US 20210002656A1 INI ( 19 ) United States ( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2021/0002656 A1 Voytas et al . ( 43 ) Pub . Date : Jan. 7 , 2021

( 54 ) METHODS FOR NON - TRANSGENIC ( 60 ) Provisional application No. 61 / 835,307 , filed on Jun . GENOME EDITING IN PLANTS 14 , 2013 .

( 71 ) Applicant: CELLECTIS , Paris ( FR ) Publication Classification ( 72 ) Inventors : Daniel F. Voytas, Falcon Heights, MN ( 51 ) Int . Ci . ( US ) ; Feng Zhang, Maple Grove , MN C12N 15/82 ( 2006.01 ) ( US ) ; Jin Li , Ankeny, IA ( US ) ; C12N 9/22 ( 2006.01 ) Thomas Stoddard , St. Louis Park , MN ( 52 ) U.S. Ci . ( US ) ; Song Luo , Chicago , IL (US ) CPC C12N 15/8206 ( 2013.01 ) ; C12N 9/22 ( 2013.01 ) ; C12N 15/8207 ( 2013.01 ) ; C12N ( 21 ) Appl. No .: 17 / 022,421 15/8213 ( 2013.01 ) ( 22 ) Filed : Sep. 16 , 2020 ( 57 ) ABSTRACT Related U.S. Application Data ( 63 ) Continuation of application No. 14 / 898,208 , filed on Materials and methods for creating genome -engineered Dec. 14 , 2015 , filed as application No. PCT / IB2014 / plants with non -transgenic methods are provided herein . 062223 on Jun . 13 , 2014 . Specification includes a Sequence Listing. Patent Application Publication Jan. 7 , 2021 Sheet 1 of 13 US 2021/0002656 A1

Nuclease domain

Sequence recognition domain 1Figure Sub-cellular localization domain CPPdomain Patent Application Publication Jan. 7 , 2021 Sheet 2 of 13 US 2021/0002656 A1

Vinv7(CT) N

1 ALS2T1R 2Figure ALS2TIL N Patent Application Publication Jan. 7 , 2021 Sheet 3 of 13 US 2021/0002656 A1

ALS1 ALS2T1on + 3Figure ALS2 Patent Application Publication Jan. 7 , 2021 Sheet 4 of 13 US 2021/0002656 A1

SSAefficiency(%)

0 0.49 4.4 2.7 87.7

Figure4 l-Scelactivityonepisomaltargetsinplantcells SSAconstruct,thenl-Scelprotein(sequential)

dH20andSSAconstruct 35S:l-ScelandSSAconstruct l-ScelproteinandSSAconstruct Treatment YFP35S: Patent Application Publication Jan. 7 , 2021 Sheet 5 of 13 US 2021/0002656 A1

NHEJmutagenesisfreq.

59.2%(9,222) 15.0%(19,261) 7.7%(14,921) 0%(11,130) 0%(9,264) 0%(14,362) 5Figure

I-Scel(protein)+TreXDNA Scell-(DNA)+TreX

TreX(DNA) 1-Scel(DNA) l-Scelprotein() Treatment H20 Patent Application Publication Jan. 7 , 2021 Sheet 6 of 13 US 2021/0002656 A1

SEQID 8 9 10 11 12 13 14 15 16 17 18 -gagcccaattcataaatt t -agggtaatacagattcgagcccaattcataaatt -tacagattcgagcccaattcataaatt cagattcgagcccaattcataaatt*** cagattcgagcccaattcataaatt } aacagggtaatacagattcgagcccaattcataaattGatcgcagatccccgggtacccgggagcctgcagtcgacgctaggg-- cagggtaatacagattcgagcccaattcataaattgatcgcagatccccgggtacccgggatcctgcagtcgacgctagggwww magggtaatacagattogagcccaattcataaattgatcgcagatccccgggtaccogggagcctgcagtcgacgctaggg-- -acagggtaatacagattcgagcccaattcataaattgatcgcagatccccgggtacccgggatcctgcagtcgacgct-- gatcgcagatccccgggtacccgggatcctgcagtcgacgct--- gatcgcagatccccgggtacccgggatcctgcagtcgacgc. 6Figure

- gatcgcagatccccgggtacccgggat.cctgcagtcgacgctagggataacagggtaatacagattcgagcccaattcataaatt gatcgcagatccccgggtacccgggatcctgcagtcgacg gatcgcag gatcg---- gatcgcaga Patent Application Publication Jan. 7 , 2021 Sheet 7 of 13 US 2021/0002656 A1

YFP ; 35S DNA + TreX protein + YFP ; 35S DNA + 10ulALS2T1 protein 2

Trex protein + Trex DNA * 20ulALS2T1 protein

Trex protein + Trex ONA * -- ALS2T12u1 protein 7Figure co

Trex protein * 6 %48 Trex DNA of ALS2T115ug DNA 4 %18 w 2 Control 1 Patent Application Publication Jan. 7 , 2021 Sheet 8 of 13 US 2021/0002656 A1 SEQID 19 21 25 28 30--tgggtcagattggaactcct 31 20attaatttctaatggagtagtttagtgtaataaagttagottgttccacatttttattt--waagctatgtcatgctgggtcagattggaactcct 22attaatttctaatggagtagtttagtgtaataaagttagettgttccacattttt-----aaaagctatgtcatgctgggtcagattggaactcct: attaatttctaatggagtagtttagtgtaataaagttagcttgttccacatttttattt------?tatgtcatgctgggtcagattggaactcct23 attaatttctaatggagtagtttagtgtaataaagttagettgttccacattttt-----tatgtcatgctgggtcagattggaactcct27 atgctgggtcagattggaactcct--- 29ctatgtcatgctgggtcagattggaactcct--- tttcataagctatgtcatgctgggtcagattggaactcct attaatttctaatggagtagtttagtgtaataaagttagettgttccacatttttatttt----gctatgtcatgctgggtcagattggaactcct attaatttctaatggagtagtttagt.gtaataaagttagettgttccacatttttatwww.ctatgtcatgctgggtcagattggaactcct---24 attaatttctaatggagtagtttagtgtaataaagttagettgttccacatttttatt------tatgtcatgctgggtcagattggaactcct ataagctatgtcatgctgggtcagattggaactcct26attaatttctaatggagtagtttagtgtaataaagttagottgttccacat--- 8Figure attaatttctaatggagtagtttagtgtaataaagttagettgttccacatttttatttcataagctatgtcatgctgggtcagattggaactcct attaatttctaatggagtagtttagtgtaataaagttagettgttocacatttttatt attaatttctaatggagtagtttagtgtaataaagttagettgttcca----- attaatttctaatggagtagtttagtgtaataaagttagettgttccacatttttat: Patent Application Publication Jan. 7 , 2021 Sheet 9 of 13 US 2021/0002656 A1

121bppolya

Nucleaseopen frame reading 9Figure

T7Promoter Patent Application Publication Jan. 7 , 2021 Sheet 10 of 13 US 2021/0002656 A1

10 10Figure

Sij?b ?A !!sod din % Patent Application Publication Jan. 7 , 2021 Sheet 11 of 13 US 2021/0002656 A1

32)SEQIDNO:(

11Figure

Xyl_T04 ATGAACAAGAAAAAGCTGAAAATTCTTGTTTCTCTCTTCGCTCTCAACTCAATCACTCTCTATCTCTACTTCTCTTCCCACCCTGATCAC Patent Application Publication Jan. 7 , 2021 Sheet 12 of 13 US 2021/0002656 A1

NHEJmutagenesisfreq. control**negativewith 0.11% 0.15% 0.11% 0.15%

NHEJmutagenesisfreq. withTALEN* 54.91%(2300) 44.23%(728) 31.23%(2571) 22.93%(663) 12Figure

Locationoftargetsite XylT1 XylT2 XyIT1 XylT2

DeliveredTALEN DNAXylT_T04 mRNAXylTT04 Patent Application Publication Jan. 7 , 2021 Sheet 13 of 13 US 2021/0002656 A1

2bp 5op 6bp 8bp DeletionSize Wild-Type 12bp 15bp 16bp 23bp 28bp 32bp Wild-Type 4bp 5bp 6bp 7bp 8bp 11bp 12bp 17bp 26bp 29bp DeletionSizeSEQ SEQ 33 35 36 37 38 39 40 42 43 44 45 46 47 48 49 50 51 52 53 54 ---tctcttcccaccctg ---ctcttcccaccctg ---tctacttctcttcocaccctg ctctacttctcttcccaccctg--- -tctctacttctcttcccaccctg --tacttctcttcccaccctgm --tctacttctcttcccaccctg 13Figure Xylosyltransferase1 --tctatctctacttctcttcccaccctg Xylosyltransferase2 -ctctctatctctacttctcttcccaccctg tctctatctctacttctcttcccaccctgnmawa -ctctatctctacttctcttcccaccctg ctctatct.ctacttctctt.cccaccctggtttctctcttcgctctcaactcaatca-- tatctctacttctcttcccaccctggtttctctcttcgctctcaactcaatca----- gtttctctcttcgctctcaactcaa--tctatctctacttctcttcccaccctg actctctatctctacttctcttcccaccctg.gtttctctcttcgctctca--nevemnomewasinan gtttctctcttcgctctcaactcaatca--- tctctatctctacttctcttcccaccctggtttctctcttcgctctcaactcaa--* ctatct.ctacttctcttcccaccctggtttctctcttcgctctcaactcaatc----- tctatctctacttctcttcccaccctggtttctctcttcgctctcaactcaa------gtttctctcttcgctctcaactcaatcm-atctctacttctcttcccaccctg actctctatctctacttctcttcccaccctg.gtttctctcttcgctctca-menneconmascomm gtttctctcttcgctct.caactcaa------11 ---gtttctctctt 1 gtt. .gtt gtttcTCTCTTCGCTCTCAACTcaatcactctctatCTCTACTTCTCTTCCCAccctg gtttctctcttcgctctcaactcaatca gtttctctcttcg- gtt gtttctctcttcgctctcaactcaatcactctctatctctacttctcttoccaccctg gtttctctcttcgctctcaactcaatca gtttctctcttcgctctcaactcaa- g US 2021/0002656 A1 Jan. 7 , 2021 1

METHODS FOR NON - TRANSGENIC SUMMARY GENOME EDITING IN PLANTS [ 0005 ] The above -mentioned advances in plant genetic engineering do not necessarily allay public fears concerning CROSS - REFERENCE TO RELATED the production and widespread growth of engineered plant APPLICATIONS species . A solution to this problem would therefore be a [ 0001 ] This application is a continuation of U.S. applica method which can precisely alter the genome of a plant in a tion Ser. No. 14 / 898,208 , filed Dec. 14 , 2015 , which is a targeted way without the use of traditional transgenic strat National Stage Application under 35 U.S.C. § 371 of PCT egies . The disclosure herein provides such a solution by Application No. PCT / IB2014 / 062223 , filed Jun . 13 , 2014 , providing methods for targeted , non -transgenic editing of a which claims benefit of priority from U.S. Provisional plant genome . The methods more particularly rely on the Application Ser. No. 61 / 835,307 , filed on Jun . 14 , 2013 . introduction into a plant cell of sequence - specific nucleases under protein or mRNA forms, which are translocated to the nucleus and which act to precisely cut the DNA at a TECHNICAL FIELD predetermined locus . Errors made during the repair of the [ 0002 ] This document relates to the field of plant molecu cut permit the introduction of loss of function ( or gain of lar biology , and in particular provides materials and methods function ) mutations without the introduction into the for creating genome - engineered plants with non - transgenic genome of any exogenous genetic material. methods . [ 0006 ] In this way, genetically modified plant species can be produced that contain no residual exogenous genetic BACKGROUND material. [ 0007 ] Prior to development of the methods described [ 0003 ] Traditional plant breeding strategies have been herein , genetic modification of plant cells required the stable developed over many years to introduce desirable traits into genomic integration of a transgene cassette for the expres plant species such as increased drought tolerance and crop sion in vivo of a nuclease or a DNA modifying enzyme. yield . Such strategies have the drawback that they typically Such integration was typically achieved through Agrobac require many successive rounds of crossing, and thus it can terium -mediated transformation of plant species . As take many years to successfully alter a specific plant trait. described herein , however, consistent and reproducible With the advent of transgenic technologies it became pos genomic modification can be achieved through the introduc sible to engineer plants with genomic alterations by intro tion into a plant cell of either purified nuclease protein or ducing transgene constructs and thus circumvent the need mRNA encoding for such nuclease . This is an unexpected for traditional plant breeding. However, these transgenic effect, because recombinant nucleases or purified mRNA techniques also had several drawbacks. First , transgene were not considered to be sufficiently active to have a insertion into the genome ( such as that mediated by Agro significant effect on plant chromosomal or organelle DNA . bacterium tumefaciens) is largely random and can lead to Further, this document provides new protocols for genomic multiple insertions which can cause difficulties in tracking modification , and also provides sequences and vectors suit multiple transgenes present on different chromosomes dur able to practice the methods described herein , and to pro ing segregation . Further, expression of the transgene can be duce modified plant cells without introducing exogenous unpredictable due to its chromosomal environment, and in DNA . many cases expression of the transgene is silenced . In [ 0008 ] This document describes methods for editing plant addition , production of transgenic plants has proven to be a genomes using non - transgenic strategies. Sequence - specific very controversial topic , with public opinion often being nucleases ( including ZFNs , homing endonucleases, TAL against the creation of such varieties — particularly where the effector nucleases, CRISPR - associated systems [ Cas9 ] ) are varieties in question are crop plants that will be grown over introduced into plant cells in the form of purified nuclease large geographical areas and used as food for human con protein or as mRNA encoding the nuclease protein . In the sumption. case of CRISPR - associated systems [ Cas9 ] , the nuclease can [ 0004 ] Methods that allow for targeted modification of the be introduced either as mRNA or purified protein along with plant genome may overcome the first two of these problems, a guide RNA for target site recognition . making it possible to target transgene insertions to single [ 0009 ] The functional nucleases are targeted to specific chromosomal sites that are conducive to gene expression , sequences, and cut the cellular DNA at predetermined loci . thus reducing or eliminating the possibility of multiple The DNA damage triggers the plant cell to repair the double transgene insertions and silencing events . Targeted genome strand break . Mistakes ( e.g. , point mutations or small inser modification has been demonstrated in a number of species tions /deletions ) made during DNA repair then alter DNA using engineered Zinc Finger Nucleases ( ZFNs ) , which sequences in vivo . permit the creation of double stranded DNA break points at [ 0010 ] Unlike conventional DNA transformation , the pro preselected loci and the subsequent insertion of transgenes tein or RNA -based genome editing strategies described in a targeted manner ( Lloyd et al . 2005 ; Wright et al . 2005 ; herein specifically modify target nucleic acid sequences and Townsend et al . 2009 ) . A variation on this technique is to leave no footprint behind . Since no foreign DNA is used in simply use the ZFN to create a break point at a chosen locus these methods, this process is considered to be non - trans and then allow repair of the DNA by NHEJ ( non - homolo genic plant genome editing . gous end joining ) . During this process , errors are often [ 0011 ] In one aspect , this document features a method for incorporated into the newly joined region ( e.g. , nucleotide targeted genetic modification of a plant genome without deletions ) and this method allows for the targeted mutagen inserting exogenous genetic material. The method can esis of selected plant genes as well as for the insertion of include ( i ) providing a plant cell that contains an endog transgene constructs . enous gene to be modified, ( ii ) obtaining a sequence - specific US 2021/0002656 A1 Jan. 7 , 2021 2 nuclease containing a sequence recognition domain and a ents, and other references mentioned herein are incorporated nuclease domain ; ( iii ) transfecting the plant cell with the by reference in their entirety. In case of conflict, the present sequence - specific nuclease, and ( iv ) inducing one or more specification , including definitions, will control . In addition , double stranded DNA breaks ( DSB ) in the genome, to the materials, methods, and examples are illustrative only produce a plant cell or cells having a detectable targeted and not intended to be limiting . genomic modification without the presence of any exog [ 0022 ] The details of one or more embodiments of the enous genetic material in the plant genome. The DSB can be invention are set forth in the accompanying drawings and repaired by non -homologous end joining ( NHEJ ) . the description below . Other features, objects , and advan [ 0012 ] The sequence - specific nuclease can be a TAL effec tages of the invention will be apparent from the description tor -nuclease , a homing endonuclease , a zinc finger nuclease and drawings, and from the claims . ( ZFN ) , or a CRISPR - Cas9 endonuclease . The sequence specific nuclease can be delivered to the plant cell in the BRIEF DESCRIPTION OF THE DRAWINGS form of a purified protein , or in the form of purified RNA [ 0023 ] FIG . 1 is a diagram depicting a structural organi ( e.g. , an mRNA ). zation of the sequence - specific nucleases used for genome [ 0013 ] The sequence - specific nuclease can further contain engineering . The nucleases contain domains that function to one or more subcellular localization domains . The one or enable cell penetration , sub - cellular protein localization , more subcellular localization domains can include an SV40 DNA sequence recognition , and DNA cleavage . nuclear localization signal , an acidic M9 domain of [ 0024 ] FIG . 2 is a picture showing SDS- PAGE of tran hnRNPA1, a PY -NLS motif signal , a mitochondrial targeting scription activator - like effector endonucleases ( TALENTM ) signal, or a chloroplast targeting signal . The sequence produced in E. coli . ALS2T1L and ALS2T1R are TAL specific nuclease can further contain one or more cell ENTMs that target a site in the Nicotiana benthamiana ALS2 penetrating peptide domains ( CPPs ) . The one or more CPPs gene . VInv7 is a compact TALENTM ( CT ) that targets the can include a transactivating transcriptional activator ( Tat) potato VInv gene . peptide or a Pep - 1 CPP domain . [ 0025 ] FIG . 3 is a picture of an agarose gel showing in [ 0014 ] The sequence - specific nuclease can be co - trans vitro activity of purified TALENTMs targeting the N. ben fected with one or more plasmids encoding one or more thamiana ALS2 gene . A PCR product was generated that exonucleases . The one or more exonucleases can include a contains the target site for the ALS2T1 TALENTMs. The member of the TREX exonuclease family ( e.g. , TREX2 ) . PCR product was incubated without ( - ) or with ( + ) the [ 0015 ] The endogenous gene to be modified can be an purified ALS2T1L and ALS2T1R proteins. Only in the acetolactate synthase gene ( e.g. , ALS1 or ALS2 ) , or a presence of the two proteins was the PCR product cleaved . vacuolar invertase gene ( e.g. , the potato ( Solanum tubero As a negative control, the purified ALS2T1L and ALS2TIR sum ) vacuolar invertase gene ( VInv ). proteins were incubated with a PCR product from the ALSI [ 0016 ] The plant cell can be from a field crop species of gene ; no cleavage was observed . alfalfa , barley, bean , corn , cotton , flax , pea , rape, rice , rye , [ 0026 ] FIG . 4 is a table showing the activity of I - Scel on safflower, sorghum , soybean , sunflower, tobacco , wheat. episomal targets when delivered to plant cells as a protein . The plant cell can be from the genus Nicotiana, or from the [ 0027 ] FIG . 5 is a table showing activity of I - Scel activity species Arabidopsis thaliana. on a chromosomal site when delivered to plant cells as a [ 0017 ] Transfection can be effected through delivery of protein alone or in combination with TreX . The number in the sequence - specific nuclease into isolated plant proto the total number of 454 sequencing reads used for this plasts . For example, transfection can be effected delivery of analysis is indicated in parentheses in column 2 . the sequence - specific nuclease into isolated plant protoplasts [ 0028 ] FIG . 6 is a sequence alignment showing examples using polyethylene glycol ( PEG ) mediated transfection , of I - Scel - induced mutations in a transgenic N. tabacum line electroporation, biolistic mediated transfection , sonication that contains an integrated I - Scel recognition site . The top mediated transfection , or liposome mediated transfection . line ( SEQ ID NO : 8 ) indicates the DNA sequence of the [ 0018 ] Induction of one or more double stranded DNA recognition site for I - Scel ( underlined ). The other sequences breaks in the genome can be followed by repair of the break ( SEQ ID NOS : 9 to 18 ) show representative mutations that or breaks through a homologous recombination mechanism . were induced by imprecise non - homologous end - joining [ 0019 ] This document also features a transformed plant ( NHEJ ). cell obtainable according to the methods provided herein , as [ 0029 ] FIG . 7 is a graph summarizing TALENTM ALS2T1 well as a transformed plant containing the plant cell . mutagenesis activity after transformation into plant cells in [ 0020 ] In another aspect , this document features a kit for different forms ( DNA or protein ) or treatment combinations . targeted genetic modification of a plant genome without [ 0030 ] FIG . 8 is a sequence alignment showing examples inserting exogenous genetic material . The kit can include ( i ) of TALENTM ALS2T1 induced mutations in the N. bentha one or more sequence - specific nucleases in protein or miana ALS2 gene . The top line ( SEQ ID NO : 19 ) shows the mRNA format , ( ii ) one or more plant protoplasts or whole DNA sequence of the recognition site for ALS2T1 (under cultured plant cells , and optionally ( iii ) one or more DNA lined ). The other sequences ( SEQ ID NOS : 20 to 31 ) show plasmid vectors encoding one or more exonucleases . representative mutations that were induced by imprecise [ 0021 ] Unless otherwise defined , all technical and scien non - homologous end - joining (NHEJ ). tific terms used herein have the same meaning as commonly [ 0031 ] FIG . 9 is a diagram showing the structural organi understood by one of ordinary skill in the art to which this zation of a sequence - specific nuclease as used for in vitro invention pertains. Although methods and materials similar mRNA production. The nuclease construct contains a 17 or equivalent to those described herein can be used to promoter, a nuclease ORF , and a 121 - bp polyA tail . practice the invention , suitable methods and materials are [ 0032 ] FIG . 10 is a graph plotting the cleavage activity of described below . All publications, patent applications, pat 1 - Crel mRNA delivered to plant protoplasts in a YFP - based US 2021/0002656 A1 Jan. 7 , 2021 3

SSA assay . A SSA target plasmid together with p35S - 1 -Crel Trex2 ( SEQ ID NO : 6 ) has shown to be particularly effective or I -Crel mRNA was co - delivered to tobacco protoplasts via by increasing mutagenesis as described herein . Using Trex2 PEG - mediated transformation . Twenty four hours after expressed as a single polypeptide chain ( SEQ ID NO : 7 ) was transformation , the protoplasts were subjected to flow even more effective. cytometry to quantify the number of YFP - positive cells . [ 0046 ] Purified nucleases are delivered to plant cells by a [ 0033 ] FIG . 11 is the target sequence ( SEQ ID NO : 32 ) for variety of means . For example, biolistic particle delivery the Xy1T_T04 TALENTM in N. benthamiana . systems may be used to transform plant tissue . Standard [ 0034 ] FIG . 12 is a table recapitulating the 454 pyro PEG and / or electroporation methods can be used for proto sequencing data for delivery of Xyl_T04 TALENTM mRNA plast transformation . After transformation , plant tissue / cells to tobacco protoplasts . The numbers in parenthesis in col are cultured to enable cell division , differentiation and umn 3 are the total number of sequencing reads obtained * : regeneration . DNA from individual events can be isolated NHEJ mutagenesis frequency was obtained by normalizing and screened for mutation . the percentage of 454 reads with NHEJ mutations to the [0047 ] In some embodiments , the sequence - specific protoplast transformation efficiency. The total number of nuclease is a TAL - effector nuclease (Beurdeley et al . , 2013 ) . 454 sequencing reads used for this analysis is indicated in It is also envisaged that any type of sequence - specific parentheses. ** : Negative controls were obtained from pro nuclease may be used to perform the methods provided toplasts transformed only by the YFP - coding plasmid . herein as long as it has similar capabilities to TAL - effector [ 0035 ] FIG . 13 is a sequence alignment showing examples nucleases. Therefore, it must be capable of inducing a of mutations induced by XylT_T04 mRNA in N. benthami double stranded DNA break at one or more targeted genetic ana at the XylT1 ( SEQ ID NOS : 33 to 43 ) and XylT2 ( SEQ loci , resulting in one or more targeted mutations at that locus ID NOS : 44 to 54 ) genes . or loci where mutation occurs through erroneous repair of the break by NHEJ or other mechanism ( Certo et al . , 2012 ) . DETAILED DESCRIPTION Such sequence - specific nucleases include , but are not lim [ 0036 ] This document provides new strategies for editing ited to , ZFNs , homing endonucleases such as I - Scel and plant genomes to generate non - transgenic plant material. 1 - Crel, restriction endonucleases and other homing endonu The methods provided herein are carried out using a nucle cleases or TALENTMs. In a specific embodiment, the endo ase designed to recognize specific sequences in any site of nuclease to be used comprises a CRISPR - associated Cas the plant genome . protein , such as Cas9 (Gasiunas et al . , 2012 ) . [ 0037 ] In one aspect , this document relates to a method for [ 0048 ] The sequence - specific nuclease to be delivered targeted genetic modification of a plant genome without may be either in the form of purified nuclease protein , or in inserting exogenous genetic material comprising one or the form of mRNA molecules which can are translated into several of the following steps : protein after transfection . Nuclease proteins may be pre [ 0038 ] i ) providing a plant cell which comprises an endog pared by a number of means known to one skilled in the art, enous gene to be modified ; using available protein expression vectors such as , but not [ 0039 ] ii ) obtaining a sequence - specific nuclease compris limited to , pQE or pET . Suitable vectors permit the expres ing a sequence recognition domain and a nuclease domain ; sion of nuclease protein in a variety of cell types ( E. coli , [ 0040 ] iii ) transformation of the plant cell with said insect, mammalian ) and subsequent purification . Synthesis sequence - specific nuclease, and of nucleases in mRNA format may also be carried out by [ 0041 ] iv ) induction of one or more double stranded DNA various means known to one skilled in the art such as breaks in the genome; through the use of the T7 vector ( pSF - T7 ) which allows the [ 0042 ] This method aims at producing a plant cell or cells production of capped RNA for transfection into cells . having a detectable targeted genomic modification , prefer [ 0049 ] In some embodiments , the mRNA is modified with ably without the presence of any exogenous genetic material optimal 5 ' untranslated regions (UTR ) and 3 ' untranslated in the plant genome. regions. UTRs have been shown to play a pivotal role in [ 0043 ] Induction of double stranded breaks in the genome post -translational regulation of gene expression via modu generally leads to repair of the breaks by non homologous lation of localization , stability and translation efficiency end joining (NHEJ ) , which favours deletion , correction or (Bashirullah , 2001 ) . As noted above , mRNA delivery is insertion of genetic sequences into the genome of the plant desirable due to its non - transgenic nature ; however, mRNA cell obtained by the method . is a very fragile molecule , which is susceptible to degrada [ 0044 ] After the coding sequence for the nuclease has tion during the plant transformation process. Utilization of been synthesized and cloned into an expression vector, UTRs in plant mRNA transformations allow for increased nuclease protein or mRNA is produced and purified . To stability and localization of mRNA molecules , granting improve efficacy , cell penetrating peptides ( CPP ) can be increased transformation efficiency for non -transgenic added to improve cell membrane permeability for small genome modification. molecules ( drugs ), proteins and nucleic acids ( Mae and [ 0050 ] In some embodiments, the engineered nuclease Langel, 2006 ; US 2012/0135021 , US 2011/0177557 , U.S. includes one or more subcellular localization domains, to Pat . No. 7,262,267 ) . Sub - cellular localization peptides can allow the efficient trafficking of the nuclease protein within also be added to direct protein traffic in cells , particularly to the cell and in particular to the nucleus ( Gaj. et al . , 2012 ; US the nucleus ( Gaj et al . 2012 ; US 20050042603 ) . 2005/0042603 ) . Such a localization signal may include , but [ 0045 ] In some embodiments, a protein with exonuclease is not limited to , the SV40 nuclear localization signal ( Hicks activity, such as , for example , Trex ( WO 2012/058458 ) et al . , 1993 ) . Other, non - classical types of nuclear localiza and / or Tdt ( Terminal deoxynucleotidyl transferase ) ( WO tion signal may also be adapted for use with the methods 2012/13717 ) , is co - delivered to the plant cell for increasing provided herein , such as the acidic M9 domain of hnRNPA1 sequence - specific nuclease induced mutagenesis efficiency. or the PY - NLS motif signal (Dormann et al . , 2012 ) . Local US 2021/0002656 A1 Jan. 7 , 2021 4 ization signals also may be incorporated to permit trafficking [ 0056 ] Alternatively, liposome or spheroplast fusion may of the nuclease to other subcellular compartments such as be used to introduce exogenous material into plants ( see , the mitochondria or chloroplasts. Guidance on the particular e.g. , Christou et al . , 1987 ) . Electroporation of protoplasts mitochondrial and chloroplastic signals to use may be found and whole cells and tissues has also been described ( Laursen in numerous publications ( see , Bhushan S. et al . , 2006 ) and et al . , 1994 ) . techniques for modifying proteins such as nucleases to [ 0057 ] Depending on the method used for transfection and include these signals are known to those skilled in the art. its efficiency, the inventors determined that the optimal [ 0051 ] In some embodiments, the nuclease includes a protein concentration for performing the methods described cell- penetrating peptide region ( CPP ) to allow easier deliv herein , especially with TALENTMs, was between 0.01 to 0.1 ery of proteins through cell membranes ( Mae and Langel, ug / ul. When using PEG , the volume of the protein suspen 2006 ; US 2012/0135021 , US 2011/0177557 , U.S. Pat . No. sion was generally between 2 to 20 ul. RNA concentration 7,262,267 ) . Such CPP regions include, but are not limited to , was found optimal in the range of 1 to 5 ug / ul, it being the transactivating transcriptional activator ( Tat ) cell pen considered that it can be sometimes advantageous to add non etration peptide ( Lakshmanan et al . , 2013 , Frankel et al . , coding RNA , such as tRNA carrier, up to 10 ug / ul , in order 1988 ) . It is envisaged that other CPP's also may be used , to increase RNA bulk . This later adjunction of RNA including the Pep -1 CPP region, which is particularly suit improves transfection and has a protective effect on the RNA able for assisting in delivery of proteins to plant cells ( see, encoding the nuclease with respect to degradative enzymes Chugh et al . , 2009 ) . encountered in the plant cell . [ 0052 ] In some embodiments, one or more mutations are [ 0058 ] A plant can be obtained by regenerating the plant generated in the coding sequence of one of the acetolactate cell produced by any of the method described herein . When synthase ( ALS ) genes ALS1 or ALS2 , or one or more the function of the endogenous gene is suppressed in the mutations are generated in the vacuolar invertase (VInv ) plant cell into which the non - silent mutation is introduced at gene . In a further aspect of these embodiments, the mutation the target DNA site , the phenotype of the plant regenerated may be any transition or transversion which produces a from such a plant cell may be changed in association with non - functional or functionally - reduced coding sequence at a the suppression of the function of the endogenous gene . predetermined locus . It is generally envisaged that one or Accordingly, the methods described herein make it possible more mutations may be generated at any specific genomic to efficiently perform breeding of a plant. The regeneration locus using the methods described herein . of a plant from the plant cell can be carried out by a method [ 0053 ] In some embodiments, the plant species used in the known to those skilled in the art which depends on the kind methods provided herein is N. benthamiana , although in a of the plant cell . Examples thereof include the method further aspect the plant species may be any monocot or dicot described in Christou et al . ( 1997 ) for transformation of rice plant, such as (without limitation ) Arabidopsis thaliana ; species . field crops ( e.g. , alfalfa , barley, bean , corn , cotton , flax, pea , [ 0059 ] In some embodiments , the nuclease can be co rape, rice , rye , safflower, sorghum , soybean , sunflower, delivered with a plasmid encoding one or more exonuclease tobacco , and wheat ) ; vegetable crops ( e.g. , asparagus, beet , proteins to increase sequence - specific nuclease induced broccoli, cabbage , carrot, cauliflower, celery, cucumber, mutagenesis efficiency. Such exonucleases include, but are eggplant, lettuce , onion , pepper, potato , pumpkin , radish , not limited to , members of the Trex family of exonucleases spinach , squash , taro , tomato , and zucchini ); fruit and nut ( Therapeutic red cell exchange exonucleases ) such as crops ( e.g. , almond , apple , apricot, banana , blackberry, TREX2 ( Shevelev et al . 2002 ) . The inventors have surpris blueberry, cacao , cherry , coconut, cranberry, date , fajoa , ingly found that co -delivery of an exonuclease such as filbert, grape , grapefruit, guava , kiwi , lemon , lime , mango , TREX with purified I - Scel protein increases the frequency melon , nectarine , orange, papaya , passion fruit, peach , pea of NHEJ events observed as compared with delivery of the nut , pear, pineapple, pistachio , plum , raspberry , strawberry, I - Scel protein alone . It is to be noted that other suitable tangerine, walnut, and watermelon ); and ornamentals ( e.g. , exonucleases may also be used in the methods provided alder, ash , aspen , azalea , birch , boxwood , camellia , carna herein . tion , chrysanthemum , elm , fir, ivy, jasmine , juniper, oak , [ 0060 ] As used herein the term “ identity ” refers to palm , poplar, pine, redwood, rhododendron , rose , and rub sequence identity between two nucleic acid molecules or ber ). polypeptides. Identity is determined by comparing a position [ 0054 ] In some embodiments , the protein or mRNA in each sequence which may be aligned for purposes of encoding the nuclease construct is delivered to the plant comparison . When a position in the compared sequence is cells via PEG - mediated transformation of isolated proto occupied by the same base , then the molecules are identical plasts . PEG typically is used in the range from half to an at that position . A degree of similarity or identity between equal volume of the mRNA or protein suspension to be nucleic acid or amino acid sequences is a function of the transfected , PEG40 % being mostly used in this purpose. number of identical or matching nucleotides at positions [ 0055 ] In some cases , the nuclease may be delivered via shared by the nucleic acid sequences. Alignment algorithms through biolistic transformation methods or through any and programs are used to calculate the identity between two other suitable transfection method known in the art ( Yoo et sequences . FASTA and BLAST are available as a part of the al , 2007 ) . In the case of biolistic transformation, the nuclease GCG sequence analysis package (University of Wisconsin , can be introduced into plant tissues with a biolistic device Madison , Wis .) , and are used with default setting. BLASTP that accelerates the microprojectiles to speeds of 300 to 600 may also be used to identify an amino acid sequence having m / s which is sufficient to penetrate plant cell walls and at least 80 % , 85 % , 87.5 % , 90 % , 92.5 % , 95 % , 97.5 % , 98 % , membranes ( see , Klein et al . , 1992 ) . Another method for or 99 % sequence similarity to a reference amino acid introducing protein or RNA to plants is via the sonication of sequence using a similarity matrix such as BLOSUM45 , target cells . BLOSUM62 or BLOSUM80 . Unless otherwise indicated , a US 2021/0002656 A1 Jan. 7 , 2021 5 similarity score is based on use of BLOSUM62 . When proteins of Xanthomonas to a catalytic domain of a nuclease , BLASTP is used , the percent similarity is based on the as described by Voytas and Bogdanove in WO 2011/072246 . BLASTP positives score and the percent sequence identity TAL -effector endonucleases are named TALENTM by the is based on the BLASTP identities score . BLASTP “ Iden applicant ( Cellectis , 8 rue de la Croix Jarry , 75013 PARIS ). tities ” shows the number and fraction of total residues in the [ 0069 ] The invention will be further described in the high scoring sequence pairs which are identical; and following examples, which do not limit the scope of the BLASTP " Positives ” shows the number and fraction of invention described in the claims . residues for which the alignment scores have positive values and which are similar to each other. Amino acid sequences EXAMPLES having these degrees of identity or similarity or any inter mediate degree of identity of similarity to the amino acid Example 1 : Designing and Constructing sequences disclosed herein are contemplated and encom Sequence -Specific Nucleases for Protein Expression passed by this disclosure . The same applies with respect to polynucleotide sequences using BLASTN . [ 0070 ] A sequence - specific nuclease typically includes the [ 0061 ] As used herein the term “ homologous ” is intended following components ( FIG . 1 ) : to mean a sequence with enough identity to another one to [ 0071 ] 1. A DNA binding domain that recognizes a spe lead to a homologous recombination between sequences, cific DNA sequence in a plant genome . more particularly having at least 95 % identity ( e.g. , at least [ 0072 ] 2. A nuclease domain that creates a DNA double 97 % identity, or at least 99 % identity ). strand break at the recognition site in the plant genome. [ 0062 ] As used herein the term “ endonuclease ” refers to Imprecise repair of the break through non -homologous an enzyme capable of causing a double - stranded break in a end - joining introduces mutations at the break site . DNA molecule at highly specific locations . [ 0073 ] 3. A sub - cellular localization signal that directs the [ 0063 ] As defined herein the term “ exonuclease” refers to nuclease to the nucleus, mitochondria or chloroplast . an enzyme that works by cleaving nucleotides one at a time [ 0074 ] 4. A cell penetration motif that helps the sequence from the end ( exo ) of a polynucleotide chain causing a specific nuclease penetrate cell membranes during transfor hydrolyzing reaction that breaks phosphodiester bonds at mation . either the 3 ' or the 5 ' to occur. [ 0064 ] As used herein the term “ sequence - specific nucle [ 0075 ] Sequences encoding the custom nuclease may be ase ” refers to any nuclease enzyme which is able to induce synthesized and cloned into a protein expression vector, a double - strand DNA break at a desired and predetermined such as pQE or pET . Functional protein can therefore be genomic locus expressed in E. coli and purified using standard protocols or [ 0065 ] As used herein the term “ meganuclease ” refers to commercial kits . Alternatively, other protein expression sys natural or engineered rare - cutting endonuclease, typically tems , including yeast , insect or mammalian cells , can be having a polynucleotide recognition site of about 12-40 bp used to produce proteins that are difficult to express and in length , more preferably of 14-40 bp . Typical meganucle purify in E. coli. ases cause cleavage inside their recognition site , leaving 4 nt [ 0076 ] Here , PQE - 8OL - Kan was used as the protein staggered cut with 3'OH overhangs. The meganuclease are expression vector. An SV40 nuclear localization signal was preferably homing endonuclease, more particularly belong added as well as the Tat cell penetration peptide ( Frankel and ing to the dodecapeptide family (LAGLIDADG ; SEQ ID Pabo , 1988 , Schwarze et al . , 1999 ) . Sequence specific nucle NO : 55 ) ( WO 2004/067736 ) , TAL - effector like endonu ases included a TALENTM pair targeting a site in the N. clease , zinc - finger -nuclease , or any nuclease fused to modu benthamiana ALS2 gene . In addition , a compact TALENTM lar base - per - base binding domains (MBBBD ) —i.e ., endo was also used that targets a site in the VInv7 gene in S. nucleases able to bind a predetermined nucleic acid target tuberosum . E. coli strain BL21 was used for protein expres sequence and to induce cleavage in sequence adjacent sion ( Beurdeley et al . , 2013 ) . A Qiagen Ni- NTA Spin kit was thereto . These meganucleases are useful for inducing used for protein purification . A high yield of recombinant double - stranded breaks in specific DNA sequences and protein was obtained for all three TALENTM in E. coli ( FIG . thereby promote site -specific homologous recombination 2 ) . The plasmids for producing the recombinant TALENTM and targeted manipulation of genomic sequences. were provided by Cellectis Bioresearch ( 8 , rue de la Croix [ 0066 ] As used herein the term “ vector ” refers to a nucleic Jarry, 75013 PARIS ). acid molecule capable of transporting another nucleic acid to which it has been linked into a cell , or a cell compartment. Example 2 : In Vitro Sequence - Specific Nuclease [ 0067 ] As used herein the term “ zinc finger nuclease ” Activity of Purified TALENTM refers to artificial restriction enzymes generated by fusing a [ 0077 ] To test the enzyme activity of purified TALENTM , zinc finger DNA - binding domain to a DNA - cleavage equal amounts of ALS2TIL ( SEQ ID NO : 2 ) and ALS2TIR domain . Briefly , ZFNs are synthetic proteins comprising an ( SEQ ID NO : 3 ) proteins were mixed and incubated with a engineered zinc finger DNA - binding domain fused to the PCR fragment derived from the N. benthamiana ALS2 gene cleavage domain of the Foki restriction endonuclease . ZFNs ( the PCR product has the TALEN recognition site ) . The may be used to induce double - stranded breaks in specific reaction was carried out at 25 ° C. and had the following DNA sequences and thereby promote site -specific homolo buffer system : 100 mM NaCl , 50 mM Tris -HCl , 10 mM gous recombination and targeted manipulation of genomic MgCl2 , and 1 mM dithiothreitol, pH 7.9 . A PCR fragment sequences . derived from the N. benthamiana ALS1 gene ( lacking the [ 0068 ] As used herein the term “ TAL - effector endonu TALEN recognition site ) was used as a negative control. The clease ” refers to artificial restriction enzymes generated by two TALENs clearly cleaved the ALS2 gene fragment in fusing a DNA recognition domain deriving from TALE vitro ; no activity was observed with the ALS1 fragment US 2021/0002656 A1 Jan. 7 , 2021 6

( FIG . 3 ) . The data indicate that the purified TALENTM have Example 5 : Activity of I - Scel at their Endogenous sequence -specific nuclease activity. Target Sites in N tabacum [ 0082 ] A transgenic tobacco line contains a single 1 - Scel Example 3 : Delivery of Sequence -Specific recognition site in the genome as described previously Nucleases to Plant Cells as Proteins ( Pacher et al . , 2007 ) . Transformed protoplasts isolated from this transgenic line were harvested 24-48 hours after treat [ 0078 ] The enzyme I - Scel was purchased from New Eng ment, and genomic DNA was prepared . Using this genomic land Biolabs and dialyzed to remove the buffer supplied by DNA as a template , a 301 bp fragment encompassing the the manufacturer. Briefly, 20 ul ( 100 U ) of I - Scel was placed I - Scel recognition site was amplified by PCR . The PCR on a Millipore 0.025 um VSWP filter ( CAT # VSWP02500 ) . product was then subjected to 454 pyro - sequencing . The filter was floated on a MMG buffer ( 0.4 M mannitol, 4 Sequencing reads with insertion / deletion ( indel) mutations mM IVIES , 15 mM MgCl2 , pH 5.8 ) at 4 ° C. for 1 hour. After in the recognition site were considered as having been the enzyme solution was completely equilibrated by MMG derived from imprecise repair of a cleaved I - Scel recogni buffer, it was transferred to a new tube and kept on ice until tion site by NHEJ . Mutagenesis frequency was calculated as further use . The protein was delivered to plant cells by the number of sequencing reads with NHEJ mutations out of PEG - mediated protoplast transformation . Methods for the total sequencing reads. tobacco protoplast preparation were as previously described [ 0083 ] The activity of the I - Scel protein and its control ( Zhang et al . 2013 ) . Briefly, seeds from a transgenic tobacco treatments against the target sequence is summarized in FIG . line with an integrated I - Scel recognition site were planted 5. The delivery of I - Scel as DNA ( SEQ ID NO : 1 ) yielded a in moistened vermiculite and grown under low light condi 15 % mutagenesis frequency. When combined with DNA tions for 3-5 weeks ( Pacher et al . , 2007 ) . Young , fully encoding the exonuclease Trex2, the mutagenesis frequency expanded leaves were collected and surface sterilized , and increased to 59.2 % . When I - Scel was delivered as protein , protoplasts were isolated . the mutagenesis activity was undetectable; however, when [ 0079 ] Purified 1 - Scel protein was introduced into N. I - Scel protein was co -delivered with Trex2 -encoding DNA tabacum protoplasts by PEG - mediated transformation as ( SEQ ID NO : 6 ) , a 7.7 % mutagenesis frequency was described elsewhere ( Yoo et al . , Nature Protocols 2 : 1565 observed . Examples of I - Scel protein induced mutations are 1572 , 2007 ) . Briefly, 20-200 U of I - Seel protein was mixed shown in FIG . 6. Collectively, the data demonstrate that with 200,000 protoplasts at room temperature in 200 ul of I - Scel protein creates targeted chromosome breaks when 0.4 M mannitol, 4 mM IVIES , 15 mM MgCl2 , pH 5.8 . Other delivered to plant cells as protein . Further, the imprecise treatments included transforming protoplasts with DNA that repair of these breaks leads to the introduction of targeted encodes 1 - Scel ( SEQ ID NO : 1 ) , DNA that encodes the Trex2 protein , or both . Trex2 is an endonuclease that increases mutations. frequencies of imprecise DNA repair through NHEJ ( Certo Example 6 : Delivery of TALEN Proteins to Plant et al . 2012 ) . In addition , in one sample , I - Scel protein was Cells co - delivered with Trex2 - encoding DNA ( SEQ ID NO : 6 ) . After transformation , an equal volume of 40 % PEG - 4000 , [ 0084 ] Purified TALENTM protein was introduced into N. 0.2 M mannitol, 100 mM CaCl2 , pH5.8 was added to benthamiana protoplasts by PEG - mediated transformation protoplasts and immediately mixed well . The mixture was as described in Example 4. Briefly , 2-20 ul of ALS2T1 incubated in the dark for 30 minutes before washing once protein was mixed with 200,000 protoplasts at room tem with 0.45 M mannitol, 10 mM CaCl2 . The protoplasts were perature in 200 ul of 0.4 M mannitol, 4 mM IVIES , 15 mM then washed with K3G1 medium twice before moving the MgCl2 , pH 5.8 . Other treatments included transforming cells to 1 ml of K3G1 in a petri dish for long - term culture . protoplasts with combination of Trex2 protein , DNA that encodes ALS2T1 , DNA that encodes the Trex2 protein , or a DNA construct for YFP expression . Trex2 is an endonu Example 4 : Activity of I - Scel on Episomal Target clease that increases frequencies of imprecise DNA repair Sites in N tabacum through NHEJ . After transformation , an equal volume of [ 0080 ] To assess the protein activity of the I - Scel targeting 40 % PEG - 4000 , 0.2 M mannitol, 100 mM CaCl2 , pH5.8 was episomal sites in plant cell , a SSA construct was co -deliv added to protoplasts and immediately mixed well . The ered with I - Scel protein . For this assay , a target plasmid was mixture was incubated in the dark for 30 minutes before constructed with the I - Sce recognition site cloned in a washing once with 0.45 M mannitol, 10 mM CaCl2 . The non - functional YFP reporter gene . The target site was protoplasts were then washed with K3G1 medium twice flanked by a direct repeat of YFP coding sequence such that before moving the cells to 1 ml of K3G1 in a petri dish for if the reporter gene was cleaved by the I - Sce , recombination long -term culture . would occur between the direct repeats and function would be restored to the YFP gene . Expression of YFP, therefore , Example 7 : Activity of TALENTM ALS2T1 at their served as a measure of I - Scel cleavage activity . Endogenous Target Sites in N Benthamiana [ 0081 ] The activity of the I - Scel protein and its control [ 0085 ] Transformed protoplasts were harvested 48 hours treatments against the episomal target sequence is summa after treatment, and genomic DNA was prepared. Using this rized in FIG . 4. The delivery of I - Scel as DNA yielded a genomic DNA as a template, a 253 bp fragment encompass 0.49 % YFP expression ; while 1 - Scel protein yielded 4.4 % ing the ALS2T1 recognition site was amplified by PCR . The expression of YFP. When the SSA construct and the I - Scel PCR product was then subjected to 454 pyro - sequencing. protein were delivered sequentially, the YFP SSA efficiency Sequencing reads with insertion / deletion ( indel) mutations was 2.4 % . The transformation efficiency was indicated by in the recognition site were considered as having been YFP expression of 35S : YFP DNA delivery control . derived from imprecise repair of a cleaved I - Scel recogni US 2021/0002656 A1 Jan. 7 , 2021 7 tion site by NHEJ . Mutagenesis frequency was calculated as flow cytometry ( FIG . 10 ) . Similar levels of targeted cleav the number of sequencing reads with NHEJ mutations out of age of the SSA reporter were observed both with p35S - I the total sequencing reads . Crel DNA and I - Crel mRNA . The data demonstrate that [ 0086 ] The activity of the ALS2T1 protein and its control functional nucleases can be successful delivered to proto treatments against the target sequence is summarized in FIG . plasts in the form of mRNA . 7. The delivery of ALS2T1 as DNA ( SEQ ID NOS : 2 and 3 ) yielded an 18.4 % mutagenesis frequency . When combined Example 10 : Cleavage Activity on Chromosomal with DNA encoding the exonuclease Trex2 ( SEQ ID NO : 6 ) , Targets of Sequence -Specific Nucleases Delivered the mutagenesis frequency increased to 48 % . When as mRNA ALS2T1 was delivered as protein , the mutagenesis activity was 0.033 % to 0.33 % ; however, when ALS2T1 protein was [ 0090 ] A TALEN pair (XylT_TALENTM ) was designed to co - delivered with 35S : YFP DNA , a 0.72 % mutagenesis cleave the endogenous B1,2 - xylosyltransferase genes of N. frequency was observed . Examples of ALS2T1 protein benthamiana ( Strasser et al . 2008 ) ( FIG . 11 ) . These genes induced mutations are shown in FIG . 8. Collectively, the are designated XylT1 and XylT2 , and the TALENTM recog data demonstrate that ALS2T1 protein creates targeted chro nizes the same sequence found in both genes . Each XylT mosome breaks when delivered to plant cells as protein . TALENTM was subcloned into a 17 -driven expression plas Further, the imprecise repair of these breaks leads to the mid ( FIG . 12 ) . The resulting TALENTM expression plasmids introduction of targeted mutations . were linearized by Sapi digestion and served as DNA templates for in vitro mRNA production as described in Example 8 : Preparation of mRNA Encoding Example 8 . Sequence - Specific Nucleases [ 0091 ] TALENTM - encoding plasmid DNA or mRNA were next introduced into N. benthamiana protoplasts by PEG [ 0087 ] Sequence - specific nucleases, including mega mediated transformation ( Golds et al . , 1993 , Yoo et al . 2007 , nucleases, zinc finger nucleases ( ZFNs ) , or transcription Zhang et al . , 2013 ) . Protoplasts were isolated from well activator - like effector nucleases ( TALENTM ), are cloned into expanded leaves of one month old N. benthamiana . The a T7 expression vector ( FIG . 9 ) . Several different 5 ' and 3 ' protoplast density was adjusted to the cell density of 5x105 / UTR pairs were chosen based on data from a genome wide ml to 1x10 ° / ml , and 200 ul of protoplasts were used for each study of transcript decay rates in A. thaliana ( Narsai, 2007 ) . transformation . For mRNA delivery, an RNA cocktail was The sequences selected were based on the half - lives of prepared by mixing 15 ul of L - TALEN mRNA ( 2 ug / ul ) , 15 various transcripts as well as the functional categories . ul of R - TALEN mRNA ( 2 ug / ul ) , and 10 ul of yeast tRNA These UTR pairs were synthesized to allow convenient carrier ( 10 ug / ul ). To minimize the potential degradation by cloning into the T7 - driven plasmid vector . The resulting RNAse , the RNA cocktail was quickly added to 200 ul of nuclease constructs are linearized by Sapi digestion ; a Sapi protoplasts, and gently mixed only for a few seconds by site is located right after the polyA sequences. The linearized finger tapping. Almost immediately, 210 ul of 40 % PEG was plasmid serves as the DNA template for in vitro mRNA added , and mixed well by finger tapping for 1 min . The production using the T7 Ultra kit ( Life Technologies Cor transformation reaction was incubated for 30 min at room poration ). Alternatively, mRNA encoding the nuclease can temperature. The transformation was stopped by the addi be prepared by a commercial provider. Synthesized mRNAs tion of 900 ul of wash buffer. After a couple of washes , are dissolved in nuclease - free distilled water and stored at transformed protoplasts were cultured in K3 / G1 medium at -80 ° C. the cell density of 5x10 ° /ml . The TALEN - encoding plasmid DNA was also transformed as a positive control . Example 9 : Activity on Episomal Targets of [ 0092 ] Three days after treatment, transformed protoplasts Sequence - Specific Nucleases Delivered as mRNA were harvested , and genomic DNA was prepared. Using the [ 0088 ] A single - strand annealing ( SSA ) assay was used to genomic DNA prepared from the protoplasts as a template , measure activity of nuclease mRNAs that had been trans an approximately 300 -bp fragmentencompassing the formed into tobacco protoplasts ( Zhang et al . 2013 ) . As TALENTM recognition site was amplified by PCR . The PCR described in Example 4 , the SSA assay uses a non-1 - functional product was then subjected to 454 pyro -sequencing . YFP reporter that is cleaved by the nuclease. Upon cleavage, Sequencing reads with insertion / deletion ( indel) mutations recombination between repeated sequences in the reporter in the spacer region were considered as having been derived reconstitutes a functional YFP gene. YFP fluorescence can from imprecise repair of a cleaved TALENTM recognition then be quantified by flow cytometry . site by non - homologous end - joining ( NHEJ ). Mutagenesis [ 0089 ] To determine whether mRNA could be delivered to frequency was calculated as the number of sequencing reads plant cells and mediate targeted DNA modification , I - Crel with NHEJ mutations out of the total sequencing reads . mRNAs together with a SSA target plasmid were introduced [ 0093 ] Xyl_T04 TALENTM DNA and mRNA were tested into tobacco protoplasts by PEG - mediated transformation against their targets, namely the XylT1 and XylT2 genes in ( Golds et al . 1993 , Yoo et al . 2007 , Zhang et al . 2013 ) . The N. benthamiana . As indicated above , the TALENTM recog SSA reporter has an I - Crel site between the repeated nition sites are present in both XylT1 and XylT2 genes . As sequences in YFP. Methods for tobacco protoplast prepara summarized in FIG . 12 , Xyl_T04 TALENTM plasmid DNAs tion and transformation were as previously described ( Zhang induced very high frequencies of NHEJ mutations in both et al . 2013 ) . The SSA target plasmid alone served as a genes , ranging from 31.2 % to 54.9 % . In parallel, Xyl_T04 negative control. As a positive control, cells were trans TALENTM mRNAs also induced high frequencies of NHEJ formed with a DNA construct expressing 1 - Crel (p35S - I mutations in both genes , ranging from 22.9 % to 44.2 % . Crel ) as well as the I - Crel SSA reporter. Twenty - four hours Examples of TALENTM - induced mutations on XylT1 and after transformation , YFP fluorescence was measured by Xy1T2 loci are shown in FIG . 13 . US 2021/0002656 A1 Jan. 7 , 2021 8

OTHER EMBODIMENTS [ 0106 ] Klein T. M. , Arentzen R. , Lewis P. A. , Fitzpatrick McElligott S. ( 1992 ) Transformation of microbes, plants [ 0094 ] It is to be understood that while the invention has and animals by particle bombardment. Biotechnology been described in conjunction with the detailed description (NY ) 10 ( 3 ) : 286-91 . thereof, the foregoing description is intended to illustrate [ 0107 ] Lakshmanan , M. , Kodama, Y., Yoshizumi, T. , and not limit the scope of the invention , which is defined by Sudesh , K. , Numata , K. ( 2013 ) Rapid and efficient deliv the scope of the appended claims . Other aspects , advantages , ery into plant cells using designed peptide carriers . and modifications are within the scope of the following Biomacromolecules 14 ( 1 ) : 10-6 claims . [ 0108 ] Laursen C. M. , Krzyzek R. A. , Flick C. E. , Ander son P. C. , Spencer T. M. , ( 1994 ) Production of fertile REFERENCES transgenic maize by electroporation of suspension culture cells . Plant Mol Biol. 24 ( 1 ) : 51-61 . [ 0095 ] Bashirullah A , Cooperstock R , Lipshitz H ( 2001 ) [ 0109 ] Lloyd , D. Plaisier C. L. , Carroll D , Drews G. N. , Spatial and temporal control of RNA stability . PNAS 98 : ( 2005 ) Targeted mutagenesis using zinc -finger nucleases 7025-7028 . in Arabidopsis. PNAS 102 : 2232-2237 . [ 0096 ] Beurdeley M , Bietz F , Li J, Thomas S , Stoddard T , [ 0110 ] Mae , M. , Langel, U. ( 2006 ) Cell -penetrating pep et al . ( 2013 ) Compact designer TALENTM for efficient tides as vectors for peptide, protein and oligonucleotide genome engineering. Nature Communications 4 : 1762 . delivery. Curr. Opin . Pharmacol. 6 ( 5 ) : 509-14 . [ 0097 ] Bhushan S , Kuhn C , Berglund A K , Roth C , Glaser [ 0111 ] Narsai R. , Howell K. , Millar A. , O'Toole N. , Small E ( 2006 ) The role of the N - terminal domain of chloroplast I. , Whelan J. ( 2007 ) Genome - Wide Analysis of mRNA targeting peptides in organellar protein import and miss Decay Rates and Their Determinants in Arabidopsis thali sorting. FEBS Letters Volume 580 , Issue 16 , 10 Jul. 2006 , ana . The Plant Cell 19 : 3418-3436 . Pages 3966-3972 . [ 0112 ] Pacher M. , Schmidt - Puchta W., Puchta H. ( 2007 ) [ 0098 ] Certo M T , Gwiazda K S , Kuhar R , Sather B , Two unlinked double - strand breaks can induce reciprocal Curinga G , et al . ( 2012 ) Coupling endonucleases with exchanges in plant genomes via homologous recombina DNA end - processing enzymes to drive gene disruption. tion and nonhomologous end joining . Genetics 175 : Nature methods 9 : 973-975.Christou , P. ( 1997 ) Rice trans 21-29 . formation : bombardment. Plant Mol Biol . 35 ( 1-2 ): 197 [ 0113 ] Schwarze S. R. , Ho A. , Vocero - Akbani A. , Dowdy 203 . S. F. ( 1999 ) In vivo protein transduction : delivery of a [ 0099 ] Chugh , A. , Amundsen , E., Eudes , F. ( 2009 ) Trans biologically active protein into the mouse . Science 285 : location of cell -penetrating peptides and delivery of their 1569-1572 . cargoes in triticale microspores. Plant Cell Rep . 28 ( 5 ) : [ 0114 ) Shevelev , I. V., Ramadanm K. , Hübscher, U. ( 2002 ) 801-10 The TREX2 3 ' - 5 ' exonuclease physically interacts with [ 0100 ] Dormann , D. , Madl , T. , Valori, C. F. , Bentmann , E. , DNA polymerase delta and increases its accuracy . Scien Tahirovic , S. , Abou - Ajram , C. , Kremmer , E. , Ansorge, O. , tificWorldJournal 2 : 275-81 . Mackenzie , I. R. , Neumeann, M. , Haass , C. ( 2012 ) Argi [ 0115 ] Strasser R. , Stadlmann J. , Schahs M. , Stiegler G. , nine methylation next to the PY -NLS modulates Trans Quendler H. , et al . ( 2008 ) Generation of glyco - engineered portin binding and nuclear import of FUS . EMBO J. Nicotiana benthamiana for the production of monoclonal 31 ( 22 ): 4258-75 . antibodies with a homogeneous human - like N - glycan [ 0101 ] Frankel A. D. , Pabo C. O. ( 1988 ) Cellular uptake of structure . Plant biotechnology journal 6 : 392-402 . the tat protein from human immunodeficiency virus . Cell [ 0116 ] Townsend J. A. , Wright D. A. , Winfrey R. J. , Fu F. , 55 : 1189-1193 . Maeder M. L. , Joung J. K. , Voytas D. F. ( 2009 ) High [ 0102 ] Gaj T. , Guo J. , Kato Y., Sirk S. , Barbas C. ( 2013 ) frequency modification of plant genes using engineered Targeted gene knockout by direct delivery of ZFN pro zinc - finger nucleases . Nature 459 : 442-445 . teins . Nat Methods 9 ( 8 ) : 805-807 [ 0117 ] Wright D. A. , Townsend J. A. , Winfrey R. J. , Jr., [ 0103 ] Gasiunas, G. , Barrangou , R. , Horvath , P., Siksnys, Irwin P. A. , Rajagopal J. , et al. ( 2005 ) High - frequency V. ( 2012 ) Cas9 - crRNA ribonucleoprotein complex medi homologous recombination in plants mediated by zinc ates specific DNA cleavage for adaptive immunity in finger nucleases. Plant J 44 : 693-705 . bacteria . PNAS 109 ( 39 ) : E2579-86 . [ 0118 ] Yoo S. D. , Cho Y. H. , Sheen J. ( 2007 ) Arabidopsis [ 0104 ] Golds T. , Maliga P., Koop H. U. ( 1993 ) Stable mesophyll protoplasts : a versatile cell system for transient plastid transformation in PEG -treated protoplasts of Nico gene expression analysis . Nature Protocols 2 : 1565-1572 . tiana tabacum . Nature Biotechnology 11 : 95-97 . [ 0119 ] Zhang Y., Zhang F. , Li X , Baller J. A. , Qi Y., et al . [ 0105 ] Hicks , G. R. , Raikhel , N. V. ( 1993 ) Specific bind ( 2013 ) Transcription activator - like effector nucleases ing of nuclear localization sequences to plant nuclei . enable efficient plant genome engineering. Plant Physi Plant Cell 5 ( 8 ) : 983-94 ology 161 : 20-27 .

SEQUENCE LISTING

< 160 > NUMBER OF SEQ ID NOS : 55 < 210 > SEQ ID NO 1 < 211 > LENGTH : 720 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence US 2021/0002656 A1 Jan. 7 , 2021 9

- continued

< 220 > FEATURE : < 223 > OTHER INFORMATION : I - sceI coding sequence < 400 > SEQUENCE : 1 atggccaaaa acatcaaaaa aaaccaggta atgaacctgg gtccgaactc taaactgctg 60 aaagaataca aatcccagct gatcgaactg aacatcgaac agttegaagc aggtatcggt 120 ctgatcctgg gtgatgotta catccgttct cgtgatgaag gtaaaaccta ctgtatgcag 180 ttcgagtgga aaaacaaagc atacatggac cacgtatgtc tgctgtacga tcagtgggta 240 ctgtccccgc cgcacaaaaa agaacgtgtt aaccacctgg gtaacctggt aatcacctgg 300 ggcgcccaga ctttcaaaca ccaagctttc aacaaactgg ctaacctgtt catcgttaac 360 aacaaaaaaa ccatcccgaa caacctggtt gaaaactacc tgaccccgat gtctctggca 420 tactggttca tggatgatgg tggtaaatgg gattacaaca aaaactctac caacaaatcg 480 atcgtactga acacccagtc tttcactttc gaagaagtag aatacctggt taagggtctg 540 cgtaacaaat tocaactgaa ctgttacgta aaaatcaaca aaaacaaacc gatcatctac 600 atcgattcta tgtcttacct gatcttctac aacctgatca aaccgtacct gatcccgcag 660 atgatgtaca aactgccgaa cactatctcc tccgaaactt tectgaaagc ggccgactaa 720

< 210 > SEQ ID NO 2 < 211 > LENGTH : 2814 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : TAL domain ALS2T1_L coding sequence < 400 > SEQUENCE : 2 atgggcgatc ctaaaaagaa acgtaaggtc atcgattacc catacgatgt tccagattac 60 gctatcgata tcgccgatct acgcacgctc ggctacagcc agcagcaaca ggagaagato 120 aaaccgaagg ttcgttcgac agtggcgcag caccacgagg cactggtcgg ccacgggttt 180 acacacgcgc acatcgttgc gttaagccaa cacccggcag cgttagggac cgtcgctgtc 240 aagtatcagg acatgatcgc agcgttgcca gaggcgacac acgaagcgat cgttggcgtc 300 ggcaaacagt ggtccggcgc acgcgctctg gaggccttgc tcacggtggc gggagagttg 360 agaggtccac cgttacagtt ggacacaggc caacttctca agattgcaaa acgtggcggc 420 gtgaccgcag tggaggcagt gcatgcatgg cgcaatgcac tgacgggtgc cccgctcaac 480 ttgaccccgg agcaggtggt ggccatcgcc agcaatattg gtggcaagca ggcgctggag 540 acggtgcagg cgctgttgcc ggtgctgtgc caggcccacg gottgacccc ccagcaggtg 600 gtggccatcg ccagcaataa tggtggcaag caggcgctgg agacggtcca gcggctgttg 660 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagccac 720 gatggcggca agcaggcgct ggagacggtc cagcggctgt tgccggtgct gtgccaggcc 780 cacggcttga ccccccagca ggtggtggcc atcgccagca atggcggtgg caagcaggcg 840 ctggagacgg tccagcggct gttgccggtg ctgtgccagg cccacggctt gaccccccag 900 caggtggtgg ccatcgccag caatggcggt ggcaagcagg cgctggagac ggtccagcgg 960 ctg cgg tgct gcca ggcccacgg ttga ccccc agcaggtggt ggccatcgcc 1020 agcaataatg gtggcaagca ggcgctggag acggtccagc ggctgttgcc ggtgctgtgc 1080 caggcccacg gottgacccc ccagcaggtg gtggccatcg ccagcaatgg cggtggcaag 1140 US 2021/0002656 A1 Jan. 7 , 2021 10

- continued caggcgctgg agacggtcca gcggctgttg ccggtgctgt gccaggcoca cggcttgacc 1200 ccccagcagg tggtggccat cgccagcaat ggcggtggca agcaggcgct ggagacggtc 1260 cagcggctgt tgccggtgct gtgccaggcc cacggcttga ccccggagca ggtggtggcc 1320 atcgccagcc acgatggcgg caagcaggcg ctggagacgg tccagcggct gttgccggtg 1380 ctgtgccagg cccacggett gaccccggag caggtggtgg ccatcgccag ccacgatggc 1440 ggcaagcagg cgctggagac ggtccagcgg ctgttgccgg tgctgtgcca ggcccacggc 1500 ttgaccccgg agcaggtggt ggccatcgcc agcaatattg gtggcaagca ggcgctggag 1560 acggtgcagg cgctgttgcc ggtgctgtgccaggcccacg gottgacccc ggagcaggtg 1620 gtggccatcg ccagccacga tggcggcaag caggcgctgg agacggtcca goggctgttg 1680 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagcaat 1740 attggtggca agcaggcgct ggagacggtg caggcgctgt tgccggtgct gtgccaggcc 1800 cacggcttga ccccccagca ggtggtggcc atcgccagca atggcggtgg caagcaggcg 1860 ctggagacgg tccagcggct gttgccggtg ctgtgccagg cccacggctt gaccccccag 1920 caggtggtgg ccatcgccag caatggcggt ggcaagcagg cgctggagac ggtccagcgg 1980 ctgttgccgg tgctgtgcca ggcccacggc ttgacccctc agcaggtggt ggccatcgcc 2040 agcaatggcg goggcaggcc ggcgctggag agcattgttg cccagttatc tcgccctgat 2100 ccggcgttgg ccgcgttgac caacgaccac ctcgtcgcct tggcctgcct cggcgggcgt 2160 cctgcgctgg atgcagtgaa aaagggattg ggggatccta tcagccgttc ccagctggtg 2220 aagtccgagc tggaggagaa gaaatccgag ttgaggcaca agctgaagta cgtgccccac 2280 gagtacatcg agctgatcga gatcgcccgg aacagcaccc aggaccgtat cctggagatg 2340 aaggtgatgg agttcttcat gaaggtgtac ggctacaggg gcaagcacct gggcggctcc 2400 aggaagcccg acggcgccat ctacaccgtg ggctccccca tcgactacgg cgtgatcgtg 2460 gacaccaagg cctactccgg cggctacaac ctgcccatcg gccaggccga cgaaatgcag 2520 aggtacgtgg aggagaacca gaccaggaac aagcacatca accccaacga gtggtggaag 2580 gtgtacccct ccagcgtgac cgagttcaag ttcctgttcg tgtccggcca cttcaagggc 2640 aactacaagg cccagctgac caggctgaac cacatcacca actgcaacgg cgccgtgctg 2700 tccgtggagg agctcctgat cggcggcgag atgatcaagg ccggcaccct gaccctggag 2760 gaggtgagga ggaagttcaa caacggcgag atcaacttcg cggccgactg ataa 2814

< 210 > SEQ ID NO 3 < 211 > LENGTH : 2832 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : TAL domain targeting ALS2T1_R coding sequence < 400 > SEQUENCE : 3 atgggcgatc ctaaaaagaa acgtaaggtc atcgataagg agaccgccgc tgccaagttc 60 gagagacagc acatggacag catcgatatc gccgatctac gcacgctcgg ctacagccag 120 cagcaacagg agaagatcaa accgaaggtt cgt cgacag tggcgcagca ccacgaggca 180 ctggtcggcc acgggtttac acacgcgcac atcgttgcgt taagccaaca cccggcagcg 240 ttagggaccg tcgctgtcaa gtatcaggac atgatcgcag cgttgccaga ggcgacacac 300 US 2021/0002656 A1 Jan. 7 , 2021 11

- continued gaagcgatcg ttggcgtcgg caaacagtgg tccggcgcac gcgctctgga ggccttgctc 360 acggtggcgg gagagttgag aggtccaccg ttacagttgg acacaggcca acttctcaag 420 attgcaaaac gtggcggcgt gaccgcagtg gaggcagtgc atgcatggcg caatgcactg 480 acgggtgccc cgctcaactt gaccccggag caggtggtgg ccatcgccag ccacgatggc 540 ggcaagcagg cgctggagac ggtccagcggctgttgccgg tgctgtgcca ggcccacggc 600 ttgacccccc agcaggtggt ggccatcgcc agcaatggcg gtggcaagca ggcgctggag 660 acggtccagc ggctgttgcc ggtgctgtgccaggcccacg gottgacccc ccagcaggtg 720 gtggccatcg ccagcaataa tggtggcaag caggcgctgg agacggtcca gcggctgttg 780 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagcaat 840 attggtggca agcaggcgct ggagacggtg caggcgctgt tgccggtgct gtgccaggcc 900 cacggcttga ccccggagca ggtggtggcc atcgccagcc acgatggcgg caagcaggcg 960 ctggagacgg tccagcggct gttgccggtgctgtgccagg cccacggctt gaccccggag 1020 caggtggtgg ccatcgccag ccacgatggc ggcaagcagg cgctggagac ggtccagcgg 1080 ctgttgccgg tgctgtgcca ggcccacggc ttgaccccgg agcaggtggt ggccatcgcc 1140 agccacgatg goggcaagca ggcgctggag acggtccagc ggctgttgcc ggtgctgtgc 1200 caggcccacg gottgacccc ggagcaggtg gtggccatcg ccagcaatat tggtggcaag 1260 caggcgctgg agacggtgca ggcgctgttg ccggtgctgt gccaggcoca cggcttgacc 1320 ccccagcagg tggtggccat cgccagcaat aatggtggca agcaggcgct ggagacggtc 1380 cagcggctgt tgccggtgct gtgccaggcc cacggcttga ccccggagca ggtggtggcc 1440 atcgccagcc acgatggcgg caagcaggcg ctggagacgg tccagcggct gttgccggtg 1500 ctgtgccagg cccacggctt gaccccggag caggtggtgg ccatcgccag caatattggt 1560 ggcaagcagg cgctggagac ggtgcaggcg ctgttgccgg tgctgtgcca ggcccacggc 1620 ttgacccccc agcaggtggt ggccatcgcc agcaatggcg gtggcaagca ggcgctggag 1680 acggtccagc ggctgttgcc ggtgctgtgc caggcccacg gottgaccccccagcaggtg 1740 gtggccatcg ccagcaataa tggtggcaag caggcgctgg agacggtcca gcggctgttg 1800 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagcaat 1860 attggtggca agcaggcgct ggagacggtg caggcgctgt tgccggtgct gtgccaggcc 1920 cacggcttga ccccggagca ggtggtggcc atcgccagcc acgatggcgg caagcaggcg 1980 ctggagacgg tccagcggct gttgccggtg ctgtgccagg cccacggctt gacccctcag 2040 caggtggtgg ccatcgccag caatggcggc ggcaggccgg cgctggagag cattgttgcc 2100 cagttatctc gccctgatcc ggcgttggcc gcgttgacca acgaccacct cgtcgccttg 2160 gcctgcctcg gcgggcgtcc tgcgctggat gcagtgaaaa agggattggg ggatcctatc 2220 agccgttccc agctggtgaa gtccgagctg gaggagaaga aatccgagtt gaggcacaag 2280 ctgaagtacg tgccccacga gtacatcgag ctgatcgaga tcgcccggaa cagcacccag 2340 gaccgtatcc tggagatgaa ggtgatggag ttcttcatga aggtgtacgg ctacaggggc 2400 aagcacctgg ccag gaagcccgac ggcgccatct acaccgtggg ctcccccato 2460 gactacggcg tgatcgtgga caccaaggcc tactccggcg gctacaacct gcccatcggc 2520 caggccgacg aaatgcagag gtacgtggag gagaaccaga ccaggaacaa gcacatcaac 2580 US 2021/0002656 A1 Jan. 7 , 2021 12

- continued cccaacgagt ggtggaaggt gtacccctcc agcgtgaccg agttcaagtt cctgttcgtg 2640 tccggccact tcaagggcaa ctacaaggcc cagctgacca ggctgaacca catcaccaac 2700 tgcaacggcg ccgtgctgtc cgtggaggag ctcctgatcg goggcgagat gatcaaggcc 2760 ggcaccctga ccctggagga ggtgaggagg aagttcaaca acggcgagat caacttcgcg 2820 gccgactgat aa 2832

< 210 > SEQ ID NO 4 < 211 > LENGTH : 2810 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : TAL domain targeting Xyl_T04_L1 coding sequence < 400 > SEQUENCE : 4 atgggcgatc ctaaaaagaa acgtaaggtc atcgattacc catacgatgt tccagattac 60 gctatcgata tcgccgatct acgcacgctc ggctacagcc agcagcaaca ggagaagato 120 aaaccgaagg ttcgttcgac agtggcgcag caccacgagg cactggtcgg ccacgggttt 180 acacacgcgc acatcgttgc gttaagccaa cacccggcag cgttagggac cgtcgctgtc 240 aagtatcagg acatgatcgc agcgttgcca gaggcgacac acgaagcgat cgttggcgtc 300 ggcaaacagt ggtccggcgc acgcgctctg gaggccttgc tcacggtggc gggagagttg 360 agaggtccac cgttacagtt ggacacaggc caacttctca agattgcaaa acgtggcggc 420 gtgaccgcag tggaggcagt gcatgcatgg cgcaatgcac tgacgggtgc cccgctcaac 480 ttgaccccgg agcaggtggt ggccatcgcc agccacgatg goggcaagca ggcgctggag 540 acggtccagc ggctgttgcc ggtgctgtgc caggcccacg gottgacccc ccagcaggtg 600 gtggccatcg ccagcaatgg cggtggcaag caggcgctgg agacggtcca gcggctgttg 660 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagccac 720 gatggcggca agcaggcgct ggagacggtc cagcggctgt tgccggtgct gtgccaggcc 780 cacggcttga ccccccagca ggtggtggcc atcgccagca atggcggtgg caagcaggcg 840 ctggagacgg tccagcggct gttgccggtg ctgtgccagg cccacggctt gaccccccag 900 caggtggtgg ccatcgccag caatggcggt ggcaagcagg cgctggagac ggtccagcgg 960 ctgttgccgg tgctgtgcca ggcccacggc ttgaccccgg agcaggtggt ggccatcgcc 1020 agccacgatg goggcaagca ggcgctggag acggtccagc ggctgttgcc ggtgctgtgc 1080 caggcccacg gottgaccccccagcaggtg gtggccatcg ccagcaataa tggtggcaag 1140 caggcgctgg agacggtcca gcggctgttg ccggtgctgt gccaggccca cggettgacc 1200 cggagcaggt ggtggccatc gccagccacg atggcggcaa gcaggcgctg gagacggtcc 1260 agcggctgtt gccggtgctg tgccaggccc acggcttgac cccccagcag gtggtggcca 1320 tcgccagcaa tggcggtggc aagcaggcgc tggagacggt ccagcggctg ttgccggtgc 1380 tgtgccaggc ccacggcttg accccggagc aggtggtggc catcgccagc cacgatggcg 1440 gcaagcaggc gctggagacg gtccagcggc tgttgccggt gctgtgccag gcccacggct 1500 tgacccccca gc gccatcgcca gca cgg tggcaagcag gcgctggaga 1560 cggtccagcg gctgttgccg gtgctgtgcc aggcccacgg cttgaccccg gagcaggtgg 1620 tggccatcgc cagccacgat ggcggcaagc aggcgctgga gacggtccag cggctgttgc 1680 US 2021/0002656 A1 Jan. 7 , 2021 13

- continued cggtgctgtg ccaggcccac ggcttgaccc cggagcaggt ggtggccatc gccagcaata 1740 ttggtggcaa gcaggcgctg gagacggtgc aggcgctgtt gccggtgctg tgccaggccc 1800 acggcttgac cccggagcag gtggtggcca tcgccagcaa tattggtggc aagcaggcgc 1860 tggagacggt gcaggcgctg ttgccggtgc tgtgccaggc ccacggcttg accccggage 1920 aggtggtggc catcgccagc cacgatggcg gcaagcaggc gctggagacg gtccagcggo 1980 tgttgccggt gctgtgccag gcccacggct tgacccctca gcaggtggtg gccatcgcca 2040 gcaatggcgg cggcaggccg gcgctggaga gcattgttgc ccagttatct cgccctgatc 2100 cggcgttggc cgcgttgacc aacgaccacc tcgtcgcctt ggcctgcctc ggcgggcgtc 2160 ctgcgctgga tgcagtgaaa aagggattgg gggatcctat cagccgttcc cagctggtga 2220 agtccgagct ggaggagaag aaatccgagt tgaggcacaa gotgaagtac gtgccccacg 2280 agtacatcga gctgatcgag atcgcccgga acagcaccca ggaccgtatc ctggagatga 2340 aggtgatgga gttcttcatg aaggtgtacg getacagggg caagcacctg ggcggctcca 2400 ggaagcccga cggcgccatc tacaccgtgg gctcccccat cgactacggc gtgatcgtgg 2460 acaccaaggc ctactccggc ggctacaacc tgcccatcgg ccaggccgac gaaatgcaga 2520 ggtacgtgga ggagaaccag accaggaaca agcacatcaa ccccaacgag tggtggaagg 2580 tgtacccctc cagcgtgacc gagttcaagt tcctgttcgt gtccggccac ttcaagggca 2640 actacaaggc ccagctgacc aggctgaacc acatcaccaa ctgcaacggc gccgtgctgt 2700 ccgtggagga gctcctgatc ggcggcgaga tgatcaaggc cggcaccctg accctggagg 2760 aggtgaggag gaagttcaac aacggcgaga tcaacttcgc ggccgactga 2810

< 210 > SEQ ID NO 5 < 211 > LENGTH : 2829 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : TAL domain targeting Xyl_T04_R1 coding sequence < 400 > SEQUENCE : 5 atgggcgatc ctaaaaagaa acgtaaggtc atcgataagg agaccgccgc tgccaagttc 60 gagagacagc acatggacag catcgatatc gccgatctac gcacgctcgg ctacagccag 120 cagcaacagg agaagatcaa accgaaggtt cgttcgacag tggcgcagca ccacgaggca 180 ctggtcggcc acgggtttac acacgcgcac atcgttgcgt taagccaaca cccggcagcg 240 ttagggaccgtcgctgtcaa gtatcaggac atgatcgcag cgttgccaga ggcgacacac 300 gaagcgatcg ttggcgtcgg caaacagtgg tccggcgcac gcgctctgga ggccttgctc 360 acggtggcgg gagagttgag aggtccaccg ttacagttgg acacaggcca acttctcaag 420 attgcaaaac gtggcggcgt gaccgcagtg gaggcagtgc atgcatggcg caatgcactg 480 acgggtgccc cgctcaactt gaccccccag caggtggtgg ccatcgccag caataatggt 540 ggcaagcagg cgctggagac ggtccagcgg ctgttgccgg tgctgtgcca ggcccacggo 600 ttgacccccc agcaggtggt ggccatcgcc agcaataatg gtggcaagca ggcgctggag 660 acggtccagc ggctg tgcc ggtgctgtgc caggcccacg gottgacccc ccagcaggtg 720 gtggccatcg ccagcaataa tggtggcaag caggcgctgg agacggtcca gcggctgttg 780 ccggtgctgt gccaggccca cggcttgacc ccggagcagg tggtggccat cgccagcaat 840 US 2021/0002656 A1 Jan. 7 , 2021 14

- continued attggtggca agcaggcgct ggagacggtg caggcgctgt tgccggtgct gtgccaggcc 900 cacggcttga ccccggagca ggtggtggcc atcgccagca atattggtgg caagcaggcg 960 ctggagacgg tgcaggcgct gttgccggtg ctgtgccagg cccacggctt gaccccccag 1020 caggtggtgg ccatcgccag caataatggt ggcaagcagg cgctggagac ggtccagcgg 1080 ctgttgccgg tgctgtgcca ggcccacggc ttgaccccgg agcaggtggt ggccatcgcc 1140 agcaatattg gtggcaagca ggcgctggag acggtgcagg cgctgttgcc ggtgctgtgc 1200 caggcccacg gottgacccc ccagcaggtg gtggccatcg ccagcaataa tggtggcaag 1260 caggcgctgg agacggtcca gcggctgttg ccggtgctgt gccaggccca cggcttgacc 1320 ccggagcagg tggtggccat cgccagcaat attggtggca agcaggcgct ggagacggtg 1380 caggcgctgt tgccggtgct gtgccaggcc cacggcttga ccccggagca ggtggtggcc 1440 atcgccagca atattggtgg caagcaggcg ctggagacgg tgcaggcgct gttgccggtg 1500 ctgtgccagg cccacggott gaccccccag caggtggtgg ccatcgccag caataatggt 1560 ggcaagcagg cgctggagac ggtccagcgg ctgttgccgg tgctgtgcca ggcccacggc 1620 ttgacccccc agcaggtggt ggccatcgcc agcaatggcg gtggcaagca ggcgctggag 1680 acggtccagc ggctgttgcc ggtgctgtgc caggcccacg gottgacccc ggagcaggtg 1740 gtggccatcg ccagcaatat tggtggcaag caggcgctgg agacggtgca ggcgctgttg 1800 ccggtgctgt gccaggccca cggcttgaccccccagcagg tggtggccat cgccagcaat 1860 aatggtggca agcaggcgct ggagacggtc cagcggctgt tgccggtgct gtgccaggcc 1920 cacggcttga ccccggagca ggtggtggcc atcgccagca atattggtgg caagcaggcg 1980 ctggagacgg tgcaggcgct gttgccggtg ctgtgccagg cccacggctt gacccctcag 2040 caggtggtgg ccatcgccag caatggcggc ggcaggccgg cgctggagag cattgttgcc 2100 cagttatctc gccctgatcc ggcgttggcc gcgttgacca acgaccacct cgtcgccttg 2160 gcctgcctcg gcgggcgtcc tgcgctggat gcagtgaaaa agggattggg ggatcctatc 2220 agccgttccc agctggtgaa gtccgagctg gaggagaaga aatccgagtt gaggcacaag 2280 ctgaagtacg tgccccacga gtacatcgag ctgatcgaga tcgcccggaa cagcacccag 2340 gaccgtatcc tggagatgaa ggtgatggag ttcttcatga aggtgtacgg ctacaggggc 2400 aagcacctgg goggctccag gaagcccgac ggcgccatct acaccgtggg ctcccccato 2460 gactacggcg tgatcgtgga caccaaggcc tactccggcg getacaacct gcccatcggc 2520 caggccgacg aaatgcagag gtacgtggag gagaaccaga ccaggaacaa gcacatcaac 2580 cccaacgagt ggtggaaggt gtacccctcc agcgtgaccg agttcaagtt cctgttcgtg 2640 tccggccact tcaagggcaa ctacaaggcc cagctgacca ggctgaacca catcaccaac 2700 tgcaacggcgccgtgctgtc cgtggaggag ctcctgatcg goggcgagat gatcaaggcc 2760 ggcaccctga ccctggagga ggtgaggagg aagttcaaca acggcgagat caacttcgcg 2820 gccgactga 2829

< 210 > SEQ ID NO 6 < 211 > LENGTH : 2262 < 212 > TYPE : DNA < 213 > ORGANISM : homo sapiens < 220 > FEATURE : < 223 > OTHER INFORMATION : Trex2 polynucleotide sequence US 2021/0002656 A1 Jan. 7 , 2021 15

- continued

< 400 > SEQUENCE : 6 atgggcgggg cgcggctcgg agcgcgaaac atggcggggc aggacgctgg ctgcggccgt 60 ggcggcgacg actactcaga ggacgaaggc gacagcagcg tgtccagggc ggctgtggag 120 gtgttcggga agctgaagga cctaaactgc cccttcctcg agggtctgta tatcacagag 180 ccaaagacaa ttcaggaact gctgtgcagc ccctcagagt accgcttgga gatcctagag 240 tggatgtgta cccgggtctg gccctcactg caggacaggt tcagctcact gaaaggggtc 300 ccaacagagg tgaagatcca agaaatgacg aagctgggcc acgagctgat gctgtgtgcg 360 ccagatgacc aggagctcct caagggctgt gcctgcgccc agaagcagct acacttcatg 420 gaccagttgc tcgataccat ccggagcctg accattgggt gctccagttg ctcgagcctg 480 atggagcact tcgaggacac cagggagaag aacgaggcct tgctggggga gctcttctct 540 agcccccacc tgcagatgct cctgaatcca gagtgcgacc cgtggcccct ggacatgcag 600 cccctcctca acaagcagag tgatgactgg cagtgggcca gtgcctctgc caagtccgag 660 gaggaggaga agctggcgga gottgccagg cagctgcagg agagtgctgc caagttgcac 720 gcgcttagaa cggagtactt tgcacagcat gagcaagggg ctgctgcggg cgcagccgac 780 atcagcaccc tagaccagaa gctgcgtctg gtcacttccg acttccacca gctaatcttg 840 gcttttctcc aagtctacga cgacgagctg ggcgagtgct gccagcgccc aggccctgac 900 ctccacccgt gcggccccat catccaggcc acgcaccaga atctgacttc ctacagccaa 960 atccccagag gccaacctaa aaagccggct ttagttacga tgactacagt tcccacgtgc 1020 gcaactctgc cettggotca aggattccgt gatgttcatt ttggttttct aagcgagagg 1080 ctccgagcct tccaacctct gactggctgg tcctgtgaga cccctcgatc agggatgctg 1140 ctgcaagtgg tcatggcagt tgctgacacc tctgcgaagg ccgtggagac cgtgaagaag 1200 cagcaaggcg agcagatctg ctggggtggc agcagctccgtcatgagtct agctaccaag 1260 atgaatgaac taatggagaa atagaaagtc ttcagtgatg gcctacgcca aagcacagga 1320 tggggcgggc aggaagccct ctcccaagat cgagttggcc gaggatggat gattgtggca 1380 gcagaagccg ttgcagcccc acgttgtgct ctaggcagct gggggcgggc tgcggccgct 1440 gattaaaggc cgcctagagc agcctgtgtg gcgacaggtg cccagaagcc caggaagccg 1500 gtcagtgccc gccccagttt gaggacttgc tatccccgtg ggaacatcac catgtccgag 1560 gcaccccggg ccgagacctt tgtcttcctg gacctggaag ccactgggct ccccagtgtg 1620 gagcccgaga ttgccgagct gtccctcttt gctgtccacc gctcctccct ggagaacccg 1680 gagcacgacg agtctggtgc cctagtattg ccccgggtcc tggacaagct cacgctgtgc 1740 atgtgcccgg agcgcccctt cactgccaag gccagcgaga tcaccggcct gagcagtgag 1800 ggcctggcgc gatgccggaa ggctggcttt gatggcgccg tggtgcggac gctgcaggcc 1860 ttcctgagcc gocaggcagg gcccatctgc cttgtggccc acaatggctt tgattatgat 1920 ttccccctgc tgtgtgccga gctgcggcgc ctgggtgccc gcctgccccg ggacactgtc 1980 tgcctggaca cgctgccggc cctgcggggc ctggaccgcg cccacagcca cggcacccgg 2040 gcccggggcc gccag ta cagcctcggc agcctcttcc accgctactt ccgggcagag 2100 ccaagcgcag cccactcagc cgagggcgac gtgcacaccc tgctcctgat cttcctgcac 2160 cgcgccgcag agctgctcgc ctgggccgat gagcaggccc gtgggtgggc ccacatcgag 2220 US 2021/0002656 A1 Jan. 7 , 2021 16

- continued cccatgtact tgccgcctga tgaccccagc ctggaggcct ga 2262

< 210 > SEQ ID NO 7 < 211 > LENGTH : 1458 < 212 > TYPE : DNA < 213 > ORGANISM : artficial sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : single chain Trex2 coding sequence < 400 > SEQUENCE : 7 atgggttccg aggcaccccg ggccgagacc tttgtcttcc tggacctgga agccactggg 60 ctccccagtg tggagcccga gattgccgag ctgtccctct ttgctgtcca ccgctcctcc 120 ctggagaacc cggagcacga cgagtctggt gccctagtat tgccccgggt cctggacaag 180 ctcacgctgt gcatgtgccc ggagcgcccc ttcactgcca aggccagcga gatcaccggc 240 ctgagcagtg agggcctggc gcgatgccgg aaggctggct ttgatggcgc cgtggtgcgg 300 acgctgcagg ccttcctgag ccgccaggca gggcccatct gccttgtggc ccacaatggc 360 tttgattatg atttccccct gctgtgtgcc gagctgcggc gcctgggtgc ccgcctgccc 420 cgggacactg tctgcctgga cacgctgccg gccctgcggg gcctggaccg cgcccacagc 480 cacggcaccc gggcccgggg ccgccagggt tacagcctcg gcagcctctt ccaccgctac 540 ttccgggcag agccaagcgc agcccactca gccgagggcg acgtgcacac cctgctcctg 600 atcttcctgc accgcgccgc agagctgctc gcctgggccg atgagcaggc ccgtgggtgg 660 gcccacatcg agcccatgta cttgccgcct gatgacccca gcctggaggc gactcctcca 720 cagaccggtc tggatgttcc ttactccgag gcaccccggg ccgagacctt tgtcttcctg 780 gacctggaag ccactgggct ccccagtgtg gagcccgaga ttgccgagct gtccctcttt 840 gctgtccacc gctcctccct ggagaacccg gagcacgacg agtctggtgc cctagtattg 900 ccccgggtcc tggacaagct cacgctgtgc atgtgcccgg agcgcccctt cactgccaag 960 gccagcgaga tcaccggcct gagcagtgag ggcctggcgc gatgccggaa ggctggcttt 1020 gatggcgccg tggtgcggac gctgcaggcc ttcctgagcc gccaggcagg gcccatctgc 1080 cttgtggccc acaatggctt tgattatgat ttccccctgc tgtgtgccga gctgcggcgc 1140 ctgggtgccc gcctgccccg ggacactgtc tgcctggaca cgctgccggc cctgcggggc 1200 ctggaccgcg cccacagcca cggcacccgg gcccggggcc gccagggtta cagcctcggc 1260 agcctcttcc accgctactt ccgggcagag ccaagcgcag cccactcagc cgagggcgac 1320 gtgcacaccc tgctcctgat cttcctgcac cgcgccgcag agctgctcgc ctgggccgat 1380 gagcaggccc gtgggtgggc ccacatcgag cccatgtact tgccgcctga tgaccccago 1440 ctggaggcgg ccgactga 1458

< 210 > SEQ ID NO 8 < 211 > LENGTH : 85 < 212 > TYPE : DNA < 213 > ORGANISM : Nicotiana tabaccum < 400 > SEQUENCE : 8 gatcgcagat co gggtac ccgggatcct go gacg ctagggataa cagggtaata 60 cagattcgag cccaattcat aaatt 85 US 2021/0002656 A1 Jan. 7 , 2021 17

- continued < 210 > SEQ ID NO 9 < 211 > LENGTH : 83 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 9 gatcgcagat ccccgggtac ccgggagcct gcagtcgacg ctagggaaca gggtaataca 60 gattcgagcc caattcataa att 83

< 210 > SEQ ID NO 10 < 211 > LENGTH : 81 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 10 gatcgcagat coccgggtac ccgggatcct gcagtcgacg ctagggcagg gtaatacaga 60 ttcgagccca attcataaat t 81

< 210 > SEQ ID NO 11 < 211 > LENGTH : 80 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 11 gatcgcagat ccccgggtac ccgggagcct gcagtcgacg ctagggaggg taatacagat 60 tcgagcccaa ttcataaatt 80

< 210 > SEQ ID NO 12 < 211 > LENGTH : 78 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nuclei acid < 400 > SEQUENCE : 12 gatcgcagat ccccgggtac ccgggatcct gcagtcgacg ctacagggta atacagattc 60 gagcccaatt cataaatt 78

< 210 > SEQ ID NO 13 < 211 > LENGTH : 76 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 13 gatcgcagat coccgggtac ccgggatcct gcagtcgacg ctagggtaat acagattega 60 gcccaattca taaatt 76

< 210 > SEQ ID NO 14 < 211 > LENGTH : 68 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid US 2021/0002656 A1 Jan. 7 , 2021 18

- continued

< 400 > SEQUENCE : 14 gatcgcagat ccccgggtac ccgggatcct gcagtcgacg ctacagattc gagcccaatt 60 cataaatt 68

< 210 > SEQ ID NO 15 < 211 > LENGTH : 65 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 15 gatcgcagat ccccgggtac ccgggatcct gcagtcgacg cagattcgag cccaattcat 60 aaatt 65

< 210 > SEQ ID NO 16 < 211 > LENGTH : 26 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 16 gatcgcagga gcccaattca taaatt 26

< 210 > SEQ ID NO 17 < 211 > LENGTH : 30 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 17 gatcgcagat togagcccaa ttcataaatt 30

< 210 > SEQ ID NO 18 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 18 gatcgcagat 10

< 210 > SEQ ID NO 19 < 211 > LENGTH : 96 < 212 > TYPE : DNA < 213 > ORGANISM : Nicotiana benthamiana < 400 > SEQUENCE : 19 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttatttc 60 ataagctatg tcatgctggg tcagattgga actcct 96

< 210 > SEQ ID NO 20 < 211 > LENGTH : 93 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid US 2021/0002656 A1 Jan. 7 , 2021 19

- continued

< 400 > SEQUENCE : 20 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttattta 60 agctatgtca tgctgggtca gattggaact cct 93

< 210 > SEQ ID NO 21 < 211 > LENGTH : 92 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 21 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttatttt 60 gctatgtcat gctgggtcag attggaactc ct 92

< 210 > SEQ ID NO 22 < 211 > LENGTH : 91 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 22 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttaaaag 60 ctatgtcatg ctgggtcaga ttggaactcct 91

< 210 > SEQ ID NO 23 < 211 > LENGTH : 90 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 23 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttatttc 60 tatgtcatgc tgggtcagat tggaactcct

< 210 > SEQ ID NO 24 < 211 > LENGTH : 88 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 24 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttatcta 60 tgtcatgctg ggtcagattg gaactcct 88

< 210 > SEQ ID NO 25 < 211 > LENGTH : 88 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 25 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttattta 60 tgtcatgctg ggtcagattg gaactcct 88 US 2021/0002656 A1 Jan. 7 , 2021 20

- continued

< 210 > SEQ ID NO 26 < 211 > LENGTH : 87 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 26 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tataagctat 60 gtcatgctgg gtcagattgg aactcct 87

< 210 > SEQ ID NO 27 < 211 > LENGTH : 85 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 27 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca ttttttatgt 60 catgctgggt cagattggaa ctcct 85

< 210 > SEQ ID NO 28 < 211 > LENGTH : 82 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 28 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttattat 60 gctgggtcag attggaactc ct 82

< 210 > SEQ ID NO 29 < 211 > LENGTH : 79 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 29 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttocact atgtcatgct 60 gggtcagatt ggaactcct 79

< 210 > SEQ ID NO 30 < 211 > LENGTH : 77 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 30 attaatttct aatggagtag tttagtgtaa taaagttagc ttgttccaca tttttattgg 60 gtcagattgg aactcct 77

< 210 > SEQ ID NO 31 < 211 > LENGTH : 40 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence US 2021/0002656 A1 Jan. 7 , 2021 21

- continued

< 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 31 tttcataagc tatgtcatgctgggtcagat tggaactcct 40

< 210 > SEQ ID NO 32 < 211 > LENGTH : 90 < 212 > TYPE : DNA < 213 > ORGANISM : Nicotiana benthamiana < 400 > SEQUENCE : 32 atgaacaaga aaaagctgaa aattcttgtt tctctcttcg ctctcaactc aatcactctc 60 tatctctact tctcttccca ccctgatcac 90

< 210 > SEQ ID NO 33 < 211 > LENGTH : 58 < 212 > TYPE : DNA < 213 > ORGANISM : Nicotiana benthamiana < 400 > SEQUENCE : 33 gtttctctct tcgctctcaa ctcaatcact ctctatctct acttctcttc ccaccctg 58

< 210 > SEQ ID NO 34 < 211 > LENGTH : 56 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 34 gtttctctct tcgctctcaa ctcaatcact ctatctctac ttctcttccc accctg 56

< 210 > SEQ ID NO 35 < 211 > LENGTH : 53 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 35 gtttctctct tcgctctcaa ctcaatcata tctctacttc tcttcccacc ctg 53

< 210 > SEQ ID NO 36 < 211 > LENGTH : 52 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 36 gtttctctct tcgctctcaa ctcaatctat ctctacttct cttcccaccc tg 52

< 210 > SEQ ID NO 37 < 211 > LENGTH : 50 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 37 gtttctctct tcgctctcaa ctctctatct ctacttctct tcccaccctg 50 US 2021/0002656 A1 Jan. 7 , 2021 22

- continued

< 210 > SEQ ID NO 38 < 211 > LENGTH : 46 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 38 gtttctctct tcgctctcaa ctcaatctac ttctcttccc accctg 46

< 210 > SEQ ID NO 39 < 211 > LENGTH : 43 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 39 gtttctctct tcgctctcaa ctcaatcatc tcttcccacc ctg 43

< 210 > SEQ ID NO 40 < 211 > LENGTH : 42 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 40 gtttctctct tcgctctcaa ctcaatcact cttcccaccc tg 42

< 210 > SEQ ID NO 41 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 41 gtttctctct tcgctctact tctcttccca ccctg 35

< 210 > SEQ ID NO 42 < 211 > LENGTH : 30 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 42 gtttctatct ctacttctct tcccaccctg 30

< 210 > SEQ ID NO 43 < 211 > LENGTH : 26 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 43 gtttctctac ttctcttccca tg 26

< 210 > SEQ ID NO 44 < 211 > LENGTH : 58 US 2021/0002656 A1 Jan. 7 , 2021 23

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Nicotiana benthamiana < 400 > SEQUENCE : 44 gtttctctct tcgctctcaa ctcaatcact ctctatctct acttctcttc ccaccctg 58

< 210 > SEQ ID NO 45 < 211 > LENGTH : 54 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 45 gtttctctct tcgctctcaa ctcaatctct atctctactt ctcttcccac cctg 54

< 210 > SEQ ID NO 46 < 211 > LENGTH : 53 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 46 gtttctctct tcgctctcaa ctcaatccta tctctacttc tcttcccacc ctg 53

< 210 > SEQ ID NO 47 < 211 > LENGTH : 52 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 47 gtttctctct tcgctctcaa ctcaatctat ctctacttct cttcccaccc tg 52

< 210 > SEQ ID NO 48 < 211 > LENGTH : 51 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 48 gtttctctct tcgctctcaa ctcaatcatc tctacttctc ttcccaccct g 51

< 210 > SEQ ID NO 49 < 211 > LENGTH : 50 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 49 gtttctctct tcgctctcaa ctctctatct ctacttctct toccaccctg 50

< 210 > SEQ ID NO 50 < 211 > LENGTH : 47 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 50 US 2021/0002656 A1 Jan. 7 , 2021 24

- continued gtttctctct tcgctctcaa ctcaatcata cttctcttcc caccctg 47

< 210 > SEQ ID NO 51 < 211 > LENGTH : 46 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 51 gtttctctct tcgctctcaa ctcaatctac ttctcttccc accctg 46

< 210 > SEQ ID NO 52 < 211 > LENGTH : 41 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 52 gtttctctct tctctctatc tctacttctc ttcccaccct g 41

< 210 > SEQ ID NO 53 < 211 > LENGTH : 32 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 53 gtttctctat ctctacttct cttcccaccc tg 32

< 210 > SEQ ID NO 54 < 211 > LENGTH : 29 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : synthetic nucleic acid < 400 > SEQUENCE : 54 gctctatctc tacttctctt cccaccctg 29

< 210 > SEQ ID NO 55 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : consensus < 400 > SEQUENCE : 55 Leu Ala Gly Leu Ile Asp Ala Asp Gly 1 5

What is claimed is : ( iii ) transfecting the plant cell with said purified Cas9 1. À method for targeted genetic modification of a plant endonuclease protein and said guide RNA using biolis genome without inserting exogenous genetic material into tic or protoplast transformation, such that said Cas9 endonuclease introduces one or more double stranded the genome, the method comprising : DNA breaks ( DSB ) in the genome to produce a plant ( i ) providing a plant cell that comprises an endogenous cell or cells having a detectable targeted genomic gene to be modified; modification without the presence of any exogenous ( ii ) providing a purified Cas9 endonuclease protein and a Cas9 genetic material in the plant genome . guide RNA for targeted recognition of the endogenous 2. The method of claim 1 , wherein said one or more DSBs gene; and are repaired by non - homologous end joining (NHEJ ). US 2021/0002656 A1 Jan. 7 , 2021 25

3. The method of claim 1 , wherein introduction of one or 12. The method of claim 1 , wherein said plant cell is from more DSBs in the genome is followed by repair of the one a crop species of alfalfa , barley, bean , corn , cotton , flax , pea , or more DSBs through a homologous recombination mecha rape , rice , rye, safflower, sorghum , soybean , sunflower, nism . tobacco , or wheat . 4. The method of claim 1 , wherein the Cas9 endonuclease 13. The method of claim 12 , wherein said plant cell is further comprises one or more subcellular localization from the genus Nicotiana . domains . 14. The method of claim 12 , wherein said plant cell is 5. The method of claim 4 , wherein the one or more from the species Arabidopsis thaliana . subcellular localization domains comprise an SV40 nuclear 15. The method of claim 1 , wherein transfection is localization signal , an acidic M9 domain of hnRNPA1, a effected through delivery of said purified Cas9 endonuclease PY -NLS motif signal , a mitochondrial targeting signal , or a protein into isolated plant protoplasts . chloroplast targeting signal. 16. The method of claim 1 , wherein transfection is 6. The method of claim 1 , wherein the Cas9 endonuclease effected through delivery of said purified Cas9 endonuclease further comprises one or more cell penetrating peptide protein by biolistic transformation . domains ( CPPs ) . 17. The method of claim 1 , further comprising regener 7. The method of claim 6 , wherein said one or more CPPs ating the plant cell or cells having the detectable targeted comprise a transactivating transcriptional activator ( Tat) genomic modification into a plant. peptide . 18. A kit for targeted genetic modification of a plant 8. The method of claim 6 , wherein said one or more CPPs genome without inserting exogenous genetic material, said comprise a Pep - 1 CPP domain . kit comprising: 9. The method of claim 1 , wherein the Cas9 endonuclease protein is co - transfected with one or more plasmids encod ( i ) one or more Cas9 proteins; ing one or more exonucleases. ( ii ) one or more plant protoplasts or whole cultured plant 10. The method of claim 9 , wherein said one or more cells ; exonucleases comprise a member of the TREX exonuclease and optionally family . ( iii ) one or more DNA plasmid vectors encoding one or 11. The method of claim 10 , wherein the member of the more TREX family exonucleases . TREX exonuclease family is TREX2 .