DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Messenger RNA expression of albumin, transferrin, transthyretin, asialoglycoprotein receptor, P450 isoform, uptake transporter and efflux transporter genes as a function of culture duration in prolonged cultured cryopreserved human hepatocytes as collagen-matrigel sandwich cultures:

Evidence for redifferentiation upon prolonged culturing

Author names

Qian Yang and Albert P. Li Downloaded from Author affiliations

In Vitro ADMET Laboratories Inc., Columbia, MD dmd.aspetjournals.org

at ASPET Journals on October 1, 2021

1

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Running title: Redifferentiation of prolonged human hepatocyte cultures

Corresponding author: Albert P. Li, Ph. D., In Vitro ADMET Laboratories Inc., 9221 Rumsey Road Suite 8,

Columbia, MD 21045, USA. Telephone: (410)869-9037. Fax: (410)869-9034. Email: [email protected].

Number of text pages: 26

Number of tables: 3 Downloaded from

Number of figures: 10

Number of references: 78 dmd.aspetjournals.org

Number of words (Abstract): 235

Number of words (Introduction): 520 at ASPET Journals on October 1, 2021 Number of words (Discussion): 1828

List of Abbreviations: ALB (albumin), ASGPR (asialoglycoprotein receptor), CYP (cytochrome P450),

HPRT1 (hypoxanthine phosphoribosyl transferase 1), GAPDH (glyceraldehyde 3-phosphate dehydrogenase), RT-PCR (real time polymerase chain reaction), SLC (solute carrier), (TR) transferrin, TTR,

(transthyretin).

2

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Abstract.

Hepatic gene expression as a function of culture duration was evaluated in prolonged cultured human hepatocytes. Human hepatocytes from 7 donors were maintained as near-confluent collagen-matrigel sandwich cultures, with messenger RNA expression for genes responsible for key hepatic functions quantified by real time polymerase chain reaction at culture durations of 0 (day of plating), 2, 7, 9, 16,

23, 26, 29, 36 and 43 days. Key hepatocyte genes were evaluated including the differentiation markers

albumin (ALB), transferrin (TR) and transthyretin (TTR); the hepatocyte-specific asialoglycoprotein Downloaded from receptor (ASGR1); cytochrome P450 isoforms CYP1A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6,

CYP3A4, CYP3A7; uptake transporter isoforms SLC10A1, SLC22A1, SLC22A7, SLCO1B1, SLCO1B3, dmd.aspetjournals.org SLCO2B1; efflux transporter isoforms ABCB1, ABCB11, ABCC2, ABCC3, ABCC4, ABCG2; as well as the nonspecific housekeeping gene hypoxanthine ribosyl transferase (HPRT1). The well-established dedifferentiation phenomenon was observed on day 2, with substantial (>80%) decreases in gene at ASPET Journals on October 1, 2021 expression in day 2 cultures observed for all genes evaluated except HPRT1 and efflux transporters

ABCB1, ABCC2, ABCC3 ( <50% decrease in expression), ABCC4 ( >400% increase in expression), and

ABCG2 (no decrease in expression). All genes with a >80% decrease in expression were found to have increased levels of expression on day 7, with peak expression observed on either day 7 or day 9, followed by a gradual decrease in expression up to the longest duration evaluated of 43 days. Our results provide evidence that cultured human hepatocytes undergo redifferentiation upon prolonged culturing.

Significance Statement: We report that while human hepatocytes underwent dedifferentiation upon 2 days of culture, prolonged culturing resulted in redifferentiation based on gene expression of differentiation markers, uptake and efflux transporters, and P450 isoforms. The observed redifferentiation suggests that prolonged (>7 days) culturing of human hepatocyte cultures may represent an experimental approach to overcome the initial dedifferentiation process, resulting in “stabilized” hepatocytes that can be applied towards the evaluation of drug properties requiring an extended period of treatment and evaluation.

3

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Introduction

Primary human hepatocytes are considered the “gold standard” in vitro experimental system for the evaluation of human-specific drug properties, which, due to species differences, may not be obtained from studies in laboratory animals. Human hepatocytes are used routinely in drug development for the definition of human hepatic drug metabolism, transporter-mediated drug uptake and efflux, drug-drug interactions, and hepatotoxic potential (LeCluyse et al., 2005; Hewitt et al., 2007; Zhang et al., 2009;

Kenny et al., 2013; Li, 2015; Dvorak, 2016; Zhang et al., 2016) during drug development for the selection Downloaded from of drug candidates most likely to be successful in clinical trials. Primary cultured human hepatocytes have also been applied in drug discovery in the identification of potential therapeutic targets and the identification of new chemical entities for the treatment of various human liver diseases such as viral dmd.aspetjournals.org hepatitis and nonalcoholic steatohepatitis (Baktash and Randall, 2019; Ortega-Prieto et al., 2019;

Suurmond et al., 2019; Xiang et al., 2019). Most recently, we reported that prolonged cultured human hepatocytes (PCHH) represent a useful experimental tool to evaluate the potency and duration of gene at ASPET Journals on October 1, 2021 silencing effects of siRNA therapeutics (Yang et al., 2020).

Dedifferentiation of primary cultured hepatocytes, resulting in diminished hepatic functions, represents a major technical challenge limiting the utility of this experimental system (Elaut et al., 2006). Recently, several approaches have been applied successfully in the partial restoration and prolongation of hepatic functions. These approaches include three dimensional culturing of hepatocytes (Li et al., 1992; No da et al., 2012; Bell et al., 2016; Chacko et al., 2019), co-cultures of human hepatocytes with non-hepatic cells (Bhatia et al., 1997; Bonn et al., 2016; Cassidy and Yi, 2018; Ware et al., 2018), microfluidic cultures

(Burkhardt et al., 2014; Kang et al., 2015; Ortega-Prieto et al., 2019; Shoemaker et al., 2020), as well as alterations of cell culture media composition and culturing conditions (Guo et al., 2017; Oorts et al.,

2018; Xiang et al., 2019; Davidson and Khetani, 2020).

4

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Recently, we have optimized the cryopreservation conditions resulting in the preparation of cryopreserved human hepatocytes that can be maintained as near 100% confluent monolayer cultures for a prolonged culture duration of over 40 days (Yang et al., 2020). The longevity of the cultured hepatocytes allows investigation of the relationship between culture duration and hepatocyte functions, especially, if redifferentiation would occur upon prolonged culturing after initial dedifferentiation that has been previously reported by others.

We report here the quantification of mRNA expression of as a function of genes responsible for key Downloaded from hepatic functions versus culture duration in prolonged cultured human hepatocytes. Human hepatocytes from 7 donors were cultured for 43 days with mRNA quantified by RT-PCR on days 0 (day of dmd.aspetjournals.org cell plating), 2, 7, 9, 16, 23, 26, 29, 36 and 43 for genes responsible for key hepatic functions including hepatic proteins (ALB, TR, TTR), plasma membrane receptor ASGR1, P450 isoforms (CYP1A2, CYP2B6,

CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, CYP3A7), uptake transporters (SLC10A1, SLC22A1, at ASPET Journals on October 1, 2021 SLC22A7, SLCO1B1, SLCO1B3, SLCO2B), and efflux transporters (ABCB1, ABCB11, ABCC2, ABCC3, ABCC4,

ABCG2), as well as the non-specific housekeeping gene HGPRT1. Our results provide evidence for redifferentiation upon prolonged culturing of human hepatocytes.

Materials and methods

Cryopreserved human hepatocytes. 999Elite™ Cryopreserved Human Hepatocytes (In Vitro ADMET

Laboratories Inc., Columbia, MD) from 7 donors were used in the study. The cryopreserved human hepatocytes used were prepared from livers intended for but not used for transplantation, provided to our laboratory by the International Institute for the Advancement of Medicine (IIAM, Edison, NJ), with explicit donor/family consent and Institutional Review Board approval for research applications.

Hepatocytes were isolated via collagenase digestion and cryopreserved immediately after isolation without culturing to retain in vivo liver functions as previously reported (Loretz et al., 1989; Li, 1999; Li

5

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

et al., 1999; Li, 2007; Hewitt and Li, 2015; Yang et al., 2020). Demographics of the donors are presented in Table 1.

Recovery and culturing of cryopreserved human hepatocytes. Cryopreserved human hepatocytes from the 7 donors were thawed at 37°C in Cryopreserved Hepatocyte Recovery Medium (CHRM™, AP

Sciences Inc, Columbia, MD) and collected by centrifugation at 100 x g for 10 minutes. The cell pellet was resuspended in universal primary cell plating medium (UPCM™, In Vitro ADMET Laboratories Inc,

Columbia, MD) followed by viability determination via trypan blue exclusion, and cell concentration Downloaded from determination using a hemocytometer. Cell density was adjusted to 0.7 million viable cells per mL in

UCPM™ and plated in collagen coated 24-well plates (CellAffix™, AP Sciences Inc., Columbia, MD) at a dmd.aspetjournals.org volume of 0.5 mL (350,000 cells/well). Upon addition of the hepatocytes, the 24-well plates were placed in a cell culture incubator kept at 37°C in a humidified atmosphere of 5% carbon dioxide and 95% air.

The hepatocytes were allowed to attach for approximately 4 hrs followed by replacement of the plating at ASPET Journals on October 1, 2021 medium with 0.5 mL per well of Hepatocyte Induction medium (HIM, In Vitro ADMET Laboratories Inc,

Columbia, MD) containing 0.25 mg/ml Matrigel™ (Corning Inc., Pennsylvania, PA) for the establishment of a collagen-matrigel sandwich (CMS) hepatocyte culture. Upon culturing for approximately 24 hrs, medium was changed to HIM without matrigel. HIM is a serum free medium supplemented with 1% ITS medium supplement (Sigma Aldrich, St. Louis, MO) and dexamethasone (Sigma Aldrich). The final concentrations of the supplements were: recombinant human insulin (10 µg/ml), human transferrin

(5.5 µg/ml), sodium selenite (0.005 μg/ml), and dexamethasone (0.1 µM).

Prolonged culturing of the hepatocytes. Hepatocytes from each of the 7 donors were cultured as independent single donor cultures for 43 days with medium removed and replaced with fresh medium every Monday, Wednesday and Friday. The hepatocytes from the 7 donors were cultured in the same

24-well plate (3 wells per donor), with each plate designated for a specific culture duration for mRNA

6

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

isolation. mRNA quantification was performed at days 0 (4 hrs after plating), 2, 7, 9, 16, 23, 26, 29, 36 and 43 of culture. For the duration of the study, cell morphology was monitored and recorded using phase contrast photomicrography (Axiovert 25, Carl Zeiss Microscopy Inc., White Plains, NY).

Real-time PCR (RT-PCR). mRNA was isolated from each of the 7 independent cultures at the designated culture durations using an E-Z 96 Total RNA kit (Omega Bio-tek Inc., Norcross, GA, USA) and quantitated using Quant-iT™, Ribogreen® RNA Assay Kit (Life Technologies, Eugene, OR, USA) and cDNA synthesized

from total RNA using the High Capacity cDNA RT Kit (Applied Biosystems, Foster City, CA, USA) according Downloaded from to the manufacturer’s recommended protocols. cDNA was synthesized using a PTC-200 thermal cycler instrument (MJ Research, Watertown, MA, USA). Real-time polymerase chain reaction (PCR) was done in dmd.aspetjournals.org triplicate in 96-well PCR plates using the Fast Universal PCR Master Mix (Quanta Biosciences Inc.,

Beverly, MA, USA). The Master Mix was prepared by mixing per well of the 96-well plate 5 µL of Fast

Universal PCR Master mix, 2 µL RNAse-free water and 1 µL primer/probe mix (commercial TaqMan Gene at ASPET Journals on October 1, 2021 Expression Assays). In each well of the 96-well PCR plate, 2 µL cDNA solution and 8 µL Master Mix were pipetted. The 96-well plate was transferred into an ABI Prism 7500Fast RT-PCR instrument (version

2.0.6, Applied Biosystems, Foster City, CA, USA). The primers used for mRNA expression analysis are shown in Table 2. The identities and key physiological functions of the genes evaluated are shown in

Table 3.

Data analysis. Results are reported as mean and standard errors of the mean (SEM) of mRNA expression values from the 7 lots of human hepatocytes. Relative Expression was calculated using the 2–

∆∆Ct method (Rao et al., 2013), with the average Ct values of each of the target genes evaluated normalized to the average Ct value of the housekeeping gene, GAPDH and expressed as ΔCt, and with the ΔCt value at each culture duration normalized to the ΔCt value for that on the day of culture initiation (day 0) and expressed as ΔΔCt, with the results expressed as relative expression to that of day

0 using the following equations:

7

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

ΔCt = average Ct (target gene) – average Ct(GAPDH)

ΔΔCt= average ΔCt (culture duration) – average ΔCt (Day 0)

Relative Expression = 2-ΔΔCt

Statistical analysis. Two tailed ANOVA statistical analysis (GraphPad Prism 9.0) was employed to compare the mean relative expression values (mean of 7 donors) at each culture duration versus that on the day of plating (day 0), with probability (p) values of 0.05 or less considered to be statistically Downloaded from significant. Pearson correlation analysis (GraphPad Prism 9.0) was used to evaluate the correlation of mRNA expression as a function of culture duration for the genes quantified. dmd.aspetjournals.org

Results

In this study, mRNA expression was quantified in human hepatocytes derived from livers of 7 individual donors on days 0 (4 hrs after plating), 2, 7, 9, 16, 23, 26, 29, 36 and 43 of culture. The average values of at ASPET Journals on October 1, 2021 the 7 lots of human hepatocytes (N=7) are presented.

Cell morphology. On the day of plating (day 0), the hepatocytes attached after approximately 4 hrs. and assumed the cobble stone epithelial cell morphology but with minimal cell-cell contact. Near 100% confluency was observed on day 2 and throughout the duration of the study till day 30 where cell separation occurred while the hepatocytes continued to exhibit extensive cell-cell contacts similar to that in the earlier confluent cultures. (Fig. 1)

Hepatic differentiation markers. Significant (>80%) decreases in relative expression were observed on day 2 cultures for the classical markers for hepatic differentiation, ALB, TR, TTR and ASGR1. The relative expression values increased to within 50% of day 0 values on day 7, with the highest expression observed on day 9, followed by gradual decreases at the longer culturing durations. In contrast to the

8

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

differentiation marker genes, expression of the housekeeping gene HPRT1 did not decrease on day 2.

(Fig. 2)

Cytochrome P450 (CYP) isoforms. As observed with ALB, TR, TTR and ASGR1, significant (>80%) decreases in expression of all P450 isoforms evaluated were observed on day 2 of culturing with increases observed on day 7. On days 7 and 9, expression was similar or higher than that on day 0 for

CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4 and CYP3A7. Relative expression values for CYP2B6 and

CYP2C8, while increased to be higher than that for day 2, remained significantly lower than that on day Downloaded from

0. Decreased expression with culture duration was observed after day 9 for all isoforms except for

CYP2C19 and CYP2D6 with relatively stable expression at levels similar to that for day 0 throughout the dmd.aspetjournals.org culture duration. (Fig. 3)

Uptake transporters. Significant (>80%) decreases in expression of all uptake transporters SLC10A1,

SLC22A1, SLC22A7, SLCO1B1, SLCO1B3, and SLCO2B1 were observed on day 2 with increases in at ASPET Journals on October 1, 2021 expression on day 7. On days 7 and 9, the relative expression values were similar or higher than that on day 0 was observed for all uptake transporter genes except SLCO1B3. Relative expression values for

SLCO1B3, while increased to be higher on days 7 and 9 than that on day 2, remained significantly lower than day 0 values (Fig. 4).

Efflux transporters. Significant (>80%) decreases in expression were observed on day 2 for ABCB11.

Slight (>50%) but statistically significant decreases in expression were observed for ABCC2, and ABCC3.

Expression values higher than that on day 2 were observed on day 7 for these three isoforms. No decreases in relative expression values on day 2 were observed for ABCB1, ABCC4 and ABCG2. The relative expression values of ABCC4 were >4 fold of that for day 0 throughout the culture duration.

Except for ABCC4, the relative expression values for the efflux transporters were generally within 50% of that for day 0 from day 7 to day 43. (Fig. 5)

9

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Correlation analysis of gene expression. Pearson correlation analysis of gene expression versus culture duration was performed for the various genes. The results are as follows:

1. ALB, TR, TTR, ASGR1, and HPRT1. The expression of hepatic differentiation marker genes

ALB, TR, TTR, and ASGR1 versus culture duration were found to be highly correlated

among each other, with Pearson coefficient values of >0.8, with their expression

negatively correlated with the housekeeping gene, HPRT1 (Fig. 6A).

2. P450 isoforms. For P450 isoforms, positive correlation was observed among the various Downloaded from

isoforms with the exception of a negative correlation between CYP2C19 and CYP1A2.

(Fig. 6B). dmd.aspetjournals.org

3. Uptake transporters. Positive correlation was observed among all transporter genes

except for that between SLCO1B1 and SLCO2B1. (Fig. 6 C)

4. Efflux transporters. Positive correlation was observed among ABCB1, ABCB11, ABCC2, at ASPET Journals on October 1, 2021

and ABCC3; and among ABCC4, ABCB1, and ABCC3. Negative correlation was observed

between ABCG2 and all efflux transporters. (Fig. 6D)

5. All genes. Positive correlation was observed among all genes with the following

exceptions: HPRT1 has an overall negative correlation with all genes except CYP2B6,

CYP2C8, CYP2C9. CYP2C19 has a positive correlation with all genes except for CYP1A2,

CYP2B6, CYP2C9. ABCC4 has a positive correlation only with CYP2C19 and ABCG2.

CYP2C19 had positive correlations with all genes except CYP1A2, CYP2B6, CYP2C8, and

CYP2C9. ABCC4 had negative correlations with all genes except CYP2C19, SLCO2B1,

ABCB1, and ABCC4. ABCG2 had negative correlations with all genes except HPRT1,

CYP2B6, CYP2C8, CYP2C9, SLC22A1, and SLCO1B3. (Fig. 6E）

10

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Individual variations. Results of the 7 individual lots are shown in Fig. 7 (ALB, TR, TTR, ASGR1, and

HPRT1), Fig. 8 (P450 isoforms), Fig. 9 (uptake transporters), and Fig. 10 (efflux transporters).

Discussion

We report here results of mRNA expression of genes responsible for key hepatic functions versus culture duration in prolonged cultured human hepatocytes. The hepatocyte-specific genes evaluated include Downloaded from hepatic proteins ALB, TR, and TTR that are generally regarded as markers of mature hepatocytes (Lok and Loh, 1998; Ascoli et al., 2006; Buxbaum et al., 2008; Bal et al., 2013; Fujiwara and Amisaki, 2013; Lee

and Wu, 2015; Alemi et al., 2016; Zorzi et al., 2019); the plasma membrane receptor asialoglycoprotein dmd.aspetjournals.org receptor1 (ASGR1) used routinely for the delivery of therapeutic agents specifically to hepatocytes

(Merwin et al., 1994; Kim et al., 2005; Thapa et al., 2015; Huang et al., 2017); P450 isoforms CYP1A2,

CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, and CYP3A4 that are considered the key isoforms at ASPET Journals on October 1, 2021 responsible for drug metabolism (Rendic and Guengerich, 2010; Zanger and Schwab, 2013) as well as

CYP3A7, a CYP3A isoform mainly expressed in fetal but also expressed in adult livers (Kamataki et al.,

1995; Greuet et al., 1996; Okuyama et al., 2020); drug uptake transporters SLC10A1, SLC22A1, SLC22A7,

SLCO1B1, SLCO1B3 and SLCO2B1 (Fenner et al., 2012; Barton et al., 2013; Bi et al., 2019), and efflux transporters ABCB1, ABCB11, ABCC2, ABCC3, ABCC4, ABCG2 (Matsushima et al., 2005; Ishiguro et al.,

2008; Pfeifer et al., 2014) that play key roles in the regulation of intracellular concentrations of drugs and their metabolites that are transporter substrates. Expression of the housekeeping gene HPRT1

(Nishimura et al., 2006) as a function of culture duration was also evaluated for comparison to the above-mentioned hepatocyte-specific genes. The key attributes of the genes evaluated are shown in

Table 3.

11

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Our findings on dedifferentiation are consistent with the current opinion that hepatocyte dedifferentiation affects a multitude of hepatic functions. With the exception of 5 of the 6 efflux transporters (ABCB1, ABCC2, ABCC3, ABCC4, ABCG2), all the hepatic functional genes evaluated demonstrated >80% decreases in gene expression after two days of culturing, an observation consistent with the well-established phenomenon of dedifferentiation of cultured hepatocytes (Padgham and

Paine, 1993). Interestingly, of the efflux transporters evaluated, only ABCB11 demonstrated the >80% decreased expression on day 2. The lack of decreased gene expression on day 2 for the housekeeping Downloaded from gene HPRT1 provides evidence that the decreased expression of the hepatocyte-specific genes is a function of dedifferentiation and not due to an overall decrease in RNA synthesis. dmd.aspetjournals.org We report here a novel observation that all the genes with >80% decreased expression on day 2 (ALB,

TR, TTR, ASGR1, CYP1A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, SLC10A1, SLC22A1,

SLC22A7, SLCO1B1, SLCO1B3, SLCO2B1 and ABCB11) were found to have increased expression on day 7. at ASPET Journals on October 1, 2021 As ALB, TR and TTR are commonly used gene markers for hepatocyte differentiation (Page et al., 2007), the results suggest that redifferentiation occurs upon prolonged culturing of the hepatocytes. Positive correlations based on Pearson analysis of gene expression versus culture duration provide additional evidence that expression of P450 and transporter genes was similarly affected by the dedifferentiation and redifferentiation processes.

An interesting finding with uptake transporter and P450 isoform gene expression is that while they all exhibit the dedifferentiation-redifferentiation phenomenon, the extent and duration of redifferentiation based on gene expression vary among the isoforms. This observation suggests that factors in addition to that present in the culture medium may be responsible for their respective levels of expression in vivo

(presumably day 0 expression). A plausible explanation is the exposure of the liver donors to endogenous and exogenous inducers (Zanger et al., 2005; Zollner et al., 2006; Zheng et al., 2009; Inagaki et al., 2020; Zamek-Gliszczynski et al., 2020) that are absent in the culture medium.

12

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Besides the housekeeping gene HPRT1, efflux transporter gene expression was less affected by the dedifferentiation/redifferentiation process in the prolonged cultured human hepatocytes except for the bile salt efflux transporter ABCB11. ABCB11 expression had a >80% decrease in expression on day 2 of culturing and returned to near day 0 level on day 7. The other efflux transporter genes were expressed at levels within 50% of and in the case for ABCB4 (multiple drug resistance protein 3), several fold higher than that on day 0. The results suggest ABCB11 expression but not the other efflux transporter genes evaluated involves liver transcription factors that are downregulated and upregulated during Downloaded from dedifferentiation and redifferentiation, respectively, of the prolonged cultured human hepatocytes.

Another interesting observation is that, in contrast to other efflux transporters, culture duration for

ABCG2 (BCRP) expression was observed for hepatocytes from 6 of the 7 donors (Fig. 10). While the dmd.aspetjournals.org mechanism for this decrease is yet to be elucidated, it may be a result of the absence of biomolecules in the culture medium that are responsible for the maintenance of ABCG2 gene expression in vivo. It is interesting that ABCG2 has been reported to be regulated by AH receptor ligands (Tan et al., 2010; at ASPET Journals on October 1, 2021

Sayyed et al., 2016) and that its down-regulation with culture duration was similar to that observed for

CYP1A2 in this study.

Examination of individual differences in gene expression provides additional insight on the expression of the various genes evaluated. Consistent responses among the 7 donors were observed for the classical markers of hepatocyte differentiation, namely, ALB, TR, and TTR, as well as the hepatocyte specific

ASGR1, thereby providing strong evidence that confluent collagen-matrigel human hepatocytes cultures undergo dedifferentiation on day 2 and redifferentiation on day 7 (Fig. 7). It is interesting that among the P450 isoforms (Fig. 8), the non-inducible CYP2D6 expression was the most consistent among the 7 donors, suggesting that its expression in cultured hepatocytes is mainly regulated by the differentiation process. Of the inducible isoforms, CYP2C19, CYP3A4 and CYP3A7 demonstrated more consistency among the 7 donors than CYP1A2, CYP2B6, CYP2C8 and CYP2C19 which we will further explore to

13

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

further improve our understanding of differences in P450 expression. Uptake transporter expression

(Fig. 9) is consistent among all donors, with down-regulation on day 2 and up-regulation back to levels similar to that on day 0 (except for SLCO1B1 which returned to approximately 10% of that for day 0), suggesting that their expression is mainly regulated by the differentiation process. It is notable that

CYP3A7, the fetal CYP3A isoform, also returned to a level similar but not significantly exceeding that for day 0, providing evidence supporting that the hepatocytes maintained their mature phenotypes throughout the prolonged cultured durations evaluated in this study. The comparatively lower Downloaded from expression of SLCO1B1 suggests that its expression may require factors present in vivo but absent in the culture medium. Expression of efflux transporters (Fig. 10) was consistent among the various donors, with an interesting observation made with ABCC4 where expression on day-2 and longer culture dmd.aspetjournals.org durations was higher than that for day 0 for 5 of the 7 donors, and that one donor did not exhibit decreases in expression of ABCG2 with culture duration as observed for the other 6 donors. Elucidation of the mechanism of the observed individual differences may further our understanding of at ASPET Journals on October 1, 2021 environmental and genetic factors regulating P450 and transporter expression in the human liver, thereby improving our ability to evaluate individual differences in drug properties in the human population.

The dedifferentiation and redifferentiation observed based on hepatic gene expression suggest that prolonged human hepatocyte cultures may represent an experimental tool to elucidate the mechanism of hepatocyte differentiation. Dedifferentiation of cultured hepatocytes has been attributed to the downregulation of transcription factors involved in liver-specific gene expression as a result of cell proliferation based on experimental findings with cultured rat hepatocytes (Padgham et al., 1993;

Mizuguchi et al., 1998) and in vivo partial hepatectomy studies (Flodby et al., 1993; Eleswarapu and

Jiang, 2005). As culture duration as the only variable in our study, reestablishment of gap junctions between hepatocytes is a likely mechanism. The current working hypothesis that we employ to guide

14

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

further investigation is that hepatocyte dedifferentiation occurs in early hepatocyte cultures due to the lack of cell-cell communication via gap junctions that are disrupted during hepatocyte isolation, with redifferentiation occurring upon the reestablishment of cell-cell junctions upon prolonged culturing of the hepatocytes as confluent cultures. This hypothesis is consistent with the key roles established for cell-cell communication via gap junctions in the expression of hepatic functions (Hamilton et al., 2001;

Stoehr and Isom, 2003; Vinken et al., 2006; Willebrords et al., 2015), as well as the findings that culturing of hepatocytes under experimental conditions allowing prolonged culturing with extensive cell- Downloaded from cell contact such as hepatocyte spheroids (Bell et al., 2017; Desai et al., 2017) and co-cultures with non- hepatocytes (Ramsden et al., 2014; Ware et al., 2018) lead to enhanced hepatic functions. A potential implication of our findings is that in vivo conditions resulting in disruption of cell-cell junctions may lead dmd.aspetjournals.org to down regulation of hepatic functions including protein synthesis, uptake and efflux transport, and

P450-dependent drug metabolism with recovery of the functions upon the reestablishment of cell-cell junctions. at ASPET Journals on October 1, 2021

The observed redifferentiation suggests that prolonged (>7 days) culturing of cryopreserved human hepatocyte may overcome the dedifferentiation phenomenon that has been a major challenge in the application of this “gold standard” in vitro human experimental system. Prolonged (>7 days) cryopreserved human hepatocyte cultures may represent “stabilized” hepatocytes for the evaluation of certain aspects of drug properties requiring an extended period of treatment and evaluation, with the caveats that certain hepatic genes such as CYP2B6, CYP2C8 and SLCO1B3 remained substantially under- expressed compared to that at the initiation of the cultures, and that the duration of the increased expression levels vary among the different genes. We have recently reported a proof-of-concept study successfully demonstrating the application of prolonged human hepatocyte cultures in the evaluation of potency and duration of siRNA therapeutics on target gene expression (Yang et al., 2020). Additional potential applications of the prolonged human hepatocyte cultures to aid drug development that we will

15

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

evaluate in our laboratory include hepatitis viral replication, chronic drug toxicity, as well as investigation of the effects of prolonged drug treatment on the inhibition and induction of drug metabolizing enzymes and transporters.

In our laboratory, we are investigating experimental approaches to overcome the phenomenon of dedifferentiation of primary human hepatocytes cultured as 2-dimensional monolayers, a property that has been considered a limitation of this “gold standard” in vitro experimental system for the evaluation

of human drug properties. Our ultimate goal is to develop practical and reproducible culture conditions Downloaded from for stable and fully functional human hepatocytes to extend the utility of this valuable experimental system. Results from the current study provide convincing data based on mRNA expression that dmd.aspetjournals.org prolonged culturing may lead to hepatocytes with stable hepatic properties, at least for several days after day 7. As there may be differences between mRNA and protein expression (Wegler et al., 2020), it is necessary to confirm our results with functional evaluation. Research is ongoing in our laboratory to at ASPET Journals on October 1, 2021 extensively evaluate drug metabolizing enzyme and transporter activities as a function of culture duration. Our current investigation includes various cell culture plate formats (e.g. 24-well plates versus

96-well plates), donor-to-donor variations, as well as identification of medium supplements required to maintain hepatic functions.

16

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Acknowledgment

The author grateful acknowledge Ms. Kirsten Amaral for her assistance in cell cultures and Linda Loretz,

Ph. D., for her critical review of the manuscript.

Downloaded from dmd.aspetjournals.org at ASPET Journals on October 1, 2021

17

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Authorship Contributions.

Participate in research design: Li, Yang

Conducted experiments: Yang

Contributed new reagents or analytical tools: Li, Yang

Performed data analysis: Yang, Li

Wrote or contribute to the writing of the manuscript: Qian Yang, A. P. Li. Downloaded from dmd.aspetjournals.org at ASPET Journals on October 1, 2021

18

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

References

Alemi M, Gaiteiro C, Ribeiro CA, Santos LM, Gomes JR, Oliveira SM, Couraud PO, Weksler B, Romero I, Saraiva MJ, and Cardoso I (2016) Transthyretin participates in beta-amyloid transport from the brain to the liver--involvement of the low-density lipoprotein receptor-related protein 1? Sci Rep 6:20164. Ascoli GA, Domenici E, and Bertucci C (2006) Drug binding to human serum albumin: abridged review of results obtained with high-performance liquid chromatography and circular dichroism. Chirality 18:667-679. Baktash Y and Randall G (2019) Live Cell Imaging of Hepatitis C Virus Trafficking in Hepatocytes. Methods Mol Biol 1911:263-274. Bal W, Sokolowska M, Kurowska E, and Faller P (2013) Binding of transition metal ions to albumin: sites,

affinities and rates. Biochim Biophys Acta 1830:5444-5455. Downloaded from Barton HA, Lai Y, Goosen TC, Jones HM, El-Kattan AF, Gosset JR, Lin J, and Varma MV (2013) Model- based approaches to predict drug-drug interactions associated with hepatic uptake transporters: preclinical, clinical and beyond. Expert Opin Drug Metab Toxicol 9:459-472. Bell CC, Hendriks DF, Moro SM, Ellis E, Walsh J, Renblom A, Fredriksson Puigvert L, Dankers AC, Jacobs F,

Snoeys J, Sison-Young RL, Jenkins RE, Nordling A, Mkrtchian S, Park BK, Kitteringham NR, dmd.aspetjournals.org Goldring CE, Lauschke VM, and Ingelman-Sundberg M (2016) Characterization of primary human hepatocyte spheroids as a model system for drug-induced liver injury, liver function and disease. Sci Rep 6:25187. Bell CC, Lauschke VM, Vorrink SU, Palmgren H, Duffin R, Andersson TB, and Ingelman-Sundberg M (2017) Transcriptional, Functional, and Mechanistic Comparisons of Stem Cell-Derived

Hepatocytes, HepaRG Cells, and Three-Dimensional Human Hepatocyte Spheroids as Predictive at ASPET Journals on October 1, 2021 In Vitro Systems for Drug-Induced Liver Injury. Drug Metab Dispos 45:419-429. Bhatia SN, Yarmush ML, and Toner M (1997) Controlling cell interactions by micropatterning in co- cultures: hepatocytes and 3T3 fibroblasts. J Biomed Mater Res 34:189-199. Bi YA, Costales C, Mathialagan S, West M, Eatemadpour S, Lazzaro S, Tylaska L, Scialis R, Zhang H, Umland J, Kimoto E, Tess DA, Feng B, Tremaine LM, Varma MVS, and Rodrigues AD (2019) Quantitative Contribution of Six Major Transporters to the Hepatic Uptake of Drugs: "SLC- Phenotyping" Using Primary Human Hepatocytes. J Pharmacol Exp Ther 370:72-83. Bonn B, Svanberg P, Janefeldt A, Hultman I, and Grime K (2016) Determination of Human Hepatocyte Intrinsic Clearance for Slowly Metabolized Compounds: Comparison of a Primary Hepatocyte/Stromal Cell Co-culture with Plated Primary Hepatocytes and HepaRG. Drug Metab Dispos 44:527-533. Burkhardt B, Martinez-Sanchez JJ, Bachmann A, Ladurner R, and Nussler AK (2014) Long-term culture of primary hepatocytes: new matrices and microfluidic devices. Hepatol Int 8:14-22. Buxbaum JN, Ye Z, Reixach N, Friske L, Levy C, Das P, Golde T, Masliah E, Roberts AR, and Bartfai T (2008) Transthyretin protects Alzheimer's mice from the behavioral and biochemical effects of Abeta toxicity. Proc Natl Acad Sci U S A 105:2681-2686. Cassidy KC and Yi P (2018) Qualitative and quantitative prediction of human in vivo metabolic pathways in a human hepatocyte-murine stromal cell co-culture model. Xenobiotica 48:1192-1205. Chacko SA, Ly VT, Christopher LJ, and Gan J (2019) Hepatocyte spheroids as a viable in vitro model for recapitulation of complex in vivo metabolism pathways of loratadine in humans. Xenobiotica:1- 9. Davidson MD and Khetani SR (2020) Intermittent Starvation Extends the Functional Lifetime of Primary Human Hepatocyte Cultures. Toxicol Sci 174:266-277.

19

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Desai PK, Tseng H, and Souza GR (2017) Assembly of Hepatocyte Spheroids Using Magnetic 3D Cell Culture for CYP450 Inhibition/Induction. Int J Mol Sci 18. Dvorak Z (2016) Opportunities and challenges in using human hepatocytes in cytochromes P450 induction assays. Expert Opin Drug Metab Toxicol 12:169-174. Elaut G, Henkens T, Papeleu P, Snykers S, Vinken M, Vanhaecke T, and Rogiers V (2006) Molecular mechanisms underlying the dedifferentiation process of isolated hepatocytes and their cultures. Curr Drug Metab 7:629-660. Eleswarapu S and Jiang H (2005) Growth hormone regulates the expression of hepatocyte nuclear factor-3 gamma and other liver-enriched transcription factors in the bovine liver. J Endocrinol 184:95-105. Fenner KS, Jones HM, Ullah M, Kempshall S, Dickins M, Lai Y, Morgan P, and Barton HA (2012) The evolution of the OATP hepatic uptake transport protein family in DMPK sciences: from obscure liver transporters to key determinants of hepatobiliary clearance. Xenobiotica 42:28-45. Flodby P, Antonson P, Barlow C, Blanck A, Porsch-Hallstrom I, and Xanthopoulos KG (1993) Differential Downloaded from patterns of expression of three C/EBP isoforms, HNF-1, and HNF-4 after partial hepatectomy in rats. Exp Cell Res 208:248-256. Fujiwara S and Amisaki T (2013) Fatty acid binding to serum albumin: molecular simulation approaches. Biochim Biophys Acta 1830:5427-5434. Greuet J, Pichard L, Bonfils C, Domergue J, and Maurel P (1996) The fetal specific gene CYP3A7 is dmd.aspetjournals.org inducible by rifampicin in adult human hepatocytes in primary culture. Biochem Biophys Res Commun 225:689-694. Guo R, Xu X, Lu Y, and Xie X (2017) Physiological oxygen tension reduces hepatocyte dedifferentiation in in vitro culture. Sci Rep 7:5923. Hamilton GA, Jolley SL, Gilbert D, Coon DJ, Barros S, and LeCluyse EL (2001) Regulation of cell morphology and cytochrome P450 expression in human hepatocytes by extracellular matrix and at ASPET Journals on October 1, 2021 cell-cell interactions. Cell Tissue Res 306:85-99. Hewitt NJ, Lechon MJ, Houston JB, Hallifax D, Brown HS, Maurel P, Kenna JG, Gustavsson L, Lohmann C, Skonberg C, Guillouzo A, Tuschl G, Li AP, LeCluyse E, Groothuis GM, and Hengstler JG (2007) Primary hepatocytes: current understanding of the regulation of metabolic enzymes and transporter proteins, and pharmaceutical practice for the use of hepatocytes in metabolism, enzyme induction, transporter, clearance, and hepatotoxicity studies. Drug Metab Rev 39:159- 234. Hewitt NJ and Li AP (2015) Cryopreservation of Hepatocytes. Methods Mol Biol 1250:13-26. Huang X, Leroux JC, and Castagner B (2017) Well-Defined Multivalent Ligands for Hepatocytes Targeting via Asialoglycoprotein Receptor. Bioconjug Chem 28:283-295. Inagaki M, Nishimura T, Nakanishi T, Shimada H, Noguchi S, Akanuma SI, Tachikawa M, Hosoya KI, Tamai I, Nakashima E, and Tomi M (2020) Contribution of Prostaglandin Transporter OATP2A1/SLCO2A1 to Placenta-to-Maternal Hormone Signaling and Labor Induction. iScience 23:101098. Ishiguro N, Maeda K, Saito A, Kishimoto W, Matsushima S, Ebner T, Roth W, Igarashi T, and Sugiyama Y (2008) Establishment of a set of double transfectants coexpressing organic anion transporting polypeptide 1B3 and hepatic efflux transporters for the characterization of the hepatobiliary transport of telmisartan acylglucuronide. Drug Metab Dispos 36:796-805. Kamataki T, Hashimoto H, Shimoji M, Itoh S, Nakayama K, Hattori K, Yokoi T, Katsuki M, and Aizawa S (1995) Expression of CYP3A7, a human fetus-specific cytochrome P450, in cultured cells and in the hepatocytes of p53-knockout mice. Toxicol Lett 82-83:879-882.

20

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Kang YB, Sodunke TR, Lamontagne J, Cirillo J, Rajiv C, Bouchard MJ, and Noh M (2015) Liver sinusoid on a chip: Long-term layered co-culture of primary rat hepatocytes and endothelial cells in microfluidic platforms. Biotechnol Bioeng 112:2571-2582. Kenny JR, Liu MM, Chow AT, Earp JC, Evers R, Slatter JG, Wang DD, Zhang L, and Zhou H (2013) Therapeutic protein drug-drug interactions: navigating the knowledge gaps-highlights from the 2012 AAPS NBC Roundtable and IQ Consortium/FDA workshop. AAPS J 15:933-940. Kim EM, Jeong HJ, Park IK, Cho CS, Moon HB, Yu DY, Bom HS, Sohn MH, and Oh IJ (2005) Asialoglycoprotein receptor targeted gene delivery using galactosylated polyethylenimine-graft- poly(ethylene glycol): in vitro and in vivo studies. J Control Release 108:557-567. LeCluyse EL, Alexandre E, Hamilton GA, Viollon-Abadie C, Coon DJ, Jolley S, and Richert L (2005) Isolation and culture of primary human hepatocytes. Methods Mol Biol 290:207-229. Lee P and Wu X (2015) Review: modifications of human serum albumin and their binding effect. Curr Pharm Des 21:1862-1865. Li AP (1999) Overview: hepatocytes and cryopreservation--a personal historical perspective. Chem Biol Downloaded from Interact 121:1-5. Li AP (2007) Human hepatocytes: isolation, cryopreservation and applications in drug development. Chem Biol Interact 168:16-29. Li AP (2015) Evaluation of Adverse Drug Properties with Cryopreserved Human Hepatocytes and the Integrated Discrete Multiple Organ Co-culture (IdMOC(TM)) System. Toxicol Res 31:137-149. dmd.aspetjournals.org Li AP, Colburn SM, and Beck DJ (1992) A simplified method for the culturing of primary adult rat and human hepatocytes as multicellular spheroids. In Vitro Cell Dev Biol 28A:673-677. Li AP, Lu C, Brent JA, Pham C, Fackett A, Ruegg CE, and Silber PM (1999) Cryopreserved human hepatocytes: characterization of drug-metabolizing enzyme activities and applications in higher throughput screening assays for hepatotoxicity, metabolic stability, and drug-drug interaction potential. Chem Biol Interact 121:17-35. at ASPET Journals on October 1, 2021 Lok CN and Loh TT (1998) Regulation of transferrin function and expression: review and update. Biol Signals Recept 7:157-178. Loretz LJ, Li AP, Flye MW, and Wilson AG (1989) Optimization of cryopreservation procedures for rat and human hepatocytes. Xenobiotica 19:489-498. Matsushima S, Maeda K, Kondo C, Hirano M, Sasaki M, Suzuki H, and Sugiyama Y (2005) Identification of the hepatic efflux transporters of organic anions using double-transfected Madin-Darby canine kidney II cells expressing human organic anion-transporting polypeptide 1B1 (OATP1B1)/multidrug resistance-associated protein 2, OATP1B1/multidrug resistance 1, and OATP1B1/breast cancer resistance protein. J Pharmacol Exp Ther 314:1059-1067. Merwin JR, Noell GS, Thomas WL, Chiou HC, DeRome ME, McKee TD, Spitalny GL, and Findeis MA (1994) Targeted delivery of DNA using YEE(GalNAcAH)3, a synthetic glycopeptide ligand for the asialoglycoprotein receptor. Bioconjug Chem 5:612-620. Mizuguchi T, Mitaka T, Hirata K, Oda H, and Mochizuki Y (1998) Alteration of expression of liver-enriched transcription factors in the transition between growth and differentiation of primary cultured rat hepatocytes. J Cell Physiol 174:273-284. Nishimura M, Koeda A, Suzuki E, Shimizu T, Kawano Y, Nakayama M, Satoh T, Narimatsu S, and Naito S (2006) Effects of prototypical drug-metabolizing enzyme inducers on mRNA expression of housekeeping genes in primary cultures of human and rat hepatocytes. Biochem Biophys Res Commun 346:1033-1039. No da Y, Lee SA, Choi YY, Park D, Jang JY, Kim DS, and Lee SH (2012) Functional 3D human primary hepatocyte spheroids made by co-culturing hepatocytes from partial hepatectomy specimens and human adipose-derived stem cells. PLoS One 7:e50723.

21

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Okuyama S, Kawamura F, Kubiura M, Tsuji S, Osaki M, Kugoh H, Oshimura M, Kazuki Y, and Tada M (2020) Real-time fluorometric evaluation of hepatoblast proliferation in vivo and in vitro using the expression of CYP3A7 coding for human fetus-specific P450. Pharmacol Res Perspect 8:e00642. Oorts M, Keemink J, Deferm N, Adriaensen R, Richert L, Augustijns P, and Annaert P (2018) Extra collagen overlay prolongs the differentiated phenotype in sandwich-cultured rat hepatocytes. J Pharmacol Toxicol Methods 90:31-38. Ortega-Prieto AM, Skelton JK, Cherry C, Briones-Orta MA, Hateley CA, and Dorner M (2019) "Liver-on-a- Chip" Cultures of Primary Hepatocytes and Kupffer Cells for Hepatitis B Virus Infection. J Vis Exp. Padgham CR, Boyle CC, Wang XJ, Raleigh SM, Wright MC, and Paine AJ (1993) Alteration of transcription factor mRNAs during the isolation and culture of rat hepatocytes suggests the activation of a proliferative mode underlies their de-differentiation. Biochem Biophys Res Commun 197:599- 605. Padgham CR and Paine AJ (1993) Altered expression of cytochrome P-450 mRNAs, and potentially of Downloaded from other transcripts encoding key hepatic functions, are triggered during the isolation of rat hepatocytes. Biochem J 289 ( Pt 3):621-624. Page JL, Johnson MC, Olsavsky KM, Strom SC, Zarbl H, and Omiecinski CJ (2007) Gene expression profiling of extracellular matrix as an effector of human hepatocyte phenotype in primary cell culture. Toxicol Sci 97:384-397. dmd.aspetjournals.org Pfeifer ND, Hardwick RN, and Brouwer KL (2014) Role of hepatic efflux transporters in regulating systemic and hepatocyte exposure to xenobiotics. Annu Rev Pharmacol Toxicol 54:509-535. Ramsden D, Tweedie DJ, Chan TS, Taub ME, and Li Y (2014) Bridging in vitro and in vivo metabolism and transport of faldaprevir in human using a novel cocultured human hepatocyte system, HepatoPac. Drug Metab Dispos 42:394-406. Rao X, Huang X, Zhou Z, and Lin X (2013) An improvement of the 2^(-delta delta CT) method for at ASPET Journals on October 1, 2021 quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath 3:71-85. Rendic S and Guengerich FP (2010) Update information on drug metabolism systems--2009, part II: summary of information on the effects of diseases and environmental factors on human cytochrome P450 (CYP) enzymes and transporters. Curr Drug Metab 11:4-84. Sayyed K, Vee ML, Abdel-Razzak Z, Jouan E, Stieger B, Denizot C, Parmentier Y, and Fardel O (2016) Alteration of human hepatic drug transporter activity and expression by cigarette smoke condensate. Toxicology 363-364:58-71. Shoemaker JT, Zhang W, Atlas SI, Bryan RA, Inman SW, and Vukasinovic J (2020) A 3D Cell Culture Organ- on-a-Chip Platform With a Breathable Hemoglobin Analogue Augments and Extends Primary Human Hepatocyte Functions in vitro. Front Mol Biosci 7:568777. Stoehr SA and Isom HC (2003) Gap junction-mediated intercellular communication in a long-term primary mouse hepatocyte culture system. Hepatology 38:1125-1135. Suurmond CE, Lasli S, van den Dolder FW, Ung A, Kim HJ, Bandaru P, Lee K, Cho HJ, Ahadian S, Ashammakhi N, Dokmeci MR, Lee J, and Khademhosseini A (2019) In Vitro Human Liver Model of Nonalcoholic Steatohepatitis by Coculturing Hepatocytes, Endothelial Cells, and Kupffer Cells. Adv Healthc Mater:e1901379. Tan KP, Wang B, Yang M, Boutros PC, Macaulay J, Xu H, Chuang AI, Kosuge K, Yamamoto M, Takahashi S, Wu AM, Ross DD, Harper PA, and Ito S (2010) Aryl hydrocarbon receptor is a transcriptional activator of the human breast cancer resistance protein (BCRP/ABCG2). Mol Pharmacol 78:175- 185. Thapa B, Kumar P, Zeng H, and Narain R (2015) Asialoglycoprotein Receptor-Mediated Gene Delivery to Hepatocytes Using Galactosylated Polymers. Biomacromolecules 16:3008-3020.

22

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Vinken M, Papeleu P, Snykers S, De Rop E, Henkens T, Chipman JK, Rogiers V, and Vanhaecke T (2006) Involvement of cell junctions in hepatocyte culture functionality. Crit Rev Toxicol 36:299-318. Ware BR, Durham MJ, Monckton CP, and Khetani SR (2018) A Cell Culture Platform to Maintain Long- term Phenotype of Primary Human Hepatocytes and Endothelial Cells. Cell Mol Gastroenterol Hepatol 5:187-207. Wegler C, Olander M, Wisniewski JR, Lundquist P, Zettl K, Asberg A, Hjelmesaeth J, Andersson TB, and Artursson P (2020) Global variability analysis of mRNA and protein concentrations across and within human tissues. NAR Genom Bioinform 2:lqz010. Willebrords J, Crespo Yanguas S, Maes M, Decrock E, Wang N, Leybaert L, da Silva TC, Veloso Alves Pereira I, Jaeschke H, Cogliati B, and Vinken M (2015) Structure, Regulation and Function of Gap Junctions in Liver. Cell Commun Adhes 22:29-37. Xiang C, Du Y, Meng G, Soon Yi L, Sun S, Song N, Zhang X, Xiao Y, Wang J, Yi Z, Liu Y, Xie B, Wu M, Shu J, Sun D, Jia J, Liang Z, Sun D, Huang Y, Shi Y, Xu J, Lu F, Li C, Xiang K, Yuan Z, Lu S, and Deng H (2019) Long-term functional maintenance of primary human hepatocytes in vitro. Science Downloaded from 364:399-402. Yang Q, Humphreys SC, Lade JM, and Li AP (2020) Prolonged cultured human hepatocytes as an in vitro experimental system for the evaluation of potency and duration of activity of RNA therapeutics: Demonstration of prolonged duration of gene silencing effects of a GalNAc-conjugated human hypoxanthine phosphoribosyl transferase (HPRT1) siRNA. Biochem Pharmacol:114374. dmd.aspetjournals.org Zamek-Gliszczynski MJ, Patel M, Yang X, Lutz JD, Chu X, Brouwer KLR, Lai Y, Lee CA, Neuhoff S, Paine MF, Sugiyama Y, Taskar KS, and Galetin A (2020) Intestinal P-gp and Putative Hepatic OATP1B Induction: International Transporter Consortium Perspective on Drug Development Implications. Clin Pharmacol Ther. Zanger UM, Klein K, Richter T, Toscano C, and Zukunft J (2005) Impact of genetic polymorphism in relation to other factors on expression and function of human drug-metabolizing p450s. Toxicol at ASPET Journals on October 1, 2021 Mech Methods 15:121-124. Zanger UM and Schwab M (2013) Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther 138:103-141. Zhang J, Doshi U, Suzuki A, Chang CW, Borlak J, Li AP, and Tong W (2016) Evaluation of multiple mechanism-based toxicity endpoints in primary cultured human hepatocytes for the identification of drugs with clinical hepatotoxicity: Results from 152 marketed drugs with known liver injury profiles. Chem Biol Interact 255:3-11. Zhang L, Zhang YD, Zhao P, and Huang SM (2009) Predicting drug-drug interactions: an FDA perspective. AAPS J 11:300-306. Zheng HX, Huang Y, Frassetto LA, and Benet LZ (2009) Elucidating rifampin's inducing and inhibiting effects on glyburide pharmacokinetics and blood glucose in healthy volunteers: unmasking the differential effects of enzyme induction and transporter inhibition for a drug and its primary metabolite. Clin Pharmacol Ther 85:78-85. Zollner G, Wagner M, Moustafa T, Fickert P, Silbert D, Gumhold J, Fuchsbichler A, Halilbasic E, Denk H, Marschall HU, and Trauner M (2006) Coordinated induction of bile acid detoxification and alternative elimination in mice: role of FXR-regulated organic solute transporter-alpha/beta in the adaptive response to bile acids. Am J Physiol Gastrointest Liver Physiol 290:G923-932. Zorzi A, Linciano S, and Angelini A (2019) Non-covalent albumin-binding ligands for extending the circulating half-life of small biotherapeutics. Medchemcomm 10:1068-1081.

23

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Footnotes

Source of funding. This work received no external funding.

Conflicts of interests statement. The authors (QY, APL) are employees of In Vitro ADMET Laboratories

Inc., a commercial provider of cryopreserved human hepatocytes.

Legends to Figures

Fig. 1. Morphology of prolonged cultured 999Elite Human Hepatocytes (lot HH1136) at various culturing Downloaded from durations in the study (Phase contrast image, 200X magnification).

Fig. 2. Effects of prolonged culturing on gene expression of classical markers of “mature” hepatocyte, dmd.aspetjournals.org genes ALB, TF, TTR and ASGR. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of results of hepatocytes from 7 human hepatocyte lots are shown. Probability (p) values are shown for relative expression values that are at ASPET Journals on October 1, 2021 statistically significant (p<0.05) to be different from that for day 0.

Fig. 3. Effects of prolonged culturing on gene expression of P450 isoforms CYP1A2, CYP2B6, CYP2C8,

CYP2C9, CYP2C19, CYP2D6, CYP3A4 and CYP3A7. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of results of hepatocytes from 7 human hepatocyte lots are shown. Probability (p) values are shown for relative expression values that are statistically significant (p<0.05) to be different from that for day 0.

Fig. 4. Effects of prolonged culturing on gene expression of uptake transporters SLC10A1, SLC22A1,

SLC22A7, SLCO1B1, SLCO1B3, and SLCO2B1. Relative mRNA expression (expressed as fold of that for day

0) is plotted versus culture duration. Mean and standard errors (error bars) of results of hepatocytes from 7 human hepatocyte lots are shown. Probability (p) values are shown for relative expression values that are statistically significant (p<0.05) to be different from that for day 0.

24

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Fig. 5. Effects of prolonged culturing on gene expression of efflux transporters ABCB1, ABCB11, ABCC2,

ABCC3, ABCC4 and ABCG2. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of results of hepatocytes from 7 human hepatocyte lots are shown. Probability (p) values are shown for relative expression values that are statistically significant (p<0.05) to be different from that for day 0.

Fig. 6. Heat map of the results of Pearson correlation analysis of hepatic gene expression. ALB, TR, TTR,

ASGR1 and HPRT1 (A); P450 isoforms (B); uptake transporters (C), efflux transporters (D), and all 20 Downloaded from genes (E). The genes depicted in Fig. 6E are: ALB(A), TR(B), TTR(C), ASGR1(D), HPRT1(E), CYP1A2(F),

CYP2B6(G), CYP2C8(H), CYP2C9(I), CYP2C19(J), CYP2D6(K), CYP3A4(L), SLC10A1(M), SLC22A1(N), dmd.aspetjournals.org SLC22A7(O), SLCO1B1(P), SLCO1B3(Q), SLCO2B1(R), ABCB1(S), ABCB11(T), ABCC2(U), ABCC3(V),

ABCC4(W) and ABCG2(X). Pearson correlation coefficient is shown in each cell. The extent of correlation is depicted by the intensity of the color in each cell, with blue representing positive at ASPET Journals on October 1, 2021 correlation and red representing negative correlation as shown in the scale bars next to each plot.

CYP3A7 is not included in this analysis.

Fig. 7. Effects of prolonged culturing on gene expression of classical markers of “mature” hepatocyte, genes ALB, TF, TTR and ASGR for hepatocytes from each of the 7 donors to illustrate the extend of individual variations. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of triplicate evaluation at the various culture durations are shown.

Fig. 8. Effects of prolonged culturing on gene expression of P450 isoforms CYP1A2, CYP2B6, CYP2C8,

CYP2C9, CYP2C19, CYP2D6, CYP3A4 and CYP3A7 for hepatocytes from each of the 7 donors to illustrate the extend of individual variations. Relative mRNA expression (expressed as fold of that for day 0) is

25

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

plotted versus culture duration. Mean and standard errors (error bars) of triplicate evaluation at the various culture durations are shown.

Fig. 9. Effects of prolonged culturing on gene expression of uptake transporters SLC10A1, SLC22A1,

SLC22A7, SLCO1B1, SLCO1B3, and SLCO2B1 for hepatocytes from each of the 7 donors to illustrate the extend of individual variations. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of triplicate evaluation at the various

culture durations are shown. Downloaded from

Fig. 10. Effects of prolonged culturing on gene expression of efflux transporters ABCB1, ABCB11, ABCC2,

ABCC3, ABCC4 and ABCG2 for hepatocytes from each of the 7 donors to illustrate the extend of dmd.aspetjournals.org individual variations. Relative mRNA expression (expressed as fold of that for day 0) is plotted versus culture duration. Mean and standard errors (error bars) of triplicate evaluation at the various culture durations are shown. at ASPET Journals on October 1, 2021

26

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Table 1. Demographic information of the 7 donors whose livers were used in the preparation of the cryopreserved human hepatocytes employed in the study. (BMI: Body mass index).

Lot Ethnicity Gender Age (Years) BMI

HH1086 Hispanic Female 77 30.3

HH1117 Caucasian Male 31 27.4

HH1121 Hispanic Female 24 34

HH1136 Caucasian Male 1.3 27.34 Downloaded from

HH1142 Caucasian Female 27 24.99

HH1144 Caucasian Female 24 24 dmd.aspetjournals.org HH1161 African American Male 35 32.26

at ASPET Journals on October 1, 2021

27

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Table 2. Gene primers used for RT-PCR quantification of hepatic gene expression in prolonged cultured human hepatocytes.

Customer Primers Taqman Primers

F: ATGGTCCCAGTGTTGCVTTGT ALB HS00910225_m1 TF R: CATCCAGTGTCACAGCATCC HPRT1 Hs02800695_m1 F: ACTTGGCATCTCCCCATTC ASGR1 HS01005019_m1 TTR R: TAGGAGTAGGGGCTCAGCAG ABCB1 HS00184500_m1 F: AAGGTGAAGGTCGGAGTCAA ABCB11 HS00184824_m1 GAPDH Downloaded from R: AATGAAGGGGTCATTGATGG ABCC2 HS00166123_m1 F: CTTCGTAAACCAGTGGCAGG ABCC3 HS00978473_m1 CYP1A2 R: AGGGCTTGTTAATGGCAGTG ABCC4 HS00988734_m1 F: CCCTTTTGGGAAACCTTCTG ABCG2 HS01053790_m1 CYP2B6

R: GTCCCAGGTGTACCGTGAAG SLC10A1 HS00161820_m1 dmd.aspetjournals.org F: CTCGGGACTTTATGGATTGC SLC22A1 HS00427552_m1 CYP2C8 R: CAGTGCCAACCAAGTTTTCA SLC22A7 HS00198527_m1 F: TGCTTCCTGATGAAAATGGA SLCO1B1 HS00272374_m1 CYP2C9 R: TCTCTGTCCCAGCTCCAAAC SLCO1B3 HS00251986_m1 F: TTGCTTCCTGATCAAAATGG SLCO2B1 HS00200670_m1 CYP2C19 at ASPET Journals on October 1, 2021 R: GTCTCTGTCCCAGCTCCAAG F: TGGACTTCCAGAACACACCA CYP2D6 R: CCCATTGAGCACGACCAC F: TTTTGTCCTACCATAAGGGCTTT CYP3A4 R: CACAGGCTGTTGACCATCAT F: GGGAAATGCTTTGTCCTTCC CYP3A7 R: AGCCAGCATAGGCTGTTGAC

28

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

Table 3. Genes and their respective proteins and selected attributes evaluated in this study

Gene Protein Selected Attributes Reference

ALB Albumin The most abundant plasma protein responsible for the (Ascoli et al., 2006; Bal maintenance of plasma oncotic pressure. Plays a key role et al., 2013; Fujiwara in the bioavailability and distribution of metal ions, fatty and Amisaki, 2013; acids, steroid hormones and pharmaceutical drugs Lee and Wu, 2015; Zorzi et al., 2019). TF Transferrin Transferrin binds and transfer iron to cells for the synthesis (Lok and Loh, 1998). of iron-containing proteins (e.g. hemoglobin synthesis during erythropoiesis) via the transferrin receptor on the plasma membrane TTR Transthyretin Transthyretin has high affinity for thyroxine and retinol, (Buxbaum et al., 2008;

and recently has been found bind amyloid beta protein and Alemi et al., 2016) Downloaded from may have a protective role in the onset of Alzheimer’s disease ASGR1 Asialoglycoprotein Transmembrane protein mediating the endocytosis and (Tanowitz et al., 2017; receptor 1 lysosomal degradation of glycoproteins. Target of Yang et al., 2020) drug/siRNA therapeutic delivery into hepatocytes.

HPRT1 Hypoxanthine Enzyme present in all tissues catalyzing purine salvage (Agrahari et al., 2019) dmd.aspetjournals.org ribosyl pathway in the formation of hypoxanthine to inosine transferase monophosphate and guanine to guanosine monophosphate GAPDH Glyceraldehyde-3- Housekeeping enzyme for oxidative phosphorylation of (Colell et al., 2009) phosphate glyceraldehyde-3-phosphate dehydrogenase CYP1A2 Cytochrome P450 Aryl hydrocarbon receptor (AhR) ligand inducible P450 (Koonrungsesomboon at ASPET Journals on October 1, 2021 isoform 1A2 isoform responsible for caffeine metabolism and the et al., 2018) oxidation of polycyclic aromatic hydrocarbons to toxic/carcinogenic metabolites CYP2B6 Cytochrome P450 Constitutive androstanol receptor (CAR) ligand inducible (Wang and Tompkins, isoform 2B6 P450 isoform 2008) CYP2C8 Cytochrome P450 Inducible isoform responsible for the fatal interaction (Backman et al., 2016) isoform 2C8 between its substrate, cerivastatin, and its inhibitor, gemfibrozil CYP2C9 Cytochrome P450 Most abundant CYP2C isoform with large interindividual (Daly et al., 2017) isoform 2C9 differences resulting from genetic polymorphism and induction/inhibition by co-administered drugs CYP2C19 Cytochrome P450 Inducible polymorphic CYP2C isoform responsible for (Brown and Pereira, isoform 2C19 clopidogrel metabolism 2018) CYP2D6 Cytochrome P450 A non-inducible polymorphic P450 isoform largely (Taylor et al., 2020) isoform 2D6 responsible for psychiatric drugs with its inhibition resulting in clinically significant drug-drug interactions CYP3A4 Cytochrome P450 The most abundant P450 isoform inducible by PXR ligands. (Li et al., 1995; Klein isoform 3A4 CYP3A4 is responsible for the metabolism of 50% of and Zanger, 2013) marketed drug and target enzyme of drug-drug interaction by inhibitors and inducers CYP3A7 Cytochrome P450 CYP3A4 isoform highly expressed in human fetal liver but (Kamataki et al., 1995; isoform 3A7 also in some adult populations Greuet et al., 1996; Okuyama et al., 2020) SLC10A1 Sodium Uptake transporter responsible for bile acids uptake from (Slijepcevic and van de taurocholate plasma into hepatocytes Graaf, 2017) cotransporting polypeptide (NTCP)

29

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

SLC22A1 Organic cation Key transporter for drug (e.g. metformin) uptake into (Sam et al., 2017) transporter 1 hepatocytes (OCT1) SLC22A7 Organic anion Hepatic uptake transporter recently reported to have a (Bi et al., 2018a; Bi et transporter potential role in individual variations in tolbutamide and al., 2018b) 2 (OAT2) warfarin metabolism SLCO1B1 Organic anion Sinusoidal transporter together with SLCO1B3 are (Kunze et al., 2014) transporter responsible for drug (e.g. statins) uptake into hepatocytes 1B1 (OATP1B1) SLCO1B3 Organic anion Sinusoidal transporter together with SLCO1B1 are (Kunze et al., 2014) transporter responsible for drug (e.g. statins) uptake into hepatocytes 1B3 (OATP1B3) SLCO2B1 Organic anion Polymorphic drug uptake transporter (e.g. montelukast) (Kim et al., 2013) transporter 2B1 (OATP2B1) ABCB1 P-glycoprotein 1 Inducible efflux transporter with numerous drug substrates (Schuetz et al., 1995) Downloaded from (multidrug with diverse structures considered the most important resistance protein efflux transporter contributed to transporter-mediated 1) drug interactions ABCB11 Bile Salt Export Major transporter responsible for the secretion of bile (Kenna et al., 2018) Pump (BSEP) acids from hepatocytes into bile with a potential correlation between its inhibition and drug induced liver dmd.aspetjournals.org injuries ABCC2 Multi-drug Apical efflux transporter in hepatocytes with a variety of (Jemnitz et al., 2010) resistance protein amphiphilic anions that belong to different classes of 2 (MRP2) molecules with its mutations resulting in hyperbilirubinemia (Dubin-Johnson syndrome). ABCC3 Multi-drug Efflux of toxic organic anion conjugates, including bile salts (Chai et al., 2012) resistance protein with expression upregulated in cholestasis 3 (MRP3) at ASPET Journals on October 1, 2021 ABCC4 Multi-drug Efflux of endogenous and xenobiotic organic anionic (Russel et al., 2008) resistance protein compounds as well as cyclic nucleotides, eicosanoids, urate 4 (MRP4) and conjugated steroids. ABCG2 breast cancer Efflux hepatic transporter initially identified in multidrug (Heyes et al., 2018) resistance resistant breast cancer cell lines with a variety of protein (BCRP) anticancer drugs as substrates

30

DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

Day 0 Day 2 Day 7 Day 9 dmd.aspetjournals.org

Day 21 Day 23

Day 14 Day 19 at ASPET Journals on October 1, 2021

Day 26 Day 30 Day 35Day 33 Day 40 DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

Transferrin Transthyretin

0.0020 <0.0001

0.0028 <0.0001

<0.0001 0.0061 0.0001 0.0060 Albumin dmd.aspetjournals.org 2.0 <0.0001 <0.0001 2.0 2.0 0.0092 1.5 1.5 1.5

1.0 1.0 1.0

0.5 0.5 0.5 Relative Expression Relative Expression Relative Expression

0.0 0.0 0.0 02791623293643 02791623293643 0 2 7 9 16 23 29 36 43 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) at ASPET Journals on October 1, 2021

ASGR1

0.0003 HPRT1 0.0026 0.0015 0.0065 0.0174 0.0098 0.0001 0.0344 1.5 2.0 0.0004 <0.0001 1.5 1.0

1.0

0.5 0.5 Relative Expression Relative Expression

0.0 0.0 02791623293643 02791623293643 Culture Duration (Days) Culture Duration (Days) DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

CYP2B6

<0.0001 dmd.aspetjournals.org <0.0001 Figure 3 CYP3A4 <0.0001 CYP3A7 CYP1A2 0.0005 <0.0001 0.0001 0.0435 <0.0001 0.0011 0.0372 0.0054 0.0011 0.0010 0.0022

at ASPET Journals on October 1, 2021 <0.0001 0.0003 2.5 0.0020 0.0002 15

1.5 n o

0.0003 i 2.0

2.0 n s

<0.0001 <0.0001 o

n

s

i

o

s

n

e

i

r

s

o s

i 10 1.5

e

p s s 1.5

1.0 r

e

x

s

r

p

e

E

x

p

r

x

p

E

e

x 1.0

E

v

1.0 e

i

E

e

t

v

i e

v 5

a

t

i v

0.5 l

t

i

a

t

l e

a 0.5

l

a e

l 0.5

R

e

e

R

R R 0.0 0.0 0.0 0 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) Culture Duration (Days)

CYP2C8

<0.0001

<0.0001 CYP2C9

<0.0001 <0.0001

<0.0001 <0.0001

<0.0001 0.0001 CYP2D6

<0.0001 0.0105 CYP2C19 0.0205 1.5 <0.0001 0.0485 0.0072

1.5 1.5 5 <0.0001

n

n

n

n

o

i

o

o

o

i i

i <0.0001 <0.0001

s

s

s s

4 s 1.0

s

s

s

e

r

e

e

e

r

r r

1.0 1.0 p

p

p p

3 x

x

x

x

E

E

E

E

e

e

e

e v

2 i 0.5

v

v

v

t

i

i

i

t

t a

t 0.5 0.5

l

a

a

a

e

l

l

l

e

e e

1 R

R

R R

0.0 0.0 0 0.0 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version.

SLC22A1 Downloaded from

SLC10A1 <0.0001 0.0006 <0.0001 0.0006 <0.0001 SLC22A7 0.0010 <0.0001 0.0016 <0.0001 0.0001 <0.0001 2.0 1.5 2.5

<0.0001 dmd.aspetjournals.org 2.0 1.5 1.0 1.5 1.0 1.0 0.5 0.5 0.5 Relative Expression Relative Expression Relative Expression

0.0 0.0 0.0 02791623293643 02791623293643 02791623293643 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) at ASPET Journals on October 1, 2021 SLCO1B3

<0.0001

<0.0001

<0.0001 SLCO1B1 <0.0001 0.0041 <0.0001 0.0347 <0.0001 SLCO2B1 0.0484 <0.0001 <0.0001 2.0 <0.0001 1.5 2.5 <0.0001 2.0 1.5 1.0 1.5 1.0 1.0 0.5 0.5 0.5 Relative Expression Relative Expression Relative Expression

0.0 0.0 0.0 02791623293643 02791623293643 02791623293643 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

ABCC2 ABCB11 0.0400 0.0300 ABCB1 0.0448

<0.0001 dmd.aspetjournals.org 2.5 2.0 1.5 0.0125 2.0 1.5 1.0 1.5 1.0 1.0 0.5 0.5 0.5 Relative Expression Relative Expression Relative Expression

0.0 0.0 0.0 at ASPET Journals on October 1, 2021 02791623293643 0 2 7 9 1623293643 0 2 7 9 16 23 29 36 43 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days)

ABCC3 ABCC4 ABCG2 0.0225 0.0412 2.5 10 2.0 0.0009

2.0 8 1.5

1.5 6 1.0 1.0 4 0.5 0.5 2 Relative Expression Relative Expression Relative Expression

0.0 0 0.0 02791623293643 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 Culture Duration (Days) Culture Duration (Days) Culture Duration (Days) DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

AB E dmd.aspetjournals.org

ALB TF TTR ASGR1 HPRT1 1.0 CYP1A2 CYP2CB6 CYP2C8 CYP2C9 CYP2C19 CYP2D6 CYP3A4 1.0 ALB 1.00 0.81 0.82 0.82 -0.36 CYP1A2 1.00 0.53 0.48 0.50 -0.06 0.58 0.42 A B C D E F G H I J K L M N O P Q R S T U V W X 1.0 A 1.00 0.81 0.82 0.82 0.40 0.48 0.33 0.69 0.69 0.91 0.62 0.87 0.70 0.95 0.91 0.37 0.85 0.60 0.98 0.79 0.87 0.5 CYP2CB6 0.53 1.00 0.97 0.96 -0.15 0.73 0.20 B 0.81 1.00 0.99 0.99 0.64 0.64 0.46 0.76 0.23 0.82 0.85 0.98 0.93 0.89 0.91 0.48 0.64 0.24 0.89 0.63 0.76 0.81 1.00 0.99 0.99 -0.13 0.5 TF C 0.82 0.99 1.00 1.00 0.56 0.58 0.39 0.72 0.30 0.79 0.90 0.99 0.90 0.92 0.94 0.41 0.64 0.25 0.90 0.62 0.82 CYP2C8 0.48 0.97 1.00 0.89 -0.25 0.63 -0.01 D 0.82 0.99 1.00 1.00 0.56 0.58 0.39 0.72 0.30 0.79 0.90 0.99 0.90 0.92 0.94 0.41 0.64 0.25 0.90 0.62 0.82 TTR 0.82 0.99 1.00 1.00 -0.11 0 E 1.00 0.43 0.49 0.31 0.15 0.50 0.02 0.80 CYP2C9 0.50 0.96 0.89 1.00 0.10 0.85 0.35 0 F 0.40 0.64 0.56 0.56 1.00 0.53 0.48 0.50 0.58 0.42 0.55 0.66 0.43 0.42 0.46 0.38 0.45 0.39 0.32 0.5 CYP2C19 -0.06 -0.15 -0.25 0.10 1.00 0.47 0.29 G 0.48 0.64 0.58 0.58 0.43 0.53 1.00 0.97 0.96 0.73 0.20 0.53 0.86 0.39 0.53 0.98 0.07 0.48 0.72 0.17 0.35 ASGR1 0.82 0.99 1.00 1.00 -0.11 -0.5 H 0.33 0.46 0.39 0.39 0.49 0.48 0.97 1.00 0.89 0.63 0.34 0.73 0.20 0.33 1.00 0.30 0.65 0.39 -0.5 at ASPET Journals on October 1, 2021 CYP2D6 0.58 0.73 0.63 0.85 0.47 1.00 0.50 I 0.69 0.76 0.72 0.72 0.31 0.50 0.96 0.89 1.00 0.10 0.85 0.35 0.69 0.90 0.60 0.72 0.91 0.28 0.08 0.68 0.82 0.41 0.20 HPRT1 -0.36 -0.13 -0.11 -0.11 1.00 J 0.69 0.23 0.30 0.30 0.10 1.00 0.47 0.29 0.38 0.05 0.63 0.50 0.75 0.64 0.62 0.48 0.74 0.52 CYP3A4 0.42 0.20 -0.01 0.35 0.29 0.50 1.00 K 0.91 0.82 0.79 0.79 0.58 0.73 0.63 0.85 0.47 1.00 0.50 0.82 0.83 0.83 0.82 0.66 0.72 0.37 0.90 0.86 0.67 -1.0 -1.0 L 0.62 0.85 0.90 0.90 0.42 0.20 0.35 0.29 0.50 1.00 0.89 0.67 0.83 0.79 0.01 0.63 0.22 0.76 0.32 0.81 0.07 0 M 0.87 0.98 0.99 0.99 0.55 0.53 0.34 0.69 0.38 0.82 0.89 1.00 0.87 0.95 0.95 0.36 0.72 0.32 0.94 0.62 0.86 N 0.70 0.93 0.90 0.90 0.15 0.66 0.86 0.73 0.90 0.05 0.83 0.67 0.87 1.00 0.74 0.80 0.74 0.42 0.05 0.76 0.72 0.55 0.20

ABCB1 ABCB11 ABCC2 ABCC3 ABCC4 ABCG2 O 0.95 0.89 0.92 0.92 0.43 0.39 0.20 0.60 0.63 0.83 0.83 0.95 0.74 1.00 0.95 0.24 0.85 0.52 0.98 0.69 0.95 0.02 SLC10A1 SLC22A1 SLC22A7 SLCO1B1 SLCO1B3 SLCO2B1 1.0 1.0 0.91 0.91 0.94 0.94 0.42 0.53 0.33 0.72 0.50 0.82 0.79 0.95 0.80 0.95 1.00 0.37 0.69 0.38 0.95 0.66 0.90 ABCB1 1.00 0.49 0.49 0.50 0.44 -0.62 P SLC10A1 1.00 0.87 0.95 0.95 0.36 0.72 Q 0.37 0.48 0.41 0.41 0.50 0.46 0.98 1.00 0.91 0.66 0.01 0.36 0.74 0.24 0.37 1.00 0.33 0.69 0.38 0.85 0.64 0.64 0.64 0.38 0.07 0.28 0.75 0.72 0.63 0.72 0.42 0.85 0.69 1.00 0.66 0.85 0.51 0.82 0.29 ABCB11 0.49 1.00 0.72 0.91 -0.08 -0.35 0.5 R SLC22A1 0.87 1.00 0.74 0.80 0.74 0.42 0.5 -0.5 S 0.60 0.24 0.25 0.25 0.08 0.64 0.37 0.22 0.32 0.05 0.52 0.38 0.66 1.00 0.49 0.49 0.50 0.44 0.98 0.89 0.90 0.90 0.45 0.48 0.30 0.68 0.62 0.90 0.76 0.94 0.76 0.98 0.95 0.33 0.85 0.49 1.00 0.72 0.91 0.49 0.72 1.00 0.53 -0.32 -0.08 T SLC22A7 0.95 0.74 1.00 0.95 0.24 0.85 ABCC2 U 0.79 0.63 0.62 0.62 0.02 0.39 0.72 0.65 0.82 0.48 0.86 0.32 0.62 0.72 0.69 0.66 0.69 0.51 0.49 0.72 1.00 0.53 0 0 V 0.87 0.76 0.82 0.82 0.32 0.17 0.41 0.74 0.67 0.81 0.86 0.55 0.95 0.90 0.82 0.50 0.91 0.53 1.00 0.22 SLCO1B1 0.95 0.80 0.95 1.00 0.37 0.69 ABCC3 0.50 0.91 0.53 1.00 0.22 -0.41 W 0.52 0.07 0.02 0.29 0.44 0.22 1.00 X 0.80 0.35 0.39 0.20 0.20 0.38 1.00 SLCO1B3 0.36 0.74 0.24 0.37 1.00 -0.04 -0.5 ABCC4 0.44 -0.08 -0.32 0.22 1.00 -0.55 -0.5 -1.0

SLCO2B1 0.72 0.42 0.85 0.69 -0.04 1.00 ABCG2 -0.62 -0.35 -0.08 -0.41 -0.55 1.00 -1.0 -1.0 C D DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from Figure 7

ALBUMIN TRANSFERIN TRANSTHYRETIN

100.000 10.000 10.000 dmd.aspetjournals.org HH1117 HH1117 HH1117 10.000 HH1121 1.000 HH1121 HH1121 1.000 1.000 HH1136 HH1136 HH1136 0.100 0.100 HH1142 HH1142 HH1142 0.100 HH1144 0.010 HH1144 HH1144 0.010 HH1161 HH1161 Relative Expression Relative Relative Expression Relative HH1161 Relative Expression Relative 0.001 0.001 HH1186 HH1086 0.010 HH1186

0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 at ASPET Journals on October 1, 2021 All Donors All Donors All Donors Days in Culture Days in Culture Days in Culture

ASGR1 HPRT1 10.000 10.000 HH1117 HH1117 HH1121 HH1121 1.000 1.000 HH1136 HH1136 HH1142 HH1142 0.100 0.100 HH1144 HH1144 HH1161 HH1161 Relative Expression Relative Relative Expression Relative 0.010 HH1186 0.010 HH1186 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 All Donors All Donors Days in Culture Days in Culture DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

Figure 8 CYP1A2 CYP2B6 CYP2C8 dmd.aspetjournals.org 10.000 10.000 10.000 HH1117 HH1117 HH1117 1.000 1.000 1.000 HH1121 HH1121 HH1121 0.100 HH1136 0.100 HH1136 0.100 HH1136

0.010 HH1142 0.010 HH1142 0.010 HH1142 at ASPET Journals on October 1, 2021 HH1144 HH1144 HH1144 0.001 0.001 0.001 HH1161 HH1161 HH1161

Relative Expression Relative 0 2 7 9 16 23 29 36 43 Expression Relative 0 2 7 9 16 23 29 36 43 Expression Relative 0 2 7 9 16 23 29 36 43 Days in Culture HH1086 Days in Culture HH1186 Days in Culture HH1186

CYP2C9 CYP2C19 CYP2D6 10.000 100.000 10.000 HH1117 HH1117 HH1117 10.000 1.000 1.000 HH1121 HH1121 HH1121 HH1136 1.000 HH1136 0.100 HH1136 0.100 HH1142 0.100 HH1142 0.010 HH1142 HH1144 HH1144 HH1144 0.010 0.010 0.001 HH1161 HH1161 HH1161 Relative Expression Relative Expression Relative 0 2 7 9 16 23 29 36 43 Expression Relative 0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 Days in Culture HH1186 Days in Culture HH1186 Days in Culture HH1186

CYP3A4 CYP3A7 100.000 10.000 HH1117 HH1117 10.000 1.000 HH1121 HH1121 1.000 HH1136 0.100 HH1136 0.100 HH1142 HH1142 0.010 0.010 HH1144 HH1144 0.001 0.001 HH1161 HH1161

Relative Expression Relative 0 2 7 9 16 23 29 36 43 Expression Relative 0 2 7 9 16 23 29 36 43 Days in Culture HH1186 Days in Culture HH1186 DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from Figure 9

SLC10A1 SLC22A1 SLC22A7 dmd.aspetjournals.org 10.00 10.000 10.000

HH1117 HH1117 HH1117 1.000 1.000 1.00 HH1121 HH1121 HH1121 HH1136 0.100 HH1136 0.100 HH1136 0.10 HH1142 HH1142 HH1142 0.010 0.010 HH1144 HH1144 HH1144 Relative Expression Relative Relative Expression Relative 0.01 Expression Relative 0.001 HH1161 0.001 HH1161 HH1161

0 2 7 9 16 23 29 36 43 0 2 7 9 16 23 29 36 43 at ASPET Journals on October 1, 2021 HH1186 0 2 7 9 16 23 29 36 43 HH1186 HH1186 Days in Culture Days in Culture Days in Culture

SLCO1B1 SLCO1B3 SLCO2B1

10.00 10.000 10.000

HH1117 HH1117 HH1117 1.00 1.000 HH1121 HH1121 1.000 HH1121 HH1136 0.100 HH1136 HH1136 0.10 HH1142 HH1142 0.100 HH1142 0.010 HH1144 HH1144 HH1144 Relative Expression Relative Relative Expression Relative 0.01 Expression Relative HH1161 0.001 HH1161 0.010 HH1161 02791623293643 0 2 7 9 16 23 29 36 43 0 2 7 9 1623293643 HH1186 HH1186 HH1186 Days in Culture Days in Culture Days in Culture DMD Fast Forward. Published on June 16, 2021 as DOI: 10.1124/dmd.121.000424 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from Figure 10

ABCB1 ABCB11 ABCC2

10.000 10.000 10.000 dmd.aspetjournals.org

HH1117 HH1117 HH1117 1.000 HH1121 1.000 HH1121 HH1121 HH1136 HH1136 1.000 HH1136 0.100 HH1142 0.100 HH1142 HH1142 HH1144 HH1144 HH1144 Relative Expression Relative Relative Expression Relative Relative Expression Relative 0.010 HH1161 0.010 HH1161 0.100 HH1161

0 2 7 9 16 23 29 36 43 HH1086 0 2 7 9 1623293643 HH1186 0 2 7 9 1623293643 HH1186 at ASPET Journals on October 1, 2021 Days in Culture Days in Culture Days in Culture ABCC3 ABCC4 ABCG2 10.000 100.00 10.00 HH1117 HH1117 HH1117 HH1121 10.00 HH1121 HH1121 1.000 HH1136 HH1136 1.00 HH1136 HH1142 1.00 HH1142 HH1142 HH1144

Relative Expression Relative HH1144 HH1144 0.100 HH1161 Relative Expression Relative HH1161 Expression Relative HH1161 0 2 7 9 16 23 29 36 43 HH1186 0.10 0.10 Days in Culture 0 2 7 9 1623293643 HH1186 0 2 7 9 16 23 29 36 43 HH1186 Days in Culture Days in Culture