACTCAGACAGACGTGCTCCTGGGAAAACCCAAGAGCGCCATTTGCGTTCAAAGATTCGATGATTCACTGA ATTCTGCAATTCACACTACTTATCGCAGCTGGCTGCGTTCTTCATCGATGCACGAGCCAAGAGATCCACC GTTAAAAGTTGTGATCTTTTACTCATGTTTTCTTCGCGGCGATGCACGAAGGAATTCTGCAAGTTGAGGT GTGTAAAATGAAATGAAAGTCAAGGTGGGGGCCGTGGCCATGCCATCGTTTGACGCCCCGTTCGAGGCGA CCCCCACCGGTTAGTACGGTTCGCGGTGTGCGTCTGTGCGACGACGTCAGATCGGTAATGATCCTTCCGC AGGTTCAC - 147 -

Appendix III – Population Site Details

- 148 -