Inhibin Is a Novel Paracrine Factor for Tumor Angiogenesis and Metastasis Priyanka Singh1, Laura M

Published OnlineFirst March 13, 2018; DOI: 10.1158/0008-5472.CAN-17-2316

Cancer Tumor Biology and Immunology Research

Inhibin Is a Novel Paracrine Factor for Tumor Angiogenesis and Metastasis Priyanka Singh1, Laura M. Jenkins1, Ben Horst1, Victoria Alers1, Shrikant Pradhan1, Prabhjot Kaur2, Tapasya Srivastava2, Nadine Hempel3,Balazs Gyorffy4, Eugenia V. Broude5, Nam Y. Lee6, and Karthikeyan Mythreye1,5

Abstract

Inhibin is a heterodimeric TGFb family ligand that is expressed SMAD1/5 activation and angiogenesis in vitro and in vivo. Inhibin- in many cancers and is a selective biomarker for ovarian cancers; induced angiogenesis was abrogated via anti-inhibin a antibo- however, its tumor-specific functions remain unknown. Here, we dies. The endothelial-specific TGFb receptor complex comprising demonstrate that the a subunit of inhibin (INHA), which is ALK1 and endoglin was a crucial mediator of inhibin signaling, critical for the functionality of dimeric inhibin A/B, correlates offering a molecular mechanism for inhibin-mediated angiogen- with microvessel density in human ovarian tissues and is predic- esis. These results are the first to define a role for inhibin in tumor tive of poor clinical outcomes in multiple cancers. We demon- metastasis and vascularization and offer an antibody-based strate that inhibin-regulated angiogenesis is necessary for metas- approach for targeting inhibin therapeutically. tasis. Although inhibin had no direct impact on tumor cell Significance: Inhibin is a predictor of poor patient survival in signaling, both tumor cell-derived and recombinant inhibin elicit multiple cancers and is a potential target for antiangiogenic a strong paracrine response from endothelial cells by triggering therapies. Cancer Res; 78(11); 2978–89. 2018 AACR.

Introduction angiogenic therapy remains a formidable challenge due to their nonendothelial pleiotropic functions. Here, we focus on the Inhibition of angiogenesis, the growth of new blood vessels unique TGFb family member inhibin, an endocrine hormone from preexisting vasculature, is a clinically validated anticancer that sharply declines at the onset of menopause in healthy normal strategy for numerous tumor types. However, although the women and remains low (2) unlike other TGFb family members VEGF/VEGF receptor (VEGFR) signaling axis is widely recog- and prototypical angiogenic factors like VEGF. Importantly, when nized as the principal target of this therapeutic approach, inhibin becomes elevated in postmenopausal women, this ele- current FDA-approved anti-VEGF drugs have demonstrated vation becomes a diagnostic and prognostic marker for OVCA sub-optimal responses in the clinic. In many cases, including where along with CA125 detects 95% of ovarian tumors with 95% in ovarian cancers (OVCA), patient relapse, acquired resistance specificity (3, 4). and cytotoxicity is commonly observed following anti-VEGF Inhibin is a heterodimeric member of the TGFb family com- therapy. The identification of new vascular targets with poten- posed of an alpha (a; coded by INHA) and b subunit (INHBA or tially fewer adverse effects is therefore critical for improving INHBB). Combinations of these subunits give rise to either therapeutic outcomes. inhibin A (abA) or inhibin B (abB; 5). Although inhibin null TGFb family members, particularly TGFb1 and BMP9, are mice (INHA / ) are viable, they present with alterations to the essential regulators of angiogenesis (1). Targeting these for anti- ovarian vasculature and result in spontaneous gonadal tumors (6). In humans, however, inhibin levels are elevated in multiple cancer types, including ovarian, prostate, adrenal, stomach, and 1Department of Chemistry and Biochemistry, University of South Carolina, Columbia, South Carolina. 2Department of Genetics, University of Delhi, South pancreatic cancers with indications for a role for inhibin in Campus, India. 3Department of Pharmacology, Penn State University College of prostate cancer metastasis (7–11). Despite these findings, the Medicine, Hershey, Pennsylvania. 4MTA TTK Lendulet€ Cancer Biomarker functional consequences of elevated tumor-derived inhibin have Research Group, Institute of Enzymology, and Semmelweis University 2nd yet to be determined. 5 Department of Pediatrics, Budapest, Hungary. Department of Drug Discovery Several inhibin-binding proteins/receptors were previously and Biomedical Sciences, School of Pharmacy, Ohio State University, Columbus, reported (12). However, unlike other TGFb members, whose Ohio. 6Division of Pharmacology, College of Pharmacy, Ohio State University, Columbus, Ohio. signal transduction mechanisms have been well studied, the mechanisms of inhibin signaling remain largely unclear. The Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). best-characterized inhibin-binding protein is the epithelial cell surface TGFb coreceptor TbRIII/betaglycan (13). Inhibin binding P. Singh and L.M. Jenkins contributed equally to this article. to betaglycan fails to activate any discernable downstream path- Corresponding Author: Karthikeyan Mythreye, University of South Carolina, 631 ways in epithelial cells. Others and we previously demonstrated, Sumter Street, Columbia, SC 29208. Phone: 803-576-5806; E-mail: several tumor suppressor functions for betaglycan, which is lost in [email protected] the majority of human cancers (14), but little is known about the doi: 10.1158/0008-5472.CAN-17-2316 impact of elevated inhibin on nonepithelial cells that do not 2018 American Association for Cancer Research. express significant betaglycan.

2978 Cancer Res; 78(11) June 1, 2018

Inhibin Promotes Angiogenesis and Metastasis

Given the urgent need to identify new antiangiogenic pathways puromycin. Transient DNA transfections of HMEC-1 and COS7 and targets to complement and improve existing therapies, we were performed using either Targetfect (#HUVEC-01) from examined the potential role of inhibin as a novel regulator of Targeting Systems or Lipofectamine 2000 (#11668019) from angiogenesis and metastasis. Importantly, we demonstrate inhib- Life Technologies. in as an unexpected, clinically relevant, paracrine factor of tumor- fi induced angiogenesis and de ne the underlying mechanism of RNA isolation and qRT-PCR analysis inhibin action and therapeutic potential. Total RNAs was extracted using TRIzol and chloroform. RNA was retro-transcribed using iScript Reverse Transcription Super- Materials and Methods mix (#1708841) and Advanced Universal SYBR Green Super- mix (#1725271) from Bio-Rad. All expression data were nor- Cell lines and reagents malized to those for RPL13A. qRT-PCR primer sequences are Ovarian epithelial carcinoma cell lines were obtained either listed in Table 1. from Duke Gynecology/Oncology Bank (Durham, NC) and ATCC. Authentication was carried out at the University of Plasmid constructs and stable cell lines Colorado (Denver, CO) sequencing facility. HMEC-1 (human The shRNA sequences for INHA were obtained either from dermal microvascular endothelial cells) from ATCC CRL-3243 þ þ Sigma-Aldrich or Dharmacon. ShINHA1 used in all the experi- and murine embryonic endothelial cells (MEEC) ENG / and ments was generated using TRCN0000063904: CCGGCCTC- ENG / were as described previously (15). HUVEC (human GGATGGAGGTTACTCTTCTCGAGAAGAGTAACCTCCATCCGA- umbilical vein endothelial cells) was purchased from Lonza. GGTTTTG in a pLKO1-puromycin backbone. Scramble vector was HMEC-1s were grown as per the ATCC instructions. Epithelial used as control (nontargeted control). The second shRNA sequ- carcinoma cell lines A2780, HEY, IGROV, OVCA247, M41, ences from Dharmacon: shRNA V3SH11240-226731666: TTCA- OVCA3, OVCA4, OVCA420, OVCA429, OVCA448, SKOV3 and GTGCTACTCTGTGGC. shRNA for ALK1 was obtained from Sig- PA1 were cultured in RPMI-1640 (ATCC 30–2001) containing ma-Aldrich TRCN0000000356: CCGGCAGTCCAGAGAAGCC- L-glutamine, 10% FBS and 100 U of penicillin–streptomycin. TAAAGTCTCGAGACTTTAGGCTTCTCTGGACTGTTTTT. Human All cells lines were maintained at 37 Cinahumidified incu- endoglin shRNA was described previously (16). bator at 5% CO2,routinelycheckedforMycoplasma 3timesa year and experiments conducted within 3–6passagesdepend- ing on the cell line. Antibodies phospho-SMAD1/5 (#9516), ELISA phospho-SMAD2/3 (#8828S) and SMAD2/3 (#5678S) were The enzyme linked immunosorbent assay (ELISA) was from from Cell Signaling Technology, SMAD1/5 (#ab75273) from AnshLabs (#AL-134) and was performed according to the man- Abcam. Mouse anti-HA antibody, rabbit anti-HA antibody ufacturer's instructions to quantitatively measure total inhibin and mouse anti-Myc antibody were from invitrogen. Monoclo- (inhibin A, inhibin B and inhibin a; alpha). Cells were serum nal antibodies to CD31 (#F8402) and inhibin a (#ab47720) starved for 24 hours before conditioned media (CM) was for IHC were purchased from Sigma-Aldrich and Abcam, collected. respectively. Anti-INHA antibody (polyclonal #sc22048, Santa Cruz Biotechnology) and (monoclonal #sc365439, Santa Co-patch immunofluorescence Cruz Biotechnology) were used as indicated. ML347, Dorso- Antibody-mediated immunofluorescence co-patching was per- morphin and SB351432 were from Sigma-Aldrich, TRC105 was formed as described previously (17, 18). HA and Myc tags at the a gift from TRACON pharmaceuticals (http://www.tracon cell surface were immunolabeled at 4C for 45 minutes using anti- pharma.com/trc105.php). Inhibin A was from Sigma-Aldrich HA and anti-Myc antibodies, to allow only surface labeling and to (# I9149) and R&D Systems (# 8506-AB). Lentiviral particles reduce internalization. Alexa 488 and Alexa 594 conjugated to were generated at the COBRE Center for Targeted Therapeutics anti-HA and anti-Myc were used as secondary antibodies, respec- Core Facility at South Carolina. For INHA knockdown, SKOV3 tively. Imaging was performed using an Olympus IX81 inverted cells were infected with shRNA lentivirus, selected in 2 mg/mL microscope (Shinjuku). Images were exported to ImageJ. The puromycin and stable cell lines maintained in 1 mg/mL number of superimposed (red and green) yellow patches were

Table 1. qRT-PCR primer sequences Primers Forward Reverse Human RPL13A AGATGGCGGAGGTGCAG GGCCCAGCAGTACCTGTTTA ENG CGCCAACCACAACATGCAG GCTCCACGAAGGATGCCAC INHA TTCCACTACTGTCATGGTGGT AGTGCTGCGTGAGAAGGTTG ALK1 CATCGCCTCAGACATGACCTC GTTTGCCCTGTGTACCGAAGA ALK2 GTGAAGGTCTCTCCTGCGGTA GCCATCGTTGATGCTCAGTGA ALK3 TGAAATCAGACTCCGACCAGA TGGCAAAGCAATGTCCATTAGTT ALK4 CTTCCCCCTTGTTGTCCTCC TCTCACACGTGTAGTTGGCC ALK5 TCCCAAACAGATGGCAGAGC ATCCGCAATGCTGTAAGCCT ALK6 ATGGAACTTGCTGTATTGCT CAACTCGAGTGTTAGGTGGT ALK7 GATGTGACCGCCTCTGGATC CCATCTTCCATGCCACACCT Mouse RPL13A CAAGGTTGTTCGGCTGAAGC GCTGTCACTGCCTGGTACTT ENG GCTGAAGACACTGACGACCA AGCCTGACGGGAAACTGATG

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2979

Singh et al.

counted manually on flat cell regions as described previously suspended in 200 mL HBSS. Two independent biological trials (17, 18). >50 patches/cell were counted. were conducted (first with 5 mice per group and the second with 8 mice per group) and monitored weekly with girth measurements Endothelial capillary sprouting and tube formation assay in triplicates. At 7 weeks (or if mice lost 20% of body weight), Tube formation in HMEC-1, HUVEC, and MEECs was per- incisions were made in the mice abdomen and ascites collected, formed as described previously (16, 19) using endothelial cells followed by necropsy for metastatic burden quantitation. plated between two layers of Matrigel except in the case of MEEC's, fl which were plated on a single layer of Matrigel. Brie y, 24-well DAB-based IHC m plates were coated with 200 L of Matrigel matrix (#354230, BD The tissue microarray (TMA) of OVCA tumor cores was pur- Biosciences). Thirty minutes following the addition of Matrigel, chased from Protein Biotechnologies Inc. (#TMA-2213). The 3 3 3 HMEC-1 cells (70 10 ), HUVEC (50 10 ) or MEEC (50 10 ) formalin-fixed, paraffin-embedded tissue arrays were deparaffi- were plated onto the matrix. For HMEC-1's, a second layer of nized by sequential washing with xylene, 100% ethanol, 90% m 200 L Matrigel was added after 1 hour of plating cells. After a ethanol, 80% ethanol, 70% ethanol and distilled water for 10 m 30 minutes incubation at 37 C, 300 L growth medium with minutes each. For antigen retrieval the tissue sections were heated b growth factors (300 pmol/L inhibin A, TGF , BMP9, or activin as for 10 minutes in Sodium citrate buffer (pH 6.0) or Tris EDTA indicated) or CM collected from shControl or shINHA stable cell buffer [pH 9.0; anti-INHA (inhibin a) or anti-CD31, respectively]. lines as indicated was added. Sixteen hours later images were taken Endogenous peroxidases were blocked with 3% H O for 10 fi 2 2 using an Olympus IX81 inverted microscope ( 4 magni cation). minutes, followed by block with 10% normal goat serum in TBST fi For all tube formation experiments, quanti cation presented for 1 hour room temperature, followed by incubation with in represents the two commonly used angiogenesis parameters primary antibody overnight at 4 C in a humidified chamber. vitro fi (20): number of meshes that are de ned as regions enclosed Appropriate secondary antibody conjugated to horseradish per- by segments (tubes delimited by two junctions) and/or closed oxidase in blocking solution was added for 30 minutes at room fi 0 polygons; nodes/branches, which are de ned as individual junc- temperature. Horseradish peroxidase was detected with 3,3 -dia- tions/branching points. The Angiogenesis Analyzer plugin in minobenzidine (DAB; ThermoFisher Scientific) substrate for 5 ImageJ was used for the analysis. For spheroid-based sprout minutes, washed and counterstained with hematoxylin. Mono- assays, endothelial spheroids were prepared as previously clonal antibodies to CD31 (#F8402, Sigma) and inhibin a fl 3 reported (21). Brie y, 1 10 HMEC-1 cells were cultured in (#ab47720) from Abcam were used. Stained specimens were m hanging drops of 25 L medium containing 20% methocel and examined using a phase-contrast microscope (model IX70; Olym- 80% culture medium, and allowed to aggregate as spheroids. After pus). For inhibin a levels, semiquantitative analysis was per- 24 hours, the spheroids were collected and plated on 24-well formed independently by 2 blind investigators (one pathologist) – plates coated with growth factor reduced Matrigel and treated as using a 3-tiered scoring system (none/trace/low, medium, or high indicated. Sprouts were digitally imaged after the indicated times being dark to high staining). Discrepancies between the 2 inves- and the number and length of sprouts per spheroid quantitated. tigators were discussed and reconciled (<10 samples). For CD31 For all experiments, a minimum of two biological trials, with each analysis, images were processed using ImageJ (NIH) to quantify trial containing three technical replicates were analyzed by count- CD31-positive areas. To quantify microvessel density (MVD), fi ing a minimum of 3 elds/technical replicate. microvessel-like structures consisting of endothelial cells that were stained with anti-CD31 antibody were counted in similar Study approval fields in the entire core by setting a constant threshold and All animal experimental protocols were performed in accor- presented as number of vessels/mm2 of tissue section. Five ran- dance with the Institutional Animal Care and Use Committee at dom fields of each section were analyzed. the University of South Carolina under an approved protocol (AUP 2329-101161-121916). Statistical analysis All clinical and xenograft data were analyzed using non- In vivo Matrigel plug assay parametric statistics. Survival curves were analyzed with log- Matrigel plug assays were carried out by using Matrigel (BD rank statistics. In vitro experiments were analyzed using Biosciences, #354230) mixed with 100 ng/mL inhibin A or mixed parametric statistics (ANOVA global test with Bonferroni- with CM from shControl/shINHA SKOV3 in a ratio of 2:3 (total corrected two-tailed Student t tests as post-hoc tests) and pre- volume of 0.2 mL) and injected subcutaneously into the right sented as mean SEM. In cases where data were normalized to flank of BALB/c female mice ages 5 to 6 weeks. n ¼ 3 mice per control, 1-sample Student t testwasusedwithanexpected group were used (22, 23) with each experiment conducted two value of 1% or 100% to decrease the likelihood of a type I independent times. Plugs were harvested 12 days after injection error. All statistical analyses were conducted with GraphPad and hemoglobin content was determined according to the Drab- Prism Software. kin's method.

Orthotopic xenografts Results Stable 5 106 of shControl or shINHA SKOV3 cells were Inhibin a analysis in ovarian cancer and impact on patient intraperitoneally injected into 7-week-old female NCr nude mice survival (Taconic Biosciences) athymic nude mice that were housed under Prior reports on analysis of inhibin a (encoded by INHA)in pathogen-free conditions on a 12-hour-light/dark cycle. Animals tumors, have indicated INHA and inhibin a in circulation, were monitored closely for tumor growth and signs of illness and including its utility as a biomarker for ovarian cancers (OVCA). sacriﬁced at humane end points. Cells were pathogen free and To assess parameters in tumor tissues that could reveal inhibin

2980 Cancer Res; 78(11) June 1, 2018 Cancer Research

Inhibin Promotes Angiogenesis and Metastasis

function in tumors, we first evaluated inhibin a expression using an ELISA to detect total inhibin (Fig. 2A, ii). We find that in human normal and primary OVCA tissues using immunohis- endothelial cells incubated with CM from scramble PLKO1 tochemistry on an ovarian TMA with 75 distinct tissue cores shRNA (shControl) cells robustly induced tube formation of spanning different OVCA subtypes. We find that, whereas inhibin endothelial cells 4.5 times more than CM from shINHA cells a was detectable at low levels in the tissue cores from normal (Fig. 2B), which secrete less inhibin (Fig. 2A, ii). This finding was patients, 46 % of endometrial, 51 % of serous and 44 % of confirmed using CM from a second independent shRNA to INHA mucinous tumors expressed high inhibin a (Fig. 1A and B; (Supplementary Fig. S2, i). Because TGFb members besides Supplementary Fig. S1, i and S1, ii), suggesting a broad increase inhibin could be altered in shINHA SKOV3 cells, we aimed to in inhibin a across all OVCA subtypes. The levels of inhibin a were determine whether the CM effects were specific to inhibin by further elevated in higher tumor grades in all subtypes (Fig. 1B, ii). examining endothelial cell tubulogenesis in the presence of an These results are in agreement with prior reports. Using this TMA, anti-inhibin a antibody. We find that incubating CM with two we noted inhibin a localization exclusively in epithelial cells in independent anti-inhibin a antibodies (polyclonal and mono- 20% of tumors and in both epithelial and stromal cells in the clonal) suppresses CM-induced tube formation 2.5 times more remaining 80% of tumors (Supplementary Table S1), suggesting than controls (Fig. 2B; Supplementary Fig. S2, ii). The effect of potential stromal inhibin functions. We next examined changes in anti-inhibin a was not tumor cell line specific as anti-inhibin a MVD using CD31 staining in the same tissues. A total of 52 cores also suppressed CM induced tube formation from a second OVCA were scorable for both inhibin a and CD31 based on quality of cell line M41 (Supplementary Fig. S2, iii). These findings are the cores. We find that tumor cores that expressed either medium first to demonstrate the use of an anti-inhibin a antibody in the and/or high levels of inhibin a (inhibin amed/high, N ¼ 29) suppression of any tumor promoting phenotype. We next used exhibited 2.5 times more microvessels per mm2 as compared recombinant inhibin (inhibin A) to examine inhibin potency in with inhibin alow tumor cores (N ¼ 23; Fig. 1C; Supplementary tube formation alongside equimolar amounts of other TGFb Fig. S1, iii). Regression analysis revealed that higher MVD corre- members that are known angiogenesis regulators: BMP9, activin, lated with higher inhibin a levels, with a Spearman correlation and TGFb, which either suppress or promote angiogenesis in of 0.337(P < 0.05). different contexts (24, 25). We find that inhibin induced tube Using Cox proportional hazards regression to analyze the formation 9 and 4.5 times more effectively than TGFb or activin, impact of INHA expression on patient survival, we find that respectively, and to a similar extent as BMP9 (Fig. 2C). Combining higher inhibin a mRNA (INHA) was associated with shorter inhibin with either activin or TGFb resulted in a significant overall survival (OS) in TP53 mutated OVCA's (P < 0.05; HR, increase in tube formation with no further increase observed 1.42, Fig. 1D). Because INHA levels correlate with CD31 in upon combining inhibin with BMP9 (Fig. 2C). A second com- ovarian tumors, we examined whether INHA level in tumors mercial source of inhibin (Supplementary Fig. S3, i) and an would be a stronger predictor of survival in renal clear cell antibody to block recombinant inhibin (Supplementary Fig. carcinomas that are highly angiogenic and for which antiangio- S3, ii) confirmed the specificity of inhibin's impact on tube genic therapies are the mainstay of treatment. We find that renal formation in multiple endothelial cell types (Fig. 2D). To examine clear cell carcinoma patients with high INHA had significantly whether the response of endothelilal cells to inhibin was restricted worse OS, with a median OS of 91.7 versus 54.2 months for to tube formation on Matrigel, we tested chemotactic migration tumors with low and high INHA, respectively (P < 0.005; HR, toward inhibin, endothelial cell spheroid sprouting (Materials 2.02, Fig. 1D). On the basis of these observations, to examine andMethods),andcellproliferation.Noeffectofinhibin whether INHA expression and inhibin a secretion by tumors was on endothelial cell proliferation was observed (Supplementary causal to the increased vascular density and to identify model Fig. S4i). However, inhibin increased endothelial cell migration systems for examining the role of inhibin in tumors, we first toward recombinant inhibin and increased endothelial spher- examined INHA mRNA levels across a panel of OVCA and oid sprouting (Supplementary Fig. S4, ii and S4, iii). Notably, endothelial cells. We find a spectrum of secreted inhibin a and no effect of shRNA to inhibin was observed on tumor cell INHA mRNA expression in epithelial cells (Supplementary Fig. growth (Supplementary Fig. S4, iv) or Matrigel invasion in vitro S1, iv; Fig. 1E) in contrast with low to no INHA expression in all (Supplementary Fig. S4, v). These data suggest a likely endo- four commonly used-endothelial cell lines tested (Fig. 1E). thelial-specific response to inhibin. Although these data do not rule out endothelial cells as potential sources of INHA in the tumor, they suggest epithelial cells as the Effect of inhibin on tumor angiogenesis and metastasis likely source of inhibin in OVCA tissues, and point to a potential Given the SKOV3-derived and recombinant inhibin-dependent correlative impact of inhibin a expression on tumor vasculature. effects on tube formation in vitro (Fig. 2), we examined the impact of paracrine produced and recombinant inhibin in an in vivo Tumor cell–produced inhibin a and recombinant inhibin A Matrigel plug assay. Compared with endothelial cell growth induce specifically endothelial cell responses supplement (ECGS, positive control) and CM from shControl Given the correlation between inhibin a expression and MVD SKOV3 cells (Fig. 3A), CM from shINHA SKOV3 cells that secrete in tumors (Fig. 1C), we examined the impact of epithelial-pro- less inhibin (Fig. 2A) had substantially reduced functional blood duced inhibin on endothelial cell biology by, using shRNA- flow into the Matrigel plug, as measured using hemoglobin mediated suppression of INHA mRNA in epithelial cancer cells. content as a surrogate marker (Fig. 3A, 40% decrease, , P < We used SKOV3 cancer cells (high INHA mRNA), and two 0.01; refs. 23, 26). Because components in CM besides inhibin independent shRNAs to reduce INHA mRNA (Fig. 2A; Supple- could impact angiogenesis into the Matrigel plug in vivo, we next mentary Fig. S2: 2nd shRNA). Reduction in INHA mRNA corre- examined whether recombinant inhibin alone was sufficient to lated with reduced secretion of inhibin a and total dimeric increase blood flow in the Matrigel plug assay using 100 ng/mL inhibin (A/B; from here on referred to as inhibin), as confirmed ECGS as a positive control. We find that compared with PBS,

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2981

Singh et al.

(i) Normal Endometrioid Mucinous Serous A B 100% 80% Low Normal Ovary Endometrioid Serous Mucinous Medium 60% High 40% 20%

500 μm % of Tissue cores 0% (ii) Endometrioid Serous Mucinous 100% Low Medium High 100% 100% 80% 80% 80% Grade III

60% 60% 60% Grade II

40% 40% 40% Grade I

20% 20% 20% % of Tissue cores 0% 0% 0% C Low MedHigh Low MedHigh Low Med High

) 140 2 120 ** low 100 Inhibinα 80 Inhibinαmed/high 60 An-CD31 An-Inhibin α 40

20 Microvessel density/(mm 0

D Ovarian cancer Renal clear cell cancer 1 1 Censors x Censors x Low 0.8 Low 0.8 High High 0.6 0.6 P = 0.0082, HR=1.42 0.4 0.4 Probability Probability P = 7e-06, HR=2.02 0.2 0.2

0 0 0 100 200 0 100 200 Time (months) Time (months) E 0.15

0.1

0.05 mRNA levels Relave INHA OVCA429 A2780 HEY IGROV OVCA4 PA1 M41 OVCA448 OVCA3 OVCA420 SKOV3 HUVEC MEEC BAEC HMEC-1 0 OVCA247

Ovarian cancer Endothelial cell lines cell lines

Figure 1. Inhibin a expression in ovarian carcinoma and RCC and association with angiogenesis and overall survival. A, Representative images from IHC from a human ovarian cancer TMA of either normal tissue or different ovarian cancer subtypes with high inhibin a staining as determined by immunolabeling with anti-inhibin a antibody and IgG control (Supplementary Fig. S1, i). Top, representative high staining cores across subtypes as shown. Zoomed in examples are in Supplementary Fig. S1, ii. Bottom, representative cores scored using a three-tier system (Materials and Methods) as none/trace/low, medium, or high staining as shown across subtypes. B, Quantitation represented as the percentage of cores with inhibin a immunoreactivity scored as none/trace/low, medium, or high staining for (i) each subtype and (ii) relative to tumor grade (I–III) as indicated. C, IHC of tissue arrays immunolabeled with anti-inhibin a or anti-CD31 antibody. Representative images of CD31 staining with the corresponding inhibin a levels from the same cores. Additional examples are in Supplementary Fig. S1, iii. Chart represents MVD quantitation in tumor cores with respect to inhibin a levels quantiﬁed as in A and B and described in Materials and Methods. , P < 0.01 (Mann–Whitney test). Medium and high cores were combined as indicated. D, Overall patient survival with low or high inhibin a (INHA) mRNA in either ovarian cancer or renal clear cell carcinomas. E, INHA mRNA expression by qRT-PCR to detect endogenous INHA mRNA in a panel of ovarian cancer cell lines and endothelial cells as indicated.

2982 Cancer Res; 78(11) June 1, 2018 Cancer Research

Inhibin Promotes Angiogenesis and Metastasis

(i) A (ii) 300 ** 0.15 ***

200 0.1

0.05 100 Inhibin A (ng/ml)

INHA mRNA levels 0 0 shControl shINHA shControl shINHA B CM-shControl 100 150 (i) CM-shINHA CM-shControl *** (ii) 80 IgG An-INHA 120 ** 60 90 40 60 20 30 Number of meshes Number of meshes 0 0 shINHA shControl IgG An-Inhibinα

(iii) *** 100

*** 50

Inhibin A - + + α An-Inhibin --+Number of meshes 0 Inhibin A - + + An-Inhibinα - - + β C Acvin BMP9 TGF 1 - Inhibin A 80 *** + Inhibin A ** 60 *** - Inhibin A 40 ***

20 Number of meshes 0 + Inhibin A Acvin BMP9 TGFβ1 D - Inhibin A + Inhibin A *** *** *** 100 1,000 HMEC-1

0 0 0 *** *** *** 20 100 300 200 50 100 HUVEC

0 0 No. of nodes 0 No. of meshes *** No. of branches *** ** 60 800 200 400 30 100 MEEC 0 0 0 Inhibin A - + - + - +

Figure 2. Inhibin increases endothelial cell tubulogenesis. A, (i) INHA mRNA levels in stable SKOV3 shControl and shINHA cancer cells (Materials and Methods). (ii) ELISA for total inhibin (inhibin a, inhibin A/B) from shControl and shINHA SKOV3 CM. B, Tube formation of HMEC-1 cells in the presence of CM from shControl SKOV3 cancer cells or shINHA SKOV3 cells (i)and10mg/mL anti-inhibin a or IgG control (ii) or treated with 300 pmol/L recombinant inhibin A alone or in the presence of anti-inhibin a antibody [10 mg/mL; (iii)]. Bar graphs represent the average number of meshes quantiﬁed and represents an average of independent trials (Materials and Methods). Mean SEM; , P < 0.00 and , P < 0.01, Student t test; scale bar, 500 mm. C, HMEC-1 treated with equimolar amounts (300 pmol/L) of indicated TGFb members either alone or in combination with inhibin A. Bar graph represents quantitation as in B. One-way ANOVA, Tukey multiple comparison test, , P < 0.001 and , P < 0.01. D, Tube formation of HMEC-1, HUVEC, and MEEC cells upon treatment with 300 pmol/L inhibin A for 16 hours. Graph represents number of meshes, branches, and nodes (Materials and Methods). Mean SEM; , P < 0.001 and , P < 0.01, Student t test; scale bar, 500 mm.

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2983

Singh et al.

CM A B ECGS shControl shINHA ECGS Inhibin A PBS

*** 40 ** 5 4 ** 30 3 20 * 2 10 1

0 Hemoglobin (mg/dL) 0 Hemoglobin (mg/dL)

PBS ECGS ECGS shINHA Inhibin A shControl

C (i) (ii) 72.00 * (iii) n.s. 70.00 No Ascites 1.5 * Ascites 68.00

shINHA 66.00 1.0

* 64.00 0.5 Average girth (cm) shcontrol 62.00 Metastac burden (g) 60.00 0.0 50 10 15 20 Number of mice

Figure 3. Inhibin increases blood vessel formation, tumor angiogenesis, and metastatic burden in vivo. Representative images (top) and hemoglobin quantiﬁcation using Drabkins reagent (bottom) of Matrigel plugs 12 days post-subcutaneous injection of growth factor–reduced Matrigel mixed with either 100 ng/mL ECGS (positive control), shControlCM, or shINHA CM from SKOV3-stable cells (A) or recombinant inhibin A (100 ng/mL) or PBS (negative control; B). Mean SEM; , P < 0.001; , P < 0.01; and , P < 0.05, ANOVA with Holm–Sidak post hoc test; n ¼ 3 mice per condition; scale bar, 20 mm. C, Nude mice were injected intraperitoneally with 5 106 shControl or shINHA SKOV3 cells, animals were sacriﬁced at 7 weeks and/or if body weight loss reached 20% as a humane endpoint. Ascites and metastatic burden were examined at necropsy: (i) number of mice per group that had ascites, (ii) abdominal girth measurements (in triplicate) at the beginning and end points, (iii) overall weight of tumors/lesions found in the peritoneal cavity. , P < 0.05, c2 test for (i) and Mann–Whitney U test for (ii)and(iii). n ¼ 13 mice per group (two independent trials combined). Sample mouse images are provided in Supplementary Fig. S4, vi.

100 ng/mL inhibin led to twice as much hemoglobin content with ovarian tumors (Supplementary Fig. S4, vi, dotted yellow circles). visibly distinct vasculature in the Matrigel plug (Fig. 3B, 50% However, while 10/13 mice injected with shControl SKOV3 cells increase relative to PBS, , P < 0.05). These data together indicate accumulated ascites, only 5/13 mice injected with shINHA cells that inhibin induces blood vessel formation in vivo. had ascites (Fig. 3C, i). Consistently, only mice receiving shCon- Angiogenesis is critical for peritoneal metastasis manifested trol SKOV3 cells showed an increase in abdominal girth (initial by accumulation of ascites in >70% of advanced human OVCA girth vs. final girth; Fig. 3C, ii). Necropsy confirmed that tumor (27, 28). To mimic the widespread intra-abdominal metastasis burden in the abdominal cavity was significantly higher in mice observed in the peritoneal cavity during OVCA progression (29, receiving shControl cells as compared with mice receiving 30), we injected nude mice intraperitoneally (intrapertoneal shINHA SKOV3 cells (Fig. 3C, iii). Together, these findings are injection) and used this in vivo model to determine whether the the first to link a reduction in inhibin with suppression of reduced angiogenesis observed in shINHA SKOV3 cells in Matri- angiogenesis and metastatic burden in vivo. gel plugs and in in vitro analysis (Fig. 2) translated to alterations in peritoneal burden and ascites accumulation. We intrapertoneally Inhibin specifically promotes SMAD1/5 activation in injected either shControl or shINHA SKOV3 cells into 7-week-old endothelial cells using the TGFb coreceptor endoglin athymic female nude mice. Seven weeks after tumor cell injec- Because TGFb family members transduce signals via SMAD2/3 tions, mice were sacrificed and ascites and tumor burden quan- or SMAD1/5 pathways, we examined the effects of paracrine tified (Materials and Methods). We find that all mice contained and recombinant inhibin on SMAD2/3 and SMAD1/5

2984 Cancer Res; 78(11) June 1, 2018 Cancer Research

Inhibin Promotes Angiogenesis and Metastasis

A HMEC-1 Condioned media from SKOV3 shControl shINHA 2.00 ** 0 5 10 20 40 60 05 10 20 40 60 Time (min) ** P-Smad1/5 1.50 n.s. Smad1 1.00

P-Smad2/3 Normalized 0.50

Smad2/3 P-SMAD1/5/SMAD1 0.00 Time (min) 0 20 40 0 20 40 GAPDH shControl shINHA

B 20pM Inhibin A C HMEC-1 HMEC-1 MEEC 20pM Inhibin A - Inhibin A + Inhibin A HMEC-1 Time (min) 0 15 30 0 15 30 MEEC 2.5 *** -Inhibin P-SMAD1/5 * * 2.0 2.0 100 +Inhibin SMAD1 1.5

- TRC105 n.s. meshes P-SMAD2/3 1.0 1.0 50 Normalized of SMAD2 (arbitrary units) 0.5 P-SMAD1/5/SMAD1 0.0 0.0 No. 0 β -Acn Time (min) 015 30 0 15 30 - TRC105 + TRC105 + TRC105

HMEC-1 D (i) - Inhibin A + Inhibin A 150 *** 0.1 *** - Inhibin + Inhibin

NTC 100

0.05 meshes

mRNA n.s.

of 50 Relave ENG No. 0 0

NTC shENG

shENG NTC shENG

(ii) 20 pM Inhibin A 20pM Inhibin A HMEC-1 NTC HMEC-1 shENG 2.0

0 20 40 60 0 20 40 60 Time (min) ** 1.5 * ** P-Smad1/5 n.s. Smad1/5 1.0

P-Smad2/3 Normalized 0.5 Smad2 0.0 GAPDH Time P-SMAD1/5/SMAD1 (min) 0 20 40 60 0 20 40 60 shControl shINHA MEEC E (i) - Inhibin A + Inhibin A *** - Inhibin (ii) 20 pM Inhibin A + Inhibin 60 MEEC ENG +/+ MEEC ENG -/-

ENG+/+ 40 0 5 10 20 40 60 05 10 20 40 60 Time (min) meshes P-Smad1/5

20 Smad1/5 No. of 0 GAPDH ENG-/- ENG+/+ ENG-/-

Figure 4. Endoglin is essential for inhibin-induced signaling and tubulogenesis. A, Western blot analysis of lysates from HMEC-1 cells serum starved for 6 hours and then incubated with indicated CM for up to 60 minutes, followed by immunoblotting of lysates. Quantitation of pSMAD1/5 changes (right graph) from two independent biological trials B, Western blot analysis of lysates from HMEC-1 or MEECs serum starved for 6 hours and then incubated with 20 pmol/L inhibin A for up to 30 minutes, followed by immunoblotting of lysates as indicated. Quantitation of pSMAD1/5 changes (right graph) from two independent biological trials. C, Tube formation of HMEC-1 cells in the presence or absence of recombinant inhibin A (300 pmol/L) either untreated or pretreated with 100 mg/mL TRC105 for 30 minutes before inhibin A treatment. Average number of meshes/ﬁeld quantiﬁed 16 hours after inhibin treatment (Materials and Methods). Scale bar, 500 mm. D, qRT-PCR analysis of endoglin mRNA after transient knockdown of endoglin using either control shRNA in HMEC-1 (shControl) or shRNA to endoglin, followed by (i) tube formation in the absence or presence of recombinant inhibin A. Graph of average number of meshes as described in Materials and Methods; scale bar, 500 mm. (ii) Western blotting for SMAD1/5 phosphorylation in response to 20 pmol/L inhibin A for up to 60 minutes. Quantitation of pSMAD1/5 changes (right graph) from two independent biological trials is presented. E, (i) Tube formation in MEEC ENGþ/þ cells and endoglin null ENG/ MEECs cells in the absence or presence of inhibin A after 16 hours. Graph of average number of meshes as described in Materials and Methods; scale bar, 500 mm. (ii) Western blotting for SMAD1/5 phosphorylation in response to 20 pmol/L inhibin A for up to 60 minutes in MEEC ENGþ/þ or ENG/ cells as indicated.

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2985

Singh et al.

phosphorylation in endothelial cells. We find that CM from binant inhibin, SKOV3 epithelial cancer cells did not stimulate shControl SKOV3 cells (Fig. 2A) specifically increased phosphor- phosphorylation of SMAD1/5 in response to recombinant inhib- ylation of SMAD1/5 in endothelial cells (Fig. 4A), whereas no in (Supplementary Fig. S6, ii). change in phosphorylation of SMAD2/3 was observed (Fig. 4A). SMAD1/5 activation positively regulates angiogenesis Reducing inhibin in the CM of SKOV3 cells by INHA shRNA (Fig. (31, 32) and our data indicate inhibin specifically induces 2A) resulted in significantly reduced SMAD1/5 activation in SMAD1/5 activation in endothelial cells. These data suggest endothelial cell lines (Fig. 4A). We further tested the specificity a requirement of endothelial-specific receptors for the observed of inhibin's effects within CM on SMAD1/5 phosphorylation by inhibin response. Endoglin/CD105 is a well-established endo- incubating CM with an inhibin a antibody. We find that CM- thelial-specificTGFb coreceptor that we, and several others, induced SMAD1/5 phosphorylation was suppressed significantly have shown to have key roles in transducing angiogenic signals by the antibody to similar extents as shINHA SKOV3 CM (Sup- (33). To test whether inhibin induced tube formation and plementary Fig. S5). To determine the specificity and kinetics of SMAD1/5 phosphorylation in endothelial cells are dependent the SMAD1/5 activation, we used recombinant inhibin and find on endoglin, we employed three approaches, (i) a humanized that recombinant inhibin robustly activated only SMAD1/5, and monoclonal antibody to endoglin TRC105 that we and others not SMAD2/3 (Fig. 4B) in multiple endothelial cells in a time and have shown to neutralize endoglin function (34, 35), (ii) a dose dependent manner (Supplementary Fig. S6, i). In contrast previously characterized endoglin knockout mouse embryonic with the signaling responsiveness of endothelial cells to recom- endothelial cell line (MEECs, ENG / and corresponding

*** A - Inhibin A + Inhibin A 100 B 100 pM Inhibin A - ML347 +ML347 ML347 ** 50 0 30 60 0 30 60 Time (min) P-Smad1/5

No. of meshes 0 Smad1/5 Inhibin A - + + GAPDH ML347 - - +

C - Inhibin A + InhibinA D 20 pM Inhibin A ***

100 - Inhibin 0.003 shControl shALK1 + Inhibin 0 5 10 20 40 60 0 5 10 20 40 60 Time (min) 0.002 shControl 50 P-Smad1/5 0.001 of meshes Smad1/5

0 No. 0 GAPDH shALK1 shControl shALK1 ALK1 mRNA expression shALK1 shControl

E Unprocessed Processed Colocalized F ENG+/+

COS7 image image pixels A ENG+/+ *** *** 20 ENG-/- 60

- Inhibin 15 ENG+/+ 40 - Inhibin A 10 n.s. 5 + Inhibin A Co-patching 20

Alk1-myc-ENG/nuclei %

A ENG-/- 0 Inhibin A - + + + Inhibin A 0

ENG-HA Inhibin A - + Inhibin + ALK1-myc

Figure 5. Inhibin A induced tube formation and SMAD1/5 phosphorylation is mediated via ALK1 receptor kinases. Tube formation (A) and SMAD1/5 phosphorylation (B)in HMEC-1 cells in response to inhibin A in the absence and presence of 5 mmol/L of ML347 (ALK1,2 inhibitor) added 30 minutes before treatment with inhibin A. Graph of average number of meshes as described in Materials and Methods. C, qRT-PCR analysis of ALK1 mRNA in HMEC-1 cells transfected with either control (shControl) or ALK1 shRNA (shALK1) for 48 hours before tube formation assays in the absence or presence of recombinant inhibin A. D, Western blotting for SMAD1/5 phosphorylation in response to 20 pmol/L inhibin A treatments for up to 60 minutes. Graph of average number of meshes as described in Materials and Methods. Mean SEM; , P < 0.001 and , P < 0.01, Student t test; scale bar, 500 mm. E, Endoglin-HA and ALK1-Myc receptor complex formation at the cell surface of COS7 cells either untreated or stimulated with 100 pmol/L inhibin A, followed by immunolabeling with anti-Myc and anti-HA antibodies at 4C to capture cell surface interactions (Materials and Methods). The unprocessed images are raw images. Processed images represent a 20% reduction in intensity and colocalized images show only those pixels where red (ALK1-Myc) and green (ENG-HA) punctum overlap. Bar graph shows percentage of co-patched puncta of ALK1-Myc/Endoglin HA complexes. , P < 0.001 (n ¼ 5 ﬁelds/condition), ANOVA with Holm-Sidak post hoc test; scale bar, 500 mm. F, Endogenous endoglin interactions with Myc-tagged Alk1 determined using a proximity ligation assay in MEEC ENGþ/þ and MEEC ENG/ either untreated or upon inhibin A treatment for 30 minutes; scale bar, 20 mm. Bar graph shows ALK1–ENG interactions normalized to nuclei (n ¼ 10/condition).

2986 Cancer Res; 78(11) June 1, 2018 Cancer Research

Inhibin Promotes Angiogenesis and Metastasis

wild-type MEECs; refs. 15, 36), and (iii) endoglin shRNA. We strongly suggest a novel endoglin-ALK1 response to inhibin, find that inhibin-induced tube formation was significantly aTGFb family ligand with previously unknown functions in reduced by TRC105 compared with cells treated with inhibin cancer and in endothelial cells. Taken together, we demonstrate alone (Fig. 4C). Both endoglin shRNA in HMEC-1s and endo- a novel signaling ligand for angiogenesis in cancer. glin knockout in MEEC ENG / abrogated inhibin-induced tube formation and SMAD1/5 activation (Fig. 4D and E, Discussion respectively). These data demonstrate that endoglin is a key mediator of inhibin responses. Using a combination of antibody and shRNA-based approaches coupled with in vivo experimental models; we have Inhibin-induced signaling and tube formation require ALK1 identified and defined a novel paracrine regulator of tumor and promote endoglin–ALK1 interactions in endothelial cells angiogenesis. Although inhibin has long been known to be SMAD1/5 is phosphorylated by specific serine threonine elevated in multiple cancers no specific mechanism of action and kinase type I receptors (37). We thus sought to identify outcome of elevated inhibin has been previously established. thetypeITGFb receptor in inhibin-induced SMAD1/5 signaling Our findings provide the first evidence of inhibin's ability to and angiogenesis. We first determined the mRNA levels of transduce signals and act as a pacracrine tumor angiogenic factor. different TGFb type I receptors (ALK1-7) in HMEC-1's as Likewise, we provide the first use of an anti-inhibin a antibody to compared with epithelial SKOV3 cells, because inhibin- suppress angiogenesis. In accordance with prior studies, we induced signaling was specific to endothelial cells (Supplemen- observed inhibin a overexpression in a spectrum of ovarian tary Fig. S6, ii). qRT-PCR analysis (Supplementary Fig. S7, i) cancers (Fig. 1) and observed increased inhibin a levels in tumors indicated higher ALK1 and ALK3 mRNA levels compared with correlating with MVD in patients and xenograft tumors. Increased ALK2, 4, 5, 6,7 in endothelial cells with limited ALK1 expres- inhibin a also correlated with poor overall patient survival, sion in SKOV3 cells (Supplementary Fig. S7, i, right graph). We particularly in high-grade serous ovarian cancer patients with thus used the ALK1/2 inhibitor ML347, to block ALK1 and alterations in TP53 and in renal clear cell carcinomas that are partially block ALK2/3 (IC50 for ALK1,2,3 are 46 nmol/L, 32 highly angiogenic. Notably, we demonstrate a novel function for nmol/L and 10 mmol/L, respectively). SB431542 and Dorso- inhibin that is dependent on endothelial specific TGFb receptors morphinwereusedtoblockALK5,4,7andALK2,3,6,respec- endoglin and ALK1, which are upregulated during tumor angio- tively (38). We find that ML347 was able to suppress inhibin genesis and explored as angiogenic targets (43). Surprisingly, induced tube formation (Fig. 5A, 1.2 fold, , P < 0.001), suppressing inhibin a expression and inhibin secretion in tumor and completely blocked inhibin induced SMAD1/5 activation cells had marginal effects on epithelial (autocrine) cell growth (Fig. 5B). SB431542 and dorsomorphin had no significant (Supplementary Fig. S4iv). However, in the intraperitoneal model impact on inhibin induced tube formation (Supplementary that mimics human disease leading to ascites accumulation and Fig. S7, ii). These data implicate ALK1 kinase activity in inhibin peritoneal spread (44, 30), inhibin a shRNA significantly reduced induced tube formation and signaling responses. To confirm a ascites accumulation and peritoneal tumor burden in vivo role for ALK1, shRNA to ALK1 (shALK1) was used in HMEC-1's (Fig. 3C), indicating not just a significant role for inhibin in and compared with control HMEC-1's. shALK1 cells were metastasis but also the potential significance of inhibin induced unable to mount an inhibin-mediated tubulogenesis response angiogenesis in this process. Although our findings using inhibin (Fig. 5C). shAlk1 HMEC-1 cells were also unable to increase a antibodies (Fig. 2) and recombinant inhibin in in vitro (Figs. SMAD1/5 phosphorylation in response to inhibin, to the same 2, 4, 5) and in vivo Matrigel plug assays (Fig. 3A) indicate a direct extent as shControl HMEC-1 cells (Fig. 5D). These data impli- role for inhibin on angiogenesis that is reduced upon cate ALK1 in mediating inhibin signaling in endothelial cells. INHA shRNA, one alternate mechanism for reduced metastasis ALK1, a primarily endothelial-specific receptor (39), forms observed using shINHA tumor cells could be alterations in pro- stable complexes with endoglin, and this interaction is required angiogenic factors secreted from the tumor cells that warrants for SMAD1/5 signaling (40). To test whether stable, cell surface future investigation. ALK1–endoglin interactions could be regulated by inhibin, we Previous studies on inhibin signaling, emphasize the non- used a live cell co-patching method (41). We transiently signaling interactions with the TGFb coreceptor betaglycan via expressed HA-tagged endoglin (ENG-HA) and Myc-tagged the a subunit in epithelial cells, highlighting a competitive ALK1 (ALK1-Myc) in COS7 cells and determined the change antagonist model for inhibin with TGFb members (13, 45). in percentage of co-patched receptors at the cell surface upon However, some outcomes of inhibin, including effects of inhibin treatment. We find a 20% baseline interaction between inhibininprostatecancermetastasis (11) and systems where ALK1-Myc and endoglin-HA, which increased significantly to inhibin does not antagonize activin (46), appear inconsistent 60% upon inhibin treatment (Fig. 5E, , P < 0.001), suggest- with this model as inhibin's only mode action. Supporting the ing inhibin-dependent increases in ALK1-endoglin complexes possibility of additional modes of action for inhibin, we find at the cell surface. To complement the COS7 cell surface co- that activin primarily activates SMAD2/3 in endothelial cells patch studies and confirm the effect of inhibin in the endo- (Supplementary Fig. S8), contrasting with inhibin, which thelial environment, we used a proximity ligation assay (42) in primarily activates SMAD1/5 exclusively in endothelial cells MEECs. We examined and quantified the proximity of ALK1- (Fig. 4B; Supplementary Fig. S6ii). Because our findings dem- HA and endogenous endoglin in unstimulated and inhibin onstrate the critical role for endoglin (Fig. 4) in inhibin stimulated MEECs and find a significant increase in the ALK1 induced angiogenesis and signaling (Fig. 4), it is likely that proximity interactions with endogenous endoglin in response the established model of inhibin's functional antagonism to a 30 minutes inhibin treatment. ENG / MEECs were used as using betaglycan, may not be the same in endothelial cells controls (Fig. 5F, , P < 0.001). Together, these findings that express endoglin.

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2987

Singh et al.

In addition to inhibin, the ligands that use these receptors Authors' Contributions include TGFb1, and BMP9/GDF2 that can activate both Conception and design: P. Singh, K. Mythreye ALK1/SMAD1/5/8 and ALK5/Smad2/3 (1). We find that Acti- Development of methodology: P. Singh, L.M. Jenkins, V. Alers, B. Gyorffy, vin significantly activates Smad2/3 with limited activation of K. Mythreye Acquisition of data (provided animals, acquired and managed patients, SMAD1/5 (Supplementary Fig. S8). The SMAD2/3 pathway is provided facilities, etc.): L.M. Jenkins, B. Horst, P. Kaur, K. Mythreye an established antiangiogenic mechanism contrasting with Analysis and interpretation of data (e.g., statistical analysis, biostatistics, SMAD1/5 as a proangiogenic mechanism (1). Consistently, computational analysis): P. Singh, L.M. Jenkins, B. Horst, V. Alers, S. Pradhan, activin did not support angiogenesis in vitro (Fig. 2) and was T. Srivastava, B. Gyorffy, E.V. Broude, N.Y. Lee, K. Mythreye reported to suppress angiogenesis in vivo (47). Combining Writing, review, and/or revision of the manuscript: P. Singh, L.M. Jenkins, inhibin with other TGFb members in vitro (Fig. 2), reveal that B. Horst, N. Hempel, B. Gyorffy, E.V. Broude, N.Y. Lee, K. Mythreye inhibin promotes angiogenesis to the same extent as BMP9 Administrative, technical, or material support (i.e., reporting or organizing b data, constructing databases): P. Singh, L.M. Jenkins, N.Y. Lee, K. Mythreye and can override both TGF and activin in inducing angio- Study supervision: E.V. Broude, K. Mythreye genesis. It is likely that the specificity of SMAD1/5 activation in response to inhibin (unlike TGFb, BMP9) represents an Acknowledgments important distinction between inhibin and other TGFb mem- We thank Drs. Shannon Davis and Ioluia Chatzistamou for help with bers in angiogenesis that necessitate future in depth analysis. mouse tissue processing and analysis of tissue cores, Andy Nixon and In summary, we provide new insights for inhibin in cancer, a Miao at Duke University with optimizing inhibin ELISAs and the "Uni- hormone and TGFb family member under investigation for over versity of South Carolina Center for Targeted Therapeutics Functional Genomics Core Facility" for lentiviral preparations andthe"University 90 years and provide a molecular and mechanistic basis for of South Carolina Center for Targeted Therapeutics Microscopy and Flow clinical outcomes observed in these cancers based on inhibin Cytometry Core Facility" for help with imaging. This work was funded by expression. Inhibin can have pronounced effects on angiogenesis the NIH grant 5P20-GM109091 and a grant from the Marsha Rivkin and metastasis with broad therapeutic implications for other Foundation to Karthikeyan Mythreye, USC Aspire Fellowship to P. Singh cancers as well. We thus propose inhibin as an attractive and safe and the USC SPARC Graduate Research Grant AAUW Dissertation target for ovarian cancer and other cancers prevalent in postmen- Fellowship, and NIH Predoctoral F31 Fellowship, (GM122379-01; to L.M. Jenkins). opausal women where inhibin levels are normally very low, thereby limiting potential on target side effects. Further investi- The costs of publication of this article were defrayed in part by the gation into anti-inhibin therapeutic strategies, as a result, is payment of page charges. This article must therefore be hereby marked warranted. advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Disclosure of Potential Conflicts of Interest Received August 2, 2017; revised January 3, 2018; accepted March 9, 2018; No potential conflicts of interest were disclosed. published first March 13, 2018.

References 1. Pardali E, ten Dijke P. Transforming growth factor-beta signaling and pro-metastatic and associated with extracapsular spread in advanced tumor angiogenesis. Front Biosci 2009;14:4848–61. prostate cancer. Br J Cancer 2009;100:1784–93. 2. Overlie I, Morkrid L, Andersson AM, Skakkebaek NE, Moen MH, Holte A. 12. Farnworth PG, Harrison CA, Leembruggen P, Chan KL, Stanton PG, Ooi Inhibin A and B as markers of menopause: a five-year prospective longi- GT, et al. Inhibin binding sites and proteins in pituitary, gonadal, adrenal tudinal study of hormonal changes during the menopausal transition. Acta and bone cells. Mol Cell Endocrinol 2001;180:63–71. Obstet Gynecol Scand 2005;84:281–5. 13. Lewis KA, Gray PC, Blount AL, MacConell LA, Wiater E, Bilezikjian LM, et al. 3. Walentowicz P, Krintus M, Sadlecki P, Grabiec M, Mankowska-Cyl A, Betaglycan binds inhibin and can mediate functional antagonism of Sokup A, et al. Serum inhibin A and inhibin B levels in epithelial ovarian activin signalling. Nature 2000;404:411–4. cancer patients. PLoS One 2014;9:e90575. 14. Gatza CE, Oh SY, Blobe GC. Roles for the type III TGF-beta receptor in 4. Robertson DM, Pruysers E, Jobling T. Inhibin as a diagnostic marker for human cancer. Cell Signal 2010;22:1163–74. ovarian cancer. Cancer Lett 2007;249:14–7. 15. Pece-Barbara N, Vera S, Kathirkamathamby K, Liebner S, Di Guglielmo 5. Walton KL, Makanji Y, Robertson DM, Harrison CA. The synthesis and GM, Dejana E, et al. Endoglin null endothelial cells proliferate faster and secretion of inhibins. Vitam Horm 2011;85:149–84. are more responsive to transforming growth factor beta1 with higher 6. Matzuk MM, Finegold MJ, Su JG, Hsueh AJ, Bradley A. Alpha-inhibin is a affinity receptors and an activated Alk1 pathway. J Biol Chem 2005; tumour-suppressor gene with gonadal specificity in mice. Nature 1992; 280:27800–8. 360:313–9. 16. Tian H, Mythreye K, Golzio C, Katsanis N, Blobe GC. Endoglin mediates 7. Shanbhag SA, Sheth AR, Nanivadekar SA, Sheth NA. Immunoreactive fibronectin/alpha5beta1 integrin and TGF-beta pathway crosstalk in endo- inhibin-like material in serum and gastric juice of patients with benign thelial cells. EMBO J 2012;31:3885–900. and malignant diseases of the stomach. Br J Cancer 1985;51:877–82. 17. Gilboa L, Wells RG, Lodish HF, Henis YI. Oligomeric structure of type I 8. Suzuki Y, Sugiyama M, Abe N, Fujioka Y, Atomi Y. Immunohistochemical and type II transforming growth factor beta receptors: homodimers form similarities between pancreatic mucinous cystic tumor and ovarian mucin- in the ER and persist at the plasma membrane. J Cell Biol 1998;140: ous cystic tumor. Pancreas 2008;36:e40–6. 767–77. 9. McCluggage WG, Maxwell P. Adenocarcinomas of various sites may exhibit 18. Varadaraj A, Jenkins LM, Singh P, Chanda A, Snider J, Lee NY, et al. TGF- immunoreactivity with anti-inhibin antibodies. Histopathology 1999;35: beta triggers rapid fibrillogenesis via a novel TbetaRII dependent fibro- 216–20. nectin trafficking mechanism. Mol Biol Cell 2017;28:1195–1207. 10. McCluggage WG, Maxwell P, Patterson A, Sloan JM. Immunohistochem- 19. Malinda KM. In vivo matrigel migration and angiogenesis assay. Methods ical staining of hepatocellular carcinoma with monoclonal antibody Mol Biol 2009;467:287–94. against inhibin. Histopathology 1997;30:518–22. 20. DeCicco-Skinner KL, Henry GH, Cataisson C, Tabib T, Gwilliam JC, 11. Balanathan P, Williams ED, Wang H, Pedersen JS, Horvath LG, Achen MG, Watson NJ, et al. Endothelial cell tube formation assay for the in vitro et al. Elevated level of inhibin-alpha subunit is pro-tumourigenic and study of angiogenesis. J Vis Exp 2014:e51312.

2988 Cancer Res; 78(11) June 1, 2018 Cancer Research

Inhibin Promotes Angiogenesis and Metastasis

21. Laib AM, Bartol A, Alajati A, Korff T, Weber H, Augustin HG. Spheroid- for endoglin shedding and deregulation of TGF-beta signaling. Oncogene based human endothelial cell microvessel formation in vivo. Nat Protoc 2014;33:3970–9. 2009;4:1202–15. 36. Barbara NP, Wrana JL, Letarte M. Endoglin is an accessory protein that 22. Wu SY, Rupaimoole R, Shen F, Pradeep S, Pecot CV, Ivan C, et al. A miR- interacts with the signaling receptor complex of multiple members of 192-EGR1-HOXB9 regulatory network controls the angiogenic switch in the transforming growth factor-beta superfamily. J Biol Chem 1999; cancer. Nat Commun 2016;7:11169. 274:584–94. 23. Stone RL, Baggerly KA, Armaiz-Pena GN, Kang Y, Sanguino AM, Thanap- 37. Massague J, Attisano L, Wrana JL. The TGF-beta family and its composite prapasr D, et al. Focal adhesion kinase: an alternative focus for anti- receptors. Trends Cell Biol 1994;4:172–8. angiogenesis therapy in ovarian cancer. Cancer Biol Ther 2014;15:919–29. 38. Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, et al. 24. David L, Feige JJ, Bailly S. Emerging role of bone morphogenetic proteins in SB-431542 is a potent and speciﬁc inhibitor of transforming growth factor- angiogenesis. Cytokine Growth Factor Rev 2009;20:203–12. beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, 25. Jin Y, Kaluza D, Jakobsson L. VEGF, Notch and TGFbeta/BMPs in regula- ALK5, and ALK7. Mol Pharmacol 2002;62:65–74. tion of sprouting angiogenesis and vascular patterning. Biochem Soc Trans 39. Bertolino P, Deckers M, Lebrin F, ten Dijke P. Transforming growth factor- 2014;42:1576–83. beta signal transduction in angiogenesis and vascular disorders. Chest 26. Pecot CV, Rupaimoole R, Yang D, Akbani R, Ivan C, Lu C, et al. Tumour 2005;128:585S–90S. angiogenesis regulation by the miR-200 family. Nat Commun 2013; 40. Pomeraniec L, Hector-Greene M, Ehrlich M, Blobe GC, Henis YI. Regula- 4:2427. tion of TGF-beta receptor hetero-oligomerization and signaling by endo- 27. Tan DS, Agarwal R, Kaye SB. Mechanisms of transcoelomic metastasis in glin. Mol Biol Cell 2015;26:3117–27. ovarian cancer. Lancet Oncol 2006;7:925–34. 41. Gilboa L, Nohe A, Geissendorfer T, Sebald W, Henis YI, Knaus P. Bone 28. Ahmed N, Stenvers KL. Getting to know ovarian cancer ascites: opportu- morphogenetic protein receptor complexes on the surface of live cells: a nities for targeted therapy-based translational research. Front Oncol new oligomerization mode for serine/threonine kinase receptors. Mol Biol 2013;3:256. Cell 2000;11:1023–35. 29. Shaw TJ, Senterman MK, Dawson K, Crane CA, Vanderhyden BC. Char- 42. Soderberg O, Gullberg M, Jarvius M, Ridderstrale K, Leuchowius acterization of intraperitoneal, orthotopic, and metastatic xenograft mod- KJ, Jarvius J, et al. Direct observation of individual endogenous els of human ovarian cancer. Mol Ther 2004;10:1032–42. protein complexes in situ by proximity ligation. Nat Methods 2006; 30. Connolly DC, Hensley HH. Xenograft and transgenic mouse models of 3:995–1000. epithelial ovarian cancer and non-invasive imaging modalities to monitor 43. Jonker L.TGF-beta & BMP receptors endoglin and ALK1: overview of their ovarian tumor growth in situ: applications in evaluating novel therapeutic functional role and status as antiangiogenic targets. Microcirculation agents. Curr Protoc Pharmacol 2009;45:14.12.1–14.12.26. 2014;21:93–103. 31. Goumans MJ, Valdimarsdottir G, Itoh S, Lebrin F, Larsson J, Mummery C, 44. Jazaeri AA, Bryant JL, Park H, Li H, Dahiya N, Stoler MH, et al. Molecular et al. Activin receptor-like kinase (ALK)1 is an antagonistic mediator of requirements for transformation of fallopian tube epithelial cells into lateral TGFbeta/ALK5 signaling. Mol Cell 2003;12:817–28. serous carcinoma. Neoplasia 2011;13:899–911. 32. David L, Mallet C, Mazerbourg S, Feige JJ, Bailly S. Identiﬁcation of BMP9 45. Looyenga BD, Wiater E, Vale W, Hammer GD. Inhibin-A antagonizes and BMP10 as functional activators of the orphan activin receptor-like TGFbeta2 signaling by down-regulating cell surface expression of the kinase 1 (ALK1) in endothelial cells. Blood 2007;109:1953–61. TGFbeta coreceptor betaglycan. Mol Endocrinol 2010;24:608–20. 33. Nassiri F, Cusimano MD, Scheithauer BW, Rotondo F, Fazio A, Yousef GM, 46. Wang QF, Tilly KI, Tilly JL, Preffer F, Schneyer AL, Crowley WF Jr, et al. et al. Endoglin (CD105): a review of its role in angiogenesis and tumor Activin inhibits basal and androgen-stimulated proliferation and induces diagnosis, progression and therapy. Anticancer Res 2011;31:2283–90. apoptosis in the human prostatic cancer cell line, LNCaP. Endocrinology 34. Rosen LS, Hurwitz HI, Wong MK, Goldman J, Mendelson DS, Figg WD, 1996;137:5476–83. et al. A Phase 1 First-in-Human Study of TRC105 (Anti-Endoglin Antibody) 47. Kaneda H, Arao T, Matsumoto K, De Velasco MA, Tamura D, Aomatsu K, in Patients with Advanced Cancer. Clin Cancer Res 2012;18:4820–9. et al. Activin A inhibits vascular endothelial cell growth and suppresses 35. Kumar S, Pan CC, Bloodworth JC, Nixon AB, Theuer C, Hoyt DG, et al. tumour angiogenesis in gastric cancer. British journal of cancer 2011;105: Antibody-directed coupling of endoglin and MMP-14 is a key mechanism 1210–7.

www.aacrjournals.org Cancer Res; 78(11) June 1, 2018 2989

Inhibin Is a Novel Paracrine Factor for Tumor Angiogenesis and Metastasis

Priyanka Singh, Laura M. Jenkins, Ben Horst, et al.

Cancer Res 2018;78:2978-2989. Published OnlineFirst March 13, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-2316

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/03/13/0008-5472.CAN-17-2316.DC1

Cited articles This article cites 45 articles, 12 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/11/2978.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/78/11/2978.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/11/2978. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.