Structural and Functional Insights Into Host Death Domains Inactivation by the Bacterial Arginine Glcnacyltransferase Effector

Article

Structural and Functional Insights into Host Death Domains Inactivation by the Bacterial Arginine GlcNAcyltransferase Effector

Graphical Abstract Authors Jingjin Ding, Xing Pan, Lijie Du, ..., Death domain (DD) interactions Da-Cheng Wang, Shan Li, Feng Shao Signaling Arg Arg Correspondence Homo- Hetero- EPEC [email protected] (J.D.), [email protected] (S.L.), [email protected] (F.S.) Arg NleB GlcNAc In Brief The NleB family of bacterial effectors Arg blocks host inﬂammation by catalyzing arginine GlcNAcylation of host death- Inverting domain (DD) proteins. Ding et al. NleB-DD determines crystal structures of NleB, complex NleB in complex with FADD-DD, and GlcNAc NleB-GlcNAcylated TRADD-DD and Arg RIPK1-DD. The study uncovers the mechanism for NleB substrate selectivity and an inverting sugar-transfer reaction. Signaling DD interactions

Highlights d Crystal structures of arginine-GlcNAcylated death domains of TRADD and RIPK1 d Crystal structures of NleB alone and in complex with FADD- DD and the ligand d Structural basis for the death-domain substrate speciﬁcity of NleB d An inverting sugar-transfer reaction and mechanisms for inactivating the arginine

Ding et al., 2019, Molecular Cell 74, 922–935 June 6, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.molcel.2019.03.028 Molecular Cell Article

Structural and Functional Insights into Host Death Domains Inactivation by the Bacterial Arginine GlcNAcyltransferase Effector

Jingjin Ding,1,4,* Xing Pan,2,3 Lijie Du,3 Qing Yao,4 Juan Xue,3 Hongwei Yao,5 Da-Cheng Wang,1 Shan Li,2,3,* and Feng Shao4,6,7,* 1National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China 2Bio-Medical Center, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, China 3Institute of Infection and Immunity, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei 442000, China 4National Institute of Biological Sciences, Beijing 102206, China 5College of Chemistry and Chemical Engineering, High-Field Nuclear Magnetic Resonance Center, Xiamen University, Xiamen, Fujian 361005, China 6Tsinghua Institute of Multidisciplinary Biomedical Research, Tsinghua University, Beijing 102206, China 7Lead Contact *Correspondence: [email protected] (J.D.), [email protected] (S.L.), [email protected] (F.S.) https://doi.org/10.1016/j.molcel.2019.03.028

SUMMARY receptors including FAS, TNF-associated apoptosis-inducing ligand (TRAIL) receptor 1 (TRAIL-R1, also known as DR4), and Enteropathogenic E. coli NleB and related type III ef- TRAIL-R2 (DR5) recruit FADD and caspase-8 to form the fectors catalyze arginine GlcNAcylation of death death-inducing signaling complex (DISC) (Park et al., 2007; domain (DD) proteins to block host defense, but the Strasser et al., 2009). TRADD and RIPK1 are key arbitrators in underlying mechanism is unknown. Here we solve the TNFR signaling, which stimulates NF-kB-mediated tran- crystal structures of NleB alone and in complex scriptional response for cell survival, inflammation, or differenti- with FADD-DD, UDP, and Mn2+ as well as NleB- ation or activates a death program through formation of the DISC (He et al., 2009; Wang et al., 2008). Defective death domain inter- GlcNAcylated DDs of TRADD and RIPK1. NleB actions undermine death receptor signaling, which often leads to adopts a GT-A fold with a unique helix-pair insertion disease manifestation. For instance, genetic mutations in the to hold FADD-DD; the interface contacts explain the death domain of FAS (FAS-DD) cause human autoimmune lym- selectivity of NleB for certain DDs. The acceptor argi- phoproliferative syndrome (ALPS) (Fisher et al., 1995; Rieux- nine is fixed into a cleft, in which Glu253 serves as a Laucat et al., 1995; Wang et al., 2010). base to activate the guanidinium. Analyses of the Manipulating host signaling pathways is a common strategy enzyme-substrate complex and the product struc- used by bacterial pathogen to facilitate infection and evade tures reveal an inverting sugar-transfer reaction and host immune defenses (Cui and Shao, 2011; Reddick and Alto, a detailed catalytic mechanism. These structural 2014). Many bacterial agents hijack the NF-kB or the cell death insights are validated by mutagenesis analyses of signaling due to their critical roles in host defense against infec- NleB-mediated GlcNAcylation in vitro and its functions. Recently, we and others identify the first bacterial effector that directly targets the death receptor signaling complex (Li tion in mouse infection. Our study builds a structural et al., 2013; Pearson et al., 2013). NleB, a type III secretion sys- framework for understanding of NleB-catalyzed argi- tem (T3SS) effector of enteropathogenic Escherichia coli (EPEC), nine GlcNAcylation of host death domain. catalyzes the attachment of N-acetylglucosamine (GlcNAc) onto the death domain of TRADD or FADD and thereby disrupts their interactions with the death receptors and formation of the death INTRODUCTION receptor complexes. The modification blocks NF-kB activation, apoptosis, and necroptosis in EPEC-infected cells and facilitates Death receptor signaling is crucial for cell death, inflammation, bacterial survival and colonization in mouse colon. NleB-like and immune homeostasis. Death receptor signaling is meditated effectors are present in other attaching and effacing (A/E) by homotypic or heterotypic interactions among death domains pathogens including enterohemorrhagic E. coli (EHEC) and (DDs) of the tumor necrosis factor receptor (TNFR) family of Citrobacter rodentium. Salmonella enterica strains encode transmembrane death receptors and the downstream adaptors three NleB-homologous T3SS effectors, SseK1–3. SseK1 including TNFR1-associated death domain protein (TRADD), re- and 3 also glycosylate death-domain proteins, particularly ceptor-interacting serine/threonine-protein kinase 1 (RIPK1), FADD and TRADD, to block death receptors-mediated proin- and FAS-associated death domain protein (FADD) (Wilson flammatory or cell death responses (El Qaidi et al., 2017; Gunster et al., 2009). Upon activation by the cognate ligands, death et al., 2017; Li et al., 2013).

922 Molecular Cell 74, 922–935, June 6, 2019 ª 2019 Elsevier Inc. Protein glycosylation is one of the most common post-transla- this antibody revealed that TRADD-DD, FADD-DD, and RIPK1- tional modifications (PTMs) in all kingdoms of life. Bacterial path- DD were efficiently GlcNAcylated by the co-expressed NleB ogens have exploited protein glycosylation as a virulence mech- (Figure S1B). We succeeded in crystalizing GlcNAcylated anism (Lu et al., 2015). Known bacterial glycosyltransferase TRADD- and RIPK1-DD and determined the high-resolution toxins/effectors catalyze mono-O-glycosylation of their host structures to 1.45-A˚ resolution by molecular replacement target proteins (Belyi and Aktories, 2010; Jank et al., 2015). (Table 1). In both structures, there is one molecule of death The clostridial large toxin family including Clostridium difficile domain per asymmetric unit; the final models contain residues toxin A/B (TcdA/B) glucosylates (occasionally GlcNAcylates) a 198–312 of TRADD and 574–670 of RIPK1, respectively. Both conserved threonine in members of the Rho/Ras family of small structures have six antiparallel helixes (aA–aF) (Figures 1A, 1B, GTPases to subvert host functions, particularly actin cytoskel- S1C, and S1D), characteristic of the death fold. Interestingly, res- eton dynamics (Aktories et al., 2017). The Lgt family in Legionella idues 198–214 of TRADD-DD, preceding the conserved death pneumophila glucosylates elongation factor 1A (eEF1A) on a fold, form a b-hairpin that acts as a lid to cover the hydrophobic serine to inhibit protein synthesis (Belyi et al., 2006). The Photo- surface of aE/aF(Figure S1C). This b-hairpin extension has also rhabdus asymbiotica PaTox toxin adds a GlcNAc onto a tyrosine been noted in the NMR structure of TRADD-DD (Zhang et al., in Rho GTPases to block their activation (Jank et al., 2013). 2017). In RIPK1-DD, residues preceding the conserved death These glycosyltransferase toxins/effectors all adopt a GT-A fold form a loop instead, which also covers the hydrophobic fold and employ a retaining mechanism to transfer the sugar patch in the surface of its aE/aF helix pair (Figure S1D). Such onto a hydroxyl group. In contrast, the NleB/SseK family mod- structural features might be conserved in other death domains ifies an arginine in its death-domain substrates, representing and therefore of potential functional relevance. an unprecedented arginine N-linked GlcNAcylation. Recently, NleB GlcNAcylates Arg235 of TRADD-DD (Li et al., 2013). EarP is shown to catalyze arginine rhamnosylation of the trans- In the structure, there are clear extra electron densities on lation elongation factor P (EF-P) to rescue ribosome stalling Arg235 that can be unambiguously modeled with a GlcNAc within the bacteria (Lassak et al., 2015). group (Figure 1A). This finding provides the most direct evidence Here we determined crystal structures of NleB alone, NleB for the unusual arginine GlcNAcylation modification. The GlcNAc in complex with FADD-DD and the sugar donor, as well is covalently linked to the Nε atom of arginine guanidinium, as NleB-GlcNAcylated TRADD-DD and RIPK1-DD. These yielding the product anti-GlcNAcylarginine (Figure 1A). The provide structural snapshots for all major steps in NleB recogni- linkage adopts a b-anomeric configuration. Close inspection tion of death-domain substrates and catalysis of arginine of Arg602 in the RIPK1-DD structure, equivalent to Arg235 GlcNAcylation. The structural data, together with in vitro of TRADD-DD, also revealed high-quality electron densities of biochemical analyses, reveal the detailed mechanism for the a GlcNAc attached to the Nε atom via the b-anomeric config- specificity of NleB in modifying a subgroup of death-domain pro- uration (Figure 1B). Moreover, in contrast to the anti- teins and establish NleB as a pleotropic inhibitor of multiple GlcNAcylarginine in TRADD-DD, the modification on Arg602 of death receptors signaling. We also show that NleB is an inverting RIPK1-DD is presented as a syn-GlcNAcylarginine (Figure 1B). enzyme that converts the a-configuration in the UDP-GlcNAc Thus, NleB modification of death domains generates diverse donor to the b configuration in the GlcNAcylarginine product. stereoisomers of the GlcNAcylarginine product. An aspartate/arginine dyad in NleB bind the GlcNAc; a glutamate in NleB, forming bidentate hydrogen bonds with the guanidinium NleB Is a GT-A-Type GlcNAcyltransferase of the arginine acceptor, serves as a base to activate the arginine All structurally characterized bacterial glycosyltransferase for nucleophilic attack on UDP-GlcNAc. These structural toxins/effectors share a metal-coordinating DXD catalytic motif findings are supported by functional analyses of NleB in promot- and are classified as GT-A type glycosyltransferases (Jank ing C. rodentium colonization. Our study builds a structural et al., 2015). Previous mutagenesis analyses show that NleB framework for mechanistic understanding of the arginine also employs a putative catalytic DXD motif (Asp221-Ala222- GlcNAcylation by the NleB family of bacterial virulence effectors. Asp223) despite the lack of evident sequence homology to any GT-A-type glycosyltransferase (Li et al., 2013; Pearson RESULTS et al., 2013). To understand the structural basis of NleB GlcNAcyltransferase activity, we attempted to determine its Crystal Structures of Arginine-GlcNAcylated TRADD-DD crystal structure. Wild-type (WT) NleB is recalcitrant to crystalli- and RIPK1-DD zation; an optimized variant devoid of the N-terminal 27 residues Most death domains are prone to oligomerize when ectopically with a K115A mutation, which had intact GlcNAcyltransferase overexpressed and thus are refractory to recombinant purifi- activity (Figure S2A), yielded high-quality crystals. The structure ˚ cation. NleB-catalyzed GlcNAcylation blocks the inter-death of apo-NleB was solved to 2.10 A in space group P21212 by se- domain interactions, which may allow to obtain homogeneous lenium single-wavelength anomalous diffraction (Table 1). Each proteins for structural and mechanistic studies. We found that asymmetric unit contains one NleB molecule. The final model the death domains of TRADD, FADD, and RIPK1, when co-ex- comprises residues 28–318 of NleB. In addition to missing the pressed with NleB in E. coli, were in the monomeric form and C-terminal tail (residues 319–329), three loop regions (residues could be readily purified (Figure S1A). We previously developed 67–68, 204–209, and 246–253) are omitted in the final model a sensitive anti-GlcNAcylarginine antibody that does not recog- due to the lack of interpretable electron density, indicative of nize O-GlcNAcylation (Pan et al., 2014). Immunoblotting using the intrinsic flexibility of these regions in apo-NleB.

Molecular Cell 74, 922–935, June 6, 2019 923 Table 1. Data Collection and Reﬁnement Statistics TRADD-DD RIPK1-DD apo-NleB NleB/FADD-DD complex Data Collection

Space group P41212P43212P21212P3121 Cell dimensions a, b, c (A˚ ) 28.60, 28.60, 264.72 55.75, 55.75, 59.15 85.59, 101.46, 36.64 84.59, 84.59, 145.88 a, b, g () 90.00, 90.00, 90.00 90.00, 90.00, 90.00 90.00, 90.00, 90.00 90.00, 90.00, 120.00 Wavelength (A˚ ) 0.97899 0.97928 0.97899 0.97899 Resolution (A˚ ) 28.60–1.45 (1.53–1.45) 32.80–1.45 (1.53–1.45) 20.00–2.10 (2.14–2.10) 36.63–1.87 (1.97–1.87)

Rmerge (%) 11.1 (34.9) 7.7 (26.5) 21.4 (43.9) 9.1 (47.3) I/sI 8.1 (3.8) 21.4 (7.9) 21.5 (3.0) 16.3 (5.5) Completeness (%) 96.7 (99.3) 99.9 (100.0) 97.9 (95.9) 99.6 (100.0) Redundancy 4.6 (5.3) 13.2 (11.4) 6.5 (4.5) 10.4 (10.7) Refinement Resolution (A˚ ) 28.44–1.45 26.13–1.45 19.74–2.10 36.59–1.87 No. reflections 20,047 17,021 19,963 50,377 a Rwork/Rfree (%) 18.44/22.42 15.58/18.94 20.14/24.19 16.44/20.94 No. atoms protein 927 791 2,244 3,168 ligand 14 24 36 25 water 104 111 84 436 Mn2+ 1 B-factors (A˚ 2) protein 20.57 19.54 39.31 29.71 ligand 39.24 29.86 49.36 20.10 water 34.97 33.06 37.51 38.01 Mn2+ 19.00 Rmsds bond lengths (A˚ ) 0.006 0.010 0.008 0.017 bond angles () 0.873 1.057 1.222 1.603 Ramachandran plot favored (%) 98.23 98.95 95.22 97.14 allowed (%) 1.77 1.05 4.04 2.86 Values in parentheses are for the highest-resolution shell. a 5% of reflections are randomly selected for calculating Rfree.

The structure of NleB bears a main domain and an antiparallel (RMSD) of 1.36 A˚ over 266 aligned Ca positions (Figure S2C). helix-pair insertion (a3/a4) (Figure 1C). The main domain adopts The major deviation lies in the a3/a4 insertion, suggesting an extended Rossmann-like fold featuring a central six-stranded its conformational flexibility relative to the core GT-A fold. b sheet (b2–b5, b7, and b8) sandwiched by eight helices (a1, a2, These observations confirm that the NleB family are GT-A-type and a5–a10). A b1/b6 antiparallel b sheet packs with the bottom glycosyltransferase. of the central b sheet to form the compact main domain (Fig- ure 1C). The helix-pair insertion protrudes from the main domain, Crystal Structure of NleB/FADD-DD Complex which, together with the main domain, constitutes a ‘‘C’’-like Known bacterial glycosyltransferase toxins/effectors often bear shape. Dali search (Holm and Rosenstro¨ m, 2010) reveals that substantial structural insertions into the core GT-A fold for bind- the main domain of NleB is structurally similar to other bacterial ing the substrate proteins. NleB is smaller in size with only one glycosyltransferase toxins/effectors, all of which adopt the GT-A helix-pair insertion but has a high specificity for the death- fold with the DXD motif situated in the center of the structure (Fig- domain proteins (Li et al., 2013; Pearson et al., 2013). To reveal ure S2B). A recent study determined the crystal structure of the mechanism underlying NleB targeting of the death-domain SseK3, a Salmonella homolog of NleB (Esposito et al., 2018). substrate, we tried to obtain the enzyme-substrate complex Comparison of NleB structure with that of SseK3 revealed a structure. After extensive trials, we found that native FADD-DD high degree of similarity with a root mean square deviation could be recombinantly purified from E. coli as a homogeneous

924 Molecular Cell 74, 922–935, June 6, 2019 Figure 1. Crystal Structures of NleB and NleB-GlcNAcylated Death Domains (A and B) Structures of Arg-GlcNAcylated TRADD-DD (A) and RIPK1-DD (B). TRADD-DD or RIPK1-DD was co-expressed with NleB and puriﬁed from E. coli. Left, cartoon models of the overall structure of GlcNAcylated TRADD- and RIPK1-DD with numbered secondary structures. The GlcNAcylated arginine (R235 in TRADD and R602 in RIPK1) is shown in sticks. Middle, the Sigma-A weighted 2Fo À Fc electron density maps of GlcNAcylated R235 in TRADD and R603 in RIPK1 contoured at 0.7 s and 1.0 s, respectively. Right, structural formula of the GlcNAcylated R235 and R603. The b-anomeric linkage is highlighted in red. (C) Cartoon model of the overall structure of apo-NleB. Secondary structure elements are numbered. The three unmodeled loops are shown as dotted lines. See also Figures S1, S2, and S8. monomer. We reconstituted a stable 1:1 complex of FADD-DD one molecule of NleB loaded with a UDP and a Mn2+ (Figure 2A). with the NleB variant (DN27 and K115A). The complex was crys- FADD-DD in the complex structure adopts the canonical death tallized in the presence of UDP and Mn2+, leading to determina- fold (residues 96–182 of FADD), which could be well superim- tion of a high-resolution structure of 1.87 A˚ (Table 1). Each asym- posed with FADD-DD in the FAS-DD/FADD-DD complex (Fig- metric unit of the crystal contains one molecule of FADD-DD and ure S3A; Scott et al., 2009; Wang et al., 2010).

Molecular Cell 74, 922–935, June 6, 2019 925 Figure 2. Crystal Structure of the NleB/FADD-DD Complex and Analyses of the Binding Interface (A) Overall structure of UDP and Mn2+-bound NleB in complex with FADD-DD. Structures of NleB and FADD-DD, colored in green and yellow, respectively, are shown in cartoons. UDP and Mn2+ are shown as magenta sticks and a gray sphere, respectively. (B) The intermolecular interface. NleB is shown as surface presentation and the regions involved in binding to FADD-DD are colored in pink. The primary and secondary intermolecular interface is highlighted by a large and small blue ellipse, respectively. (legend continued on next page)

926 Molecular Cell 74, 922–935, June 6, 2019 The model of NleB in the FADD-DD complex covers all 302 nition, the positively charged triad residues Lys292, Lys289, and residues encoded by the construct; its overall structure resem- Lys277 in NleB were combinedly mutated into alanine. The mu- bles that of apo-NleB (Figure S3B). Compared with apo-NleB, tations resulted in a completely inactive NleB that failed to cata- three regions in NleB in the FADD-DD complex exhibit evident lyze GlcNAcylation of FADD (Figure 2D). Other combined muta- changes. The disordered loop (residues 246–253) in the apo tions targeting the primary enzyme-substrate binding interface, structure is folded into a b-hairpin (bI/bII) in the complex; the un- including Y284A/D285A and K277A/D279A in NleB, also abol- structured C-terminal tail now assumes an ordered conformation ished or attenuated GlcNAcylation of FADD (Figure 2D). Double and thereby participates in UDP and Mn2+ binding; and the helix- mutations of Tyr145 and Asp151 in NleB at the second interface pair insertion moves more closely to the main domain for efficient did not abolish but severely reduced the activity of NleB. We binding to FADD-DD (Figure S3B). Moreover, the other two loops further assayed the function of these substrate binding-defective that are missing in the apo structure (residues 67–68 and 204– mutants in HeLa cell infection. As shown in Figure 2E, EPEC 209) become visible in the complex. Thus, NleB undergoes 2348/69 expressing any of the NleB mutants all failed to block conformational changes upon binding the sugar ligand and the TRAIL-induced FADD-dependent host cell death. As a negative death-domain substrate. control, E58A, a point mutation outside of the substrate-binding interfaces, did not affect the activity of NleB in blocking host cell The Enzyme-Substrate Binding Interface between NleB death during EPEC infection. All the mutants assayed appeared and FADD-DD to be structurally intact, as suggested by their normal behaviors The NleB/FADD-DD complex structure provides insights into on ion-exchange and gel-filtration chromatography that were substrate recognition. In a general view, the globular FADD-DD similar to those of WT NleB (Figures S4A and S4B). These data is complementary to the ‘‘C’’-like contour of NleB structure validate the structural findings about the substrate-recognition and elegantly accommodated by its large concave surface (Fig- mechanism of NleB. ure 2B). The aB/aC face of FADD-DD bears the primary surface for binding to NleB by directly contacting a9 and its adjacent The Binding Interface Determines the Death-Domain loops of NleB. On one side of the aB/aC face, Asp123, Selectivity of NleB Asp127, and Glu130 of FADD-DD form a negatively charged Arg235 of TRADD-DD, modified by NleB, is highly conserved in triad that interacts with the positively charged triad of Lys292, 12 human death-domain proteins, among which the adaptors Lys289, and Lys277 of NleB through an extensive hydrogen- TRADD, RIPK1, and FADD and the receptors TNFR1, FAS, bond network; the network is strengthened by an additional DR3, DR4, and DR5 function in death receptor signaling (Fig- hydrogen bond between Asp123 of FADD-DD and Tyr303 of ure S5A). When co-expressed with NleB in mammalian or bacte- NleB (Figure 2C). On the other side, Arg113 and Arg140, together rial cells, death domains of TRADD, RIPK1, FADD, TNFR1, FAS, with Trp112, interact with two oppositely charged Asp285 and and DR3, but not those of DR4 and DR5, were GlcNAcylated by Asp279 of NleB via another set of hydrogen bonds (Figure 2C). NleB (Figures 3A and 3B). Consistently, mass spectrometry re- The side chain of Tyr284 of NleB is held in a cleft on the aB/aC vealed a 203-dalton mass increase on the six death domains pu- face through a non-polar interaction with Ile126 and a hydrogen rified from NleB-expressing cells (Figure 3C). Mutation of the bond with the backbone carbonyl of Val121 of FADD-DD (Fig- conserved arginine in death domains of RIPK1, FADD, TNFR1, ure 2C). These contacts are supplementary to the strong interac- or FAS completely abolished the mass increase (Figure S5B). tions mediated by those surrounding hydrogen-bond networks. These data confirm that NleB could impose a GlcNAc modifica- In addition to the aB/aC primary interface, the C terminus of aC tion on the six proteins. Among the six death domains, the struc- and the following loop of FADD-DD interact closely with the a3/ tures of TRADD-DD (Zhang et al., 2017) and FADD-DD (Scott a4 insertion of NleB, generating a second enzyme-substrate et al., 2009; Wang et al., 2010) were determined previously, binding interface (Figure 2C). Arg135 of FADD-DD forms a which are nearly identical to our structures. Structural compari- hydrogen bond to the main-chain carbonyl of Glu149 and is son showed that both the negatively and positively charged further fixed by a stacking interaction with the side chain of patches on the aB/aC face in FADD-DD were conserved in Tyr145 on the turning loop of a3/a4. Arg140 and the nearby TRADD-DD and RIPK1-DD (Figure 3D). Alignment of the primary Leu137 of FADD-DD interact with Asp151 and Leu154 of sequences showed that the residues forming the two charged NleB via a water-mediated hydrogen bond and a hydrophobic surfaces in FADD-DD were also conserved in other NleB-sensi- interaction, respectively (Figure 2C). tive death domains (Figure S5A). By contrast, most charged res- We performed mutagenesis of the substrate recognition inter- idues mediating the interaction of FADD-DD with NleB were faces. As a single-residue mutation, like K292A in NleB (Wong substituted by oppositely charged residues in NleB-resistant Fok Lung et al., 2016), may not be sufficient to abolish the recog- death domains including DR4-DD and DR5-DD (Figure S5A).

(C) Close-up views of the primary (left) and secondary (right) intermolecular interface. Residues mediating NleB and FADD-DD interaction are labeled and shown as sticks. Dotted lines represent hydrogen bonds. (D and E) Mutation analyses of the NleB and FADD-DD binding interfaces. In (D), 3 3 Flag-FADD puriﬁed from 293T cells were reacted with recombinant NleB or the indicated mutants in the presence of 3H-UDP-GlcNAc. Protein loading is shown on the Coomassie blue-stained gel. 3H-auto, 3H autoradiography. In (E), HeLa cells infected with indicated EPEC strains were stimulated with TRAIL; cell viability was determined by measuring ATP levels and is shown as mean ± SD from three technical repeats. DescN is a type III secretion-deﬁcient EPEC strain. See also Figures S3 and S4.

Molecular Cell 74, 922–935, June 6, 2019 927 ACE

Figure 3. Death-Domain Substrate Selectivity of NleB (A and B) Selective modification of death-domain substrates by NleB. Indicated death domains were co-expressed with EGFP-NleB in 293T cells (A) or with NleB in E. coli (B). Cell and bacteria lysates were subjected to anti-Flag immunoprecipitation and GST pull-down respectively, followed by immunoblotting analyses as shown. (C) Summary of electrospray ionization (ESI)-mass spectrometry determination of the total mass of indicated death domains purified from NleB-transfected 293T cells. (D) Cartoon and electrostatic potential surface schemes of FADD-, RIPK1-, and TRADD-DDs. The coloration from red to blue represents negatively to positively charged regions. The two regions recognized by NleB are highlighted by black ellipses. (E) Point mutations in DR5-DD render its GlcNAcylation by NleB. Wild-type (WT) or an indicated mutant DR5-DD was co-expressed with NleB in 293T cells. (F) Point mutations in NleB enable NleB to GlcNAcylate DR5-DD. Wild-type (WT) or an indicated mutant NleB was co-expressed with DR5-DD in 293T cells. Anti-GlcNAc-Arg, the GlcNAcylarginine-specific antibody. See also Figure S5.

928 Molecular Cell 74, 922–935, June 6, 2019 A B

(legend on next page)

Molecular Cell 74, 922–935, June 6, 2019 929 Notably, when a single mutation K369D, E355R, or K372E glycosyltransferase toxins/effectors, the cavity contains a was introduced into DR5-DD to reverse the charge state, the conserved Asp/Arg dyad that functions to stabilize the sugar K369D mutant became efficiently GlcNAcylated by NleB in moiety of the ligand through hydrogen-bond interactions. An transfected cells (Figure 3E). According to the NleB/FADD com- equivalent dyad of Asp186 and Arg189 of a6 is also present plex structure, Asp369 in the DR5 mutant should be contacted in the cavity of NleB structure (Figure S6). In general, all the res- by Lys289 and Lys292 from NleB. In a reciprocal manner, we idues involved in sugar ligand binding and Mn2+ coordination found that simultaneous mutations of Lys289 and Lys292 into are highly conserved in NleB and other bacterial glycosyltrans- aspartate and glutamine, respectively, could enable NleB to effi- ferase toxins/effectors. Alanine substitutions of these residues ciently GlcNAcylate WT DR5-DD despite the fact that K289D either abolished or attenuated NleB GlcNAcylation of FADD- mutation alone was not sufficient (Figure 3F). These results vali- DD in vitro (Figure 4C). Consistently, EPEC harboring any of date the structural insights into specific recognition of certain these NleB mutants except for F185A failed to block TRAIL- death-domain substrates by NleB and highlight the critical induced death of infected host cells (Figure 4D). The intact contribution of the positively Lys289 and Lys292 surface in the activity of NleB F185A suggests a minimal or dispensable role NleB structure. of Phe185-mediated stacking interaction with the uracil of UDP-GlcNAc. UDP-GlcNAc Loading and Mn2+ Coordination NleB-catalyzed GlcNAc transfer requires Mn2+ (Li et al., 2013; Interactions with the Acceptor Arginine and an Inverting Pearson et al., 2013). When crystalizing the NleB/FADD-DD Sugar-Transfer Mechanism complex, UDP rather than UDP-GlcNAc was added to prevent Arg117 of FADD-DD is located on aB of FADD-DD at the inter- potential complex destabilization. In the determined structure, face in the NleB/FADD-DD complex (Figures 2A and 5A). The UDP and Mn2+ are tightly bound in a ligand-binding pocket side chain of Arg117 stretches into a narrow cleft in NleB, near the substrate-binding interface (Figure 4A). The pocket is formed by His182, His281, Tyr283, Tyr284, and Trp329 (Fig- formed by a6, b2, the loop bearing the DXD motif and the bI/ ures 5A and 5B). This structural arrangement orientates bII hairpin, and partially covered by the C-terminal tail of NleB the arginine side chain toward the negatively charged bI/bII (Figure 4A). These structural elements have extensive interac- hairpin, generating a bidentate hydrogen-bond interaction be- tions with the uracil, ribose, and diphosphate groups of UDP tween the arginine guanidinium and the carboxyl group of (Figure 4B). Specifically, the uracil O2, N3, and O4 atoms Glu253 on the bI/bII hairpin (Figure 5B). Such strong interaction interact with the backbone of the Phe50-Glu51-Ala52 sequence possibly drives the folding of the corresponding disordered of b2 via three direct or water-mediated hydrogen bonds, and loop in apo-NleB into the hairpin structure. Moreover, the gua- its planar ring has p-stacking interactions with the side chains nidinium of Arg117 is stacked with the side chain of Tyr283 on of Trp49 and Phe185 from b2 and a6, respectively (Figure 4B). one side while its opposite side is the deduced GlcNAc-hold- The ribose C2 hydroxyl is fixed by hydrogen bonding to the ing cavity. When an intact UDP-GlcNAc was modeled into backbone carbonyl of Gln48 as well as the side-chain hydroxyl the structure, the cavity is filled with the GlcNAc with the of Tyr219 preceding the DXD motif; the C3 hydroxyl group in- a-anomeric carbon exposing its b face to the guanidinium Nε teracts with the backbone amide of the DXD motif through a of Arg117 (Figure 5B). Supporting the structural observation, direct and a water-mediated hydrogen bond (Figure 4B). One the E253A and Y283A mutant NleB were defective or attenu- side of the diphosphates bears three hydrogen bonds with ated in GlcNAcylating Arg117 of FADD-DD (Figure 5C) and the side chains of Ser327, Ser328, and Trp329 on the C-termi- could not block TRAIL-induced host cell death during EPEC nal tail that is fixed into an ordered conformation. A similar infection (Figure 5D). conformational change of the tail has been observed in the Geometry of the sugar donor and the acceptor observed in ligand-bound structure of SseK3 (Esposito et al., 2018). The the NleB/FADD-DD structure indicates that NleB employs an other side of the diphosphates coordinates the Mn2+, which, inverting sugar-transfer mechanism to convert a-anomeric together with side chains of Ser322, Asp223, Asn320, and a configuration of C1 in UDP-GlcNAc into a b-glycosidic linkage. water molecule (fixed by Asp221), adopts an octahedral geom- As a direct proof to this notion, b-glycosidic bond was etry (Figure 4B). Between the two phosphates and the bI/bII observed in crystal structures of NleB-GlcNAcylated TRADD- hairpin is a cavity that likely accommodates the deduced DD and RIPK1-DD (Figures 1A and 1B). This mechanism is GlcNAc group (Figure 4A and see below). In other bacterial further supported by the sensitivity of NleB-modified death

Figure 4. Structural Basis for UDP-GlcNAc Binding and Mn2+ Coordination (A) Surface scheme of NleB shows the binding pocket for UDP and Mn2+. The surface region involved in UDP-GlcNAc binding and Mn2+ coordination is colored in pink. UDP and Mn2+ are shown as stick and sphere models, respectively. The inset shows the Fo À Fc electron density map of UDP and Mn2+ contoured at 3.0 s. (B) Close-up views of UDP binding and Mn2+ coordination. Residues involved in the binding are labeled and shown as sticks. Grey sphere, Mn2+; red sphere, water molecules; dotted lines, hydrogen bonds. (C and D) Mutation analyses of UDP binding and Mn2+ coordination. In (C), 3 3 Flag-FADD puriﬁed from 293T cells were reacted with recombinant NleB or the indicated mutants in the presence of 3H-UDP-GlcNAc. Protein loading is shown on the Coomassie blue-stained gel. 3H-auto, 3H autoradiography. In (D), HeLa cells infected with indicated EPEC strains were stimulated with TRAIL; cell viability was determined by measuring ATP levels and is shown as mean ± SD from three technical repeats. See also Figure S6.

930 Molecular Cell 74, 922–935, June 6, 2019 AB Figure 5. The Catalytic Site Structure in NleB (A) The catalytic site in the NleB/FADD-DD complex. NleB is shown as electrostatic potential surface; the coloration from red to blue indicates negatively to positively charged regions, respectively. FADD is in cartoon models with R117 in sticks. The black ellipse marks the deduced GlcNAc-binding pocket. (B) Close-up view of the catalytic site structure. The UDP-GlcNAc donor is docked into the pocket based on the position of UDP in the crystal structure. Residues involved in activating the arginine acceptor are shown in stick models. Dotted lines D represent hydrogen bonds. C (C and D) Mutation analyses of the catalytic-site residues. In (C), 3 3 Flag-FADD purified from 293T cells were reacted with recombinant NleB or the indicated mutants in the presence of 3H-UDP- GlcNAc. Protein loading is shown on the Coo- massie blue-stained gel. 3H-auto, 3H autoradiography. In (D), HeLa cells infected with indicated EPEC strains were stimulated with TRAIL; cell viability was determined by measuring ATP levels and is shown as mean ± SD from three technical repeats. See also Figure S8. domain to the anti-GlcNAcylarginine antibody that was devel- lyzing O-glycosylation (Lairson et al., 2008), an inverting mech- oped using a GlcNAcylated peptide antigen with a b-glycosidic anism has also been recorded with the bacterial arginine rham- linkage (Pan et al., 2014). A recent NMR study proposes a nosyltransferase EarP (Krafczyk et al., 2017; Li et al., 2016). retaining mechanism for SseK3-catalyzed GlcNAc transfer based on analyses of the substrate-free UDP-GlcNAc hydroly- In Vivo Functional Validation of the Structural sis (Esposito et al., 2018). In the hydrolysis reaction, a water Mechanism of NleB molecule carries out the nucleophilic attack, which normally We further performed mouse infection assays to investigate the generates both a and b-anomeric configuration, but the former functional significance of above structural observations on NleB can be stabilized by a non-conserved arginine at the C termi- GlcNAcylation of host death-domain proteins. Previous studies nus of SseK3. Another recent report claims an a-anomeric show that deletion of nleB from C. rodentium (encoding NleBc) configuration for SseK1-catalyzed GlcNAcylation according to causes severely reduced bacterial colonization (Li et al., 2013;

NMR analyses of a synthetic GAPDH peptide (GAPDH187-203) Pearson et al., 2013), as shown by colony-forming units of bac- that has been treated with excessive amounts of recombinant teria recovered from the stool samples and colons of infected SseK1 (Park et al., 2018). While it is not clear whether the mice (Figures 6A and 6B). These defects could be restored by forced modification of a GAPDH peptide in vitro is of any complementing the mutant bacteria with a plasmid expressing physiological relevance, we found no evidences of GAPDH WT NleBc. Using this assay, we found that alanine substitution GlcNAcylation by NleB or SseK1 in transfected or Salmo- of Trp49, Tyr219, or the Asp186/Arg189 dyad that interact with nella-infected 293T cells (Figures S1E and S1F; Li et al., the uracil, the ribose, and the GlcNAc moiety of UDP-GlcNAc, 2013). To further clarify the issue, we also performed NMR an- respectively, diminished the ability of NleBc to promote bacterial alyses of 13C-labeled NleB-GlcNAcylated RIPK1-DD protein colonization in the intestinal tract of infected mice (Figures 6A (NleB did not modify any relevant peptide substrate in our and 6B). Similarly, NleBc Y283A and E253A mutants that are hands). The high-quality 2D HSQC (heteronuclear single quan- structurally deficient in binding the arginine acceptor also tum coherence) spectra obtained allowed for determination of became inactive in mediating C. rodentium replication and colo- 1 the JCH coupling of the anomeric C1 in the GlcNAcylarginine nization. Bacteria expressing the D186A, Y219A, or Y283A to be 157 Hz, suggesting a b-anomeric linkage (Figures mutant of NleBc were even more defective in replication and S1G–S1I). The b-configuration was further supported by the colonization than the nleB-deficient strain. These three muta- presence of C1-H3 and C1-H5 cross-peaks and the absence tions did not affect structural integrity of NleB, as suggested by of C1-H2 cross-peak in the 2D 1H-13C HSQC-NOESY spectra their normal behavior on ion-exchange and gel-filtration chroma- (Figure S1J). These analyses firmly establish that NleB em- tography (Figures S7A and S7B). Consistent with our observa- ploys an inverting sugar-transfer mechanism to catalyze tions, previous mutagenesis screen has found that NleB GlcNAcylation of host death-domain substrates. Of note, while Y219A and E253A mutants are deficient in GlcNAcylating NleB differs from known bacterial glycosyltransferase toxins FADD and supporting C. rodentium colonization in mice (Wong and effectors that all employ a retaining mechanism in cata- Fok Lung et al., 2016). These data strengthen the model that

Molecular Cell 74, 922–935, June 6, 2019 931 Figure 6. Functional Analyses of NleB Targeting of Death Domains In Vivo

5- to 6-week-old C57BL/6 mice were orally gavaged with C. rodentium ICC168 strain harboring an indicated NleB mutant. Viable stool bacteria counts (log10

CFU/g feces) measured at indicated time points post-inoculation (A), and bacterial colonization in the intestine (log10 CFU/g colon, n > 6) 8 days post-infection (B) are shown as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by Student’s t test. ns, not statistically signiﬁcant. See also Figure S7.

NleB-catalyzed GlcNAcylation of a specific arginine in host solic TRADD/RIPK1/FADD complex. We found that NleB-cata- death-domain proteins underlies its virulence function in vivo. lyzed GlcNAcylation abolished not only the co-immunoprecipitation of TRADD-DD with TNFR1-DD or RIPK1-DD in 293T cells NleB Is a Pleotropic Inhibitor of Death Receptor (Figure 7B) but also the interactions of FADD-DD with TRADD- Signaling DD and RIPK1-DD (Figure 7C). Thus, NleB is a broad-spectrum NleB-targeted arginine in FADD-DD and FAS-DD is involved in inhibitor of death receptor signaling pathways due to its pleo- heterotypic DD interactions for assembly of the DISC complex tropic blocking of death-domain interactions. (Wang et al., 2010). The bulky GlcNAc modification introduces a steric hindrance that is expected to block the FADD-FAS inter- DISCUSSION action. Supporting this notion, FADD could pull down FAS-DD from transfected 293T cells, which was diminished by WT NleB Bacterial Glycosyltransferase Toxins/Effectors and the but not the GlcNAcyltransferase-deficient DXD mutant (both Glycosylation Modifications Asp mutated into Ala, Figure 7A). We further investigated whether Employing specialized glycosyltransferase toxins/effectors the arginine also participates in the interactions of FADD with to hijack relevant host targets is an emerging mechanism other death receptors. Like FAS-DD, both DR4-DD and DR5- by which bacterial pathogens antagonize host defense. In DD were co-immunoprecipitated by FADD from 293T cells, which contrast to host glycosyltransferases that often modify a was similarly sensitive to the GlcNAcyltransferase activity of NleB broad spectrum of substrates, bacterial glycosyltransferase (Figure 7A). As DR4 and DR5 are not modified by NleB, this result toxins/effectors, including the NleB family, target specific suggests that the arginine in FADD is critical for its interaction with host proteins (Jank et al., 2015). Since the identification of the upstream death receptors. It is well established that TNFR1 the prototype C. difficile TcdA/TcdB, the mechanism for the activates two pathways through different death domain-medi- substrate specificity of bacterial glycosyltransferase toxins/ ated signaling complexes; upon TNFa stimulation, TNFR1 effectors has been poorly understood due to the lack of induces RIPK1-dependent NF-kB activation through binding to enzyme-substrate complex structure. In this study, we deter- TRADD or activates caspase-8 to trigger cell death via the cyto- mine crystal structure of NleB in complex with its substrate

932 Molecular Cell 74, 922–935, June 6, 2019 AC

Figure 7. NleB Disrupts Multiple Death-Domain Interactions in Death Receptors Signaling Indicated epitope-tagged death domains were co-expressed with NleB or its GlcNAcyltransferase-deﬁcient DXD mutant in 293T cells. Heterotypical death- domain interactions were probed by co-immunoprecipitation assays followed by immunoblotting. Interactions of FADD with FAS-, DR4-, or DR5-DD (A), interactions of TRADD-DD with TNFR1- or RIPK1-DD (B), and interactions of FADD-DD with RIPK1- or TRADD-DD (C) are shown.

FADD-DD. The conserved GT-A fold and the unique helix-pair The Unique Catalytic Mechanism for Arginine insertion of NleB constitute a large concave surface to accom- GlcNAcylation by NleB modate FADD-DD. Extensive salt bridge or hydrogen-bond in- Known bacterial glycosyltransferase toxins/effectors employ a teractions at the intermolecular interface determine a strong retaining mechanism to synthesize an a-anomeric glycosidic and selective binding to the death domain. Notably, residues linkage. On the host side, both OGT-catalyzed O-GlcNAcylation that bind to FADD-DD are highly conserved in NleB homologs and OST-catalyzed N-glycosylation bear a b-configuration, sug- including SseK1 and SseK3. Recently, SseK1 and SseK3 were gesting an inverting sugar-transfer mechanism (Lazarus et al., shown to GlcNAcylate similar death domains as NleB (Gunster 2011; Lizak et al., 2011). In our NleB/FADD-DD structure, the po- et al., 2017). Insights gained from the NleB/FADD-DD structure sition of the arginine guanidinium suggests that it attacks the C1 also explain why NleB selectively targets certain death do- atom of the GlcNAc group from the b-anomeric face. Consis- mains among the large death-domain protein family. tently, a b-anomeric configuration in the GlcNAcylated arginine Known bacterial glycosyltransferase toxins/effectors, except is directly visualized in the crystal structures of NleB-modified for the NleB family, add a monosaccharide to the hydroxyl group TRADD-DD and RIPK1-DD, which is further confirmed by NMR of a serine, threonine, or tyrosine, referred to as O-linked glyco- analyses of NleB-GlcNAcylated RIPK1-DD in solution. Thus, sylation. The dominant protein monoglycosylation in eukaryotes NleB also employs an inverting mechanism, which is similar to is O-linked GlcNAcylation, a reversible PTM catalyzed by a single host glycosyltransferases but different from other bacterial gly- O-GlcNAc transferase (OGT) and a single O-GlcNAcase (OGA) in cosyltransferase toxins/effectors. Moreover, the geometry of the cytoplasm (Hart et al., 2011; Vocadlo, 2012). OGA cleaves the sugar donor and the position of the arginine acceptor sug- only OGT-modified substrates and cannot reverse bacteria- gest a direct-displacement SN2-like reaction for NleB-catalyzed induced GlcNAcylation due to the different glycosidic linkage sugar transfer. Specifically, Glu253 of NleB acts as the base to (see below). The NleB family catalyzes arginine GlcNAcylation, deprotonate the guanidinium in the arginine substrate. The argi- generating an N-linked glycosylation. Eukaryotes also have nine then nucleophilically attacks the C1 atom of UDP-GlcNAc, N-linked glycosylation catalyzed by oligosaccharyltransferase forming an oxocarbenium ion-like transition state that pro-

(OST) in the ER, which occurs on the side-chain amide of gresses to SN2-like displacement of the leaving group (UDP). De- an asparagine in some membrane and secretory proteins. parture of the UDP is facilitated by the Mn2+ that coordinates the The differences highlight the uniqueness of NleB-catalyzed diphosphates and stabilizes the negative charge of the transition N-GlcNAcylation, which shall resist the activity of endogenous state (Figure S8). Although NleB and OST are both inverting en- glycosidases and exert a long-lasting virulence effect on the host. zymes catalyzing N-linked glycosylation, there are differences in

Molecular Cell 74, 922–935, June 6, 2019 933 their catalytic mechanisms. For OST, the enzyme-bound Mn2+ SUPPLEMENTAL INFORMATION not only stabilizes the lipid-pyrophosphate leaving group but also chelates an aspartate and a glutamate which function Supplemental Information can be found online at https://doi.org/10.1016/j. molcel.2019.03.028. together as the base to activate the incoming amide of the asparagine acceptor (Lizak et al., 2011). ACKNOWLEDGMENTS Glycosylation of an arginine is unusual given that the guanidinium has a high pKa value and is intrinsically a poor nucleophile. We thank the staff of beamlines BL17U1 at National Center for Protein Sci- The NleB/FADD-DD structure reveals two unique features in the ences, Shanghai, and Shanghai Synchrotron Radiation Facility for X-ray data catalytic site, which can help to understand NleB-catalyzed argi- collection and the proteomics facility at NIBS for mass spectrometry analyses. nine GlcNAcylation. First, the side chain of Arg117 of FADD is This work was supported by the National Key Research and Development tightly docked into a narrow cleft formed by His182, His281, Programs of China (2018YFA0508000, 2017YFA0504000, 2017YFA0505900, and 2016YFA0501500), the Strategic Priority Research Program of the Tyr283, Tyr284, and Trp329 of NleB. Such unique chemical Chinese Academy of Sciences (XDB29020202 and XDB08020202), and the microenvironment may lower the pKa of the arginine guanidi- program Youth Innovation Promotion Association CAS (2017127). This work nium. Second, the arginine is located on a rigid helix and pre- was also supported by National Natural Science Foundation of China sented in the most extended conformation. This not only allows (NSFC) no. 31470245, the Natural Science Foundation of Hubei Province of the terminal guanidinium forming bidentate hydrogen bonds with China (2015CFA030 and 2017CFB379), the Foundation for Innovative Glu253 of NleB but also may facilitate deprotonation of the argi- Research Team of Hubei Provincial Department of Education T201713, Funda- mental Research Funds for the Central Universities (2662017PY011 and nine by Glu253. In fact, bidentate hydrogen bonding to an argi- 2662018PY028), and Huazhong Agricultural University Scientific & Technolog- nine guanidinium by a carboxyl group has been noted in other ical Self-Innovation Foundation 2017RC003 to S.L. arginine modification enzymes like protein arginine methyltrans- ferase (Fuhrmann et al., 2015). As a result of the above described AUTHOR CONTRIBUTIONS structural features, the arginine acceptor is positioned closely to the C1 atom of the GlcNAc group to be ready for performing the J.D., S.L., and F.S. conceived the study; J.D., supported by D.-C.W., determined the structures of TRADD-DD, RIPK1-DD, and NleB/FADD-DD complex. nucleophilic attack. EarP is the other arginine-targeting glycosyl- X.P., L.D., and J.X., supervised by S.L., performed biochemical and functional transferase, but its catalysis has different structural basis and assays; Q.Y. solved the apo-NleB structure; H.Y. performed NMR analyses; enzymological feature. EarP uses an aspartate as the base to and J.D., S.L., and F.S. analyzed the data and wrote the paper. activate the arginine substrate. EarP-catalyzed rhamnosylation requires the rhamnose ring of the bound sugar donor to undergo DECLARATION OF INTERESTS a remarkable conformational change to expose the b-anomeric The authors declare no competing interests. face of the C1 atom so that it can be attacked by the arginine guanidinium (Sengoku et al., 2018). Received: August 21, 2018 Revised: December 27, 2018 STAR+METHODS Accepted: March 22, 2019 Published: April 9, 2019 Detailed methods are provided in the online version of this paper REFERENCES and include the following: Adams, P.D., Afonine, P.V., Bunko´ czi, G., Chen, V.B., Davis, I.W., Echols, N., d KEY RESOURCES TABLE Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). d CONTACT FOR REAGENT AND RESOURCE SHARING PHENIX: a comprehensive Python-based system for macromolecular struc- d EXPERIMENTAL MODEL AND SUBJECT DETAILS ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221. B Microbe Strains Aktories, K., Schwan, C., and Jank, T. (2017). Clostridium difficile toxin biology. B Cell Lines Annu. Rev. Microbiol. 71, 281–307. B Animals Belyi, Y., and Aktories, K. (2010). Bacterial toxin and effector glycosyltrans- d METHOD DETAILS ferases. Biochim. Biophys. Acta 1800, 134–143. B Recombinant protein expression and purification Belyi, Y., Niggeweg, R., Opitz, B., Vogelsgesang, M., Hippenstiel, S., Wilm, M., B Crystallization, data collection, and structure determi- and Aktories, K. (2006). Legionella pneumophila glucosyltransferase inhibits nation host elongation factor 1A. Proc. Natl. Acad. Sci. USA 103, 16953–16958. B In vitro 3H-UDP-GlcNAc labeling Chen, V.B., Arendall, W.B., 3rd, Headd, J.J., Keedy, D.A., Immormino, R.M., B NMR analyses of the anomeric configuration of NleB- Kapral, G.J., Murray, L.W., Richardson, J.S., and Richardson, D.C. (2010). MolProbity: all-atom structure validation for macromolecular crystallography. GlcNAcylated death domain Acta Crystallogr. D Biol. Crystallogr. 66, 12–21. B Bacterial infection and cell death assay Cui, J., and Shao, F. (2011). Biochemistry and cell signaling taught by bacterial B Immunoprecipitation and pulldown assays effectors. Trends Biochem. Sci. 36, 532–540. B LC-MS analysis Dodson, E.J., Winn, M., and Ralph, A. (1997). Collaborative Computational B Citrobacter rodentium mouse infection assays Project, number 4: providing programs for protein crystallography. Methods d QUANTIFICATION AND STATISTICAL ANALYSIS Enzymol. 277, 620–633. B Cell death assay El Qaidi, S., Chen, K., Halim, A., Siukstaite, L., Rueter, C., Hurtado-Guerrero, B Citrobacter rodentium mouse infection assays R., Clausen, H., and Hardwidge, P.R. (2017). NleB/SseK effectors from d DATA AND SOFTWARE AVAILABILITY Citrobacter rodentium, Escherichia coli, and Salmonella enterica display

934 Molecular Cell 74, 922–935, June 6, 2019 distinct differences in host substrate specificity. J. Biol. Chem. 292, Z. Otwinowski, and W. Minor, eds. (1997). Processing of X-ray Diffraction Data 11423–11430. Collected in Oscillation Mode (New York: Academic Press). Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and Pan, M., Li, S., Li, X., Shao, F., Liu, L., and Hu, H.G. (2014). Synthesis development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501. of and specific antibody generation for glycopeptides with arginine Esposito, D., Gunster,€ R.A., Martino, L., El Omari, K., Wagner, A., Thurston, N-GlcNAcylation. Angew. Chem. Int. Ed. Engl. 53, 14517–14521. T.L.M., and Rittinger, K. (2018). Structural basis for the glycosyltransferase ac- Park, H.H., Lo, Y.C., Lin, S.C., Wang, L., Yang, J.K., and Wu, H. (2007). The tivity of the Salmonella effector SseK3. J. Biol. Chem. 293, 5064–5078. death domain superfamily in intracellular signaling of apoptosis and inflamma- Fisher, G.H., Rosenberg, F.J., Straus, S.E., Dale, J.K., Middleton, L.A., Lin, tion. Annu. Rev. Immunol. 25, 561–586. A.Y., Strober, W., Lenardo, M.J., and Puck, J.M. (1995). Dominant interfering Park, J.B., Kim, Y.H., Yoo, Y., Kim, J., Jun, S.H., Cho, J.W., El Qaidi, S., Fas gene mutations impair apoptosis in a human autoimmune lymphoprolifer- Walpole, S., Monaco, S., Garcıá-Garcıá, A.A., et al. (2018). Structural basis ative syndrome. Cell 81, 935–946. for arginine glycosylation of host substrates by bacterial effector proteins. Fuhrmann, J., Clancy, K.W., and Thompson, P.R. (2015). Chemical biology of Nat. Commun. 9, 4283. protein arginine modifications in epigenetic regulation. Chem. Rev. 115, Pearson, J.S., Giogha, C., Ong, S.Y., Kennedy, C.L., Kelly, M., Robinson, K.S., 5413–5461. Lung, T.W., Mansell, A., Riedmaier, P., Oates, C.V., et al. (2013). A type III Gunster, R.A., Matthews, S.A., Holden, D.W., and Thurston, T.L. (2017). SseK1 effector antagonizes death receptor signalling during bacterial gut infection. and SseK3 type III secretion system effectors inhibit NF-kappaB signaling and Nature 501, 247–251. necroptotic cell death in Salmonella-infected macrophages. Infect. Immun. 85, Reddick, L.E., and Alto, N.M. (2014). Bacteria fighting back: how pathogens e00010-17. target and subvert the host innate immune system. Mol. Cell 54, 321–328. Hart, G.W., Slawson, C., Ramirez-Correa, G., and Lagerlof, O. (2011). Cross Rieux-Laucat, F., Le Deist, F., Hivroz, C., Roberts, I.A., Debatin, K.M., Fischer, talk between O-GlcNAcylation and phosphorylation: roles in signaling, tran- A., and de Villartay, J.P. (1995). Mutations in Fas associated with human lym- scription, and chronic disease. Annu. Rev. Biochem. 80, 825–858. phoproliferative syndrome and autoimmunity. Science 268, 1347–1349. He, S., Wang, L., Miao, L., Wang, T., Du, F., Zhao, L., and Wang, X. (2009). Robert, X., and Gouet, P. (2014). Deciphering key features in protein structures Receptor interacting protein kinase-3 determines cellular necrotic response with the new ENDscript server. Nucleic Acids Res. 42, W320-4. to TNF-alpha. Cell 137, 1100–1111. Scott, F.L., Stec, B., Pop, C., Dobaczewska, M.K., Lee, J.J., Monosov, E., Holm, L., and Rosenstro¨ m, P. (2010). Dali server: conservation mapping in 3D. Robinson, H., Salvesen, G.S., Schwarzenbacher, R., and Riedl, S.J. (2009). Nucleic Acids Res. 38, W545–W549. The Fas-FADD death domain complex structure unravels signalling by recep- ¨ Jank, T., Bogdanovic, X., Wirth, C., Haaf, E., Spoerner, M., Bohmer, K.E., tor clustering. Nature 457, 1019–1022. Steinemann, M., Orth, J.H., Kalbitzer, H.R., Warscheid, B., et al. (2013). A bacterial toxin catalyzing tyrosine glycosylation of Rho and deamidation of Gq and Sengoku, T., Suzuki, T., Dohmae, N., Watanabe, C., Honma, T., Hikida, Y., Gi proteins. Nat. Struct. Mol. Biol. 20, 1273–1280. Yamaguchi, Y., Takahashi, H., Yokoyama, S., and Yanagisawa, T. (2018). Structural basis of protein arginine rhamnosylation by glycosyltransferase Jank, T., Belyi, Y., and Aktories, K. (2015). Bacterial glycosyltransferase toxins. EarP. Nat. Chem. Biol. 14, 368–374. Cell. Microbiol. 17, 1752–1765. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., Krafczyk, R., Macosek, J., Jagtap, P.K.A., Gast, D., Wunder, S., Mitra, P., Jha, McWilliam, H., Remmert, M., So¨ ding, J., et al. (2011). Fast, scalable generation A.K., Rohr, J., Hoffmann-Ro¨ der, A., Jung, K., et al. (2017). Structural basis for of high-quality protein multiple sequence alignments using Clustal Omega. EarP-mediated arginine glycosylation of translation elongation factor EF-P. Mol. Syst. Biol. 7, 539. MBio 8,8. Strasser, A., Jost, P.J., and Nagata, S. (2009). The many roles of FAS receptor Lairson, L.L., Henrissat, B., Davies, G.J., and Withers, S.G. (2008). signaling in the immune system. Immunity 30, 180–192. Glycosyltransferases: structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521–555. Vocadlo, D.J. (2012). O-GlcNAc processing enzymes: catalytic mechanisms, Lassak, J., Keilhauer, E.C., Furst,€ M., Wuichet, K., Go¨ deke, J., Starosta, A.L., substrate specificity, and enzyme regulation. Curr. Opin. Chem. Biol. 16, Chen, J.M., Søgaard-Andersen, L., Rohr, J., Wilson, D.N., et al. (2015). 488–497. Arginine-rhamnosylation as new strategy to activate translation elongation Wang, L., Du, F., and Wang, X. (2008). TNF-alpha induces two distinct factor P. Nat. Chem. Biol. 11, 266–270. caspase-8 activation pathways. Cell 133, 693–703. Lazarus, M.B., Nam, Y., Jiang, J., Sliz, P., and Walker, S. (2011). Structure of Wang, L., Yang, J.K., Kabaleeswaran, V., Rice, A.J., Cruz, A.C., Park, A.Y., Yin, human O-GlcNAc transferase and its complex with a peptide substrate. Q., Damko, E., Jang, S.B., Raunser, S., et al. (2010). The Fas-FADD death Nature 469, 564–567. domain complex structure reveals the basis of DISC assembly and disease Li, S., Zhang, L., Yao, Q., Li, L., Dong, N., Rong, J., Gao, W., Ding, X., Sun, L., mutations. Nat. Struct. Mol. Biol. 17, 1324–1329. Chen, X., et al. (2013). Pathogen blocks host death receptor signalling by argi- Wilson, N.S., Dixit, V., and Ashkenazi, A. (2009). Death receptor signal trans- nine GlcNAcylation of death domains. Nature 501, 242–246. ducers: nodes of coordination in immune signaling networks. Nat. Immunol. Li, X., Krafczyk, R., Macosek, J., Li, Y.L., Zou, Y., Simon, B., Pan, X., Wu, Q.Y., 10, 348–355. Yan, F., Li, S., et al. (2016). Resolving the a-glycosidic linkage of arginine- Wong Fok Lung, T., Giogha, C., Creuzburg, K., Ong, S.Y., Pollock, G.L., Zhang, rhamnosylated translation elongation factor P triggers generation of the first Y., Fung, K.Y., Pearson, J.S., and Hartland, E.L. (2016). Mutagenesis and func- Rha Arg specific antibody. Chem. Sci. (Camb.) 7, 6995–7001. tional analysis of the bacterial arginine glycosyltransferase effector NleB1 from Lizak, C., Gerber, S., Numao, S., Aebi, M., and Locher, K.P. (2011). X-ray struc- enteropathogenic Escherichia coli. Infect. Immun. 84, 1346–1360. ture of a bacterial oligosaccharyltransferase. Nature 474, 350–355. Zhang, N., Yuan, W., Fan, J.S., and Lin, Z. (2017). Structure of the C-terminal Lu, Q., Li, S., and Shao, F. (2015). Sweet talk: protein glycosylation in bacterial domain of TRADD reveals a novel fold in the death domain superfamily. Sci. interaction with the host. Trends Microbiol. 23, 630–641. Rep. 7, 7073.

Molecular Cell 74, 922–935, June 6, 2019 935 STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-a-Tubulin Sigma-Aldrich Cat# T5168; RRID: AB_477579 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat# F1804; RRID: AB_262044 Rabbit monoclonal anti-Arginine (glcnac) Abcam Cat# ab195033 Mouse monoclonal anti-GST (26H1) Cell Signaling Technology Cat# 2624S; RRID: AB_2189875 Rabbit polyclonal anti-GFP Santa Cruz Biotechnology Cat# sc-8334; RRID: AB_641123 Rabbit polyclonal anti-HA (Y11) Santa Cruz Biotechnology Cat# sc-805; RRID: AB_631618 Bacterial and Virus Strains Citrobacter rodentium DnleB strain DBS100 Li et al., 2013 N/A EPEC E2348/69 DescN strain SC3909 Li et al., 2013 N/A EPEC E2348/69 DnleB/E strain SC3909 Li et al., 2013 N/A Salmonella Typhimurium strain SL1344 DsseK1/2/3 This paper N/A Chemicals, Peptides, and Recombinant Proteins Isopropyl b-D- thiogalactopyranoside (IPTG) Sigma-Aldrich Cat# I6758 cOmplete Protease Inhibitor Cocktail Sigma-Aldrich Cat# 11697498001 Human TRAIL Sigma-Aldrich Cat# SRP8024 Cycloheximide (CHX) Sigma-Aldrich Cat# 5087390001 Flag peptide Sigma-Aldrich Cat# F3290 Uridine Diphosphate N-Acetyl-D-Glucosamine, Perkin Elmer Cat# NET434250UC [Glucosamine-6-3H(N)] Dulbecco’s modiﬁed Eagle’s medium (DMEM) GIBCO Cat# C11965500BT Fetal bovine serum (FBS) GIBCO Cat# 10091148 L-glutamine GIBCO Cat# 25030081 Penicillin and streptomycin (Pen Strep) GIBCO Cat# 15140122 L-Selenomethionine (SeMet) J&K Scientiﬁc Cat# 114587 Vigofect Vigorous Biotechnology Cat# T001 13C-labeled glucose Cambridge Isotope Laboratories, Inc. Cat# 110187-42-3 Critical Commercial Assays CellTiter-Glo Luminescent Cell Viability Assay kit Promega Cat# G7570 Crystal Screen kit Hampton Research Cat# HR2-110 Crystal Screen 2 kit Hampton Research Cat# HR2-112 Deposited Data Crystal Structure of GlcNAcylated TRADD-DD This paper PDB: 6AC0 Crystal Structure of GlcNAcylated RIPK1-DD This paper PDB: 6AC5 Crystal Structure of apo-NleB This paper PDB: 6E66 Crystal Structure of NleB/FADD-DD complex This paper PDB: 6ACI Original data published as Mendeley dataset This paper https://data.mendeley.com/datasets/ rmcf2b6x6g/edit Experimental Models: Cell Lines Human: HEK293T cells ATCC Cat# CRL-3216 Human: HeLa cells ATCC Cat# CCL-2 Experimental Models: Organisms/Strains Mouse: C57BL/6 BEIJING HFK BIOSICENSE CO., LTD Cat# 20161105 (Continued on next page)

e1 Molecular Cell 74, 922–935.e1–e6, June 6, 2019 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for DnleB in C. rodentium This paper N/A Forward: tcagggccggccgactggaacatatgcggg Reverse: tgacggcgcgccttaccatgaactgttggtatacatactg Recombinant DNA Plasmid: pSUMO-NleBDN27 K115A This paper N/A Plasmid: pCS2-EGFP-NleB K289A/K292A/Y303A This paper N/A Plasmid: pCS2-EGFP-NleB Y284A/D285A This paper N/A Plasmid: pCS2-EGFP-NleB K277A/D279A This paper N/A Plasmid: pCS2-EGFP-NleB Y145A/D151A This paper N/A Plasmid: pCS2-EGFP-NleB D221A This paper N/A Plasmid: pCS2-EGFP-NleB D223A This paper N/A Plasmid: pCS2-EGFP-NleB W49A This paper N/A Plasmid: pCS2-EGFP-NleB Y219A This paper N/A Plasmid: pCS2-EGFP-NleB D186A This paper N/A Plasmid: pCS2-EGFP-NleB R189A This paper N/A Plasmid: pCS2-EGFP-NleB E58A This paper N/A Plasmid: pCS2-EGFP-NleB S327A/S328A/W329A This paper N/A Plasmid: pCS2-EGFP-NleB Y72A This paper N/A Plasmid: pCS2-EGFP-NleB F185A This paper N/A Plasmid: pCS2-EGFP-NleB N320A This paper N/A Plasmid: pCS2-EGFP-NleB S322A This paper N/A Plasmid: pCS2-EGFP-NleB Y283A This paper N/A Plasmid: pCS2-EGFP-NleB E253A This paper N/A Plasmid: pCS2-EGFP-NleB K289D This paper N/A Plasmid: pCS2-EGFP-NleB K289D/K292Q This paper N/A Plasmid: pCS2-EGFP-NleB This paper N/A Plasmid: pCS2-EGFP-NleB DxD This paper N/A Plasmid: pCS2-EGFP-NleB DN27 K115A This paper N/A Plasmid: pCS2-EGFP- SseK1 This paper N/A Plasmid: pCS2-3Flag-TRADD-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-TNFR1-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-FADD-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-DR3-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-RIPK1-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-FAS-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-DR4-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-DR5-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-DR5-DD K369D This paper N/A Plasmid: pCS2-3Flag-DR5-DD E355R This paper N/A Plasmid: pCS2-3Flag-DR5-DD K372E This paper N/A Plasmid: pET28a-LFN-NleB Li et al., 2013 N/A Plasmid: pGEX6p-2-TRADD-DD This paper N/A Plasmid: pGEX6p-2-TNFR1-DD This paper N/A Plasmid: pGEX6p-2-FADD-DD This paper N/A Plasmid: pGEX6p-2-DR3-DD This paper N/A Plasmid: pGEX6p-2-RIPK1DD-DD This paper N/A Plasmid: pGEX6p-2-FAS-DD This paper N/A (Continued on next page)

Molecular Cell 74, 922–935.e1–e6, June 6, 2019 e2 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pGEX6p-2-DR4-DD This paper N/A Plasmid: pGEX6p-2-DR5-DD This paper N/A Plasmid: pGEX6p-2-IRAK1-DD This paper N/A Plasmid: pCS2-3HA-TRADD-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-TNFR1-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-FADD-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-DR3-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-RIPK1DD-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-FAS-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-DR4-DD Li et al., 2013 N/A Plasmid: pCS2-3HA-DR5-DD Li et al., 2013 N/A Plasmid: pCS2-3Flag-GAPDH This paper N/A Software and Algorithms HKL2000 program Otwinowski and Minor, 1997 http://www.hkl-xray.com/ CCP4 program Dodson et al., 1997 http://www.ccp4.ac.uk/ PHENIX Adams et al., 2010 https://www.phenix-online.org/ Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu Clustal Omega Sievers et al., 2011 https://www.ebi.ac.uk/Tools/msa/clustalo/ ESPript Robert and Gouet, 2014 http://espript.ibcp.fr/ESPript/ESPript/ PyMOL The PyMOL Molecular Graphics http://www.pymol.org/2 System,Schrodiner, LLC. Analyst Software SCIEX https://sciex.com/products/software Prism 7 GraphPad https://www.graphpad.com/scientiﬁc- software/prism/ Other Ni-Sepharose resin GE Healthcare Cat# 17057502 Glutathione-Sepharose resin GE Healthcare Cat# 17513202 Protein G HP SpinTrap GE Healthcare Cat# 28903134 HiTrap Q column GE Healthcare Cat# 17115301 Superdex G75 column GE Healthcare Cat# 28989333

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the Lead Contact, Feng Shao ([email protected]). DNA constructs and other research reagents generated by the authors will be distributed upon request to other research investigators under a Material Transfer Agreement.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Microbe Strains EPEC E2348/69 DnleB/E strain SC3909 (Li et al., 2013) and S. Typhimurium strain SL1344 (ATCC 700720) were used for cell culture infection. Deletions of nleB in Citrobacter rodentium strain DBS100 (ATCC 51459) and of sseK1/sseK2/sseK3 in S. Typhimurium was achieved by standard homologous recombination using the suicide vector pCVD442 as described previously (Li et al., 2013). All bacterial strains were prepared by overnight shaking of bacterial culture at 37C in LB medium.

Cell Lines HEK293T and HeLa cells obtained from American Type Culture Collection (ATCC) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/mL penicillin and 100 mg/mL streptomycin. Cells were cultured in a humidified atmosphere containing 5% CO2 at 37 C. e3 Molecular Cell 74, 922–935.e1–e6, June 6, 2019 Animals All animal experiments were conducted following the Ministry of Health national guidelines for housing and care of laboratory animals and performed in accordance with institutional regulations after review and approval by the Institutional Animal Care and Use Committee at Taihe Hospital, Hubei University of Medicine. 5 to 6-week-old male C57BL/6 mice maintained in the specific pathogen-free (SPF) environment were used. All animals were housed in individually HEPA-filtered cages with sterile bedding. Each experiment was performed using at least six mice per group.

METHOD DETAILS

Recombinant protein expression and purification For recombinant expression in E. coli, full-length NleB and the optimized NleB variant devoid of the N-terminal 27 residues with a Lys115Ala mutation were respectively cloned into a modified pET vector with an anthrax Lethal Factor N-domain (LFN) tag or a 6xHis-SUMO tag at the N terminus. cDNAs for FADD-DD (residue 93-184), RIPK1-DD (residue 561-671) and TRADD-DD (residue 195-312) were cloned into the pGEX-6P-2 vector with an N-terminal GST tag. Native recombinant proteins were expressed in E. coli strain BL21 (DE3) with 0.4 mM isopropyl b-D-1-thiogalactopyranoside (IPTG) for overnight induction at 22C in LB medium. Selenomethionine-substituted (SeMet) NleB were expressed in the methionine auxotrophic E. coli strain B834 (DE3). NleB were purified by affinity chromatography using Ni-Sepharose beads. The 6xHis-SUMO tag was removed by overnight digestion with homemade ULP1 protease at 4C. The untagged proteins were further purified by HiTrap Q anion-exchange and then Superdex G75 gel-filtration chromatography. SeMet-NleB were purified in the same way as the native protein. FADD-DD was purified by glutathione affinity chromatography using glutathione-Sepharose beads and the GST tag was removed by homemade PreScission protease digestion at 4C. The untagged proteins were purified by Superdex G75 gel-filtration chromatography. To obtain GlcNAcylated death domains, TRADD- and RIPK1-DD were co-expressed with NleB in E. coli, and the GlcNAcylated death domains were purified in the same way as FADD-DD. The NleB/FADD-DD complex was produced by incubation of purified NleB with FADD-DD at the equal molar ratio and further purified by the Superdex G75 gel-filtration column. All the purified proteins were concentrated and stored in the buffer containing 20 mM Tris-HCl (pH 8.0), 150 mM NaCl and 5 mM dithiothreitol (DTT).

Crystallization, data collection, and structure determination The crystallization experiments were carried out at 20C using the sitting-drop vapor diffusion method with 2 mL drop containing 1 mL of protein solution and 1 mL of reservoir solution equilibrated over 100 mL of reservoir solution. Initial crystallization hits of NleB were obtained by using the Crystal Screen Kit. The qualified crystals of SeMet-labeled NleB appeared within two weeks in the reservoir buffer containing 100 mM sodium cacodylate trihydrate (pH 6.5), 30% (w/v) polyethylene glycol 8000, and 200 mM ammonium sulfate. Crystals of GlcNAcylated TRADD-DD and RIPK1-DD were grown in the reservoir buffer containing 1.6 M Na/KPO4 (pH 6.0), and 2.2 M ammonium sulfate with 100 mM Bis-Tris (pH 5.5), respectively. Crystals of NleB/FADD-DD complex were obtained in the presence of 2 mM UDP and 5 mM Mn2+ in the reservoir buffer containing 4.5 M NaCl and 100 mM HEPES (pH 7.5). All the crystals were soaked in a cryoprotectant solution containing the reservoir buffer supplemented with 10%–20% glycerol before flash-freezing with liquid nitrogen. Diffraction data were collected at the Shanghai Synchrotron Radiation Facility (Shanghai, China) beamline BL17U1 and processed with HKL2000 program suite (Otwinowski and Minor, 1997) or IMOSFLM from the CCP4 program suite (Dodson et al., 1997). Phase of SeMet-NleB crystal was determined by the single wavelength anomalous dispersion (SAD) method and automatic model building was performed in the PHENIX program suite (Adams et al., 2010). The rest of the model was manually built in Coot (Emsley et al., 2010). The structures of GlcNAcylated TRADD- and RIPK1-DD were determined by molecular replacement using the FADD-DD structure as the initial model. The structure of NleB/FADD-DD complex was also determined by molecular replacement using the structures of apo-NleB and FADD-DD as the initial models. All the structures were refined with PHENIX, and manual modeling was performed between refinement cycles. The statistics of data collection and refinement are summarized in Table 1. The quality of the final models was validated by MolProbity (Chen et al., 2010). Multiple sequence alignments were generated using Clustal Omega algorism (Sievers et al., 2011), and the alignment figures were generated by ESPript (Robert and Gouet, 2014). All other structural figures were prepared in PyMOL.

In vitro 3H-UDP-GlcNAc labeling 3xFlag-FADD expressed in HEK293T cells were immunopuriﬁed and immobilized on the anti-Flag M2 beads. The beads were incu- bated with 5 mg of NleB for 2 h at 37 Cina40mL buffer containing 20 mM HEPES (pH 7.5), 100 mM KCl, 2 mM MgCl2, 1 mM MnCl2, and 0.4 mCi (0.2 mM) of 3H-UDP-GlcNAc. The reaction mixtures were separated on a 12% SDS-PAGE gel followed by Coomassie blue staining. Incorporation of 3H-UDP-GlcNAc was visualized by 3H autoradiography of the dried SDS-PAGE gel.

NMR analyses of the anomeric conﬁguration of NleB-GlcNAcylated death domain To obtain 13C-labeled GlcNAcylated death domain, RIPK1-DD was co-expressed with NleB in E. coli cultured in the M9 minimal medium supplied with 13C-labeled glucose. The 13C-labeled GlcNAcylated RIPK1-DD protein was puriﬁed in the same way as the

Molecular Cell 74, 922–935.e1–e6, June 6, 2019 e4 unlabeled protein. All NMR experiments were carried out at 298 K on the Bruker AVANCE III 850 MHz spectrometer equipped with a cryoprobe. The assignment of the GlcNAc group is based on 2D 1H-13C HSQC-TOCSY with a mixing time of 60 ms and 2D 1H-13C HSQC-NOESY with a mixing time of 120 ms.

Bacterial infection and cell death assay A single EPEC colony was inoculated into 0.5 mL of LB medium and statically cultured overnight at 37C. Bacterial cultures were then diluted by 1:40 in DMEM supplemented with 1 mM IPTG and cultured for an additional 4 h at 37 C in the presence of 5% CO2. Infec- tion of HeLa cells was performed at a multiplicity of infection (MOI) of 200:1 in the presence of 1 mM IPTG for 2 h. Cells were washed four times with PBS and bacteria were killed by 200 mg/mL gentamicin. 1-h CHX pretreatment (1 mg/mL) was used to sensitize TRAIL (200 ng/mL)-stimulated apoptosis. Cell survival was determined 6 h after treatment by using the CellTiter-Glo Luminescent Cell Viability Assay kit. A single Salmonella colony was inoculated and cultured overnight in LB medium at 37C. 293T cells transfected with a control vector or an indicated Flag-tagged protein were subjected to infection at MOI of 100:1. 24 h after infection, cells were collected and subjected to immunoprecipitation and immunoblotting analysis.

Immunoprecipitation and pulldown assays Vigofect was used for mammalian cell transfection following the manufacturer’s instructions. For co-immunoprecipitation, HEK293T cells at a confluency of 60%–70% in 6-well plates were transfected with a total of 5 mg plasmids. 24 h after transfection, cells were washed by PBS once and lysed by ultrasonication in buffer A containing 25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 10% glycerol, and 1% Triton X-100, supplemented with cOmplete Protease Inhibitor Cocktail. Pre-cleared lysates were subjected to anti-Flag M2 immunoprecipitation following the manufacturer’s instructions. The beads were washed for four times with the lysis buffer and the immunoprecipitates were eluted by 2 3 SDS sample buffer followed by standard immunoblotting analyses. All immunoprecipitations were performed for more than three times and representative results are shown in the figures. To purify death domains or death domain-containing protein for mass spectrometry measurement of the total molecular weight, HEK293T cells overexpressing the desired protein were harvested in buffer B containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 20 mM n-octyl-b-D-glucopyranoside (INALCO) and 5% glycerol, supplemented with cOmplete Protease Inhibitor Cocktail. Cells were lysed by ultrasonication. The supernatants were pre-cleared by Protein G Sepharose at 4C for 1 h and subjected to anti- Flag M2 immunoprecipitation. Following 4-h incubation, the beads were washed with buffer B once and subsequently the TBS buffer (50 mM Tris-HCl, pH 7.5 and150 mM NaCl) for four times. Bound proteins were eluted with 600 mg/mL Flag peptide in the TBS buffer. The eluted proteins were verified by Coomassie brilliant blue staining on a SDS-PAGE gel prior to mass spectrometry analysis.

LC-MS analysis E. coli or HEK293T-cell puriﬁed death domains or their point mutation proteins were loaded onto a home-made capillary column (150 mm ID, 3 cm long) packed with Poros R2 media, and eluted by an Agilent 1100 binary pump system with the following solvent gradient: 0%–100% B in 60 min (A = 0.1 M acetic acid in water; B = 0.1 M acetic acid/40% acetonitrile/40% isopropanol). The eluted proteins were sprayed into a QSTAR XL mass spectrometer equipped with a Turbo Electrospray ion source. The instrument was acquired in MS mode under 5 K-volt spray voltage. The protein charge envelop was averaged across the corresponding protein elution peaks, and de-convoluted into non-charged forms by the Analyst Software provided by the manufacturer.

Citrobacter rodentium mouse infection assays For oral inoculation and harvesting, C. rodentium WT strain and indicated derivatives were prepared by overnight shaking of bacterial culture at 37C in LB broth. Mice were orally inoculated using a gavage needle with 200 mL bacteria suspension in PBS (2x109 CFU). The number of viable bacteria used as the inoculum was determined by retrospective plating onto the LB agar containing the appropriate antibiotics. Stool samples were recovered aseptically at various time points after inoculation, and the number of viable bacteria per gram of stool was determined after homogenization in PBS and plating onto LB agar containing the appropriate antibiotics. 8 days after inoculation, colons were removed aseptically, weighed and homogenized in PBS. Homogenates were serially diluted and plated for determining the CFU counts.

QUANTIFICATION AND STATISTICAL ANALYSIS

Cell death assay Cell viability was determined by measuring ATP levels. Results are represented as the meanc ± cSD from three technical repeats.

Citrobacter rodentium mouse infection assays

Viable stool bacteria counts (log10 CFU/g feces) measured at indicated time points post-inoculation and bacterial colonization in the intestine (log10 CFU/g colon, n > 6) 8 days post-infection are represented as mean ± cSEM. Data were analyzed using Student’s t test in the software GraphPad Prism. P value < 0.05 was considered signiﬁcant.

e5 Molecular Cell 74, 922–935.e1–e6, June 6, 2019 DATA AND SOFTWARE AVAILABILITY

The atomic coordinates and structure factors generated in this study have been deposited in the Protein Data Bank with the acces- sion code 6AC0 for GlcNAcylated TRADD-DD, 6AC5 for GlcNAcylated RIPK1-DD, 6E66 for apo-NleB, and 6ACI for the NleB/FADD- DD complex. The original data for in vitro 3H-UDP-GlcNAc labeling assay and the co-immunoprecipitation assay have been published on Mendeley (https://data.mendeley.com/datasets/rmcf2b6x6g/edit).

Molecular Cell 74, 922–935.e1–e6, June 6, 2019 e6