Epithelial IL-33 Appropriates Exosome Trafficking for Secretion in Chronic Airway Disease

Epithelial IL-33 appropriates exosome trafficking for secretion in chronic airway disease

Ella Katz-Kiriakos, … , Mark J. Miller, Jennifer Alexander-Brett

JCI Insight. 2021. https://doi.org/10.1172/jci.insight.136166.

Research In-Press Preview Immunology Pulmonology

Graphical abstract

Find the latest version: https://jci.me/136166/pdf TITLE: Epithelial IL-33 appropriates exosome trafficking for secretion in chronic airway disease

AUTHORS: Ella Katz-Kiriakos1, Deborah F. Steinberg1, Colin E. Kluender1, Omar A.

Osorio1, Catie Newsom-Stewart1, Arjun Baronia1, Derek E. Byers1, Michael J.

Holtzman1,2, Dawn Katafiasz3, Kristina L. Bailey3, Steven L. Brody1, Mark J. Miller4,

Jennifer Alexander-Brett1,5*

Affiliations:

1Department of Medicine, Division of Pulmonary and Critical Care Medicine

Washington University School of Medicine, Saint Louis, MO, USA

2Department of Cell Biology and Physiology

Washington University School of Medicine, Saint Louis, MO, USA

3Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Allergy

University of Nebraska Medical Center, Omaha, Nebraska, USA

4Department of Medicine, Division of Infectious Diseases

Washington University School of Medicine, Saint Louis, MO, USA

5Department of Pathology and Immunology

Washington University School of Medicine, Saint Louis, MO, USA

*Corresponding Author: Jennifer Alexander-Brett, Campus Box 8052 660 S. Euclid Ave.

Washington University St. Louis, MO 63110 phone: 314-273-1554 email: [email protected]

2 CONFLICT OF INTEREST STATEMENT: MJH serves as a member of the data and safety monitoring board of clinical trials done by AstraZeneca and as president/founder

NuPeak Therapeutics. All other authors declare no conflict of interest.

ABSTRACT

Interleukin-33 (IL-33) is a key mediator of chronic airway disease driven by type-2 immune pathways, yet the non-classical secretory mechanism for this cytokine remains undefined.

We performed a comprehensive analysis in human airway epithelial cells, which revealed that tonic IL-33 secretion is dependent on the ceramide biosynthetic enzyme neutral sphingomyelinase 2 (nSMase2). IL-33 is co-secreted with exosomes by the nSMase2- regulated multivesicular endosome (MVE) pathway as surface-bound cargo. In support of these findings, human chronic obstructive pulmonary disease (COPD) specimens exhibited increased epithelial expression of the abundantly secreted IL33Δ34 isoform and augmented nSMase2 expression compared to non-COPD specimens. Using an

Alternaria-induced airway disease model, we found the nSMase2 inhibitor GW4869 abrogated both IL-33 and exosome secretion as well as downstream inflammatory pathways. This work elucidates a novel aspect of IL-33 biology that may be targeted for therapeutic benefit in chronic airway diseases driven by type-2 inflammation.

4 INTRODUCTION

IL-33 is a cytokine abundantly expressed at mucosal barriers (1) that has been shown to promote type 2-polarized immune programs in health and disease (2, 3). A role for IL-33 in human type-2 driven chronic airway disease was highlighted by genome-wide association studies linking IL33 and IL1RL1/ST2 with asthma (4-6), and increased IL-33 in serum, sputum or tissue from asthma (7, 8) and chronic obstructive pulmonary disease

(COPD) patients (9-11). Animal models have also supported a role for IL-33 in response to virus (9) or allergen (12, 13) triggers of airway disease. The IL-33 system is also broadly linked to pulmonary inflammation, arthritis, inflammatory bowel disease, hepatitis, heart failure, central nervous system inflammation and cancer (reviewed in (2)). This wide- ranging disease relevance emphasizes the necessity to understand how a nuclear- targeted cytokine or ‘nucleokine’ lacking a classical secretion signal can be released from intact cells to propagate inflammation.

Human full-length IL-33 (IL-33full) is a 270-amino acid protein encoded by eight exons that encompass the N-terminal ‘chromatin-interacting’ domain (NTD) and C- terminal ‘cytokine’ domain (CTD). The NTD chromatin-interacting motif (14) appears to be responsible for tightly sequestering IL-33 within the nucleus, presumably to regulate the cytokine, as a specific nuclear function for full-length IL-33 protein has yet to be firmly established (15). The CTD includes exons 5-8 and is sufficient to induce signaling through the IL-33 receptor (IL-1RL1/ST2 and IL-1RAP) (16). Unlike the prototypic IL-1 family member, IL-1β, IL-33 is not cleaved by inflammasome-associated caspases (17, 18).

Apoptotic and inflammatory proteases can process full-length IL-33 in vitro, which can result in either enhanced function (19) or deactivation (20, 21). While these in vitro studies

5 have shown processed cytokine retains activity, it remains unknown whether proteolysis is required for activation or secretion of endogenous IL-33 in vivo.

Interleukin-33 secretion has been investigated under multiple conditions and two primary scenarios have unfolded in the literature (reviewed in (22)): passive ‘alarmin’ release from necrotic cells during tissue damage versus non-classical secretion from intact cells. In the context of airway disease, passive IL-33 release could occur with acute airway damage, but this transient activity is unlikely to account for maintenance of chronic disease. A mechanism based on non-classical secretion appears to be the more likely basis for persistent IL-33 activity. Support for this mechanism is provided by the recent description of natural spliced IL33 isoforms lacking portions of the NTD (23, 24), which may not be regulated by nuclear sequestration.

To investigate the mechanism of epithelial IL-33 secretion in chronic airway disease, we took advantage of the properties of these truncated IL33 isoforms. We expressed IL-33 protein variants in primary human airway basal cells as dual-fluorescent and peptide tagged fusion proteins, demonstrating secretion of intact protein through the neutral sphingomyelinase-2 (nSMase2)-dependent multivesicular endosome pathway

(MVE). IL-33 can be co-secreted non-covalently bound to small extracellular vesicles

(~100-150 nm diameter) commonly referred to as exosomes (25). We also leveraged chronic obstructive pulmonary disease (COPD) specimens to investigate this pathway and found the IL-33 isoform lacking NTD exons 3 and 4 (IL33Δ34) and nSMase2 were increased in COPD-derived specimens relative to non-COPD controls. Interleukin-33 was isolated from COPD bronchial wash fluid and the primary species present was a truncated, bioactive form with immunoreactivity consistent with the IL-33Δ34 variant. Using

6 an Alternaria-induced model of airway disease, we demonstrated that blockade of nSMase2 with GW4869 resulted in reduced IL-33 and exosome secretion in bronchoalveolar lavage fluid and downstream type-2 inflammation. Together these data reveal a mechanism for IL-33 secretion from intact airway cells and demonstrate a potential avenue for development of novel therapeutics in type-2 endotypes of chronic airway disease driven by this cytokine pathway.

RESULTS

Tonic secretion of truncated IL-33 variants from intact airway cells

We leveraged a series of known N-terminal truncated IL33 isoforms (23, 24) lacking exons

3-5 (Figure 1A) to investigate the mechanism of non-classical secretion from intact airway epithelial cells. We transduced airway basal cells with lentiviruses expressing dual-tagged

IL-33 fusion proteins, comprised of either N-terminal mCherry and C-terminal monomeric eGFP (mCherry-IL-33-GFP) or N-terminal Flag and C-terminal 6-His tags (Flag-IL-33-His)

(Figure 1B). This strategy allowed simultaneous tracking of N- and C-terminal fragments, should proteolysis occur in the process of secretion. We imaged live COPD basal cells

(Figure 1C) and stable HBE-1 cell lines (Figure S1A&B) expressing mCherry-IL-33-GFP fusion proteins including full-length IL-33 (IL-33full), single exon-deletion variants (IL-33Δ3,

IL-33Δ4, IL-33Δ5), compound deletion variants (IL-33Δ34 and IL-33Δ345) and a non-natural

IL-33Δ2 variant (for comparison). Results demonstrated tight nuclear mCherry and GFP signal for IL-33full and all single-exon deletion variants. In contrast, the compound deletion variants exhibited mixed nuclear and cytoplasmic staining apparent by both epifluorescence (Figure 1C) and confocal imaging (Figure S1B). The strict merged signal for all variants indicated proteins were intact within respective cellular compartments.

To determine whether altered cellular localization impacted IL-33 secretion efficiency, we performed IL-33 ELISA on cell supernatants and lysates for epithelial cells expressing IL-33 variants as both mCherry-GFP and Flag-His fusions (Figure 1D&E,

Figure S1C,D&E). In both COPD and non-COPD basal cells as well as the epithelial HBE-

1 cell line, we found IL-33Δ34 exhibited the most abundant protein expression and tonic

8 secretion among the isoforms tested. When normalized to account for differences in protein expression levels (% secreted, Figure 1E, Figure S1C&D), IL-33Δ34 was still secreted more efficiently than any other variant, which was stable over a 10-fold range of total protein expression (Figure 1F). The IL-33Δ345 variant also exhibited increased secretion efficiency, but total expression was well below other variants and near assay detection limits.

We also tested vectoral secretion of IL-33full and IL-33Δ34 from non-COPD basal cells assayed in polarized format (Figure 1G). Flag-IL-33-His secretion was measured in apical and basal compartments of confluent cultures grown on transwell supports, which showed that both IL-33full and IL-33Δ34 were secreted in both directions, but more abundantly from the apical surface. Similar to non-polarized format, the IL-33Δ34 variant was secreted more efficiently (2-fold) over IL-33full. Results were not influenced by the pore sizes in the transwell support (Figure 1G, Figure S1F).

To investigate the role of proteolysis in tonic secretion, we Flag-immunoprecipitated

(Flag-IP) Flag-IL-33Δ34-His from cell supernatants and analyzed by anti-6His western blot

(Figure 1H). Flag-IP IL-33Δ34 protein from supernatant migrated at the same molecular weight (MW) as protein from cell lysate and was detected by anti-6His western blot, indicating that secreted protein was intact (not proteolytically processed). This is consistent with imaging of mCherry-IL-33-GFP isoforms, which demonstrated merged signal in both nuclear and cytoplasmic compartments.

Together, these results demonstrate that the protein product of the natural IL33Δ34 isoform can be abundantly expressed in airway basal cells, exhibits cytoplasmic accumulation due to lack of nuclear targeting, and is tonically-secreted at high levels

9 preferentially from the apical surface without proteolytic processing. These findings support a model in which IL33 isoforms with altered cellular localization are released from nuclear regulation to undergo tonic secretion from the base of the epithelium predominantly toward the airway lumen.

Epithelial IL-33 and exosomes are secreted through the nSMase2-depedent multivesicular endosome (MVE) pathway

The protein products of all IL33 isoforms lack a signal sequence to mediate secretion via the ER-Golgi pathway, therefore the tonic secretion observed in our cellular assay must occur via a non-classical mechanism. Multiple routes of non-classical protein secretion have been described, including active transporters (26), cell-death inducing membrane pores (27), budding from the plasma membrane (microvesicles) or multivesicular endosomes (MVE) that fuse with the cell surface to release small intraluminal extracellular vesicles or ‘exosomes’ containing protein and miRNA cargo (28).

To address which non-classical secretion pathway was involved, we tested a panel of chemical inhibitors in our IL-33 ELISA secretion assay. We performed inhibition experiments in non-COPD and COPD basal cells and HBE-1 cells expressing Flag-IL-

33Δ34-His and mCherry-IL-33Δ34-GFP (Figure 2A, Figure S2A&B). The ER-Golgi inhibitors brefeldin and monensin had no effect on secretion, however, we did observe a marked inhibition of IL-33Δ34 secretion following treatment with GW4869, a non-competitive antagonist of the ceramide synthetic enzyme neutral sphingomyelinase 2 (nSMase2) (29)

(Figure 2A). GW4869 was found to inhibit IL-33Δ34 secretion in both non-COPD and COPD basal cells and HBE-1 cells, which was apparent as both the amount and % secreted

10 (Figure 2A, Figure S2A&B). Other putative nSMase2 inhibitors spiroepoxide (29), glutathione (29) and cambinol (30) and the microautophagy inhibitor 3-methyladenine (3-

MA) (31) exhibited a modest effect on secretion, which was variably significant among non-COPD, COPD and HBE-1 cells tested. When GW4869 was tested against the panel of IL-33 variants in COPD cells, it was found to globally inhibit secretion for variants that exhibit distinct cellular localization patterns and expression levels (Figure 2B, Figure S2C).

The ceramide biosynthetic enzyme neutral sphingomyelinase 2

(nSMase2/SMPD3) regulates the ESCRT-independent MVE pathway through maturation and membrane fusion of multivesicular endosomes (29). Our observed inhibition of tonic epithelial IL-33 secretion with the compound GW4869 suggested this that phenomenon may be dependent on nSMase2 activity. We first examined SMPD3 expression in airway basal cells, which revealed significantly increased expression in COPD relative to non-

COPD specimens (Figure 2C). NSMase2 enzyme activity was measured in a subset of cultured cell lysates, and multiple COPD specimens exhibited increased activity compared to non-COPD. Given these findings, we targeted the nSMase2-dependent MVE pathway with shRNA knockdown and compared to mediators of the ESCRT-dependent MVE

(VPS4A) (32) and microautophagy (LAMP2) (33) pathways. Experiments using primary cells also included the ROCK inhibitor Y27632, which functions to block microvesicle (MV) shedding from the plasma membrane (34). In COPD cells, we performed serial rounds of transduction with shRNA- and Flag-IL-33Δ34-His-expressing lentiviruses, followed by selection and recovery (Figure 2D). Successful knockdown of targets was confirmed by qPCR (Figure S2E). We were careful to fully recover cells prior to secretion assay, to avoid ongoing cell death from selection complicating interpretation. Subsequent IL-33

11 secretion assay demonstrated a 2-fold reduction in IL-33Δ34 secretion only with nSMase2 shRNA knockdown, based on both absolute and % secretion (Figure 2D, Figure S2D). As a confirmatory approach we developed an HBE-1 SMPD3-/- cell line, which revealed further (3-fold) reduction in IL-33Δ34 absolute and % secretion (Figure 2D, Figure S2G).

COPD cells expressing Flag-IL-33Δ34-His were also immunostained with anti-Flag and corresponding antibodies for VPS4A, LAMP2, and nSMase2, demonstrating a vesicular staining pattern for pathway intermediates and diffuse nucleocytoplasmic staining for IL-

33Δ34 (Figure 2E). Immunostaining was also performed in cells expressing nSMase2 shRNA and Flag-IL-33Δ34-His, which demonstrated a loss of nSMase2 staining and an accumulation of cytoplasmic IL-33Δ34 (and loss of nuclear staining).

To investigate the impact of nSMase2 knockdown on extracellular vesicle (EV) production, we analyzed EVs secreted from COPD cells (Figure 2F). Culture supernatants were concentrated using a 100 kilodalton (kDa) cutoff centrifugal filter and the concentrations of particles <150 nm diameter were measured by tunable resistive pulse sensing (TRPS, Figure 2F, Figure S3A). Secreted EVs were notably increased 10-fold with VPS4A knockdown but undetectable (<107 particles/ml) for nSMase2 (Figure 2F).

Particle size histograms revealed mean EV size for control cells was 125 nm, consistent with exosomes, which was shifted slightly larger with VPS4A or LAMP2 knockdown.

Because TRPS analysis is limited to a pre-determined size range, we also analyzed EVs with DLS (dynamic light scattering), which showed particle histograms shifted larger in

VPS4A, further with LAMP2, and larger than exosome size range with nSMase2 knockdown (Figure 2G, Figure S3D). For all shRNA knockdown conditions, vesicles exhibited increased heterogeneity based on polydispersity index (PdI) compared to

12 control, suggesting that disruption of any pathway intermediate could have global effects on vesicle biogenesis.

We also sought to determine whether this is a general phenomenon as IL-33 expression has been reported in multiple cell types, including some immune cell populations (13, 35). We found that the human mast cell line HMC 1.2 exhibited 150-fold lower SMPD3 expression compared to airway basal cells (Figure 2H) and therefore transduced these cells with Flag-IL-33Δ34-His and performed secretion assay. Despite adequate cellular protein expressed in cell lysate, no IL-33Δ34 protein could be detected in cell supernatants, including under GW4869 treatment conditions (Figure 2I).

Together, these data reveal that tonic epithelial IL-33Δ34 secretion can be blocked by nSmase2 inhibition using both pharmacologic and genetic approaches. This coupled with reduction in secreted exosomes under these same conditions, strongly implicates the nSMase2-dependent exosome biogenesis pathway in non-classical IL-33 secretion.

Parallel analysis in other cell types further suggests that IL-33 secretion could be a specialized function of nSMase2-expressing cells.

Augmenting nSMase2 promotes IL-33 secretion

We used the nSMase2 activator 4-methylumbelliferone (4-MU, (36)) to determine whether modulation of nSMase2 activity could promote IL-33Δ34 secretion. Treatment of Flag-IL-

33Δ34-His expressing COPD cells resulted in a 2-fold increase in secreted IL-33Δ34 protein and a 10% increase in secretion efficiency, which could be reversed using the non- competitive nSMase2 inhibitor GW4869 (Figure 3A). Live-cell imaging of the mCherry-IL-

33Δ34-GFP HBE-1 line treated with both the nSMase2 activator 4-MU and GW4869 in an

13 effort to trap MVEs at the point of secretion demonstrated foci of merged IL-33 signal near the plasma membrane (Figure 3B). Cells were then fixed under the same conditions and immunostained for the exosome marker CD9, which demonstrated these IL-33-GFP foci also contained CD9.

In contrast to IL-33Δ34, full-length IL-33 appears to be tightly sequestered in the nucleus of airway cells. We next asked whether altered cytoplasmic trafficking of IL-33full could drive secretion of this variant through the nSMase2-dependent MVE pathway. We tested this under conditions of nuclear import inhibition with ivermectin (37) and with the nSMase2 activator 4-MU. With ivermectin treatment, we observed a ~2-fold increase in secreted IL-33full protein (Figure 3C) which could be reversed by GW4869. Likewise, 4-

MU induced a 3-fold enhancement of Flag-IL-33full-His secretion, also sensitive to GW486, suggesting both nuclear import blockade and nSMase2 activation function to shunt cytoplasmic IL-33full toward the MVE secretory pathway. To visualize altered trafficking of

IL-33full the mCherry-IL-33full-GFP HBE-1 line was treated with both of Ivermectin and 4-

MU and live-cell imaging was performed, which demonstrated accumulation of cytoplasmic mCherry-IL-33full-GFP signal with sustained signal within the nucleus (Figure

3D). We interpret these results as augmented secretion due to altered trafficking of newly synthesized (overexpressed) IL-33full protein rather than cytoplasmic translocation of nuclear sequestered protein.

This data would suggest that recruitment of IL-33 protein to the nSMase2- dependent MVE pathway could occur for any IL33 isoform expressed under cellular conditions where the cytokine accumulates within the cytoplasm and that nSMase2 activation can enhance secretion efficiency accordingly.

IL-33Δ34 is secreted with exosomes as surface-bound cargo

As the secretion of IL-33 and exosomes are both sensitive to nSMase2 activity, we next investigated whether IL-33 was in fact associated with exosomes, potentially secreted as cargo upon MVE fusion. We concentrated Flag-IL-33Δ34-His-expressing HBE-1 supernatant with a 100 kDa centrifugal filter and western blot analysis revealed IL-33Δ34 was retained above the filter, even though free protein (MW 25 kDa) would be expected to flow-through (Figure 3E). We then resolved exosomes from free proteins by size exclusion chromatography, and western blot on column fractions revealed IL-33Δ34 signal was absent from exosome fraction 7 but present in free protein fractions 12-15 (Figure

3E). Recognizing that IL-33 could be oxidized in cell culture media (38), we repeated the experiment with fixed, fresh culture supernatant. In fixed supernatant, IL-33Δ34 signal was present in exosome fraction 7 but migrated at a higher molecular weight (likely as a result of fixation). We therefore tested whether purified, recombinant IL-33Δ34 could bind to separately isolated exosomes. We purified HBE-1 secreted exosomes by size exclusion chromatography and incubated with biotinylated IL-33Δ34 protein (Figure 3F). Repeat size exclusion chromatography on the mixture demonstrated clear elution of IL-33Δ34 within exosome fractions 7-9, highlighted by CD9, and detected by both anti-IL-33 antibody and streptavidin.

These findings demonstrate that fixation can trap secreted non-covalently bound

IL-33Δ34 in complex with exosomes in culture supernatant and that exogenously-applied

IL-33Δ34 can form a stable complex with purified exosomes. Collectively, these data

15 illuminate a pathway for IL-33Δ34 secretion with exosomes as surface-bound cargo via the nSMase2-dependent MVE pathway.

Expression of the IL33Δ34 isoform in human COPD

To provide context for our in vitro observations we examined human COPD tissue specimens for expression of IL33 isoforms. We analyzed specimens from subjects with very severe COPD undergoing lung transplantation compared to donor lungs unsuitable for transplant (non-COPD) (Table S1). Using isoform-specific qPCR assays, we observed that IL33full and IL33Δ34 isoforms were significantly increased in COPD tissue, unlike

IL33Δ3, IL33Δ4 and IL33Δ345 which were detected but not significantly upregulated (Figure

4A, Figure S4A&B). To define the expression pattern of IL33Δ34 in lung tissue, we performed in situ hybridization using an isoform specific probe (Figure 4B, Figure S5A).

We found IL33Δ34 signal to be enriched in cells at the base of the epithelium in COPD compared to non-COPD tissue (Figure 4B, Figure S5C&D), suggesting airway epithelial basal cells were the primary source of increased IL33Δ34 transcript. When the same tissue sections were immunostained for IL-33, protein staining could be observed in corresponding regions with high IL33Δ34 probe staining (Figure S5D).

To further examine the protein product of IL33Δ34 in COPD tissue, we analyzed a subset of non-COPD and COPD specimens for which matched tissue sections, protein lysates and bronchial wash (BW) samples were available. We immunostained tissue sections for IL-33 and the basal cell marker cytokeratin 5 (Krt5) in order to highlight the cellular localization of IL-33 protein in COPD airways (Figure 4C, Figure S6).

Representative non-COPD tissues exhibited lower-intensity predominantly nuclear IL-33

16 staining at the base of the airway epithelium, while COPD sections exhibited variable IL-

33 staining patterns, including intense nuclear, diffuse vesicular and in one specimen strong signal co-localizing with the cytoplasmic basal cell marker Krt5 (Figure 4C, COPD

3). We next analyzed these specimens by western blot to characterize the MW of IL-33 protein products within tissue lysates and bronchial wash (BW) fluid. We used commercial

IL-33 antibodies raised against either NTD (exon 3-4) or CTD (exon 5), which were validated against recombinant IL-33 variants (Figure 4D). Western blot in tissue using the

CTD antibody shows multiple variable-intensity bands in the MW ranges corresponding to IL-33full (red) and IL-33Δ34 (blue) in both COPD and non-COPD specimens (Figure 4E).

NTD antibody staining from tissue lysates could not be interpreted due to high background signal (not shown). Parallel analysis of BW samples demonstrated a ~28 kDa band of variable intensity detected by the CTD antibody, but not the NTD antibody, suggesting the absence of exon 3-4 epitope (Figure 4E). IL-33 protein was quantified in equivalent tissue and BW samples (normalized to total protein) revealing significantly elevated IL-33 levels in tissue and a trend toward increased levels in BW fluid. Soluble

IL-1RL1/ST2 was also quantified and found to be significantly reduced in COPD samples, suggesting a deficiency in soluble receptor-mediated IL-33 neutralization in COPD BW specimens. Among the matched samples in this analysis, COPD 3 was of particular interest, as this specimen demonstrated strong cytoplasmic IL-33 signal in tissue, an intense CTD-reactive 28 kDa band on western blot, and the highest IL-33 protein level measured in BW by ELISA (highlighted in yellow, Figure 4C&E).

Analysis of a separate cohort of cultured airway basal cells also revealed increased

IL33full and IL33Δ34 expression (Figure 4F) compared to non-COPD controls. Similar to

17 tissue specimens, IL33Δ3, IL33Δ4 and IL33Δ345 were detected but not significantly upregulated (Figure S4B). Western blot analysis on a subset of these cells using NTD and CTD antibodies as above, demonstrates again the presence of ~28 kDa band reactive with CTD antibody but not NTD, which appears enriched in COPD basal cells

(Figure 4G). ELISA-quantified IL-33 in the airway cell cohort demonstrates increased total protein in COPD specimens relative to non-COPD, similar to lung tissue specimens.

Together, these results provide support for enrichment of the spliced IL33Δ34 isoform in COPD airway epithelium, which we have found is capable of tonic secretion from basal cells. One COPD specimen demonstrated particularly strong cytoplasmic IL-

33 signal in tissues with concomitant high levels of a truncated protein in BW that exhibits an immunoreactivity profile consistent with the IL33Δ34 variant.

NSMase2 pathway in COPD specimens

NSMase2 (SMPD3) metabolizes sphingomyelin to generate ceramide and both lung nSMase2 activity and ceramide metabolism have been shown to be altered in the setting of cigarette smoking (39, 40) and COPD (41-43). We have shown that nSMase2 is increased in COPD airway basal cells and regulates tonic IL-33 secretion, and therefore extended the analysis to our cohort of COPD and non-COPD tissue specimens. We found that SMPD3 exhibited highly variable expression in lung tissue and was increased in multiple COPD specimens, in some by orders of magnitude (Figure 5A). SMPD3 expression correlated with the IL-33 receptor IL1RL1 and the major airway mucin upregulated in COPD, MUC5AC and in some samples these three transcripts were coincidentally increased by multiple orders of magnitude (boxed red data points, Figure

18 5B). Though SMPD3 expression trended higher in COPD tissue samples, this did not translate to a difference in nSMase2 activity observed in a subset of specimens, likely in part due to the 10-fold lower activity in tissue compared to airway cells (Figure 5C and

Figure 2C). Immunohistochemistry and immunofluorescence staining of nSMase2 and IL-

33 in tissue sections demonstrated a patchy basilar pattern in non-COPD and more intense, diffuse staining pattern in COPD tissues (Figure 5D&E, Figure S7A&B).

Frequently nSMase2-enriched epithelium was coincident with cells exhibiting a vesicular cytoplasmic IL-33 pattern that extended toward the airway lumen, examples for multiple

COPD specimens shown in Figure 5F. These regions were also stained for the exosome marker CD9 (separately due to same antibody host species), which demonstrated a striking linear-reticular pattern surrounding IL-33 positive basal cells extending to the subepithelial and luminal surfaces, examples shown in Figure 5G.

Together these data reveal that SMPD3 expression and nSMase2 protein staining are enriched in COPD specimens, and in some cases expression was strongly induced concomitant with IL1RL1 and Muc5AC. NSMase2 and CD9 staining in proximity to cells exhibiting cytoplasmic and/or vesicular IL-33 staining patterns suggests the appropriate machinery is in place to facilitate secretion of IL-33-exosome complexes into the airway lumen and interstitium.

Isolation of IL-33 and exosomes from COPD bronchial wash

In parallel with our in vitro analysis of IL-33 and exosomes secreted from cultured airway basal cells, we sought to isolate and characterize endogenous components from bronchial wash specimens. We performed this analysis with the COPD 3 sample exhibiting

19 the highest IL-33 level, first by concentrating using a centrifugal 100 kDa filter, as in Figure

3E. Similar to culture supernatant, endogenous BW IL-33 was retained above the filter, quantified in Figure 6A. Concentrated BW was fractionated by size exclusion chromatography and ELISA-quantified IL-33 as well as total protein levels are shown in

Figure 6B. Peak exosome fraction 7 was analyzed by TRPS and DLS (Figure 6C, Figure

S3A&B), yielding vesicle size and distribution nearly identical to airway cell derived exosomes and ultimately confirmed by transmission electron microscopy (Figure 6D).

Exosome properties were also consistent for multiple COPD specimens evaluated (Figure

S3B&D). Western blot was performed on BW exosome fraction 7 to verify CD9-positivity and epithelial origin based on EpCAM staining (Figure 6E). Bronchial wash IL-33 largely segregated from exosomes into free protein fractions as observed for non-fixed airway cell supernatant. Western blot using CTD antibody confirmed the ~28 kDa band observed in

Figure 4E and IL-33 was again concentrated (10 kDa filter) and further resolved on a high- resolution Superose 6 size-exclusion column. Endogenous IL-33 eluted at a volume corresponding to MW 25 kDa based on standard curve (Figure 6G), consistent with the calculated MW of IL-33Δ34. Purified endogenous BW IL-33 was then tested for bioactivity in an HMC 1.2 activation assay (Figure 6H&I). Due to limited quantities of purified BW IL-

33, sample and controls were carefully matched for input concentration prior to assay

(Figure 6H). Endogenous BW-derived IL-33 was found to induce IL-8 secretion from HMC

1.2 cells with greater potency than commercial (CTD) protein at the same input concentration (125 pg/ml), which was inhibited by anti-IL-1RL1 blocking antibody, demonstrating specificity (Figure 3I).

20 These results collectively reveal that endogenous IL-33 protein isolated from COPD

BW fluid exhibits biochemical properties consistent with IL-33Δ34 and retains bioactivity.

Furthermore, endogenous IL-33 was retained with higher-MW species during concentration of BW fluid, similar to IL-33Δ34 secreted from airway cells. Exosomes derived from COPD BW specimens also demonstrate a marker profile consistent with epithelial origin, suggesting the bulk of exosomes secreted into COPD airway surface liquid are epithelial derived.

NSMase2 inhibitor blocks IL-33 secretion and type-2 inflammation in vivo

We have uncovered a mechanism for tonic IL-33 secretion from human airway cells in vitro and found support for this model in human COPD specimens. To test whether blockade of nSMase2 activity could disrupt IL-33-mediated inflammation in vivo, we employed an allergic airway disease model using the fungal allergen Alternaria alternata.

We selected the Alternaria model for this analysis because it is dependent on IL-33 for induction of type-2 inflammation (44-46) and robustly induces IL-33 protein in bronchoalveolar lavage (BAL) fluid (45). Regarding strategy for nSMase2 blockade, the spontaneously derived mouse Smpd3 mutation characterized as fragilitas ossium (fro) confers severe developmental abnormalities in mice, including osteogenesis imperfecta and high perinatal mortality (47). We therefore chose to focus our efforts on the GW4869 compound that was effective in our in vitro studies and has been successfully applied to other inflammatory mouse models (48, 49).

To induce type-2 driven airway disease in mice, we administered 5 doses of

Alternaria extract (or PBS) intranasally (i.n.) to mice on alternating days, as an extension

21 of published protocols (44), and treated mice with either GW4869 (Alt/G) or vehicle control

(Alt/D) intraperitoneally (i.p.) beginning with the first dose of Alternaria, and daily thereafter

(Figure 7A). At 10 days post-Alternaria treatment, lung Il33 and Smpd3 mRNA were found to be increased 3-fold in the Alt/D groups and not significantly reduced with GW4869 treatment (Figure 7B). Induction was limited to Il33, as other type-2 cytokines were not impacted by Alternaria (Tslp unchanged, Figure S8C and Il25 not detected). Measurement of IL-33 protein revealed a 3-fold induction of total IL-33 in lung tissue for both Alt/D and

Alt/G groups (Figure 7C). In contrast, GW4869 appeared to increase intracellular IL-33 protein levels 4-fold in cell suspension, suggesting retention of IL-33 in the setting of nSMase2 blockade. Likewise, IL-33 protein was detected in bronchoalveolar lavage (BAL) fluid in the Alt/D group at 1 hr. and 24 hr. following the 5th dose of Alternaria, which was markedly decreased in the Alt/G group at both time points. Absolute BAL IL-33 protein was approximately 6-fold higher in BAL at the 1 hr. versus 24 hr. time points (600 pg/ml versus

100 pg/ml, respectively), which is not reflected by normalized levels due to the high BAL protein content immediately following Alternaria dose. We attribute induced BAL IL-33 protein to secretion rather than cellular necrosis, as the epithelium appears intact at 1 hr.

(Figure S8B) and 24 hr. (Figure S8A) post-Alternaria. Likewise, LDH activity in BAL fluid is marginal compared to tissue lysate in samples at 1 and 24 hrs., with no observed difference between Alternaria and control (Figure S8B).

Exosomes isolated from BAL fluid 24 hrs. after last Alternaria dose were analyzed by TRPS and western blot. Results for pooled replicates show the Alt/D group exhibits increased CD9 signal by western blot and particle number by TRPS, which is decreased

22 to control level with GW4869 treatment. Exosome distribution and mean particle size for

Alt/D group are similar to human airway epithelial and BW derived exosomes (Figure 7D).

Interleukin-33 immunostaining of tissue sections demonstrate Alternaria-induced expansion of IL-33-positive parenchymal cells with alveolar type-2 (AT2) morphology

(Figure 7E), similar to observations in other IL-33-dependent airway disease models (9).

This effect was observed in both Alt/D and Alt/G groups, consistent with GW4869 mediating blockade of IL-33 secretion rather than expression. In control tissue, IL-33 exhibited a predominant nuclear pattern, while in the Alt/D and Alt/G groups, many cells exhibited a mixed nucleo-cytoplasmic IL-33 staining pattern (Figure 7E).

With respect to IL-33-induced type-2 inflammation, we analyzed the model at 6- and 10-day time-points and found a 15-fold induction of lung Il13 mRNA at 6 days (3 doses) and 100-fold at 10 days (5 doses) (Figure 7F and Figure S8C). Subsequent analyses were therefore performed at the 10-day time point. In addition to Il13, lung Il5 was also increased 5-fold, and both were substantially decreased with GW4869 treatment.

Likewise, lungs sorted for IL-1RL1+/Thy1.2+ innate lymphoid type-2 (ILC2) cells demonstrated induction of ILC2s in the Alt/D group, which was partially blocked in the Alt/G group (Figure 7G). Analysis of il13 expression in sorted cells from pooled replicates demonstrates a 2-fold increase in Alt/D group that is reduced to control level in Alt/G group.

We observed a mild increase in Muc5ac 6 days post-Alternaria, which was further induced at 10 days and was augmented with GW4869 treatment (Figure S8C). While qualitatively

PAS staining appeared diminished in Alt/G tissue sections (Figure S8A), it is possible that other IL-33-indepdendent pathways contributing to mucus production are induced in this model (50).

23 Together these findings support our model developed in the human system implicating the nSMase2-dependent exosome biogenesis pathway in lung epithelial IL-33 secretion. Disruption of type-2 inflammation in this model is not based on a substantial reduction in Il33 expression, but rather inhibition of IL-33 secretion, implicating a novel pathway in IL-33-induced chronic airway disease, which we have shown to be amenable to therapeutic intervention.

24 DISCUSSION

This study addresses multiple fundamental questions in the field of IL-33 biology and advances our understanding of human chronic airway disease pathogenesis. We show that the IL-33Δ34 isoform is increased in COPD and can undergo tonic secretion from airway cells independent of proteolytic processing. We found that this mechanism of secretion from intact airway cells is applicable to all IL-33 variants and occurs through the nSMase2-dependent MVE pathway. Remarkably, IL-33 appears to be secreted as surface-bound rather than an encapsulated exosome cargo. Identification of nSMase2 as a key mediator of IL-33 secretion and demonstration of increased nSMase2 expression in COPD specimens provides a connection between environmental triggers and non- classical inflammatory cytokine secretion. We furthermore highlight a potential novel therapeutic angle for disrupting the IL-33 system by demonstrating that nSMase2 inhibition can block IL-33 secretion and subsequent type-2 inflammation in a mouse model of airway disease.

Our investigation revealed that tonic secretion of the IL-33Δ34 isoform is dependent on the exosome biogenesis pathways regulated by nSMase2. In the context of prior work, multiple stimuli for IL-33 release have been described based on the alarmin hypothesis, including cryoshock (51), proteases (19), respiratory viral infection (52, 53) and allergens including house dust mite (54). Comparatively, Alternaria extract has been reported to induce alarmin release via cellular necrosis (55) or regulated secretion involving purinergic receptors, intracellular calcium signaling and reactive oxygen species (56, 57).

We have also observed modest amounts of endogenous IL-33 secreted from intact airway basal cells exposed to exogenous ATP (9). One common theme among these stimuli is

25 that they all can induce extracellular vesicle flux as a cellular pro-survival signal (58).

Therefore, it is possible that a diverse array of cellular signals could converge upon a fundamental cellular pathway that mediates non-classical protein and exosome secretion.

In this case, it appears such a pathway is co-opted by dysregulated IL33 isoforms expressed in chronic airway disease. It is our expectation that IL-33 would not be the only inflammatory mediator to utilize such a secretory mechanism, indeed this may be a shared phenomenon among IL-1 family members (59, 60). Future studies of non-classical cytokine secretion will be greatly informed by a more thorough understanding of functional compensation between ESCRT-dependent and independent MVE pathways and their intersection with chaperone-mediated microautophagy.

The results presented here provide key mechanistic insights into a potential role for extracellular vesicle-mediated cellular communication in chronic airway disease pathogenesis. Indeed, exosome biogenesis pathways have previously been linked to chronic lung disease (61) and nSMase2/SMPD3 has been associated with eosinophilic asthma (62) and found to be increased along with ceramide metabolites in smokers (43) and COPD (42). We have found that nSMase2 is increased COPD specimens and propose a model by which nSMase2 regulates secretion of IL-33 as surface-bound exosome cargo. It will be important going forward to define the molecular interactions between cytoplasmic IL-33 and chaperones that recruit this cytokine to the MVE pathway.

Likewise, it will be necessary to determine what role exosome-bound IL-33 plays in the efficiency of IL-33 receptor signaling on effector cells. Future studies should also address whether exosomes can enhance IL-33 stability, given the propensity of this cytokine to be inactivated by protease digestion or oxidation in the extracellular milieu (38).

26 With respect to the endogenous form of IL-33, our analysis of COPD BW IL-33 protein indicates a truncated bioactive form is present, with an antibody reactivity profile consistent with the IL-33Δ34 isoform. Several prior studies have examined the issue of IL-

33 processing, mostly in the context of IL-33full protein. The flexible linker region encoded by exon 4 is not a substrate of caspase-1, in contrast to IL-1β and IL-18 (17, 19, 20), but is sensitive to multiple inflammatory proteases. Given that the secreted IL-33Δ34 isoform lacks the protease-sensitive exon 4 linker, it is not surprising that we observe the protein to be secreted in an intact form. Definitive characterization of endogenous IL-33 will require mass spectrometry-based analysis of sufficient quantities of highly purified (non- degraded) protein from relevant biological specimens, which remains a challenging endeavor.

Regarding limitations of our approach, we understand that our in vitro observations have been made in the context of protein overexpression, which has limitations and could produce unexpected artifacts in any system. We have conducted our experiments carefully to address the phenomenon with different tagged formats, diseased/non- diseased primary cells and cell lines and under a range of expression levels and culture formats to address any irregularities that may result from these experimental conditions.

With respect to our in vivo model, we recognize that COPD is a heterogeneous disorder with multiple described inflammatory endotypes (63) among them type-2 predominant asthma-COPD overlap syndrome (64). Clear challenges remain in defining and validating these endotypes in research and clinical care. In choosing a model system for this study, we considered factors including variable severity of phenotype (smoking), strain and/or pathogen-specific responses (virus) and distinct respiratory anatomy in mice

27 and humans (IL-33 expression in type 2 pneumocytes in mice versus basal cells in humans). Multiple studies to date have implicated IL-33 in Alternaria-induced respiratory disease and have identified this fungal allergen as a potent stimulus for IL-33 secretion in

BAL fluid in vivo. With this in mind, we established the Alternaria model to test respiratory

IL-33 secretion and downstream inflammation with disruption of nSmase2 activity. We recognize that this model does not encompass the full spectrum of COPD disease.

Clinical COPD care would indeed benefit from a better understanding of which patients may respond more favorably to therapies targeting specific inflammatory endotypes. Our COPD cohort includes sufficient material to explore disease mechanism, but is comprised of severe COPD specimens, which limits our ability to correlate IL-33Δ34 or nSMase2 with COPD disease severity or expression-based metrics of type-2 endotypes (65). Future investigation and validation of pathways illuminated in this study will require the addition of specimens across the spectrum of disease severity and endotypes that incorporate protein- and exosome-focused sampling methods.

In summary, our analysis in human COPD illuminates a role for nSMase2 and exosome pathways in the mechanism of IL-33 airway secretion, supported by amelioration of type-2 inflammation with pharmacological blockade of nSMase2 in vivo.

This work reveals a novel aspect of IL-33 biology with potential to open a new area of investigation in chronic airway disease and development of novel COPD therapeutics.

METHODS

(Additional methods described in Supplementary Materials)

Human Lung Samples and Study Design

28 Clinical samples were obtained from consenting patients at the time of lung transplantation from COPD recipients (n=27) with very severe disease (GOLD Stage IV) during the period from 2011-2019 at Barnes-Jewish Hospital (BJH, St. Louis, MO).

Control samples were obtained from non-COPD donor lungs (n=13) that were not useable for transplantation at BJH and University of Nebraska Medical Center (Omaha, NE).

There were no pre-determined inclusion or exclusion criteria beyond criteria for lung transplant candidacy. To analyze tissue staining, gene expression and protein levels, lung tissue samples were collected and processed for histopathology, RNA and protein analysis from four different lung zones of each specimen. For this study, equivalent quantities of the 4 lung areas were pooled for RNA and protein analysis to represent a single sample per specimen. Tissue was homogenized in Trizol (Invitrogen) for all COPD

(n=27) and non-COPD (n=13) specimens for RNA extraction. COPD (n=14) and non-

COPD (n=6) specimens were minced and lysed in T-PER (Pierce) supplemented with

HALT protease inhibitor (Pierce), centrifuged at 10,000xg and supernatant collected for protein analysis. COPD (n=14) and non-COPD (n=6) tissue specimens were fixed in 10% neutral buffered formalin (ThermoFisher) prior to paraffin embedding and sectioning for histopathology analysis. Airway basal cells were cultured from large airways (1st-3rd generation) for COPD (n=26) and non-COPD (n=12) specimens and cells processed for

RNA and protein analysis. For a subset of COPD (n=6) and non-COPD (n=3) specimens, bronchial wash (BW) was also performed at the time of specimen collection above.

Bronchial wash fluid was obtained from explanted lungs by gently injecting 100 ml of PBS into maintstem bronchi and fluid recovered with passive return and gentle suctioning (to preferentially return airway surface liquid and minimize alveolar lavage). Bronchial wash

29 fluid was centrifuged at 100xg to pellet cells, HALT was added to supernatant prior to storage for further analysis.

Exosome preparations and analysis

Extracellular vesicles were isolated from bronchial wash fluid and cell culture supernatants in an analogous manner. Solutions were first spun at 2000xg to clarify, followed by concentration using a centrifugal concentrator with 100 kilodalton (kDa) molecular weight (MW) cutoff (Sartorius Vivaspin Turbo). For low abundance samples

(mouse BAL fluid, shRNA knockdown), samples of equivalent volumes were analyzed following the concentration step. For samples of larger quantity (culture supernatants), equivalent volumes of supernatant from confluent cultures were concentrated and fractionated on a qEV 35 (Izon Science) size exclusion column. Fractions were collected in PBS supplemented with HALT protease inhibitor and screened by dynamic light scattering (DLS, Malvern NanoS) to verify vesicle size and homogeneity (polydispersity index, PdI). Exosomes (100-150 nm) typically eluted in fraction 7-8 and free proteins in fractions 12-17 when run according to manufacturer protocol. For experiments conducted under fixed conditions, following clarification supernatant was fixed with 1% paraformaldehyde for 5 minutes at room temperature and quenched with 1M Tris pH 8.0.

Supernatant was then concentrated similar to non-fixed sample and exosomes purified using qEV 35 column; exosome integrity (size, homogeneity) was verified post-fixation.

For purified exosomes mixed with recombinant biotinylated IL-33∆34 protein, approximately 1x108 HBE-derived exosomes were incubated with 1 g IL-33∆34-biotin in

100 l PBS for 15 minutes at room temperature. Sample was then purified on a qEV 35

30 column as above.

Exosome analysis was performed using a combination of dynamic light scattering (DLS), transmission electron microscopy (TEM) and tunable resistive pulse sensing (TRPS).

Human and mouse exosomes were typically concentrated 10-fold and quantified by

TRPS (Izon Biosciences qNano device) using a 150 nm cutoff pore filter (NP150) and by

DLS (Malvern NanoS). Human COPD 3 BAL-derived exosomes were purified by qEV 35 column as above and prepared according to (66) for imaging on a JEOL JEM-1400 120 kV transmission electron microscope with an Advance Microscopy Technologies camera system.

IL-33 secretion assays

Primary airway basal cells from non-COPD and COPD specimens and HBE-1 cell line were cultured as described in Supplementary Methods on collagen coated tissue culture plates (unless otherwise indicated). All secretion assays were performed at 37°C and 5%

CO2. Media was exchanged to fresh pre-warmed BEGM at beginning of assay and plates were incubated for 2 hrs. Supernatant was clarified and cells were lysed in MPER (Pierce) supplemented with HALT protease inhibitor (Pierce). For all secretion assays, IL-33 protein was quantified in supernatant and lysate using R&D commercial ELISA assays

(Supplementary Methods) with total assay protein (supernatant + lysate) and % secretion

(supernatant/(supernatant + lysate) x100) quantified based on standard curve. Some experiments were performed in polarized format using Transwell® culture dishes (0.4 m and 1.0 m pore size). Calculations were performed similarly for polarized format, with

31 total assay protein (apical + basal + lysate) and % secretion (apical or basal/(apical + basal + lysate) x100).

For chemical inhibition assays, all chemicals were solubilized in DMSO and filter sterilized prior to use. As a control, DMSO was used at highest concentration required for solubility in the assay. Inhibitors were pre-incubated with cells for 1 hr. prior to beginning secretion assay and maintained in media during assay. Chemical concentrations used for inhibition assay are as follows: PBS; DMSO vehicle control (2.5%); BD GolgiPlugTM

Brefeldin (1:1000), GolgiStopTM Monensin (1:1500), GW4869 (20 M), Cambinol (10 M),

Spiroepoxide (5 M), glutathione (5 M) and 3-methyladenine (3-MA, 5 M).

All secretion assays were performed with n=5 biological replicates (unless otherwise indicated) and performed in triplicate.

Alternaria mouse model

Wild-type 5-week old male C57Bl/6 mice were purchased from Jackson Laboratories.

Alternaria alternata extract was purchased from Greer Laboratories and reconstituted and adjusted to 1 mg/ml solution in sterile saline (based on BCA assay, Pierce). GW4869

(N,N’-Bis[4-(4,5-dihydro-1H-imidazol-2-yl)phenyl]-3,3’-p-phenylene-bis-acrylamide dihydrochloride; molecular weight 577.5 g/mol; Sigma) was reconstituted in DMSO (20 mg/mL stock) and diluted into sterile saline prior to use. Experiments included n=11-14 mice per group and were repeated in triplicate. Five-week-old mice were either treated with 25 µg intranasal Alternaria extract (in 25 µl) or PBS control (25 µl) under isoflurane anesthesia every 48 hrs. for a total of 5 doses over 9 days. Mice in Alternaria groups were also treated with 100 µl of 0.5 mg/mL GW4869 in 2.5% DMSO/saline (50 µg/mouse; 2-

32 2.5 µg/g body weight) or 100 µl of 2.5% DMSO/saline vehicle control every 24 hr. for 9 days, beginning on the same day as the first dose of Alternaria. Mice were analyzed 24 h after the final Alternaria dose except for 1 hr. post-Alternaria bronchoalveolar lavage

(BAL), for which mice were analyzed 1 hr. after the 5th dose. No behavioral problems were observed during treatment. Mild body weight loss was observed in both Alternaria treatment groups (5-10%), which was not different between groups and recovered by the end of the experiment. RNA extraction, qPCR and ELISA and cell sorting are described in Supplementary Materials; tissue and cell preparations were lysed in Trizol or

TPER/HALT for analysis. BAL fluid was obtained by intratracheal instillation of 0.7 ml PBS with return volume ~0.3-0.4 mL and samples centrifuged to pellet cells. Supernatants from n=3 mice were analyzed by ELISA (mouse IL-33 DuoSet (R&D Systems) normalized to total protein by BCA assay) and an equivalent volume of each pooled and concentrated with 100 kDa concentrator and analyzed by TRPS and western blot. Mouse

Alternaria model experiments were performed with accompanying analysis in triplicate.

Statistical analysis

For statistical analysis, Student’s t test was used for comparisons between two groups and comparisons with 3 or more groups were analyzed using One-way ANOVA. For all experiments, P value < 0.05 was considered statistically significant. Within individual figure panels P-value information is indicated as follows: * = P < 0.05, ** = P < 0.01, *** =

P < 0.001 with symbols superimposed (and comparison groups indicated) on graphs accordingly. Correlation analysis was performed based on Pearson’s coefficient. For all

33 data in which 3 or more independent measurements are reported, data are displayed as mean ± standard error of mean (SEM).

Study Approvals

All human studies were conducted with protocols approved by the Washington University

Institutional Review Board and written informed consent was obtained from study participants. All experiments involving animals followed approved protocols by

Washington University’s Institutional Animal Care and Use Committee.

34 ACKNOWLEDGEMENTS

Special thanks to Tom Brett, Gaya Amarasinghe and Jeff Haspel for critical reading of the manuscript. We thank the Washington University Digestive Diseases Research Core

(NIDDK P30 DK052574) for providing qNano TRPS services. We thank Bill Eades and the Siteman Center Flow Cytometry Core for FACS support. We thank the Washington

University Center for Cellular Imaging for Microscopy support (ORIP OD021629). We thank the Washington University Genome Engineering and iPSC Center (GEiC) for generating the HBE SMPD3-/- KO pool. We thank the Pulmonary Morphology Core for tissue histology preparation. Support for this work was provided by NIH/NHLBI (K08

HL121168 and R01 HL52245, JAB), American Thoracic Society (Early Career

Investigator Award, JAB), Burroughs Wellcome Fund (Career Award for Medical Scientist,

JAB), and Doris Duke Foundation (Fund to Retain Clinical Scientists, JAB).

AUTHOR CONTRIBUTIONS

E.K., D.S., C.E.K., O.O., A.B., and J.A.B. designed and/or performed the experiments;

E.K., D.S., C.E.K., O.O., C.N.S. and J.A.B. prepared figures and wrote the manuscript;

S.L.B. and M.J.M. contributed to preparation and editing of manuscript; D.K., K.L.B. and

D.E.B. contributed to enrollment of human subjects and biobanking efforts; S.L.B., M.J.M. and M.J.H. provided guidance with design/interpretation of experiments.

References:

1. Pichery M, Mirey E, Mercier P, Lefrancais E, Dujardin A, Ortega N, et al. Endogenous IL-33 is highly expressed in mouse epithelial barrier tissues, lymphoid organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33- LacZ gene trap reporter strain. J Immunol. 2012;188(7):3488-95. 2. Liew FY, Girard JP, and Turnquist HR. Interleukin-33 in health and disease. Nat Rev Immunol. 2016;16(11):676-89. 3. Rostan O, Arshad MI, Piquet-Pellorce C, Robert-Gangneux F, Gangneux JP, and Samson M. Crucial and diverse role of the interleukin-33/ST2 axis in infectious diseases. Infect Immun. 2015;83(5):1738-48. 4. Moffatt MF, Gut IG, Demenais F, Strachan DP, Bouzigon E, Heath S, et al. A large- scale, consortium-based genomewide association study of asthma. N Engl J Med. 2010;363(13):1211-21. 5. Bonnelykke K, Sleiman P, Nielsen K, Kreiner-Moller E, Mercader JM, Belgrave D, et al. A genome-wide association study identifies CDHR3 as a susceptibility locus for early childhood asthma with severe exacerbations. Nat Genet. 2014;46(1):51- 5. 6. Savenije OE, Mahachie John JM, Granell R, Kerkhof M, Dijk FN, de Jongste JC, et al. Association of IL33-IL-1 receptor-like 1 (IL1RL1) pathway polymorphisms with wheezing phenotypes and asthma in childhood. J Allergy Clin Immunol. 2014;134(1):170-7. 7. Prefontaine D, Lajoie-Kadoch S, Foley S, Audusseau S, Olivenstein R, Halayko AJ, et al. Increased expression of IL-33 in severe asthma: evidence of expression by airway smooth muscle cells. J Immunol. 2009;183(8):5094-103. 8. Wang Y, Wang L, and Hua S. Interleukin-33 in children with asthma: A systematic review and meta-analysis. Allergol Immunopathol (Madr). 2017;45(4):387-92. 9. Byers DE, Alexander-Brett J, Patel AC, Agapov E, Dang-Vu G, Jin X, et al. Long- term IL-33-producing epithelial progenitor cells in chronic obstructive lung disease. J Clin Invest. 2013;123(9):3967-82. 10. Kim EY, Battaile JT, Patel AC, You Y, Agapov E, Grayson MH, et al. Persistent activation of an innate immune response translates respiratory viral infection into chronic inflammatory lung disease. Nat Med. 2008;14:633-40. 11. Xia J, Zhao J, Shang J, Li M, Zeng Z, Zhao J, et al. Increased IL-33 expression in chronic obstructive pulmonary disease. Am J Physiol Lung Cell Mol Physiol. 2015;308(7):L619-27. 12. Bartemes KR, Iijima K, Kobayashi T, Kephart GM, McKenzie AN, and Kita H. IL- 33-responsive lineage- CD25+ CD44(hi) lymphoid cells mediate innate type 2 immunity and allergic inflammation in the lungs. J Immunol. 2012;188(3):1503-13. 13. Hardman CS, Panova V, and McKenzie AN. IL-33 citrine reporter mice reveal the temporal and spatial expression of IL-33 during allergic lung inflammation. Eur J Immunol. 2013;43(2):488-98. 14. Roussel L, Erard M, Cayrol C, and Girard JP. Molecular mimicry between IL-33 and KSHV for attachment to chromatin through the H2A-H2B acidic pocket. EMBO Rep. 2008;9(10):1006-12.

36 15. Gautier V, Cayrol C, Farache D, Roga S, Monsarrat B, Burlet-Schiltz O, et al. Extracellular IL-33 cytokine, but not endogenous nuclear IL-33, regulates protein expression in endothelial cells. Sci Rep. 2016;6:34255. 16. Schmitz J, Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK, et al. IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity. 2005;23(5):479-90. 17. Ohno T, Oboki K, Kajiwara N, Morii E, Aozasa K, Flavell RA, et al. Caspase-1, caspase-8, and calpain are dispensable for IL-33 release by macrophages. J Immunol. 2009;183(12):7890-7. 18. Talabot-Ayer D, Lamacchia C, Gabay C, and Palmer G. Interleukin-33 is biologically active independently of caspase-1 cleavage. J Biol Chem. 2009;284(29):19420-6. 19. Lefrancais E, Roga S, Gautier V, Gonzalez-de-Peredo A, Monsarrat B, Girard JP, et al. IL-33 is processed into mature bioactive forms by neutrophil elastase and cathepsin G. Proc Natl Acad Sci U S A. 2012;109(5):1673-8. 20. Cayrol C, and Girard JP. The IL-1-like cytokine IL-33 is inactivated after maturation by caspase-1. Proc Natl Acad Sci U S A. 2009;106(22):9021-6. 21. Luthi AU, Cullen SP, McNeela EA, Duriez PJ, Afonina IS, Sheridan C, et al. Suppression of interleukin-33 bioactivity through proteolysis by apoptotic caspases. Immunity. 2009;31(1):84-98. 22. Cayrol C, and Girard JP. Interleukin-33 (IL-33): A nuclear cytokine from the IL-1 family. Immunol Rev. 2018;281(1):154-68. 23. Tsuda H, Komine M, Karakawa M, Etoh T, Tominaga S, and Ohtsuki M. Novel splice variants of IL-33: differential expression in normal and transformed cells. J Invest Dermatol. 2012;132(11):2661-4. 24. Gordon ED, Simpson LJ, Rios CL, Ringel L, Lachowicz-Scroggins ME, Peters MC, et al. Alternative splicing of interleukin-33 and type 2 inflammation in asthma. Proc Natl Acad Sci U S A. 2016;113(31):8765-70. 25. Kowal J, Tkach M, and Thery C. Biogenesis and secretion of exosomes. Curr Opin Cell Biol. 2014;29:116-25. 26. Schmitt L, and Tampe R. Structure and mechanism of ABC transporters. Curr Opin Struct Biol. 2002;12(6):754-60. 27. Brough D, Pelegrin P, and Nickel W. An emerging case for membrane pore formation as a common mechanism for the unconventional secretion of FGF2 and IL-1beta. J Cell Sci. 2017;130(19):3197-202. 28. Colombo M, Raposo G, and Thery C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu Rev Cell Dev Biol. 2014;30:255-89. 29. Trajkovic K, Hsu C, Chiantia S, Rajendran L, Wenzel D, Wieland F, et al. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science. 2008;319(5867):1244-7. 30. Figuera-Losada M, Stathis M, Dorskind JM, Thomas AG, Bandaru VV, Yoo SW, et al. Cambinol, a novel inhibitor of neutral sphingomyelinase 2 shows neuroprotective properties. PLoS One. 2015;10(5):e0124481.

37 31. Seglen PO, and Gordon PB. 3-Methyladenine: specific inhibitor of autophagic/lysosomal protein degradation in isolated rat hepatocytes. Proc Natl Acad Sci U S A. 1982;79(6):1889-92. 32. Baietti MF, Zhang Z, Mortier E, Melchior A, Degeest G, Geeraerts A, et al. Syndecan-syntenin-ALIX regulates the biogenesis of exosomes. Nat Cell Biol. 2012;14(7):677-85. 33. Kaushik S, and Cuervo AM. The coming of age of chaperone-mediated autophagy. Nat Rev Mol Cell Biol. 2018;19(6):365-81. 34. Li B, Antonyak MA, Zhang J, and Cerione RA. RhoA triggers a specific signaling pathway that generates transforming microvesicles in cancer cells. Oncogene. 2012;31(45):4740-9. 35. Talabot-Ayer D, Calo N, Vigne S, Lamacchia C, Gabay C, and Palmer G. The mouse interleukin (Il)33 gene is expressed in a cell type- and stimulus-dependent manner from two alternative promoters. J Leukoc Biol. 2012;91(1):119-25. 36. Qin J, Kilkus J, and Dawson G. The hyaluronic acid inhibitor 4-methylumbelliferone is an NSMase2 activator-role of Ceramide in MU anti-tumor activity. Biochim Biophys Acta. 2016;1861(2):78-90. 37. Wagstaff KM, Sivakumaran H, Heaton SM, Harrich D, and Jans DA. Ivermectin is a specific inhibitor of importin alpha/beta-mediated nuclear import able to inhibit replication of HIV-1 and dengue virus. Biochem J. 2012;443(3):851-6. 38. Cohen ES, Scott IC, Majithiya JB, Rapley L, Kemp BP, England E, et al. Oxidation of the alarmin IL-33 regulates ST2-dependent inflammation. Nat Commun. 2015;6:8327. 39. Bodas M, Pehote G, Silverberg D, Gulbins E, and Vij N. Autophagy augmentation alleviates cigarette smoke-induced CFTR-dysfunction, ceramide-accumulation and COPD-emphysema pathogenesis. Free Radic Biol Med. 2019;131:81-97. 40. Levy M, Khan E, Careaga M, and Goldkorn T. Neutral sphingomyelinase 2 is activated by cigarette smoke to augment ceramide-induced apoptosis in lung cell death. Am J Physiol Lung Cell Mol Physiol. 2009;297(1):L125-33. 41. Koike K, Berdyshev EV, Bowler RP, Scruggs AK, Cao D, Schweitzer KS, et al. Bioactive Sphingolipids in the Pathogenesis of Chronic Obstructive Pulmonary Disease. Ann Am Thorac Soc. 2018;15(Supplement_4):S249-S52. 42. Lea SR, Metcalfe HJ, Plumb J, Beerli C, Poll C, Singh D, et al. Neutral sphingomyelinase-2, acid sphingomyelinase, and ceramide levels in COPD patients compared to controls. Int J Chron Obstruct Pulmon Dis. 2016;11:2139-47. 43. Filosto S, Castillo S, Danielson A, Franzi L, Khan E, Kenyon N, et al. Neutral sphingomyelinase 2: a novel target in cigarette smoke-induced apoptosis and lung injury. Am J Respir Cell Mol Biol. 2011;44(3):350-60. 44. Causton B, Pardo-Saganta A, Gillis J, Discipio K, Kooistra T, Rajagopal J, et al. CARMA3 Mediates Allergic Lung Inflammation in Response to Alternaria alternata. Am J Respir Cell Mol Biol. 2018;59(6):684-94. 45. Bartemes K, Chen CC, Iijima K, Drake L, and Kita H. IL-33-Responsive Group 2 Innate Lymphoid Cells Are Regulated by Female Sex Hormones in the Uterus. J Immunol. 2018;200(1):229-36.

38 46. Anderson EL, Kobayashi T, Iijima K, Bartemes KR, Chen CC, and Kita H. IL-33 mediates reactive eosinophilopoiesis in response to airborne allergen exposure. Allergy. 2016;71(7):977-88. 47. Aubin I, Adams CP, Opsahl S, Septier D, Bishop CE, Auge N, et al. A deletion in the gene encoding sphingomyelin phosphodiesterase 3 (Smpd3) results in osteogenesis and dentinogenesis imperfecta in the mouse. Nat Genet. 2005;37(8):803-5. 48. Dinkins MB, Dasgupta S, Wang G, Zhu G, and Bieberich E. Exosome reduction in vivo is associated with lower amyloid plaque load in the 5XFAD mouse model of Alzheimer's disease. Neurobiol Aging. 2014;35(8):1792-800. 49. Essandoh K, Yang L, Wang X, Huang W, Qin D, Hao J, et al. Blockade of exosome generation with GW4869 dampens the sepsis-induced inflammation and cardiac dysfunction. Biochim Biophys Acta. 2015;1852(11):2362-71. 50. Bankova LG, Dwyer DF, Yoshimoto E, Ualiyeva S, McGinty JW, Raff H, et al. The cysteinyl leukotriene 3 receptor regulates expansion of IL-25-producing airway brush cells leading to type 2 inflammation. Sci Immunol. 2018;3(28). 51. Travers J, Rochman M, Miracle CE, Habel JE, Brusilovsky M, Caldwell JM, et al. Chromatin regulates IL-33 release and extracellular cytokine activity. Nat Commun. 2018;9(1):3244. 52. Jackson DJ, Makrinioti H, Rana BM, Shamji BW, Trujillo-Torralbo MB, Footitt J, et al. IL-33-dependent type 2 inflammation during rhinovirus-induced asthma exacerbations in vivo. Am J Respir Crit Care Med. 2014;190(12):1373-82. 53. Kearley J, Buckland KF, Mathie SA, and Lloyd CM. Resolution of allergic inflammation and airway hyperreactivity is dependent upon disruption of the T1/ST2–IL-33 pathway. Am J Respir Crit Care Med. 2009;179:772-81. 54. Fux M, Pecaric-Petkovic T, Odermatt A, Hausmann OV, Lorentz A, Bischoff SC, et al. IL-33 is a mediator rather than a trigger of the acute allergic response in humans. Allergy. 2014;69(2):216-22. 55. Murai H, Qi H, Choudhury B, Wild J, Dharajiya N, Vaidya S, et al. Alternaria- induced release of IL-18 from damaged airway epithelial cells: an NF-kappaB dependent mechanism of Th2 differentiation? PLoS One. 2012;7(2):e30280. 56. Kouzaki H, Iijima K, Kobayashi T, O'Grady SM, and Kita H. The danger signal, extracellular ATP, is a sensor for an airborne allergen and triggers IL-33 release and innate Th2-type responses. J Immunol. 2011;186(7):4375-87. 57. Uchida M, Anderson EL, Squillace DL, Patil N, Maniak PJ, Iijima K, et al. Oxidative stress serves as a key checkpoint for IL-33 release by airway epithelium. Allergy. 2017;72(10):1521-31. 58. O'Neill CP, Gilligan KE, and Dwyer RM. Role of Extracellular Vesicles (EVs) in Cell Stress Response and Resistance to Cancer Therapy. Cancers (Basel). 2019;11(2). 59. Ansari MA, Singh VV, Dutta S, Veettil MV, Dutta D, Chikoti L, et al. Constitutive interferon-inducible protein 16-inflammasome activation during Epstein-Barr virus latency I, II, and III in B and epithelial cells. J Virol. 2013;87(15):8606-23. 60. Kovach MA, Singer BH, Newstead MW, Zeng X, Moore TA, White ES, et al. IL- 36gamma is secreted in microparticles and exosomes by lung macrophages in

39 response to bacteria and bacterial components. J Leukoc Biol. 2016;100(2):413- 21. 61. Hough KP, Chanda D, Duncan SR, Thannickal VJ, and Deshane JS. Exosomes in immunoregulation of chronic lung diseases. Allergy. 2017;72(4):534-44. 62. Virkud YV, Kelly RS, Croteau-Chonka DC, Celedon JC, Dahlin A, Avila L, et al. Novel eosinophilic gene expression networks associated with IgE in two distinct asthma populations. Clin Exp Allergy. 2018;48(12):1654-64. 63. Barnes PJ. Inflammatory endotypes in COPD. Allergy. 2019;74(7):1249-56. 64. Christenson SA. The Reemergence of the Asthma-COPD Overlap Syndrome: Characterizing a Syndrome in the Precision Medicine Era. Curr Allergy Asthma Rep. 2016;16(11):81. 65. Christenson SA, Steiling K, van den Berge M, Hijazi K, Hiemstra PS, Postma DS, et al. Asthma-COPD overlap. Clinical relevance of genomic signatures of type 2 inflammation in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2015;191(7):758-66. 66. Thery C, Amigorena S, Raposo G, and Clayton A. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol. 2006;Chapter 3:Unit 3 22. 67. Kober DL, Alexander-Brett JM, Karch CM, Cruchaga C, Colonna M, Holtzman MJ, et al. Neurodegenerative disease mutations in TREM2 reveal a functional surface and distinct loss-of-function mechanisms. Elife. 2016;5. 68. You Y, Richer EJ, Huang T, and Brody SL. Growth and differentiation of mouse tracheal epithelial cells: selection of a proliferative population. Am J Physiol Lung Cell Mol Physiol. 2002;283(6):L1315-21. 69. Rock JR, Onaitis MW, Rawlins EL, Lu Y, Clark CP, Xue Y, et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proc Natl Acad Sci U S A. 2009;106(31):12771-5. 70. Randell SH, Walstad L, Schwab UE, Grubb BR, and Yankaskas JR. Isolation and culture of airway epithelial cells from chronically infected human lungs. In Vitro Cell Dev Biol Anim. 2001;37(8):480-9. 71. Baumlin-Schmid N, Salathe M, and Fregien NL. Optimal Lentivirus Production and Cell Culture Conditions Necessary to Successfully Transduce Primary Human Bronchial Epithelial Cells. J Vis Exp. 2016(113). 72. Yankaskas JR, Haizlip JE, Conrad M, Koval D, Lazarowski E, Paradiso AM, et al. Papilloma virus immortalized tracheal epithelial cells retain a well-differentiated phenotype. Am J Physiol. 1993;264(5 Pt 1):C1219-30. 73. Sentmanat MF, Peters ST, Florian CP, Connelly JP, and Pruett-Miller SM. A Survey of Validation Strategies for CRISPR-Cas9 Editing. Sci Rep. 2018;8(1):888. 74. Sundstrom M, Vliagoftis H, Karlberg P, Butterfield JH, Nilsson K, Metcalfe DD, et al. Functional and phenotypic studies of two variants of a human mast cell line with a distinct set of mutations in the c-kit proto-oncogene. Immunology. 2003;108(1):89-97.

40 FIGURES

Figure 1. Tonic secretion of IL-33 from airway epithelial cells. A) Human IL33 exon structure with N-terminal domain (orange), inter-domain linker (cyan) and C-terminal domain (magenta). B) Schematic of human IL-33 fusion protein reagents cloned with either dual-fluorescent (N-terminal mCherry and C-terminal GFP) tags, or dual-peptide (N-terminal Flag and C-terminal 6xHis) tags. C) Live cell imaging of COPD airway basal cells lentiviral transduced with mCherry-IL-33-GFP variants: full-length (Full), truncated lacking singe exons 2-5 (Δ2, Δ3, Δ4, Δ5) or multiple exons (Δ34 and Δ345), showing

41 cytoplasmic yellow (merged) staining for Δ34 and Δ345 variants; Hoechst 33342 counterstain and scale bar 10 m (white). D) and E) ELISA secretion assay performed for mCherry-GFP and Flag-His IL-33 variants in non-COPD and COPD airway basal cells (n=5). Unshaded bars measured with R&D monoclonal assay and shaded bars with polyclonal assay. F) Secretion assay for Flag-IL-33Δ34-His demonstrating % secretion is stable over a 10-fold expression range in non-COPD cells (n=5). G) Secretion assay in polarized format for non-COPD cells expressing full-length Flag-IL-33full-His and truncated Flag-IL-33Δ34-His variants (n=3). Protein is detected in both apical and basal fractions with apical predominance as both concentration and % secreted. H) Flag immunoprecipitation (IP) of Flag-IL-33Δ34-His from COPD cell supernatant, lanes: cell lysate (lys), supernatant (sup), and Flag-IP supernatant (elute) detected by anti-6His western blot demonstrating intact (unprocessed) secreted protein. Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (D, E) and t-test (G), P-value limits: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 2. NSMase2 regulates tonic IL-33 and exosome secretion from epithelial cells. A) ELISA secretion assay for Flag-IL-33Δ34-His COPD and non-COPD airway basal cells treated with chemical inhibitors (concentrations in Methods): PBS, DMSO vehicle control, Golgi (Brefeldin and Monensin), vesicle pathway (GW4869, Cambinol, Spiroepoxide and glutathione) and microautophagy (3-methyladenine, 3-MA) inhibitors,

43 showing marked blockade with GW4869 (n=5). B) COPD cells treated with DMSO or GW4869 (20 M) demonstrating inhibition for all IL-33 variants (n=3-5). C) QPCR for SMPD3 mRNA in n=12 non-COPD and n=22 COPD cell specimens and nSMase2 enzyme activity for a subset (n=6 non-COPD, n=12 COPD), demonstrating increased expression in COPD. D) ShRNA knockdown in COPD cells or SMPD3-/- HBE-1 showing decreased Flag-IL-33Δ34-His secretion with nSMase2 shRNA, further reduced in SMPD3- /- HBE-1 (n=5). E) COPD cells expressing Flag-IL33Δ34-His immunostained for VPS4A, LAMP2, or nSMase (green) and Flag (red), co-expression of nSMase2 shRNA demonstrates loss of staining; Hoechst 33342 nuclear counterstain, scale bar 10 m (white). F) Secreted exosomes (<150 nm) from shRNA knockdown cells quantified by TRPS (tunable resistive pulse sensing, Izon qNano) demonstrating increased particles for VPS4A but undetectable for nSMase2 #detection limit 1x107 particles/ml. G) DLS (dynamic light scattering) particle size distribution on same samples with peak shifted larger for nSMase2 shRNA. H) SMPD3 qPCR demonstrating increased relative expression in airway basal cells compared to HMC1.2 mast cell line (n=3). I) HMC1.2 cells expressing Flag-IL-33Δ34-His demonstrate no tonic secretion (ND) despite measurable total protein in lysate (n=3). Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (A, D) and t-test (B, C, D and H), P-value limits: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 3. IL-33 co-secretion with exosomes as surface-bound cargo. A) ELISA secretion assay for Flag-IL-33Δ34-His expressing COPD airway basal cells treated with nSMase2 activator 4-methylumbelliferone (4-MU, 10 M) and GW4869 (20 M); 4-MU augments secretion, which is blocked by GW4869 (n=5). B) Live cell imaging for mCherry-IL33Δ34-GFP HBE-1 treated with 4-MU and GW4869 for 15 min., demonstrating foci (white arrows) of yellow merged signal. HBE-1 were also fixed and permeabilized after 15 min. and imaged for GFP only (green) and immunostained for CD9 (red),

45 demonstrating foci of co-localization (white arrows); DAPI nuclear counterstain, scale bar 10 m (white). C) Secretion of Flag-IL-33full-His from COPD airway basal cells is augmented by disruption of nuclear entry (Ivermectin 1 M) or by nSMase2 activation (4- MU 10 M), both inhibited by GW4869 (n=5). D) Live cell imaging of mCherry-IL-33full- GFP HBE-1 cells treated with DMSO or Ivermectin + 4-MU, showing accumulation of cytoplasmic IL-33full signal within 1 hr.; Hoechst 33342 nuclear counterstain, scale bar 10 m (white). E) Exosome and protein fractionation from Flag-IL33Δ34-His-expressing HBE- 1 supernatants (sup). Secreted IL-33 is retained above centrifugal concentrator 100 kDa filter (conc sup) and detected by anti-Flag western blot, lysate (lys) for comparison. Exosomes were resolved from free proteins by qEV (Izon) size exclusion column and fractions analyzed: non-fixed sup Flag-IL-33Δ34-His resolves into protein fractions and fixed sup protein migrates at a higher molecular weight (MW) and resolves into both exosome and protein fractions. F) Purified HBE-derived exosomes (108 particles) incubated for 15 min with recombinant site-specific biotinylated IL33Δ34 protein (1g) and resolved on qEV column, showing IL-33 co-elutes in CD9-containing exosome fractions without fixation. Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (A, C), P-value limits: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 4. IL33 isoforms in COPD specimens. A) IL33 isoform-specific qPCR in lung tissue specimens for IL33full (non-COPD n=13, COPD n=27) and IL33Δ34 (non-COPD n=12, COPD n=23). B) In-situ hybridization in non-COPD and COPD tissues targeting the IL33Δ34 isoform with increased staining in COPD tissue (violet); nuclear fast red counterstain, scale bars 50 m (gray), 10 m (white). C) Immunostaining of non-COPD

47 and COPD tissue with IL-33 (green) and cytokeratin 5 (Krt5, red), showing variable cytoplasmic IL-33 staining prominent in COPD 3; DAPI counterstain and scale bar 10 m (white). D) Epitopes for IL-33 NTD and CTD targeting antibodies and reactivity validated with IL-33 variants expressed in HEK293T cells; IL-33Full 38 kDa (red, 30 kDa degraded band), IL-33Δ34 28 kDa (blue) and IL-33 CTD 17 kDa (Peprotech, black). E) Matched tissue and bronchial wash (BW) non-COPD (n=3) and COPD (n=6) specimens. Western blot shows multiple fragments detected by CTD antibody in tissue and a 28 kDa band detected by CTD but not NTD antibody in BW. Adjacent is ELISA-quantified IL-33 in same samples, normalized to total protein. IL-33 protein quantity is increased and soluble ST2 (sST2) decreased in COPD; COPD 3 with highest BW IL-33 protein is highlighted in yellow. F) IL33 isoform-specific qPCR in airway basal cells for IL33full (non-COPD n=12, COPD n=26) and IL33Δ34 (non-COPD n=11, COPD n=24); with mean  SEM. G) Western blot on a subset of airway basal cell lysates shows a 28 kDa band detected in COPD by CTD but not NTD antibody. ELISA-quantified normalized IL-33 protein in non-COPD (n=12) and COPD (n=26) cells show IL-33 is increased in COPD. Data points displayed with mean  SEM. Statistical analysis: t-test (A, E, F, G), P-value limits: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 5. Neutral sphingomyelinase 2 (nSMase2) in COPD. A) SMPD3 qPCR in non- COPD (n=12) and COPD (n=26) lung tissue specimens demonstrating increased expression in COPD (logarithmic scale due to wide variation in expression level). B) Pearson’s correlation analysis of SMPD3 vs IL1RL1 and MUC5AC expression; three specimens exhibited high relative expression in COPD compared to non-COPD for all 3 transcripts (red and boxed). C) NSMase2 activity in non-COPD (n=6) and COPD (n=14) lung tissue normalized to total protein. D) Immunohistochemistry in non-COPD and COPD tissue stained for nSMase2 (blue) and IL-33 (red), nuclear fast red counterstain, scale bar 10 m (gray). E) Immunofluorescence staining in non-COPD and COPD tissue for nSMase2 (green) and IL-33 (red) with DAPI counterstain. Both methods (D and E) demonstrate increased nSMase2 signal in COPD airways. F) Focal areas of NSMase2 and IL-33 co-staining with punctate cytoplasmic IL-33 pattern extending toward airway lumen (white arrows) G) Immunostaining for IL-33 (red) with CD9 (green) shows variable IL-33 cytoplasmic signal with surrounding reticular CD9 pattern.

Figure 6. Analysis of IL-33 and exosomes from COPD bronchial wash specimens. A) ELISA quantified IL-33 in concentrated bronchial wash (BW) fluid (100 kDa filter cutoff) with retention of endogenous IL-33 above the filter. B) IL-33 and protein concentration measured in fractions eluted from size exclusion column (Izon qEV). C) and D) Extracellular vesicles isolated from BW were consistent with exosomes based on transmission electron microscopy (TEM), tunable resistive pulse sensing (TRPS) and dynamic light scattering (DLS). E) Western blot with CD9 and EpCAM positive exosome fractions indicating an epithelial source. F) Western blot (CTD antibody) showing elution of truncated IL-33 protein (MW ~28 kDa), similar to Figure 4E, IL-33 CTD fragment for

50 reference. G) ELISA analysis of qEV fractions subject to further resolution with Superose6 (Sup6) size exclusion chromatography; elution profile with peak IL-33 in fraction 17 corresponds to MW=25 kDa based on protein standard curve. H) and I) HMC1.2 activation assay for purified endogenous BW IL-33 protein. Input IL-33 concentration for purified protein and CTD standard verified by ELISA due to low BW IL-33 yield. IL-8 level in cell supernatant measured by ELISA after 12 hrs. incubation with CTD standard, concentrator flow through (FT, negative control) or endogenous IL-33  IL-1RL1 blocking antibody (100 ng/ml, Proteintech). Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (I), P-values: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 7. nSMase2 inhibition in Alternaria airway disease model. A) Schematic of Alternaria experimental model. Mice were treated intranasally (i.n.) with 25μg of Alternaria extract (Alt) or PBS (control) every other day for 9 days, mice receiving Alt were either treated intraperitoneally (i.p.) with DMSO/saline vehicle control (Alt/D) or GW4869 (Alt/G, 2-2.5 g/g) daily for 9 days. Some mice were analyzed 1 hr. following the last Alt dose, remainder analyzed 24 hr. after the last dose. B) Lung tissue qPCR for the 3 groups (n=3) demonstrating increased Il33 and Smpd3 mRNA with Alt treatment. C) IL-33 protein quantified by ELISA (normalized to total protein) for lung lysate (n=3), intracellular fraction (pooled single cell suspension, n=3 each), and 1 hr. (n=3) or 24 hr. (n=3) bronchoalveolar

52 lavage (BAL) samples. IL-33 is increased in the intracellular fraction and decreased in BAL with GW4869 treatment. D) Exosome quantity measured by TRPS for pooled (n=3) BAL samples with vesicle quantity, representative size distribution (with peak) and CD9 western blot, reflecting decrease in BAL vesicle quantity and corresponding CD9 staining with GW4869 treatment. E) Tissue IL-33 immunofluorescence staining (red) demonstrates increased cytoplasmic IL-33 signal (inset) and expansion of IL-33+ parenchymal cells in Alt groups; DAPI counterstain, scale bars: 50 m (gray), 10 m (white). F) Lung tissue Il13 and Il5 qPCR (n=3) demonstrating induction with Alt treatment that is attenuated with GW4869. G) Representative FACS plots for sorted lung innate lymphoid type 2 cells (ILC2, pooled samples, n=3) and Il13 qPCR in sorted cells, demonstrating induction of ILC2 cells and IL13 expression with Alt treatment and concomitant reduction with GW4869. Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (B, C, F), P-values: *P < 0.05, **P < 0.01, ***P < 0.001.

53 SUPPLEMENTARY MATERIALS

Supplementary Methods

Table S1. clinical characteristics of subjects without COPD (Non-COPD) and with severe (GOLD Stage IV) COPD, related to Figure 1.

Table S2. List of reagents and materials.

Figure S1. Live cell imaging and secretion assays for IL-33 variants in HBE-1 and primary airway basal cells, related to Figure 1.

Figure S2. Chemical inhibition and shRNA knockdown with validation of assays, related to Figure 2.

Figure S3. Analysis of exosomes in COPD airway basal cell supernatants and COPD bronchial wash (BW) fluid, related to Figures 2, 3 and 6.

Figure S4. Expression of IL33 isoforms in COPD, related to Figure 4.

Figure S5. In situ hybridization staining for IL33Δ34 in COPD and non-COPD tissues with corresponding IL-33 protein immunostaining, related to Figure 4.

Figure S6. IL-33 immunostaining in COPD and non-COPD tissues, related to Figure 4.

Figure S7. NSMase2 and IL-33 immunostaining in lung tissue, related to Figure 5.

Figure S8. Analysis of mouse Alternaria airway disease model, related to Figure 7.

54 SUPPLEMENTARY METHODS

Quantitative PCR assays

To quantify alternate-spliced IL33 transcripts in COPD specimens, we designed a series of quantitative PCR (qPCR) assays to probe the N-terminal truncation isoforms lacking exons 3 (IL33Δ3), exon 4 (IL33Δ4), exons 3-4 (IL33Δ34) and exons 3-5 (IL33Δ345). A specific assay could not be generated for exon 5 (IL33Δ5) deleted isoform. Assay specificity was validated using individual plasmid standards (Figure S4A).

In general, RNA for qPCR was purified from lung homogenates and cell lysates using Trizol (Invitrogen) extraction and converted to cDNA template using a High-

Capacity cDNA Archive® kit (Applied Biosystems), both according to manufacturer protocols. Target mRNA expression was quantified by qPCR assay fluorogenic probe- primer sets (labeled with 5’FAM and 3’-IowaBlack) as detailed in Table S2, either designed using the PrimerQuest online tool through Integrated DNA Technologies (IDT) website (IL33 isoform-specific) or using IDT pre-designed, validated assays. QPCR was performed using the KAPA PCR Master Mix system (KAPA Biosystems). Samples were assayed with the 7500 Fast Real-Time PCR System and analyzed using Fast System

Software (Applied Biosystems). Transcript copy/ml was quantified based on cycle threshold (Ct) for human IL33 transcripts with reference plasmid standard, in cases where plasmid standard was not available, fold-change was calculated using the ΔΔCt method relative to average ΔCt for control group. Samples that did not amplify with a Ct value threshold < 35 for a given target were not included in analyses. In all cases values were normalized to GAPDH (Applied Biosystems human and mouse GAPDH 20X assays).

55 In situ hybridization

A custom double-DIG labeled miRCURY LNA detection probe (Qiagen) was synthesized to target the IL33Δ34 sequence (5’DIG-AGGTGAAATTCTTCCCAGCTTGAAA-3’DIG) at the exon2-exon 5 junction. The Qiagen miRCURY ISH detection system was chosen over conventional antisense RNA probe generation due to the increased sensitivity/stability of the probe and the short sequences allowed, thus minimizing hybridization to other IL-33 isoforms present in tissue. In situ hybridization was carried out according to manufacturer protocol using the miRCURY LNA miRNA ISH optimization kit (FFPE) 2 with U6 snRNA positive control and random sequence negative control LNA probes provided with the kit.

Optimal signal-to-noise for overexpressed IL33Δ34 (relative to IL33full) was obtained for the probe when used at 100 nM in the hybridization reaction (optimized conditions shown in

Figure S5A). For the staining protocol, fresh cut FFPE slides were de-paraffinized in xylenes followed by proteinase K digestion (10 g/ml) for 7 minutes. Probes were loaded in miRCURY hybridization buffer and incubated in a Dako hybridizer at 55°C for 1 hr.

Serial SSC (saline sodium citrate) washes were performed at 55°C, followed by blocking with sheep serum and then incubation with alkaline phosphatase conjugated anti-DIG sheep FAB fragments (Roche) for 1 hr. Development using BCIP/NBT substrate supplemented with 20 mM levamisol was performed until optimal signal-to-noise was achieved, approximately 2 hrs. at 30°C. Slides were then counterstained with nuclear fast red and mounted for imaging.

Tissue and cell immunofluorescence

Tissues were fixed with 10% neutral buffered formalin, embedded in paraffin, cut into 5-

56 µm sections, and adhered to charged slides. Sections were deparaffinized in

Fisherbrand® CitroSolv®, rehydrated, and treated with heat-activated Vector Citrate antigen unmasking solution (Vector laboratories, Inc). After blocking (Tris buffered saline with 0.1% Triton X100 and animal free blocking solution, Vector labs), immunofluorescence staining was performed by incubating at 4° C overnight with primary antibodies at dilutions outlined in Table S2 followed by washing and incubating with secondary antibodies for 2 hr. at 25° C, including combinations of Alexa Fluor 488 nm,

594 nm or 647 fluorochromes (Invitrogen) or using Vector Laboratories fluorescent signal amplification kits (human IL-33 only). Immunohistochemistry staining followed a similar approach instead using alkaline phosphatase or horseradish peroxidase conjugated secondary antibodies (Vector Laboratories ImmPact staining kits) and Vector blue or

AMEC red chromophores (Vector Laboratories), respectively. Cells on chamber slides were either imaged directly under live-cell conditions for cells transduced with mCherry-

GFP labeled proteins or fixed for 5 min at room temperature with 4% paraformaldehyde and permeabilized in 0.1% Tris buffered saline, with detection using primary and secondary antibodies as above.

Live and fixed cell or tissue fluorescent imaging was performed on an Olympus

IX83 inverted microscope with 40 and 60X objectives and a Hammamatsu Orca ER camera. Brightfield images were measured on an Olympus IX equipped with a Nikon color camera and 20X, 40X and 100X (oil) objectives. Confocal imaging was performed using a Zeiss LSM 880 Confocal with Airyscan with 40X objective.

Cloning and fusion protein construct generation

57 For cloning of IL33 isoforms from COPD tissue, PCR was performed using random-primer generated cDNA as template, and Pfu UltraII High Fidelity Master Mix (Agilent) according to manufacturer protocol. PCR products were separated on 1% agarose gel and visualized with ethidium bromide. Discernable bands amplified with IL-33 coding sequence primers (exon 2 and 8 with NdeI and XhoI restriction sites, Table S2) were extracted using Qiagen gel extraction kit, digested with corresponding restriction enzymes, ligated into pET23b expression vector and transformed into NEB 10-beta E. coli for plasmid isolation (New England Biolabs). Fifteen individual clones were isolated by miniprep (Qiagen) and submitted for Sanger sequencing, yielding duplicate clones of

IL33full, IL33Δ34 and IL33Δ345. Isoforms not cloned from COPD cells were generated by

PCR by engineering a SpeI restriction site into the IL33Δ4 exon 3-5 boundary followed by quick-change mutagenesis (Stratagene QuickChange Lightning) or using an internal

BamHI site at the exon 2-4 boundaries of IL33Δ3 and AgeI at the exon 4-6 boundaries of

IL33Δ5. The non-natural IL33Δ2 construct was generated using cloning primers to exclude the second exon segment. These products were used as templates for cloning of fusion proteins and as qPCR plasmid standards.

Lentiviral constructs were designed to express IL-33 proteins as dual tagged fusions with N-terminal mCherry and C-terminal eGFP (eGFP monomeric variant) or

5’Flag and 3’-6His tags. For fluorescent fusion proteins, mCherry, IL-33 variants and GFP

(Clontech mCherry and monomeric eGFP) were amplified with complimentary primers and

Gly-Gly-Gly-Ser (GGGS) linkers as follows: NdeI-mCherry-(GGGS)-EcoRI-IL-33-KpnI-

(GGGS)-GFP-NotI. PCR products were digested, ligated into the lentiviral vector(s) pCDH-EF1-MCS-IRES-Puro/Neo (System Biosciences) and transformed into NEB stable

58 cells (New England Biolabs). An analogous approach was taken for Flag/His dual-tagged constructs (without GGGS linkers). Constructs were generated using the pCDH-EF1-

MCS-IRES-Puro vector in all cases except where double selection was required for use with shRNA lentiviruses, in which case, constructs were cloned into pCDH-EF1-MCS-

IRES-Neo.

Recombinant IL-33 protein expression

We validated the anti-IL-33 NTD antibody targeting exons 3-4 (Abcam) and anti-CTD antibody targeting exons 5-8 (R&D systems) by western blot using HEK293T lysates overexpressing IL33 isoforms IL33full (calculated molecular weight (MW) 34 kilodaltons

(kDa)) and IL33Δ34 (calculated MW 25 kDa) compared to commercially available CTD product (amino acids 110-270, 17 kDa, Peprotech). Proteins were transiently expressed in HEK293T cells by combining a 2:1 (μl reagent:μg plasmid) ratio of plasmid DNA with

293Fectin (Life Technologies) in Optimem (Gibco) according to manufacturer protocol and transfection complexes were added to cells at 70% confluence. Cells lysates were used in analysis 24 hours later. The CTD-targeting antibody reacted with all three forms, while the NTD antibody reacted only with the full-length protein, thus validating these reagents to probe endogenous IL-33 fragments (Figure 4D).

Recombinant IL-33Δ34 for exosome binding experiments was cloned into pET21a

(Novagen) with an N-terminal hexahistidine (6XHis) tag, followed by an N-terminal

AviTag™ sequence (GLNDIFEAQKIEWHE) and (GGS)2 linker. The IL-33Δ34 construct was transformed into Rosetta2(DE3) E. coli, (Novagen) under antibiotic selection and 2L of cells were grown in Luria Broth (LB) at 37°C to an OD600 of ~0.8 before induction with

59 0.5mM of IPTG per manufacturer protocols. Cells were shaken at 16°C overnight, then pelleted and resuspended in 50 mM Na2HPO4 pH 8.0, 300mM NaCl, 5mM imidazole,

10mM -ME and 10% glycerol. Lysozyme, DNAse, MgCl2, 1mM PMSF and 0.1% Triton

X-100 were added prior to sonication. Following centrifugation at 12,000 x g, supernatants were passed over NiNTA superflow resin (Qiagen). Resin was washed with 50 mM

Na2HPO4 pH 8.0, 300 mM NaCl, 40 mM imidazole, 10 mM -ME and 10% glycerol, and bound protein eluted in 50 mM Na2HPO4 pH 8.0, 300 mM NaCl, 300 mM imidazole, 10 mM -ME and 10% glycerol supplemented with protease inhibitor cocktail (Sigma). IL-

33Δ34-birA-6His was further purified by size exclusion chromatography (SEC) using a

Superdex™ 75 Increase column. Purified IL-33Δ34 was exchanged into 100mM Tris-HCl pH 7.5, 200mM NaCl, 5mM MgCl2, 10mM -ME and 10% glycerol for subsequent birA enzymatic biotinylation as previously described (67).

IL-33 ELISA

Lung tissues were homogenized in T-PER with HALT protease inhibitors (Pierce) and cultured cells were lysed in M-PER with HALT; samples were centrifuged at >10,000xg for 5 min to clarify and further diluted as necessary based on dynamic range of assay.

Human IL-33 ELISA was performed using IL-33 DuoSet (R&D Systems) according to the manufacturer’s protocol. For all variants in cellular assays that included exon 5 as well as endogenous IL-33 protein, the monoclonal DuoSet assay was used. For variants lacking exon 5, the IL-33 polyclonal DuoSet was required for detection (due to monoclonal epitope residing within exon 5), and throughout figures this is indicated with shading of data bars. Chromogenic signal was developed using TMB substrate

60 (SeraCare) and absorbance at 450 nm measured on a BioTek Synergy H1 system. The

IL-33 level was normalized to total protein in biological samples using BCA assay

(Pierce).

NSMase2 activity assay

NSMase2 activity was measured by colorimetric assay using a commercial kit (Abcam).

Tissue and cell lysates were added to 96-well assay plates along with substrate and assay buffers provided in the kit per manufacturer protocol. Bronchial wash samples were also tested but did not demonstrate signal above background. Plates were incubated for recommended time frame and read on a BioTek Synergy H1 system at 695 nm. NSMase2 activity was calculated based on standard curve provided in kit.

Western blot

For analysis of truncated IL-33 proteins in biological samples, equivalent amounts of cell and tissue lysate or bronchial wash fluid were prepared for western blot and ELISA for each sample. Gel electrophoresis was performed using NuPAGE™ 4-12% Bis-Tris

Protein Gels (Invitrogen), followed by transfer to nitrocellulose membrane using iBlot™ 2

Transfer Stacks (Invitrogen) and an iBlot™ 2 Dry Blotting System (Invitrogen).

Membranes were washed in PBS 0.1% Tween-20 (PBST) and stained in PBST with 2%

BSA in the SNAP I.D.® 2.0 Protein Detection System (Millipore). Antibodies were used at dilutions specified in Table S2 with overnight incubation at 4°C. Membranes were washed and incubated with 1:5000 dilution of appropriate HRP-conjugated secondary antibodies (Santa Cruz) at room temperature. Western blots were developed using ECL

61 Substrate (Pierce) and chemiluminescence detected by exposure to autoradiography film.

Airway epithelial cell culture

Primary-culture airway basal cells were established from large airway (1st-3rd generation) tracheobronchial specimens as described (68, 69) and cultured in 2D submerged format either on collagen-coated plastic or Transwell (Corning 0.4 m, Millipore 1.0 m) inserts.

Airway basal cells were maintained at 37C 5% CO2 in BEGM medium without retinoic acid (RA) or serum (70). HBE cell lines were grown in LHC-8 medium (Gibco). Cells were seeded at 20,000 cells/well and grown to >90% confluence on plastic or 100% confluence in Transwells prior to study. Airway cells were lysed either in Trizol or M-PER/HALT for mRNA and protein analysis.

Generation of lentiviruses and transduction of cells

Lentiviruses were generated for fusion protein expression in primary airway basal cells and generation of stable HBE-1 lines using the LentiSuite system (Systems Biosciences) according to manufacturer protocol. Briefly, HEK293Ts were transfected with transfer plasmid pPACKH1 using PureFection reagent. Virus was collected at 48-72 hours post transfection, clarified by centrifugation at 3000xg and virus precipitated with PEG-it solution. Titer of the virus was measured using Lenti Go-Stix and aliquots stored at -80C until use. Airway epithelial cells (HBE-1 or primary airway basal cells) cultured on collagen coated tissue culture plates were infected according to published protocols (71). Briefly, they were trypsinized, centrifuged and resuspended in BEGM media supplemented with

62 1 μg/ml protamine. Lentivirus was added to cells resuspended at 1x106 cells/ml at MOI

1-10 and cells were returned to collagen-coated plates for 24 hrs. Media and virus was then removed and fresh media containing the appropriate antibiotic selection (puromycin at 0.5 μg/ml or G418 at 250 μg/ml) and 10 μM Y27632 (Stem Cell Technologies) was added. Transfection efficiency ranged from 10-50% and cells were allowed to completely recover to 80-90% confluence and transduced protein expression verified prior to use.

For shRNA assays, low passage primary human airway basal cells were trypsinized and plated with high-titer shRNA lentiviruses purchased from Santa Cruz and protamine at 1

μg/ml. After 24 hours, virus was removed and media replaced with BEGM containing puromycin at 0.5 μg/ml and 10 μM Y-27632. Media was changed daily until cells had visibly recovered and were sufficient in number to undergo a repeated round of infection.

The process was repeated with Flag-IL-33Δ34-His lentivirus. Cells underwent a second round of selection with G418, allowed to recover, and then were plated on 96-well plates for ELISA assay or chamber slides for imaging.

Generation of stable mCherry-IL-33-GFP expressing HBE-1 cell lines

We initially chose the immortalized human airway epithelial line HBE-1 (72) to develop these assays, as we determined that this line exhibited in vitro behavior and markers that best approximated primary airway basal cells (compared to A549 and BEAS2B) and could be grown in serum-free medium. Stable mCherry-IL-33-GFP HBE-1 lines were developed to establish a robust system to probe IL-33 cellular trafficking under stable expression conditions. Cells were transduced with lentiviruses and passaged under appropriate antibiotic selection for 2-3 weeks, then sorted selecting for the top 0.5-1% of double-

63 positive cells on a Beckman Coulter MoFlo sorter. Cells were recovered and expanded and post-sort cells exhibited 100% expression of fusion proteins, which was stable without selection for greater than 10 passages.

CRISPR generation of SMPD3-/- HBE-1 cell line

SMPD3−/− HBE-1 cells were generated using CRISPR-Cas9 ribonucleoprotein (RNP) targeting exon 1 of SMPD3 with guide RNA (Alt-R sgRNA, Integrated DNA technologies) and Cas9 protein (QB3 Berkeley MacroLab, UC Berkeley). Transfection was performed on the Nucleofector 4D X Unit using 250K cells in a 20 ul cuvette with solution P3 and program CA-137. Targeted deep-sequencing was performed to validate the KO pool and clones as previously described(73). Initial pools demonstrated 76% NHEJ with 25% wild- type alleles present. Flag-IL-33Δ34-His secretion was then used as functional readout to enrich for deletion by limiting dilution assay. After 4 rounds of limiting dilution, subsets with the lowest level of secretion were genotyped and verified to have 0% residual wild- type expression with a combination of 3 indels present (Figure S2G) as and were subsequently used for secretion assay.

HMC1.2 assays

The human mast cell line HMC1.2 (74) was purchased from Millipore and cultured in

IMDM media supplemented with penicillin-streptomycin, 10% fetal calf serum and α- thioglycerol according to manufacturer protocol. For Flag-IL-33Δ34-His secretion, lentiviral transduction and selection were performed as above for airway epithelial cells. Cells were plated at 3x105 cells per well in 96-well assay plates, and assays were performed for 2

64 hrs. at 37C 5% CO2 with a minimum of 3 biological replicates, repeated in triplicate. For

IL-33-induced stimulation, concentrated BW-purified protein from Superose 6 column and concentrator flow-through (negative control) and commercial IL-33 CTD (Peprotech) were diluted into HMC media and re-quantified prior to assay (to ensure matched concentrations due to low quantity of purified endogenous BW IL-33 protein). Cells were plated as above and incubated overnight and supernatants harvested for IL-8 quantification by ELISA (R&D Systems). Under conditions where IL-1RL1 blockade was performed, blocking antibody was added at 100 ng/ml to HMC cells 2 hr. prior to performing assay and was maintained in the culture conditions during assay.

Mouse lung cell sorting and FACS analysis

Lungs were prepared for FACS analysis as previously described (9). Briefly, single-cell suspensions were generated from minced lung tissue subjected to collagenase (Liberase

Blendzyme III, Roche), hyaluronidase (Sigma Aldrich), and DNAse I (grade II, Roche) with digestion for 45 minutes at 37°C. After FcR blockade, lung cell suspensions were incubated with labeled antibodies and sorted using a Moflo (DAKO-Cytomation) high- speed cell sorter. Mouse cells were immunostained with AF700-conjugated anti-mouse

CD45 (Biolegend), APC-conjugated anti-mouse lineage cocktail (BD Biosciences),

BV421-conjugated anti-Thy1.2 (Biolegend) and PE-conjugated anti-mouse IL1RL1/ST2

(Biolegend). Flow cytometry results were analyzed using FlowJo software (TreeStar).

Table S1. Clinical characteristics of lung transplant donors without COPD (Non-COPD) and recipients with severe (GOLD Stage IV) COPD.

Characteristics Non-COPD COPD

Number per group 13 27

Mean age (range) 39.13 (16-68) 61.43 (51-75)

Male:Female 8:5 12:15

FVC (L) – 2.12 (0.83)

FEV1 (L) – 0.52 (0.17)

FEV1/FVC (%) – 22.74

Pack-years (range) 2.53 (0-20) 7.68 (0.67-34)

66 Table S2: List of reagents and materials.

Reagent Supplier Reference/Identifier Antibodies Human IL-33 rabbit polyclonal (1:50 IF) Sigma Aldrich HPA024426 Human IL-33 goat monoclonal (1:1000 WB) R&D systems MAB36253 Human IL-1RL1/ST2 mouse monoclonal (B) Proteintech 60112-1 Human nSMase2 mouse monoclonal (1:50 IF) Santa Cruz sc-166637 Human VPS4A (A-11) mouse (1:100 IF) Santa Cruz Sc-393428 Human LAMP2 (ABL-93) mouse (1:100 IF) Santa Cruz Sc-20004 Human CD9 (H19a) mouse (1:1000 WB) Biolegend 312102 Human CD9 (MM2/57) (1:100 IF) Millipore CBL162 Anti-DYKDDDDK-AF594 Biolegend 637313 Human EpCAM/CD326 (1:1000 WB) Biolegend 324201 Anti-Mouse lineage cocktail (1:75 FC) BD 558074 Human IL-1RL1 monoclonal (1:75 FC) Biolegend 145303 Human Thy1.2/CD90 monoclonal (1:75 FC) Biolegend 105341 Mouse IL-33 goat polyclonal (1:50 IF) R&D systems AF3625 IF = immunofluorescence, WB = western blot, FC = flow cytometry B = blocking

Commercial lentiviruses Scrambled shRNA Santa Cruz sc-108080 nSMase2 shRNA Santa Cruz sc-62655-V VPS4 shRNA Santa Cruz sc-106731-V LAMP2 shRNA Santa Cruz sc-29390-V

Biological Samples Primary human basal cells BJH N/A Control and COPD lung tissue BJH, UNMC N/A Control and COPD Bronchial wash fluid BJH N/A

Chemicals, Peptides, and Recombinant Proteins IL-33 Peprotech 200-33 GW4869 Sigma Aldrich D1692 Brefeldin A BD Biosciences 51-2301KZ Monensin BD Biosciences 51-2092KZ 4-methylumbelliferone Sigma Aldrich M1381 Cambinol Sigma Aldrich C0494 Spiroepoxide Chem Cruz sc-202721 Glutathione Sigma Aldrich 1294820 3-methyladenine Sigma Aldrich M9281 Alternaria alternata extract Greer laboratories XPM1D3A2.5

Commercial Assays

67 R&D IL-33 ELISA duoset R&D Systems DY3625B (human) DY3626 (mouse) R&D IL-8 ELISA duoset R&D Systems DY208 (human)

Cell Lines HBE-1 Yankaskas et al, 1993 Gift from MJ Holtzman lab

Oligonucleotides Cloning primers 5'-EcoRI-Kozak-FLAG- GGAATTCCGCCACCATGGATTACAAGGATGACGATGA hIL33 CAAGCCTAAAATGAAGTATTCA 3’-hIL33-6His-stop-Not1 ATAGTTTAGCGGCCGCTCAATGGTGATGGTGATGATG AGTTTCAGAGAGCTTAAACAAG 5’-NheI-Kozak-mCherry CTAGCTAGCGCCACCATGGTGAGCAAGGGCG 3’-EcoRI-mCherry GGAATTCCTTGTACAGCTCGTCC 5'-EcoRI-hIL33-GS-link GGAATTCGGTGGTGGCGGTTCAAAGCCTAAAATGAA GTATTCA 3'-hIL33-Kpn GGGGTACCAGTTTCAGAGAGCTTAAACAA 5’-Kpn-GSS-linker-GFP GGGGTACCGGTGGTGGCGGTTCAGTGAGCAAGGGC GCCGAGG 3’-GFP-stop-NotI ATAGTTTAGCGGCCGCTCACTTGTACAGCTCATCCAT GC hIL-33 Δ Exon4 ACTAGTACCTGTTTTCAGTGAAGGCCTTTTG 3’-segment1 hIL-33 Δ Exon4 ACTAGTCCTATTACAGAGTATCTTGCTTCTCTAAGCAC 5’-segment2 hIL-33 Δ Exon3 CGGGATCCCAGCTTGAAACACAAGGCTTTGC 3’-segment1 hIL-33 Δ Exon3 CGGGATCCAGAAAGCACAAAAGACATCTGG 5’ segment2 5'-EcoRI-Kozak-FLAG- GGAATTCCGCCACCATGGATTACAAGGATGACGATGA hIL33 Δ Exon2 CAAATCCCAACAGAAGGCCAAAGAAG

Human SMPD3 CRISPR targeting and genotyping primers IL33 sgRNA GCCCTACATCTATTCACGGC XCB616e.F TTCCATGCTACTGGCTGGTG XCB616e.R CCGCGCTTGGGTGTTAAAAA

LNA probe (ISH) IL33 Δ Exon 34 5’DIG-AGGTGAAATTCTTCCCAGCTTGAAA-3’DIG qPCR assays Lab designed assays Human IL33 full specific

68 Forward Primer CCCAACAGAAGGCCAAAGAA Probe TTTATGAAGCTCCGCTCTGGCCTT Reverse Primer GGTGGTTTCTCTCCTAAAGTAACAG IL33 Δ Exon 4 Forward Primer ACAGGTATTAGTCCTATTACAGAGTAT Probe CTTGCTTCTCTAAGCACATACAATGATCA Reverse Primer TCATAACTTTCATCCTCCAAAGC IL33 Δ Exon 3 Forward Primer TCAAGCTGGGATCCAGAAAG Probe ATCTGGTACTCGCTGCCTGTCAAC Reverse Primer GATATACCAAAGGCAAAGCACTC IL33 Δ Exon 34 Forward Primer CACAGCAAAGTGGAAGAACAC Probe AGCTTGAAACACAAGGCTTTGCTTGC Reverse Primer TACTCTGTAATAGGTGAAATTCTTCCC IL33 Δ Exon 345 Forward Primer GTGTTTCAAGCTGGGAAATAAGG Probe TGAATCAGGTGACGGTGTTGATGGT Reverse Primer GGACTCAGGGTTACCATTAACA SMPD3 Forward Primer GACGTGGCCTATCACTGTTAC Probe TGTTTCTCAAGGTGCAGGTGGGAA Reverse Primer CGATGTACCCGACGATTCTTT LAMP2 Forward Primer GATACTTGTCTGCTGGCTACC Probe TCCTGAGTGATGTTCAGCTGCAGC Reverse Primer GCCTGTGGAGTGAGTTGTATT VPS4A Forward Primer TGAAGGTGGGAGGTTGATTG Probe ATGTCAACAGCCAGACAGGGCT Reverse Primer CAGCAGAGGGAACTCTGTATTG

Mouse Il33 Forward Primer CAGCTGCAGAAGGGAGAAAT Probe CACGGCAGAATCATCGAGAAACCTGA Reverse Primer GGGAAATCTTGGAGTTGGAATACT

IDT PrimeTime® predesigned qPCR assays Muc5ac Mm.PT.58.42279692 Il13 Mm.PT.58.31366752 Tslp Mm.PT.58.41321689 Il5 Mm.PT.58.41498972 Smpd3 Mm.PT.58.11603057

Constructs

69 human IL-33 Full Length pCDH - puro Cterm-GFP human IL-33 Full Length pCDH - puro Cterm-GFP, N-term-mCherry human IL-33 Full Length pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon3-4 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon3-4 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon3-4 pCDH - neo Nterm-flag, Cterm-6his human IL-33 Δ Exon3-4 pCDH - neo Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon2 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon2 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon3 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon3 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon4 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon4 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon5 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon5 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon3-5 pCDH - puro Nterm-flag, Cterm-6his human IL-33 Δ Exon3-5 pCDH - puro Nterm-mCherry, Cterm-GFP human IL-33 Δ Exon3-4 pET21 N-term-birA-6His Other Sphingomyelinase Assay Abcam ab138876 Kit (Colorimetric)

Figure S1. Secretion of IL-33 variants in HBE-1 and COPD airway basal cells, related to Figure 1. A) Live cell imaging of stable HBE-1 mCherry-IL33-GFP variants with phase contrast overlay for single exon deleted variants: IL-33full, IL-33Δ3, IL-33Δ4, and IL-33Δ5 (and a non-natural IL-33Δ2 deletion variant, generated for comparison) and compound deleted variants IL-33Δ34 and IL-33Δ345. Individual GFP and mCherry signal, as well as merged yellow signal shown for IL-33full demonstrating overlapping signal for dual tags. Nuclear localization of IL-33Full, IL-33Δ2, IL-33Δ3, IL-33Δ4 and IL-33Δ5 fusion proteins is observed, while mixed nuclear and cytoplasmic distribution is seen for IL-33Δ34 and IL-

71 33Δ345 as in Figure 1C; scale bar 10 m (white). B) Confocal imaging of stable HBE-1 mCherry-IL-33Full-GFP and mCherry-IL-33Δ34-GFP variants with same cellular distribution as observed for epifluorescent imaging. C) ELISA secretion assay for stable mCherry- IL33-GFP HBE-1 cell lines with similar results as seen for primary cells in Figure 1D (n=5). IL-33 protein was measured using monoclonal (R&D Systems, unshaded bars) and polyclonal (R&D Systems, shaded bars) assays. Absolute (pg/ml) and % secreted were most abundant for IL-33Δ34 variant, which also exhibited highest protein levels. D) and E) Total protein and % secretion for mCherry-IL33-GFP and Flag-IL-33-His variants in non- COPD and COPD cells, corresponding to Figure 1D&E, with IL-33Δ34 variant demonstrating most abundant and % secretion (n=5). F) Secretion assay for non-COPD cells expressing Flag-IL-33Δ34-His protein using Falcon® cell culture inserts with 1 m pore size; protein detected in both apical and basal fractions with an apical predominance as in Figure 1G both as absolute (pg/ml) and % secreted protein (n=4). Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (C, D, E), t-test (F), P- values: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure S2. Inhibition of nSMase2 with validation of assays, related to Figure 2. A) Chemical inhibition of mCherry-IL-33Δ34-GFP secretion in HBE-1 stable cells treated with PBS, vehicle control (DMSO), Golgi transport inhibitors (Brefeldin, Monensin), nSMase inhibitors (GW4869, Cambinol, Spiroepoxide), glutathione, and autophagy inhibitor (3-

73 MA) as in Fig 2A (concentrations in Methods). ELISA-quantified secreted protein, total and % secreted demonstrate marked inhibition by GW4869, similar to Figure 2A (n=5). B) Total protein levels and % secretion for COPD and non-COPD cells treated with inhibitors corresponding to Figure 2A (n=5). A decrease in total assay protein with GW4869 treatment is noted, but % secretion (adjusted for total protein) still demonstrates significant blockade. C) Secretion assay for COPD cells treated with GW4869 and control (DMSO), demonstrating stable total protein and significant decrease in % secretion for variants, corresponding to Figure 2B (n=3-5). D) Flag-IL-33Δ34-His secretion assay in COPD cells with shRNA knockdown demonstrating stable total protein level and decreased % secretion with nSMase2 shRNA, corresponding to Figure 2D (n=5). E) Validation of shRNA-mediated knockdown of targets in COPD cells by qPCR. F) Secretion assay for Flag-IL-33full-His and Flag-IL-33Δ34-His in COPD cells corresponding to Figure 3A-D, demonstrating modest effect of Ivermectin and 4-MU on total protein levels, with modest decrease in total protein with GW4869 treatment, yet significant blockade when accounted for in % secretion (n=5). G) Total Flag-IL-33Δ34-His protein in HBE wild-type and SMPD3-/- secretion assay (n=5) and % total reads for indels #1-3 in SMPD3-/- line that exhibit large deletions and insertions, all expected to result in non- functional protein product. Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (A, B, D, F), t-test (C, G), P-values: *P < 0.05, **P < 0.01, ***P < 0.001.

Figure S3. Analysis of exosomes related to Figures 2, 3 and 6. Tunable Resistive Pulse Sensing (Izon qNano) and Dynamic Light Scattering (DLS, Malvern NanoS) were used to analyze concentration and size distribution of exosomes from COPD bronchial wash (BW) fluid and airway basal cell culture supernatants. A) TRPS analysis of particles < 150 nm size range are tabulated for COPD BW and airway basal cell supernatants under baseline and shRNA knockdown conditions, shown for fraction 7, the typical peak elution of exosomes from the column. Representative histograms are shown in Figure 2F and 6D. HEK293T cell supernatants are shown for comparison. #the lower limit of instrument detection is 107 particles/ml, exosome secretion was reduced to an undetectable level under nSMase2 shRNA conditions, but total depletion of particles in

75 the ~150 nm size range cannot be confirmed. Dynamic light scattering particle size histograms over the range of 101 to 104 nm (Malvern NanoS) are shown for comparison to TRPS method for B) COPD BW (n=3 specimens) and C) COPD basal cell supernatants (fractions 7-9). Results are tabulated in D) for 3 different COPD BW specimens and COPD basal cell supernatants under baseline and shRNA knockdown conditions. Results obtained using TRPS and DLS are consistent with respect to vesicle size distribution. TRPS offers measurement of vesicle concentration with more limited size resolution, while DLS is not dependent on filter cutoffs and samples a broader dynamic range, demonstrating increase in vesicle size (maximum intensity peaks) and heterogeneity under shRNA knockdown conditions.

Figure S4. Expression of IL-33 isoforms in COPD and validation of assays, related to Figure 1. A) Validation of isoform-specific qPCR assays by cycling threshold (Ct) measured for each isoform using plasmid standards at 107 copies/ml as indicated. Note, while these assays demonstrate high specificity, the efficiency of amplification in complex samples containing multiple IL-33 isoforms is reduced relative to purified single plasmid standards. B) Isoform-specific qPCR performed on lung tissue for IL33Δ3 (non-COPD n=11, COPD n=19), IL33Δ4 (non-COPD n=13, COPD n=24) and IL33Δ345 (non-COPD n=13, COPD n=23) isoforms, and cultured airway basal cells for for IL33Δ3 (non-COPD n=12, COPD n=20), IL33Δ4 (non-COPD n=10, COPD n=19) and IL33Δ345 (non-COPD n=11, COPD n=19) isoforms which demonstrate no statistical difference between COPD and non-COPD specimens. Note a suitable specific qPCR assay could not be designed for the IL33Δ5 isoform, and therefore qPCR was not measured. Data points displayed with mean  SEM. Statistical analysis: t-test (B).

Figure S5. In situ hybridization in COPD and non-COPD tissues with IL-33 protein immunostaining, related to Figure 4. A) Optimized In situ hybridization (ISH) conditions shown for the IL33Δ34 targeting probe (100 nM) after titration of probe concentration and reaction conditions for overexpressed transcripts as labeled and untransduced HBE-1 cells (none). Probe was detected using alkaline phosphatase conjugated anti-digoxigenin Fab fragments and signal developed with NBT/BCIP substrate (violet) with nuclear fast

78 red counterstain. Scale bar 10 m (white). B) ISH performed with scrambled control in non-COPD tissues. Scale bar: 50 m (gray) and 10 m (white). C) ISH with IL33Δ34 targeting probe in non-COPD tissues with corresponding immunofluorescence anti-IL-33 (green) and Krt5 (red) staining and nuclear counterstain with DAPI, in the same tissue specimen. D) ISH staining with IL33Δ34 targeting probe in COPD tissue, with corresponding immunofluorescence staining for IL-33 and Krt5 in the same specimen, demonstrating ISH signal localized primarily to the base of the epithelium, analogous IL- 33 protein staining is seen in a nuclear localized as well as more diffusely cytoplasmic patterns within the airway.

Figure S6. IL-33 immunostaining in COPD and non-COPD tissues, related to Figure 4. Anti-IL-33 and cytokeratin 5 (Krt5) immunofluorescence co-staining in non-COPD tissues and COPD tissues for the matched cohort analyzed in Figure 4. Scale bar 10 m (white). Staining demonstrates variable IL-33 staining patterns with localization generally nuclear and lower intensity in non-COPD. In COPD tissues, IL-33 staining is observed varying from nuclear predominant to mixed cytoplasmic/nuclear to diffuse airway staining,

80 with variability observed along individual sections and length within a single airway. Krt5 co-staining demonstrates IL-33 is highly expressed within Krt5+ basal cells in all specimens. High background staining of connective tissue was frequently observed in human tissues, and more intense under conditions utilizing 488-conjugated secondary antibodies despite use of multiple blocking protocols/reagents.

Figure S7. NSMase2 and IL-33 immunostaining in lung tissue, related to Figure 5. A) Anti-IL-33 (AMEC red) and nSMase2 (Vector blue) immunohistochemistry in non- COPD and COPD tissues demonstrating variable staining patterns, with nSMase2 generally more intense and diffuse throughout the airway in COPD relative to non-COPD specimens. Scale bar 10 m (white). B) Anti-IL-33 (red) and nSMase2 (green) immunofluorescence staining in same specimens as labeled. Prominent nuclear and variable cytoplasmic IL-33 staining pattern along with diffuse cytoplasmic pan-epithelial nSMase2 staining pattern are noted.

Figure S8. nSMase2 inhibition in Alternaria airway disease model, related to Figure 7. A) Periodic Acid Schiff (PAS) staining for mouse tissue sections: PBS (i.n.) only (control), Alternaria (i.n.)/2.5% DMSO/PBS (vehicle control, i.p.) (Alt/D) and Alternaria(i.n.)/GW4869 (i.p.) (Alt/G) collected at 10 days (24 hrs following the last Alternaria treatment). Scale bar 50 m (gray). Increased PAS staining is observed in Alt/D appears partially attenuated in Alt/G. B) H&E stained mouse tissue sections collected at 1 hr. post-Alternaria treatment, demonstrating intact airway epithelium. Corresponding LDH activity measured in BAL (and tissue lysates for comparison) at 1 hr. and 24 hr. post- Alternaria treatment demonstrates no difference between control and Alternaria treated BAL samples. Together these results indicate absence of airway cell necrosis with

83 Alternaria treatment. C) Quantitative PCR for transcripts as indicated at Day 6 and 10 time points demonstrating increased Il13 and Muc5ac in response to Alternaria as early as Day 6, with further increase in both at Day 10. No difference is observed in Tslp. D) Gating strategy; cells gated on side scatter low populations, then CD45-positive, lineage negative (BD mouse lineage cocktail) and subsequent CD90.2/Thy1.2 and IL-1RL1/ST2 double positive. D) Comparison of Il13 mRNA expression in total cell input, sorted total CD45-positive and sorted ILC2 cell populations demonstrating most abundant signal in ILC2 cells, which was decreased in response to GW4869. Data points displayed with mean  SEM. Statistical analysis: one-way ANOVA (C), P-values: *P < 0.05, **P < 0.01, ***P < 0.001.