Dengue Bulletin Volume 31, December 2007
South-East Asia Region Western Pacific Region South-EastSouth-East AAsiasia RegionRegion WesternWestern PPacificacific RegionRegion From the Editor's Desk
he endemicity of dengue fever and dengue haemorrhagic fever (DHF) in Tcountries of the South-East Asia (SEA) and the Western Pacific regions continues to rise. During 2007, in the SEA Region, Indonesia, Thailand and Myanmar contributed 62.89%, 25.14% and 6.10% dengue cases respectively, both in morbidity and mortality. When compared with 2006 and previous years, the number of cases in all three countries showed an increasing trend.
Nepal which reported 25 cases for the first time in 2006 reported only three cases in 2007. DENV-2 was found to be circulating in Nepal.
In view of this scenario, WHO developed the biregional Asia-Pacific Strategic Plan (2008–2015) for Prevention and Control of Dengue in 2007. The thrust of this plan will be to strengthen systems in countries to predict and prevent epidemics, improve early recognition and management of cases, support prevention of dengue through integrated vector management and on community participation and research.
The current Volume 31 (2007) of Dengue Bulletin includes contributions from WHO's SEA Region (5); the Western Pacific Region (8); and the American Region (4).
We now invite contributions for Volume 32 (2008). The deadline for receipt of contributions is 30 November 2008. Contributors are requested to please follow the instructions carefully while preparing their manuscripts. Contributions accompanied by CD-ROMs using MS Word for Windows should be sent to the Editor, Dengue Bulletin, WHO/Regional Office for South-East Asia, Mahatma Gandhi Road, I.P. Estate, Ring Road, New Delhi-110002, India, or by e-mail as a file attachment to the Editor at [email protected] and [email protected]. Readers desirous of obtaining copies of Dengue Bulletin may contact the WHO Regional Offices in New Delhi, India or Manila, Philippines or the WHO Country Representative in their country of residence.
Dr Chusak Prasittisuk Coordinator, Communicable Diseases Control (CDC) and Editor, Dengue Bulletin World Health Organization Regional Office for South-East Asia New Delhi, India Dengue Bulletin Volume 31, December 2007
South-EastSouth-East AAsiasia RRegionegion WesternWestern PacificPacific RegionRegion ISSN 0250-8362 © World Health Organization 2007 Publications of the World Health Organization enjoy copyright protection in accordance with the provisions of Protocol 2 of the Universal Copyright Convention. For rights of reproduction or translation, in part or in toto, of publications issued by the WHO Regional Office for South-East Asia, application should be made to the Regional Office for South-East Asia, World Health House, Indraprastha Estate, New Delhi 110002, India. The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the Secretariat of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. The views expressed in this publication are those of the authors and do not necessarily reflect the decisions or stated policy of the World Health Organization; however they focus on issues that have been recognized by the Organization and Member States as being of high priority. Printed in India
Indexation: Dengue Bulletin is being indexed by BIOSIS and Elsevier's Bibliographic Databases including, EMBASE, Compendex, Geobase and Scopus Acknowledgements
Editor, Dengue Bulletin, WHO/SEARO, gratefully thanks the following for peer reviewing manuscripts submitted for publication.
In-house Review:
Nand L. Kalra: Reviewed the manuscripts in respect of format check, content, conclusions drawn, including condensation of tabular and illustrative materials for clear, concise and focused presentation and bibliographic references. He was also involved in the final stages of printing of the Bulletin.
Peer reviewers
1. Duane J. Gubler 5. Philip McCall Asia-Pacific Institute of Tropical Vector Research Group Medicine and Infectious Diseases Liverpool Tropical School of Medicine John A. Burns School of Medicine Pembroke Place Honolulu, HI 96813, USA Liverpool, UK E-mail: [email protected] E-mail: [email protected]
2. John G. Aaskov 6. Henry Wilde WHO Collaborating Centre for Division of Research Affairs Arbovirus Reference and Research Faculty of Medicine Queensland University of Technology Chulalongkorn University Brisbane, Queensland Rama IV Road, Bangkok Australia Thailand 10330 E-mail: [email protected] E-mail: [email protected]
3. Eng Eong Ooi 7. Kate L. McElroy Defense Medical and Environmental Molecular Virology and Surveillance Research Institute Laboratory DSO National Laboratories CDC Dengue Branch 27 Medical Drive, #09-01 1324 Calle Cañada Singapore 117510 San Juan, PR 00920 E-mail: [email protected] E-mail: [email protected]
4. V.K. Saxena 8. Pierre F. Guillet Centre for Medical Entomology and Vector Control & Prevention Vector Management Global Malaria Programme National Institute of Communicable WHO, 27 Avenue Appia Diseases CH-1211 Geneva 27 22, Shamnath Marg Switzerland New Delhi 110054, India E-mail: [email protected] E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 iii Acknowledgements
9. Brian Kay 15. Rosemary C. Sang Australian Centre for International and Arbovirology/VHF Laboratory Tropical Health and Nutrition Centre for Virus Research Queensland Institute of Medical Kenya Medical Research Institute Research P. O. Box 54628 Post Office Royal Brisbane Hospital Nairobi, Kenya Brisbane, Queensland E-mail: [email protected] Australia 4029 E-mail: [email protected] 16. Goro Kuno Arboviral Diseases Branch 10. Audrey Lenhart Division of Vector-Borne Infectious Vector Group Diseases Liverpool School of Tropical Medicine National Center for Infectious Diseases Pembroke Place Centers for Disease Control and Liverpool L3 5QA, UK Prevention E-mail: [email protected] Fort Collins, Colorado USA 11. Craig Williams E-mail: [email protected] Sansom Institute School of Pharmacy & Medical Sciences 17. John D. Edman University of South Australia Professor Emeritus GPO Box 2471 Adelaide Department of Entomology South Australia 5000 UC Davis E-mail: [email protected] One Shields Avenue Davis, CA 95616-8584 12. Gavin Screaton USA Imperial College E-mail: [email protected] Hammersmith Hospital Du Cane Road 18. Cameron Simmons London W12 0NN Oxford University Clinical Research Unit E-mail: [email protected] Hospital for Tropical Diseases 190 Ben Ham Tu, District 5 13. Linda S. Lloyd Ho Chi Minh City, Viet Nam Public Health Consultant E-mail: [email protected] 3443 Whittier St. San Diego, CA 92106 19. Alan L. Rothman E-mail: [email protected] Center for Infectious Disease and Vaccine Research 14. Veerle Vanlerberghe University of Massachusetts Medical Epidemiology and Disease Control Unit School Department of Public Health 55 Lake Avenue North Institute of Tropical Medicine Worcester, MA 01655 Nationalestraat 155 USA 2000 Antwerp E-mail: [email protected] Belgium E-mail: [email protected]
iv Dengue Bulletin – Volume 31, 2007 Acknowledgements
20. Daniel Strickman 25. Gerardo Chowell Veterinary, Medical, and Urban School of Human Evolution and Entomology Social Change Agricultural Research Service Arizona State University U.S. Department of Agriculture Box 872402 George Washington Carver Center Tempe, AZ 85287, USA 5601 Sunnyside Avenue E-mail: [email protected] Beltsville, Maryland, 20705 USA 26. Amy Morrison E-mail: [email protected] NMRCD Clinica Naval 21. Timothy P. Endy Av. La Marina con C/Trujillo #951 Infectious Disease Division Punchana, Peru Department of Medicine E-mail: [email protected] SUNY Upstate Medical University 725 Irving Avenue, Suite 304 27. Lourdes Esteva Syracuse, NY 13210 Departamento de Matemáticas USA Facultad de Ciencias E-mail: [email protected] UNAM 04510 México, D.F. Mexico 22. Wej Choochote E-mail: [email protected] Department of Parasitology Faculty of Medicine 28. Dana A. Focks Chiang Mai University Infectious Disease Analysis, LLC Chiang Mai 50200 P.O. Box 12852 Thailand Gainesville, FL 32604 E-mail: [email protected] or 7409 NW 23rd Avenue 23. Ng Lee-Ching Gainesville, FL 32606, USA Environmental Health Institute E-mail: [email protected] National Environment Agency 40 Scotts Road 29. Neal Alexander Environment Building #13-00 Infectious Diseases Epidemiology Unit Singapore 228231 London School of Hygiene and E-mail: [email protected] Tropical Medicine London, UK 24. John T. Roehrig E-mail: [email protected] Arboviral Diseases Branch DVBID, NCZVED, CCID 30. Siripen Kalyanarooj U.S. Centers for Disease Control and WHO Collaborating Centre for Case Prevention Management of Dengue/DHF/DSS 3150 Rampart Road Queen Sirikit National Institute of Fort Collins, CO 80521 Child Health (Children’s Hospital) USA Bangkok, Thailand E-mail: [email protected]; [email protected] E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 v Acknowledgements
31. Morteza Zaim 32. Michael Nathan WHO Pesticide Evaluation Scheme World Health Organization (WHOPES) Headquarters Vector Ecology & Management 20 Avenue Appia Department of Control of Neglected 1211 Geneva 27 Tropical Diseases Switzerland World Health Organization E-mail: [email protected] 20 Avenue Appia CH-1211 Geneva 27 Switzerland E-mail: [email protected]
The quality and scientific stature of the Dengue Bulletin is largely due to the conscientious efforts of the experts and also due to the positive response of contributors to comments and suggestions.
vi Dengue Bulletin – Volume 31, 2007 Epidemic situation of dengue fever in Guangdong province, China, 1990-2005
He Jian-feng* , Luo Hui-ming*, Liang Wenj-jia, Zheng Kui, Kang Min and Liu Li-ping
Guangdong Provincial Center for Disease Control and Prevention, WHO Collaborating Centre for Surveillance, Research and Training of Emerging Infectious Diseases, Guangzhou, China
Abstract
During the period 1990 to 2005, a total of 11 844 cases of dengue fever (DF), with 3 deaths, were reported in Guangdong province. The average attack rate was 1.27/100 000 pop. The disease affected 17 out of 21 cities in the province. DF occurred throughout the year and the epidemic phase extended from July to December. DENV-1, that affected all age groups, appeared to be the predominant circulating virus, although DENV-2, -3 and -4 were also involved. Aedes albopictus was the only vector species responsible for the DF outbreaks. The results of molecular epidemiological studies showed that dengue fever epidemics in Guangdong province were initiated by imported cases from South-east Asia. Control measures comprised of insecticidal fogging and elimination of man-made breeding places of Ae. albopictus.
Keywords: Dengue fever; Epidemiological surveillance; Guangdong; China.
Introduction (DHF). The global prevalence of dengue has increased dramatically in recent decades. As Dengue fever (DF), an acute febrile viral per WHO estimates, DF/DHF is now prevalent disease characterized by sudden onset of fever in over 100 countries, posing a threat to more for 2–7 days (sometimes biphasic), intense than 2.5 billion people in the tropics and [1,2] headache, myalgia, arthralgia, retro-orbital pain, subtropics. anorexia, nausea, vomiting and rash, is one of the most common and widespread vector- In China, in the 1980s, Aedes aegypti was borne arboviral infections in the world. The reported in Hainan island and Leizhou viruses of dengue fever belong to the family peninsula, and caused an epidemic affecting Flaviridae and include four serotypes (DENV- one million people. However, Aedes albopictus, 1, -2, -3, -4), all of which can classically cause another common species of mosquito, is known to be the principal vector of DF in undifferentiated fever, dengue fever and its [3-5] severe form, dengue haemorrhagic fever Guangdong province since 1990. Guangdong
E-mail: [email protected]; Tel.: 86-20-84195466, Fax: 86-20-84193323 *These authors contributed equally to this work.
Dengue Bulletin – Volume 31, 2007 1 Dengue in Guangdong Province, China has been a major province in China affected • Clinical symptoms, such as abrupt by dengue fever outbreaks in addition to Fujian, onset of fever, severe headache, Zhejiang and Jiangsu provinces since 1990.[6] myalgia, arthralgia, nausea, vomiting, rash, etc. Guangdong province had a population of • When only sporadic cases are found 85 million (in 2000).[7] It is located in southern or no local cases have been reported: China in the subtropical zone, which is suitable clinical manifestations of dengue (DF, for mosquito breeding. The first confirmed DHF or DSS) with positive IgG or IgM outbreak of dengue in the province was reported in a single serum specimen. in 1978.[8-9] Since then, dengue fever has become a major public health concern. The • When local cases have been reported: present study focuses on the epidemiological clinical manifestations of dengue (DF, features and molecular characterization of DHF or DSS) with decreased white dengue viruses during 1990–2005. cell count (<4×109/l) and lower thrombocytopenia count (<100×109/l). • The isolation of DENV, by cell culture Materials and methods and virus antigen preparation from culture supernatants of DENV-1, Data sources DENV-2, DENV-3 and DENV-4- infected C6/36 cells.[11] The culture In China, DF is a notifiable disease. Hence, all supernatants were used as the source health care facilities like hospitals and clinics of E/M and NS1 antigens for ELISA. in the country are required to report clinical The control antigen was prepared by and confirmed cases of dengue to the Centers the same procedure from vero cells for Disease Control and Prevention (CDC) culture without viral infection. system: first to the county CDC, which then • Positive test of real-time one-step RT- reports to the provincial CDC. Once these PCR: The nucleotide sequence of notifications are received, the CDC performs DENV-1 E/NS1 gene segment was laboratory verification, then conducts further isolated. Viral RNA was extracted for epidemiological investigation, and searches for use in one-step reverse transcriptase other dengue cases or clusters. polymerase chain reaction (RT-PCR). Following amplification by RT-PCR, the Based on mandatory notification, we partial nucleotide fragments of the E/ collected and analysed all notified cases of NS1 gene junction were then cloned dengue in Guangdong province from 1990 to into the plasmid pbluescript II SK for 2005. However, it is required by law to classify sequencing. The following primers these notifications of dengue into different were used for sequencing: clinical manifestations {DF, DHF, dengue shock syndrome (DSS)}. Both clinical cases and Forward primer: confirmed cases are reported.[10] 5’–GTCGAGCTCGGATCACAAGAAGGAG–3’ Reverse primer: 5’–TGATGGTACCGAGACGAGTGGCTGA–3’ Case definitions The sequence results were analysed using the DNASTAR software. A clinical case of dengue is defined as follows:
2 Dengue Bulletin – Volume 31, 2007 Dengue in Guangdong Province, China
• Positive seroconversion or four-fold Results increase in dengue-specific IgM or IgG antibody from appropriately timed Epidemiological information paired serum (with acute-phase sera collected during day 1–7 after the During the period of 16 years (1990–2005), a onset of symptoms, and early and late total of 11 844 cases of dengue fever and 3 convalescent sera collected during day deaths were reported in Guangdong province 8–13 and day 14–30, respectively). (Table). The notification rates ranged from 0.003 • High-titre dengue-specific IgM and IgG to 9.75 per 100 000 population per year. The antibody in a single serum specimen epidemic peak appeared in 1995. The male-to- where cross-reaction to Japanese female ratio was 1:1.02. All age groups were encephalitis (JE) had been excluded. involved, although most of them (72.07%) were aged 15 to 50 (Figures 1, 2).
Vector surveillance An analysis by occupation indicated that out of the 11 470 reported cases, 2842 were In Guangdong, surveillance of Aedes albopictus workers, 3482 farmers, 1552 students, 749 was carried out throughout the year, particularly office clerks, 711 unemployed and household in areas reporting active cases. The persons and 294 were children. It is noteworthy investigations included search for Aedes that medical staff accounted for 0.92% of the breeding places and determining the cases (106 cases). entomological indices, viz. Breteau index (BI) (number of positive containers for Aedes per 100 houses) and Container index (CI) Seasonal distribution (percentage of containers positive for Aedes The majority of the dengue cases (93%) were breeding) until two weeks after the last local notified from August to October, although cases case was reported. were reported throughout the years (primarily
Figure 1: Epidemic status of dengue fever in Guangdong, 1990–2005
8000 s
e 6000 s a c f o
r 4000 e b m u 2000 N
0 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005
Cases 374 371 2 359 4 6812 2 632 488 304 401 365 1576 82 49 23 Year
Dengue Bulletin – Volume 31, 2007 3 Dengue in Guangdong Province, China
Table: Epidemiological data for dengue fever in Guangdong province, 1990-2005*
*Only three deaths were reported in 1991 with mortality rate of 0.005.
4 Dengue Bulletin – Volume 31, 2007 Dengue in Guangdong Province, China imported cases) (Figure 3). Dengue outbreaks Chaozhou, 8% from Zhaoqing, and 7% from occurred from June to November, with peaks Foshan. The outbreaks occurred in all these during August to October. years with the exception of 1992, 1994, 1996 and 2005. Although multiple outbreaks occurred in Guangzhou, Zhongshan, Foshan, Geographical distribution Chaozhou and Jieyang, there was no place where DF outbreaks occurred over two Approximately 63% of cases were reported consecutive years (Figure 4). from Guangzhou (the Capital city), 10% from
Figure 2: Age composition of dengue cases in Guangdong province, 1990-2005
14.00
12.00
10.00
8.00 % 6.00
4.00
2.00
0.00 0- 5- 10- 15- 20- 25- 30- 35- 40- 45- 50- 55- 60- 65- 70- 75- 80-
Age
CaseCase c compositionomposition PopulationPopulation c compositionomposition
Figure 3: The seasonal dynamics of DF and Aedes albopictus in Guangzhou province
No.No. o off c casesases BI
6000 2.5
5000 2 s
e 4000 s 1.5 a I c f 3000 B o
. 1 o 2000 N 1000 0.5 0 0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Month
Dengue Bulletin – Volume 31, 2007 5 Dengue in Guangdong Province, China
Figure 4: Geographical distribution of dengue fever in Guangdong province, 1990–2005
Dengue virus 2005 has been mapped and it branches into two genotypic groups (Figure 5). The nucleotide In Guangdong, all four serotypes, DENV-1–4, sequences showed maximum homology of caused the dengue outbreaks. With the 99.2% with Indonesian strains, 100% with exception of 1990 and 1993, DENV-1 strains from the Philippines, and 98.8% with appeared to be the predominant circulating strains from Thailand. virus. In addition, DENV-2 and DENV-4 were isolated from patients in Foshan, Zhongshan and Zhuhai city. Many of the index cases of Surveillance of vector these outbreaks were imported from outside Aedes albopictus is a highly urbanized species China. For example, index cases were imported and, in the Guangdong province, it breeds in from China, Macao Special Administrative water stored in man-made containers and Region (SAR), Singapore and Thailand during natural habitats. The seasonal distribution of 2003. All reported cases in 2005 were Aedes albopictus is correlated with a Breteau imported from South-east Asia. index which, in turn, is affected by temperature and rain. In Guangdong, the The phylogenic tree of the density of Aedes albopictus peaked from May sequenced 14 strains of DENV-1 to October, and was very low from November to February.[4] The phylogenic tree of the sequenced 14 strains of DENV-1 isolated between 1990 and
6 Dengue Bulletin – Volume 31, 2007 Dengue in Guangdong Province, China
Figure 5: Phylogenetic tree of DENV-1 isolated in different years and regions from Guangdong province
Discussion A secular trend of increased reporting of dengue outbreak was observed. The developing We have provided the epidemiological economy and rapid urbanization within information of dengue spanning over a period Guangdong have contributed towards increased of 16 years from 1990 to 2005 in Guangdong opportunities for the development and province. Our data sources are based on transmission of DF in the province, especially mandatory notification, which have the intrinsic in the Pearl delta region. Risk factors for DF inadequacies such as incomplete reporting, or epidemic included: (i) the changing lifestyle of false positive results due to cross reaction of people; for example, more people now grow dengue viruses with Japanese encephalitis bonsai and raise fish in tanks near their homes; vaccine viruses. In addition, dengue (ii) more construction sites with poor sanitation notifications in China are not classified by conditions; (iii) frequent travel to and from clinical manifestations (DF, DHF or DSS), a South-east Asia resulting in importation of majority of them are known to be presented viruses, especially the Chaozhou and Shantou; as classical dengue fever. For example, a total (iv) delayed detection and treatment of active of 758 cases of dengue were reported in 1995, disease due to lack of knowledge of DF among of which 12 (1.58%) were DHF.[6] Out of the primary medical staff; and (v) high densities of 978 hospitalized dengue cases in an infectious vector mosquitoes. The vector control mainly disease hospital of Guangzhou in 2002, only covered adult Aedes mosquitoes control, which two were DHF.[12] remains largely an ineffective intervention.
Dengue Bulletin – Volume 31, 2007 7 Dengue in Guangdong Province, China
The evidences from epidemiological albopictus. Thirdly, comprehensive measures investigation and molecular epidemiology of prevention and control including supported the hypothesis that the identified environmental solid waste disposal and dengue cases were imported from other chemical, biological and ecological control countries into Guangdong. The circulating virus should be developed. Lastly, community health strains in an area were usually different in education needs to be strengthened to improve different years, and different virus serotypes awareness of the dengue virus transmission prevailed in different areas in one year. From through Aedes albopictus. 1979 to 1999, the circulating DENV-1 strain belonged to two geno-subtypes. It is likely that From our experience, source reduction and most of these strains were imported from use of non-chemical methods supported by neighbouring countries such as the Philippines, intersectoral and community participation are Indonesia and Thailand, where indigenous the most potential methods for control of dengue epidemics have been confirmed. The dengue during interepidemic periods. The results of nucleotide sequencing showed that Breteau index is the most important indicator DENV-1 was closely related to viruses identified to predict impending dengue outbreaks in this in these regions. High mosquito density and province. Maintaining lower BI levels (below favourable natural conditions (such as optimal 5) is a very effective measure to prevent and temperature and rainfall) are responsible for control dengue outbreaks. Further studies are localized outbreaks, once dengue viruses are required to determine the BI cut-off value for imported into the province.[13] mosquito control to prevent DF outbreaks.
For building up an early response to outbreaks, it is necessary to improve diagnostic Acknowledgment capacity and strengthen training and reporting The authors thank local health department awareness of local physicians, particularly in employees who provided epidemiological and early detection, diagnosis, notification and laboratory data. The authors also thank the isolating patients. Secondly, it is important to support of Chin-Kei Lee and Ms Andrea establish a vector monitoring system to Boudvill of the World Health Organization. understand population dynamics of Aedes
References
[1] World Health Organization. Strengthening [4] Huiming L, editor. Manual of dengue fever implementation of the global strategy for dengue prevention, control and treatment. Standard fever/dengue haemorrhagic fever. report of the Press of China, 2002. informal consultation, 18-20 October 1999. Geneva: 2001. Document WHO/CDS/(DEN)/ [5] Guijiao L, Youchan G, Bao-yan W, Ye T. An IC/2000.1. analysis of epidemic of dengue fever in Zhongshan city. Chin J Dis Control Prev. 2004; [2] Monath TP. Dengue: the risk to developed and 8(5): 396-398. developing countries. Proc Natl Acad Sci U S A. 1994 Mar 29; 91(7): 2395-400. [6] Wenjie W. Control of dengue/dengue haemorrhagic fever in China. Dengue Bulletin. [3] Baolin L. The problem of the method selection 1997; 21: 25-29. in mosquito control. Chinese Journal of Vector Biology and Control, 1997, 8: I-V.
8 Dengue Bulletin – Volume 31, 2007 Dengue in Guangdong Province, China
[7] Population Census Office of Guangdong [11] Tesh RB. A method for the isolation and province. Tabulation of the 2000 population identification of dengue viruses, using mosquito census of Guangdong province. Beijing: China cell cultures. Am J Trop Med Hyg. 1979 Nov; Statistics Office, 2002. 28(6): 1053-9. [8] Zhao HL, Luo QH, Shen G. The epidemiology [12] Luo H, He J, Zheng K, Li L, Jiang L. Analysis on of dengue outbreak in Shiwanjheu, Nanhai the epidemiologic features of dengue fever in county, Guangdong province., China. Med Guangdong province, 1990-2000. Zhonghua Jour. 1981; 61(8): 466-469. Liu Xing Bing Xue Za Zhi. 2002 Dec; 23(6): 427-30. Chinese. [9] Zao ZG, Lin HZ. Report and analysis of dengue and dengue haemorrhagic fever 1980-86. [13] Yanqing C, Fuchun Z, Jian W. Clinical Special publication on dengue. Hainan Medi. characteristics analysis of 978 patients with 1986; 36: 60-66. Chinese. dengue fever in Guangzhou areas. J Tropical Medicine. 2003 Jun; 3(2): 190-192. Chinese. [10] Hao R, Luo H, Peng W, et al. Diagnosis criteria and treatment principles for dengue fever. Beijing: Publishing House of China; 2002. p728.
Dengue Bulletin – Volume 31, 2007 9 A clinical, epidemiological and virological study of a dengue fever outbreak in Guangzhou, China – 2002-2006
Fuchun Zhanga , Xiaoping Tanga, Xuchu Hub, Yecheng Lua, Yanqing Chena, Jian Wanga, Wanshan Chena and Haolan Hea
aDepartment of Infectious Diseases, Guangzhou No. 8 People’s Hospital, Guangzhou, 510060, China bDepartment of Parasitology, Zhongshan Medical College of Sun Yat-sen University, Guangzhou, 510060, China
Abstract
We analysed the clinical and epidemiological characteristics of dengue fever (DF) during the dengue virus (DENV)-1 outbreak in Guangzhou, China. Clinical and epidemiological data of 1342 patients with DF from May 2002 to November 2006 were analyzed retrospectively. The average age was 34.7±13.2 years. The ratio of male to female was 1.05:1. The peak time of the epidemic lasted from August to October. The most common manifestations included fever (100%), headache (85.9%), myalgia (64.5%), bone soreness (46.6%), fatigue (78.2%), skin rash (65.9%) and positive tourniquet test (51.3%). Leukopenia, thrombocytopenia, elevated alanine aminotransferase (ALT), elevated aspartate aminotransferase (AST) and hypopotassemia were found in 66%, 61.3%, 69%, 85.7% and 28.4% of the patients respectively. Only 2(0.15%) patients fulfilled the WHO case definition criteria for dengue haemorrhagic fever (DHF), the others were all diagnosed as classic DF. However, 64(4.8%) patients had severe clinical manifestations (internal haemorrhage, shock, marked thrombocytopenia, myocarditis, sepsis, pneumonia and encephalopathy). Anti-dengue IgM was detected in 90% of patients. Dengue viruses were isolated using the Aedes albopictus C6/36 cell line and identified as DENV-1 by RT-PCR. A 346bp fragment from RT-PCR product of every isolate was sequenced to compare with published sequences of other DENV-1 viruses. The nucleotide homology were 97%, 97% and 98% compared with those of DENV-1 strains of dengue fever outbreak in Cambodia, in 1997 and 1999 in China, respectively. In conclusion, the epidemic of dengue fever was caused by DENV-1 infection from 2002 to 2006 in Guangzhou. Patients with severe clinical manifestations are few, but in some of them, the diagnosis of DHF may be missed if the WHO classification is strictly applied, especially in adults.
Keywords: Dengue fever; DENV-1, Severe dengue; Epidemiological and clinical characteristics.
Introduction important emerging public health problems in the tropics and subtropics. In the past 20 years, Dengue fever (DF) is an acute febrile viral there has been a dramatic increase in the disease frequently presenting with headaches, number of cases and the severity of illness in bone or joint and muscular pains, rash and countries in South-East Asia, the Caribbean and [1,2] leukopenia. DF has become one of the most Latin America. An estimated 50-100 million
E-mail: [email protected]
10 Dengue Bulletin – Volume 31, 2007 Dengue fever outbreak in Guangzhou, China – 2002-2006 people across the globe contract dengue initially enrolled in this study. Eighteen patients annually, with about 500 000 persons developing which were imported cases in 2004-2005 were the more severe dengue haemorrhagic fever/ excluded. Thus, 1342 patients (978 in 2002, dengue shock syndrome (DHF/DSS) and 54 in 2003, and 310 in 2006) were analysed resulting in about 21 000 deaths.[3] in Guangzhou where dengue was endemic.
WHO classifies symptomatic dengue virus In all patients, a detailed history was taken infection into three categories: undifferentiated and clinical examination was done at the time fever, classic dengue fever, and DHF.[3] of admission and subsequently during the stay According to WHO criteria, DHF is defined by at the hospital. The hospital records for all the presence of fever, a haemorrhagic tendency, patients were supported by serological and/or thrombocytopenia, and some evidence of virological confirmation. Serology was plasma leakage. DHF is further subdivided, with performed by indirect ELISA, and/or most severe cases categorized as DSS, when immunochromatographic test (ICT), and dot circulatory failure is present. The WHO immunobinding assay (DIBA) for specific IgM. classification system has been widely applied in research settings and publications. In recent years, several studies reported difficulties with Virus isolation classification, especially in adults with many severe cases being missed: more than two thirds We collected 85 blood samples within five days of all adults with severe dengue manifestations after onset (36 samples were obtained in 2002, were not classified as having DHF.[4-7] 18 samples in 2003, and 41 samples in 2006). Virus was isolated by Aedes albopictus mosquito The first dengue case in Guangdong was C6/36 cell micromethod. The patient blood reported in 1978. Infections with all 4 dengue serum was diluted with RPMI 1640 containing virus serotypes (DENV-1, 2, 3, and 4) were 2% FBS to an appropriate concentration and reported in Guangdong.[8] The first dengue inoculated into the C6/36 cells. The C6/36 cells outbreak was caused by DENV-3 in 1980. Since were incubated at 28 °C, 5% CO2 for 21 days. then, increasing larger outbreaks have been Cultures were monitored for cytopathic effect documented throughout the 1980s and the (CPE) daily under the inverted phase contrast 1990s, caused by DENV-1, DENV-2, and DENV- microscope. The inoculated cells were 4. In this paper, we present a retrospective passaged once a week. Those with CPE were analysis of 1342 patients to analyse the judged as positive for dengue virus, while those epidemiological, clinical, laboratory and without CPE after passaging three times were virological presentations of the dengue infection declared negative.[9] from 2002 to 2006 in Guangzhou, China. RT-PCR, DNA purification and Materials and methods sequencing Viral RNA was extracted from the culture Patients and investigative methods supernatants of infected C6/36 with an improved sodium iodide method. Nucleotides The study was conducted from May 2002 to encoding a fragment of the NS2 gene were November 2006 at the Guangzhou No. 8 amplified using RT-PCR. The amplification People’s Hospital. A total of 1360 patients were parameter was as follows: 93° 40s, 55° 45s,
Dengue Bulletin – Volume 31, 2007 11 Dengue fever outbreak in Guangzhou, China – 2002-2006
72° 60s, thirty cycles. The products of RT-PCR Result were then analysed by 1.5% agarose (including ethidium bromide) electrophoresis. The universal primer sequences were P 5’- Patients’ characteristics and GACATGGGGTATTGGAT-3’, P 5’- geographical and time distribution TCCATCCCATACCAGCA-3’, which result in an of dengue outbreak amplification product of 413bp. DENV-1-type specific primer sequences were D1S 5’- During the study period, we observed a total of GTTGTTCCGCAGACTA-3’, D1C 5’- 1342 patients (687 male and 655 female, male/ CATGGTTAGTGGTTTG -3’, and the expected female ratio = 1.05:1). The involvement of all size of the amplification product was 346bp. age groups, especially an adult predominance, The DENV and DENV-1, 2, 3, 4-type specific was observed. The mean age of the patients primers were provided by Institute of Military was 34.4±13.1 years and most of them belonged Medicine in Joint-Service Department of to the 20~29-year age group; less than 15% Guangzhou Military Region. The bands of patients were children (Figure 1). predicted size were cut and purified using a Golden Bead Product Purification Kit (Songon, Figure 1: Age groups distribution in 1342 China) according to the manufacturers’ patients with dengue fever instructions. Purified PCR products were cloned on to pMD18-T Vector (TaKaRa, Japan) and 25 23.4 delivered to TaKaRa Biotechnology Co. Ltd. 20.2 20 [10] 16.2 for sequencing. 14.3
) 15
%
(
t 9.8
n
e 10 8.2
c
r
e 5.4
PercentP (%) Sequences analysis 5 2.5 0 0- 10- 20- 30- 40- 50- 60- 70-
Sequence homology searches within the AgeAge g groupsroups GenBank gene database were performed using NCBI BLASTn. In addition, CLUSTALX and TREEVIEW software were used to analyse sequence homology, and constructed its system Geographical and time distribution cladogram. The DENV-1 international and of dengue outbreak domestic reference strains are as follows: Singapore strain(S275/90), Cambodia strain Dengue fever cases were observed to be (Cambodia), West Pacific Ocean strain distributed in all 12 districts of Guangzhou. (WestPac), Thai strain (TH-Sman), Peruvian There were 872(65%) patients in the strain (Peru), Nauru strain (Nauru), Hawaian predominant outbreak spots where the number standard strain (Hawaii), and Guangdong 1995 of DF cases was above 10. strain (GD23/95), 1997 strain (GD14/97), 1999 epidemic strain (GD05/99). The peak time of the epidemics was from August to October each year. The number of cases in September reached its maximum, with Statistics analyses 587 hospitalized cases, which constituted 43.7% of the total cases. All data were analysed using the SPSS10.0 software package.
12 Dengue Bulletin – Volume 31, 2007 Dengue fever outbreak in Guangzhou, China – 2002-2006
Clinical and laboratory feature hypotension or narrow pulse pressure along with clinical signs of shock designates DSS.[3] Of the 1342 DF patients observed from the On the basis of strict WHO criteria, only onset of acute fever, a majority of the cases 2(0.15%) patients had DHF. However, we had the typical signs and symptoms of DF, that found that 64(4.8%) cases had severe clinical included fever (100%), headache (85.9%), manifestations, including 50(3.7%) cases who myalgia (64.5%), bone soreness (46.6%), fatigue had internal haemorrhage consisting of (78.2%), skin rash (65.9%), lymphadenectasis gastrointestinal tract bleeding (n=34) and/or (11.5%), splenohepatomegalia (8.4%), petechia hypermenorrhea or ecchymosis, as well as rare (24.6%), positive tourniquet test (51.3%), complications such as myocarditis (n=9), internal haemorrhage (3.7%) and pleural encephalopathy (n=5), shock (n=12), sepsis effusion (0.22%), as shown in Figure 2. (n=9), and pneumonia (n=4). Four of the 12 patients with shock did not manifest bleeding According to the WHO criteria, the signs. diagnosis of DHF requires the presence of all 4 manifestations, i.e. fever, platelet count less As shown in the Table, most patients had than 100 000 cells/mm3, haemorrhagic either a low WBC or platelet count during the tendency, and evidence of capillary leakage (i.e. acute phase of illness. 224(16.7%) patients had haematocrit increase for more than 20% from marked thrombocytopenia with a platelet count baseline, pleural effusion, ascites, or <50 000 cells/mm, the lowest platelet count hypoproteinemia); the additional presence of was 4500 cells/mm in this case series. Among
Figure 2: Clinical presentation in 1342 patients with dengue fever
pleural effusion internal haemorrhage retro-orbital pain, cough splenohepatomegalia diarrhoea lymphadenectasis petechiae nausea and vomiting bone pain positive tourniquet test myalgia skin rash fatigue headache fever 0 200 400 600 800 1000 1200 1400 1600 The number of patients of every clinical presentation
Dengue Bulletin – Volume 31, 2007 13 Dengue fever outbreak in Guangzhou, China – 2002-2006
Table: Laboratory parameters in 1342 those patients tested, over two thirds of them patients with dengue fever had increased liver enzyme levels, 10.7% and Item Cases (%) 11.8% of the patients had a 5-fold increase in White blood cell count ALT and AST levels respectively. Hypopotassemia <×109/L 886 (66.0) were found in 276 (28.4%) patients. 4~10×109/L 376 (28.0) >×109/L 80 (6.0) Diagnosis of dengue virus infection Blood platelets count <100×109/L 828 (61.3) and identification of DENV-isolated <50×109/L 224 (16.7) strains and sequence analysis ALT elevation 926 (69.0) 40~200 U/L 782 (89.3) In the serological analysis, 1208(90%) patients >200 U/L 144 (10.7) were positive for IgM antibody while AST elevation 1150 (85.7) 467(34.8%) were positive for anti-dengue IgG. 40~200 U/L 992 (88.2) Forty-four virus isolations (51.7%) were >200 U/L 158 (11.8) made from the blood samples of 85 cases CK elevation 404 (30.1) which were inoculated in C6/36 cells. RT- LDH elevation 611 (45.5) PCR amplification from the supernatants of Hypopotassemia (<3.6 umol/L) 276 (28.4) the infected C6/36 cells samples was Total bilirubin elevation 72 (5.4) performed using universal primers, which BUN elevation (>7.1 umol/L) 15 (1.1)
Figure 3: Agarose gel analysis of the cDNA products from RT-PCR samples isolated from the supernatants of the infected C6/36 cells. The expected size of the amplification product was 346bp with DENV-1 type specific primers.
12345
Lane 1: Sample 1 Lane 2: DL 2000 marker (GeneRuler) Lane 3: Sample 2 2000bp Lane 4: Sample 3 1000bp Lane 5: Sample 4 750bp 500bp 250bp 346bp 100bp
14 Dengue Bulletin – Volume 31, 2007 Dengue fever outbreak in Guangzhou, China – 2002-2006 yielded the 413bp fragment, which was then dengue viruses belonged to the DENV-1 virus. used for DENV identification and sequencing. The nucleotide homology of Guangdong All the results were found to be confirmed epidemic strain in 2003 were 97%ÿ97% and DENV-1 positive by DENV-1-specific primer 98% when compared with that of DENV-1 and amplified fragment was 346bp located strain of dengue fever outbreak in Cambodia, on DENV-1 gene group’s NS2a~NS2b site, in 1997 and 1999 in Guangdong respectively see Figure 3. The results confirmed that all (see Figure 4).
Figure 4: Sequence comparison of four DENV-1 isolated strains from Guangdong and Cambodia
GD29/2003 : GTTGTTCCGCAGACTAACATCCAGAGAAGTTCTTCTTCTAACAATTGGATTGAGTC :56 GD14/97 : ...... T...... T...... T...... T...... :56 GD05/99 : A..A...... C.A..A...... C...... :56 Cambodia : a..a...... a..a...... :56:56
GD29/2003 : TAGTGGCATCTGTGGAGTTACCAAATTCCTTGGAGGAGCTGGGGGATGGACTTGCATAGTGGCATCTGTGGAGTTACCAAATTCCTTGGAGGAGCTGGGGGATGGACTTGCA :112 GD14/97 : ...... C...... :112 GD05/99 : ...... :112 Cambodia : ...... :112
GD29/2003 : ATGGGCATCATGATTTTAAAATTATTGACTGACTTTCAATCACATTAGTTGTGGGCATGGGCATCATGATTTTAAAATTATTGACTGACTTTCAATCACATTAGTTGTGGGC :168:168 GD14/97 : ...... T...... T...... G...T..C..C...... G...T..C..C...... :168:168 GD05/99 : ...... C...... C...... :168:168 Cambodia : ...... t...... c..c...... t...... c..c...... :168:168
GD29/2003 : TACCTTGCTGTCCTTGACATTTATCAAAACAACGTTTTCCTTGCACTATGTACCTTGCTGTCCTTGACATTTATCAAAACAACGTTTTCCTTGCACTATGCATGGACATGGA :224:224 GD14/97 : ...... :224:224 GD05/99 : ...... :224:224 Cambodia : ...... :224:224
GD29/2003 : AGACAAAGACAATAGCTATGGTACTGTCAATTGTATCTCTCTTCCCCTTATGCCTGTCCACGTAGCTATGGTACTGTCAATTGTATCTCTCTTCCCCTTATGCCTGTCCACG :280:280 GD14/97 : ...... G...... G...... :280:280 GD05/99 : ...... :280:280 Cambodia : ...... g...... g...... :280:280
GD29/2003 : ACCTCCCAAAAAACAACATGGCTTCCGGTGCTGTTGGGATCTCTTGGATGCAAACCACCTCCCAAAAAACAACATGGCTTCCGGTGCTGTTGGGATCTCTTGGATGCAAACC :336 GD14/97 : ...... A...... A...... :336 GD05/99 : ...... :336 Cambodia : ...... a...... a...... :336
GD29/2003 : ACTAACCATGACTAACCATG :346:346 GD14/97 : ...... :346:346 GD05/99 : ...... :346:346 Cambodia : ...... :346:346
Dengue Bulletin – Volume 31, 2007 15 Dengue fever outbreak in Guangzhou, China – 2002-2006
Discussion All age groups were affected, but over 80% of them were adults. Children aged 0~10 years From May 2002 to November 2006, Guangzhou comprised only 8.2% of the sample. experienced a comparatively large-scale dengue fever outbreak. The case specimens In our study, the patients showed most of collected at different times over four years were the typical clinical features of dengue fever, analysed by virus isolation, RT-PCR gene with only 2(0.15%) patients developing DHF identification and sequencing, confirming that according to the WHO criteria. The incidence this epidemic was caused by DENV-1. The of DHF was much lower in this study, nucleotide homology of the Guangdong compared with the reported 2%~6% in populations in the areas where dengue is epidemic strain in 2003 were 97%, 97%, and [14,15] 98% compared with those of DENV-1 strain of endemic. In an in-vitro experiment, DENV- dengue fever outbreak in Cambodia, in 1997 1 was isolated from samples of DF patients in and 1999 in China, respectively, and these 2002. DENV-1 is not as virulent as the other types of DENV and DENV-1 infection seems strains belonged to the identical gene type. [16,17] The initial cases were imported during the to have mild clinical presentations. epidemic period and subsequently In the present study, a few unusual clinical disseminated locally. Although four serotypes observations and complications such as had been involved in several episodes of the fulminant hepatitis, myocarditis, comparatively large-scale DENV-1 outbreaks encephalopathy, and ophthalmic disease were since 1995,[7,8] DENV-1 was the most observed.[18-23] We found that 64(4.8%) of cases predominant serotype in Guangdong. had severe clinical manifestations including DF, as a mosquito-borne infection, would internal haemorrhage like gastrointestinal tract be expected to spread rapidly in populous bleeding and/or hypermenorrhea or areas, so the presence of a large proportion of ecchymosis, as well as rare complications such patients in downtown is consistent with the as myocarditis, encephalopathy, shock, sepsis, experience elsewhere of dengue infection as and pneumonia. 16.7% of the patients had an urban phenomenon.[11,12] In our study, 65% marked thrombocytopenia with a platelet count of 1342 cases presented in the main outbreak <50 000 cells/mm. More than 10% of the patients had a 5-fold increased liver enzymes. spots in downtown Guangzhou. This DENV-1 [12,18] epidemic occurred in the rainy seasons from Our result is consistent with other reports. August to October when the abundant rainfall In recent years, the validity of the WHO and the temperature favoured high rates of classification scheme to define severe dengue mosquito’s reproduction. Rainfall is considered disease has been found to be inconsistent. to be a risk factor for dengue outbreak, Several studies have found that the WHO especially in urban districts with poor sanitary classification is difficult to apply, with many environment, providing optimal breeding sites severe adult cases being missed.[4-6] Because, for mosquitoes.[13] The main mosquito vector according to the WHO criteria, haemorrhagic for dengue viruses is Ae. albopictus in manifestations without capillary leakage do not Guangdong, which breeds primarily in relatively constitute DHF, the DSS refers to a condition clean, stagnant domestic water containers in which shock is present in addition to all four during the rainy season. DHF-defining conditions. The WHO Our data showed that there was no obvious classification is mainly based on studies of difference in the patients’ gender distribution. children in South-east Asia in the 1960s and
16 Dengue Bulletin – Volume 31, 2007 Dengue fever outbreak in Guangzhou, China – 2002-2006 may therefore not be applicable to of dengue fever and were diagnosed as typical predominantly adult subjects. Shock and plasma DF. But in some patients, the diagnosis of DHF leakage appear to be more common in may be missed if the WHO classification is children, whereas internal haemorrhage is a strictly applied, especially in adults. A new more frequent manifestation in adults. In definition for severe dengue may be needed. addition, the DHF/DSS classification excludes severe dengue disease associated with “unusual manifestations”. Therefore, a new Acknowledgements definition for severe dengue is urgently needed.[24] A large multicentre study should We are grateful to the CDC of Guangzhou and be performed to establish a more robust the CDC of Guangdong province for their dengue classification scheme for use by continuing epidemiological survey and clinicians, epidemiologists and scientists virological laboratory support. This work was involved in dengue pathogenesis research.[6] partially supported by grants from the Foundation of Guangzhou Municipal Science In brief, the DF epidemic in Guangzhou and Technology Bureau. We thank Alfredo from 2002 to 2006 was caused by DENV-1. Garzino-Demo for critically reading this Most cases had the typical clinical manifestation manuscript.
References
[1] Gubler DJ. Dengue and dengue haemorrhagic Organization classification system helpful? Am fever: its history and resurgence as a global J Trop Med Hyg 2004 Feb;70(2):172-9. public health problem. In: Gubler DJ, Kuno G, editors. Dengue and dengue haemorrhagic fever. [6] Deen JL, Harris E, Wills B, Balmaseda A, New York: CAB International; 1997. p.1-23. Hammond SN, Rocha C, Dung NM, Hung NT, Hien TT, Farrar JJ. The WHO dengue [2] Gubler DJ. Dengue and dengue hemorrhagic classification and case definitions: time for a fever. Clin Microbiol Rev. 1998 Jul; 11(3): 480- reassessment. Lancet. 2006 Jul 8; 368(9530): 96. 170-3. [3] World Health Organization. Dengue [7] Luo H, He J, Zheng K, Li L, Jiang L. [Analysis on haemorrhagic fever: diagnosis, treatment, the epidemiologic features of Dengue fever in prevention and control. 2nd edn. Geneva; Guangdong province, 1990-2000]. Zhonghua WHO, 1997. Liu Xing Bing Xue Za Zhi. 2002 Dec; 23(6): 427-30. Chinese. [4] Balmaseda A, Hammond SN, Pérez MA, Cuadra R, Solano S, Rocha J, Idiaquez W, [8] Zhang FC, Chen YQ, Lu YC, Wang J, Chen Harris E. Short report: assessment of the World WS, Hong WX. [Analysis on clinical and Health Organization scheme for classification epidemiological characteristics of 1032 of dengue severity in Nicaragua. Am J Trop patients with Dengue fever in Guangzhou]. Med Hyg. 2005 Dec; 73(6): 1059-62. Zhonghua Liu Xing Bing Xue Za Zhi. 2005 Jun; 26(6): 421-3. Chinese. [5] Phuong CX, Nhan NT, Kneen R, Thuy PT, van Thien C, Nga NT, Thuy TT, Solomon T, [9] Gubler DJ, Kuno G, Sather GE, Velez M, Oliver Stepniewska K, Wills B; Dong Nai Study A. Mosquito cell cultures and specific Group. Clinical diagnosis and assessment of monoclonal antibodies in surveillance for severity of confirmed dengue infections in dengue viruses. Am J Trop Med Hyg. 1984 Jan; Vietnamese children: is the World Health 33(1): 158-65.
Dengue Bulletin – Volume 31, 2007 17 Dengue fever outbreak in Guangzhou, China – 2002-2006
[10] Deubel V, Laille M, Hugnot JP, Chungue E, [18] Wichmann O, Gascon J, Schunk M, Puente Guesdon JL, Drouet MT, Bassot S, Chevrier D. S, Siikamaki H, Gjørup I, Lopez-Velez R, Clerinx Identification of dengue sequences by genomic J, Peyerl-Hoffmann G, Sundøy A, Genton B, amplification: rapid diagnosis of dengue virus Kern P, Calleri G, de Górgolas M, Mühlberger serotypes in peripheral blood. J Virol Methods. N, Jelinek T; European Network on 1990 Oct; 30(1): 41-54. Surveillance of Imported Infectious Diseases. Severe dengue virus infection in travelers: risk [11] Kuno G. Factors influencing the transmission factors and laboratory indicators. J Infect Dis. of dengue viruses. In: Gubler DJ, Kuno G, 2007 Apr 15; 195(8): 1089-96. editors. Dengue and dengue haemorrhagic fever. New York: CAB International; 1997. p. 61- [19] Sumarmo, Wulur H, Jahja E, Gubler DJ, 88. Sutomenggolo TS, Saroso JS. Encephalopathy associated with dengue infection. Lancet. 1978 [12] Brown TU, Babb K, Nimrod M, Carrington Feb 25; 1(8061): 449-50. CVF, Salas RA, Monteil MA. A retrospective study of the 1996 DENV-1 epidemic in [20] Seet RC, Lim EC, Wilder-Smith EP. Acute Trinidad: demographic and clinical features. transverse myelitis following dengue virus Dengue Bulletin. 2004; 28: 7-19. infection. J Clin Virol. 2006 Mar; 35(3): 310- 2. [13] Focks DA, Chadee DD. Pupal survey: an epidemiologically significant surveillance [21] Misra UK, Kalita J, Syam UK, Dhole TN. method for Aedes aegypti: an example using Neurological manifestations of dengue virus data from Trinidad. Am J Trop Med Hyg. 1997 infection. J Neurol Sci. 2006 May 15; 244(1- Feb; 56(2): 159-67. 2): 117-22. [14] Guzmán MG, Kouri G, Valdes L, Bravo J, [22] Poovorawan Y, Hutagalung Y, Chongsrisawat Alvarez M, Vazques S, Delgado I, Halstead SB. V, Boudville I, Bock HL. Dengue virus infection: Epidemiologic studies on Dengue in Santiago a major cause of acute hepatic failure in Thai de Cuba, 1997. Am J Epidemiol. 2000 Nov 1; children. Ann Trop Paediatr. 2006 Mar; 26(1): 152(9): 793-9; discussion 804. 17-23. [15] Shepard DS, Suaya JA, Halstead SB, Nathan [23] Chan DP, Teoh SC, Tan CS, Nah GK, MB, Gubler DJ, Mahoney RT, Wang DN, Rajagopalan R, Prabhakaragupta MK, Chee Meltzer MI. Cost-effectiveness of a pediatric CK, Lim TH, Goh KY; The Eye Institute Dengue- dengue vaccine. Vaccine. 2004 Mar 12;22(9- Related Ophthalmic Complications 10):1275-80. Workgroup. Ophthalmic complications of dengue. Emerg Infect Dis. 2006 Feb; 12(2): [16] Zhang J, Jian R, Wan YJ, Peng T, An J. 285-9. Identification and phylogenetic analysis of DENV-1 virus isolated in Guangzhou, China, [24] Rigau-Pérez JG. Severe dengue: the need for in 2002. Dengue Bulletin. 2004; 28: 135-144. new case definitions. Lancet Infect Dis. 2006 May; 6(5): 297-302. [17] Kalayanarooj S, Nimmannitya S. Clinical and laboratory presentations of dengue patients with different serotypes. Dengue Bulletin. 2000; 24:53-59.
18 Dengue Bulletin – Volume 31, 2007 Circulation of dengue serotypes in five provinces of northern Thailand during 2002-2006
Punnarai Veeraseatakul , Boonrat Wongchompoo, Somkhid Thichak, Yuddhakarn Yananto, Jarurin Waneesorn and Salakchit Chutipongvivate
Clinical Pathology Section, Regional Medical Sciences Centre Chiangmai, Department of Medical Sciences, Ministry of Public Health, 191 M.8 T. Donkaew, Maerim District, Chiangmai 50180, Thailand
Abstract
Dengue haemorrhagic fever is an epidemic infectious diseases caused by dengue virus. It is a major disease prevalent in all provinces of Thailand. This study was to determine the circulating dengue serotypes by reverse transcription polymerase chain reaction (RT-PCR). A total of 1116 seropositive acute samples were analysed from DF/DHF patients in five provinces of northern Thailand (Chiangmai, Lampang, Lamphun, Mae Hong Son and Phrae) during the period January 2002 to December 2006. Five hundred and fifty-nine samples were found positive, of which 47.2%, 30.6%, 18.4% and 3.8% were affected with DENV-2, DENV-1, DENV-4 and DENV-3 respectively. From 2002 to 2005, the predominant dengue serotype was DENV-2, whereas DENV-1 was predominant in 2006. There was an apparent increase in the percentage of DENV-4 from 2005 to 2006. Our results indicated that all four dengue serotypes were circulating in this region and the annual change of predominant serotypes was the cause of the severity of the disease.
Keywords: Dengue haemorrhagic fever; Dengue serotype; Northern Thailand.
Introduction increasingly larger dengue outbreaks have occurred. There were 99 410, 127 189 and Dengue is a mosquito-borne viral infection 114 800 cases of dengue reported to the caused by four distinct dengue virus serotypes Bureau of Epidemiology in 1997, 1998 and [3] DENV-1–4. It is the most prevalent arbovirus 2002 respectively. In 1999, the Ministry of in tropical and subtropical regions of Africa, the Public Health initiated a dengue control Americas, the Eastern Mediterranean, the programme to reduce the incidence rate to [4] Western Pacific and South-East Asia.[1,2] In less than 50 cases/100 000 population. In Thailand, the first dengue outbreak occurred northern Thailand, many provinces are located in Bangkok in 1958, initially in a pattern with a approximately 250–300 metres above the sea 2-year cycle, and subsequently in irregular level, with some urban areas and large rural cycles, as the disease spread throughout the areas. There were 13 915, 11 092, 6147, 6992 country. The largest outbreak was reported in and 6914 dengue cases reported during the 1987, with an incidence rate of 325 cases/ five-year period 2002–2006, with incidence 100 000 population. In recent years, rates of 119.4, 91.5, 51.3, 58.9 and 58.1 cases/
E-mail: [email protected], [email protected]; Fax: 66-53-112192
Dengue Bulletin – Volume 31, 2007 19 Circulation of dengue serotypes in Thailand
100 000 population respectively,[5-8] with 120 Figure 1: Map of five provinces of northern deaths. Thailand
Gubler et al.[9] and Lam et al.[10] reported that virological surveillance, which involves monitoring of dengue virus infection in humans, Mac Hong Son has been used as an early warning system to Chiang Mai predict outbreaks. Such surveillance, based on Lampang Laos the isolation and identification of dengue Lamphun Phrae viruses infecting the human population, North provides an important means of early detection of any change in the prevalence of dengue Northeast Central virus serotypes. Each dengue serotype has East characteristics that affect the nature of dengue Myanmar epidemic and disease severity. Nisalak et al.[11] reported that the predominant dengue serotype South in the outbreaks in Bangkok during 1997–1998 [12] was DENV-3. Anantapreecha et al. detected Malaysia the predominant serotypes DENV-1 and DENV- 2 in six provinces across Thailand during 2001– 2002. However, dengue serotypes in five RNA extraction provinces of northern Thailand have not yet been well elucidated, thus the present study, Viral RNA was isolated by using QIAamp viral which is aimed at clarifying the pattern of RNA Mini Kit (QIAGEN, Cat. no. 52904). circulating dengue serotypes in this region with Briefly, the serum (100 μl) was added and a view to better understand the mixed with 400 μl of AVL/RNA carrier solution epidemiological complexities of the epidemics (lysis buffer). After incubation at room of dengue infection. temperature for 10 min, 400 μl of absolute ehtanol was added to the solution. All the solutions were then transferred to a spin Materials and methods column and were spun at 8000 rpm for 1 min. The RNA was then washed by adding 500 μl of AW1 (washing buffer 1) and spun at 8000 Patients rpm for 1 min and following the same procedure with AW2 (washing buffer 2). Finally, A total of 1116 seropositive acute samples with the RNA was eluted by adding 60 μl of elution positive anti-dengue IgM antibody were buffer and spun at 8000 rpm for 1 min. The analysed for dengue serotype by RT-PCR at eluted RNA was kept in –70 °C until use. the Regional Medical Sciences Centre, Chiangmai (RMSc_CM), Thailand. These samples were collected from DF/DHF patients RT-PCR in five northern provinces that included Chiangmai, Lamphun, Lampang, Mae Hong RT-PCR method was performed as previously Son and Phrae during 2002–2006 (Figure 1). described by Yenchitsomanus et al.[13] Briefly,
20 Dengue Bulletin – Volume 31, 2007 Circulation of dengue serotypes in Thailand
Table 1: Primer sequences of dengue virus 2 was the predominant serotype (47.2% cases), and serotyping by RT-PCR followed by DENV-1 (30.6% cases), DENV-4 Primer Sequence 5’- 3’ (18.4% cases) and DENV-3 (3.8% cases). DUL GCTGTGTCACCCAGAGTGGCCAT The circulation of dengue serotypes in northern DUR TGGCTGGTGCACAGACAATGGTT Thailand by year during 2002-2006 is shown in D1L GGGGCTTCAACATCCCAAGAG Figure 2. From 2002 to 2005, the predominant D1R GCTTAGTTTCAAAGCTTTTTCAC serotype was DENV-2 as 46.0%, 59.7%, 70.3% D2L ATCCAGATGTCATCAGGAAAC and 44.8% of cases were of this serotype, D2R CCGGCTCTACTCCTATGATG respectively, followed by DENV-1 (42.0%, D3L CAATGTGCTTGAATACCTTTGT 32.3% and 25.0% cases) from 2002 to 2004 D3R GGACAGGCTCCTCCTTCTTG respectively and DENV-4 (26.6% cases) in 2005. D4L GGACAACAGTGGTGAAAGTCA In 2006, the predominant serotype had D4R GGTTACACTGTTGGTATTCTCA changed to DENV-1 (42.8% cases), followed by DENV-4 (33.1% cases). DENV-3 was found 5 μl of RNA solution was mixed with reagents to be the least circulating serotype during 2003 of one step RT-PCR kit (QIAGEN, Cat. no. to 2006 and not found at all in 2002. 210212) and specific oligonucleotide primers of dengue-envelope (E) gene; DUL and DUR. The distribution of the predominant dengue The cDNA synthesis was performed at 50 °C serotypes by provinces were analysed when for 30 min in a thermal cycler (MJ research more than five positive dengue virus samples PTC-100, USA) followed by 40 cycles of PCR were detected. In Chiangmai province, the step including 94 °C for 5 min, 94 °C for 1 min, predominant serotypes were DENV-1 (48.7% 45 °C for 1 min and 72 °C (5 min for the last and 56.9% cases) in 2002 and 2006, and DENV- cycle). 1 μl of the primary PCR product was 2 (54.8%, 71.4% and 52.0% cases) in 2003, used as the template for the second PCR with 2004 and 2005 respectively. In Lampang four serotype-specific primer pairs; D1L, D1R, province, the predominant serotypes were D2L, D2R, D3L, D3R, D4L and D4R (Table DENV-2 (100.0%, 62.5%, 79.3% and 40.0% 1). The PCR step was the same as above with cases) from 2002 to 2005 respectively and the annealing temperature set at 62 °C. DENV-1 (72.0% cases) in 2006. In Lamphun Negative and positive dengue controls were province, the predominant serotypes were used. The secondary PCR products were DENV-2 (66.7% and 50.0% cases) in 2002 and analysed in 2% agarose gel electrophoresis and 2004, and DENV-4 (61.8% and 77.8% cases) then visualized by ethidium bromide staining. in 2005 and 2006. In Mae Hong Son province, the predominant serotypes were DENV-2 (75.1% cases) in 2005 and DENV-1 (80.0% Results and discussion cases) in 2006. In Phrae province, the predominant serotype was DENV-2 (50.0% and The number of seropositive acute cases and 38.4% cases) in 2005 and 2006. dengue serotypes in the five provinces during 2002-2006 are shown in Table 2. Five hundred The comparison of the predominant dengue and fifty-nine dengue viral cases were detected serotypes among the five provinces by year with an average positivity rate of 50.0% by RT- was analysed. In 2002, DENV-1 was PCR. All the four dengue serotypes were predominant in one province (Chiangmai) and detected during this study. The total numbers DENV-2 was predominant in two provinces of positive dengue cases were analysed. DENV- (Lamphun and Lampang). In 2003, DENV-2 was
Dengue Bulletin – Volume 31, 2007 21 Circulation of dengue serotypes in Thailand
Table 2: Summary of seropositive dengue cases and dengue serotypes in five provinces of northern Thailand, 2002–2006
predominant in two provinces (Chiangmai and (Phrae) and DENV-4 was predominant in one Lampang). In 2004, DENV-2 was predominant province (Lamphun). This result has shown that in three provinces (Chiangmai, Lamphun and the spread of predominate DENV-2 was Lampang). In 2005, DENV-2 was predominant increasing from two provinces to four provinces in four provinces (Chiangmai, Lampang, Mae during 2002–2005; after that it rapidly Hong Son and Phrae) and DENV-4 was decreased in all provinces. In 2006, DENV-1 predominant in one province (Lamphun). In was predominant in three provinces. This 2006, DENV-1 was predominant in three finding provides an important starting point of provinces (Chiangmai, Lampang and Mae Hong change to predominance from DENV-2 to Son), DENV-2 was predominant in one province DENV-1 in the northern region and was a
22 Dengue Bulletin – Volume 31, 2007 Circulation of dengue serotypes in Thailand
Figure 2: Circulation of dengue serotypes in northern Thailand by year during 2002–2006
Positive dengue Dengue serotype (%) virus (case) 200 80.0
150 60.0
100 40.0
50 20.0
0 0.0 2002 2003 2004 2005 2006 Year
Positive dengue virus DENV-1 DENV-2 DENV-3 DENV-4 predictive indicator of the continuous pattern Conclusion of DENV-1 predominance in the next year. Our study found that all the four dengue From the 1116 seropositive acute samples serotypes were circulating continuously in five collected from confirmed DF/DHF patients provinces of northern Thailand, with one with positive anti-dengue IgM antibody by serotype emerging as the cause of a periodic MAC-ELISA for this study, only 559 (50.0%) dengue infection. These results were similar to cases could be found positive for dengue virus. the ones in the central and north-east regions.[15] It is possible that some patients visited the The pattern of fluctuation in the predominant hospital in the late period of viremia, as it has dengue serotype in our study during 2002–2004 been reported that the samples from patients is DENV-2 as per the annual report of dengue which were collected on fever day 1 were 50% [3,5-6] [14] serotype in Thailand. While DENV-2 was positive for dengue virus. Moreover, other still prominent in 2005 and changed to DENV- factors could be influenced by the outcome of 1 in 2006 as per our study, but DENV-1 was laboratory determination, such as sample initially the main serotype reported during 2005– collection, handling and storage from 2006. It is possible that since the northern region community hospital to the Regional Medical is mostly rural and mountainous area, the spread Sciences Centre, Chiangmai. of the new serotypes was delayed. It is
Dengue Bulletin – Volume 31, 2007 23 Circulation of dengue serotypes in Thailand concordant that DENV-4 was found increasing and future work can focus on using this pattern during 2005–2006, which was first detected in of dengue serotype circulation to develop a August 2005 (data not shown), whereas a predictive model of DF/DHF in Thailand. reported case with DENV-4 was initially detected in Bangkok in April 2005. Our study found that DENV-3 was the least reported serotype. Acknowledgements Nisalak et al. reported that DENV-3 was the least predominant dengue serotype in Bangkok We thank Ms Surapee Anantapreecha, Chief in 1997–1998.[11] of Arbovirus Laboratory at Thai NIH for providing dengue control isolate. We also thank Our study has shown the pattern of dengue Ms Sutheewan Sriuprayo, Director of the virus serotypes in five provinces of northern Regional Medical Sciences Centre, Chiangmai, Thailand from year to year and provided some for her support. This work was supported by a insight into the dengue epidemic situation in grant from the Regional Medical Sciences this region. This information should be Centre, Chiangmai, Department of Medical beneficial in the long-term dengue surveillance, Sciences, Ministry of Public Health, Thailand.
References
[1] Gubler DJ. Dengue and dengue hemorrhagic Nonthaburi: Bureau of Epidemiology, fever. Clin Microbiol Rev. 1998 Jul; 11(3): 480- Department of Disease Control, 2005. 96. [8] Ministry of Public Health, Department of [2] Chusak P, Andjaparidze AG, Kumar V. Current Disease Control, Bureau of Epidemiology, status of DF/DHF in WHO South-East Asia Thailand. Weekly epidemiological surveillance Region. Dengue Bulletin. 1993; 22: 1-11. report. 2006; 37: 898-99. [3] Ministry of Public Health, Thailand. Annual [9] Gubler DJ. Surveillance for dengue and epidemiological surveillance report 2002. dengue hemorrhagic fever. Bull Pan Am Health Nonthaburi: Bureau of Epidemiology, Organ. 1989; 23(4): 397-404. Department of Disease Control, 2002. [10] Lam SK. Two decades of dengue in Malaysia. [4] Kantachuvessiri A. Dengue hemorrhagic fever Trop Med. 1993; 35: 195-200. in Thai society. Southeast Asian J Trop Med Public Health. 2002 Mar;33(1): 56-62. [11] Nisalak A, Endy TP, Nimmannitya S, Kalayanarooj S, Thisayakorn U, Scott RM, [5] Ministry of Public Health, Thailand. Annual Burke DS, Hoke CH, Innis BL, Vaughn DW. epidemiological surveillance report 2003. Serotype-specific dengue virus circulation and Nonthaburi: Bureau of Epidemiology, dengue disease in Bangkok, Thailand from Department of Disease Control, 2003. 1973 to 1999. Am J Trop Med Hyg. 2003 Feb; 68(2): 91-202. [6] Ministry of Public Health, Thailand. Annual epidemiological surveillance report 2004. [12] Anantapreecha S, Chanama S, A- Nonthaburi: Bureau of Epidemiology, nuegoonpipat A, Naemkhunthot S, Sa- Department of Disease Control, 2004. ngasang A, Sawanpanyalert P, Kurane I. Annual changes of predominant dengue virus [7] Ministry of Public Health, hailand. Annual serotypes in six regional hospitals in Thailand epidemiological surveillance report 2005. from 1999 to 2002. Dengue Bulletin. 2004; 28: 1-6.
24 Dengue Bulletin – Volume 31, 2007 Circulation of dengue serotypes in Thailand
[13] Yenchitsomanus PT, Sricharoen P, Jaruthasana Anantapreecha S, Sawanpanyalert P, Kurane I, Pattanakitsakul SN, Nitayaphan S, I. Evaluation of RT-PCR as a tool for diagnosis Mongkolsapaya J, Malasit P. Rapid detection of secondary dengue virus infection. Jpn J Infect and identification of dengue viruses by Dis. 2003 Oct-Dec; 56(5-6): 205-9. polymerase chain reaction (PCR). Southeast Asian J Trop Med Public Health. 1996 Jun; [15] Dengue serotype in Thailand (cited at 5 August 27(2): 228-36. 2007). Available from: URL: http:// www.cclts.org/dengue/index.asp [14] Sa-ngasang A, Wibulwattanakij S, Chanama S, O-rapinpatipat A, A-nuegoonpipat A,
Dengue Bulletin – Volume 31, 2007 25 Clinical diagnostic delays and epidemiology of dengue fever during the 2002 outbreak in Colima, Mexico
Gerardo Chowella,b , Porfirio Díaz-Dueñasc, Diego Chowelld, Sarah Hewse, Gabriel Ceja-Espírituf, James M. Hymanb and Carlos Castillo-Chaveze
aSchool of Human Evolution and Social Change, Arizona State University, Box 872402, Tempe, AZ 85287, USA bCenter for Nonlinear Studies & Mathematical Modeling and Analysis (MS B284), Los Alamos National Laboratory, Los Alamos, NM 87545, USA cHospital General de Medicina Familiar No. 1. Instituto Mexicano del Seguro Social (IMSS), Colima, Col., Mexico dSchool of Sciences, Universidad de Colima, Bernal Díaz del Castillo No. 340, C.P. 28045 Colima, Col., Mexico eDepartment of Mathematics and Statistics, Arizona State University, P.O. Box 871804, Tempe, AZ 85287-1804, USA fSchool of Medicine, Universidad de Colima, Colima, Col., Mexico
Abstract
Dengue fever is a re-emergent and challenging public health problem in the world. Here, we assess retrospectively the epidemiological and clinical characteristics of the 2002 dengue epidemic in the state of Colima, Mexico. This study is carried out by analysing a database containing demographic, epidemiological and clinical information. Of the 4040 clinical dengue cases diagnosed in the hospitals of the Mexican Institute of Public Health in the state of Colima, 548 cases were confirmed by laboratory tests, and 495 cases presented at least one haemorrhagic manifestation. Of the total clinically diagnosed cases, the most common symptoms observed were: fever (99.6%), headache (92.4%), myalgia (89.4%) and arthralgia (88.6%). The most common haemorrhagic manifestations were: petechiae (7.1%), gingivitis (3.4%) and epistaxis (3.6%). The median time between the onset of illness and visit to the health care clinic (diagnostic delay) was 1 day (interquartile range [IQR]: 0-3). For cases presenting haemorrhagic manifestations, the diagnostic delay was higher (median: 2 days, IQR: 0-4) than for non-haemorrhagic cases (median: 1 day, IQR: 0-3). The proportion of males presenting haemorrhagic manifestations was higher than females (Fisher Exact test; p<0.01). Moreover, the age group 0-5 years presented a lower proportion of cases with haemorrhagic manifestations compared with the age group of 6 years and older (p=0.0281). No significant differences were found between the diagnostic delays in the case of males and females.
Keywords: Dengue fever; Clinical diagnostic delay; Haemorrhagic; Colima; Mexico.
E-mail: [email protected] Phone: 480-965-4730 Fax: 480-965-7671
26 Dengue Bulletin – Volume 31, 2007 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
Introduction cases of DHF.[9] We report the results of a retrospective study on the epidemiological and Annually there are approximately 100 million clinical characteristics of the 2002 (serotype cases of dengue worldwide.[1] It is endemic in DENV-2) dengue epidemic in the state of [10] Africa, the Americas, the Eastern Colima, Mexico. Mediterranean, South-East Asia and the Western Pacific regions. The challenges seem daunting. For example, in Singapore, dengue Materials and methods is a major public health problem despite the fact that a set of extraordinary control efforts The epidemiological and clinical characteristics have been put into place over the past few of dengue fever cases recorded during the years.[2] The etiological agent is a Flavivirus with 2002 epidemic (January through December) four different serotypes (DENV-1–4). The in the state of Colima have been studied. The primary vectors of dengue are mosquitoes of state of Colima is located on the Pacific coast, the species Aedes aegypti and Aedes albopictus. has a tropical climate, and has a population of Humans are infected when bitten by feeding 488 028 (Figure 1).[11] The data used include infectious females. Those who recover may cases diagnosed at the hospitals of the Mexican become permanently immune to the serotype Institute of Public Health (IMSS). The IMSS are involved and partially immune to the other a collection of state hospitals that provide serotypes.[3] Susceptible vectors acquire the primary health services to 60% of the infection when feeding on infectious humans. population in the state. The remaining Female mosquitoes are responsible for the population receives health care services from transmission of the virus since males are non- the hospitals of the Mexican Health Ministry blood suckers and feed primarily on plants and and the private sector. flowers.[4] Figure 1: Map of the state of Colima, Cases of dengue are classified as Mexico, with divisions by municipalities asymptomatic, clinically non-specific flu-like Armería (1), Colima (2), Comala (3), symptoms, dengue fever (DF), dengue Coquimatlán (4), Cuauhtémoc (5), haemorrhagic fever (DHF) and dengue shock Ixtlahuacán (6), Manzanillo (7), Minatitlán [5] syndrome (DSS). DHF and DSS are the severe (8), Tecomán (9), Villa de Alvarez (10) forms of the disease. Dengue attack rates vary from 40% to 50% but may be as high as 80% to 90%.[6]
Mexico was declared dengue-free when the principal vector, Ae. aegypti, was eliminated in 1963. However, Ae. aegypti reappeared two years later and the disease returned.[7] All the four dengue serotypes are now circulating in Mexico since 1980.[7] DHF has become a public health problem in the country since 1994.[8] In 2002, over 30 Latin American countries reported a total of over a million cases of classical dengue as well as more than 17 000
Dengue Bulletin – Volume 31, 2007 27 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
Patient record data are stratified by not exhibit haemorrhagic manifestations were municipality where the dengue cases were classified as non-haemorrhagic. diagnosed (Figure 1); the week of symptom onset and diagnosis; the IgM antibody test We characterize variations using the mean result; patient’s age and gender; and diagnostic and standard deviation (SD). Proportions are delay (as presented later in the paper). compared using Fisher’s exact test of Furthermore, non-haemorrhagic recorded independence, which uses a hypergeometric symptoms included: fever, headache, myalgia, sampling distribution for cell frequencies.[14] arthralgia, retro-orbital pain, exanthema, Population distributions are compared using the diarrhoea, vomit, nausea, pruritus, chills, non-parametric Wilcoxon test. Results are photophobia, abdominal pain, conjunctivitis, deemed significant when the p value is less nasal decongestion, cough, hepatomegaly and than 0.05. Some records are not complete. splenomegaly. Haemorrhagic recorded For example, the date of symptom onset was symptoms included: petechiae, ecchymosis, only recorded in 2242 patient records. Hence, ascites, pleural effusion, gingivitis, epistaxis, the number of records (denoted by N) used is haematemesis and melena. We classified a included in the analyses. patient as “delayed” when clinical diagnosis was made two days after the onset of symptoms. Results The World Health Organization (WHO) The 2002 dengue epidemic in Colima, Mexico, case definition of probable dengue cases[3] began in January, peaked in September and requires the presence of fever or chills and at died out in December (Figure 2). Four least two symptoms from: myalgia, arthralgia, thousand and forty cases were clinically retro-orbtial pain, headache, rash, or some diagnosed, including 495 cases with haemorrhagic manifestation (e.g. petechiae, haemorrhagic manifestations. A total of 555 haematuria, haematemesis, melena). The clinical dengue cases (14%) were subjected laboratory testing was only carried out in a small to ELISA test and 548 cases were positive for subset of the clinically diagnosed dengue cases anti-dengue IgM antibodies. Thrombocytopenia through anti-dengue IgM antibody tests (ELISA). was detected in 528 cases but platelet counts We classified cases of DHF following as were only recorded for 1227 cases (30%). Both closely as possible all the four requirements thrombocytopenia and haemorrhagic for the WHO definition of DHF (fever, symptoms were present in 203 cases (17%, haemorrhage, thrombocytopenia, and signs of N=1227), but only 8 cases could be classified plasma leakage).[6] Difficulties arose because as DHF under the WHO classification. The basic measurements, such as platelet counts, distribution of dengue cases by municipality is were conducted in only 1227 (30%) of the given in Table 1. The mean age of a dengue cases and signs of plasma leakage were assessed case was 24.61 ± 16.30 (SD) years (Figure only clinically (pleural effusion and/or ascites). 3A). The attack rate was about 9.5 dengue The difficulties in characterizing DHF cases cases per 1000 persons. This rate was reported using the WHO system have led some among two age groups of 5-14 and 25-34 years. investigators to use modified classification The male/female ratio was about 1:1 with 2045 schemes.[12,13] Here, we used the number of (50.6%) males and 1993 (49.4%) females. We haemorrhagic symptoms as a measure of found no significant difference between the disease severity and classify dengue patients age distribution of non-haemorrhagic and as haemorrhagic whenever one haemorrhagic haemorrhagic cases (Wilcoxon test, p=0.5018, symptom was reported. Dengue cases that did N=4007).
28 Dengue Bulletin – Volume 31, 2007 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
Figure 2: The weekly number of clinical haemorrhagic and non-haemorrhagic dengue cases during the course of the 2002 dengue epidemic in Colima, Mexico
350
Non-haemorrhagic 300 Haemorrhagic
250
200
150
Weekly number of dengue cases 100
50
0 0 10 20 30 40 50 Time (weeks)
Table 1: Number of dengue cases reported by municipality and classified as haemorrhagic and non-haemorrhagic
Dengue Bulletin – Volume 31, 2007 29 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
Figure 3: Age (A) and effective diagnostic delay (B) distributions of dengue cases presenting haemorrhagic and non-haemorrhagic manifestations during the 2002 dengue epidemic in Colima, Mexico
The most common symptoms in non- The median diagnostic delay was 1 day haemorrhagic dengue patients were fever (IQR: 0-3) with a range of 0 to 22 days (99.6%), headache (92.4%), myalgia (89.4%) (N=2242). Significant differences between the and arthralgia (88.6%), while the least common diagnostic delay distributions of non- symptoms were hepatomegaly (3.3%) and haemorrhagic and haemorrhagic cases were splenomegaly (2.3%). For haemorrhagic obtained (Figure 3B, Wilcoxon test, p=0.0004, dengue cases, the median number of N=2242). In fact, the proportion of cases that haemorrhagic manifestations was 1 experienced haemorrhagic manifestations and (interquartile range [IQR]: 1-2) with a range a diagnostic delay greater than two days was from 1 to 7. The most common haemorrhagic significantly higher than those with a diagnostic manifestations were petechiae (7.1%), gingivitis delay less than or equal to two days (17.4 vs (3.4%) and epistaxis (3.6%), while the least 9.9%, p<0.0001, N= 2283; Fisher’s exact were ascites (0.3%) and pleural effusion (0.1%). test). The median diagnostic delay for The relative frequency of symptom appearance haemorrhagic cases was 2 days (IQR: 0-4; is displayed in Table 2. range: 0-14) that is higher than for non- haemorrhagic cases, for which the median
30 Dengue Bulletin – Volume 31, 2007 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
Table 2: Frequency of clinical symptoms diagnostic delay was 1 day (IQR: 0-3; range: presented in dengue cases during the 2002 0-22). The proportion of cases with a diagnostic outbreak in Colima, Mexico delay less than or equal to 2 days was (Because some data were not completely significantly higher for children (<=15 years) recorded, we provide both the numerator (n) than for adults (>15 years) (73% vs 67%, and denominator (N) used to compute the p=0.001, N=2283, Fisher’s exact test). No frequencies) significant association between short diagnostic delay (less than or equal to 2 days) and gender Characteristic Positive, % (n/N) (p=0.36, Fisher’s exact test, N=2281) was Non-haemorrhagic found. The median diagnostic delay turned out manifestations to be 3 days (IQR: 0-4) (N=114) for cases Fever 99.6 (4009/4025) with both haemorrhagic manifestations and Headache 92.4 (3707/4013) thrombocytopenia. Myalgia (muscle pain) 89.4 (3586/4010) A significant association between the Arthralgia (joint pain) 88.6 (3550/4006) presence of haemorrhagic manifestations and Retro orbital pain 73.3 (2936/4004) age was found. In fact, the 0-5 years age group Chills 58.1 (2334/4018) supported a lower proportion of cases with Nausea 52.5 (2107/4015) haemorrhagic manifestations than the age Vomit 36.7 (1476/4023) group of 6 years and older (8.7 vs 12.7%, Photophobia 33.2 (1331/4006) p=0.0281, Fisher’s exact test, N=4007). A Abdominal Pain 32.4 (1299/4014) significant association between the presence of haemorrhagic manifestations and gender was Exanthema (skin rash) 30.3 (1217/4019) also identified. In fact, the proportion of males Conjunctivitis (pink eye) 26.1 (1046/4010) (13.6%) with haemorrhagic dengue was higher Pruritus (itching) 25.6 (1027/4015) than for females (10.8%) (p=0.0072; N=4038; Diarrhea 18.3 (736/4019) Fisher’s exact test). Cough 17.5 (702/4013 Nasal decongestion 17.3 (694/4003) Hepatomegaly 3.3 (128/3938) Discussion (liver enlargement) Splenomegaly 2.3 (90/3940) A retrospective study on the clinical and (spleen enlargement) epidemiological characteristics of dengue was Haemorrhagic manifestations carried out during the 2002 epidemic in Petechiae 7.1 (268/3761) Colima. The levels of association significance (small purplish spots) were assessed between disease severity and Epistaxis (nosebleed) 3.6 (136/3748) epidemiological, clinical and demographic variables. We did not find a correlation between Gingivitis (bleeding gums) 3.4 (126/3747) dengue disease and gender. The 1:1 female/ Haematemesis 1.5 (58/3747) (vomiting blood) male ratio is in agreement with other dengue studies conducted in Nicaragua,[15] Thailand[16] Ecchymosis (bruising) 1.4 (52/3745) and Taiwan.[17] Males in our study were Melena (blood in stool) 1.1 (41/3743) statistically more likely to experience Haematoma 0.6 (22/3746) haemorrhagic manifestations, a finding that Ascites 0.3 (10/3741) agrees with a study conducted in Nicaragua.[15] Pleural effusion 0.1 (5/3733) We found a significantly higher median
Dengue Bulletin – Volume 31, 2007 31 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002) diagnostic delay for cases presenting be more likely to seek treatment. Gender haemorrhagic manifestations than for non- exhibited no correlation with the length of the haemorrhagic cases. diagnostic delays. The most common explanations for diagnostic delays in malaria Not surprisingly, this finding indicates an studies in sub-Saharan Africa include poverty and important correlation between the disease’s the inability to pay for treatment.[22] This clinical evolution and diagnostic delay. perspective could not be assessed here as most Diagnostic delays may complicate the clinical of the patients comprised only the insured state of the patient while facilitating the individuals by IMSS. In summary, a combination transmission of dengue in the population. In of cultural factors, the inability to distinguish other words, although interventions have dengue illnesses from traditional fevers at the shown to be incapable of reverting a dengue early stages of the disease, and the differentiated epidemic,[18] reductions in the diagnostic delays treatment are the main factors behind can reduce the final epidemic size. differences in diagnostic delays. Mathematical models of dengue transmission have shown that educational campaigns aiming The impact of dengue diagnostic delay at shortening the diagnostic delays can lead to distributions and their association with clinical, significant reductions in the final epidemic demographic and epidemiological factors have size.[19] Control strategies that benefit from a not received much attention. This contrasts, for prompt identification of dengue cases include example, with epidemiological studies dealing the use of nets and screens, the application of with other infectious diseases such as pulmonary insecticides to clothing and the application of tuberculosis.[23] However, there are some mosquito repellents. Moreover, strategies relevant studies. For example, an estimate of aiming at the elimination or reduction in the the median diagnostic delay of 5 days has been number of breeding sites through the use of reported for the 1996 dengue epidemic in larvicidal control including ovitraps[20] and north-eastern Brazil,[24] that is, a significantly malathion spraying for adult control can also longer median diagnostic delay than our reduce the dengue burden. estimate of 1 day. Guzman et al.[25] found that the average time from fever onset to A fever alone is usually not enough to hospitalization associated with the 1997 dengue motivate patients to seek medical care. It is only outbreak in Cuba was about 2.9 days. On the the presence of severe symptoms (e.g. other hand, a median diagnostic delay of 2 days haemorrhagic manifestations) that motivate to was reported for malaria-stricken travellers seek medical care. This observation may explain returning to Sweden during 1994 to 2001.[26] the significant association that we found between diagnostic delays and the presence of We found a lower proportion of haemorrhagic manifestations. Specifically, we haemorrhagic cases in the age group 0-5 years found that the proportion of cases with a than those in the age group of 6 years and older. diagnostic delay of less than or equal to 2 days Secondary dengue infections have been was significantly higher for children (<=15 years) associated with the presence of haemorrhagic than for adults (>15 years). This is in agreement manifestations, a phenomenon explained by the with the findings by Ahorlu et al.[21] who studied theory of antibody-dependent enhancement.[5] the socio-cultural determinants of treatment delay for childhood malaria in southern Ghana. Seasonal effects are also critical. The peak Ahorlu et al.[21] found that families with similar of the epidemic in Colima occurred in mid- economic situations who have sick children will September, which correlates well with the
32 Dengue Bulletin – Volume 31, 2007 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002) peak in the rainfall.[27] A similar pattern has including Indonesia, China, India, Philippines, been reported for other dengue outbreaks Thailand, South Pacific and Latin America.[13] {Nicaragua (1998),[15] El Salvador (2000)[28] and To improve the tracking of dengue, workers at Bangladesh (2000)[29]}. IMSS hospitals would need to collect as complete patient information as possible. Efforts In contrast to dengue hyperendemic areas to follow the WHO classification guidelines as where dengue haemorrhagic fever is primarily closely as possible would be quite helpful. a disease of children under 15 years, we found Dengue symptoms can be confused in the a lower proportion of haemorrhagic cases in epidemic and non-epidemic situations with the age group 0-5 years compared to the age other exanthematous and non-exanthematous group of 6 years and older. viral diseases such as measles, rubella, enteroviruses and influenza.[31] We recognize The number of dengue infections per that there are limited resources for laboratory municipality was determined by the location of testing. In the 2002 dengue epidemic in the patient’s address albeit the actual dengue Colima, only 14% of the clinical dengue cases infection may have occurred at work because were tested in the laboratory for anti-dengue dengue mosquitoes are daytime feeders.[30] IgM. The low proportion of clinical dengue cases tested serologically make it difficult to This study was limited by the lack of validate some of our findings. complete medical records. Difficulties were encountered in rigorously following the WHO Our findings indicate that an educational classification scheme for DHF, because the campaign in the community with the objective signs of plasma leakage were assessed only of informing the population about early clinically (pleural effusion and/or ascites). The symptoms of dengue infection could lead to number of DHF cases may in fact be as high not only reductions in diagnostic delays but also as 203, that is, the number of cases for which to reduce the final size of a dengue epidemic. the other three requirements of the WHO classification scheme for DHF (fever, haemorrhage and thrombocytopenia) were Acknowledgement satisfied. On the other hand, dengue cases with severe haemorrhage, not accompanied by Gerardo Chowell was supported by a Director’s increased vascular permeability, have been Post-doctoral Fellowship from Los Alamos reported from several regions of the world National Laboratory.
References
[1] Kurane I, Takasaki T. Dengue fever and dengue [3] World Health Organization. Clinical diagnosis haemorrhagic fever: challenges of controlling of dengue. Available from: URL:http:// an enemy still at large. Rev Med Virol. 2001 www.who.int/csr/resources/publications/ Sep-Oct; 11(5): 301-11. dengue/012-23.pdf [2] Singapore Ministry of Health. The [4] Scott TW, Chow E, Strickman D, Kittayapong communicable disease surveillance in P, Wirtz RA, Lorenz LH, Edman JD. Blood- Singapore 2004. Available from: URL:http:// feeding patterns of Aedes aegypti (Diptera: www.moh.gov.sg/cmaweb/attachments/ Culicidae) collected in a rural Thai village. J publication/36c375c7%9a8t/Vector- Med Entomol. 1993 Sep; 30(5): 922-7. Borne\_Diseases.pdf
Dengue Bulletin – Volume 31, 2007 33 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
[5] Vaughn DW, Green S, Kalayanarooj S, Innis [14] Agresti A. An introduction to categorical data BL, Nimmannitya S, Suntayakorn S, Endy TP, analysis. New York: Wiley, 1996. Raengsakulrach B, Rothman AL, Ennis FA, Nisalak A. Dengue viremia titer, antibody [15] Harris E, Videa E, Pérez L, Sandoval E, Téllez Y, response pattern, and virus serotype correlate Pérez ML, Cuadra R, Rocha J, Idiaquez W, with disease severity. J Infect Dis. 2000 Alonso RE, Delgado MA, Campo LA, Acevedo Jan;181(1):2-9. F, Gonzalez A, Amador JJ, Balmaseda A. Clinical, epidemiologic, and virologic features [6] World Health Organization. Dengue and of dengue in the 1998 epidemic in Nicaragua. dengue hemorrhagic fever. Geneva: WHO, Am J Trop Med Hyg. 2000 Jul-Aug; 63(1-2): 5- 2008. Fact sheet No. 117. (http:// 11. www.who.int/mediacentre/factsheets/fs117/ en/ - accessed 30 December 2008). [16] Wichmann O, Hongsiriwon S, Bowonwatanuwong C, Chotivanich K, [7] Díaz FJ, Black WC 4th, Farfán-Ale JA, Loroño- Sukthana Y, Pukrittayakamee S. Risk factors Pino MA, Olson KE, Beaty BJ. Dengue virus and clinical features associated with severe circulation and evolution in Mexico: a dengue infection in adults and children during phylogenetic perspective. Arch Med Res. 2006 the 2001 epidemic in Chonburi, Thailand. Aug; 37(6): 760-73. Trop Med Int Health. 2004 Sep; 9(9): 1022-9. [8] Navarrete-Espinosa J, Gómez-Dantés H, Celis- [17] Chao DY, Lin TH, Hwang KP, Huang JH, Liu Quintal JG, Vázquez-Martínez JL. Clinical CC, King CC. 1998 dengue hemorrhagic fever profile of dengue hemorrhagic fever cases in epidemic in Taiwan. Emerg Infect Dis. 2004 Mexico. Salud Publica Mex. 2005 May-Jun; Mar; 10(3): 552-4. 47(3): 193-200. [18] Gubler DJ. Aedes aegypti and Aedes aegypti- [9] Guzman MG, Kouri G. Dengue and dengue borne disease control in the 1990s: top down hemorrhagic fever in the Americas: lessons and or bottom up. Charles Franklin Craig Lecture. challenges. J Clin Virol. 2003 May; 27(1): 1- Am J Trop Med Hyg. 1989 Jun; 40(6): 571-8. 13. [19] Chowell G, Diaz-Dueñas P, Miller JC, Alcazar- [10] Espinoza-Gómez F, Díaz-Dueñas P, Torres- Velazco A, Hyman JM, Fenimore PW, Castillo- Lepe C, Cedillo-Nakay RA, Newton-Sánchez Chavez C. Estimation of the reproduction OA. Clinical pattern of hospitalized patients number of dengue fever from spatial epidemic during a dengue epidemic in Colima, Mexico. data. Math Biosci. 2007 Aug; 208(2): 571-89. Dengue Bull. 2005; 29: 8-17. [20] Ooi EE, Goh KT, Gubler DJ. Dengue [11] INEGI. National Institute of Geography and prevention and 35 years of vector control in Informatics. 1995. Singapore. Emerg Infect Dis. 2006 Jun; 12(6): 887-93. [12] Deen JL, Harris E, Wills B, Balmaseda A, Hammond SN, Rocha C, Dung NM, Hung [21] Ahorlu CK, Koram KA, Ahorlu C, de Savigny NT, Hien TT, Farrar JJ. The WHO dengue D, Weiss MG. Socio-cultural determinants of classification and case definitions: time for a treatment delay for childhood malaria in reassessment. Lancet. 2006 Jul 8; 368(9530): southern Ghana. Trop Med Int Health. 2006 170-3. Jul;11(7):1022-31. [13] Bandyopadhyay S, Lum LC, Kroeger A. [22] Williams HA, Jones CO. A critical review of Classifying dengue: a review of the difficulties behavioral issues related to malaria control in in using the WHO case classification for sub-Saharan Africa: what contributions have dengue haemorrhagic fever. Trop Med Int social scientists made? Soc Sci Med. 2004 Aug; Health. 2006 Aug; 11(8): 1238-55. 59(3): 501-23.
34 Dengue Bulletin – Volume 31, 2007 Clinical diagnostic delays and dengue fever in Colima, Mexico (2002)
[23] Chowell G, Diaz-Dueñas P, Chowell D. The [28] Hayes JM, García-Rivera E, Flores-Reyna R, dynamics of pulmonary tuberculosis in Suárez-Rangel G, Rodríguez-Mata T, Coto- Colima, Mexico (1999-2002). Scand J Infect Portillo R, Baltrons-Orellana R, Mendoza- Dis. 2005; 37(11-12): 858-62. Rodríguez E, De Garay BF, Jubis-Estrada J, Hernández-Argueta R, Biggerstaff BJ, Rigau- [24] Flannery B, Pereira MM, Velloso L de F, Pérez JG. Risk factors for infection during a Carvalho C de C, De Codes LG, Orrico G de severe dengue outbreak in El Salvador in 2000. S, Dourado CM, Riley LW, Reis MG, Ko AI. Am J Trop Med Hyg. 2003 Dec; 69(6): 629-33. Referral pattern of leptospirosis cases during a large urban epidemic of dengue. Am J Trop [29] Rahman M, Rahman K, Siddque AK, Shoma Med Hyg. 2001 Nov; 65(5): 657-63. S, Kamal AH, Ali KS, Nisaluk A, Breiman RF. First outbreak of dengue hemorrhagic fever, [25] Guzmán MG, Alvarez M, Rodríguez R, Rosario Bangladesh. Emerg Infect Dis. 2002 Jul; 8(7): D, Vázquez S, Vald s L, Cabrera MV, Kourí G. 738-40. Fatal dengue hemorrhagic fever in Cuba, 1997. Int J Infect Dis. 1999 Spring; 3(3): 130-5. [30] Effler PV, Pang L, Kitsutani P, Vorndam V, Nakata M, Ayers T, Elm J, Tom T, Reiter P, Rigau-Perez [26] Askling HH, Ekdahl K, Janzon R, Henric JG, Hayes JM, Mills K, Napier M, Clark GG, Braconier J, Bronner U, Hellgren U, Rombo L, Gubler DJ; Hawaii Dengue Outbreak Tegnell A. Travellers returning to Sweden with Investigation Team. Dengue fever, Hawaii, falciparum malaria: pre-travel advice, 2001-2002. Emerg Infect Dis. 2005 May; behaviour, chemoprophylaxis and diagnostic 11(5): 742-9. delay. Scand J Infect Dis. 2005; 37(10): 760-5. [31] George R, Lum LCS. Clinical spectrum of [27] Chowell G, Sanchez F. Climate-based dengue infection. In: Gubler DG and Kuno descriptive models of dengue fever: the 2002 G, editors. Dengue and dengue hemorrhagic epidemic in Colima, Mexico. J Environ Health. fever. New York: CABI Publishing; 1997. 2006 Jun; 68(10): 40-4, 55.
Dengue Bulletin – Volume 31, 2007 35 Exposure to the risk of dengue virus infection in an urban setting: ecological versus individual heterogeneity
Maria Glória Teixeiraa , Maurício Lima Barretoa, Maria da Conceição N. Costaa, Leila Denise Alves Ferreirab, Vanessa Moratoa, Pedro Fernando Vasconcelosc and Sandy Cairncrossd
aInstituto de Saúde Coletiva/UFBA – Rua Basílio da Gama, s/n Campus Universitário, Canela, Salvador –Bahia CEP:41.110-170 bInstituto de Matemática da Universidade Federal da Bahia cInstituto Evandro Chagas – SVS/Ministério da Saúde do Brasil dLondon School of Hygiene and Tropical Medicine
Abstract
The dynamics of dengue virus circulation in the intra-urban spaces of large cities and the risk factors for the occurrence of such infections are still not well known. Although it has been established that poverty is one of the determinants of the majority of infectious and parasitic diseases, in the case of dengue this is still a matter of some controversy. This study had the objective of describing the distribution of dengue seroprevalence and seroincidence in different intra-urban spaces within a large and complex city in north-eastern Brazil. The study investigated whether there is any relationship between the intensity of virus circulation and the population’s living conditions or between group immunity and Aedes aegypti infestation rates. The variability in the risk of such infections was also examined. A prospective study was conducted by means of serological investigations among a sample of people living in 30 different spaces (“sentinel areas”) in the city of Salvador, which was selected according to extreme differences in living conditions. High rates of seroprevalence (67.7%) and seroincidence (70.6%) were found for the circulating serotypes (DENV-1 and DENV-2). Similar to what has been occurring in south-east Asia, the seroincidence was high (55%) even when the group immunity had already been partially established (42%) and the Ae. aegypti infestation rates were relatively low (<3%). Contrary to the ecological analysis, at the individual level, substantial heterogeneity in dengue exposure was observed. This paper discusses this apparent contradiction, highlighting its implications for the effectiveness of vector control strategies.
Keywords: Dengue; Prospective study; Herd immunity; Seroprevalence; Seroincidence; Spatial distribution; Aedes aegypti; Epidemiology.
Introduction studies of dengue infections have been neglected,[1] even though they are important The dynamics and determinants of dengue virus for developing dengue prevention and control circulation in urban areas, particularly in large strategies, as has recently been recognized in [2] cities, are not well-established. Epidemiological the dengue research agenda of WHO.
E-mail: [email protected]; Tel (71) 32837412; Fax 32837460
36 Dengue Bulletin – Volume 31, 2007 Exposure to the risk of dengue virus infection in an urban setting
The re-emergence of this disease in several out in Salvador, Bahia state, Brazil. This city continents and its potential virulence is of great had more than 2.3 million inhabitants in 1998 concern to public health worldwide. Moreover, and presented marked differences between the available control strategies are based on specific areas with regard to socioeconomic vector control, and these have not always been conditions and environmental sanitation. The effectively implemented to prevent present study considered 30 spatial units of transmission of the disease.[3,4] Unlike yellow analysis that were named “sentinel areas”. fever, restrictions on human movement These were selected by stratified sampling through quarantine are not applicable for the using data obtained from the Brazilian Institute control of dengue for lack of vaccines. for Geography and Statistics[9] regarding sanitation system coverage and income levels, In the large urban centres that are infested which were taken to be estimators of living with Aedes aegypti, large numbers of conditions, using the following strata: susceptible individuals and high population density[3] probably facilitate more extensive (1) High: more than 80% of the homes transmission of dengue virus as mosquito were connected to the sanitation vectors, because of multiple probing/feeding system and more than 50% of the behaviours are likely to infect multiple families had an income of more than individuals in different households. However, five minimum salaries (80 US dollars the risk of exposure to dengue virus infection at the time of the study) (6 areas). in relation to the range of social and economic conditions in big cities remains unclear. These (2) Medium: 50% to 80% of the homes risk factors are related both to low income areas were connected to the sanitation and areas with more favourable conditions.[5,6] system and more than 50% of the families had an income of between In Salvador, a large city in north-eastern one and four minimum salaries (19 Brazil, the dengue virus was first detected in areas). January 1995, and, by the end of 1999, there (3) Low: less than 50% of the homes were had been two recorded epidemics. The mean connected to the sanitation system annual incidence over that period reached 691 and more than 50% of the families reported cases per 100 000 inhabitants.[7] We had an income of less than one carried out a serological study of the prevalence minimum salary (5 areas). and incidence of dengue virus infection in this [8] This selection strategy has been described city, at a time when only DENV-1 and DENV- [10] 2 were circulating.[7] The present study in more detail elsewhere. attempts to examine the relationship between To determine the number of individuals the spatial distribution of dengue virus for the serological surveys, a seroprevalence circulation and the population’s living of 50% was assumed because this was the conditions, group immunity and Ae. aegypti mean observed in previous surveys in Brazilian infestation rates, and also to find out any [6,11] variability in the risk of such infections. state capitals. With this, and assuming precision of less than or equal to 3% and a confidence level of 5%, the sample size was Materials and methods estimated to be 1503 individuals. After adding 30% to compensate for possible losses, the This prospective study on dengue result was 2149 individuals. Using the database seroprevalence and seroincidence was carried of a demographic census carried out in 30
Dengue Bulletin – Volume 31, 2007 37 Exposure to the risk of dengue virus infection in an urban setting sentinel areas in 1997, when 68 749 individuals controversy regarding the interpretation of the were counted, a random draw for the serological response to flaviviruses, which participants was made (without replacements). differs between the first (primary) infection and These individuals were then grouped in areas any subsequent (secondary) infection with by taking the home address into another flavivirus or serotype (flaviviruses show consideration.[12] an increasingly strong response on subsequent infection and serological cross-reactions are Two surveys were carried out. The first, in frequently observed). 1998, is referred to here as “the seroprevalence survey”. The second, one year later in 1999, Thus, for the interpretation of serological is termed “the seroincidence survey.” response, the WHO[15] criteria was followed, i.e. HI titres of 1:20 or higher, exclusively for a After the approval of the study protocol by specific dengue serotype, or titres four times the Ethics Committee for Scientific Research of higher for one serotype than for another (DENV- the Gonçalo Moniz Research Centre (Oswaldo 1 or DENV-2), were considered positive and Cruz Foundation, Bahia), a structured specific for that serotype (primary response). questionnaire was formulated during May Titres indicative of secondary response also through July 1998. The data sought in the followed the WHO criteria.[15] These were also questionnaire included: name, address, sex, age, confirmed by IgG enzyme-linked educational level and history of vaccination immunosorbent assay[16] and were considered against yellow fever. Just after the interview, positive to both serotypes, meaning that infection these individuals were provided with with both DENV-1 and DENV-2 had occurred. clarifications regarding the nature of the study and they were asked to sign an informed-consent For each sentinel area, the seroprevalence form. Following this, the first blood sample was and seroincidence rates of dengue infection were collected. Three individuals previously estimated both unadjusted (crude) and with vaccinated against yellow fever were excluded standardization by age using the indirect method in order to avoid false positive serological test (Rothman),[17] and the total composition of the results due to cross-reactions. A second blood study sample as the reference population. Since sample was collected a year later, from the the interval between the two surveys was one individuals who were negative during the first year, the seroincidence was expressed as an serological survey, or had positive reactions to annual rate per cent. The prevalence ratio (PR) only one serotype of the dengue virus. and relative risk (RR) of dengue virus infection with 95% confidence intervals (CI) were Blood samples were collected in 10 ml estimated by taking as the reference standard sterilized vacuum tubes, and the serum was the sentinel areas with the lowest separated by centrifugation and stored at seroprevalence (area 427) and seroincidence –20 °C. These samples were sent in thermal (area 7), respectively, among the areas in the boxes containing ice to the arbovirus laboratory highest socio-sanitary stratum. For the three of the Evandro Chagas Institute. There, the strata according to living conditions, the haemagglutination inhibition (HI) test,[13] as respective seroprevalence and infection modified by Shope,[14] was carried out using incidence were calculated after Rothman,[17] and antigens for the four serotypes of the dengue the chi-squared test for trend was applied. virus and four other flaviviruses (YF, Rocio, Ilhéus and St. Louis encephalitis), although From the information collected using the these do not circulate in Salvador. There is a questionnaire, the frequency indicators were
38 Dengue Bulletin – Volume 31, 2007 Exposure to the risk of dengue virus infection in an urban setting estimated for each area by taking into that their family income was less than two consideration the proportions of individuals minimum salaries and 50% earned from two according to sex, age greater than or equal to to less than five minimum salaries. There were 15 years, schooling (assuming that individuals 595 individuals in the seroincidence survey, out were at risk if they were 15 or more years old of 860 who were eligible according to the and had not completed elementary schooling) criteria established, which represented a loss and mean family income less than or equal to of 31%. The great majority of these losses two minimum monthly salaries. The mean were due to changes of address, and it was population density was obtained from the 1996 not appropriate to locate these losses since this census.[9] Calculations of Pearson’s correlation was an ecological study of sentinel areas. coefficient were used to investigate the Nonetheless, the social and demographic existence of associations between the variables structure of the sample remained similar to of interest. what was found in the first survey. Among the sentinel areas, the population density varied In April 1999, health workers trained and widely, from a maximum of 49 980 to a supervised by the research team visited and minimum of 1834 inhabitants per km2. inspected all the houses in the 30 sentinel areas. The existence of foci of Ae. aegypti was checked The mean seroprevalence was 69% and records were made of these visits. The unit (ranging from 16% to 98% among the sentinel of analysis for these data was the sentinel area. areas), and this distribution was little changed Every building with one or more breeding sites after standardization for age. The prevalence containing the larvae of this mosquito was ratio (PR) indicated a risk of positive findings considered to be positive, and the Premises that ranged from 0.36 in sentinel area 1011 to Index (PI) was estimated as the percentage of 2.20 in area 1054, which were both in the positive buildings. The infection incidence was medium stratum of living conditions (Table 1). calculated for different PI bands (less than or equal to 3%; 3.1% to 5%; 5.1% to 10%; and As shown in Table 2, the stratum of lowest over 10%) using covariance analysis,[18] with living conditions had the highest mean adjustments for age and mean seroprevalence seroprevalence (74.0%), and this trend was (herd immunity indicator). The preventable statistically significant (χ2 = 8.386; p = 0.004). fraction was estimated by considering individuals It can be seen from Table 3 that the who lived in areas with PI less than or equal to seroprevalence presented a positive correlation 3% to be “non-exposed”. (r = 0.4914; p = 0.006) with population density and a weak negative correlation (r = –0.2778; The data were entered using Epi-Info 6.0 p = 0.137) with the proportion of individuals and analysed using SAS and STATA. aged 15 years or over who had had less than eight years of schooling. No statistically significant association was found with mean Results income (r = 0.0571; p = 0.764).
Among the 1515 individuals who took part in The mean seroincidence was 71.0% per the seroprevalence survey, 58% were female year. Three areas in which the sample size was and 71% were aged 15 years or older, mainly less than four were not taken into consideration; in the age groups 15 to 29 (33%) and 30 to 49 in the others, the seroincidence ranged from (29%). The majority (68%) had had schooling 50% (area 323) to 90% (area 678) (Table 1). In for eight years or less. Around 25% reported the areas in which the seroprevalence was
Dengue Bulletin – Volume 31, 2007 39 Exposure to the risk of dengue virus infection in an urban setting index (PI) according to sentinel area and strata of living conditions in Salvador – Bahia, Brazil, 1998-1999 Seroprevalence and seroincidence (crude and standardized) for dengue, study population, population density and premises Seroprevalence and seroincidence (crude standardized) for dengue, study population, *: 1998; **: 1999; H: High living conditions; M: Middle L: Low conditions Table 1: Table
40 Dengue Bulletin – Volume 31, 2007 Exposure to the risk of dengue virus infection in an urban setting lower, the incidence of infection indicated by Differing from the seroprevalence survey, a change in serological status was high, except the highest unadjusted or standardized in area 571. There was only one area (575) in seroincidence rates were in the stratum of which no individuals seroconverted in the highest living conditions (Table 2), but the chi- second survey, although the number of initially squared test for trend did not show statistical negative individuals was only two and this area significance (χ2 = 1.332; p = 0.248). had the lowest PI (0.27%) (Table 1). The relative risk of seroincidence among the areas A comparison between the incidence in the second survey ranged from 0.64 to 1.52, adjusted for age and the mean seroprevalence excluding area 575, in which there were no in the sentinel areas (herd-immunity indicator), new cases. In addition, there was a statistically when grouped according to the PI ranges significant negative correlation between the considered (Figure), revealed that the lowest seroincidence (55%) was in the group with PI incidence of infection and the proportion of less than or equal to 3% and the highest (77%) individuals aged 15 years or over, who had not was in the group from 3% to 5%. The completed elementary schooling. For mean differences were statistically significant at the income and population density, a negative 5% level only between the first and second PI correlation was also found, but without groups (p < 0.01) and between the first and statistical significance (Table 4). fourth groups (p = 0.02).
Table 2: Seroprevalence (%) and seroincidence (%) of dengue, prevalence ratio (PR), relative risk (RR) and confidence interval (CI: 95%) according to living condition strata in 30 sentinel areas of Salvador – Bahia, Brazil, 1998-1999
Test for trend: *χ2 = 8.386, p= 0.004; ** χ2 = 1.332, p= 0.2484
Table 3: Seroprevalence and seroincidence for two serotypes of dengue virus in Salvador, Brazil, 1998-1999
Dengue Bulletin – Volume 31, 2007 41 Exposure to the risk of dengue virus infection in an urban setting
Table 4: Spearman correlation coefficient (r) for association between crude and standardized seroprevalence and seroincidence for dengue virus and selected variables for residents of 30 sentinel areas in Salvador – Bahia, Brazil, 1998-1999
Figure: Incidence of dengue (and 95% CI) adjusted for initial seroprevalence and mean age and compared with Premises Index (PI) for Aedes aegypti, in 30 areas of Salvador, Brazil
In the individual analysis, it was observed that, period of approximately one year. Among those among the individuals who in the seroprevalence who had been positive for one of the serotypes survey had been negative, 38% presented a risk in the first examination, 83% had a second of being infected by the two serotypes within a infection within this period (Table 4).
42 Dengue Bulletin – Volume 31, 2007 Exposure to the risk of dengue virus infection in an urban setting
Discussion suggest that dengue in Brazil is a disease that affects all social classes. The high seroprevalence level for dengue virus infection found in this study (69%), and the Despite the statistically significant subsequent high incidence level (71%), were associations found between dengue surprising. This was particularly so given the short seroprevalence and population density and also period of time (around four years) that had between seroincidence and degree of PI and elapsed since the virus was introduced into schooling, it can be seen that the risk of infection Salvador. These findings demonstrate the force was high in almost all the areas, including in the of the transmission of this virus in Salvador, given areas with good living conditions. It is likely that that surveys carried out in other Brazilian state this dynamics is at least partially due to the fact capitals after similar periods of time of virus that in Salvador high population density and PI circulation revealed lower mean seroprevalence are found both in areas with precarious living (41% to 44%).[6,19] One plausible explanation conditions and in those where economically for the rates that were so high in Salvador may more favoured populations live, even if some relate to the almost complete lack of vector people may have been infected away from control measures at the outset of virus home, for instance at school or at work. transmission in this city. Such measures were only[7] had waned. On the other hand, in other This possible similarity of exposure to the cities[6,19] such measures had already been risk of being infected by the dengue virus, in implemented routinely even before the different intra-urban environments, introduction of the dengue virus. differentiates this agent from those of the great majority of infectious and parasitic diseases. In It is worth emphasizing that the results particular, it differentiates dengue from the from the present investigation have made it microorganisms whose transmission routes are possible to estimate that, between 1995 and connected with the environment and which 1999, around two million individuals in Salvador predominantly affect poor populations. were infected by the dengue virus. This means that the population was at a higher risk for In contrast to the uniformity of exposure haemorrhagic dengue, given that DENV-3 suggested by the ecological comparison started circulating in 2002. described above, our results indicate substantial heterogeneity in exposure to dengue at the The association found in 1998 between individual level. Since there is no evidence of dengue seroprevalence and precarious living variation in the susceptibility of naive individuals conditions (Table 2) disappeared in the to dengue infection, our finding of a higher seroincidence for the subsequent year. In other incidence of seropositivity (83%) among words, the risk of being infected by the dengue individuals who were initially seropositive to virus became practically the same between the one serotype, is strongly indicative of different economic strata of the population as heterogeneity in the degree of exposure among viral transmission became established in the individuals of the population of this city. Salvador. This distribution, which was relatively The lack of variation in exposure between homogeneous between the strata, has also neighbourhoods, as described above, suggests been observed in Fortaleza and São Luís do that the main differences are between Maranhão. The risk in Fortaleza was even found individual households or people. to be slightly higher in the districts with better socioeconomic indices.[6,19] These facts strongly These results suggest puzzling and apparently contradictory conclusions regarding
Dengue Bulletin – Volume 31, 2007 43 Exposure to the risk of dengue virus infection in an urban setting the degree to which exposure to dengue relatively low and group immunity had already infection varies across the population, unrelated been partially established (42%), which also to the observed Ae. aegypti density in each expresses the transmission strength of this agent. area. The lack of association between mosquito It was found that seroincidence did not vary density and dengue seroincidence is particularly with PI when this was greater than 3%. This remarkable in view of the way in which finding has strong implications for Ae. aegypti differentials existing between individuals can control programmes, since it suggests that it is be expected to be amplified in ecological necessary to intensify vector control and bring comparisons.[20] It is hard to see how people’s Aedes densities under 3%, before an observable movement about the city could explain this impact can be registered. This finding is in phenomenon; by bringing each individual into agreement with the observation in Singapore contact with various local environments, one that from the early 1990s the incidence of would expect mobility to render their exposure dengue rose considerably, even when the PI [2] more homogeneous rather than the contrary. was less than 2%. The lack of a safe and effective vaccine against the virus increases the The larval survey was carried out by the need for improved strategies and technologies research team in 100% of the households, for vector control, and for epidemiological which is grounds for confidence in this indicator, studies to identify changes in infection patterns, but the use of only one measure of the vector such as the locations of transmission foci, the population constitutes one of the limitations age group of peak incidence, and falling herd of this study. Perhaps an option to refine our immunity. The last of these was one of the results might have been to count viable pupae, most important factors in the re-establishment or adult females, per person.[21,22] However, in recent years of intense dengue virus this was not possible, for reasons of cost and circulation in Singapore.[25] operational complexity. For these same reasons, most vector control programmes use only larval It can be understood, therefore, that the indicators in their routine monitoring. Though results from this investigation should be the larval densities vary widely during the course considered at the time of defining dengue of a year,[23] the geographical patterns remain control policies and improving vector control consistent through time.[24] So, our results have measures. On the one hand, observation that disturbing implications for the effectiveness of the dengue virus in our environment does not vector control strategies. respect social spaces strengthens the principle that vector control measures must always be An approach that takes into account the universally applied in each territory. On the lifestyles that potentially favour greater other hand, the identification of specific risk exposure to the risk of being infected by the factors in the domestic domain may indicate a dengue virus ought to form one of the lines of need for other evidence-based interventions research for elucidating this question. This is which can help to eliminate the disease from because the differences may be related both cities such as Salvador. to the public and the private domain, since the environment of the home and its surroundings have a decisive influence on the Acknowledgements transmission of dengue virus. The authors acknowledge the financial and Another important finding from this study technical support of the National Centre of relates to the high incidence of dengue virus Epidemiology, Ministry of Health, Brazil, infection even when the infestation indices were especially its Director, Dr Jarbas Barbosa da Silva Junior.
44 Dengue Bulletin – Volume 31, 2007 Exposure to the risk of dengue virus infection in an urban setting
References
[1] Kuno G. Review of the factors modulating [10] Teixeira Md Mda G, Barreto ML, Costa Mda dengue transmission. Epidemiol Rev. 1995; C, Strina A, Martins D Jr, Prado M. Sentinel 17(2): 321-35. areas: a monitoring strategy in public health. Cad Saude Publica. 2002 Sep-Oct; 18(5): [2] Farrar J, Focks D, Gubler D, Barrera R, 1189-95. Guzman MG, Simmons C, Kalayanarooj S, Lum L, McCall PJ, Lloyd L, Horstick O, Dayal- [11] Figueiredo LT, Cavalcante SM, Simões MC. Drager R, Nathan MB, Kroeger A. WHO/TDR Dengue serologic survey of schoolchildren in Dengue Scientific Working Group. Towards Rio de Janeiro, Brazil, in 1986 and 1987. Bull a global dengue research agenda. Trop Med Pan Am Health Organ. 1990; 24(2): 217-25. Int Health. 2007 Jun; 12(6): 695-9. [12] Cochran WG, Sampling techniques. 3rd [3] Newton EA, Reiter P. A model of the edition, New York: Wiley & Sons, 1977. transmission of dengue fever with an evaluation of the impact of ultra-low volume [13] Clarke DH, Casals J. Techniques for (ULV) insecticide applications on dengue hemagglutination and hemagglutination- epidemics. Am J Trop Med Hyg. 1992 Dec; inhibition with arthropod-borne viruses. Am J 47(6): 709-20. Trop Med Hyg. 1958 Sep; 7(5): 561-73. [4] Gubler DJ. Dengue and dengue hemorragic [14] Shope RE. The use of a micro fever: its history and resurgence as a global hemagglutination-inhibition test to follow health problem. In: Gubler DJ, Kuno G., antibody response after arthropod-borne virus editors. Dengue and dengue hemorragic fever. infection in a community of forest animals. New York: CAB International, 1997. p. 1-22. Anais de microbiologia (Rio de Janeiro) v. 11(parte A) 1963 Sep: 167-171. [5] Rodhain F, Rosen L. Mosquito vectors and dengue virus-vector relationships. In: Gubler [15] World Health Organization. Dengue DJ, Kuno G. Editors. Dengue and dengue haemorrhagic fever: diagnosis, treatment, nd hemorragic fever. New York: CAB International, prevention and control. 2 edition, Geneva: 1997. p. 45- 60. WHO, 1997. p.84. [6] Vasconcelos PF, Lima JW, da Rosa AP, Timbó [16] Chungue E, Marché G, Plichart R, Boutin JP, MJ, da Rosa ES, Lima HR, Rodrigues SG, da Roux J. Comparison of immunoglobulin G Rosa JF. [Dengue epidemic in Fortaleza, Ceará: enzyme-linked immunosorbent assay (IgG- randomized seroepidemiologic survey] Rev ELISA) and haemagglutination inhibition (HI) Saude Publica. 1998 Oct; 32(5): 447-54. test for the detection of dengue antibodies. Portuguese. Prevalence of dengue IgG-ELISA antibodies in Tahiti. Trans R Soc Trop Med Hyg. 1989 Sep- [7] Teixeira MG, Costa MC, Barreto ML, Barreto Oct; 83(5): 708-11. FR. [Epidemiology of dengue in Salvador- Bahia, 1995-1999] Rev Soc Bras Med Trop. [17] Rothman KJ. Standardization of rates. In: 2001 May-Jun; 34(3): 269-74. Portuguese. Modern epidemiology. Ed. Little Brown and Company, Boston-Toronto: Little Brown & Co,, [8] Teixeira Mda G, Barreto ML, Costa Mda C, 1986. p. 41-49. Ferreira LD, Vasconcelos PF, Cairncross S. Dynamics of dengue virus circulation: a silent [18] Montgomery DC. Design and analysis of rd epidemic in a complex urban area. Trop Med experiments. 3 edition. New York: Wiley, Int Health. 2002 Sep; 7(9): 757-62. 1991. [9] Censo Demográfico. Fundação IBGE. Rio de [19] Vasconcelos PF, Lima JW, Raposo ML, Janeiro, Brasil: Censo demográfico, 1991. Rodrigues SG, da Rosa JF, Amorim SM, da Rosa
Dengue Bulletin – Volume 31, 2007 45 Exposure to the risk of dengue virus infection in an urban setting
ES, Moura CM, Fonseca N, da Rosa AP. [A and association of wing-length measurements seroepidemiological survey on the island of with aspects of the larval habitat. Am J Trop São Luis during a dengue epidemic in Med Hyg. 2003 Feb; 68(2): 209-17. Maranhão] Rev Soc Bras Med Trop. 1999 Mar- Apr; 32(2): 171-9. Portuguese. [23] Secretaria Municipal de Saúde. Relatório do Plano de Erradicação do Aedes aegypti no [20] Koopman JS, Longini IM Jr. The ecological Município de Salvador. Prefeitura Municipal effects of individual exposures and nonlinear de Salvador. Centro de Controle de Zoonozes, disease dynamics in populations. Am J Public 1999. Health. 1994 May; 84(5): 836-42. [24] Morrison AC, Gray K, Getis A, Astete H, [21] Focks DA, Brenner RJ, Hayes J, Daniels E. Sihuincha M, Focks D, Watts D, Stancil JD, Transmission thresholds for dengue in terms Olson JG, Blair P, Scott TW. Temporal and of Aedes aegypti pupae per person with geographic patterns of Aedes aegypti (Diptera: discussion of their utility in source reduction Culicidae) production in Iquitos, Peru. J Med efforts. Am J Trop Med Hyg. 2000 Jan; 62(1): Entomol. 2004 Nov; 41(6): 1123-42. 11-8. [25] Ooi EE, Goh KT, Gubler DJ. Dengue [22] Strickman D, Kittayapong P. Dengue and its prevention and 35 years of vector control in vectors in Thailand: calculated transmission Singapore. Emerg Infect Dis. 2006 Jun; 12(6): risk from total pupal counts of Aedes aegypti 887-93.
46 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught Aedes aegypti and Ae. albopictus larvae using C6/36 cell culture and reverse transcriptase-polymerase chain reaction (RT-PCR) techniques
A. Rohania , I. Zamreea, H.L. Leea, I. Mustafakamalb, M.J. Norjaizab and D. Kamilanc aMedical Entomology Unit, Infectious Disease Research Centre, Institute for Medical Research, Kuala Lumpur bVector Borne Disease Centre Programme, Kuala Terengganu, Terengganu cVector Borne Disease Centre Programme, Kuantan, Pahang
Abstract
Larvae of Aedes aegypti and Aedes albopictus were collected from a wide variety of artificial containers. Most samples were collected from used tyres and water-holding containers located in residential urban or rural areas. The identified mosquito larvae were pooled according to the species, date and locality and stored at –70 °C. A total of 378 pools of Ae. aegypti and 553 pools of Ae. albopictus were collected. Virus isolation was carried out using cell culture (C6/36 clone) of Ae. albopictus and virus detection by reverse-transcriptase polymerase chain reaction (RT-PCR). Transovarial transmission of dengue virus was demonstrated in both Ae. aegypti and Ae. albopictus in nature. Infected larvae were recovered from 16 localities (10 in Terengganu; 5 in Kuala Lumpur and 1 in Pahang). The study showed that both the cell culture and RT-PCR techniques can be used to detect dengue virus from mosquito larvae.
Keywords: Dengue; Aedes aegypti; Aedes albopictus; Transovarial transmission; Malaysia.
Introduction dengue.[1,2,3] Ae. aegypti breeds in clean water collected in and around human settlements. Dengue is an acute arboviral human disease Ae. albopictus can be found not only around caused by four serotypes of dengue viruses, and near human habitation, like Ae. aegypti, which are closely related but antigenically but also in forests and plantations. distinct. Dengue viruses are transmitted to humans through the bite of infected The emergence of dengue has been linked mosquitoes. For many years, members of the to economic and ecological changes that subgenus Stegomyia, especially Aedes aegypti caused dramatic expansion of the urbanized (Linn.) and Aedes albopictus (Skuse.) have been vector of dengue viruses. Industrialization and recognized as the primary vectors of rapid human population growth led to
E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 47 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus uncontrolled urbanization in Malaysia. In the type-specific identification by immuno- absence of proper water supply (for example flourescence or multiplex RT-PCR. This in the squatter (slum) areas), residents have to approach is less effective since the virus is store water for domestic use, creating the ideal already circulating in the human population. A ecological niche for Ae. aegypti and Ae. more effective approach is to detect the virus albopictus. These mosquitoes prefer to feed in mosquitoes before it is introduced into the on humans and to lay eggs in artificial human population. This way, preventive vector containers. The increase in air travel also control measures can be undertaken contributed to the expansion of dengue, immediately to offset an outbreak. Surveillance providing the means for viremic people to move of mosquitoes infected with dengue viruses very rapidly from one place to another.[4] provides an early warning sign for risk of transmission in an area and the specific The prevention and control of dengue predominant circulating serotype in the vector outbreaks depends upon the surveillance of population.[8] Control programmes can be cases and mosquito vectors. Vector surveillance prioritized and focused more effectively in allows timely implementation of emergency specific localities. mosquito control measures to limit an impending outbreak from spreading. The objective of this study was to detect dengue virus from field mosquitoes using C6/36 In Malaysia, a comprehensive mosquito cell culture and reverse transcriptase- control programme administered by the Vector- polymerase chain reaction (RT-PCR) Borne Disease Control Programme, Ministry techniques. of Health, incorporates source reduction, public health education, community participation and law enforcement against mosquito breeding. Materials and methods The Aedes control strategy has focused mainly on surveillance for the elimination of Aedes Larval collections larval breeding habitats and emergency control of adults using insecticidal fogging during Third and fourth instar Aedes aegypti and Aedes outbreaks. Although this strategy has albopictus larvae were collected from the field successfully reduced the Aedes mosquito in major towns in Malaysia, i.e. Terengganu, population to a relatively low level, as indicated Pahang and Kuala Lumpur. The larvae were by the overall House index (HI), it has not collected during dengue outbreaks for each prevented the emergence of progressively state in 2005. Mosquito larvae collected in the larger outbreaks in recent years.[5] survey were identified using standard taxonomic keys. Identified mosquito larvae Despite extensive research on vaccine were segregated according to species, site and development, there are at present no known date. Mosquito larvae were stored in pools of methods of controlling dengue except by 10 larvae per pool in cryogenic vials at –70 °C limiting the mosquito vectors. Virological for future virus isolation studies. The mosquito surveillance, which involves the monitoring of pools were selected randomly and dengue virus dengue virus infection in humans, has been detection was carried out by RT-PCR and C6/ used as an early warning system to predict 36 cell culture technique. A total of 931 pools outbreaks.[6,7] Such surveillance is based on of Aedes mosquitoes were separated equally isolation of dengue virus from human serum and assayed by C6/36 cell culture and RT-PCR. by cell culture or mosquito inoculation and
48 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
Detection of dengue virus using consensus primers (TCAATATGCTGAAACGCG reverse transcriptase-polymerase CAGAAACCG and TTGCACCAACAGTCAATGT chain reaction (RT-PCR) CTTCAGGTTC).[9] The primers correspond to genome positions 131 to 161 and 616 to 644 of dengue virus respectively. Master mix was Extraction of RNA prepared using Titan One Tube RT-PCR Kit. The larval pools were homogenized in a sterile Each reaction required 9.75 μl of double homogenizer and RNA was extracted using distilled water, 2 μl of dNTP mix, 1.25 μl of High Pure Nucleic Acid Kit (Roche, Germany). DTT, 0.5 μl RNAse inhibitor, 5.0 μl of RT-PCR The procedures of RNA extraction were as buffer, 0.5 μl of enzyme mix, 0.5 μl of dengue follows: 200 μl sample were added universal sense primer and 0.5 μl of dengue subsequently into 1.5 ml eppendorf tubes universal anti-sense primer to reach 20 μl total containing 50 μl proteinase K. This was briefly volume of master mix. vortexed and incubated at 27 °C for 10 RNA products were prepared by heating minutes. Subsequently, 100 μl of isopropanol the tubes at 65 °C for 5 minutes by block heater. was added and vortexed briefly. The solution Five microlitres of each RNA product were was then pipetted into the high pure filter added to the master mix and then centrifuged tubes, placed into collection tubes and were at 8000 rpm. The RT step was carried out at then centrifuged at 14 000 rpm for 1 minute. 51 °C for one 30 minutes to produce cDNA The flow-through was discarded and filter tubes which was then amplified by the following PCR were placed into new collection tubes. Five steps: 92 °C for 3 minutes as initial denaturation, hundred microlitres of inhibitor-remover wash 92 °C for 30 seconds as denaturation steps, 51 °C buffer were added into the upper reservoir and for 45 seconds as annealing step and 72 °C for centrifuged at 14 000 rpm for 1 minute. The 1 minutes as extension step. The cycle was flow-through was discarded and again the filter repeated 41 times before final extension at 72 °C tubes were placed into new collection tubes. for 5 minutes. For every RT-PCR run, a positive A volume of 450 μl wash buffer was added to control (a confirmed dengue isolate) and the upper reservoir and centrifuged at 14 000 negative control (C6/36 cell culture without rpm for 1 minute. The flow-through was dengue virus) were included. discarded and again the filter tubes were placed into new collection tubes. The wash step was The PCR products were analysed by repeated and continued with a short spin for performing electrophoresis in a 2.0% Nusieve 15 seconds. The collection tube was discarded PCR gel (FC Bio, USA) stained with ethidium and the filter tubes were inserted into clean bromide and run at about 100 volts. The gel 1.5 ml eppendorf tubes. RNA was eluted by was viewed under ultraviolet illuminator (Ultra adding 35 μl elution buffer into the middle spot Lum Ins., California, USA) and the image of of the filter tubes and centrifuged at 14 000 the resulting band was captured with a Polaroid rpm for 2 minutes. The extracted RNA was camera. kept at –70 °C until used.
Dengue virus detection using Ae. Detection of viral RNA using consensus [10] primers albopictus clone C6/36 cells
RNA isolated from each pool was subjected to The method employed was modified from [11] the RT-PCR assay using Lanciotti’s dengue Maneekarn. The C6/36 cells were grown in
Dengue Bulletin – Volume 31, 2007 49 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus minimum essential medium (MEM) growth peroxidase complex at 1:1000 for 40 minutes media supplemented with 10% fetal calf serum followed by washing and peroxidase reaction, (FCS) for 2 days until cell monolayers were using 0.2 mg/ml of 3,3 diaminobenzidine formed in culture tubes. Pooled mosquitoes (DAB) and 0.2% H2O2 as the substrate. The were homogenized on ice in 1.5 ml MEM cells were observed under a normal light medium with 5% fetal calf serum. 100 ul each compound microscope. The positive samples of the homogenate were passed through 0.2 were reconfirmed by a second passage in cell um filters and inoculated into respective culture culture. tubes. The culture tubes were then vortexed and left to incubate for 2 hours at ambient temperature for adsorption. Maintenance Minimum Infection Rate (MIR) medium containing 2% FCS was added and the culture tubes were incubated at 28 °C for The MIR was used to compare virus infection 7 days. rates in Ae. aegypti and Ae. albopictus larvae at the sampling area. The MIR was calculated as (number of positive pools by species ÷ total Smear preparation number of that species tested) X 1000.[13]
The culture tubes were vortexed and centrifuged after 7 days’ incubation period. Virus Infection Rate (VIR) Cells from the sediments were transferred onto the Teflon-coated, 12 well slides where each The VIR was calculated as (number of slide would have a maximum of 7 test smears, mosquitoes by species infected with dengue 4 positive control and a negative control. The virus ÷ total number of that species tested) X [14] smears were left to dry at 28 °C for 4 hours in 100. a class II biohazard cabinet with the air blower on. The smears were then fixed with cold acetone for 20 minutes. The cultures were Results and discussion stored at –20 °C for confirmation by a second or third passage in cell culture if only the initial In urban areas of Malaysia, artificial containers results were positive. are the major larval habitats of Aedes mosquitoes in and near human habitation. The type and location, presence of shade and water Peroxidase-antiperoxidase (PAP) staining conditions usually associated with water receptacles are known to affect breeding of PAP staining procedures were performed as Aedes mosquitoes.[15] previously described by Igarashi.[12] The cells that were fixed with cold acetone reacted with The dominant mosquito larvae collected dengue anti-serum at 1:1000 at room in the present survey were Ae. albopictus, temperature for 40 minutes. The antibody is whereas only very low number of containers universally reactive to all 4 dengue serotypes. were positive for Ae. aegypti larvae. Ae. aegypti The cells were rinsed in PBS and reacted with tend to be more selective in nature compared rabbit anti-mouse IgG at 1:1000 for 40 minutes. to Ae. albopictus. Ae. aegypti larvae preferred The cells were rinsed in PBS again and then heavily shaded areas. This preferential choice reacted with goat-anti rabbit IgG at 1:1000 for of shaded breeding area was due to the stability 40 minutes. The cells were then rinsed in PBS of water temperature in the artificial containers and exposed to peroxidase-rabbit anti- and therefore more conducive to breeding.[15]
50 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
A total of more than 500 containers from 179 artificial containers were positive for Ae. 422 collection sites were examined and yielded aegypti breeding and the preferred sites a total of 9310 Aedes larvae comprising 5530 included artificial receptacles: tyres – 26.3%; of Ae. albopictus and 3780 of Ae. aegypti. Ae. plastic containers – 21.2%; tins – 16.2%; and albopictus was more abundant than Aedes paint cans – 9.5% (Table 1). aegypti. The preferred sites for Ae. albopictus included artificial receptacles: tyres – 23.9%; A total of 378 Ae. aegypti pools were plastic containers – 23.5%; tins – 16.5%; and selected randomly for virus detection. Of these, earthen jars – 7.8% (Table 1). All these 33 pools were positive for dengue virus by cell containers were found not only around houses culture and 19 pools were positive by RT-PCR. and shops in urban areas but also in rubber A total of 553 Ae. albopictus pools were assayed plantations, coconut plantations and in the and 17 pools were positive by cell culture vicinity of houses in suburban areas. Overall, technique and 6 pools were positive by RT-PCR.
Table 1: Comparison of breeding of mosquito larvae in different types of containers
*10 larvae per pool
Dengue Bulletin – Volume 31, 2007 51 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
The positive pools were collected from tyres, Our findings suggest the occurrence of plastic containers, abandoned washing machine, transovarial transmission of dengue virus by Ae. glass and wheel barrow. We detected dengue aegypti and Ae. albopictus in nature. Infected virus in larvae by RT-PCR and cell culture larvae were recovered from 16 localities (10 technique because it was easier to collect larvae in Terengganu; 5 in Kuala Lumpur and 1 in from field compared with adult mosquitoes. Pahang). The virus infection rates (VIR) were Infection rates of Ae. aegypti and Ae. albopictus higher in Ae. aegypti (13.7%) compared to Ae. in the survey are expressed as MIR and albopictus (4.2%). Field isolations of dengue compared. Our study showed that MIR for Ae. virus from Ae. albopictus larvae were reported aegypti was higher compared to Ae. albopictus in China[16] and Brazil.[17] Chung[14] and despite higher number of Ae. albopictus Rohani[3] reported that field-caught male samples. More positive pools came from tyres mosquitoes of both Ae. aegypti and Ae. and plastic containers. Table 2 and 3 summarizes albopictus are capable of being infected with the results of the virus isolation. The figure shows dengue virus in the natural environment. If the agarose gel electrophoresis of RT-PCR of mechanism of infection in these infected dengue virus. The correct size of the DNA maternal parents and the sex ratio for infection product (480 bp) was obtained for each of the in the offspring was equal, it is likely that a positive pools after amplification with universal similar proportion of females in the field were dengue primers. The serotyping showed that also infected via the same mode of transovarial the viruses belonged to DENV-1 and DENV-3. transmission, without the need for the presence
Table 2: Detection of dengue virus by RT-PCR
MIR – Minimum infection Rate per 1000 mosquito larvae * 10 larvae per pool
52 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
Table 3: Detection of dengue virus by C6/36 cell culture
MIR – Minimum infection rate per 1000 mosquito larvae *10 larvae per pool of infected hosts.[17]. The infected males also role.[19] However, in an urban and suburban could pass the virus to the females during environment, they can share a breeding site.[20] mating, and the latter in turn could pass it on Ae. aegypti is a very efficient vector for dengue to their offspring transovarially.[18] viruses, highly receptive to oral infection, well adapted to urban environment (e.g. laying eggs In Malaysia, Ae. aegypti is the main vector only in artificial containers), and feeding involved in dengue virus transmission. Ae. exclusively on humans. On the other hand, Ae. albopictus plays an important but secondary albopictus, which is not highly orally receptive
Dengue Bulletin – Volume 31, 2007 53 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
Figure: Detection of dengue virus in pools of Aedes mosquitoes electrophoresis of RT-PCR products on 3% agarose gels. Lane M – marker; lanes 1 - positive control of laboratory infected Ae. albopictus; lane 2 - negative control of uninfected Ae. albopictus; Lane 3, 4 - RT-PCR products from field Ae. albopictus pools positive for dengue virus; Lane 5 - negative control of uninfected Ae. aegypti; Lane 6,7 - RT-PCR products from field Ae. aegypti pools positive for dengue virus; Lane 8 - positive control of laboratory infected Ae. aegypti; Lane 9 - negative control from cell culture and lane 10 - positive control from dengue virus culture.
to dengue virus, is present mainly in rural areas observed by Singh and Paul.[23] Gubler[24] and does not feed exclusively on humans. Ae. reported that some viruses grow slowly in C6/ albopictus could bridge a putative sylvatic and 36 cells. an urban cycle of dengue since it colonizes both rural and suburban breeding sites.[21,22] The mosquito inoculation technique and cell culture in C6/36 cell line are widely This study showed that both cell culture practised for the isolation of dengue virus from and RT-PCR techniques can be used to detect human serum. The availability of a number of dengue virus from mosquito larvae. The results tissue culture systems for the propagation of showed that the rate of dengue virus detection dengue virus has greatly facilitated studies on was significantly higher by cell culture this agent. However, the low efficiency of technique (28.0%) than RT-PCR technique infected cells and the slow development of (9.5%). However, no conclusive observation virus within them remain major obstacles. can be made because these field-collected Dengue-infected cells need 7–10 days to grow larvae were separated randomly for the study. and, therefore, virus detection methods using Our study observed heavy cytopathic effects mosquito cell line are time-consuming and in dengue-infected C6/36 cell culture as relatively labour-intensive. Another
54 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus disadvantage to this method of flavivirus populations, which typically have very short detection in field-caught mosquitoes has been periods (4-5 days) of detectable viremia. the requirement to keep captured mosquitoes alive or frozen fresh to detect viral infection. Active surveillance for dengue virus infected mosquitoes can be an effective way to predict RT-PCR for the detection of flaviviruses in the risk of dengue infection in a given area. A human clinical samples has been used for need exists for better techniques to conduct nearly a decade now.[25] The accuracy and timely, accurate and meaningful vector surveys speed of the RT-PCR assay makes it an and virus detection for estimating transmission appealing test for the diagnosis of dengue and risk among susceptible population in endemic epidemiologic surveillance. The present study areas. PCR could be considered for processing indicates that PCR could detect dengue virus large numbers of samples in operational in mosquitoes using larvae collected from the programmes, mapping areas with different levels field. Similar findings were also reported by of endemicity and stratification of areas, provided Chao et al. (2007).[26] These techniques the technique is further refined to have higher constitute practical molecular diagnostic and specificity and sensitivity. A better understanding epidemiological tools for the virological of dengue virus-vector relationships in the field surveillance of dengue virus-infected Aedes and their association with human disease can mosquitoes to serve as an early warning system help establish reliable vector population target for dengue outbreaks. levels for initiating measures to control and reduce virus transmission. In typical infections many types of mosquito tissues are eventually infected and the virus can persist in these tissues throughout Acknowledgements the life of the vector. It is generally assumed that once a mosquito becomes infected with The authors wish to thank the Director, Institute dengue it retains that infection for life.[27] for Medical Research, Kuala Lumpur, for Therefore, the collection of wild-caught permission to publish. Thanks are also due to mosquitoes would appear to be a reasonable the staff of the Medical Entomology Unit/IDRC, approach to virus detection compared with IMR, and the Vector-Borne Disease Centre attempts at virus recovery in human Programme, Terengganu and Pahang.
References
[1] Boromisa RD, Rai KS, Grimstad PR. Variation Asian J Trop Med Public Health. 1997 Mar; in the vector competence of geographic strains 28(1): 138-42. of Aedes albopictus for dengue 1 virus. J Am Mosq Control Assoc. 1987 Sep; 3(3): 378-86. [4] Gubler DJ. The global pandemic of dengue/ dengue haemorrhagic fever: current status and [2] Gubler DJ. Dengue and dengue hemorrhagic prospects for the future. Ann Acad Med fever in the Americas. P R Health Sci J. 1987 Singapore. 1998 Mar; 27(2): 227-34. Aug;6(2):107-11. [5] VBDCP. Annual report vector borne disease [3] Ahmad R, Ismail A, Saat Z, Lim LH. Detection control programme, Ministry of Health, of dengue virus from field Aedes aegypti and Malaysia. 2004: 177. Aedes albopictus adults and larvae. Southeast
Dengue Bulletin – Volume 31, 2007 55 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
[6] Lam SK. Two decades of dengue in Malaysia. [14] Kow CY, Koon LL, Yin PF. Detection of dengue Trop Med. 1993; 35(4): 195-200. viruses in field caught male Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in [7] Seah CL, Chow VT, Tan HC, Can YC. Rapid, Singapore by type-specific PCR. J Med single-step RT-PCR typing of dengue viruses Entomol. 2001 Jul; 38(4): 475-9. using five NS3 gene primers. J Virol Methods. 1995 Feb; 51(2-3): 193-200. [15] Rohani A, Abdullah AG, Ong YF, Saadiyah I, Zamree I, Lee H L. Survey of mosquito larvae [8] Loroño-Pino MA, Cropp CB, Farfán JA, distribution in container habitats collected Vorndam AV, Rodríguez-Angulo EM, Rosado- from urban and rural areas in major towns of Paredes EP, Flores-Flores LF, Beaty BJ, Gubler Malaysia. Trop Biomed. 2001; 18(1): 41-49. DJ. Common occurrence of concurrent infections by multiple dengue virus serotypes. [16] Zuo L, Shu LP. Isolation, identification, and Am J Trop Med Hyg. 1999 Nov; 61(5): 725-30. phylogenetic analysis of a dengue virus strain from Aedes albopictus collected in Mawei town [9] Lanciotti RS, Calisher CH, Gubler DJ, Chang in Guizhou Province, China. Chin Med J (Engl). GJ, Vorndam AV. Rapid detection and typing 2004 Dec; 117(12): 1847-9. of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain [17] Mitchell CJ, Miller BR. Vertical transmission of reaction. J Clin Microbiol. 1992 Mar; 30(3): dengue viruses by strains of Aedes albopictus 545-51. recently introduced into Brazil. J Am Mosq Control Assoc. 1990 Jun; 6(2): 251-3. [10] Igarashi A. Isolation of a Singh’s Aedes albopictus cell clone sensitive to dengue and [18] Tu WC, Chen CC, Hou RF. Ultrastructural chikungunya viruses. J Gen Virol. 1978 Sep; studies on the reproductive system of male 40(3): 531-44. Aedes aegypti (Diptera: Culicidae) infected with dengue 2 virus. J Med Entomol. 1998 Jan; [11] Maneekarn N, Morita K, Tanaka M, Igarashi 35(1): 71-6. A, Usawattanakul W, Sirisanthana V, Innis BL, Sittisombut N, Nisalak A, Nimmanitya S. [19] Lee HL. A nation wide resurvey of the factors Applications of polymerase chain reaction for affecting the breeding of Aedes aegypti (L.) and identification of dengue viruses isolated from Aedes albopictus (Skuse) (Diptera:Culicidae) patient sera. Microbiol Immunol. 1993; 37(1): in urban town of Peninsular Malaysia 1988- 41-7. 1999. Trop Biomed. 1991;8:185-189. [12] Igarashi A, Fujita N, Okura Y. Isolation of [20] Lee HL. Environmental friendly approaches dengue viruses from patients with dengue to mosquito control. Symposium on “Towards hemorrhagic fever (DHF) and those with fever A mosquito-safe environment” 29-30 June of unknown origin (FUO) in Jakarta, Indonesia 1999. Legend Hotel, Kuala Lumpur, Malaysia. in the year of 1981 and 1982. Annals of International Council for Medical Research [21] Rudnick A. Ecology of dengue virus. Asian J 1992;2:7-17. Infectious Disease. 1978; 2: 156-160. [13] Chow VT, Chan YC, Yong R, Lee KM, Lim LK, [22] Vazeille M, Rosen L, Mousson L, Failloux AB. Chung YK, Lam-Phua SG, Tan BT. Monitoring Low oral receptivity for dengue type 2 viruses of dengue viruses in field-caught Aedes aegypti of Aedes albopictus from Southeast Asia and Aedes albopictus mosquitoes by a type- compared with that of Aedes aegypti. Am J specific polymerase chain reaction and cycle Trop Med Hyg. 2003 Feb; 68(2): 203-8. sequencing. Am J Trop Med Hyg. 1998 May; [23] Singh KR, Pavri KM. Experimental studies with 58(5): 578-86. chikungunya virus in Aedes aegypti and Aedes albopictus. Acta Virol. 1967 Nov; 11(6): 517- 26.
56 Dengue Bulletin – Volume 31, 2007 Detection of transovarial dengue virus from field-caught larvae of Ae. aegypti and Ae. albopictus
[24] Gubler DJ, Kuno G, Sather GE, Velez M, Oliver [26] Chao DY, Davis BS, Chang GJ. Development A. Mosquito cell cultures and specific of multiplex real-time reverse transcriptase PCR monoclonal antibodies in surveillance for assays for detecting eight medically important dengue viruses. Am J Trop Med Hyg. 1984 Jan; flaviviruses in mosquitoes. J Clin Microbio. 2007 33(1): 158-65. Feb; 45(2): 584-9. [25] Eldadah ZA, Asher DM, Godec MS, Pomeroy [27] Rodhain F and Rosen L. Mosquito vectors and KL, Goldfarb LG, Feinstone SM, Levitan H, dengue virus relationships. In: DJ Gubler and Gibbs CJ Jr, Gajdusek DC. Detection of G Kuno, editors. Dengue and dengue flaviviruses by reverse-transcriptase polymerase hemorrhagic fever. Wallingford (UK): CAB; chain reaction. J Med Virol. 1991 Apr; 33(4): 1997. p. 45-60. 260-7.
Dengue Bulletin – Volume 31, 2007 57 A new approach to classify risk in dengue infection using bioelectrical impedance analysis
Fatimah Ibrahima , Wan Abu Bakar Wan Abasa, Mohd Nasir Taibb, Chan Chong Guanc and Saadiah Sulaimand aDepartment of Biomedical Engineering, Faculty of Engineering, University of Malaya, 50603, Kuala Lumpur, Malaysia bFaculty of Electrical Engineering, Universiti of Teknologi MARA, Malaysia cDepartment of Cardiology, Hospital Pantai Putri Ipoh, Perak, Malaysia dHealthmedic Research/Universiti Kebangsan, Malaysia
Abstract
The study on risk classification was conducted on 183 hospitalized dengue patients (4 DF, 179 DHF). The severity of the risk criteria was determined based on three blood investigations, namely, platelet (PLT) count (less than or equal to 30 000 cells per mm3), haematocrit (HCT) (increase by more than or equal to 20%), and either aspartate aminotransferase (AST) level (raised by 5-fold the normal upper limit) or alanine aminotransferase (ALT) level (raised by 5-fold the normal upper limit). The patients were divided into three groups based on their risk factors and the corresponding bioelectrical impedance analysis (BIA) (i.e. bioelectrical tissue conductivity (BETC) parameters), namely, resistance (R), phase α angle ( ), body capacitance (BC) and capacitive reactance (XC) were obtained and quantified. Using
logistic regression analysis, XC was found to be the best predictor in predicting the risk and severity in dengue patients. Subsequent two-way analysis of variance (ANOVA) found that there was a statistically
significant relationship between the group categories and the change in XC.
Hence, it was shown that BIA, as reflected by the XC value, can effectively segregate between the Ω Ω Ω Ω Ω lower-risk (female mean XC = 60.70 , range 58.09 –63.43 ; male mean XC = 62.17 , range 59.92 – Ω Ω Ω Ω 64.46 ) and the higher-risk dengue patients (female mean XC = 43.99 , range 42.05 –45.97 ; male Ω Ω Ω Ω mean XC = 50.65 range 49.25 –52.09 ), with the control data ((female mean XC =69.41 , range Ω Ω Ω Ω Ω 67.09 –71.74 ), and (male mean XC =64.19 , range 61.37 –67.15 )).
Keywords: Dengue infections; Bioelectrical impedance; Classify; Risk; Reactance.
Introduction has become endemic in the country with cases reported throughout the year. In 1998, there Dengue fever was first reported in Malaya (the were 27 373 dengue cases with 58 deaths former name for Malaysia) after an epidemic reported, as compared to 19 544 cases with in Penang in 1902.[1,2] Since then the disease 50 deaths in 1997. This has shown an increase
E-mail: [email protected]; Tel.: 603-7967-6818; Fax: 603-7967-4579
58 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis of 7829 cases or 40.1% in one year.[3] bioelectrical impedance technique. The However, the dengue haemorrhagic fever research findings illustrate that any change in
(DHF) case-fatality rate (CFR) increased to the value of reactance (XC) will indicate the 1.7%.[4] In 2001, there was a sharp increase in changes in electrical conductivity of the body dengue cases in the country according to the and this can be used to monitor and classify vector-borne disease unit of the Ministry of the risk severity in dengue patients. Health, Malaysia.[5] In 2003, the serologically confirmed dengue cases totaled 14 170, which number was slightly lower than the previous Principles of bioelectrical year (15 493). The CFR dropped to 4.5% as impedance in humans compared to 5.05% in 2002. The most deaths were seen in the 5–9-year-old age group, with Impedance (Z) is a measurement of the ability adults mainly in the 20–35 years age groups. of a medium to conduct current. All conductive The dengue cases have seen a rise of 16% materials have impedance, including living every year since 2003.[6] Fatalities related to tissues. The impedance of various organisms dengue cases reached record levels in 2004, is known as bioelectrical impedance, which when 102 fatalities were reported.[6] In January may vary seasonally, diurnally, and when 2005, the number of infections in parts of stimulated with an assortment of stimuli. An Malaysia rose significantly, with about 250 example of the said stimulus includes suspected dengue cases reported each week physiological changes that occur when a body in Kuala Lumpur, compared to an average of is affected by fever caused by bacterial and 100 cases weekly in December 2003. An viral infections. increase of 34.97%, representing 1416 cases, was recorded during the second week (Jan 9- Bioelectrical impedance analysis (BIA) is 15) of the year compared to the previous week [7] the assessment of changes in electrical tissue (1049 cases). Forty-four dengue patients died conductivity that indicate altered body in the first four months of 2007 out of 16 214 composition. The impedance of the body is cases reported, compared to 21 deaths and [6] made up of two components. The resistance 10 244 cases in the same period last year. (R) is the index of conductivity determined by energy-dissipating characteristics of the body. Due to the constantly high fatality rate, an The reactance (X ) is the index of conductivity accurate determination of the prognosis of the C determined by the energy-storing disease plays a very important role in the patient characteristics of the body. management, so that the high risk patients can be treated more intensively in their early phase In the healthy living body, the cell to improve survival. A non-invasive prognostic membrane consists of a layer of non-conductive system for dengue infection is yet to be lipid material sandwiched between two layers developed and deployed in Malaysia. Due to of conductive protein molecules. The structure the endemic dengue phenomenon in the of cell membranes makes them capacitive country, there is a real and obvious need for reactive elements which behave as capacitors such a prognostic system to be made available when exposed to an alternating current (Figures as soon as possible. 1a & 1b).[8] Although the total body water and extracellular water offer resistance to electrical This paper describes a novel non-invasive current, only cell membranes offer capacitive approach to monitor and classify the daily risk reactance. Since fat tissue cells are not in dengue patients using the single-frequency surrounded by cell membranes, reactance is
Dengue Bulletin – Volume 31, 2007 59 Risk measurement of dengue infection using bioelectrical impedance analysis
Figure 1(a): The plasma membrane of cell
Resistor Extacellular space Pump Lipid bilayer protein
Capacitor
Intracellular Cytoplasma space Dielectric Protein Protein channel
Figure 1(b): Plasma cell membrane electrical equivalent circuit
Dielectric Capacitor Intracellular Fluid Cell Membrane Resistor
Resistor
Capacitor
Dielectric Cell Nucleous Extracellular Fluid
Dielectric Capacitor
not affected by the quantity of body fat. Typical cell while allowing passage of some materials total body BIA measurements display the to which it is permeable. The cell membrane vectors of resistance and reactance, which are maintains a fluid osmotic pressure and ion intrinsically based on a series network of concentration gradient between the resistors and capacitors (Figure 2). intracellular and extracellular compartments. This gradient creates an electrical potential Biologically, the cell membrane functions difference across the membrane which is as a selectively permeable barrier separating essential to cell survival. Damage to the cell the intracellular and extracellular fluid membrane, and its functions, is as lethal to compartments. It protects the interior of the the cell as direct damage to the nucleus itself.
60 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis
Figure 2: Circuit of resistors and capacitors Serological study in the human body Blood samples were taken from patients with a clinical diagnosis of DF and DHF during admission and discharge to be used in the serological tests. Sera were stored at –20 °C for serological tests. Total white cell count Upper arm Torso (TWBC), platelet counts (PLT) and haematocrit (HCT) or packed cell volume (PCV) determination were done using an automated Lower arm STKS counter (Street Scientific, Holliston). This unit was calibrated everyday with a standardized specimen to ensure that the accuracy and Upper Leg Alternating precision lay within the acceptable range. Current flows (Thigh) From hand to Foot All the dengue patients’ serum samples were tested in the HUKM for serological evidence of acute dengue virus infection using Lower Leg IgM capture enzyme-linked immunosorbent (Calf) assay (ELISA)[12,13,14,15] or PanBio (2001)[16] dengue duo IgM and IgG rapid strip test. If the findings of ELISA were inconclusive, additional haemagglutin-inhibition (HI) assays were Resistance is indirectly related to the performed at the WHO collaborating Centre extracellular mass and reactance (XC) is for Arbovirus Reference and Research (dengue indirectly related to the intracellular mass. Low and dengue haemorrhagic fever) in Department
XC, which correspond to the inability of cells to of Microbiology, University of Malaya Medical store energy and indicates of cell breakdown Centre (UMMC), Kuala Lumpur. in selective permeability of cell membranes.
On the contrary, high XC, indicates large quantities of intact cell membranes and body Bioelectrical impedance [9,10,11] cell mass. measurement
Methodology All patients were required to abstain from eating and drinking for four hours and from alcohol and physical exercise for 12 hours prior Subjects to the BIA measurement. These protocols were implemented to ensure accurate body A total of 183 adult patients aged 12 years and composition results.[17] Informed consent was [12,13] above, serologically confirmed (IgM or IgG obtained for each patient and anthropometrics positive) dengue patients during their measurements (height and weight) were taken hospitalization in University Kebangsaan at admission. The clinical data comprised of Malaysia (HUKM) in 2001 and 2002, were date of onset of fever, daily surveillance of prospectively studied. For the control data, a symptoms, signs, physical examination, blood total of 142 healthy volunteers with no past results from laboratory tests and the medical history were recruited and studied. bioelectrical impedance measurements. The
Dengue Bulletin – Volume 31, 2007 61 Risk measurement of dengue infection using bioelectrical impedance analysis clinical data, weight and bioelectrical Study protocol and risk impedance measurement were taken daily, on admission, and upon discharge. This in vivo classification technique involved the application of a small average constant current of less than 1 mA at The clinical diagnosis and severity of dengue a single frequency of 50 kHz through the human haemorrhagic fever grade I to IV were based [18] body, and measuring the body’s bioelectrical on WHO recommendations. Since the tissue conductivity (BETC) parameters, namely, patients were admitted at different stages of R, phase angle (α), body capacitance (BC), and their illness, the daily progress of the patients was dated with reference to the day the fever capacitive reactance (XC) via four surface electrodes. subsided (‘Fever day +0’). Hence, ‘Fever day +0’ is defined as the day the fever subsided, Two electrodes were placed on the i.e. when the body temperature fell below patient’s right hand, one at the base of the 37.5 °C. Days prior to the fever day +0 were knuckles and another slightly above the wrist designated as ‘Fever day –1’ (one day before joint. Another two electrodes were placed on the fever subsided), etc. Days after the fever the right foot; one near the base of the toes subsided are designated as ‘Fever day +1’ (one and the other slightly above the ankle joint. A day after the fever subsided) and so on. constant current was applied to the base of the knuckles and base of the toes, and the In this study, the severity of dengue risk signal was picked up by the other two sensor criteria was determined based on the earlier [18,19,20,21,22,23,24] electrodes (slightly above the ankle and wrist research findings and confirmed joint) as shown in Figure 3. haematological profile (PLT, HCT, aspartate
Figure 3: Bioelectrical impedance measurement test position and placement of sensor electrodes
62 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis aminotransferase (AST), alanine amino- normality assumption and for tests of transfansferase (ALT)) analysis finding in this significance. If the variable was not normally research. An exhaustive literature review distributed, natural logarithm was used to conducted by Bandyopadhya et al.[24] reveals transform the variables. Using logistic regression the difficulties of using the WHO case analysis, XC was found to be the best predictor classification for DHF. It found that most in predicting the risk factors in dengue clinicians reported difficulties in meeting all the patients.[23] Subsequent two-way analysis of four criteria: (i) fever; (ii) haemorrhagic variance (ANOVA) found that there was a tendencies; (iii) thrombocytopenia (100 000 statistically significant relationship between the 3 cells per mm ); and (iv) HCT >20% set by group categories and the change in XC. The
WHO. Therefore, most clinicians used the mean of HCT and XC in the Groups 1 and 2 modified classification in their study. This study with fluid infusion and without were compared also faced the same problem and the criteria to find any significant changes. of the risk were not based on WHO classification solely; therefore, some modification was made. Thus, the severity of Results and discussions dengue risk criteria was determined based on the following blood investigations: (i) platelet Clinical dengue patients (PLT) count was less than or equal to 30 000 3 [19,20] cells per mm ; (ii) haematocrit (HCT) The 142 healthy controls (91 females and 51 [18] increase by more than or equal to 20%; and males) had their BIA measured. The clinical data (iii) aspartate aminotransferase (AST) rose by and BIA measurements were made on 97 male [21,22,23] 5-fold the normal upper limit for AST and and 86 female DF and DHF patients during their alanine aminotransfansferase (ALT) rose by 5- hospitalization. The ages of the patients varied [21,22,23] fold the normal upper limit for ALT. The between 12 and 83 years (mean of 30.8 years). patients were divided into three groups based The length of hospital stay ranged from 2 to 18 on their risk factors: (i) Group 1 (lower risk days (mean of 4.7 days). Three female and one group) accounted for DHF patients who did male patients were clinically diagnosed as DF, not experience any of the defined risk criteria, 83 as DHF I (39 females and 44 males), 92 as or experienced only one of the three risk DHF II (40 females and 52 males) and 4 female criteria; (ii) Group 2 (higher risk group) patients as dengue shock syndrome (DSS). No accounted for DHF patients who experienced DSS or fatal case was reported in the male DHF two or more risk criteria; and (iii) Group 3 patients. (control data) was the control group for healthy female and male subjects. Once the dengue The detailed descriptive analysis of patients were classified according to their haematological profile (97 males and 86 female groups, the corresponding BETC parameters dengue patients) for PLT, HCT, AST and ALT were subsequently obtained and quantified. are tabulated in Table 1. For example, the minimum platelet count recorded on the day of fever defervescence (‘Fever day 0’) was Statistical analysis 8000 cell/mm3, while the maximum was 136 000 cell/mm3, with a mean of 37 400 ± Data were analysed using the SPSS statistical 25 cell/mm3 for the male patients. The females’ package version 10.01 for Windows 1998. minimum and maximum documented platelet Kolmogorov-Smirnov test and simple linear counts were 7000 cell/mm3 and 162 000 cell/ regression were used for examining the mm3 respectively with a mean of 48 000 ± 35
Dengue Bulletin – Volume 31, 2007 63 Risk measurement of dengue infection using bioelectrical impedance analysis
Table 1: Haematological profile for PLT, HCT, AST, and ALT in dengue patients
The reference value for normal range of PLT, HCT, ALT and AST are based on Berhman and Kliegman[26] cell/mm3. The mean platelet counts observed that the criteria of platelet count <30 000 cell/ for both male and female dengue patients was mm3 identified the more severe cases. low on the day of fever defervescence (‘Fever day 0’) and remained low for the next 2 to 4 The distribution of serum transaminase is days (‘Fever days 1 to 4’). In this study, many also shown in Table 1. The mean levels of ALT DHF patients with platelet count (mean ± SD) and AST on ‘Fever day 0’ for male subjects were of lesser than 100 000 cell/mm3 were observed 177.9 ± 138 U/I (range 12–580 U/I) and 291.1 to be not ill (Table 1). However, it was observed ± 241 U/I (range 79–696 U/I) respectively. On
64 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis the other hand, the female mean levels of ALT abnormalities occur in PLT, AST and ALT, while and AST on ‘Fever day 0’ were 267.7 ± 458 U/ HCT only has a moderate elevation. I (range 13–2270 U/I) and 755.5 ± 586 U/I (range 341–1170 U/I) respectively. The results In the group’s risk categorization, 91 (49.7%) indicate that both male and female dengue dengue patients were in the lower risk group, patients had liver involvement (hepatocyte while 92 (50.3%) were in the higher risk group. injury), ranging from mild to moderate degrees, The detailed dengue diagnosis breakdown is as indicated by the elevation in the transaminase shown in Table 2. The higher risk group consists levels (>5-fold greater than the normal upper of 92 DHF patients, which was made up of 32 limit of AST and ALT). (17.5%) DHF I, 56 (30.6%) DHF II, and 4 (2.2%) DHF IV/DSS patients. The detailed descriptive It was also observed that the AST level was analysis of haematological profile for PLT, HCT, higher than that of ALT level in female dengue AST and ALT in both lower and higher-risk patient patients, while in the male patients, it only groups in the duration of ‘Fever day 0’ to ‘Fever occurred on fever days 0 and +1. The female day +4’ are tabulated in Table 3. mean levels of AST and ALT were higher (the average for fever days 0 to +4 was >9-fold It can be observed that both groups greater than the normal upper limit of AST and produced abnormal PLT, HCT, ALT and ALT ALT) than the value for male subjects for all fever levels. Patients in the higher-risk group (Group days (the average for fever days 0 to 4 was <5- 2) produced the lowest PLT values with an fold greater than the normal upper limit for the average of 7000 cells/mm3 for both genders. AST and ALT), as illustrated in Table 1. These The distribution of serum transaminases (AST findings are in agreement with those of Nguyen and ALT) indicate that the females in Group 2 et al.[25] and Kuo et al.,[21] who documented had their ALT levels raised by 76-fold (2353/31) that the elevation in the transaminase levels were the normal upper limit (<31),[26] whereas the <5-fold and >10-fold greater than the normal AST levels were raised by 167-fold (5179/31) upper limit for AST and ALT respectively. Thus, the normal upper limit (<31).[26] On the other the criteria of 5-fold rise above the normal upper hand, the ALT and AST values for males in Group limit for AST and ALT were chosen. 2 were only raised by 14.5-fold and 18.8-fold the normal upper limits of ALT and AST, The mean HCT levels for both female and respectively (Table 3). These results show that male dengue patients were not much elevated patients in the higher-risk group (Group 2) had with subsequent fever days. For example, on a high degree of liver involvement. In addition, ‘Fever day 0’ the female and male HCT values the HCT values for female (55.9) and male were 38.9 ± 7% and 44.7 ± 6% respectively. (65.7) subjects in Group 2 had exceeded the The overall descriptive analysis of haematological upper normal values (37–47) of HCT at 47 and profile (Table 1) showed that constant 54 respectively (see Table 3).
Table 2: Dengue diagnosis breakdown according to risk group
Groups DF DHF I DHF II DHF IV/DSS Total cases
Lower risk (Group 1) 4 51 36 Nil 91
Higher risk (Group 2) Nil 32 56 4 92
Dengue diagnosis cases 4 83 92 4 183
Dengue Bulletin – Volume 31, 2007 65 Risk measurement of dengue infection using bioelectrical impedance analysis
Table 3: Blood investigations for both lower risk (Group 1) and higher risk (Group 2)
N=sample size
tends to drop with fluid infusion with X (X = BIA result analysis C C 62.89 Ω) being higher, approaching the normal healthy individuals. Thus, we extrapolate further Table 4 shows the value of HCT and XC for the dengue patients in Groups 1 and 2, without or that in Group 1 the intracellular cell membrane with intravenous fluid. At ‘Fever days 0-4’, the is not much affected. On the other hand, in the higher-risk Group 2, with fluid infusion, the mean values of HCT and XC without fluid infusion (HCT = 39.05, X = 61.43 Ω) or with HCT continues to increase and this is reflected C Ω Ω further by the XC (XC = 47.92 ) that is relatively fluid infusion (HCT= 37.56, XC = 62.89 ) in Group 1, do not differ much. For Group 2, at low. This shows that the intracellular cell ‘Fever days 0-4’ the mean values of HCT and membrane is low and is affected by the severity in dengue, and low XC is indicative of cell XC without fluid infusion (HCT = 37.75, XC = 51.31 Ω) or with fluid infusion (HCT= 40.13, breakdown in selective permeability of the cell Ω membrane. Thus, XC is the indicator for the XC = 47.92 ) in Group 2 also do not differ much. However, when these mean values of degree of severity in dengue patients. HCT and X were compared between Groups C The interesting results indicate that the fluid 1 and 2, it was observed that the value of XC was always lower in the higher risk group (with infusion does not alter the cell membrane or without fluid infusion) than the lower risk (average reactance value) for ‘Fever days 0-4’ group. Group 1 (lower risk) patient without fluid infusion (61.43 Ω) and with fluid infusion (62.89 Ω In lower-risk (Group 1) dengue patients with ), while Group 2 (higher risk) patient without Ω the fluid infusion, the HCT showed the fluid infusion (51.3 ) and with fluid infusion (47.92 Ω). However, the value of X is different decreased value, while the X was high. On the C C between the groups (Group 1, X = 62.89 Ω : other hand, for the higher-risk (Group 2) dengue C Group 2, X = 47.92 Ω for fluid infusion) or patients with fluid infusion, the HCT showed C (without fluid infusion Group 1, X = 61.43 Ω : an increased value, while the X was low. At C C Group 2, X = 51.3 Ω). Reactance can be the this moment, we do not have data on normal C indicator for the dengue severity by the low individual of the degree of XC in relation to the HCT, whether affected by the fluid infusion or value of reactance in the higher-risk group as not; however, in the lower-risk Group 1 the HCT compared to lower-risk group.
66 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis
Table 4: Summary of reactance value with dengue patients with or without fluid intravenous
Theoretically, reactance in BIA is a measure vascular permeability in the pathophysiology of of the volume of cell membrane capacitance DSS. In the case of severe dengue, prompt and and an indirect measure of the intracellular vigorous volume replacement therapy is required volume or body cell mass. Any changes in the with extreme care to avoid fluid overload. If cell membrane can be measured by reactance more fluid is infused, there will be leakage; indirectly. In a normal healthy subject, if there however, it will prevent the patient from is a fluid infusion, it will go to the intravascular hypovolemic shock.[27,28] space, and if there is an excessive fluid it will go to the bladder and output as urine. It should The degree of reactance value according not leak out in the extravascular space. However, to the WHO classification and the research in dengue patients, the fluid will leak into the classification for days 0–4 are illustrated in Figures extravascular space[18] via the fine capillary, and, 4 {a(i), b(i), c(i),d(i), and e(i), respectively}. The in this case, the volume of the cell membrane graphs in Figures 4 a(i) to e(i), which is classified and the skin are the major organs involved. This by WHO, do not show any significant difference degree of fluid leakage can be indirectly of reactance value in the degree of DHF I till measured by the reactance value which is well- IV. However, our proposed classification shown recognized as one of the importance of increased in Figures 4 a(ii) to e(ii) is more precise sub-
Dengue Bulletin – Volume 31, 2007 67 Risk measurement of dengue infection using bioelectrical impedance analysis classification in the groups of DHF I till DHF IV. Figure 4 b(i): The reactance classified For example, in Figure 4 a(ii), dengue patients according to WHO classification within DHF I and DHF II themselves can be at ‘Fever day 1’ sub-classified to their risk categorization (lower risk or higher risk). From Figures 4 a(ii) to e(ii), 100.0 dengue patients in DHF I and DHF II can be sub-classified to their risk category {lower-risk 80.0 (Group 1 and higher-risk (Group 2)} and there
ance (XC) Figure 4 a(i): The reactance classified t 60.0 according to WHO classification at ‘Fever day 0’ 40.0
95% CI Reac
80.0 20.0
70.0 DF (4) DHF I (55) DHF II (72) DHF IV/DSS (4) Healthy (142)
(Xc) Dengue diagnosis 60.0
ance
t 50.0 Figure 4 b(ii): The reactance classified according to research proposed 40.0 classification at ‘Fever day 1’
95% CI Reac 30.0 Group 100.0 23 20.0 1 2 80.0 DHF I (36) DHF II (46) DHF IV/DSS (4) Healthy (142) 3 Dengue diagnosis 22 ance (Xc) 32 t 60.0 142
50 40.0 23 Figure 4 a(ii): The reactance classified
according to research proposed 95% CI Reac 20.0 classification at ‘Fever day 0’ 4
DF DHF I DHF II DHF IV/DSS Healthy Group 80.0 Dengue diagnosis 1 20 70.0 2 14
(Xc) 142 3 60.0 is a significant difference (p≤0.05) in the
ance t reactance between Groups 1 and 2 in DHF I 50.0 32 and II for ‘Fever days 0 to 3’ {See Figures 4 a(ii) 40.0 16 to d(ii)}. For ‘Fever day 4’ there is only significant difference (p≤0.05) in reactance between lower 30.0 95% CI Reac risk (Group 1) and higher risk (Group 2) in DHF 20.0 4 I {See Figure 4e(ii)}. From Figures 4 a(i) to e(ii), it can be observed that there were many dengue DHF I DHF II DHF IV/DSS Healthy Dengue diagnosis patients from the DHF I who were at equal risk
68 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis
Figure 4 c(i): The reactance classified day 0’ to ‘Fever day +4’ for both the lower- according to WHO classification (Group 1) and higher-risk (Group 2) groups. The at ‘Fever day 2’ results indicate that reactance can strongly differ between the higher- and the lower-risk groups. 80.0 The females in the higher-risk group (Group 2) Ω (Xc) 70.0 produced 44.0 on average compared to 60.7 Ω 60.0 produced by the females in the lower-risk
ance t 50.0 40.0 Figure 4 d(i): The reactance classified according to WHO classification 30.0 at ‘Fever day 3’ 20.0
95% CI Reac 10.0 100.0 DF (4) DHF 1 (65) DHF II (66) DHF IV/DSS (3) Healthy (142) 80.0 Dengue diagnosis 60.0
ance (Xc) t 40.0
Figure 4 c(ii): The reactance classified 20.0 according to research proposed 0.0
classification at ‘Fever day 2’ 95% CI Reac-20.0
-40.0 Group 80.0 DF (4) DHF I (51) DHF II (49) DHF IV/DSS (2) Healthy (142) 4 1 70.0 Dengue diagnosis (Xc) 37 20 142 60.0 2
ance t 50.0 46 3 Figure 4 d(ii): The reactance classified 28 40.0 according to research proposed 30.0 classification at ‘Fever day 3’
95% CI Reac 20.0 3 10.0 Group 100.0 1 DF DHF 1 DHF II DHF IV/DSS Healthy 4 80.0 Dengue diagnosis 2 29 17 (Xc) 60.0 142 3 (indicated by the low reactance) as in the degree ance 32 t 40.0 22 of DHF II patients. Surprisingly, there were many dengue patients from DHF II that were not at 20.0 as much risk (indicated by high reactance) that
they can be classified in the degree of DHF I. 95% CI Reac 0.0 Thus, low reactance is the indicator for dengue severity regardless of the status of the degree -20.0 of DHF in patients of DHF I and II. 2 -40.0
Table 5 summarizes the mean reactance DF DHF I DHF II DHF IV/DSS Healthy classification results in the duration of ‘Fever Dengue diagnosis
Dengue Bulletin – Volume 31, 2007 69 Risk measurement of dengue infection using bioelectrical impedance analysis
Figure 4 e(i): The reactance classified female dengue patients, it can be observed according to WHO classification that the mean reactance value decreases at ‘Fever day 4’ gradually with ‘fever days’. For example, ‘Fever day 0’ recorded a mean reactance value of Ω Ω 80.0 47.51 and this decreases to 42.14 on ‘Fever day 1’ {Figure 5(a)}. On the other hand,
60.0 the lower-risk group shows an increasing trend (Xc) beginning on ‘Fever day +1’ at 59.14 Ω and
ance Ω t 40.0 ending at 59.68 on ‘Fever day +4’.
20.0 Male patients, however, showed an increasing mean reactance value with fever
95% CI Reac 0.0 days for both risk groups (Figure 5 (b)). The mean reactance value increases from 60.95 Ω Ω -20.0 (‘Fever day 0’) to 66.49 (‘Fever day +4’) for patients in Group 1. Group 2, on the other DF (1) DHF I (24) DHF II (26) DHF IV/DSS (2) Healthy (142) hand, recorded an increase from 50.10 Ω Dengue diagnosis (‘Fever day 0’) to 52.93 Ω (‘Fever day +4’).
It can be noted that although both groups Figure 4 e(ii): The reactance classified show an increasing trend of improvement, the according to research proposed higher-risk group always experienced a lower classification at ‘Fever day 4’ value of reactance compared with the lower- risk group. Therefore, it may be concluded that 80.0 1 Group 11 1 male patients showed a positive response to 11 142 2 clinical management and generally recovered (Xc) 60.0 3 faster than female patients. Female patients,
ance t 40.0 15 thus, are at a higher risk than the males, 13 especially those categorized in the higher-risk 20.0 group (Group 2). The finding that the three fatal cases were all females supports this conclusion.
95% CI Reac 0.0 The mean reactance values with fever days 2 -20.0 for the DSS cases (3 fatal, 1 survived) are shown DF DHF I DHF II DHF IV/DSS Healthy in Figures 6 (a) and 6 (b). The trend of the three Dengue diagnosis fatal DSS cases (case 1, case 2, and case 3) in female patients is similar with the trend of the higher-risk group (Group 2), shown earlier in group (Group 1). In addition, the males in Group Figure 6 (a). Case 1 was a 12-year-old girl 2 also produced a lower reactance value of 50.6 diagnosed with DSS with no past medical history, Ω Ω compared to 62.2 produced by those in and presented with bleeding (i.e. vomiting and Group 1 (see Table 5). coughing blood, nose bleeding and tarry blood stool on admission day). She showed a decreasing The trend for the overall mean reactance trend of mean reactance value beginning on values for both genders in comparison with the ‘Fever day -4’ (reactance = 58.9 Ω) and ending lower- (Group 1) and higher-risk groups (Group at ‘Fever day +2’ (reactance = 25.5 Ω), when 2) are shown in Figures 5 (a) and 5 (b). For she died due to multiple organ failure.
70 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis
Table 5: Summary of mean reactance value for lower-risk and higher-risk females and males
Figure 5 (a): Mean reactance value for female Case 2 was a 21-year-old female DSS patients in lower- and higher-risk groups patient without past medical history, who was admitted on ‘Fever day 0’ and manifested with bleeding (blood in the urine) and recorded a 65 reactance value of 46.4 Ω. She obviously did 60 not respond to the treatment and died on ‘Fever day +2’ with a reactance value of 22.5 Ω. Case 55 female group 1 3 was a 45-year-old female DSS patient with a
ance (Ohms) female group 2 history of diabetes. She was admitted on ‘Fever
t 50 Ω day 0’ (XC = 55.3 ), and her reactance value
Reac 45 gradually decreased until ‘Fever day +2’ (XC = 24.9 Ω). The value subsequently showed a 40 day 0 day 1 day 2 day 3 day 4 slight increase on ‘Fever day +3’ (XC = 29.2 Ω) and ‘Fever day +4’ (X = 31.4 Ω), before Days after defervescence of fever C Ω she died on ‘Fever day +5’ (XC = 27.7 ) due to multiple organ failure. Figure 5 (b): Mean reactance value for male The sole DSS survivor was a 32-year-old patients in lower- and higher-risk groups female with no past medical history and bleeding manifestation. She was admitted at 70 ‘Fever day –1’ (reactance 40.6 Ω) and 65 developed hypotension on ‘Fever day 0’ Ω 60 (reactance 36.3 ). Her reactance gradually decreased to a minimum of 20.7 Ω on ‘Fever 55 day 3’ before showing a slight increase on ‘Fever ance (Ohms) t 50 day +4’ to 25.1 Ω. This value gradually male group 1 increased to 59.9 Ω at ‘Fever day 9’ and Reac 45 male group 2 reached a maximum of 67.2 Ω on ‘Fever day 40 +13’. The mean reactance value subsequently day 0 day 1 day 2 day 3 day 4 stabilized and decreased to 55.4 Ω on her Days after defervescence of fever discharge (‘Fever day +16’). She survived the
Dengue Bulletin – Volume 31, 2007 71 Risk measurement of dengue infection using bioelectrical impedance analysis
Figure 6 (a): Reactance against days of fever Table 6: Reactance values for fatal (Cases 1 to defervescence for three DSS fatal cases in 3) and survived (Case 4) DSS female patients female patients
70
60 Case 1 50 Case 2 Case 3 40
ance (Ohms) 30 t 20 Reac 10 0 -4 -3 -2 -1 0 1 2 3 4 5 Day before and after defervescence of fever
Figure 6(b): Reactance against days of fever defervescence for one DSS female patient who survived
80 Reactance 70
60
50
40 ance (Ohms)
t 30
20 Reac 10
0 -1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Acknowledgements Day before and after defervescence of fever This work was financially supported in part by Sultan Iskandar Johor Foundation Malaysian and episode primarily due to the absence of University of Malaya. Our highest appreciation bleeding and organ complications. Details of to Dean of Faculty of Faculty of Medicine, the reactance values for DSS female patients Universiti Kebangsaan Malaysia, the (3 fatal, 1 survived) are presented in Table 6. management and staff of Hospital Universiti Kebangsaan Malaysia (HUKM) for hosting and supporting this research and to all the dengue Conclusion patients involved in this study. The HUKM Ethics Committee’s approval code is D-004- A new approach to monitor and classify dengue 2002. We would also like to thank Dr Sharifah patients using bioelectrical impedance analysis Ismail for the clinical data collection, Prof. Lucy (BIA) has been described. The findings show Lum Chai See for clinical advise and Prof. Dato’ that reactance (XC) was found to be a potentially Lam Sai Kit from the University of Malaya for useful tool in classifying the risk in dengue the serological support. patients.
72 Dengue Bulletin – Volume 31, 2007 Risk measurement of dengue infection using bioelectrical impedance analysis
References
[1] Skae FM. Dengue fever in Penang. Br Med J. impedance analysis as a predictor of survival 1902; 2:1581-1582. in patients with human immunodeficiency virus infection. J Acquir Immune Defic Syndr [2] Gordon SCE. Dengue: An introduction. In: Hum Retrovirol. 1995 May 1; 9(1): 20-5. Rudnick A, Lim TW, Editors. Dengue fever studies in Malaysia Institute for Medical [11] Baumgartner RN. Electrical impedance and Research. Malaysia Bulletin. 1986; 23:1-5. total body electrical conductivity. In: Roche AF, Heymsfield SB, Lohman TG Editors. Human [3] World Health Organization. Annual Report body composition. Champaign, IL: Human (1998) of the WHO Collaborating Centre for Kinetics; 1996. p. 79-107. Arbovirus Reference and Research (dengue and dengue haemorrhagic fever) by [12] Chungue E, Boutin JP, Roux J. [Significance of Department of Medical Microbiology, Faculty IgM titration by an immunoenzyme technic of Medicine, University of Malaya, 50603 for the serodiagnosis and epidemiological Kuala Lumpur; 1998. surveillance of dengue in French Polynesia]. Res Virol. 1989 May-Jun; 140(3): 229-40. [4] World Health Organization. Annual Report French. (1999/2000) of the WHO Collaborating Centre for Arbovirus Reference and Research [13] Lam SK, Devi S, Pang T. Detection of specific (dengue and dengue haemorrhagic fever) by IgM in dengue infection. Southeast Asian J Trop Department of Medical Microbiology, Faculty Med Public Health 1987 Dec;18(4):532-8. of Medicine, University Malaya, 50603 Kuala Lumpur; 2000. [14] Lam SK, Devine PL. Evaluation of capture ELISA and rapid immunochromatographic test [5] World Health Organization. Annual Report for the determination of IgM and IgG (2001) of the WHO Collaborating Centre for antibodies produced during dengue infection. Arbovirus Reference and Research (dengue Clin Diagn Virol 1998 May 1;10(1):75-81. and dengue haemorrhagic fever) by Department of Medical Microbiology, Faculty [15] Lam SK. Application of rapid laboratory of Medicine, University Malaya, 50603 Kuala diagnosis in dengue control. Asia Pac J Mol Lumpur; 2001. Biol Biotechnol. 1995; 3: 351-355 [6] Data released by the Health Ministry’s Director [16] PanBio. Dengue duo IgM and IgG rapid strip of Disease Control, Hasan Abdul Rahman in test. Catalogue No. DEN-25S, 2001. New Straits Times Newspaper (2 May 2007). [17] Biodynamics Model 450 Bioimpedance [7] Dengue and dengue haemorrhagic fever. Analyzer user’s guide, “Basic Principles of st Nation Pg.29, The Star Newspaper 2005 (15 Bioimpedance Testing”, 1 ed. Copyright © January 2005). Biodynamics Corporation; 2000. p. 1-22. [8] Liedtke RJ. (1997). Principles of bioelectrical [18] World Health Organization. Dengue impedance analysis. Available from: haemorrhagic fever, diagnosis, treatment, nd URL:http://www.rohan.sdsu.edu/~ens314/ prevention and control. 2 edn., Geneva: bia.tm WHO, 1997. [9] Máttar JA. Application of total body [19] Chua MN, Molanida R, de Guzman M, bioimpedance to the critically ill patient. Laberiza F. Prothrombin time and partial Brazilian Group for Bioimpedance Study. thromboplastin time as a predictor of bleeding New Horiz. 1996 Nov; 4(4): 493-503. in patients with dengue hemorrhagic fever. Southeast Asian J Trop Med Public Health. [10] Ott M, Fischer H, Polat H, Helm EB, Frenz M, 1993; 24 Suppl 1: 141-3. Caspary WF, Lembcke B. Bioelectrical
Dengue Bulletin – Volume 31, 2007 73 Risk measurement of dengue infection using bioelectrical impedance analysis
[20] Tai DYH, Chee YC, Chan KW. The natural [24] Bandyopadhyay S, Lum LC, Kroeger A. history of dengue illness based on a study of Classifying dengue: a review of the difficulties hospitalized patients in Singapore. Singapore in using the WHO case classification for Med J. 1999; 40: 238-242. dengue haemorrhagic fever. Trop Med Int Health. 2006 Aug;11(8):1238-55. [21] Kuo CH, Tai DI, Chang-Chien CS, Lan CK, Chiou SS, Liaw YF. Liver biochemical tests and [25] Nguyen TL, Nguyen TH, Tieu NT. The impact dengue fever. Am J Trop Med Hyg. 1992 Sep; of dengue haemorrhagic fever on liver 47(3): 265-70. function. Res Virol. 1997 Jul-Aug; 148(4):273- 7. [22] Ibrahim F, Mohd NT, Wan Abas WAB, Sulaiman S, Chan CG. A novel approach to [26] Berhman RE, Kliegman RM. Nelson essentials classify risk in dengue haemorrhagic fever of paediatrics. 4th edn. Philadelphia: WB using bioelectrical impedance analysis. IEEE Saunders Company, 2002. Transactions on Instrumentation and st Measurement. 2005 Feb; 54(1):237-244. [27] Ganong WF. Review of Medical Physiology. 21 edn. New York: McGraw Hill, 2003. [23] Ibrahim F. Prognosis of dengue fever and dengue haemorrhagic fever using bioelectrical [28] McPhee SJ, Lingappa VR, Ganong WF, Lange impedance. PhD thesis. Department of JD. Pathophysiology of disease: an introduction nd Biomedical Engineering, Faculty of to clinical medicine. 2 edn. Connecticut: Engineering, University of Malaya, July 2005. Appleton & Lange Prentice Hall, 1997.
74 Dengue Bulletin – Volume 31, 2007 Utilization of a geographical information system for surveillance of Aedes aegypti and dengue haemorrhagic fever in north-eastern Thailand
Anun Chaikoolvatanaa , Pratap Singhasivanonb and Peter Haddawyc
aDepartment of Pharmaceutical Sciences, Ubon Rajathanee University, Warinchumrab, Ubon Ratchathani, Thailand 34190 bFaculty of Tropical Medicine, Mahidol University, Thailand cSchool of Advanced Technology, Asian Institute of Technology, Thailand
Abstract
The study aims to develop a geographical information system (GIS) for surveillance of Aedes aegypti and dengue haemorrhagic fever (DHF) in north-eastern Thailand. There are three steps in the development of the GIS – collecting primary and secondary data, analysing the data and searching the target location, and presenting the results via figures on a map. Two sub-districts in each of the five districts in Ubon Ratchathani province with high incidences of DHF cases in the last three years were investigated. Primary {e.g. House Index (HI), Container Index (CI) and Breteau Index (BI)} and secondary data (e.g. number of DHF cases/100 000 population) were collected. The time period was divided into two phases, a low disease incidence phase (February–March 2007) and a high disease incidence phase (June–July 2007). The GIS was developed via ArcView programme 3.2a®. The primary data of Ae. aegypti indices including HI, CI and BI indicated a rise in the rainy season period compared with the dry weather period, and the secondary data showed a similar rise and fall in the number of DHF cases in the rainy and dry weather periods respectively. GIS technology can help in planning, implementation and evaluation of the dengue control measures.
Keywords: Geographical information system (GIS); Ae. aegypti indices; Geographical positioning system (GPS); Dengue haemorrhagic fever (DHF).
Introduction eastern part of the country, including Ubon Ratchathani, Si Sa Ket, Yasothon and Amnat [3,4] Dengue haemorrhagic fever (DHF) caused by Charoen. Ubon Ratchathani is ranked as the the mosquito species Aedes aegypti is one of province with the fourth highest incidence of the world’s major health problems.[1] In DHF in Thailand with 172.20 cases per 100 000 [5,6] Thailand, the reported cases of DHF vary from population (Figure 1). 20 000 cases to more than 100 000 cases annually.[2] Recently, the incidence of DHF has A geographical information system (GIS) increased in many provinces in the north- is an initiative to support dengue control in Thailand. It is an automated computer-based
E-mail: [email protected], [email protected]; Tel.: 00-66-45-353670; Fax: 00-66-45-288-384
Dengue Bulletin – Volume 31, 2007 75 Use of GIS for DHF surveillance in Thailand
Figure 1: Map of Thailand indicating mosquitoes and means of surveillance and location of Ubon Ratchathani province control.[12] However, there have been limitations that include lack of professionals, restricted budget, inadequate knowledge of GIS applications and a lack of updated data. As a result, significant benefits of the use of a GIS in dengue surveillance and control have not been as successful as anticipated.[10,11,18,19] Thailand Because of these limitations, researchers are Ubon trying to develop a GIS programme to help Ratchathani public health officers gather data and information on DHF to assist in the control of this health problem.
This study is an attempt to develop a GIS for surveillance of Ae. aegypti and DHF in north- eastern Thailand.
Materials and methods
Study area system with the ability to capture, retrieve, Ubon Ratchathani is located in north-eastern manage, display and analyse large quantities Thailand, about 629 kilometres from Bangkok of spatial and temporal data in a geographical (Figure 1). The terrain is generally flat with the context. Roads, residential buildings and other river Moon flowing through the central area. The relevant data can be obtained and mapped to total area of the province is 15 517 sq. km. with form the base map layer using the software highlands and mountains in the east of the Arcview GIS®. Other layers, such as patient province. The total population is about populations, mosquito breeding, dengue case 1 600 000. There are three distinct seasons, dry incidences, addresses, sensitive areas and (March-May), rainy (June-September) and cold containers, can also be mapped into the GIS.[7- (October-February). Average temperatures are 11] Among the publications on the use of GIS from 25 °C to 35 °C depending on the season. in DHF surveillance[12-18] is included one The average rainfall is 1300–1800 mm per year. concerning the development of a database system of mosquito breeding habitats. This led to the development of a system called Implementing an ArcView “Mosquito Information Retrieval System programme 3.2a® (MIRS)”.[13] Another study conducted at the Nortre Dame University developed a computer The GIS requires a language command programme called “MODABUND” that aimed programme called “Avenue” with the Dialog to provide basic information about mosquitoes Design function of ArcView software 3.2a®. such as breeding habitats, life cycles, types, Users follow the menu and extract the required epidemiology, diseases transmitted by data. The overall structural functions include:
76 Dengue Bulletin – Volume 31, 2007 Use of GIS for DHF surveillance in Thailand
Figure 2: Development programme of a geo-database for surveillance of Ae. aegypti and dengue haemorrhagic fever in Ubon Ratchathani province (a)
(b)
Dengue Bulletin – Volume 31, 2007 77 Use of GIS for DHF surveillance in Thailand
• Installation of primary and secondary the visual larval survey.[7] The positions of the data houses in the ten villages were mapped using • Analysis of data and a search of the a GPS tool. Also, data including village names, target location house addresses, demographic primary data, breeding sites and containers were mapped • Presentation of the results via figures and imported into a GIS software for further on a map construction (ArcView 3.2a®). In this study, epidemiological, digital, satellite and Global Positioning System (GPS) Secondary data included: data were incorporated into GIS databases to • number of reported DHF cases/ better understand the spatial distribution of 100 000 population DHF cases {see Figures 2(a) and 2(b)}. Secondary data on patient cases were reported by a primary care unit (PCU), local Process hospital or central hospital and collected by the staff of the Office of Disease Prevention Process of GIS development and Control Department 7 (DPC), Ubon Ratchathani, using WHO case definition. Both The project started in February 2007 and primary and secondary data were collected by concluded in July 2007. The species of dengue the same process. Data collections were mosquito studied was Ae. aegypti. Ubon divided into low disease incidence (February– Ratchathani province in the lower north-eastern March 2007; dry weather) and high disease part of Thailand was selected as the study site incidence (June–July 2007; rainy season). due to its high incidence of DHF cases. The study focused on two sub-districts in each of the five districts in the province with the highest Method of data analysis incidences of DHF cases in the last three years. Analysis of the primary data Within each sub-district, one village was selected as part of the study, making a total of Dengue vector indexes were calculated into 10 villages. three variables:
Two categories of data were collected: • House Index (HI): Percent houses positive for containers with Ae. aegypti Primary data included: larvae or pupae • dengue vector indices • Container Index (CI): Percent of water- • water storage containers holding containers positive for Ae. aegypti larvae or pupae To quantify the relative density of mosquitoes, House Index (HI), Container • Breteau Index: Number of containers Index (CI), and Breteau Index (BI) were taken positive for Ae. aegypti larvae or pupae as indicators of the density. For CI, all natural per 100 houses. and artificial indoor and outdoor containers, such as water jars, tyres, cement tanks and ant Analysis of secondary data guard jars, etc. in every house, were inspected to determine the presence or absence of Ae. The total number of DHF patients was aegypti. The primary data were collected by presented as the number of reported cases of DHF/100 000 population of the province.
78 Dengue Bulletin – Volume 31, 2007 Use of GIS for DHF surveillance in Thailand
Results in Nacharoen village while during the high disease incidence period it ranged from 25.16 Primary data in village Ang Hin Tai to 56.36 in Nongpaung village. CI and BI also followed similar trends Dengue vector indices (HI, CI and BI) for each as indicated in Figures 3(a) and (b). village during low incidence and high incidence periods are presented in Figures 3(a) and 3(b). Secondary data
It may be seen from Figure 3(a) that during The total number of reported DHF cases per the low disease incidence period, HI ranged 100 000 population in Ubon Ratchathani from 15.04 in village Pakhuaiwangnong to 50.88 province are given in Figure 4. Comparisons were
Figure 3: Ae. aegypti indices (HI, CI, and BI) for 10 villages 3(a): Low disease incidence period (February–March 2007)
90.00 80.00 HI CI BI 70.00 60.00 50.00 40.00 30.00 20.00 10.00 0.00
MEG NAHAI DONCHAT RATSAMRAN NACHAROEN NONGPAUNG ANG HIN TAI DONTUPCHANG NONEHONGTHONG PAKHUAIWANGNONG
3(b): High disease incidence period (June–July 2007)
120.00 HI CI BI 100.00
80.00
60.00
40.00
20.00
0.00
MEG NAHAI DONCHAT RATSAMRAN NACHAROEN NONGPAUNG ANG HIN TAI DONTUPCHANG NONEHONGTHONG PAKHUAIWANGNONG
Dengue Bulletin – Volume 31, 2007 79 Use of GIS for DHF surveillance in Thailand made between the low disease incidence period in the vector receptivity (breeding potential) and high disease incidence period (Figure 4). at the beginning of the wet season and this will have an impact on the number of DHF cases. Discussion In Ubon Ratchathani, Ae. aegypti The results show that the number of DHF cases population density remains high in most areas increased during the high disease incidence and the incidence of DHF normally tends to period compared to the low disease incidence increase every other year. This indicates that period, suggesting a positive correlation when an outbreak occurs, it spreads rapidly to between the peak rainfall period in June-July nearby areas. The clustering of DHF cases in and the high density of Ae. aegypti mosquitoes some big centres such as Muang, Detudon and and high incidence of DHF cases. This finding Warinchamrap has also been attributed to the is similar to that identified in other South-East characteristics of Ae. aegypti because of its Asian countries.[20,21] Since the spread of the multiple feeding probe to complete one blood disease is facilitated by the movement of meal. In other south-east Asian countries, it viraemic people, source-reduction methods has been reported that most infections occur should get priority in vulnerable areas (hotels, among children who spend most of their time hospitals and other places of congregations). indoors and are bitten by the usually day-biting Generally, such practices undertaken in the low Ae. aegypti. The high incidence of DHF disease incidence period lead to a reduction continues to occur due to lack of standard
Figure 4: Total number of reported dengue haemorrhagic fever cases in Ubon Ratchathani province during low and high disease incidence periods
Low disease incidence period High disease incidence period
Number of cases
80 Dengue Bulletin – Volume 31, 2007 Use of GIS for DHF surveillance in Thailand mosquito control policies, poor sanitation and Acknowledgements poor preventive measures. The authors express their sincere thanks to the The introduction and implementation of an Thai Research Funds (TRF) and the World Health effective remote-sensing tool such as a Organization (WHO), Thailand, for their financial geographical information system (GIS) into the support. They also thank Mr Chawalit routine activities of the Disease Prevention and Tantinimitkul of WHO for his kindness. All data Control Programme staff needs to be support was kindly provided by the Office of considered. This tool can address some Disease Prevention and Control Department 7 limitations regarding Ae. aegypti and DHF (DPC), Ubon Ratchathani. Thanks also go to surveillance like updating, collecting, editing, Bob Tremayne, Division of International locating and analysing dengue indices and DHF Cooperation, Ubon Rajathanee University case data. By this process, rapid and effective (UBU), for his English language assistance. prevention and control strategies can be Finally, our appreciation goes to Mr Wacharapong developed prior to the onset of the disease that Saengnill, College of Medicine and Public would eventually reduce both the morbidity and Health, UBU, for his technical support. mortality rates of dengue infection.
References
[1] Thara A. Dengue vector in hemorrhagic fever. [6] Research strategy in health care. An annual National library report. National Institute of report from medical science committee. Health, Department of Medical Science, Research Council. Bangkok: Chulalongkorn Thailand. 2001. p. 1-36. University Press, 2000. p.240-95. [2] Bureau of Epidemiology, Department of [7] Goh KT. Dengue - A re-emerging infectious Disease Control, Ministry of Public Health, disease in Singapore. In: Dengue in Singapore, Thailand. An annual report of disease technical monograph series, no 2. Singapore: surveillance. Bangkok: Veteran Donating Institute of Environmental Epidemiology, Organization Press, 1997. p. 106-07. Ministry of the Environment, 1993. p.33-40. [3] Srijakrawanwong A, Popanya S, Rojanasuphuj [8] Clarke KC, McLafferty SL, Tempalski BJ. On S, Warachit P. A diagnostic test confirmed epidemiology and geographic information dengue hemorrhagic fever between 1986 and systems: a review and discussion of future 1989. J Med Sci. 1993; 35: 13-23. directions. Emerg Infect Dis. 1996 Apr-Jun; 2(2): 85-92. [4] Sathimai W, Laithaweewat L, Wonghiranraj P. A diagnostic confirmation of dengue virus [9] Gratz NG, Knudsen AB. The rsie and spread of among unknown fever patients at local dengue, dengue haemorrhagic fever and its hospitals; Khon Kaen and Roi-Et provinces. vectors: a historical review (up to 1995). Infectious Disease Journal. 1998; 24(4): 538- Geneva: World Health Organization, 1996. 45. Document WHO CTD/FIL (DEN) 96/07. [5] Bureau of Epidemiology, Department of [10] Ai-leen GT, Song RJ. The use of GIS ovitraps Disease Control, Ministry of Public Health. An monitoring for dengue control in Singapore, annual report of disease control. Bangkok: Dengue Bulletin. 2000; 24: 110-16. Veteran Donating Organization Press, 2002. p. 40-56.
Dengue Bulletin – Volume 31, 2007 81 Use of GIS for DHF surveillance in Thailand
[11] World Health Organization. Division of [17] Sithiprasasna R, Linthicum KJ, Lerdthusnee K, Control of Tropical Disease - Health Map - Brewer TG. Use of geographical information Using GIS in public health 2006. Available system to study the epidemiology of dengue from: URL: http://www.who.int/ctd/html/ haemorrhagic fever in Thailand. Dengue hmapph.html Bulletin. 1997; 21: 68-72. [12] Crovello TJ. MODABUND. The computerized [18] Sithiprasasna R, Linthicum KJ, Liu GJ, Jones mosquito data bank at University of Nortre JW, Singhasivanon P. Use of GIS-based spatial Dame. Mosq News. 1972; 32(4): 548-54. modeling approach to characterize the spatial patterns of malaria mosquito vector breeding [13] Russo RJ, McCain TL. The use of computerized habitats in northwestern Thailand. Southeast information retrieval in mosquito control. Asian J Trop Med Public Health. 2003 Sep; Mosq News. 1979; 39(2): 333-38. 34(3): 517-28. [14] Russo RJ, McCausland S. Strategies of [19] Focks DA, Chadee DD. Pupal survey: an computer use in mosquito control. Mosq epidemiologically significant surveillance News. 1983; 43(3): 311-14. method for Aedes aegypti: an example using data from Trinidad. Am J Trop Med Hyg. 1997 [15] World Health Organization. Pesticide Feb; 56(2): 159-67. application equipment for vector control. WHO Technical Report Series No. 720. Geneva: [20] World Health Organization. Vector ecology. WHO, 1985. p.36-37. WHO Technical Report Series No 501. Geneva: WHO, 1972: p.30-31. [16] Chandaeng A, Chansaeng J, Benjapong N. The classification of mosquito vectors in Thailand [21] Gould DJ, Mount GA, Scanlon JE, Ford HR, via a computerized multimedia program. J Sullivan MF. Ecology and control of dengue Health Sci. 1997; 6(3): 545-52. vectors on an island in the Gulf of Thailand. J Med Entomol. 1970 Aug 25; 7(4): 499-508.
82 Dengue Bulletin – Volume 31, 2007 Transmission thresholds and pupal/demographic surveys in Yogyakarta, Indonesia for developing a dengue control strategy based on targeting epidemiologically significant types of water-holding containers
Dana A. Focksa , Michael J. Bangsb, Cole Churchc, Mohammad Juffried and Sustriayu Nalime
aInfectious Disease Analysis, P.O. Box 12852, Gainesville, FL, USA
bFreeport Indonesia, Public Health and Malaria Control-Kuala Kencana, P.O. Box 616, Cairns 4870 Australia cOuachita Parish Mosquito Abatement District, Monroe, LA, USA dDepartment of Pediatrics, Gadjah Mada University, Yogyakarta, Indonesia
eTahija Dengue Project, Jl. Pandega Sakti 159 Kaliurang Street KM 6, 2, Yogyakarta 55283, Indonesia
Abstract
All water-holding containers (ca. 3000) associated with approximately 320 residences in Yogyakarta, Indonesia, were examined for the presence of Aedes aegypti (L.), Aedes albopictus Skuse, and Culex quinquefasciatus Say pupae in four replicate surveys conducted during two dry seasons (1996 and 1998) and two wet seasons (1997 and 1999). Less than 6% of these receptacles had pupae. Ae. aegypti pupae collected were ten times more than Ae. albopictus (ca. 1600 vs. 160 respectively); Cx. quinquefasciatus was rarely encountered. From a dengue perspective, the epidemiological significance of a particular type of container is a function of the number of Ae. aegypti pupae per person – calculated simply as the ratio of total number of Ae. aegypti pupae recovered in that type and the number of residents, ca. 2800. Overall, there was an average of 0.57 Ae. aegypti pupae per person. Assuming an overall herd immunity of 33% and an average temperature of 29 °C, we estimate the transmission threshold in Yogyakarta to be approximately 0.43 Ae. aegypti pupae per person. By eliminating mosquito production in two common household containers – wells and used tyres the number of Ae. aegypti pupae would be reduced from 0.57 to 0.29 per person, below our estimate of the transmission threshold. An assessment of the effectiveness of this strategy is currently being conducted in a multi-year study in Yogyakarta using an insect growth regulator (IGR) for mosquito control.
Keywords: Dengue; Epidemiology; Prevention and control; Risk assessment; Targeted source reduction and control; Sustainable; Community-based; Transmission threshold.
E-mail: [email protected]; Fax: +1-352-372-1838
Dengue Bulletin – Volume 31, 2007 83 Targeted source reduction/control strategy for dengue control
Introduction conducted an external review of the dengue/ dengue haemorrhagic fever prevention and control programme of Indonesia in June Dengue in Indonesia 2000.[2] The following brief history of the Indonesian dengue prevention and control Dengue and dengue haemorrhagic fever (DF/ programme reflects this report. DHF) was first observed in Indonesia in 1968 in Surabaya and Jakarta, the two largest The Indonesian Ministry of Health has [1] metropolitan cities on the island of Java. considerably modified its strategies to control While this initial epidemic involved less than dengue over the past three decades. Initially, 60 cases, the case-fatality rate exceeded 40%. adult control using perifocal space spraying of Since then the incidence of DF/DHF has insecticides with portable and vehicle-mounted increased dramatically in Indonesia and has thermal fogging and ultra low volume (ULV) spread geographically to all regions of the machines was the government’s recommended country. The DHF incidence fluctuates monthly method and response for most areas. The and typically reaches its peak in December and protocol specified treatment within a 100-metre January every year, except in large cities such radius of reported DHF cases. In the 1980s, as Jakarta, Bandung and Surabaya, where the the strategy changed to include the addition of highest incidence is reported in April and May. extensive larviciding using temephos (1% sand Currently, dengue is the eighth leading cause granules). The policy was to treat all breeding [2] of hospitalization among Indonesian children. sites in dengue-endemic urban areas a single Similar trends of progressively larger epidemics time each year, timed ideally to precede the interspersed with quieter, inter-epidemic years onset of the transmission season. The Ministry in the neighbouring countries of Cambodia, of Health subsequently modified this strategy Myanmar, Laos, Thailand and Viet Nam reflect to target only those urban areas reporting DHF waxing and waning human population “herd” for three consecutive years, wherein re- immunity, urbanization, the movement of treatments were scheduled with a frequency people, and the influence of weather of three months. This selective larviciding anomalies associated with El Niño/Southern programme was implemented between 1986 Oscillation (ENSO) events. In the face of the and 1991. Beginning in 1992 and continuing most significant ENSO event of the century, until the present, the national strategic emphasis 1998 witnessed the largest epidemic on record has been larval control involving community in Indonesia with 72 133 reported cases and efforts, health education and intersectoral 1414 deaths; the case-fatality rate (CFR) in this coordination. Currently, national efforts have epidemic was 2.0%, reflecting several decades focused on organizing working groups at the [2] of improved clinical management. In 2001, village level under the general guidance of local the total number of cases (DF and DHF) and health centre personnel. This programme, called deaths reported were almost 20 000 and 180 Bulan Gerakan (or 3M), emphasizes intensive [3] respectively. In early 2004, DF/DHF made a health education using mass media, women’s dramatic rebound with over 58 000 cases and groups and schoolchildren, community-based 658 deaths reported in the first four months. breeding source reduction, and door-to-door house inspections to monitor for larvae, and to clean containers and apply temephos as Past dengue control efforts necessary. An important member of the 3M programme is the Family Welfare Education The World Health Organization’s Regional Women’s Movement (Pendidikan Kesejahteraan Office for South-East Asia (WHO/SEARO)
84 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Keluarga or PKK). The role of the PKK is that are particularly important by some recent education of the house-owner about larval developments outlined below. This strategy inspections, methods to store water safely, and targets only the most epidemiologically the elimination or cleaning of breeding important types of breeding containers. We containers. An additional role of the PKK involves measure the epidemiological importance of community-based group education and each type of container in the environment using monitoring programme results. Finally, authorities the statistic the total standing crop of Ae. aegypti developed health education programmes for (L.) pupae per hectare or per person associated elementary schoolchildren and for use with the with each particular type. mass media.
Unfortunately, with only a few notable Results from prior research exceptions, these efforts have not been successful in controlling dengue.[2] However, a Transmission models pilot project in the city of Purwokerto, aided with funding from Rotary International has Recently, there has been a movement in the shown promise. The project organized a strategy epidemiological community to recognize the of community partnership based on dasa wisma pervasive influence of the environment and (ten houses) in several villages in the area. The climate on various vector-borne diseases. The results were encouraging to the extent that efforts of Martens et al.[4] and Patz et al.,[5] for Rotary and others funded an extension to this example, have documented substantial ties of effort that targeted 11 major urban areas in disease activity to environmental features and Indonesia. Patterned after the Purwokerto climate trends for dengue, schistosomiasis and project, it included educational programmes for malaria. The work of Bouma et al.[6] establishing the public and medical personnel. The extended statistical relationships between weather project had the endorsement and support of anomalies associated with El Niño and malaria the Indonesian government, WHO, the US in Colombia is especially encouraging in the Public Health Service, and importantly, mayors’ context of developing early warning/mitigation offices. While funding was available and key systems for weather-driven infectious diseases. public officials remained prominently associated with the project publically, e.g., the mayor’s Recognizing these ties, mathematical wife, the effort did reduce dengue cases epidemiologists and public health specialists are (Sustriayu Nalim, personal communication). beginning to construct disease models incorporating environment and climate parameters. A number of researchers have Proposed targeted source reduction recently been involved in these types of studies and control efforts on the dengue system and have developed simulation models and estimates of transmission The goal of the present work is to build on the thresholds.[7,8,9,10,11] These results have had a foundation of the 3M and PKK programmes by degree of success and are being evaluated by reducing the number of types of breeding the public health community. The algorithms of containers that must be controlled or eliminated the dengue models[7,9] take into account key to only a select few that are responsible for most factors known to influence dengue of the adult vector production. We believe it is epidemiology; the result is a software tool used possible to estimate the degree of reduction by researchers and public health practitioners required and to identify the types of containers that is orientated toward site-specific simulation.
Dengue Bulletin – Volume 31, 2007 85 Targeted source reduction/control strategy for dengue control
Validation studies compared model output with person[11] were developed for use in the field and laboratory observations at sites in Asia assessment of risk of transmission and to provide and the Americas.[8] Funding from WHO and targets for the actual degree of suppression by the US National Institutes of Health (NIH) has type of breeding container required to prevent led to ongoing evaluations of transmission or eliminate transmission in source-reduction thresholds derived from the models in Viet Nam programmes. When coupled with field and Peru respectively. The hope is that the observations from pupal/demographic surveys published thresholds[11] can be used in tropical (as reported herein for Yogyakarta), it is possible locations to predict disease vulnerability, assess for the first time for control specialists to know control measures and provide guidance in how important the various types of containers targeting the especially important classes of in the environment are in terms of contributing breeding containers. The recent development to the transmission threshold.[10,11] This strategy of the pupal/demographic survey, coupled with of concentrating on only the types of containers estimates of transmission thresholds, make the most responsible for the majority of adult vector results of simulation studies with the dengue production and hence transmission, e.g. outdoor models available to operational control drums and tyres vs typically low-producing indoor programmes in the developing world.[10,11,12] The vases and domestic containers, was recently models are currently being re-written and evaluated in a 9-country study in the Americas extended through funding from the Tahija Family and SE Asia with WHO/TDR funding (citation Foundation (Jakarta) and the Innovative Vector is: Focks DA, Alexander N. Multicountry study Control Consortium (IVCC) funded by the Bill of Aedes aegypti pupal productivity survey and Melinda Gates Foundation (the citation for methodology. Findings and recommendations. IVCC/dengue is: Hemingway J, Beaty BJ, 2006. TDR/IRM/Den/06.1)). The WHO’s Rowland M, Scott TW, Sharp BL. The Innovative Tropical Diseases Research (TDR) programme Vector Control Consortium: Improved Control has commissioned a review article on the current of mosquito-borne diseases. Trends in state of the science for entomological surveying Parasitology 2006 (22): 308-312.) for dengue risk assessment and control.[14] Central in this document are the concepts of the pupal/demographic survey, transmission Transmission thresholds and the thresholds and targeted source reduction and pupal/demographic survey control of especially productive containers. There is a growing recognition that adherence The expense and ineffectiveness of drift-based to the current strategy of attempting to eliminate insecticide aerosols to either prevent or control or control all containers, irrespective of dengue epidemics has led to suppression productivity or time of the year, is doomed to strategies based on eliminating larval breeding continued failure.[10] sites.[13] With the notable, albeit short-lived, exceptions of Cuba and Singapore, these source- reduction efforts have met with little Dengue early warning system (EWS) documented success. Public health workers attribute failure to two factors: inadequate In the last several years, there has been a call participation of the communities, and a strategy by the directors of national anti-dengue that entailed destruction or treatment of virtually programmes in Indonesia, Thailand and Viet every breeding container in the environment. Nam for the operational need of an early warning The transmission thresholds for dengue based system (EWS) that would provide sufficient lead on the standing crop of Ae. aegypti pupae per time (1 to 3 months) to permit mobilization of
86 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control control operations. In response to this call, containers in the commune received preliminary EWSs for Yogyakarta and Bangkok Mesocyclops or larvivorous fish; it is now very were developed; they are based on logistic difficult to find discarded containers, and regression analysis.[15] The predictor variables are mosquito indices have been reduced almost to sea surface temperature (SST) anomalies over zero. From 1996, this model has been extended the tropical Pacific and monthly cases of dengue to three provinces, Nam Ha, Hai Hung and Hai in each city. The predicted variable is the Phong in northern Viet Nam.[16] probability of an epidemic year forecast 1 to 3 months before the peak transmission season. The Java EWS was sufficiently accurate to be Goals of the present work operational. The Yogyakarta EWS gave perfect 1- and 2-month forecasts; the 3-month forecast The purpose of this report is to provide an incorrectly classified one year in the 14-year analysis of four annual pupal/demographic period of record. surveys conducted in Yogyakarta between 1996- 1999 highlighting the epidemiological significance of the twenty-some types of Ae. Biological control agents aegypti-breeding containers in the environment. From this analysis, and using the estimates of A very promising recent measure is the transmission thresholds for dengue, we propose application of biological agents like Mesocyclops, to develop a targeted source-reduction/control Micronecta and larvivorous fish. In Viet Nam, strategy for Yogyakarta that will require Mesocyclops, a tiny copepod crustacean, have substantially less effort than the traditional been found to be good predators of Ae. aegypti community-based efforts without targeting larvae. Since February 1993, Mesocyclops have where the goal is to control or eliminate all been released into water containers of 400 containers irrespective of their contribution to houses of a hamlet in My Van district, Hai Hung the adult population of Ae. aegypti. province. In March 1994, this measure was supplemented by a campaign to eliminate discarded containers (which are too small for Methods Mesocyclops to survive), and education about how to maintain adequate populations of Study site Mesocyclops in domestic water containers. After 17 months, Ae. aegypti had been completely Yogyakarta, a city of over 520 000 people, is eliminated and this result has been sustained the provincial capital of Yogyakarta, located in until today. Since July 1995, mobilization of the central Java. The province is divided into community for peridomestic hygiene and use administrative districts called kabupatens with of Mesocyclops to control Aedes larvae was each district divided into progressively smaller implemented for 1600 houses in one commune units beginning with sub-districts called in Thuong Tin district, Ha Tay province. Working kecamatans, and these, in turn, divided into together with the network of health kelurahans, and further divided into rukun warga collaborators, primary-school pupils, local (RW), and finally into rukun tetangga (RT), the authorities and health staff, and using the system smallest administrative unit composed of of local communication, health education approximately 50-80 families each. The study campaigns were organized in order to improve site was located in kecamatan Gondokusuman, people’s knowledge and to mobilize every within Yogyakarta city. The actual study area member of the community. Almost all big water covered approximately 6.34 ha, from which
Dengue Bulletin – Volume 31, 2007 87 Targeted source reduction/control strategy for dengue control
323 houses were selected and subsequently abundance by type of container. With the aid sampled over four time periods. Disease and of a flashlight, hand-held fine-meshed netting demographic data were derived from a recent devices and pipettes were used to remove all study conducted in the same area.[17] An pupae from the container with captured average of five houses were chosen from each specimens placed in white trays for easy RW where a dengue case had occurred and observation. While in the field, all pupae would included 64 RWs distributed among five be first immobilized using hot water supplied kelurahans (Kota Baru = 4 RWs; Terban = 11 from a thermos and immediately placed in RWs; Baciro = 21 RWs; Klitren = 16 RWs, labelled plastic bags containing 70% ethyl alcohol and Demangan = 12 RWs). The location of and sealed. Bag labels included house number, each sampled house was provided coordinates container type, location (indoor or outdoor) and in 1999 using a hand-held geographical number of pupae collected. Additionally, all positioning device (Magellan GPS 300tm, San information, including lot and house size, was Dimas, CA). Demography data were taken hand-recorded in a field logbook and later from each house, including number of transcribed into a computerized database. The permanent residents, house size and land area. only water-holding containers not surveyed in Climatological data (daily rainfall and maximum/ this study were residential wells, which are minimum ambient temperatures) were known to harbour Ae. aegypti and Culex obtained from the local Meteorology and quinquefasciatus Say larvae.[18] Geophysics Agency (Station Bulaksumar, University of Gadjah Mada). Specimen identification
The pupal/demographic survey Preserved pupae were returned to the laboratory for identification. Using an illustrated Each premise was sampled consecutively for key developed for this purpose, pupae were immature stages of container-breeding examined using a stereomicroscope and easily mosquitoes during four different time periods identified for species and sex.[19] For the between 1996 and 1999, with two sample purposes of this study, pupae were identified surveys during wet seasons and two during the as either Ae. aegypti, Aedes albopictus Skuse, dry periods of the year.# A team of three or or Cx. quinquefasciatus, with all other pupae four people would visit each house and carefully identified only to genera. inspect the inside and around the outside perimeter all natural and artificial containers for preimaginal stages of mosquitoes. The number Results and type of containers present at each house were recorded as well as the number of With very few exceptions, the four pupal/ permanent residents. The presence or absence demographic surveys conducted in the of mosquito larvae in each container was kecamatan Gondokusuman returned to the recorded without regard to the number present. same ca. 316 houses each year. The residents Collections concentrated on quantifying pupal associated with these houses numbered approximately 2800 (Table 1). Each exhaustive survey collected pupae from the ca. 3000 # Collection dates: Dry season: 8–22 May 1996, water-filled containers associated with the study Wet: 23 January–7 February 1997, Dry: 15–30 September 1998, and houses. Approximately 5.5% of the containers Wet: 30 March–19 April 1999. were positive for one or more pupae of Ae.
88 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Table 1: Summary statistics for pupal/demographic surveys conducted in Yogyakarta, Indonesia, between 1996 and 1999
aTotal precipitation (mm) two months prior to survey and average temperature during survey (°C)
Figure 1: Plot of 30- and 60-day rainfall accumulations before surveys and the average of daily average temperature (°C) in Yogyakarta, Indonesia [Approximate dates of surveys are indicated by vertical, downward-pointing arrows. Total precipitation during the two months prior to each survey and the average temperature during survey are presented in Table 1]
30.0 1,400 Avg. monthly temperature 30-day accumulation
29.5 hs 60-day accumulation 1,200 t 29.0
28.5 1,000
ure
t 28.0 800
pera
1 and 2 mon 27.5
em
for t 600 . 27.0
g
als
t
Av
o 26.5 400 t 26.0 200 25.5
Rainfall 25.0 0 Jan-96 Jan-97 Jan-98 Jan-99 aegypti, Ae. albopictus or Cx. quinquefasciatus. seasons surveys were not substantially different, Approximately ten times more Ae. aegypti averaging 28.0 °C and 27.2 °C respectively pupae were recovered than Ae. albopictus (ca. (Figure 1). However, the accumulated rainfall 1600 vs 160); Cx. quinquefasciatus was rarely for the 60 days prior to each dry-season survey encountered in the sites being examined. The was only about 10% of the wet-season average temperatures during the dry- and wet- accumulations (ca. 84 vs. 794 mm).
Dengue Bulletin – Volume 31, 2007 89 Targeted source reduction/control strategy for dengue control
Types and numbers of water-filled surveys; many of these types, however, were containers as a function of season only seen once or at most only a few times and location during the surveys. The 3, 5 and 11 most common types of containers accounted for A total of 71 different types of water-filled >60%, >75% and 90% of all water-filled containers were observed during the four containers (Table 2). Some types were
Table 2: Most frequently encountered types of containers during surveys conducted during the dry and wet seasons in Yogyakarta, Indonesia
S. No. Type Dry Wet Mean Proportion Accumulation of mean 1. Bird watering dish 670 681 675 0.23 0.23 2. Bucket 549 619 584 0.20 0.42 3. Storage in water closet a 538 549 543 0.18 0.61 4. Water container (large) b 251 220 235 0.08 0.68 5. Plastic water container 196 232 214 0.07 0.76 6. Water container (large) 112 152 132 0.04 0.80 7. Clay water container 91 90 91 0.03 0.83 8. Refrigerator water pan 58 58 58 0.02 0.85 9. Padasan 41 56 48 0.02 0.87 10. Flower pot 19 78 48 0.02 0.88 11. Flower vase 45 41 43 0.01 0.90 12. Bottle 34 44 39 0.01 0.91 13. Plant axil 2 77 39 0.01 0.92 14. Tin can 17 53 35 0.01 0.93 15. Tyre 10 47 28 0.01 0.94 16. Drinking glass 4 51 27 0.01 0.95 17. Pool, pond, tank 22 22 22 0.01 0.96 18. Bowl 3 30 17 0.01 0.97 19. Drum 11 16 14 0.00 0.97 20. Fish pond 16 4 10 0.00 0.97 21. Pan 7 8 8 0.00 0.98 22. Cover or lid 4 11 7 0.00 0.98 23. Plate, dish 2 12 7 0.00 0.98 24. Clay water pot (small) 6 8 7 0.00 0.98 a Indonesian: Bak mandi b Indonesian: Bak air
90 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control exclusively found either indoors or outdoors and frequency) bird watering dishes, buckets (ember), others could be found in both locations. By water storage container in water closet (bak location, 34 container types were observed mandi), large water tanks (bak air), plastic water indoors and 66 types outdoors. Rainfall containers (tempayan) and large water storage accumulations preceding the surveys influenced containers. These particular containers accounted the number of types of containers in the for ca. 80% of all water-filled containers. Thirty- environment (Table 2). During the two dry- five of the 71 types observed were never found season surveys, a total of 26 and 40 different positive for the pupae of any species in any of types of containers were observed indoors and the surveys. Table 2 provides a list of the 24 most outdoors respectively; the corresponding common container types in descending order of numbers for the two wet-season surveys were abundance. Of the nine most common types, 29 and 60 different types respectively. However, accounting for 87% of all containers, there were somewhat surprisingly, the average number of no significant changes in abundance as a function water-filled containers was largely independent of the season of the surveys (Table 1); the of season, suggesting that the most common average number of water-filled containers in the types of containers are not rain-filled but filled environment was 2732 and 2770 for the dry- manually. Those container types listed in Table 2 and wet-season surveys respectively. that are more commonly found in the wet season are also those that are located 0primarily outside Numerically, the most common types of of the residence, e.g. flowerpots, plant axils, tin containers observed were (in descending cans and tyres.
Figure 2: Frequency of being positive for larvae in the four surveys conducted between 1996 and 1999 in the 18 most common types of water containers
0.50
0.45
0.40
0.35
0.30
0.25
0.20
Frequency 0.15
0.10
0.05
0.00
C Tyre Bowl Bottle Tin canPadasan Bucket Container Plant axil Flower pot Flower vase Drinking glass Storage in W Bird water (sm) Water tank (lg) Pool, pond, tank Clay waterWater container container (lg) Refrigerator water pan
Dengue Bulletin – Volume 31, 2007 91 Targeted source reduction/control strategy for dengue control
Prevalence of larvae by season and for measuring the entomological impact of larval container type control interventions; (ii) that they are not proxies for adult vector abundance; and (iii) The average proportion of containers with are not useful in the development of targeted larvae in the dry and wet seasons was 0.128 control strategies.[14] Neither are they useful and 0.173 respectively. The prevalence of larvae for assessing transmission risk because they do in the 18 most common types of containers is not take into consideration the presented in Figure 2. Recent evaluations of epidemiologically important variables, including the utility of the traditional Stegomyia indices adult vector and human abundance, (the House, Container and Breteau indices, temperature and herd immunity in the human and various related derivations) concluded that: population. For these reasons, we will confine (i) they are of only limited operational value our analysis to the pupal data.
Table 3: Summary of numbers of Ae. aegypti and Ae. albopictus pupae collected and containers positive for the same by location (indoors or outdoors) based on survey year and season
92 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Table 4: Average total numbers of pupae collected as a function of season and location
Figure 3: Total number of Ae. aegypti pupae recovered during the four surveys in Yogyakarta by type of container and location (indoors or outdoors) [Containers are distributed across the horizontal axis in descending order of total standing crop in that type. The container types shown are the 18 most productive classes of containers]
3500 In Out 3000
2500
2000
1500
1000
500
0
Tyre Bowl Drum Bucket Tin can Trash can Container Flower pot Flower vaseFish pond Drinking glass Storage in WC Bird water (sm) Water tank (lg) Pool, pond, tank Water containerClay (lg) water container Refrigerator water pan
Standing crop of pupae as a function respectively. Of the pupae collected in all of the number of containers, surveys, independent of season, Ae. aegypti container type and season accounted for 89.8%, Ae. albopictus 9.0% and Cx. quinquefasciatus 1.2% of the total (Table 1). The average proportion of containers with pupae A summary of pupal collection as a function of in the dry and wet seasons was 0.047 and 0.061 survey, container location, species of mosquito
Dengue Bulletin – Volume 31, 2007 93 Targeted source reduction/control strategy for dengue control and season (Table 3) indicates that Ae. aegypti Table 5: The frequency of containers by type can be found both in indoor and outdoor and the proportion of all Ae. aegypti pupae containers, and that the number of pupae associated with that type coming from outdoor containers increases during [Container types are sorted in descending the rainy season; the standing crop of Ae. aegypti order of Ae. aegypti pupae] indoors is remarkably constant and independent of season. Outdoor breeding accounts for virtually all additional production during the rainy season. In contrast, Ae. albopictus pupae are essentially found only outdoors and in rain-filled containers. It is therefore not surprising that the average standing crop of Ae. aegypti is somewhat less a function of rainfall (dry season average– 1312 vs wet season–1862, an increase of ca. 42%) than Ae. albopictus (dry season average – 38 vs 281 in wet season, an increase of 640%). Table 4 provides an average of total pupal collections for the two seasons by mosquito and location. While the numbers collected are low and preclude confident statements, Cx. quinquefasciatus immatures in these surveys were only found outdoors and their abundance seems to be independent of rainfall. Aedes albopictus immature abundance is a strong function of rainfall and they are only found outdoors.
The total numbers of Ae. aegypti pupae a Indonesian: Bak mandi recovered in the four surveys are combined to b Indonesian: Bak air provide the best estimate of production by container type (Figure 3). The total numbers The total number of Ae. albopictus pupae of Ae. aegypti pupae in each of the types of recovered in each survey was correlated with containers highlights an important point: the the number of water-holding containers present epidemiological importance of a class of (0.84). The likely explanation is that Ae. containers is not simply a function of the albopictus largely breeds in outdoor containers, abundance of the containers, but rather the which are substantially filled by rainwater; there product of the containers’ abundance and is seasonality in abundance as a function of the average standing crop of pupae (Table 5). The number of containers (Table 4). In contrast, the water storage containers located in water total number of Ae. aegypti pupae recovered closets (bak mandi) account for 22% of all in each survey was independent of the number containers but 50% of all Ae. aegypti pupae. of water-holding containers present (correlation: The classes “large water container” (bak air) –0.10). This is a bit unexpected in so far as Ae. and “tyre” account for 6% and 1% of all aegypti production in outdoor containers containers, yet they are responsible for 13% increases substantially in the rainy season (cf. and 6% of all pupae respectively. The large Tables 3 and 4). The total numbers of Ae. aegypti water tank (12% of all containers) contributes and Ae. albopictus pupae caught in each survey essentially nothing to Ae. aegypti production. were only slightly correlated (0.32).
94 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Figure 4: Frequency histogram of the positive houses were more than three times numbers of Ae. aegypti pupae per house more likely to remain positive over time than a [Note that the frequency of the 0 to 5- negative premises that was to become positive interval class (0.80) is off scale] over the course of a year.[21,22] These persistently productive premises were given the name key 0.06 premises. Their notion was that, in government 0.05 suppression programmes with limited resources, it might improve effectiveness to 0.04 focus on former key premises for subsequent 0.03 visits rather than use a systematic approach of visiting every house. It should be noted that Frequency 0.02 the effectiveness of such a strategy would be
0.01 dependent not only on the existence of a clumped distribution of productivity at the house 0.00 level, but also on the persistence of productive 0 20 40 60 80 100 120 140 160 180 200 Ae. aegypti pupae per house houses between years.
With this in mind, we looked into the nature of the distribution of pupae per household. The Year-to-year variability in production results presented in Figure 4 clearly indicate a at the household level non-linear distribution associated with the existence of key premises. The second question Especially productive households – – the persistence or stability of such households key premises between years – is addressed in Table 6. Here, the number of Ae. aegypti pupae recovered at In an effort to facilitate the location of positive each premises in each of our sequential surveys premises and containers in Queensland, is summed; and the premises are then sorted in Australia, Tun-Lin et al. used various forms of descending order by this sum. Table 6 presents statistical analyses to develop the Premise the 28 most productive households, our key Condition Index (PCI). In essence, they were premises. While they account for only ca. 8% looking for proxies or surrogates to detect the of all homes surveyed, they accounted for 51% presence of high-level outliers among containers of all Ae. aegypti pupae recovered. The [20] and premises. They found that the condition important conclusion to be drawn from this, of the house, the degree of shade and tidiness however, is that unusually high (or low) counts of the yard, both observable without entering of pupae in a particular survey are not highly the house or yard, were strongly correlated with correlated with subsequent or previous counts; both the proportion of positive premises and this is further corroborated by the low correlation the numbers of infested containers. If only of Ae. aegypti pupae per house (Table 7) – premises with the highest PCI scores were average correlations for surveys separated by 1, surveyed, they found that the probability of 2 and 3 years were 0.11, 0.00 and 0.13 finding a positive home or container was respectively. This lack of inter-year correlation is increased approximately fourfold. These also observed with the number of Ae. albopictus particular houses represented <10% of all sites, pupae per house – average correlations for yet they accounted for 35% of all positive surveys separated by 1, 2 and 3 years were 0.08, containers. An important observation was that 0.14 and 0.00 respectively (Table 8).
Dengue Bulletin – Volume 31, 2007 95 Targeted source reduction/control strategy for dengue control
Table 6: Listing of the households responsible for the highest production of Ae. aegypti pupae during all four surveys [By way of explanation, the first row of data are the results for house TE179. A total of 247 Ae. aegypti pupae were recovered at this household during the surveys conducted between 1996 and 1999; this total represents 0.039 of all production. The table indicates that about 8% of the houses were responsible for ca. 51% of all production observed. The table indicates that unusually high counts of pupae in a particular survey are not highly correlated with subsequent or previous counts]
96 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Table 7: Correlations between the total number Table 9: Correlations between the number of of Ae. aegypti pupae per house over time people per house over time [Average correlations for surveys separated by [Average correlations for surveys separated by 1, 2 and 3 years are 0.11, 0.00 and 0.13 1, 2, and 3 years are 0.79, 0.69, and 0.64, respectively] respectively]
Table 8: Correlations between the total Number of water-holding containers number of Ae. albopictus pupae per house per house over time [Average correlations for surveys separated by There is significantly more correlation between 1, 2, and 3 years are 0.08, 0.14 and 0.00 the numbers of natural and artificial water- respectively] holding containers per house between seasons than the number of pupae per household (Table 10). Average correlations for surveys separated by 1, 2 and 3 years are 0.59, 0.57 and 0.49 respectively.
Table 10: Correlations between the total number of artificial and natural water-holding containers per house over time [Average correlations for surveys separated by 1, 2, and 3 years are 0.59, 0.57, and 0.49, respectively] Number of people per household
Not surprisingly, the number of residents per household is rather consistent. Correlations of the number of household residents observed during the four surveys declined from an average of 0.79 for surveys conducted within one year of each other to an average of 0.69 for surveys separated by two years; the correlation between the two surveys conducted three years apart, i.e. those of 1996 and 1999, was 0.64 (Table 9).
Dengue Bulletin – Volume 31, 2007 97 Targeted source reduction/control strategy for dengue control
In conclusion, while there are definitely key Figure 5: Monthly number of reported cases premises in Yogyakarta (Figure 4), the lack of of DHF in Yogyakarta province during correlation between years (Table 6) in 1985-2001 productivity probably makes any attempt to develop proxies (co-variates) for the rapid 1,200 identification of especially productive 1,000 households unlikely to succeed. The source of 800 variability in Ae. aegypti production at the 600 household level between years is not obviously 400 related to rainfall, nor changes in the numbers Cases DHF 200 of residents or wet containers. However, we 0 cannot discount the possibility that the lack of 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 00 01 correlation is due to variability in pupation on a Year daily basis. Because the key premise concept has potential for control, further study using the total pupation over perhaps a week is warranted. period. Given that most transmission occurs during the wet season (Figure 6) and that there are more pupae per person then (0.47 vs 0.67), Targeted source-reduction we will use the wet season survey results. strategy for Yogyakarta Temperature to use in estimating So far, we have estimated the number of Ae. the transmission threshold aegypti pupae per person associated with each type of container in the wet and dry seasons. For temperature, we could use the average Our goal in developing a targeted source- mean temperature for the first five months of reduction/control strategy is to identify which the year, 27.5 °C when ca. 60% of all cases types of containers, if production in them were eliminated, would result in the area being below Figure 6: Average monthly rainfall, the transmission threshold. This will involve temperature and number of dengue deciding which seasonal estimates, wet or dry, haemorrhagic fever cases by month for the to use, what temperature to use, and what period 1985–2001 for Yogyakarta province value for overall seroprevalence of dengue [Almost 60% of cases occur in the 5-month antibody to use. In all of these deliberations, period January through May] we will be conservative. We already know that wells will have to be controlled – we do not presently know their production. 450 Total (mm) Cases AvgT (°C) 28.5 400 28.0 350
ure 300 27.5 t Wet or dry season estimates of no. cases 250 27.0 pupae per person 200
empera
t
150 26.5 .
g
. rainfall &
100 Av
Figure 5 includes the annual number of g 26.0 cumulative DHF cases in Yogyakarta province Av 50 for the period 1985–2001 and Figure 6 includes 0 25.5 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec the cumulative monthly DHF cases for the same
98 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control are observed. Yet, epidemic transmission is Identification of the targeted often associated with anomalously high classes of containers temperatures, almost 29 °C, for the Yogyakarta time series (data not shown). Therefore, to be In Table 11 are listed the most productive conservative, we will use a value of 29 °C. classes of containers observed in the wet season surveys. We see that if we controlled the wells and a single type of container, the The value of seroprevalence to be Storage in WC (Bak mandi), we would achieve used in estimating the transmission a standing crop of Ae. aegypti of 0.37 pupae threshold per person. With the elimination of just these two types of containers, we are already below This one is a bit more difficult and we will our transmission threshold. Again, to be have to make a crude estimate. Graham et al. conservative, if we add to our list of types of conducted a serosurvey in the late 1990s in containers to be controlled – Wells, Water Yogyakarta and estimated that the annual container (lg) (Bak air) – a fourth type, Tyre, we seroconversion rate among children aged 4 to can anticipate being at levels of 0.29 and 0.23 9 years was, for serotypes 1–4, 0.048, 0.077, pupae per person respectively, if all of the 0.042 and 0.034 respectively.[16] In the targeted types are completely controlled. endemic situation, the rate of seroconversion declines with age as those susceptible to infection become increasingly rare. We Discussion estimate the age-specific antibody prevalence The three targeted types of containers account rate up through age 80 by multiplying the 4–9- for 45% of all production, they also account year-olds’ rates for each year by one less the for 65% of all containers. Is this much of a prevalence in the previous year. Now, to strategy, given the number of containers we estimate the average overall prevalences for are trying to control? We think so for the each of the dengue strains, we need a following reasons: wells, bak mandis and bak population estimate of the human age airs are in known locations within the house distribution in Yogyakarta. For this we used the and are typically masonry in construction. This WHO demographic data for Indonesia. Taking means that they are easy to find, identify and the average of the product of the age-specific control with several methods currently available age and prevalence proportions gives us the in Indonesia, e.g. IGRs (Altocid and Sumilarv) overall population seroprevalence for each and temephos (Abate). Tyres are similarly easy serotype – 0.54, 0.66, 0.51 and 0.45 for to locate and identify. serotypes 1–4 respectively (average: 0.54). The transmission thresholds for 0.33 and 0.67 for 29 °C from the table of transmission thresholds Research topics given in Focks et al.[11] are 0.43 and 0.96 respectively. Again, to be conservative, we will Most containers are negative for larvae use the value associated with a seroprevalence and pupae of 0.33, i.e., a strategy to bring the area-wide Why is this so? Is it because they are used abundance of Ae. aegypti to somewhat below domestically and frequently used, cleaned or 0.43 Ae. aegypti pupae per person. emptied? Is it because of natural biological
Dengue Bulletin – Volume 31, 2007 99 Targeted source reduction/control strategy for dengue control control, or perhaps because they do not receive the time course of production – are oviposition? Could an understanding of this productive containers only episodically so, phenomenon aid in controlling productive with intervals of low or no production? containers? Alternatively, are productive containers more or less continuously so? Studies on the Some containers are especially productive mechanisms leading to certain classes of and account for the majority of breeding containers being especially productive are also needed. Time series of daily pupation Studies on the mechanisms promoting in undisturbed containers in the field would productivity are needed. A related issue is be useful.
Table 11: Types of containers most responsible for the observed standing crop of Ae. aegypti pupae per person observed during the wet season surveys; averages for the two surveys are shown [Number refers to the average number of containers observed by type; the average total number of water-holding containers in the wet season surveys was 3724. Proportion of production is the average proportion of all Ae. aegypti observed in the wet season surveys. Accumulation refers to a summing of the column to the left in a downward direction; the Type “Storage in WC” accounted for 0.456 of all production, that type and the next most productive type, “Water container (lg)” account for 0.571 of all production, etc. Pupae per person refers to the actual contribution of that type of container. Balance if removed is the number of Ae. aegypti pupae per person that would remain in the environment if that Type were controlled and the ones above it. The average number of pupae per person in the environment was 0.672]
a Indonesian: Bak mandi b Indonesian: Bak air
100 Dengue Bulletin – Volume 31, 2007 Targeted source reduction/control strategy for dengue control
Seasonality in transmission and the each, it seems likely that control would typically utility of an early warning system be continuous. Perhaps the utility of validated EWSs for Indonesia would be to forecast A recent National Research Council (USA) epidemic years as an aid to the national publication investigating the feasibility of programme in securing adequate funding for developing practical and sustainable early anticipated epidemic years. warning systems (EWSs) for infectious diseases concluded that EWSs would provide significant utility where mitigation methods were Acknowledgement available.[23] Their primary value lies in the ability temporally to focus scarce resources for This work was partially supported by a number control in those periods when epidemics were of institutions including the Jean and Julius likely. Cases of dengue and DHF occur in Tahija Family Foundation, the Office of Global virtually every province and during every month Programmes, National Oceanographic and of the year in Indonesia. Does the seasonality Atmospheric Administration (NOAA), Gadjah of dengue transmission in Indonesia suggest Mada University, and the Navy Medical that there would be merit in gaining the ability Research Center, Silver Spring, MD. We thank to time suppression activities to precede peak all of the staff who dedicated long hours in the transmission periods based on an EWS? Initial field to carefully collecting mosquito specimens attempts to develop an EWS for dengue in and the data used in this study. We are Yogyakarta have been promising and will be especially thankful to Lely Sianturi, Saptoro pursued. Rusmiarto, Yoyo R. Gionar, Dwiko Susapto, and the health staff of Gondokusuman for their Given that the first five months of the year diligence and hard work during the years of account for an average of 60% of all cases and investigation. We are also grateful to Iqbal the remaining months report about ca. 5% Elyazar for data set preparation.
References
[1] Suroso T, Holani A, Ali I. Dengue haemorrhagic global warming. Climate Change. 1997 fever outbreaks in Indonesia 1997-1998. (35):145-156. Dengue Bulletin. 1998(22): 45-48. [5] Patz JA, Martens WJ, Focks DA, Jetten TH. [2] World Health Organization, Regional Office Dengue fever epidemic potential as projected for South-East Asia, New Delhi. Report of an by general circulation models of global climate external review: dengue/dengue haemorrhagic change. Environ Health Perspect. 1998 Mar; fever prevention and control programme in 106(3): 147-53. Indonesia. New Delhi: WHO-SEARO. 2001. Document SEA-Haem Fever-75, SEA-VBC-79. [6] Bouma MJ, Poveda G, Rojas W, Chavasse D, Quiñones M, Cox J, Patz J. Predicting high-risk [3] Kusriastuti R. Internal report. Jakarta, years for malaria in Colombia using parameters Indonesia: Arbovirus Sub-directorate, of El Niño Southern Oscillation. Trop Med Int Directorate of Vector-Born Disease Control, Health. 1997 Dec; 2(12): 1122-7. Ministry of Health 2002. [7] Focks DA, Haile DG, Daniels E, Mount GA. [4] Martens WJM, Jetten TH, Focks DA. Sensitivity Dynamic life table model for Aedes aegypti of malaria, schistosomiasis and dengue to (Diptera: Culicidae): analysis of the literature
Dengue Bulletin – Volume 31, 2007 101 Targeted source reduction/control strategy for dengue control
and model development. J Med Entomol. in Vietnam: survey for Mesocyclops 1993 Nov; 30(6): 1003-17. (Copepoda), Micronecta (Corixidae), and fish as biological control agents. Am J Trop Med [8] Focks DA, Haile DG, Daniels E, Mount GA. Hyg. 2000 Jan; 62(1): 5-10. Dynamic life table model for Aedes aegypti (diptera: Culicidae): simulation results and [17] Graham RR, Juffrie M, Tan R, Hayes CG, validation. J Med Entomol. 1993 Nov; 30(6): Laksono I, Ma’roef C, Erlin, Sutaryo, Porter 1018-28. KR, Halstead SB. A prospective seroepidemiologic study on dengue in [9] Focks DA, Daniels E, Haile DG, Keesling JE. A children four to nine years of age in Yogyakarta, simulation model of the epidemiology of Indonesia I. studies in 1995-1996. Am J Trop urban dengue fever: literature analysis, model Med Hyg. 1999 Sep; 61(3): 412-9. development, preliminary validation, and samples of simulation results. Am J Trop Med [18] Gionar YR, Rusmiarto S, Susapto D, Bangs MJ. Hyg. 1995 Nov; 53(5): 489-506. Use of a funnel trap for collecting immature Aedes aegypti and copepods from deep wells [10] Focks DA, Chadee DD. Pupal survey: an in Yogyakarta, Indonesia. J Am Mosq Control epidemiologically significant surveillance Assoc. 1999 Dec; 15(4): 576-80. method for Aedes aegypti: an example using data from Trinidad. Am J Trop Med Hyg. 1997 [19] Bangs MJ, Focks DA. Abridged pupa Feb; 56(2): 159-67. identification key to the common container- breeding mosquitoes in urban Southeast Asia. [11] Focks DA, Brenner RJ, Hayes J, Daniels E. J Am Mosq Control Assoc, 2006 Sep; 22(3); Transmission thresholds for dengue in terms of 565-572. Aedes aegypti pupae per person with discussion of their utility in source reduction efforts. Am J [20] Tun-Lin W, Kay BH, Barnes A. The Premise Trop Med Hyg. 2000 Jan; 62(1): 11-8. Condition Index: a tool for streamlining surveys of Aedes aegypti. Am J Trop Med Hyg. [12] Focks DA, Brenner RJ, Chadee DD, Trosper J. 1995 Dec; 53(6): 591-4. The use of spatial analysis in the control and risk assessment of vector-borne diseases. Am [21] Barker-Hudson P, Jones R, Kay BH. Entomol. 1998; (45): 173-183. Categorization of domestic breeding habitats of Aedes aegypti (Diptera: Culicidae) in [13] World Health Organization. Key Issues in Northern Queensland, Australia. J Med dengue vector control towards the Entomol. 1988 May; 25(3): 178-82. operationalization of a global strategy: report of consultation. Geneva: WHO; 1995. [22] Tun-Lin W, Kay BH, Barnes A. Understanding Document CTD/FIL (Den)/IC.96.1). productivity, a key to Aedes aegypti surveillance. Am J Trop Med Hyg. 1995 Dec; [14] Focks DA. A review of entomological sampling 53(6): 595-601. methods and indicators for dengue vectors. Geneva: World Health Organiation, 2004. [23] Burke D, Carmichael A, Focks D, Grimes D, Document TDR/IDE/Den/03.1. Harte J, Lele S, Martens P, Mayer J, Means L, Pulwarty R, Real L, Ropelewski C, Rose J, [15] Focks DA, Lele SR, Juffrie M, Suvannadabba Shope R, Simpson J, Wilson M. Under the S, Sobel AL, Trahan MW. Early warning systems weather: exploring the linkages between for dengue in Indonesia and Thailand. Proc climate, ecosystems, infectious disease, and Unified Science & Tech Reducing Biological human health. Washington, DC.: National Threats & Countering Terrorism. Research Council, National Academy Press, Albuquerque: New Mexico. 2002. 2001. [16] Nam VS, Yen NT, Holynska M, Reid JW, Kay BH. National progress in dengue vector control
102 Dengue Bulletin – Volume 31, 2007 Elevated levels of soluble tumour necrosis factor receptor 1, thrombomodulin and soluble endothelial cell adhesion molecules in patients with dengue haemorrhagic fever
Beti Ernawati Dewia,b, Tomohiko Takasakia, T. Mirawati Sudirob, R.H. Nelwanc and Ichiro Kuranea
aLaboratory of Vector-Borne Viruses, Department of Virology 1, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo, 163-8640, Japan bDepartment of Microbiology, Medical Faculty, University of Indonesia, Jalan Pegangsaan Timur No. 16, Jakarta 10320, Indonesia cDepartment of Internal Medicine, Medical Faculty, University of Indonesia, Jakarta, Indonesia
Abstract
The pathological mechanism of dengue haemorrhagic fever (DHF) is still poorly understood. Previous studies have suggested that immune responses contribute to an increase in capillary permeability. We examined the levels of cytokines and activated endothelial substances in serum samples collected from DHF patients in Indonesia. We measured the levels of soluble TNF-R1, MCP-1, GM-CSF, IL-17, TNF-α, soluble thrombomodulin, soluble E-selectin, soluble ICAM-1 and soluble VCAM-1. The levels of activated endothelial substances such as sE-selectin, sICAM-1 and sVCAM-1 were higher in DHF patients than in healthy controls. High levels of soluble activated endothelial substances suggest that endothelial cells are highly activated. When compared with patients with other febrile illness (OFI) or healthy controls, the levels of sTNF-R1 were higher in DHF patients. A similar trend was observed in the level of thrombomodulin. MCP-1, GM-CSF and IL-17 were not detected in serum samples from any patients and healthy controls. TNF-α was detected in 5(9%) of 53 patients. The results suggest that endothelial cells are highly activated in DHF patients and TNF-α is one of the factors which contributes to the activation.
Keywords: Tumor necrosis factor receptor-1; Thrombomodulin; Vascular cell adhesion molecule-1; Intercellular adhesion molecule-1.
Introduction ranging from a mild disease as dengue fever (DF) to dengue haemorrhagic fever (DHF) and [1] Dengue virus infection continues to increase dengue shock syndrome (DSS). It is estimated in tropical and sub-tropical countries. Dengue that up to 100 million individuals are infected virus causes a spectrum of clinical illnesses with dengue virus, and 500 000 cases of DHF
E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 103 Elevated level of cytokines on DHF patients and 25 000 deaths occur annually.[1] The (2001)[20] showed that down regulation of tight pathological mechanisms of DHF are still poorly junction components such as occluding by TNF understood. The role of host immune responses is mediated via TNF-R1. have been examined in a number of studies. These studies have suggested that different In the present study, we examined the types of cytokines and abnormalities in level of sTNF-R1 in serum samples from DHF coagulation may cause an increase in the patients. In addition, we also measured the capillary permeability, the hallmark of DHF.[2,3] levels of thrombomodulin and activation molecules released from endothelial cells in The absence of massive structural damage, the serum samples. a short-lived nature of the plasma leakage syndrome and a remarkably rapid recovery of children with DSS all suggest that altered Materials and methods permeability is induced by soluble mediators.[4] It has been reported that serum levels of Study population tumour necrosis factor alpha (TNF-α) are elevated in patients with dengue haemorrhagic Blood specimens were collected from 53 fever.[5,6] The role of TNF-α in the increased patients admitted to Cipto Mangunkusumo permeability of vascular endothelial cells has Hospital, Jakarta, Indonesia, between May and been postulated.[7,8] August 2002. After informed consent was obtained, blood specimens were obtained from α TNF- starts to affect cell function by adult patients with suspected dengue infection. binding to the specific, high-affinity receptors The patients were diagnosed as dengue virus on the surface; TNF-R1 (p55 TNFR) and TNF- infection by clinical findings and laboratory R2 (p75 TNFR).[9,10] Soluble forms of TNF-R1 confirmation – IgM-capture ELISA (PanBio, and TNF-R2 are present in the serum[11] and Brisbane, Australia) and IgG-capture ELISA appear to play a role as modulators of the (PanBio, Brisbane, Australia). The patients were α biological function of TNF- , modifying the clinically classified as DHF according to the α [12,13] function and availability of TNF- . criteria of the World Health Organization;[21] Measuring sTNFRs in serum offers some grade I: fever associated with non-specific advantages compared with direct qualification constitutional symptom and positive torniquet α α of TNF- , because TNF- is rapidly cleared test as the only haemorrhagic manifestation; from circulation, and some assays are unable grade II: the same symptom with grade I with α [14] to detect TNF- bound to soluble TNFRs. the spontaneous haemorrhagic manifestation; Soluble TNFRs are very stable and their serum grade III: circulatory failure manifested by rapid, concentrations correlate well with those of weak pulse with narrowing of the pulse α [15,16] TNF- . pressure (<20 mm of Hg) or hypotension; grade IV: profound shock with undetectable blood Most of the biological effects induced by pressure and pulse. TNF-α have been shown to be mediated by TNF-R1.[17] TNF-alpha induces expression of Fifty-three patients are included in this adhesion molecules such as ICAM-1, VCAM-1 study – 25 females and 28 males, with an and E-selectin under the control of TNF-R1.[18] average age of 26.75±10.77 years. Eighteen TNF-R1 also plays a key role in TNF-alpha- patients were classified as DHF grade II, and dependent responses that include proliferation, 24 patients as DHF grade I; 11 patients as non- differentiation and apoptosis.[19] Wachtel et al. dengue infection (other febrile illness, OFI).
104 Dengue Bulletin – Volume 31, 2007 Elevated level of cytokines on DHF patients
Plasma samples were also obtained from 20 Results healthy donors with a mean age of 37.29±9.67 years as controls. Level of TNF-R1
Levels of soluble TNF-R1 in DHF patients, OFI Serum sample patients during disease days 1–15 and healthy controls are shown in Figure 1. The highest Peripheral blood (5–10 ml) was drawn into sterile mean levels were 230.51±67.07 pg/ml on day tubes containing EDTA. Blood samples were 4 after onset of fever in patients with grade II collected everyday from the day of admission and 245.02±47.72 pg/ml on day 10 after onset until the days when body temperature and of fever in patients with grade I. The highest thrombocyte count became normal. Blood mean level was 184±77.64 pg/ml in patients specimens were centrifuged at 800 rpm for 10 with OFI, and the mean level in healthy minutes and the plasma was separated and then controls was 59.37±15.12 pg/ml. The levels stored at –80 °C until use. The plasma samples of soluble TNF-R1 in patients with grades I and were transported to the NIID, Tokyo, Japan, in II were significantly higher those in healthy dry ice and stored at –80 °C until use. controls, and those in patients with OFI on days 7, 8 and 9 after onset of fever. Measurement of level of cytokines, chemokines and activated Figure 1: Variation of level of soluble TNF- endothelial substance by R1 in the plasma of DHF patients, other standard ELISA febrile illness (OFI) patients and healthy controls on days after onset of fever Levels of tumour necrosis factor-α (TNF-α), [The symbol represents the soluble TNF-R1 monocyte chemoattractant protein-1 (MCP-1), value obtained from individual patients] interleukin 17 (IL-17), granulocyte macrophage colony stimulating factor (GM-CSF), soluble E- 600 DHF-II DHF-I OFI Healthy selectin, soluble vascular cell adhesion 500 molecule-1 (sVCAM-1) and ICAM-1 were 400 assessed with ELISA kits, according to the manual /ml
g of the manufacturer (BioSource International p 300 Inc., USA). Levels of soluble tumour necrosis 200 factor receptor 1 (s TNF-R1) were measured 100 using a human sTNF-R1 immunoassay (R&D 0 3 5 7 9 11 13 15 1 3 5 7 9 11 5 7 9 11 13 15 Systems, Inc., USA). Levels of thrombomodulin were measured with soluble CD141 ELISA kits Days after onset of fever (Diaclone Research, France).
Level of thrombomodulin, sE-selectin, Statistical analysis sVCAM-1 and sICAM-1 Differences were statistically analysed by Mann-Whitney U-test. The difference was The levels of thrombomodulin, soluble E- considered to be significant, when p value was selectin, soluble VCAM-1 and soluble ICAM-1 less than 0.05. were assessed as markers for activation of
Dengue Bulletin – Volume 31, 2007 105 Elevated level of cytokines on DHF patients
Figure 2: Variation of level of Figure 3: Variation of level of thrombomodulin in the plasma of DHF soluble E-selectin in the plasma of DHF patients, other febrile illness (OFI) patients, other febrile illness (OFI) patients and healthy controls on days after patients and healthy controls on days after onset of fever onset of fever [The symbol represents the thrombomodulin [The symbol represents the soluble E-selectin value obtained from individual patients] value obtained from individual patients]
100 DHF-II DHF-I OFI Healthy DHF-II DHF-I OFI Healthy 400 90 80 350 70 300 60 /ml 250
/ml
g
g
n 50
n 200 40 30 150 20 100 10 50 0 3 5 7 9 11 13 15 1 3 5 7 9 11 5 7 9 11 13 15 0 3 5 7 9 11 13 15 1 3 5 7 9 11 5 7 9 11 13 15 Days after onset of fever Days after onset of fever endothelial cells. The levels of The levels of soluble VCAM-1 in patients thrombomodulin are shown in Figure 2. The and healthy controls are shown in Figure 4. highest mean titres were 35.42±34.44 ng/ml The highest mean level found in DHF grade II on day 10 after onset of fever and was 291.23±149.05 ng/ml on day 4 after onset 18.26±12.94 ng/ml on day 7 after onset of of fever, and that in DHF grade I was fever in patients with grade II and grade I respectively. The highest mean level in patients Figure 4: Variation of level of with OFI was 14.5±10.24 ng/ml. The levels soluble VCAM-1 in the plasma of DHF of thrombomodulin in DHF grade II and I were patients, other febrile illness (OFI) significantly higher than those in healthy patients and healthy controls on days after controls. When DHF grade II and grade I were onset of fever compared with OFI, the levels were higher in [The symbol represents the soluble VCAM-1 DHF grade II and I on days 6 and 7 (p<0.05). value obtained from individual patients]
The levels of soluble E-selectin are shown 400 DHF-II DHF-I OFI Healthy in Figure 3. The highest mean level was 350 119.82±75.18 ng/ml on day 4 after onset of 300 fever in DHF grade II and 114.2±86.67 ng/ml 250
/ml on day 10 after onset of fever in DHF grade I. g 200
n In OFI patients the highest mean level was 150 65.45±21.20 ng/ml at 7 days after onset of 100 fever. In healthy controls the level was 50 43.11±10.02 ng/ml. The level of E-selectin was 0 higher in DHF grade II and grade I than in 3 5 7 9 11 13 15 1 3 5 7 9 11 5 7 9 11 13 15 Days after onset of fever healthy controls (p<0.05).
106 Dengue Bulletin – Volume 31, 2007 Elevated level of cytokines on DHF patients
Figure 5: Variation of level of endothelial substances. The highest levels of soluble ICAM-1 in the plasma of DHF cytokines and activated endothelial substances patients, other febrile illness (OFI) were detected on the same days after onset patients and healthy controls on days after of fever. For example, in DHF grade II patients, onset of fever the highest mean levels of sTNF-R1 sE-selectin, [The symbol represents the soluble ICAM-1 sVCAM-1 and sICAM-1 were detected on day value obtained from individual patients] 4 after onset of fever. In DHF grade I, the highest levels of sTNF-R1, sE-selectin, sVCAM- 1 and sICAM-1 were detected on day 10 after 140 DHF-II DHF-I OFI Healthy onset of fever. 120
100
80 Level of other cytokines
/ml
g 60 n The plasma samples were also examined for 40 the levels of TNF-α, MCP-1, GM-CSF and IL- 20 17. TNF-α was detected in 5(9%) of 53 patients
0 with DHF, but were not detected in any of the 3 5 7 9 11 13 15 1 3 5 7 9 11 5 7 9 11 13 15 healthy controls. MCP-1, GM-CSF and IL-17 Days after onset of fever were not detected in plasma samples from any of the DHF patients or healthy controls. 109.79±27.71 ng/ml on day 10 after onset of fever. The highest level of sVCAM-1 was 81.46±17.15 ng/ml in OFI patients, and the Discussion level was 7.01±2.51 ng/ml in healthy controls. The levels of sVCAM-1 were significantly higher It has been hypothesized that DHF is caused in DHF grades II and I than in healthy controls. by soluble mediator induced in immune When DHF grade II patients were compared responses. Recent studies have demonstrated with OFI, significant differences were observed the elevation of multiple mediators in DHF from day 4 to day 9 after onset of fever. patients, including IL-6,[22] tumour necrosis factor alpha (TNF-α),[6] IL-10,[23] IFN-gamma The levels of soluble ICAM-1 are shown (IFN-γ),[24] and IL-2.[25] In the present study we in Figure 5. Low level was observed in healthy did not find high levels of TNF-α; however, controls (12.4±3.11 ng/ml). The highest mean levels of TNF-R1 were higher in DHF patients level in DHF grade II was 32.99±17.67 ng/ml than in healthy controls or patients with OFI. on day 4 after onset of fever, and in DHF grade Direct qualification of TNF-α is often difficult I, the highest mean level was 21.23±6.52 ng/ because TNF-α is rapidly cleared from the ml on day 10 after onset of fever. The highest circulation and some assays cannot detect TNF- mean level in OFI patients was 21.63±9.6 ng/ α bound to soluble TNFRs.[14] ml at day 10 after onset of fever. The levels of sICAM-1 were significantly higher in patients It has been known that TNF-α has many with DHF than in healthy controls, which effects on the endothelial cell barrier functions. showed a significant difference (p<0.05). TNF-α induces the release of cytokines and chemokines,[26] the production of enzymes, A correlation was not found among plasma such as cyclooxygenases-2[27] and nitric oxide level sTNF-R1 with the level of activated synthesis.[28] TNF-α also increases the
Dengue Bulletin – Volume 31, 2007 107 Elevated level of cytokines on DHF patients expression of adhesion molecules on anticoagulant property. This protein was endothelial cells.[29] Ferrero et al. 2001[30] immobilized onto polytetrafluorethylene showed that TNF induced alteration of surfaces to create biomaterials with enhanced endothelial permeability in vitro and in vivo haemocompatibility.[33] Thrombomodulin as a via TNF-R1. High levels of TNF-R1 in DHF thrombin-binding protein serves to initiate the patients suggest that TNF-α may play important protein C anticoagulant pathway.[34] High levels roles in the development of DHF, because the of thrombomodulin in the microcirculation level of sTNFRs in serum correlate well with suggest that thrombin might accumulate and the level of TNF-α[15,16] and because most of ultimately lead to microvascular occlusion.[35] the biological effects of TNF-α have been It is well-known that thrombin increases the attributed to TNF-R1.[17] permeability of endothelial cells.[32] We feel that high levels of thrombomodulin in DHF Endothelial cells line the inner surface of patients reflect the functional changes of blood vessels, and play an important role in vascular endothelial cells in patients with DHF. vascular functions as a barrier between blood and interstitial compartments.[31] It is known that hormones, cytokines and neurotransmitters Acknowledgments regulate endothelial cell functions.[32] We found that levels of activated endothelial substances We thank Muhareva Raekiansyah MS, S. Tajima – sICAM-1, sVCAM-1 and sE-selectin – were PhD, Mr A. Kotaki, R. Nerome PhD, Laboratory elevated in DHF patients. Elevation of these of Vector-Borne Viruses, Department of substances in serum indicates that endothelial Virology 1, National Institute of Infectious cells are activated during dengue virus infection. Diseases, for their technical support. This study was supported by the grant-in-aid (No. In addition, we measured the levels of an 12877045) from the Ministry of Education, endothelial cell injure marker, thrombomodulin. Sciences, Sports, and Culture, Japan, and the We found that mean levels of thrombomodulin grant for Research on Emerging and Re- were elevated in DHF patients compared to Emerging Infectious Diseases from Ministry of those in healthy controls and in patients with Health, Labour and Welfare, Japan, (H18- OFI. Thrombomodulin is an endothelial cell Shinkou-Ippan-009). surface glycoprotein and possesses an
References
[1] Gubler DJ. Resurgent vector-borne diseases as [3] Libraty DH, Pichyangkul S, Ajariyakhajorn C, a global health problem. Emerg Infect Dis. 1998 Endy TP, Ennis FA. Human dendritic cells are Jul-Sep; 4(3): 442-50. activated by dengue virus infection: enhancement by gamma interferon and [2] Bosch I, Xhaja K, Estevez L, Raines G, Melichar implications for disease pathogenesis. J Virol. H, Warke RV, Fournier MV, Ennis FA, Rothman 2001 Apr; 75(8): 3501-8. AL. Increased production of interleukin-8 in primary human monocytes and in human [4] Innis BL. Dengue and dengue hemorrhagic epithelial and endothelial cell lines after fever. In: Exotic viral infection. Poterfield JS. Ed. dengue virus challenge. J Virol. 2002 Jun; London: Chapman & Hall; 1995. p.103. 76(11): 5588-97.
108 Dengue Bulletin – Volume 31, 2007 Elevated level of cytokines on DHF patients
[5] Iyngkaran N, Yadav M, Sinniah M. Augmented ELISA. Lymphokine Cytokine Res. 1991 Apr; inflammatory cytokines in primary dengue 10(1-2): 69-76. infection progressing to shock. Singapore Med J. 1995 Apr; 36(2): 218-21. [15] Aukrust P, Liabakk NB, Müller F, Lien E, Espevik T, Frøland SS. Serum levels of tumor necrosis [6] Hober D, Delannoy AS, Benyoucef S, De factor-alpha (TNF alpha) and soluble TNF Groote D, Wattré P. High levels of sTNFR p75 receptors in human immunodeficiency virus and TNF alpha in dengue-infected patients. type 1 infection–correlations to clinical, Microbiol Immunol. 1996; 40(8): 569-73. immunologic, and virologic parameters. J Infect Dis. 1994 Feb; 169(2): 420-4. [7] Brett J, Gerlach H, Nawroth P, Steinberg S, Godman G, Stern D. Tumor necrosis factor/ [16] Zangerle R, Gallati H, Sarcletti M, Wachter H, cachectin increases permeability of Fuchs D. Tumor necrosis factor alpha and endothelial cell monolayers by a mechanism soluble tumor necrosis factor receptors in involving regulatory G proteins. J Exp Med. individuals with human immunodeficiency 1989 Jun 1;169(6):1977-91. virus infection. Immunol Lett. 1994 Jul; 41(2- 3): 229-34. [8] Jacobs M, Levin M. An improved endothelial barrier model to investigate dengue [17] Weiss T, Grell M, Hessabi B, Bourteele S, Müller haemorrhagic fever. J Virol Methods. 2002 Jul; G, Scheurich P, Wajant H. Enhancement of 104(2): 173-85. TNF receptor p60-mediated cytotoxicity by TNF receptor p80: requirement of the TNF [9] Loetscher H, Pan YC, Lahm HW, Gentz R, receptor-associated factor-2 binding site. J Brockhaus M, Tabuchi H, Lesslauer W. Immunol. 1997 Mar 1; 158(5): 2398-404. Molecular cloning and expression of the human 55 kd tumor necrosis factor receptor. [18] Wolf D, Hallmann R, Sass G, Sixt M, Küsters S, Cell. 1990 Apr 20; 61(2): 351-9. Fregien B, Trautwein C, Tiegs G. TNF-alpha- induced expression of adhesion molecules in [10] Smith CA, Davis T, Anderson D, Solam L, the liver is under the control of TNFR1– Beckmann MP, Jerzy R, Dower SK, Cosman D, relevance for concanavalin A-induced Goodwin RG. A receptor for tumor necrosis hepatitis. J Immunol. 2001 Jan 15; 166(2): factor defines an unusual family of cellular 1300-7. and viral proteins. Science. 1990 May 25; 248(4958): 1019-23. [19] Doan JE, Windmiller DA, Riches DW. Differential regulation of TNF-R1 signaling: [11] Pinckard JK, Sheehan KC, Arthur CD, lipid raft dependency of p42mapk/erk2 Schreiber RD. Constitutive shedding of both activation, but not NF-kappaB activation. J p55 and p75 murine TNF receptors in vivo. J Immunol. 2004 Jun 15; 172(12): 7654-60. Immunol. 1997 Apr 15; 158(8): 3869-73. [20] Wachtel M, Bolliger MF, Ishihara H, Frei K, [12] Peetre C, Thysell H, Grubb A, Olsson I. A tumor Bluethmann H, Gloor SM. Down-regulation necrosis factor binding protein is present in of occludin expression in astrocytes by tumour human biological fluids. Eur J Haematol. 1988 necrosis factor (TNF) is mediated via TNF type- Nov; 41(5): 414-9. 1 receptor and nuclear factor-kappaB [13] Aderka D, Engelmann H, Shemer-Avni Y, activation. J Neurochem. 2001 Jul; 78(1): 155- Hornik V, Galil A, Sarov B, Wallach D. Variation 62. in serum levels of the soluble TNF receptors [21] World Health Organization. Dengue among healthy individuals. Lymphokine hemorrhagic fever: diagnosis, treatment and Cytokine Res. 1992 Jun; 11(3): 157-9. control. Geneva: WHO, 1986. [14] Engelberts I, Möller A, Schoen GJ, van der [22] Juffrie M, Meer GM, Hack CE, Haasnoot K, Linden CJ, Buurman WA. Evaluation of Sutaryo, Veerman AJ, Thijs LG. Inflammatory measurement of human TNF in plasma by
Dengue Bulletin – Volume 31, 2007 109 Elevated level of cytokines on DHF patients
mediators in dengue virus infection in induced endothelial barrier dysfunction. Am children: interleukin-6 and its relation to C- J Physiol Lung Cell Mol Physiol. 2001 May; reactive protein and secretory phospholipase 280(5): L914-22. A2. Am J Trop Med Hyg. 2001 Jul;65(1):70-5. [29] Nakao S, Kuwano T, Ishibashi T, Kuwano M, [23] Green S, Vaughn DW, Kalayanarooj S, Ono M. Synergistic effect of TNF-alpha in Nimmannitya S, Suntayakorn S, Nisalak A, soluble VCAM-1-induced angiogenesis Rothman AL, Ennis FA. Elevated plasma through alpha 4 integrins. J Immunol. 2003 interleukin-10 levels in acute dengue correlate Jun 1; 170(11): 5704-11. with disease severity. J Med Virol. 1999 Nov; 59(3): 329-34. [30] Ferrero E, Zocchi MR, Magni E, Panzeri MC, Curnis F, Rugarli C, Ferrero ME, Corti A. Roles [24] Azeredo EL, Zagne SM, Santiago MA, Gouvea of tumor necrosis factor p55 and p75 receptors AS, Santana AA, Neves-Souza PC, Nogueira in TNF-alpha-induced vascular permeability. RM, Miagostovich MP, Kubelka CF. Am J Physiol Cell Physiol. 2001 Oct; 281(4): Characterisation of lymphocyte response and C1173-9. cytokine patterns in patients with dengue fever. Immunobiology. 2001 Dec; 204(4): 494-507. [31] Crone C. Modulation of solute permeability in microvascular endothelium. Fed Proc. 1986 [25] Kurane I, Innis BL, Nimmannitya S, Nisalak A, Feb; 45(2): 77-83. Meager A, Janus J, Ennis FA. Activation of T lymphocytes in dengue virus infections. High [32] Rabiet MJ, Plantier JL, Rival Y, Genoux Y, levels of soluble interleukin 2 receptor, soluble Lampugnani MG, Dejana E. Thrombin- CD4, soluble CD8, interleukin 2, and induced increase in endothelial permeability interferon-gamma in sera of children with is associated with changes in cell-to-cell dengue. J Clin Invest. 1991 Nov; 88(5): 1473- junction organization. Arterioscler Thromb Vasc 80. Biol. 1996 Mar; 16(3): 488-96. [26] Mantovani A, Sozzani S, Introna M. [33] Sperling C, Salchert K, Streller U, Werner C. Endothelial activation by cytokines. Ann N Y Covalently immobilized thrombomodulin Acad Sci. 1997 Dec 15; 832: 93-116. inhibits coagulation and complement activation of artificial surfaces in vitro. [27] Mark KS, Trickler WJ, Miller DW. Tumor Biomaterials. 2004 Sep; 25(21): 5101-13. necrosis factor-alpha induces cyclooxygenase-2 expression and [34] Esmon CT. Coagulation and inflammation. J prostaglandin release in brain microvessel Endotoxin Res. 2003; 9(3): 192-8. endothelial cells. J Pharmacol Exp Ther. 2001 [35] Esmon CT. The roles of protein C and Jun;297(3):1051-8. thrombomodulin in the regulation of blood [28] Bove K, Neumann P, Gertzberg N, Johnson A. coagulation. J Biol Chem. 1989 Mar 25; Role of ecNOS-derived NO in mediating TNF- 264(9): 4743-6.
110 Dengue Bulletin – Volume 31, 2007 Increased dengue virus-infected endothelial cell apoptosis caused by antibodies against nonstructural protein 1
Chiou-Feng Lin, Shu-Wen Wan, Mei-Chun Chen, Huan-Yao Lei and Yee-Shin Lin
Department of Microbiology and Immunology, National Cheng Kung University Medical College, Tainan, Taiwan, Republic of China
Abstract
Vascular dysfunction is a hallmark of severe dengue haemorrhagic fever (DHF) in dengue virus (DENV) infection. Both viral infection and immunopathogenesis are involved in the vasculopathy of DHF. We previously showed that antibodies against DENV nonstructural protein 1 (NS1) may cross-react with endothelial cells. A further study demonstrated the pathogenic role of anti-NS1 antibodies on endothelial dysfunction by inducing cell death and inflammation. In this study, we investigated the effect of anti- NS1 antibodies on DENV-infected human endothelial cells. We found increased binding activity of anti-NS1 antibodies to endothelial cells after DENV infection. Either DENV infection or anti-NS1 treatment caused endothelial cell apoptosis. Importantly, co-treatment with anti-NS1 antibodies increased DENV-induced endothelial cell apoptosis. The generation of nitric oxide (NO) could be detected in anti-NS1-stimulated, but not DENV-infected, endothelial cells. Furthermore, anti-NS1-induced endothelial cell apoptosis was NO-dependent, whereas DENV infection-induced apoptosis was NO- independent. These results suggest an additive effect but distinct mechanisms between anti-NS1 antibodies and DENV in endothelial cell damage. These findings indicate that both viral infection and cross- reactive antibodies may be involved in dengue pathogenesis by causing endothelial dysfunction.
Keywords: Dengue virus (DENV); Autoantibody; NS1; Endothelial cells; Apoptosis.
Introduction DENV infection is responsible for DHF in the secondary infection due to the presence of Dengue virus (DENV) causes human diseases cross-reactive and non-neutralizing antibodies [3-7] like mild dengue fever (DF) and severe dengue from prior infection. In addition to ADE, viral haemorrhagic fever and dengue shock variation and immunopathogenesis are involved [5,6,8-10] syndrome (DHF/DSS) in most tropical and in the progression of DHF. We previously subtropical areas of the world. Sequential found that anti-DENV nonstructural protein 1 infection with different DENV serotypes may (NS1) antibodies cross-reacted with endothelial influence the severity of the disease.[1,2] cells and induced these cells to undergo [11-14] Antibody-dependent enhancement (ADE) of apoptosis. Autoimmunity-mediated endothelial cell damage may, therefore, also
E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 111 Anti-NS1 enhances DENV-induced endothelial cell apoptosis contribute to the pathogenesis of dengue Viruses disease. DENV-2 (PL046, Taiwan-isolated) was Vasculopathy, coagulopathy and maintained in C6/36 cells. Briefly, a monolayer thrombocytopenia are the hallmarks of severe of C6/36 cells was incubated with DENV-2 at dengue haemorrhagic syndrome.[1,5,6] Previous a multiplicity of infection (MOI) of 0.01 and studies showed the manifestation of incubated at 26 °C in 5% CO2 for 5 days. The vasculopathy characterized by endothelial cultured medium was harvested and cell debris dysfunction caused by direct viral cytotoxicity was removed by centrifugation at 900 × g for as well as immune-mediated inflammatory 10 minutes. After further centrifugation at responses and cellular damage.[15,16] In addition, 16 000 × g for 10 minutes, the virus we demonstrated that anti-NS1 antibodies supernatant was collected and stored at -70 °C present in dengue patient sera caused until use. The virus titre was determined using endothelial cell apoptosis.[11,12] Furthermore, a plaque assay. NS1 protein can be expressed in a glycosyl- phosphatidylinositol (GPI)-linked form on the surface of DENV-infected cells.[17] In the Generating anti-NS1 antibodies present study, we investigated the apoptotic effect of DENV infection in human endothelial Recombinant DENV-2 NS1 was expressed and cells in the presence of anti-NS1 antibodies. purified as previously described.[13] To generate antibodies against DENV NS1, we immunized BALB/c mice intraperitoneally, once with 25 Materials and methods μg of recombinant NS1 protein emulsified in complete Freund’s adjuvant and then four times Cell cultures with 25 μg of recombinant NS1 protein emulsified in incomplete Freund’s adjuvant. Sera Human umbilical cord vein endothelial cells were obtained 3 or 4 days after the last (HUVECs) were cultured in modified M-199 immunization. The immunoglobulin G (IgG) medium as previously described.[11] Human fractions from hyperimmunized mouse sera and microvascular endothelial cell line-1 (HMEC- normal mouse sera used for the control were 1) was passed in culture plates containing purified using a protein G-Sepharose affinity endothelial cell growth medium M200 (Cascade chromatography column (Amersham Biologics) composed of LSGS (2% fetal bovine Pharmacia, Uppsala, Sweden). serum, 1 μg/ml hydrocortisone, 10 ng/ml epidermal growth factor, 3 ng/ml basic fibroblast growth factor, 10 μg/ml heparin, and antibiotics. Detecting binding activity
C6/36 cells were cultured in DMEM medium 5 containing 10% fetal bovine serum and Endothelial cells (5 × 10 ) were washed with antibiotics. Fetal bovine serum was pre- phosphate-buffered saline (PBS) and fixed with incubated at 56 °C for 30 minutes to inactivate 1% formaldehyde in PBS at room temperature complement before cell culture. For for 10 minutes, then washed again with PBS. experiments, 1000 U/ml trypsin and 0.5 mM Mouse anti-NS1 IgG or control IgG were then ethylenediaminetetraacetic acid (EDTA) were incubated with cells at 4 °C for 1 hour. After used to detach cells. the cells had been washed three times with
112 Dengue Bulletin – Volume 31, 2007 Anti-NS1 enhances DENV-induced endothelial cell apoptosis
PBS, they were incubated with 1 μl of 1 mg/ml Statistical analysis fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Using the Student’s unpaired t-tests in Laboratories, West Grove, PA) at 4 °C for 1 hour SigmaPlot version 8.0 for Windows (Cytel and then washed again with PBS. The binding Software Corporation, Cambridge, MA), P- activity of mouse anti-NS1 or control IgG to values were determined for all data from three endothelial cells was analysed using flow independent experiments. Statistical cytometry (FACSCalibur; BD Biosciences, San significance was set at P < 0.05. Jose, CA) with excitation set at 488 nm. Results Detecting cell death Binding activity of anti-NS1 to Cells were fixed with 70% ethanol in PBS for a DENV-infected human terminal deoxynucleotidyl transferase-mediated endothelial cells dUTP nick-end-labeling (TUNEL) reaction using the ApoAlert DNA Fragmentation Assay Kit Previous studies in our laboratory showed the (Clontech, Palo Alto, CA) according to the presence of anti-endothelial cell autoantibodies manufacturer’s instructions, and then analysed in dengue patient sera and that the levels of using flow cytometry. anti-endothelial cell autoantibodies in DHF/DSS patient sera were higher than those in DF [11,12] Detecting caspase-3 activity patient sera. Further studies demonstrated that anti-NS1 antibodies accounted for the Caspase-3 activation was determined using the cross-reactivity and the induction of endothelial ApoAlert caspase-3 colorimetric assay kit cell death. After DENV infection, the (Clontech) according to the manufacturer’s expression of NS1 protein was detected in [17-19] instructions. Relative optical density (OD) patient plasma and on cell surface. In this measurements were performed using a experiment, HUVECs were infected with microplate reader (Molecular Devices). DENV-2 at MOIs of 1 and 10 for 12, 24, and 48 hours, and the binding ability of anti-NS1 antibodies was analysed using flow cytometry. Detecting nitric oxide production We found greater anti-NS1 time-dependent endothelial cell binding activity in DENV- The production of nitric oxide (NO) was infected cells than in mock-infected cells - (Figure 1). assessed as the accumulation of nitrite (NO2 ) in the medium using a colorimetric reaction with the Griess reagent. Briefly, the culture supernatants were collected and mixed with Effect of anti-NS1 in DENV-induced an equal (1:1) volume of Griess reagent (0.1% endothelial cell apoptosis N -(1-naphthyl)ethylenediamine dihydrochloride, 1% sulfanilamide, and 2.5% Our previous studies[11-14] showed that anti-NS1 antibodies induced endothelial cell apoptosis. H3PO4). The absorbance was measured at 540 Another study[15] showed that DENV infection nm using a microplate reader. NaNO2 was caused endothelial cell cytotoxicity. In this dissolved in double-distilled H2O and used for the standard control (from 1 to 50 μM). experiment, we further investigated the effect
Dengue Bulletin – Volume 31, 2007 113 Anti-NS1 enhances DENV-induced endothelial cell apoptosis
Figure 1: Binding activity of anti-NS1 to analysis. Consistent with previous studies, both DENV-infected endothelial cells DENV infection and anti-NS1 antibodies induced apoptosis (data not shown). We then assessed the effect of DENV-induced endothelial cell apoptosis in cells co-treated with anti-NS1 antibodies. We found that anti- NS1 treatment time-dependency increased DENV-induced endothelial cell apoptosis (Figure 2).
Figure 2: Additive effect of DENV and anti- NS1 antibodies on endothelial cell apoptosis
DENV-2 (MOI=1) - - 12 24 48 - - - DENV-2 (MOI=10) - - - - - 122448
[HUVECs were infected with DENV-2 (MOI 1 and 10) for 12, 24, and 48 hours, then incubated with 5 μg of mouse anti-NS1 IgG or control IgG and then FITC- conjugated anti-mouse IgG. The binding ability was analysed using flow cytometry. A set of representative histograms (A) and the percentages of HUVECs reactive with anti-NS1 IgG are shown as mean ± SD of triplicate cultures (B). The data related to their histograms are labeled (a-h). #: statistically significant compared to the group treated with anti-NS1 alone. DENV-2 (MOI=1) -- --++++ * and #: P < 0.05; **: P < 0.01; *** and Control IgG (5μ g) 12 24 - - 12 24 - - Anti-NS1 (5μ g) ###: P < 0.001] - - 12 24 - - 12 24 [HUVECs were treated with 5 μg of mouse anti-NS1 of anti-NS1 on DENV-infected endothelial cells. IgG or control IgG for 12 and 24 hours with or without DENV-2 (MOI 1) pre-infection for 24 hours. First, HUVECs were infected with DENV-2 at They were then analysed using a TUNEL reaction and an MOI of 1 for 12, 24, and 48 hours, or flow cytometric analysis. A set of representative treated with 5 or 25 μg of anti-NS1 for 24 histograms (A) and the percentages of apoptotic cells hours. Cell apoptosis was measured using a are shown as mean ± SD of triplicate cultures (B). The data related to their histograms are labelled (a-h). TUNEL reaction and then flow cytometric *: P < 0.05; **: P < 0.01; ***: P < 0.001]
114 Dengue Bulletin – Volume 31, 2007 Anti-NS1 enhances DENV-induced endothelial cell apoptosis
Figure 3: Anti-NS1 but not DENV infection Effect of nitric oxide in anti-NS1- induces NO production in endothelial cells and DENV-induced endothelial cell apoptosis 25
) 20 Our previous studies showed that anti-NS1 M caused endothelial cell apoptosis via a nitric
,μ
- 2 15 oxide (NO)-mediated pathway.[13] In the present study, the effect of DENV infection
e(NO
t 10
ri
t on NO production was investigated. First, anti- Ni 5 NS1 but not DENV infection caused NO
0 production in endothelial cell HMEC-1 (Figure DENV-2 (MOI=10) - - - - - 122424242424 3). Furthermore, there was no effect of DENV Control IgG (5μ g) -1224-- - -1224-- infection on anti-NS1-induced NO production. Anti-NS1 (5μ g) ---1224----1224 Using NO synthase inhibitor L-NAME, we next [HMEC-1 cells were treated with 5 μg of mouse examined the effects of NO on anti-NS1- and anti-NS1 IgG or control IgG for 12 and 24 hours with DENV-induced endothelial cell apoptosis by or without DENV-2 (MOI 10) pre-infection for 12 and determining the activation of caspase-3. The 24 hours. The generation of NO derivative nitrite - results demonstrated only anti-NS1- but not (NO2 ) was analysed using a colorimetric reaction with - DENV-induced endothelial cell apoptosis via a the Griess reagent. The concentrations of NO2 are shown as mean ± SD of triplicate cultures. NO-regulated signalling (Figure 4). *: P < 0.05; **: P < 0.01]
Figure 4: Anti-NS1- but not DENV infection- Discussion induced caspase-3 activation is NO-mediated In the present study, we demonstrated that anti-NS1 antibodies increased DENV-infected 0.20 [15] -L-NAME endothelial cell damage. A previous study +L-NAME had showed that DENV caused complement OD) 0.15
y(
t activation and apoptosis in cultured endothelial
ivi t cells. A recent study[19] further demonstrated 0.10 that anti-NS1 antibodies increased complement activation. Here we showed an additive effect 0.05
Caspase-3 ac between anti-NS1 antibodies and DENV in
0 endothelial cells. DENV infection increased the DENV-2 (MOI=10) - - -+++ binding activity of anti-NS1 antibodies to Control IgG (5μ g) -24--24- Anti-NS1 (5μ g) --24--24 endothelial cells. There are at least two possible explanations for this. One is the NS1 [HMEC-1 cells were treated with 5 μg of mouse expression on the surface of DENV-infected anti-NS1 IgG or control IgG for 24 hours with or cells as previously described,[17] and the other, without DENV-2 (MOI 10) pre-infection for 24 hours. which still needs to be confirmed, is the Caspase-3 activation was determined using specific increased expression of self-antigens caused substrate assay kit. The relative optical density (OD) of caspase-3 activity is shown as mean ± SD of by DENV infection. These two possibilities are triplicate cultures. not mutually exclusive. Our preliminary study *: P < 0.05; **: P < 0.01] (unpublished data) using proteomic analysis
Dengue Bulletin – Volume 31, 2007 115 Anti-NS1 enhances DENV-induced endothelial cell apoptosis identified several candidate autoantigens expression is not involved in the additive effect present on the surface of endothelial cells. We of endothelial cell apoptosis after anti-NS1 are currently investigating whether DENV binding. This yet needs to be confirmed. infection may upregulate the expression of these candidate autoantigens. In this study, the induction of endothelial cell cytotoxicity was demonstrated. We previously Although anti-NS1 binding activity was showed that anti-NS1 antibodies caused increased after DENV infection, further inflammatory activation that was mediated by mechanistic studies indicated that the causes the production of cytokines, chemokines and of endothelial cell apoptosis by anti-NS1 adhesion molecules.[20,21] A previous study[15] antibodies and DENV infection were distinct. also showed that DENV infection led to Anti-NS1 treatment without DENV infection chemokine production in endothelial cells. caused cell apoptosis through a NO-regulated Whether the combination of DENV and anti- pathway. DENV infection-induced endothelial NS1 antibodies may increase the inflammatory cell apoptosis was, however, not mediated by response requires further investigation. NO. There are at least two possibilities for the distinct mechanisms of apoptotic induction between anti-NS1 and DENV infection. One Acknowledgements is that DENV infection may induce apoptosis via a NO-independent manner as evidenced The authors thank Bill Franke for editorial in Figure 4. The other, which remains to be assistance. This work was supported by grant investigated, is that GPI-linked NS1 protein[17] (NSC94-3112-B-006-007) from the National on the surface of DENV-infected cells does not Research Program of Genomic Medicine, involve a NO-mediated pathway by anti-NS1 National Science Council, Taiwan. Dr Chiou- stimulation. Because anti-NS1 but not DENV Feng Lin was a post-doctoral fellow supported causes a NO-mediated apoptotic pathway, it by a grant (PD9403) from the National Health is likely that DENV-increased autoantigen Research Institutes, Taiwan.
References
[1] Gubler DJ. Dengue and dengue hemorrhagic [6] Lei HY, Yeh TM, Liu HS, Lin YS, Chen SH, Liu fever. Clin Microbiol Rev. 1998 Jul; 11(3): 480- CC. Immunopathogenesis of dengue virus 96. infection. J Biomed Sci. 2001 Sep; 8(5): 377- 88. [2] Rothman AL. Dengue: defining protective versus pathologic immunity. J Clin Invest. 2004 [7] Huang KJ, Yang YC, Lin YS, Huang JH, Liu HS, Apr; 113(7): 946-51. Yeh TM, Chen SH, Liu CC, Lei HY. The dual- specific binding of dengue virus and target [3] Halstead SB. Pathogenesis of dengue: cells for the antibody-dependent challenges to molecular biology. Science. 1988 enhancement of dengue virus infection. J Jan 29; 239(4839): 476-81. Immunol. 2006 Mar 1; 176(5): 2825-32. [4] Halstead SB. Neutralization and antibody- [8] Diamond MS, Edgil D, Roberts TG, Lu B, Harris dependent enhancement of dengue viruses. E. Infection of human cells by dengue virus is Adv Virus Res. 2003; 60: 421-67. modulated by different cell types and viral [5] Rothman AL, Ennis FA. Immunopathogenesis strains. J Virol. 2000 Sep; 74(17): 7814-23. of dengue hemorrhagic fever. Virology. 1999 Apr 25; 257(1): 1-6.
116 Dengue Bulletin – Volume 31, 2007 Anti-NS1 enhances DENV-induced endothelial cell apoptosis
[9] Leitmeyer KC, Vaughn DW, Watts DM, Salas integrin/adhesin proteins and binds to human R, Villalobos I, de Chacon, Ramos C, Rico- endothelial cells: potential implications in Hesse R. Dengue virus structural differences haemorrhagic fever pathogenesis. Arch Virol. that correlate with pathogenesis. J Virol. 1999 1997; 142(5): 897-916. Jun; 73(6): 4738-47. [17] Jacobs MG, Robinson PJ, Bletchly C, [10] Vaughn DW, Green S, Kalayanarooj S, Innis Mackenzie JM, Young PR. Dengue virus BL, Nimmannitya S, Suntayakorn S, Endy TP, nonstructural protein 1 is expressed in a Raengsakulrach B, Rothman AL, Ennis FA, glycosyl-phosphatidylinositol-linked form that Nisalak A. Dengue viremia titer, antibody is capable of signal transduction. FASEB J. 2000 response pattern, and virus serotype correlate Aug; 14(11): 1603-10. with disease severity. J Infect Dis. 2000 Jan; 181(1): 2-9. [18] Libraty DH, Young PR, Pickering D, Endy TP, Kalayanarooj S, Green S, Vaughn DW, Nisalak [11] Lin CF, Lei HY, Shiau AL, Liu CC, Liu HS, Yeh A, Ennis FA, Rothman AL. High circulating TM, Chen SH, Lin YS. Antibodies from dengue levels of the dengue virus nonstructural protein patient sera cross-react with endothelial cells NS1 early in dengue illness correlate with the and induce damage. J Med Virol. 2003 Jan; development of dengue hemorrhagic fever. J 69(1): 82-90. Infect Dis. 2002 Oct 15; 186(8): 1165-8. [12] Lin CF, Lei HY, Liu CC, Liu HS, Yeh TM, Chen [19] Avirutnan P, Punyadee N, Noisakran S, SH, Lin YS. Autoimmunity in dengue virus Komoltri C, Thiemmeca S, Auethavornanan infection. Dengue Bulletin. 2004; 28:51-57. K, Jairungsri A, Kanlaya R, Tangthawornchaikul N, Puttikhunt C, Pattanakitsakul SN, [13] Lin CF, Lei HY, Shiau AL, Liu HS, Yeh TM, Chen Yenchitsomanus PT, Mongkolsapaya J, SH, Liu CC, Chiu SC, Lin YS. Endothelial cell Kasinrerk W, Sittisombut N, Husmann M, apoptosis induced by antibodies against Blettner M, Vasanawathana S, Bhakdi S, dengue virus nonstructural protein 1 via Malasit P. Vascular leakage in severe dengue production of nitric oxide. J Immunol. 2002 virus infections: a potential role for the Jul 15; 169(2): 657-64. nonstructural viral protein NS1 and [14] Lin YS, Lin CF, Lei HY, Liu HS, Yeh TM, Chen complement. J Infect Dis. 2006 Apr 15; 193(8): SH, Liu CC. Antibody-mediated endothelial 1078-88. cell damage via nitric oxide. Curr Pharm Des. [20] Lin CF, Chiu SC, Hsiao YL, Wan SW, Lei HY, 2004; 10(2): 213-21. Shiau AL, Liu HS, Yeh TM, Chen SH, Liu CC, [15] Avirutnan P, Malasit P, Seliger B, Bhakdi S, Lin YS. Expression of cytokine, chemokine, Husmann M. Dengue virus infection of human and adhesion molecules during endothelial endothelial cells leads to chemokine cell activation induced by antibodies against production, complement activation, and dengue virus nonstructural protein 1. J apoptosis. J Immunol. 1998 Dec 1; 161(11): Immunol. 2005 Jan 1; 174(1): 395-403. 6338-46. [21] Lin CF, Wan SW, Cheng HJ, Lei HY, Lin YS. [16] Falconar AK. The dengue virus nonstructural- Autoimmune pathogenesis in dengue virus 1 protein (NS1) generates antibodies to infection. Viral Immunol. 2006; 19(2): 127- common epitopes on human blood clotting, 32.
Dengue Bulletin – Volume 31, 2007 117 Role of nitric oxide in the pathogenesis of dengue
Germán Añeza , Nereida Valeroa and Jesús Mosquerab
aSección de Virología, Instituto de Investigaciones Clínicas “Dr. Américo Negrette”, Facultad de Medicina, Universidad del Zulia, Apartado Postal 23, Maracaibo 4001-A, Estado Zulia, Venezuela bSección de Inmunología y Biología Celular, Instituto de Investigaciones Clínicas “Dr. Américo Negrette”, Facultad de Medicina, Universidad del Zulia, Apartado Postal 23, Maracaibo 4001-A, Estado Zulia, Venezuela
Abstract
The free radical nitric oxide (NO) has emerged in recent years as a fundamental signalling molecule for the maintenance of homeostasis, as well as a potent cytotoxic effector involved in the pathogenesis of a wide range of human diseases. The presence of NO during dengue infection as well as its experimental antiviral and apoptotic effects have been documented. In this regard, increased serum NO levels in dengue fever and basal levels in the haemorrhagic form of dengue have been reported. Clinical and experimental data suggest that NO could act as a beneficial factor during dengue infection by its antiviral and apoptotic effects; however, more intense investigations are required.
Keywords: Dengue virus; Nitric oxide; Dengue haemorrhagic fever, Pathogenesis.
Introduction The discovery that mammalian cells have the ability to synthesize the free radical nitric Dengue fever (DF) is the most important oxide (NO) has stimulated an extraordinary arboviral disease affecting public health in the impetus for scientific research in all fields of developing world. The disease is endemic in biology and medicine. NO is produced by many countries and causes epidemics three isoforms of nitric oxide synthase (NOS), frequently. These epidemics involve an the inducible form (iNOS), and the two estimated 100 million cases annually constitutive isoforms endothelial NOS (eNOS) worldwide, causing great health, social and and neuronal NOS (nNOS). Since its early economic burden.[1,2] Dengue virus (DENV), a description as an endothelial-derived relaxing RNA virus belonging to genus, Flavivirus, family factor, NO has emerged as a fundamental Flaviviridae, has four serotypes (DENV-1 to 4). signalling device regulating virtually every critical Clinically, the disease may be asymptomatic cellular function, as well as a potent mediator or may range from a mild febrile illness, DF, to of cellular damage in a wide range of conditions. the severe, life-threatening form, dengue Recent evidence indicates that most of the haemorrhagic fever/dengue shock syndrome cytotoxicity attributed to NO is rather due to (DHF/DSS), which can be caused indistinctly peroxynitrite, produced from the diffusion- by any serotype.[3-5] controlled reaction between NO and another
E-mail: [email protected]; Tel.: +58 416 6658687; Fax: +58 261 7597247
118 Dengue Bulletin – Volume 31, 2007 Role of nitric oxide in the pathogenesis of dengue free radical, the superoxide anion. Peroxynitrite effects observed in DHF. In addition, it seems interacts with lipids, DNA, and proteins via to be that virus-platelets interaction is not direct oxidative reactions or via indirect, radical- involved in the increased production of NO, mediated mechanisms. These reactions trigger suggesting other sources for this molecule. In cellular responses ranging from subtle this regard, monocyte/macrophages are the modulations of cell signalling to overwhelming most important targets of DENV,[18] and are oxidative injury, committing cells to necrosis capable of producing high amounts of NO; or apoptosis. In vivo, peroxynitrite generation thus, Mo/MΦ-DENV interaction may induce represents a crucial pathogenic mechanism in increased amount of NO. In accordance with conditions such as stroke, myocardial infarction, that suggestion, increased expression of chronic heart failure, diabetes, circulatory inducible nitric oxide synthase in monocytes shock, chronic inflammatory diseases, cancer, from DF patients has been reported,[13] which neurodegenerative disorders and viral translates into sustained NO production,[13,15,16] infections.[6-9] suggesting the possible source of NO found in patients with DF. Previous reports have suggested a possible role of NO in DF and DHF/DSS Since endothelium is an important NO pathogenesis;[10-17] however, very little producer, the direct or indirect interaction of information is available with regard to its role DENV with the endothelial cells could induce during the human dengue infection. Therefore, an increased amount of serum NO in these evidence from in vivo and in vitro conditions patients.[6-8,16,17] However, increased levels of suggesting the possible role of NO in dengue NO in patients with dengue seem to be infection is presented in this review. controversial. Other investigators[19] have reported levels of serum NO significantly lower than those of normal controls in Asiatic children Nitric oxide in dengue with DF and DHF, suggesting that the infection endothelial damage renders the endothelium incapable of producing NO. These data are different from the increased amount of serum NO is ubiquitous physiological-free radical that NO found in patients with DF reported by is responsible for many pathological disorders.[6- others.[10] This different response to the virus 9] Its presence in human dengue infection was infection could be related to the widespread reported for the first time by Valero and prevalence of human dengue resistance genes collaborators.[10] in the Americas’ populations compared to Asian In this regard, increased serum NO levels populations. The people of countries in South- in DF and normal levels in DHF patients were East Asia have high rates of severe dengue reported. There was no relationship between disease compared to consistently low case- fatality rates in American countries reporting the viral serotypes and the increased values of [20] NO. Interaction of dengue virus with primary DHF. Virtually, nothing is known about human platelet cultures did not induce further dengue resistance gene(s) in the pathogenesis regulation of NO production.[10] These data of dengue. Are the manifestations of DF suppressed by this gene(s), or does the gene(s) suggest that increased levels of NO in DF [20] patients could have a protector effect during selectively dampen dengue vasculopathy? the disease, and, on the contrary, decreased The expression of this gene(s) could involve levels could be the cause of the deleterious different cell targets during the disease leading
Dengue Bulletin – Volume 31, 2007 119 Role of nitric oxide in the pathogenesis of dengue to differential production of NO. Future respectively, to endogenous NO produced by research on dengue infections should THP-1 cells (human monocytic leukemia cell emphasize population-based designs to shed line). These findings were also related with light on the heterogeneity of dengue in amino acids changes in the RdRp and populations living in the Western and Eastern Methyltransferase (MTase) domains of NS5. hemispheres. Additionally, when compared the gene expression on DENV-2 infected THP-1 cells, NO-resistant but no NO-sensitive isolates, Anti-viral effect of nitric oxide induced the immune-related genes IL-6, IL-7, IL-8, RANTES, and MCP-3, all of which are The beneficial effect of NO in DF could be potent mediators of tissue damage as well as related to an antiviral effect of the molecule. coagulopathy. These findings need to be Previous studies have shown that NO could carefully studied to determine if this effect is have antiviral effect on dengue-infected cells. particularly restricted to DENV-2 or to its Asian In this regard, decreased expression of dengue genotype, or if NO-resistant strains occurs in virus antigens in NO-producing mononuclear the nature for the other serotypes. cells has been reported. In addition, treatment of those cultures with an iNOS inhibitor (NG- All the previous data suggest a possible methyl-L-Arginine) induced increased viral antiviral mechanism of NO in vivo, and suggest antigens detection.[13] The effect of NO a beneficial role of increased serum levels of exogenous donor (S-nitroso-N- NO reported in DF.[10] Lower levels of NO acethylpennicillamine or SNAP) on DENV found in patients with DHF could be related replication in neuroblastoma cell cultures has to the described DENV action on target cells. also been reported. DENV-2-infected cells In this regard, Chareonsirisuthigul et al.[11] treated with SNAP showed suppression of viral showed a different antiviral response in RNA synthesis and, consequently, decreased experiments using DENV-infected THP-1 cell viral proteins and viral progeny production.[12] cultures untreated and treated with an anti- This effect was also observed in DENV-1- DENV-enhancing antibodies (a model of infected C6/36 cell cultures treated with sodium infection via ADE). These experiments showed nitroprussiate, a NO donor.[13] Takhampunya suppression of NO production in ADE cultures et al.[14] showed the inhibitory effect of NO due to disruption of transcription of the IRF-1 on DENV-infected LLC-MK2 cell cultures using (an iNOS gene transcription factor) and blocking SNAP. This report found a diminished cellular of the activation of STAT-1. These findings could accumulation of viral RNA during viral RNA be related to the pathogenesis of DHF/DSS synthesis. This inhibitory effect of NO seems and could suggest a mechanism for basal serum to be related to the inhibition of DENV-2 RNA- NO levels in DHF patients.[10] dependent RNA polymerase (RdRp) domain of NS5, with further suppression of viral RNA This antiviral effect of NO is not restricted synthesis, viral structural proteins, and to the dengue virus. Several studies have decreased number of infectious particles in the reported a NO antiviral effect on an extensive culture medium. list of viruses including SARS-coronavirus, hantavirus, Ross River virus, vesicular stomatitis Recently, Ubol et al.[21] reported DENV-2 virus, Crimean-Congo haemorrhagic fever virus, clinical isolates derived from DF and DHF cases, and members of the genus Flavivirus, including which are NO-sensitive and NO-resistant, Japanese encephalitis.[22-29]
120 Dengue Bulletin – Volume 31, 2007 Role of nitric oxide in the pathogenesis of dengue
Nitric oxide and apoptosis phagocytosis and digestion of apoptotic cells, represent mechanisms to prevent viral [32] The dengue virus may be an apoptosis inducer progeny. However, damage of endothelial by direct or indirect mechanisms. Infection of cells and monocytes/macrophages could Mo/MΦ or endothelial cells with DENV results induce severe forms of dengue infection. in apoptosis;[30-32] however, the mechanisms Further investigation is required to determine of apoptosis induction remain unclear. The free the modulation of NO in order to provide the radical NO has emerged in recent years as a therapeutic strategies for dengue infection by fundamental signalling molecule for the preventing the AECA-mediated endothelial cell maintenance of homeostasis, as well as a apoptosis and to determine the in vivo potent cytotoxic effector. Under normal mechanism of NO-mediated apoptosis conditions, NO produced in low concentration induced by DENV during the course of human acts as a messenger and cytoprotective dengue infection. (antioxidant) factor; however, when the circumstances allow the formation of substantial amounts of NO, this molecule could induce Conclusion and future both oxidative and nitrosative stresses, which perspective form the basis of the apoptosis generally attributed to NO.[7-9] NO, on the basis of its physiological chemistry, provides a conceptual framework, which helps Previous investigations have shown the to distinguish between the beneficial and toxic presence of apoptosis in patients both with consequences of NO, and to envision potential dengue and in experimental dengue therapeutic strategies for the future. The high [30-34] infection. However, there is little levels of NO may be beneficial during dengue information about the role of NO in apoptosis infection by its antiviral and apoptotic effects; during dengue infection. In this regard, however it could also induce severe forms of antibodies against dengue virus nonstructural the disease by damage to endothelial cells. protein1 (NS1), which has cross-reactivity with Further investigations are required to determine endothelial cells (AECA), induce apoptosis via the source of NO during human dengue a NO-mediated mechanism in experimental infection, its role in the pathogenesis of DF dengue virus infection. Endothelial cells and DHF/DSS, its role in dengue infection undergo apoptosis via the mitochondria- according to the prevalence of human dengue dependent pathway that is regulated by NO resistance genes, and the presence of NO- production, suggesting that NO-regulated resistant strains in all the DENV serotypes. endothelial cell injury may play a role in the disruption of vessel endothelium and contribute to the pathogenesis of vasculopathy.[16,17] Other Acknowledgments investigators have shown increased apoptosis in dengue virus-replicating Kupffer cells This work was supported by the Consejo para associated with increased expression of el Desarrollo Científico y Humanístico de la inducible NO synthase and production of Universidad del Zulia (CONDES) (CC-0789- [15] NO. Apoptosis could avoid the release of 04). viral particles and, together with the
Dengue Bulletin – Volume 31, 2007 121 Role of nitric oxide in the pathogenesis of dengue
References
[1] Añez G, Balza R, Valero N, Larreal Y. Economic but suppresses anti-DENV free radical and pro- impact of dengue and dengue hemorrhagic inflammatory cytokine production, in THP-1 fever in the State of Zulia, Venezuela, 1997- cells. J Gen Virol. 2007 Feb; 88(Pt 2): 365-75. 2003. Rev Panam Salud Publica. 2006 May; 19(5): 314-20. Spanish. [12] Charnsilpa W, Takhampunya R, Endy TP, Mammen MP Jr, Libraty DH, Ubol S. Nitric [2] Gubler DJ. Epidemic dengue/dengue oxide radical suppresses replication of wild- hemorrhagic fever as a public health, social type dengue 2 viruses in vitro. J Med Virol. and economic problem in the 21st century. 2005 Sep; 77(1): 89-95. Trends Microbiol. 2002 Feb; 10(2): 100-3. [13] Neves-Souza PC, Azeredo EL, Zagne SM, Valls- [3] World Health Organization. Dengue de-Souza R, Reis SR, Cerqueira DI, Nogueira haemorrhagic fever: diagnosis, treatment and RM, Kubelka CF. Inducible nitric oxide control. 2nd edn. Geneva: WHO; 1997. synthase (iNOS) expression in monocytes during acute dengue Fever in patients and [4] Halstead SB. Pathogenesis of dengue: during in vitro infection. BMC Infect Dis. 2005 challenges to molecular biology. Science. 1988 Aug 18; 5:64. Jan 29; 239(4839): 476-81. [14] Takhampunya R, Padmanabhan R, Ubol S. [5] Halstead SB. Observations related to Antiviral action of nitric oxide on dengue virus pathogensis of dengue hemorrhagic fever. VI. type 2 replication. J Gen Virol. 2006 Oct; 87(Pt Hypotheses and discussion. Yale J Biol Med. 10): 3003-11. 1970 Apr; 42(5): 350-62. [15] Marianneau P, Steffan AM, Royer C, Drouet [6] Moncada S, Higgs EA. The discovery of nitric MT, Jaeck D, Kirn A, Deubel V. Infection of oxide and its role in vascular biology. Br J primary cultures of human Kupffer cells by Pharmacol. 2006 Jan; 147 Suppl 1: S193-201. dengue virus: no viral progeny synthesis, but [7] Liaudet L, Soriano FG, Szabó C. Biology of cytokine production is evident. J Virol. 1999 nitric oxide signaling. Crit Care Med. 2000 Jun; 73(6): 5201-6. Apr; 28(4 Suppl): N37-52. [16] Lin CF, Lei HY, Shiau AL, Liu HS, Yeh TM, Chen [8] Pacher P, Beckman JS, Liaudet L. Nitric oxide SH, Liu CC, Chiu SC, Lin YS. Endothelial cell and peroxynitrite in health and disease. Physiol apoptosis induced by antibodies against Rev. 2007 Jan; 87(1): 315-424. dengue virus nonstructural protein 1 via production of nitric oxide. J Immunol. 2002 [9] Nagy G, Clark JM, Buzás EI, Gorman CL, Cope Jul 15;169(2):657-64. AP. Nitric oxide, chronic inflammation and autoimmunity. Immunol Lett. 2007 Jul 31; [17] Lin YS, Lin CF, Lei HY, Liu HS, Yeh TM, Chen 111(1): 1-5. SH, Liu CC. Antibody-mediated endothelial cell damage via nitric oxide. Curr Pharm Des. [10] Valero N, Espina LM, Añez G, Torres E, 2004; 10(2): 213-21. Mosquera JA. Short report: increased level of serum nitric oxide in patients with dengue. [18] Blackley S, Kou Z, Chen H, Quinn M, Rose Am J Trop Med Hyg. 2002 Jun; 66(6): 762-4. RC, Schlesinger JJ, Coppage M, Jin X. Primary human splenic macrophages, but not T or B [11] Chareonsirisuthigul T, Kalayanarooj S, Ubol cells, are the principal target cells for dengue S. Dengue virus (DENV) antibody-dependent virus infection in vitro. J Viro.l 2007 Dec; enhancement of infection upregulates the 81(24): 13325-34. production of anti-inflammatory cytokines,
122 Dengue Bulletin – Volume 31, 2007 Role of nitric oxide in the pathogenesis of dengue
[19] Trairatvorakul P, Chongsrisawat V, Congo hemorrhagic fever virus. Virus Res. 2006 Ngamvasinont D, Asawarachun D, Nantasook Sep; 120(1-2): 184-90. J, Poovorawan Y. Serum nitric oxide in children with dengue infection. Asian Pac J [28] Saxena SK, Singh A, Mathur A. Antiviral effect Allergy Immunol. 2005 Jun-Sep; 23(2-3): 115- of nitric oxide during Japanese encephalitis 9. virus infection. Int J Exp Pathol. 2000 Apr; 81(2): 165-72. [20] Halstead SB. Dengue in the Americas and Southeast Asia: do they differ? Rev Panam [29] Lin YL, Huang YL, Ma SH, Yeh CT, Chiou SY, Salud Publica. 2006 Dec; 20(6): 407-15. Chen LK, Liao CL. Inhibition of Japanese encephalitis virus infection by nitric oxide: [21] Ubol S, Chareonsirisuthigul T, Kasisith J, antiviral effect of nitric oxide on RNA virus Klungthong C. Clinical isolates of dengue virus replication. J Virol. 1997 Jul; 71(7): 5227-35. with distinctive susceptibility to nitric oxide radical induce differential gene responses in [30] Espina LM, Valero NJ, Hernández JM, THP-1 cells. Virology. 2008 Jul 5; 376(2): 290- Mosquera JA. Increased apoptosis and 6. expression of tumor necrosis factor-alpha caused by infection of cultured human [22] Keyaerts E, Vijgen L, Chen L, Maes P, monocytes with dengue virus. Am J Trop Med Hedenstierna G, Van Ranst M. Inhibition of Hyg. 2003 Jan; 68(1): 48-53. SARS-coronavirus infection in vitro by S- nitroso-N-acetylpenicillamine, a nitric oxide [31] Avirutnan P, Malasit P, Seliger B, Bhakdi S, donor compound. Int J Infect Dis. 2004 Jul; Husmann M. Dengue virus infection of human 8(4): 223-6. endothelial cells leads to chemokine production, complement activation, and [23] Klingström J, Akerström S, Hardestam J, Stoltz apoptosis. J Immunol. 1998 Dec 1; 161(11): M, Simon M, Falk KI, Mirazimi A, Rottenberg 6338-46. M, Lundkvist A. Nitric oxide and peroxynitrite have different antiviral effects against hantavirus [32] Mosquera JA, Hernandez JP, Valero N, Espina replication and free mature virions. Eur J LM, Añez GJ. Ultrastructural studies on dengue Immunol. 2006 Oct; 36(10): 2649-57. virus type 2 infection of cultured human monocytes. Virol J. 2005 Mar 31; 2: 26. [24] Lidbury BA, Mahalingam S. Specific ablation of antiviral gene expression in macrophages [33] Jan JT, Chen BH, Ma SH, Liu CI, Tsai HP, Wu by antibody-dependent enhancement of Ross HC, Jiang SY, Yang KD, Shaio MF. Potential River virus infection. J Virol. 2000 Sep; 74(18): dengue virus-triggered apoptotic pathway in 8376-81. human neuroblastoma cells: arachidonic acid, superoxide anion, and NF-kappaB are [25] Chesler DA, Dodard C, Lee GY, Levy DE, Reiss sequentially involved. J Virol. 2000 Sep; CS. Interferon-gamma-induced inhibition of 74(18): 8680-91. neuronal vesicular stomatitis virus infection is STAT1 dependent. J Neurovirol. 2004 Feb; [34] Myint KS, Endy TP, Mongkolsirichaikul D, 10(1): 57-63. Manomuth C, Kalayanarooj S, Vaughn DW, Nisalak A, Green S, Rothman AL, Ennis FA, [26] Bi Z, Reiss CS. Inhibition of vesicular stomatitis Libraty DH. Cellular immune activation in virus infection by nitric oxide. J Virol. 1995 children with acute dengue virus infections is Apr; 69(4): 2208-13. modulated by apoptosis. J Infect Dis. 2006 Sep 1; 194(5): 600-7. [27] Simon M, Falk KI, Lundkvist A, Mirazimi A. Exogenous nitric oxide inhibits Crimean
Dengue Bulletin – Volume 31, 2007 123 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
C.D. Chena , W.A. Naznia, B. Seleenaa, J.Y. Moob, M. Azizahc and H.L. Leea
aMedical Entomology Unit, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur, Malaysia bCollege of Tunku Abdul Rahman, Jalan Genting Kelang, Setapak, 53100 Kuala Lumpur, Malaysia cBacteriology Unit, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur, Malaysia
Abstract
The comparative oviposition preferences of Aedes aegypti to water from storm-water drains* and seasoned tap water were evaluated in the laboratory. The sample was collected from concrete storm-water drains with stagnant clear water in a dengue-endemic site, Taman Samudera, Selangor. Ae. aegypti adults were given a blood meal and released into the cage. Gravid females were given a choice between drain water and seasoned tap water for egg deposition. In a no-choice test, there was no significant difference in the numbers of eggs, larvae, pupae and adults colonized from the drain water and seasoned tap water (p>0.05), indicating that Ae. aegypti oviposit their eggs on a substrate which is readily available. In a choice test, the number of eggs laid by Ae. aegypti in drain water (1630.67 ± 204.26) was significantly more than that in seasoned tap water (221.33 ± 53.18) (p<0.05). The number of eggs was 6-fold higher in the drain water compared to seasoned tap water. The oviposition activity index was 0.71, indicating that the drain water was more attractive compared to seasoned tap water as an oviposition substrate. The pH and biochemical oxygen demand (BOD) values of both drain water and seasoned tap water were not significantly different (p>0.05), indicating that water from the drain did not contain high organic content. Significant water conductivity (p<0.05) and the presence of bacteria could have contributed to the site selection for egg laying by Ae. aegypti. The drain water successfully supported the colonization of the immatures, with the emergence of 824.33 ± 13.96 adult mosquitoes. The ratio of male and female mosquitoes was 1:1. This study concluded that the concrete drainage system with clear stagnant water provides a suitable medium for the colonization of dengue vector Ae. aegypti.
Keywords: Oviposition; Aedes aegypti; Drain water, Seasoned tap water; Malaysia.
Introduction ranks as the most important mosquito-borne viral disease in the world. In the past 50 years, During the 19th century, dengue was considered its incidence has increased 30-fold, with large a sporadic disease, causing epidemics at long outbreaks occurring in five of the six World intervals. However, dramatic changes in this Health Organization (WHO) regions. At pattern have occurred and currently, dengue present, dengue is endemic in 112 countries in the world.[1] E-mail: [email protected] *Water from storm-water drains will be mentioned as ‘drain water’ throughout the text.
124 Dengue Bulletin – Volume 31, 2007 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water Dengue has remained endemic in Malaysia Collection of drain water from since the first case was documented in 1901– study site 1902.[2] The disease was made notifiable in 1973.[3] The drain water was collected from Taman Samudera (N03°13.987’, E101°41.918’), Aedes aegypti is a domestic mosquito while Selangor state, Malaysia, which is a dengue- Aedes albopictus is semi-domestic in urban areas. endemic area, located 16 km from Kuala Ae. aegypti breeds exclusively in artificial Lumpur city centre. Taman Samudera covers 30 containers such as earthen jars and plastic ha of land which consists of approximately 400 containers which contain relatively clean water double storey terrace brick houses. in and around houses.[4] The typical habitats of Ae. albopictus are artificial containers, tree holes The ovitrap surveillance conducted in a and bamboo stumps near human dwellings.[5] previous study by Chen et al.[7] indicated that Ae. aegypti was the principal mosquito, both The ability of gravid mosquito females to indoors and outdoors, as reflected by ovitrap distinguish among potential oviposition sites that collections. will or will not support the growth, development and survival of their offspring is critical for the Taman Samudera is an urban residential maintenance of the mosquito population. Once site, generally clean. This site had minimum the blood meal large enough to initiate ovarian artificial larval habitats such as containers and development has been obtained and the tyres. The major larval habitat appeared to be temperature-dependent egg maturation period the concrete drain with clear stagnant water. has been completed, mosquitoes must locate The drain water was collected from five suitable oviposition sites.[6] different drains in Taman Samudera for this study. All samples of the drain water were In Malaysia, rapid urbanization has resulted pooled together for colonization. in the creation of suitable habitats for Ae. aegypti. The present study was conducted to examine the suitability of drain water for the Preparation of seasoned tap water breeding of Ae. aegypti mosquitoes. Seasoned tap water (de-chlorinated water) was prepared by collecting the tap water directly Materials and Methods from pipe into a plastic container and seasoned for several days. Mosquito colony
Ae. aegypti mosquitoes** (F 967) used in this Measurement of water parameters study came from the colony maintained in the insectarium of the Medical Entomology Unit, The pH, conductivity and biochemical oxygen Institute for Medical Research, Kuala Lumpur, demand (BOD) of the drain and seasoned tap Malaysia. The colony, established 30 years ago, waters were determined. The bacterial fauna of produced test mosquitoes that are pathogen- the waters were determined by plating the water free and homogenous. sample on Nutrient Agar. Each bacteria colony was isolated and identified at the Bacteriology **Test insects were from a 30-years-old colony and as Unit, Institute for Medical Research. such may not necessarily reflect behaviour patterns that are comparable to those of field populations – Editor
Dengue Bulletin – Volume 31, 2007 125 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
Laboratory evaluation of oviposition Oviposition Activity Index (OAI) = NT–NS preference NT+NS [NT denotes the number of eggs laid on test water Preparation of ovitrap (drain water) and NS denotes the number of eggs laid in control water (seasoned tap water). Index values Ovitrap as described by Lee[8] was used in this range from +1 to –1. Positive values indicate that study. Each ovitrap consisted of a 300 ml plastic more eggs were deposited in the test water than in the control water, and that the test water was container with straight, slightly tapered sides. attractive. On the other hand, if more eggs were A filter paper in cone shape was placed in the deposited in the control water than in the test water, ovitrap to serve as a resting and oviposition negative index values will be obtained indicating that site. Each ovitrap was filled with drain water or the test water acted as repellent] seasoned tap water to a level of 5.5 cm. Statistical analysis
No-choice test T-test analysis (SPSS v.10) was used to The ovitrap described as above was filled with determine the significant difference of the drain water and placed into a cage (30 cm X 30 physical measures and the number of eggs, cm X 30 cm). A total of 30 laboratory-bred 5- larvae, pupae and adult obtained between days-old Ae. aegypti were given a blood meal drain water and seasoned tap water. All levels by feeding on a guinea pig. The gravid females of statistical significance were determined at were released into the cage and left for a week. p<0.05. The hatchability and emergence rate For all tests, 10% sugar solution was provided. of Ae. aegypti in drain water and seasoned tap At the end of the week, the ovitrap was water were also calculated. removed. The filter paper was dried and the eggs were counted. The filter paper was then placed into a tray holding drain water for the Results and discussion eggs to hatch. The larvae, pupae and adult emergence were counted and recorded. Three The oviposition preference of Ae. aegypti to drain replicates were conducted. The same procedure water and seasoned tap water from the no- was repeated by using seasoned tap water. choice test (Table 1) shows that there was no significant difference in the numbers of eggs, larvae, pupae and adults colonized from drain Choice test water and seasoned tap water (p>0.05), Two ovitraps each holding drain water and indicating that Ae. aegypti oviposit their eggs on seasoned tap water were placed in a cage (30 a substrate which is readily available. However, cm X 30 cm X 30 cm). The experimental in the choice test (Table 2), the number of eggs procedure was then carried out according to laid by Ae. aegypti in drain water (1630.67 ± the no-choice test. 204.26) was significantly more than in seasoned tap water (221.33 ± 53.18) (p<0.05). The number of eggs was 6-fold higher in drain water Data analysis compared to seasoned tap water. Furthermore, the oviposition activity index (OAI) was 0.71, The relative attractiveness of test sample was indicating that drain water was more attractive expressed as an oviposition activity index (OAI) compared to seasoned tap water as an calculated according to Kramer and Mulla,[9] oviposition substrate. where
126 Dengue Bulletin – Volume 31, 2007 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
Figure: Hatchability rate and emergence The hatchability and emergence rates of Ae. rate of Ae. aegypti in drain water and aegypti in drain water and seasoned tap water seasoned tap water (Figure) indicated that there was no complete hatchability and emergence in all the preferred
100 Drain water Seasonal water water. The majority of eggs placed in drain water 89.98 90 87.15 81.84 81.84 and seasoned tap water did hatch, with 69.0– 80 73.59 76.33 68.70 82.0% hatchability in drain water and 63.0– 70 63.10
%) 60 74.0% in seasoned tap water. In both choice
e(
g
a
t 50 and no-choice studies, drain water and seasoned 40 tap water successfully supported the colonization
Percen 30 20 of Ae. aegypti immatures. In the choice test, a 10 total of 824.33 ± 13.96 adult mosquitoes 0 No choice test Choice test No choice test Choice test emerged from the population that was colonized Hatchability rate Emergence rate in the drain water; and a total of 125.67 ± 44.95 adult mosquitoes emerged from the colony in the seasoned water (Tables 1 and 2).
Table 1: Mean numbers of eggs, larvae, pupae and adult obtained from 30 gravid female Ae. aegypti in no-choice test
p<0.05 = Significant; p>0.05 = Not significant; SE = Standard error
Table 2: Mean numbers of egg, larvae, pupae and adult obtained from 30 gravid female Ae. aegypti in choice test
* = p<0.05 (Significant); ** = p<0.01 (Highly significant); SE = Standard error
Dengue Bulletin – Volume 31, 2007 127 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
Table 3: Physical measure for drain water and seasoned tap water
p<0.05 = Significant; p>0.05 = Not significant; SE = Standard error
There was no significant difference in the was significantly higher than seasoned tap water ratio of males and females colonized from both (0.08 ± 0.00) by four-fold (p<0.05), indicating types of water (p>0.05). The ratio of males that conductivity may play a role in mosquito and females obtained from the drain water oviposition preference. and seasoned tap water was 1:1 (Tables 1 and 2). Paradise and Dunson[10] reported that high concentration of Na+ in the solution may serve The physical measurement of drain water as a nutrient for the growth of microbial and seasoned tap water is as shown in Table populations, thus increased microbial 3. The pH and BOD values of both waters production, in part, through the food chain, were not significantly different (p>0.05), leading to the support of larger numbers of indicating that water from the drain did not mosquito larvae. Paradise and Dunson[10] also contain high organic content, i.e. the water reported that in addition to direct uptake via was clean and clear. anal papillae, mosquitoes may acquire Na+ through filter-feeding on microbes and may Conductivity is a measure of the flow of grow faster under condition of high electrical current, made possible in the water concentration of Na+ due to decreased by ions in solution. The conductivity value allocation of energy toward acquiring Na+ or obtained for drain water was 0.33 ± 0.06 and increased production of food sources.
Table 4: Bacteria isolated from drain water and seasoned tap water
128 Dengue Bulletin – Volume 31, 2007 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
Microbacterial examination from drain Trexler et al.[13] also reported that a water and seasoned tap water is presented in combination of the bacterial species would elicit Table 4. A total of 9 bacteria were found in 5 a stronger oviposition response, increasing the different drain water samples collected from percentage of eggs that are deposited in the Taman Samudera. In the seasoned tap water, test containers. no bacteria were found growing on the Nutrient Agar. Larvae of many mosquito species eat bacteria or depend on them to condition organic Since bacteria are important as nutrients matter into suitable food.[11] Our study indicates for Ae. aegypti,[11] it is reasonable that microbes that at least 9 species of bacteria were isolated and microbial metabolites influence site from the drain water; however, the species selection for egg laying.[12] Certain species of that commonly attract Ae. aegypti to oviposit bacteria have been shown to influence their eggs have not been studied. The survival oviposition behaviour. Trexler et al.[13] found rates of offspring might be increased if an that water containing Psychrobacter immobilis ovipositing female has the ability to discriminate (from larval-rearing water), Sphingobacterium among habitats based on bacterial quantity and multivorum (from soil-contaminated cotton species composition. Thus, further studies are towels) and an undetermined Bacillus species required to explain this phenomenon. (from oak leaf infusion) elicited significantly higher oviposition than control water without Vythilingam et al.[17] also reported that Ae. bacteria. Benzon and Apperson[14] reported that aegypti in the field is able to lay eggs in outdoor two dominant species of bacteria, Acinetobacter drain water. Hence, dengue vector control calcoaceticus and Enterobacter cloacae, were measures should now target the concrete drain identified in holding water, which contributed system as well, being a potential source of Aedes to the oviposition response of gravid Ae. breeding. In this study, we did attempt to detect aegypti. Hazard et al.[15] also reported isolating the presence of Aedes breeding in the drains bacterial species from an infusion of alfalfa hay under field conditions but it was not possible that produced chemical stimulants of because most portion of the drainage system oviposition in Ae. aegypti and Culex was covered with concrete slabs. In Singapore, quinquefasciatus. preventive dengue control measures include larviciding of drains in the residential sites, as Ikeshoji et al.[16] isolated Pseudomonas Ae. aegypti and Ae. albopictus have been aeruginosa and found that it produced an consistently found breeding in the drains (Rama oviposition stimulant or attractant for Ae. aegypti Chandramogan, SWRO–NEA, per. comm.). and Cx. pipens molestus Forskal in vitro from decanoic acid. Two bacteria of the family Pseudomonadaceae were isolated in this study, Acknowledgments i.e. Pseudomonas gladialli and Pseudomonas alcaligenes. In studies by Ikeshoji et al.,[16] it The authors wish to thank the Director of the was shown that Ae. aegypti preferred water Institute for Medical Research, Kuala Lumpur, which had this family of bacteria. for permission to publish this paper.
Dengue Bulletin – Volume 31, 2007 129 Comparative oviposition preferences of Aedes (Stegomyia) aegypti (L.) to water from storm water drains and seasoned tap water
References
[1] Malavige GN, Fernando S, Fernando DJ, [10] Paradise CJ, Dunson WA. Effects of sodium Seneviratne SL. Dengue viral infections. concentration on Aedes triseriatus (Diptera: Postgrad Med J 2004. Oct; 80(948): 588-601. Culicidae) and microorganisms in treeholes. J Med Entomol. 1998 Sep; 35(5): 839-44. [2] Skae FMT. Dengue fever in Penang. Brit Med J. 1902; 2: 1581-1582. [11] Rozeboom LE. The relation of bacteria and bacterial filtrates to the development of [3] Lam SK. Two decades of dengue in Malaysia. mosquito larvae. Amer J Hyg. 1935; 21: 167- Tropical Biomedicine. 1993; 10: 195-200. 179. [4] Ishak H, Miyagi I, Toma T, Kamimura K. [12] Reiter P. [Oviposition and dispersion of Aedes Breeding habitats of Aedes aegypti (L) and aegypti in an urban environment]. Bull Soc Aedes. albopictus (Skuse) in villages of Barru, Pathol Exot. 1996; 89(2): 120-2. French. South Sulawesi, Indonesia. Southeast Asian J Trop Med Public Health. 1997 Dec; 28(4): 844- [13] Trexler JD, Apperson CS, Zurek L, Gemeno C, 50. Schal C, Kaufman M, Walker E, Watson DW, Wallace L. Role of bacteria in mediating the [5] Hawley WA. The biology of Aedes albopictus. oviposition responses of Aedes albopictus J Am Mosq Control Assoc. Suppl 1988 Dec; 1: (Diptera: Culicidae). J Med Entomol. 2003 1-39. Nov; 40(6): 841-8. [6] Bentley MD, Day JF. Chemical ecology and [14] Benzon GL, Apperson CS. Reexamination of behavioral aspects of mosquito oviposition. chemically mediated oviposition behavior in Annu Rev Entomol. 1989; 34: 401-21. Aedes aegypti (L.) (Diptera: Culicidae). J Med [7] Chen CD, Seleena B, Nazni WA, Lee HL, Masri Entomol. 1988 May; 25(3): 158-64. SM, Chiang YF, Sofian-Azirun M. Dengue [15] Hazard EI, Mayer MS, Savage KE. Attraction vectors surveillance in endemic areas in Kuala and oviposition stimulation of gravid female Lumpur City Centre and Selangor State, mosquitoes by bacteria isolated from hay Malaysia. Dengue Bulletin. 2006; 30: 197- infusions. Mosquito News. 1967; 27: 133- 203. 136. [8] Lee HL. Aedes ovitrap and larval survey in [16] Ikeshoji T, Saito K, Yano A. Bacterial production several suburban communities in Selangor, of the ovipositional attractants for mosquitoes Malaysia. Mosquito Borne Diseases Bulletin. on fatty acid substrates. Appl Entomol Zool. 1992; 9(1): 9-15. 1975; 10: 302-308. [9] Kramer WL, Mulla MS. Oviposition attractants [17] Vythilingam I, Novi S, Seleena P. Oviposition and repellents of mosquitoes: oviposition response of Aedes aegypti and Aedes responses of Culex mosquitoes to organic albopictus in different types of water. Tropical infusions. Environ Entomo.l 1979; 8: 1111- Biomedicine. 1999; 16: 23-28. 1117.
130 Dengue Bulletin – Volume 31, 2007 Evaluation of a grass infusion-baited autocidal ovitrap for the monitoring of Aedes aegypti (L.)
Choon Siang Tanga , Sai Gek Lam-Phuab, Youne Kow Chunga and Andrew D. Gigerc
aEnvironmental Health Department, National Environment Agency, Environment Building, 40 Scotts Road, #21-00, Singapore 228231 bEnvironmental Health Institute, National Environment Agency, Environment Building, 40 Scotts Road, #21-00, Singapore 228231 cSingapore Science Centre, Singapore
Abstract
Autocidal ovitraps used for the monitoring of Aedes (Stegomyia) aegypti (L.) (Diptera: Culicidae) in Singapore are routinely stocked with cow-grass (Axonopus commpressus) infusion. The optimum concentration of this infusion was determined to be a 1:4 dilution of a stock infusion prepared by fermenting dried cow-grass in tap water at a rate of 10g/l. Aedes aegypti females confined in an empty room and offered an ovitrap baited with cow-grass in competition with a range of common oviposition sites (plastic bottle, paper cup, plastic pail, flower pot plate, Coca-Cola can, and vase) laid significantly more eggs in the ovitrap than in the next most competitive container. The number of eggs laid in the ovitrap did not change with the competitiveness of the other sites offered, nor with the number of other sites, but it did change – albeit non-linearly – with the number of mosquitoes released. Implications for the interpretation of quantitative ovitrap data for the monitoring of mosquito populations are discussed.
Keywords: Aedes aegypti; Autocidal ovitrap; Mosquito surveillance; Hay infusion; Oviposition site.
Introduction current dengue control efforts are focused on reducing the population of Ae. aegypti. Aedes aegypti (L.) is a container-inhabiting mosquito that is commonly found in urban Many control methods have been areas. It is the primary vector of the dengue developed for Ae. aegypti, including adulticiding virus which infects hundreds of thousands of and larviciding with insecticides and/or people every year, causing dengue fever (DF) breeding-source reduction. These interventions and the potentially fatal, dengue haemorrhagic are adequately supported by health education fever (DHF). No effective drug or vaccine and legislation. The commonly employed against dengue has been developed despite methods for the surveillance of Ae. aegypti several decades of research. Hence, past and include the inspection of premises for larvae and pupae and the use of ovitraps. Most
E-mail: [email protected]; Tel: 65-67319314; Fax: 65-67319749
Dengue Bulletin – Volume 31, 2007 131 Autocidal ovitrap for monitoring Ae. aegypti operational surveillance systems depend on Ovitraps are now commonly used as a such surveys to gather their house (premise) surveillance or monitoring tool in the field. (the percentage of houses infested with larvae Lee[9] and Rawlins et al.[10] found that Ae. aegypti or pupae), Breteau (the number of positive surveillance using ovitraps is more sensitive containers per 100 houses) and larval-density than visual inspection for larvae. In the case of indices.[1] However, Focks and Chadee[2] found Ae. albopictus, studies by Ang et al.[11] and Yap no correlation between these traditional indices et al.[12] indicated that the ovitraps they used and the measured absolute densities of Ae. attracted more ovipositioning females of that aegypti and stated that the Stegomyia indices species than natural and other artificial used as epidemiological indicators of dengue containers. transmission should be viewed with caution. They also concluded that pupal survey could In situations where the vector populations provide an indication or estimation of the vector have been reduced to such low levels that larval density. Direct sampling of the adult population searches are largely unproductive, ovitraps may requires very labour-intensive manual catching be a useful indicator of the Aedes population. because the diurnal and essentially domestic However, a distinction has to be made adult Ae. aegypti do not respond well to light between using ovitraps to detect the presence traps, even if the traps are supplemented with of a species in a given area, and using dry ice.[3] A more detailed review of Stegomyia quantitative ovitrap data as an indicator of the sampling methods was being carried out by size of a mosquito population. The latter may Focks (2003),[4] and it is not necessary for this only be feasible under certain conditions, since paper to re-visit it. ovitrap catches are likely to be affected by factors other than the number of female Ovitraps had been used to provide useful mosquitoes, such as availability of alternative data for Aedes control operation and had been breeding sites, predation on the eggs, the reported to be more sensitive than the physical surroundings of the ovitrap, etc. In the traditional Stegomyia indices in detecting low Philippines, Schultz[13] found that ovitrap mosquito populations.[5] Ovitraps are devices catches did not reflect population changes. designed to attract female mosquitoes to lay Studies conducted in Singapore showed that eggs which can then be counted and identified. simultaneous adulticiding and source reduction The original ovitrap, developed in the United resulted in no change in ovitrap catches (Giger, States for the surveillance of Ae. aegypti, is a unpublished data). This may suggest that any dark-coloured, water-filled container effect of a reduction in the mosquito population supplemented with a wooden paddle or velour was cancelled out by the effect of a reduction paper strip as oviposition substrate.[6] This in the number of alternative breeding sites. design was first used in Singapore in 1969 as a Alternatively, the house index in Singapore is supplementary measure for the control of Ae. as low as less than 1% and this may also have aegypti in the Paya Lebar International Airport, an effect on ovitrap catches. Singapore.[7] Subsequently, the design was modified by adding a floating plastic ring with The ability of gravid mosquito females to fine wire mesh to prevent the escape of distinguish among potential oviposition sites emerged adults. Chan et al.[8] demonstrated that will or will not support the growth, that the resulting autocidal ovitrap was superior development and survival of their progeny is to common domestic containers in attracting critical because a wrong choice may result in Ae. aegypti to oviposit. the death of many larvae and affect the
132 Dengue Bulletin – Volume 31, 2007 Autocidal ovitrap for monitoring Ae. aegypti propagation of the species. Gravid females of The study presented here consisted of many species show a high degree of three experiments, aiming to determine the preference in selecting specific oviposition concentration of cow-grass infusion that works sites.[14,15] Aedes aegypti uses both physical and best in the field (“Optimum concentration of chemical cues in its oviposition site selection.[16] infusion”); evaluate the competitiveness of the These cues include the colour of the container, autocidal ovitrap baited with cow-grass infusion the texture of the oviposition substrate, and against various artificial containers commonly the water quality. Over the years, various associated with Ae. aegypti breeding (“Ovitrap aspects of the ovitrap have been improved, competitiveness”); and ascertain the effects of such as the structure of the oviposition substrate mosquito population size and availability of and the ovitrap as a whole, the water used, alternative breeding sites on the ovitrap catch etc. Different types of organic materials – (“Effects on ovitrap catch”). leaves, grass, sod, etc. – have been fermented to create infusions attractive to gravid Ae. aegypti.[17,18,19,20] Recent reports have shown Materials and methods that hay infusions were more attractive to ovipositioning Ae. aegypti females than clean Mosquito colony origin and water.[10,18] maintenance
[19] However, Chadee et al. indicated that Aedes aegypti larvae were collected in there were no significant preferences by gravid Singapore between January and August 2002 Ae. aegypti mosquitoes to lay eggs in tap water and reared to adults. Their offspring were or various concentrations of hay infusion. They reared in plastic trays (25 cm × 31 cm × 6 suggested that this could be due to the cm) with aged tap water, limiting the number variability in oviposition response in mosquitoes of larvae to 800 per tray to avoid overcrowding. from different areas or variability in the type of The colonies were maintained at 28 ± 1 °C, hay used and differences in the methodology 79 ± 3% RH, and a photoperiod of of preparation. Organic infusions are easy to approximately 9:15 hours (L:D). First instar make but different mosquito species will need larvae were initially fed with instant yeast (Bake different optimal infusions. The mass of the King, Singapore). Subsequent instars were fed organic material and the fermentation time will with dog chow (Glen Forrest Stockfeeders, determine the properties of the infusion. Western Australia). The adults were kept in Plexiglas cages (30 cm × 30 cm × 30 cm) In Singapore, ovitraps are routinely baited fitted with cotton cloth on two sides and were with cow-grass infusion that has been shown continuously provided with a 10% sucrose in the laboratory to be more attractive to female solution. The F1 and F2 generations were used Aedes mosquitoes than clean water (Lam-Phua, in the experiments. The females were blood- unpublished data). Cow-grass (Axonopus fed on guinea pigs 3–5 days after emergence compressus) is growing throughout the country and used for the experiments two days later. in great abundance. It is cut on a monthly basis This timing ensured that the oviposition peak and usually disposed of as waste, making it four days after the blood meal[21] fell within easily available for this alternative use. the one-week duration of each replicate.
Dengue Bulletin – Volume 31, 2007 133 Autocidal ovitrap for monitoring Ae. aegypti
Preparation of infusion different concentrations (0%, 25%, 50% and 100%) and randomly assigned to the four Fresh cow-grass was collected by a contractor, corners of a room. Ten gravid females were cleaned of foreign matter, dried under the sun then released into the room and left and packed in zip-loc bags until further use. undisturbed for 7 days. At the end of that Following a modification of the method of period, larvae found in the ovitraps were Reiter et al.,[18] stock infusions were prepared counted and discarded, while the oviposition by fermenting dried cow-grass in tap water at paddles were packed in individual plastic bags a rate of 10 g/l. Grass and tap water were and brought back to the laboratory for contained in a 50-litre plastic trough and were examination. Eggs laid on the paddles were fermented for one week at a temperature of counted under a stereomicroscope, excluding 28 ± 1 °C. The infusion was then strained empty egg shells. The total number of larvae through a screen to remove the cow-grass, and and unhatched eggs were tabulated for each kept in plastic canisters at 28 ± 1 °C for not ovitrap. Data analysis was carried out on the more than 8 weeks. total number of the eggs laid during the 7-day period, i.e. the number of larvae plus eggs laid on the paddles. The differences between data Study site points were tested for significance using ANOVA (SPSS Ver 15.0). All experiments were carried out in 16 empty rooms (3.5 m × 3.0 m, 2.5 m high; concrete Figure 1: Autocidal ovitrap. The two walls, floor and ceiling) in the same block of wooden paddles allow mosquitoes to lay flats. All windows and openings were sealed eggs and the float plastic ring with fine with fine netting to prevent the mosquitoes wire mesh helps to prevent the escape of from escaping while providing sufficient emerged adult mosquitoes ventilation within the rooms. Throughout the study, the relative humidity and temperature inside the rooms was 78 ± 11% RH and 30 ± Wire mesh Cardboard 1°C. paddle Overflow hole Experiment 1: Optimum concentration of infusion
The stock cow-grass infusion was diluted with week-old aged tap water to obtain a range of Larva concentrations. For each of the 48 replicates, Pupa four autocidal ovitraps[8] (height 155 mm, internal diameter 103 mm) with two hardboard Adult oviposition paddles each (82 mm × 32 mm × 4 mm) and a floating plastic ring with fine wire mesh to prevent the escape of emerged adults were used (Figure 1). Each ovitrap was filled with 700 ml of cow-grass infusion at four
134 Dengue Bulletin – Volume 31, 2007 Autocidal ovitrap for monitoring Ae. aegypti
Experiment 2: Ovitrap of these situations either 1, 3 or 9 gravid competitiveness mosquitoes were released and left undisturbed for 7 days. Thus, there were nine different Autocidal ovitraps baited with the optimum designs, each of which was replicated four infusion determined in experiment 1 were times. Data collection and analysis were carried tested against six different artificial containers out as in Experiments 1 and 2. that are commonly found in households and are known to attract oviposition by Ae aegypti in the field. These containers were: plastic Results bottle (height 204 mm, base diameter 60 mm, transparent); paper cup (height 115 mm, Experiment 1: Optimum opening diameter 80 mm, white with green concentration of infusion pattern); plastic pail (3 litres, blue); flower pot plate (plastic, diameter 130 mm) under a potted In order to determine the optimum money plant (Scindapsus aureus); aluminium concentration of cow-grass infusion, two rounds Coca-Cola drink can (height 80 mm, diameter of replicates were conducted. In the first round, 58 mm, red and silver); vase (height 200 mm, the four concentrations offered were 0% (i.e. opening diameter 65 mm, pink) with two lucky aged tap water only), 25%, 50% and 100% of bamboo plants (Dracaena sp.). All the artificial the stock infusion. In this round, significantly containers were filled with week-old aged tap more eggs were laid in the ovitraps with 25% water to simulate field conditions. infusion than in ovitraps containing any other concentration (p<0.01; Figure 2). There was For each of the 48 replicates, three no significant difference in the amount of eggs different artificial containers and one ovitrap laid in the ovitraps with 0%, 50% and 100% were randomly assigned to the four corners of infusion. In the second round of replicates, the a vacant room. The selection of containers for range of concentrations was narrowed down each replicate was random, with the condition to 0–45%. Here the numbers of eggs laid in that each container was included 24 times. Ten 15%, 30% and 45%, respectively, were not gravid females were then released into the significantly different, but all three of these room for 7 days, after which any larvae in the concentrations received significantly more eggs containers and ovitraps were counted, and the containers and oviposition paddles were brought Figure 2: Mean number of eggs laid in back to the laboratory and thoroughly ovitraps containing different examined for eggs. The total number of larvae concentrations of cow-grass infusion and unhatched eggs were tabulated for each (Error bars: standard error) container and ovitrap. Data analysis was carried out as in Experiment 1. st 300 1 round s laid 250 nd
gg 2 round 200 Experiment 3: Effects on 150 ovitrap catch 100
ean number of e 50 In this experiment, one ovitrap was placed in M 0 0 102030405060708090100 a vacant room together with either 1, 3 or 9 Infusion Concentration [%] pails as alternative breeding sites, and in each
Dengue Bulletin – Volume 31, 2007 135 Autocidal ovitrap for monitoring Ae. aegypti than 0% (p<0.01). Hence, concentrations To determine the effect of the presence or between 15% and 45% can be regarded as absence of the most competitive alternative optimum concentrations. For practical reasons breeding site (the pail) on the absolute egg count (ease of dilution of stock infusion by vector in the ovitrap and the total egg count in each control officers in the field) the concentration replicate, the replicates with a pail present were of 20% stock infusion was selected for the compared with the replicates without a pail. The standard infusion to be used in the remaining presence of a pail did not have any significant experiments and subsequent application in the effect on the absolute number of eggs laid in field. the ovitrap (mean absolute egg count ± standard error: with pail 538.5 ± 37.4; without pail 506.8 ± 32.3; p>0.05), but the average total egg Experiment 2: Ovitrap count in each replicate was significantly higher competitiveness with the pail present (with pail 764.1 ± 32.9; without pail 595.5 ± 29.4; p<0.01). The second experiment aimed to determine how well the autocidal ovitrap with cow-grass infusion competes with other types of potential Experiment 3: Effects on breeding sites commonly found in the field. ovitrap catch Pitted against three different containers at a time, the ovitrap attracted an average of 77.1% The third experiment was designed to of the eggs laid in each replicate (Figure 3), determine the respective effects of the which is significantly more than any other mosquito population size and the number of container (p<0.01). Among the remaining alternative breeding sites on the number of containers, the pail attracted significantly more eggs collected from ovitraps. The most eggs than any one of the others (p<0.01). competitive container in experiment 2 (the There were no significant differences in the pail) was used as an alternative breeding site. egg count among the other containers. Figure 4: Mean number of eggs laid in the Figure 3: Mean percentage of eggs laid in ovitrap and alternative oviposition sites as the ovitrap (n = 48) and the six alternative a function of the number of alternative containers (n = 24) in each of 48 sites and the number of mosquitoes replicates offering one ovitrap and released. n = 4 for each column three different alternatives.
(Error bars: standard error) 700
Ovitrap 600 100 All alternative breeding sites
500 s laid
gg s laid 80
gg a, b: p<0.01 400 c, d, e: p<0.05 60 eofe 300
g
a
t 40 200
ean number of e
M 20 100
ean percen
M 0 9 0 9 3 3 Ovitrap Pail Vase Plate Can Cup Bottle Number of 1 1 Number of 77.1 19.8 8.9 5.7 5.6 4.9 1.0 alt. breeding sites Mosquitoes
136 Dengue Bulletin – Volume 31, 2007 Autocidal ovitrap for monitoring Ae. aegypti
The number of alternative breeding sites previously been tested for Ae. albopictus with had no significant effect on the number of eggs all containers in close proximity.[7] In Experiment laid in the ovitrap, but the number of 2 we attempted to evaluate that mosquitoes did (Figure 4, significantly different competitiveness for Ae. aegypti and in a setting values are marked with a, b: p<0.01; c, d, e: more representative of the situation in the field, p<0.05). However, the ovitrap catch did not where ovitraps are not placed immediately next increase linearly with the number of to competing breeding sites. However, due to mosquitoes released into the room; with nine operational constraints, our experiments had mosquitoes, the number of eggs in the ovitraps to be conducted within the confines of single was, on average, less than twice that with rooms, which is still very different from the three mosquitoes. field situation, where the closest water-bearing container may be far away from the ovitrap and may be in a different room of a building or Discussion otherwise physically separated. Furthermore, the mosquitoes in our experiments were As a product of fermentation, grass infusion confined for one week in the vicinity of the may vary greatly in its attractive properties, same four breeding sites, which is unlikely to depending on the quality and relative amounts be the case in the field. Nevertheless, both of grass and water used, duration of experiments 2 and 3 demonstrate that, in a fermentation, ambient temperature during setting which provides the mosquitoes with fermentation, subsequent dilution and possibly ample opportunity to investigate all available other factors. However, if grass infusion is to oviposition sites, the ovitrap was much more be used in ovitraps for the purpose of competitive than any of the other containers quantitative monitoring of mosquito tested. This high acceptability of the ovitrap populations, its properties should ideally be with grass infusion to ovipositing females – constant and reproducible in order to allow even in the presence of other potential comparisons over time and between ovitraps. breeding sites – means that the ovitrap is well In an attempt to standardize our cow-grass suited for the application as a monitoring tool infusion as much as possible, we used dried in the field. grass and controlled the ratio of grass to water, ambient temperature and duration of Even a very competitive ovitrap might be fermentation to prepare a stock infusion. expected to receive fewer eggs in the presence Experiment 1, carried out to determine the of alternative oviposition sites. However, the optimum dilution of the stock infusion, results of experiment 2 reveal that the presence demonstrated that ovipositing females of a pail (the most competitive alternative preferred infusions prepared from 15–45% container) did not decrease the absolute stock infusion. Taking pragmatic considerations number of eggs laid in the ovitrap but, rather, into account, the optimum concentration for increased the total number of eggs laid. the subsequent experiments as well as the Similarly, in experiment 3, the number of application in operational monitoring was thus alternative breeding sites had no bearing on defined as a 1:4 dilution (to obtain a the ovitrap catch. These findings may be concentration of 20%) of the stock infusion. explained by the fact that all available oviposition sites were offered within one room The competitiveness of the autocidal and the mosquitoes were confined to that ovitrap against a range of other containers had room. Ae. aegypti females are known to
Dengue Bulletin – Volume 31, 2007 137 Autocidal ovitrap for monitoring Ae. aegypti distribute their eggs among a number of where more eggs were laid, in total, with two oviposition sites (“skip oviposition”).[22,23] In the attractive containers available (ovitrap and pail) field, mosquitoes would encounter different than with only one (ovitrap), suggests that there oviposition sites sequentially, and the quality is a limit to the number of eggs an ovitrap can of an alternative breeding site encountered accommodate. The nature of such a restriction before an ovitrap may well affect the to oviposition remains unclear, but this finding mosquito’s subsequent exploration and, thus, agrees well with studies that demonstrated that its chances of finding the ovitrap in the first female Ae. aegypti lay fewer eggs in containers place. On the other hand, after laying a clutch with higher existing egg density.[24,25] of eggs in an ovitrap in the field, the mosquito may well move out of the vicinity of the ovitrap This study has established that the and not return, a behaviour which would have autocidal ovitrap baited with a standardized been prevented in our experiment, leading to cow-grass infusion is highly competitive against repeated oviposition in the ovitrap. These oviposition sites commonly encountered in the speculative arguments require further field. Consequently, this ovitrap is well suited investigation, but they illustrate that the results for Aedes surveillance in Singapore as far as of the experiments reported here do not rule the choice of container and infusion is out that the catches of ovitraps set in the field concerned. The present knowledge is are affected by the number of alternative insufficient, however, to conclude whether oviposition sites in the area. quantitative data collected with these ovitraps would be able to provide a measure of the In Experiment 3, the number of eggs laid mosquito population in the field. To determine in the ovitrap increased with the number of that, more research is required into the the mosquitoes present. This increase, however, competitiveness of the ovitrap under true field was non-linear, with fewer eggs laid per conditions, as well as the nature of the apparent mosquito when more mosquitoes were present. limit to the capacity of the ovitrap. While the total number of eggs laid in each replicate increased more or less linearly with the number of mosquitoes, the ovitrap Acknowledgment collected a decreasing share of these eggs. In other words, each mosquito, on average, laid We would like to thank Mr Khoo Seow Poh, fewer eggs in the ovitrap (the most attractive Director-General for Public Health, for his container) when there were more mosquitoes permission to publish this paper. Our greatest competing for the same oviposition sites. This thank go to our lab attendant, Mr Semawi Bin finding, as well as the result of experiment 2 Syed, for all the hard work done by him.
References
[1] Chan YC, Ho BC, Chan KL. Aedes aegypti (L.) [2] Focks DA, Chadee DD. Pupal survey: an and Aedes albopictus (Skuse) in Singapore City. epidemiologically significant surveillance 5. Observations in relation to dengue method for Aedes aegypti: an example using haemorrhagic fever. Bull World Health Organ. data from Trinidad. Am J Trop Med Hyg. 1997 1971; 44(5): 651-7. Feb; 56(2): 159-67.
138 Dengue Bulletin – Volume 31, 2007 Autocidal ovitrap for monitoring Ae. aegypti
[3] Chan KL. Methods and indices used in the [13] Schultz GW. Seasonal abundance of dengue surveillance of dengue vectors. Mosquito-Borne vectors in Manila, Republic of the Philippines. Disease Bulletin. 1985; 1: 79-88. Southeast Asian J Trop Med Public Health. 1993 Jun; 24(2): 369-75. [4] Focks DA. A review of entomological sampling methods and indicators for dengue vectors. [14] Zahiri N, Rau ME. Oviposition attraction and Geneva: World Health Organization, 2003. repellency of Aedes aegypti (Diptera: Document TDR/IDE/Den/03.1. Culicidae) to waters from conspecific larvae subjected to crowding, confinement, [5] Micks DW, Moon WB. Aedes aegypti in a starvation, or infection. J Med Entomol. 1998 Texas coastal county as an index of dengue Sep; 35(5): 782-7. fever receptivity and control. Am J Trop Med Hyg. 1980 Nov; 29(6): 1382-8. [15] Roberts D. Overcrowding of Culex sitiens (Diptera: Culicidae) larvae: population [6] Schliessmann DJ. Aedes aegypti eradication regulation by chemical factors or mechanical program of the United States–progress report interference. J Med Entomol. 1998 Sep; 35(5): 1965. Am J Public Health Nations Health. 1967 665-9. Mar; 57(3): 460-5. [16] Bentley MD, Day JF. Chemical ecology and [7] Chan KL. The eradication of Aedes aegypti at behavioral aspects of mosquito oviposition. the Singapore Paya Lebar International Airport. Annu Rev Entomol. 1989; 34: 401-21. In: Chan YC, Chan KL, Ho BC, editors. Vector Control in Southeast Asia. Singapore, 1973. p. [17] Holck AR, Meek CL, Holck JC. Attractant 85-88. enhanced ovitraps for the surveillance of container breeding mosquitoes. J Am Mosq [8] Lok CK, Kiat NS, Koh TK. An autocidal ovitrap Control Assoc. 1988 Mar; 4(1): 97-8. for the control and possible eradication of Aedes aegypti. Southeast Asian J Trop Med [18] Reiter P, Amador MA, Colon N. Enhancement Public Health. 1977 Mar; 8(1): 56-62. of the CDC ovitrap with hay infusions for daily monitoring of Aedes aegypti populations. J Am [9] Lee HL. Aedes ovitrap and larval survey in Mosq Control Assoc. 1991 Mar; 7(1): 52-5. several suburban communities in Selangor, Malaysia. Mosquito-Borne Disease Bulletin. [19] Chadee DD, Lakhan A, Ramdath WR, Persad 1992; 9(1): 9-15. RC. Oviposition response of Aedes aegypti mosquitoes to different concentrations of hay [10] Rawlins SC, Martinez R, Wiltshire S, Legall G. infusion in Trinidad, West Indies. J Am Mosq A comparison of surveillance systems for the Control Assoc. 1993 Sep; 9(3): 346-8. dengue vector Aedes aegypti in Port of Spain, Trinidad. J Am Mosq Control Assoc. 1998 Jun; [20] Allan SA, Kline JD. Evaluation of organic 14(2): 131-6. infusions and synthetic compounds mediating oviposition in Aedes albopictus and Aedes [11] Ang WK, Chan KL, Lee, K.M. Field evaluation aegypti (Diptera: Culicidae). J Chemical Ecol. of the attractiveness of an ovitrap to Aedes 1995; 21: 1847-1860. albopictus (diptera, culicidae). Proceedings, Science Research Congress, Singapore; 1995. [21] Trexler JD, Apperson CS, Schal C. Diel oviposition patterns of Aedes albopictus (Skuse) [12] Yap HH, Lee CY, Chong NL, Foo AE, Lim MP. and Aedes triseriatus (Say) in the laboratory Oviposition site preference of Aedes albopictus and the field. J Vector Eco.l 1997 Jun;22(1):64- in the laboratory. J Am Mosq Control Assoc. 70. 1995 Mar; 11(1): 128-32.
Dengue Bulletin – Volume 31, 2007 139 Autocidal ovitrap for monitoring Ae. aegypti
[22] Gillett JD. Contributions to the oviposition- [24] Apostol BL, Black WC 4th, Reiter P, Miller BR. cycle by the individual mosquitoes in a Use of randomly amplified polymorphic DNA population. Journal of Insect Physiology. 1962; amplified by polymerase chain reaction 8: 665-681. markers to estimate the number of Aedes aegypti families at oviposition sites in San Juan, [23] Reiter P, Amador MA, Anderson RA, Clark GG. Puerto Rico. Am J Trop Med Hyg. 1994 Jul; Short report: dispersal of Aedes aegypti in an 51(1): 89-97. urban area after blood feeding as demonstrated by rubidium-marked eggs. Am [25] Chadee DD, Corbet PS and Greenwood JJD. J Trop Med Hyg. 1995 Feb; 52(2): 177-9. Egg-laying yellow fever mosquitoes avoid sites containing eggs laid by themselves or conspecifics. Entomologia Experimentalis et Applicata. 1990; 57:295-298.
140 Dengue Bulletin – Volume 31, 2007 Development sites of Aedes aegypti and Ae. albopictus in Nakhon Si Thammarat, Thailand
S. Wongkoon, M. Jaroensutasinee , K. Jaroensutasinee and W. Preechaporn
Computational Science Graduate Programme, School of Science, Walailak University, Thasala, Nakhon Si Thammarat 80161, Thailand
Abstract
This study investigated how the seasons affect the development sites of Aedes larvae in three topographical areas: mangrove, rice paddy fields and mountainous areas. We examined how the number of Aedes larvae varied in different types of water containers. Water containers were categorized into the following groups: indoor/outdoor containers, artificial/natural containers, earthen/plastic containers, containers with/without lids and dark/light-coloured containers. Samples were collected from 300 households in both the wet and dry seasons from three topographical areas in Nakhon Si Thammarat province with 100 households per topographical area. The results showed that in the wet season, there were higher numbers of Ae. aegypti and Ae. albopictus larvae than in the dry season. Moreover, the number of Ae. albopictus larvae was higher in mountainous areas than in mangrove and rice paddy areas, in both the wet and dry seasons. The number of positive containers was higher in outdoor containers than in indoor containers, higher in artificial containers than natural containers, higher in earthen containers than plastic containers, higher in containers without lids than containers with lids, and higher in the dark-coloured containers than light-coloured containers in the three topographical areas in both wet and dry seasons. The number of positive earthen containers was higher in mangrove areas than in rice paddy and mountainous areas. The number of positive plastic containers was higher in rice paddy areas than mountainous and mangrove areas.
Keywords: Aedes larvae; Season; Topography; Larval development site.
Introduction dengue fever; therefore, prevention and control of the disease depend on vector surveillance [5] Dengue fever is caused by dengue viruses of and control measures. Transmission cycles of the family Flaviviridae, transmitted principally the dengue virus depend on the by Aedes aegypti, and, possibly Ae. albopictus, interrelationship between the virus and its in the tropical and subtropical regions of the mosquito vector, which is influenced by [6] world.[1,2] Two clinical features, namely, dengue environmental conditions. Adult female Aedes haemorrhagic fever (DHF) and dengue shock mosquitoes acquire the dengue virus by biting syndrome (DSS) may lead to death.[3,4] No infected humans during the viremic phase, effective vaccine or chemotherapy is currently which usually lasts for 4–5 days, although it available for the prevention or treatment of may last up to 12 days. The virus is transmitted
E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 141 Development sites of Ae. aegypti and Ae. albopictus in Thailand to other persons via bites from infected cisterns, Ae. aegypti is a more important threat mosquitoes.[7] The mosquitoes that adversely for DHF.[20] Ae. albopictus is encountered in affect people in southern Thailand are primarily the peripheral areas of towns where it replaces Ae. aegypti L. and Ae. albopictus Skuse.[8-12] Ae. aegypti populations.[21]
An epidemic of DHF occurred in the Samui This study investigated the number of Islands in 1966 and 1967[13] where Ae. aegypti mosquito larvae (i.e. Ae. aegypti and Ae. and Ae. albopictus were abundant, and were albopictus) in different types of containers (i.e. responsible for the transmission of the dengue indoor/outdoor containers, artificial/natural virus.[14-16] Ae. aegypti breeds in a wide containers, earthen/plastic containers, assortment of domestic containers, whereas containers with/without lids and dark/light Ae. albopictus is more likely to be found in coloured containers) in the wet and dry seasons natural containers, such as bamboo stumps and in three topographical areas in Nakhon Si coconut shells, or in artificial containers outside Thammarat, Thailand. the houses such as tyres, opened cans and plastic bottles.[12,17-19] In southern Thailand, Ae. aegypti and Ae. albopictus have been found in Materials and methods forested habitats as well as in a variety of other habitats in rural and suburban areas.[11-12,18-19] Data collection
Since most Thai households store water The mosquito larval survey was conducted in for cooking and bathing in a variety of jars and Nakhon Si Thammarat province (8° 32' 16.5"
Figure 1: (a) Map of Thailand; (b) Map of three topographical areas of study
(a)Thailand (b) Nakhon Si Thammarat
1234
1234 1234 1234
1234 1234 1234 1234 Mangrove,1234 Rice paddy and1234 Mountainous areas
142 Dengue Bulletin – Volume 31, 2007 Development sites of Ae. aegypti and Ae. albopictus in Thailand
N latitude, 99° 56' 50.7" E longitude) in two net in the water, starting at the top of the seasons: (i) dry season (March-April 2006) and container and continuing to the bottom in a (ii) wet season (October-November 2006). We swirling motion that sampled all edges of the conducted the mosquito larval survey in three container[12,18-19,22]. All live mosquito larvae were topographical areas: mangrove, rice paddy and collected in plastic bags, taken to the 11.2 mountainous areas (Figure 1). People in these Vector-Borne Disease Control Centre three topographical areas differed in terms of laboratory, Nakhon Si Thammarat. All mosquito their main occupations. In the mangrove areas, larvae were preserved and identified up to the the main occupations of the people are fishing species level using Rattanarithikul and and aquaculture, while in the rice paddy and Panthusiri’s[23] keys. In this study, the first and mountainous areas, the main occupations are second instars and pupae were discarded mostly agriculture and farm-related. because immature mosquitoes at these stages could not be identified. Samples were collected in households in all sub-districts in the nine districts comprising There were a total of 29 container the study area using the stratified simple categories in this study. Water containers were random sampling technique. Nine districts categorized into the following groups: indoor/ were divided into three categories: mangrove, outdoor containers, artificial/natural containers, rice paddy and mountainous areas. The earthen/plastic containers, containers with/ mangrove areas included Khanom, Sichon and without lids and dark/light-coloured containers. Pakpanang districts; the rice paddy areas Indoor containers were all containers inside the included Praprom, Chalermprakiet and Huasai house that held some water such as earthen districts; and the mountainous areas included jars, cement tanks, plastic containers, flower Thungyai, Bangkhan and Thungsong districts vases, ant guards, ornamental pots and (Figures 1a, 1b). One hundred sampling units refrigerators with plates. Outdoor containers were assigned to each topographical area. The were all containers within 15 m of the house, topographical areas were assigned as stratums, such as earthen jars, cement tanks, plastic one collected household identified as a sample containers, ornamental pots and natural unit. A structured questionnaire was constructed containers. Artificial containers included earthen to obtain the information by personal interview. jars, flower vases, used cans, discarded tyres, There were a total of 300 households sampled metal boxes, preserved areca jars and foam in the dry season. The same 300 households containers. The preserved areca jars were were re-sampled in the wet season in order to earthen jars used to preserve areca nuts. Natural compare the difference in the number of Aedes containers were composed of areca/coconut larvae in various water containers between the husks, banana trees, coconut shells, tree holes two seasons. and bamboo clumps. Earthen containers were composed of small/large earthen jars, cement tanks, plant pot saucers, plant pots and Entomological studies preserved areca jars. Plastic containers were composed of plastic containers, plastic bottles We collected all mosquito larvae from both and plastic buckets. Lids were made of cement, indoor and outdoor containers using fine- plastic, wood and metal. The dark-coloured meshed fishnets. The outdoor larval surveys containers were containers that were black, were conducted within 15 m of the brown, dark grey, deep green, deep blue and houses.[10,12,18-19] Very small water containers red. On the other hand, the light coloured were emptied out through the fishnet. Larger containers were containers that were white, light water containers were sampled by dipping the pink, light blue and yellow.
Dengue Bulletin – Volume 31, 2007 143 Development sites of Ae. aegypti and Ae. albopictus in Thailand
Aedes larval index: Container Index (CI) was larvae were found in 11 out of 29 types of worked out as per standard WHO guidelines. water containers (Figures 2a-f). From 11 out of The CI was defined as the percentage of water- 29 containers, Ae. aegypti larvae were found filled containers positive for Aedes breeding. in two types of indoor containers (i.e. cement tanks and ant guards) and nine types of outdoor containers (i.e. small jars, large jars, plastic Statistical analysis tanks, used cans, tyres, metal boxes, plant pots, animal pans and preserved areca jars) (Figures The number of Ae. aegypti and Ae. albopictus 2a-f). Ae. albopictus larvae were found in 10 larvae in different types of water containers, out of 29 types of water containers. All 10 out both indoor and outdoor, were analysed using of the 29 water container types where Ae. independent sample t–tests. Chi-square tests albopictus was found were outdoor containers were used to test the differences between the (i.e. small jars, large jars, cement tanks, plastic following factors: (i) indoor/outdoor containers; tanks, used cans, tyres, metal boxes, animal (ii) artificial/natural containers; (iii) earthen/ pans, preserved areca jars and coconut shells plastic containers; (iv) containers with lids and (Figures 2a-f). The number of Ae. albopictus without lids; and (v) dark/light-coloured larvae in metal boxes was higher than Ae. containers in all three topographical areas, two aegypti larvae in both mangrove and seasons and their interactional terms. All mountainous areas in the dry season (mangrove significant tests were two-tailed. area: t98 = –2.372, P<0.05; mountainous area:
t117 = –2.919, P<0.01, Figures 2b, f).
Results The number of Ae. aegypti larvae was higher in the wet season than in the dry season, Aedes larvae and container types this did not differ among the three topographical areas, and there was some Aedes larvae were found in 15 out of 29 types interaction between topographical areas and of water containers in all three topographical seasons (Table 1). The number of Ae. albopictus areas (Figures 2a-f). There were no Aedes larvae were higher in the wet season than in larvae found in two types of indoor containers the dry season, higher in mountainous areas in mountainous areas (Figures 2a-f). Ae. aegypti than in mangrove and rice paddy areas in both
Table 1: The number of Ae. aegypti and Ae. albopictus larvae in three topographical areas in the wet and dry seasons
144 Dengue Bulletin – Volume 31, 2007 Development sites of Ae. aegypti and Ae. albopictus in Thailand
Figure 2. Ae. aegypti ( ) and Ae. albopictus () larval occurrence in three topographical areas: (a)-(b) mangrove areas, (c)-(d) rice paddy areas, and (e)-(f) mountainous areas in the wet and dry season. Indoor containers: CTI = cement tanks, AG = ant guards. Outdoor containers: SJO = small jars, LJO = large jars, CTO = cement tanks, PTO = plastic tanks, UC = used cans, T = tyres, MB = metal boxes, PP = plant pots, AP = animal pans, PAJ = preserved areca jars, PC = plastic containers, AH = areca husks, CS = coconut shells.
(a) Mangrove area in wet season (d) Rice paddy area in dry season
8 8
larvae 6 6
Aedes
Aedes
4 4
2
The number of2 larvae
The number of
CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS Container types Container types
(b) Mangrove area in dry season (e) Mountainous area in wet season
8 8
larvae 6 6
Aedes
Aedes
4 4
2
2 The number of larvae
The number of
CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS Container types Container types
(c) Rice paddy area in wet season (f) Mountainous area in dry season
8 8
larvae
larvae 6 6
Aedes
Aedes
4 4
The number of 2 2
The number of
CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS CTI AG SJO LJO CTO PTO UC T MB PP AP PAJ PC AH CS Container types Container types
Dengue Bulletin – Volume 31, 2007 145 Development sites of Ae. aegypti and Ae. albopictus in Thailand the wet and dry seasons, and there was some topographical areas, and no interaction interaction between topographical areas and between indoor/outdoor containers and seasons (Table 1). topographical areas (Table 2).
Positive indoor and outdoor Positive artificial and natural containers containers
There were more outdoor containers that were There were more artificial containers that were positive than indoor containers, more positive positive than natural containers (Table 3). There containers in the dry season than in the wet were some differences between the number season, no interaction between indoor/outdoor of positive artificial and natural containers in containers and season, no differences in the wet and dry seasons (Table 3). There was indoor/outdoor containers among the three some interaction between artificial/natural
Table 2: Container Index (CI) and the number of positive indoor and outdoor containers in three topographical areas in the wet and dry seasons
Table 3: Container Index (CI) and the number of positive artificial and natural containers in three topographical areas in the wet and dry seasons
146 Dengue Bulletin – Volume 31, 2007 Development sites of Ae. aegypti and Ae. albopictus in Thailand containers and season (Table 3). There were There were more positive earthen containers no differences in artificial/natural containers in mangrove areas than in rice paddy and among the three topographical areas and no mountainous areas, more positive plastic interaction between artificial/natural containers containers in rice paddy areas than mountainous and topographical areas (Table 3). and mangrove areas (Table 4).
Positive earthen and plastic Positive containers with and containers without lids
There were more positive containers among There were more positive containers among earthen containers than plastic containers and containers without lids than containers with lids, no differences in earthen/plastic containers more positive containers with lids and without between the wet and dry seasons, (Table 4). lids in the dry season than the wet season. No
Table 4: Container Index (CI) and the number of positive earthen and plastic containers in three topographical areas in the wet and dry seasons
Table 5: Container Index (CI) and the number of positive containers with and without lid in three topographical areas in the wet and dry seasons
Dengue Bulletin – Volume 31, 2007 147 Development sites of Ae. aegypti and Ae. albopictus in Thailand
Table 6: Container Index (CI) and the number of positive dark- and light-coloured containers in three topographical areas in the wet and dry seasons
differences were observed in containers with/ regularly filled with water even during the dry without lids among three topographical areas season. With increasing housing development, (Table 5). good tap water systems, and effective solid- waste management that do not necessitate water-catching natural containers and solid- Positive dark- and light-coloured waste to accumulate on the premises, the containers breeding potential for Ae. albopictus may decline in the future. In highly urbanized areas There were more positive containers among in Thailand such as Bangkok, Ae. aegypti has dark-coloured containers than light-coloured replaced Ae. albopictus.[10,26] containers. There were no differences in dark/ light-coloured containers among three This study clearly demonstrates that the topographical areas (Table 6). number of Aedes larvae was higher in the wet season than in the dry season. Many studies have reported the same findings in many Discussion countries such as Thailand,[10,27] Fiji[28] and the U.S.[29] Long rainy seasons, with peculiar water- Aedes larvae and container types use patterns of the residents, create favourable conditions leading to a high number of Aedes Our results showed that Ae. albopictus larvae larvae in the rainy season. People living in were found only in outdoor containers but Ae. Nakhon Si Thammarat prefer rain- and well- aegypti were found in both indoor and outdoor water to piped water for drinking and cooking containers. This indicates that Ae. aegypti and purposes, and, for this reason, rain- and well- Ae. albopictus have different preferred water are always stored in water containers in development sites that slightly overlap.[10,24] and around the house. Many studies[9-10,19,25] have shown that Ae. albopictus prefers to lay eggs in outdoor natural Previous studies[12,19] have shown that the containers and Ae. aegypti tends to lay eggs in number of Ae. aegypti and Ae. albopictus varies artificial indoor water containers that are depending on topography. This could be due
148 Dengue Bulletin – Volume 31, 2007 Development sites of Ae. aegypti and Ae. albopictus in Thailand to the different needs for water-storage cleaning practice helps to eliminate Aedes containers in topographic types. There was no larvae in the indoor containers, especially Ae. tap water available in mangrove areas; people aegypti larvae. in this area have to store water for drinking and washing in large water containers, especially in the dry season. Our results showed that Positive earthen and plastic there were more Aedes larvae in the mangrove containers areas than in other areas in the dry season. However, our results showed that there were Our results showed that the number of higher numbers of Aedes larvae in mountainous positive containers was higher among earthen areas than in other areas in the wet season. containers than among plastic containers. This This could be because there was a higher result supports Luemoh et al.’s[11] study that amount of rainfall in mountainous areas during there were a lower number of Aedes larvae in the wet season. Waste products such as cans, plastic water containers, both with lids and bottles, tyres, etc., might collect rain-water without lids than clay or cement containers. creating many suitable larval development sites This could be for two possible reasons. First, for Aedes larvae in the area. In addition, there people in Nakhon Si Thammarat prefer to store were many rubber plantations around the their water in earthen containers than plastic human dwellings in the mountainous areas. It containers. This may lead to mosquitoes that is a common practice to suspend tapping prefer to oviposit eggs in earthen water temporarily in rubber plantations leading to containers over time. Second, previous studies accumulation of rainwater in sap-collecting show that female mosquitoes prefer to oviposit containers and small shallow ponds between in darker coloured and less transparent rows of rubber trees.[30] Therefore, these containers over lighter coloured and more would provide an ideal developmental site for opaque containers. Earthen containers usually Aedes mosquitoes, especially Ae. albopictus. are dark brown colour and completely dark, Sumodan’s[31] study showed that Ae. albopictus while plastic containers are more often light laid eggs in sap-collecting containers and their coloured and transmit light. Third, temperatures eggs could fully develop into mature adults in earthen containers tend to vary less than in during that period. plastic containers. This might promote full mosquito larval development more than in highly variable temperatures. Positive indoor and outdoor containers Positive containers with and Our results support previous findings in without lids Khonkean, Thailand,[32] and Pattani, Thailand,[11] that the number of positive containers was Our results support previous findings[11,27,34] that higher in outdoor than indoor containers. the number of positive containers was higher However, Kittayapong and Strickman[33] found in containers without lids than containers with that containers placed inside houses had more lids. This could be for two possible reasons. larvae than those placed outdoors and under First, lids could prevent gravid mosquito eaves or in the bathroom. Most indoor water- females from ovipositing in water storage storage containers are cleaned regularly one containers. From a behavioural study,[27] Ae. to three times per week. This kind of routine aegypti females actively sought the narrow gaps
Dengue Bulletin – Volume 31, 2007 149 Development sites of Ae. aegypti and Ae. albopictus in Thailand between the lid and the lip of the water coloured artificial treeholes attracted higher containers to reach oviposition sites, although mosquito species diversity and abundance than the number of eggs deposited was less in green-coloured artificial containers. Our results containers with lids. Second, lids may prevent support previous findings that the number of leaf litter, insects and organic materials falling Aedes larvae was higher in dark-coloured into the water containers. These water containers. Therefore, in order to minimize the containers with lids will have fewer nutrients number of Aedes larvae in water storage available. High nutrient water is a signal of good containers, people might use light-coloured food in terms of quality and quantity known to water storage containers in their houses. attract ovipositioning females.[35-37] Therefore, water containers with lids might attract less ovipositioning females due to less nutrients Acknowledgements being available for mosquito larvae required during larval development. This work was supported in part by the Thailand Research Fund through the Royal Golden Jubilee Ph.D. Programme (Grant No. PHD/0201/ Positive dark- and light-coloured 2548), the Institute for the Promotion of containers Teaching Science and Technology, and CXKURUE, the Institute of Research and A significant amount of research has been done Development, Walailak University. We thank on colour cues for oviposition behaviour in John A. Endler and David Harding for their mosquitoes.[38] For example, Toxorhynchites r. comments on the previous versions of this septentroinalis, Tx. r. rutilus, Tx. moctezuma and manuscript. We also thank the 11.2 Vector- Tx. Amboinensis prefer to oviposit in black rather Borne Disease Control Centre, Nakhon Si than white containers.[38-41] In addition, Thammarat, for mosquito larval identification Yonoviak’s[42] study investigated how the colour and students from Yothinbamrung School for of water containers affects mosquito diversity field surveys in this study. and abundance and found that black- and red-
References
[1] Hay SI, Myers MF, Burke DS, Vaughn DW, Delhi: Ministry of Health and Family Welfare, Endy T, Ananda N, Shanks GD, Snow RW, 2001. Rogers DJ. Etiology of interepidemic periods of mosquito-borne disease. Proc Natl Acad Sci [4] Jacobs M, Levin M. An improved endothelial USA. 2000 Aug 1; 97(16): 9335-9. barrier model to investigate dengue haemorrhagic fever. J Virol Methods. 2002 Jul; [2] Stephenson I, Roper J, Fraser M, Nicholson K, 104(2): 173-85. Wiselka M. Dengue fever in febrile returning travellers to a UK regional infectious diseases [5] Morrison AC, Astete H, Chapilliquen F, unit. Travel Med Infect Dis. 2003 May; 1(2): Ramirez-Prada C, Diaz G, Getis A, Gray K, Scott 89-93. TW. Evaluation of a sampling methodology for rapid assessment of Aedes aegypti [3] National Institute of Communicable Diseases. infestation levels in Iquitos, Peru. J Med Investigation & control of outbreaks dengue Entomol. 2004 May; 41(3): 502-10. fever and dengue haemorrhagic fever. New
150 Dengue Bulletin – Volume 31, 2007 Development sites of Ae. aegypti and Ae. albopictus in Thailand
[6] Thongrungkiat S, Jirakanjanakit N, hemorrhagic fever. 3. Identification of vectors Apiwathnasorn C, Prummongkol S, Samung and observations on vector ecology. Am J Trop Y. Comparative susceptibility to oral infection Med Hyg. 1968 Jul; 17(4): 609-18. with dengue viruses among local strains of Aedes aegypti (Diptera: Culicidae) collected [15] Russell PK, Yuill TM, Nisalak A, Udomsakdi S, at different seasons of the year. J Vector Ecol. Gould DJ, Winter PE. An insular outbreak of 2003 Dec; 28(2): 166-70. dengue hemorrhagic fever. II. Virologic and serologic studies. Am J Trop Med Hyg. 1968 [7] Ali M, Wagatsuma Y, Emch M, Breiman RF. Jul; 17(4): 600-8. Use of a geographic information system for defining spatial risk for dengue transmission in [16] Russell PK, Gould DJ, Yuill TM, Nisalak A, and Bangladesh: role for Aedes albopictus in an Winter PE. Recovery of Dengue-4 viruses from urban outbreak. Am J Trop Med Hyg. 2003 mosquito vectors and patients during an Dec; 69(6): 634-40. epidemic of Dengue Haemorrhagic Fever. Am J Trop Med Hyg. 1969; 18: 580–3. [8] Winter PE, Yuill TM, Udomsakdi S, Gould D, Nantapanich S, Russell PK. An insular outbreak [17] Lester PJ, Pike AJ. Container surface area and of dengue hemorrhagic fever. I. Epidemiologic water depth influence the population observations. Am J Trop Med Hyg. 1968 Jul; dynamics of the mosquito Culex pervigilans 17(4): 590-9. (Diptera: Culicidae) and its associated predators in New Zealand. J Vector Ecol. 2003 [9] Thavara U, Tawatsin A, Phan-Urai P, Ngamsuk Dec; 28(2): 267-74. W, Chansang C, Liu M, Li Z. Dengue vector mosquitoes at a tourist attraction, Ko Samui, [18] Promprou S, Jaroensutasinee M, in 1995. Southeast Asian J Trop Med Public Jaroensutasinee K. Climatic factors affecting Health. 1996 Mar; 27(1): 160-3. dengue haemorrhagic fever incidence in southern Thailand. Dengue Bull. 2005; 29: [10] Thavara U, Tawatsin A, Chansang C, Kong- 41-8. ngamsuk W, Paosriwong S, Boon-Long J, Rongsriyam Y, Komalamisra N. Larval [19] Preechaporn W, Jaroensutasinee M, occurrence, oviposition behavior and biting Jaroensutasinee K. The larval ecology of Aedes activity of potential mosquito vectors of dengue aegypti and Ae. albopictus in three on Samui Island, Thailand. J Vector Ecol. 2001 topographical areas of southern Thailand. Dec; 26(2): 172-80. Dengue Bull. 2006; 30: 204-13. [11] Luemoh A, McNeil D, Kuning M. Water [20] Scott TW, Chow E, Strickman D, Kittayapong consumption and distribution of dengue P, Wirtz RA, Lorenz LH, Edman JD. Blood- larvae in Pattani villages. Songklanakarind Med feeding patterns of Aedes aegypti (Diptera: J. 2003; 21(3): 209-16. Culicidae) collected in a rural Thai village. J Med Entomol. 1993 Sep; 30(5): 922-7. [12] Wongkoon S, Jaroensutasinee M, Jaroensutasinee K. Larval Infestations of Aedes [21] Kalra NL, Kaul SM, Rastogi RM. Prevalence of aegypti and Ae. albopictus in Nakhon Si Aedes aegypti and Aedes albopictus vectors of Thammarat, Thailand. Dengue Bull. 2005; 29: dengue and dengue haemorrhagic fever in 169-75. north, north-East and central India. Dengue Bull. 1997; 21: 84-92. [13] Thavara U, Tawatsin A, Chompoosri J. Evaluation of attractants and egg-laying [22] Eshita Y, Kurihara T. Studies on the habitats of substrate preference for oviposition by Aedes Aedes albopictus, Aedes riversi in the albopictus (Diptera: Culicidae). J Vector Ecol. Southwestern part of Japan. Japn J Sanit Zool. 2004 Jun; 29(1): 66-72. 1978; 30: 181-6. [14] Gould DJ, Yuill TM, Moussa MA, Simasathien P, Rutledge LC. An insular outbreak of dengue
Dengue Bulletin – Volume 31, 2007 151 Development sites of Ae. aegypti and Ae. albopictus in Thailand
[23] Rattanarithikul R, Panthusiri P. Illustrated keys [33] Kittayapong P, Strickman D. Distribution of to the medically important mosquitoes of container-inhabiting Aedes larvae (Diptera: Thailand. Southeast Asian J Trop Med Public Culicidae) at a dengue focus in Thailand. J Health. 1994; 25 Suppl 1: 1-66. Med Entomol. 1993 May; 30(3): 601-6. [24] Gould DJ, Mount GA, Scanlon JE, Ford HR, [34] Schneider JR, Morrison AC, Astete H, Scott TW, Sullivan MF. Ecology and control of dengue Wilson ML. Adult size and distribution of Aedes vectors on an island in the Gulf of Thailand. J aegypti (Diptera: Culicidae) associated with Med Entomol. 1970 Aug 25; 7(4): 499-508. larval habitats in Iquitos, Peru. J Med Entomol. 2004 Jul; 41(4): 634-42. [25] Eamchan P, Nisalak A, Foy HM, Chareonsook OA. Epidemiology and control of dengue virus [35] Wilton DP. Oviposition site selection by the infections in Thai villages in 1987. Am J Trop tree-hole mosquito, Aedes triseriatus (Say). J Med Hyg. 1989 Jul; 41(1): 95-101. Med Entomol. 1968 Jun 10; 5(2): 189-94. [26] Hammon WM, Rudnick A, Sather GE. Viruses [36] Beehler J, Lohr S, Defoliart G. Factors associated with epidemic hemorrhagic fevers influencing oviposition in Aedes triseriatus of the Philippines and Thailand. Science. 1960 (Diptera: Culicidae). Great Lakes Entomol. Apr 15; 131: 1102-3. 1992; 25: 259-64. [27] Strickman D, Kittayapong P. Dengue and its [37] Paradise CJ, Kuhn KL. Interactive effects of pH vectors in Thailand: calculated transmission and leaf litter on a shredder, the scirtid beetle, risk from total pupal counts of Aedes aegypti Helodes pulchella, inhabiting tree-holes. and association of wing-length measurements Freshwater Biol. 1999; 41: 43-9. with aspects of the larval habitat. Am J Trop Med Hyg. 2003 Feb; 68(2): 209-17. [38] Collins LE, Blackwell A. Electroantennogram studies of potential oviposition attractants for [28] Raju AK. Community mobilization in Aedes Toxorhynchites moctezuma and Toxorhynchites aegypti control programme by source amboinensis mosquitoes. Physiol Entomol. reduction in Peri-Urban district of Lautoka, 1998; 23: 214-9. Viti Levu, Fiji Islands. Dengue Bull. 2003; 27: 149-55. [39] Slaff ME, Reilly JJ, Crans WJ. Colonization of the predaceous mosquito, Toxorhynchites [29] Hoeck PA, Ramberg FB, Merrill SA, Moll C, rutilus septentroinalis (Dyar and Knab). Proc N Hagedorn HH. Population and parity levels of J Mosq Contr Assoc. 1975; 62: 146-8. Aedes aegypti collected in Tucson. J Vector Ecol. 2003 Jun; 28(1): 65-73. [40] Hilburn LR, Willis NL, Seawright JA. An analysis of preference in the color of oviposition sites [30] Dieng H, Mwandawiro C, Boots M, Morales exhibited by female Toxorhynchites. rutilus in R, Satho T, Tuno N, Tsuda Y, Takagi M. Leaf the laboratory. Mosq News. 1983; 43: 302-6. litter decay process and the growth performance of Aedes albopictus larvae [41] Linley JR. Laboratory tests of the effects of p- (Diptera: Culicidae). J Vector Ecol. 2002 Jun; cresol and 4-methylcyclohexanol on 27(1): 31-8. oviposition by three species of Toxorhynchites mosquitoes. Med Vet Entomol. 1989 Oct; 3(4): [31] Sumodan PK. Potential of rubber plantations 347-52. as breeding source for Aedes albopictus in Kerala, India. Dengue Bull. 2003; 27: 197-8 [42] Yanoviak SP. Container color and location affect macroinvertebrate community structure [32] Chareonsook O, Setsaputra S, Singklang K, in artificial treeholes in Panama. Florida Yawa T, Purahung S, Suwankiri P. Prevalence Entomol. 2001; 84: 265–71. of Aedes mosquito in big cement jars and rain water tanks. Commun Dis J. 1985; 11: 247– 63.
152 Dengue Bulletin – Volume 31, 2007 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti when exposed to permethrin in an excito-repellency test system
P. P a e p o r n a , K. Supaphathoma, S. Sathantriphopa, T. Chareonviriyaphapb and R. Yaicharoenc
aChemical Control Section, Department of Medical Sciences, Ministry of Public Health, Nonthaburi 11000, Thailand
bDepartment of Entomology, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand
cDepartment of Parasitology, Faculty of Medical Technology, Mahidol University, Bangkok 10700, Thailand
Abstract
This study compared the behavioural avoidance responses of the permethrin-resistant and deltamethrin- resistant strains of Aedes aegypti, a primary vector of dengue haemorrhagic fever (DHF) in Thailand. The background of biochemical-based resistance mechanism assay of these two strains revealed a significant increase of esterase activity and monooxygenase levels when compared with a laboratory-susceptible strain. Glutathione-S-transferase activity was found to increase only in the permethrin-resistant strain. The DNA sequence of knockdown resistance (kdr) mutation in the voltage-gated sodium channel (IIS6 region) was determined but the leucine to phenylalanine amino acid substitution, which is commonly associated with resistance to pyrethroids in many insect species, was not found in either strain. The behavioural escape response of both contact irritancy and non-contact repellency when exposed to permethrin at standard field dose (0.25 g/m2) was observed by using an excito-repellency test chamber. The results showed that in contact trials, the permethrin-resistant strain showed a lower irritancy response when compared with the deltamethrin-resistant strain. This was probably due to the higher levels of resistance to this insecticide for the permethrin resistance strain. For the repellency test by non- contact trials, the response was not significantly different between the two strains. This may be because the repellency effect was much weaker than that of the irritancy effect. This study indicated that the behavioural response of mosquitoes differs according to different pyrethroid compounds and to the physiological resistance mechanism of the mosquitoes. However, further work is necessary to understand how these responses are mediated.
Keywords: Behavioural response; Aedes aegypti; Insecticide resistance; Excito-repellency test chamber.
E-mail: [email protected]
Dengue Bulletin – Volume 31, 2007 153 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
Introduction Public Health, Thailand, was used as a laboratory-susceptible strain. Insecticide resistance in Aedes aegypti, a primary vector of dengue haemorrhagic fever (DHF), Two selected strains of Ae. aegypti, i.e. has been reported in many parts of the world. one deltamethrin-selected strain which showed In Thailand, fenitrothion, deltamethrin and significant elevation of esterase and permethrin are the primary insecticides used monooxygenase activity as compared with in thermal fogging and ultra-low volume sprays laboratory-susceptible strains, and the other the for the control of adult Aedes aegypti mosquitoes permethrin-resistant strain which had a during DHF outbreaks. The widespread use of significant increase in glutathione-S-transferase insecticides has led to selective insecticide activity when compared with the deltamethrin- resistance in vector mosquitoes reducing the resistant strain and the susceptible strain. The efficacy of control measures. details to obtain these two resistant strains were described elsewhere.[2] Insecticide resistance can be grouped within four categories:[1] (i) behavioural resistance where PCR and sequencing of partial the insect behaviour is modified to avoid contact with the insecticide; (ii) penetration resistance, genomic DNA of sodium channel where the composition of the insect’s gene exoskeleton becomes modified in a way that inhibits insecticide penetration; (iii) target-site Adult female mosquitoes, from permethrin- insensitivity, where the chemical site of action and deltamethrin-selected strains were used for the insecticide is modified, limiting the affinity for the detection of point mutation in the of the insecticide for the target site and reducing segment 6 of domain II (IIS6) of sodium [3] its ability to disrupt the function of the target channel gene. The mosquitoes were site; and (iv) metabolic resistance, where homogenized individually and total genomic detoxification enzymes rapidly break down the DNA was extracted by phenol chloroform [4] insecticide so it is no longer toxic to mosquitoes. method. The DNA pellet was diluted in TE Although several reports of insecticide resistance buffer before using as PCR template. PCR was in Ae. aegypti have been published, most of them performed by using AegF, (5’ AAC TTA CTC [5] describe biochemical resistance. The impact of ATT TCC ATC ATG G3’) and Dg2, (5’ GC (T/ these compounds on Ae. aegypti in terms of G/A) AT (C/T) TT (A/G) TT(G/A/T/C) GT (G/A) behavioural resistance has not been studied. TC (G/A) TT (G/A) TC 3’) primers. Nested PCR was carried out using primers Dg1, (5’ TGG AT In this paper, permethrin and (T/C/A) G (A/C) (A/G) (T/A) (C/G) (A/C/T) ATG deltamethrin-resistant strains were examined TGG GA (T/C) TG 3’) and Dip2, (5’TTG GAC for target-site insensitivity and for behavioural AAA AGC AA (G/A) GCT AAG 3’) primers.[6] resistance. The PCR products were subjected to DNA sequencing (Bioservice Unit, Thailand).
Materials and methods Behavioural resistance test Test populations Tests were carried out to compare the behavioural responses of the two strains of Ae. A susceptible colony of Ae. aegypti from the aegypti exposed to 0.25 g/m2 permethrin by Department of Medical Sciences, Ministry of
154 Dengue Bulletin – Volume 31, 2007 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
Figure 1: Excito-repellency test chamber 1 chemical-treated surfaces whereas repellency is a response from a distinct distance without
7 physical contact with insecticides. 6 The test system consists of two treated test 5 7. Exit portal chambers and two paired control chambers. Prior 6. Front door to the exposure, mosquitoes were starved for 4 5. Outer chamber at least 24 hours. Twenty-five female mosquitoes 3 were carefully transferred into each of the 4 4. Screened inner chamber 2 test chambers (Figure 3). Mosquitoes were 3. Plexiglass holding frame allowed a 3-min resting period to permit 1 adjustment to the chamber conditions. 2. Plexiglass panel with rubbered door Observations for behavioural responses were 1. Rear door cover taken at 1 min intervals for 30 mins. After each test was completed, the number of dead or knockdown specimens was recorded separately using excito-repellency test chambers (Figures for each exposure chamber, paired control 1 and 2) developed by Chareonviriyaphap et chamber and external holding cage, which was al.[7] Generally, behavioural responses, or the receiving box connected to the exit portal insecticide avoidance, can be categorized as for collecting escaped mosquitoes. Escaped contact irritancy and non-contact repellency. specimens and those remaining inside the Irritancy results from physical contact with chambers, for each treatment, were held
Figure 2: Excito-repellency test chamber 2
1. Non-contact control 2. Non-contact 3. Contact control treatment 4. Contact treatment
Repellency Irritability system system
Dengue Bulletin – Volume 31, 2007 155 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
Figure 3: Excito-repellency test chamber 3
Exposure-tested External holding chamber cage
separately in small holding containers with cotton leucine (L, CTC) to phenylalanine (F, TTC) pads soaked in 10% sugar solution as food. substitution was not found from the Mortality counts were made at the end of the mosquitoes sequenced, although all 24-hour observation period. The test was mosquitoes showed the highest resistance replicated 4 times for each insecticide strain and against insecticide from each strain. each arm (permethrin treatment, control).
Behavioural test Results Even though this was the preliminary study, as PCR and sequencing of the the sample size was not sufficient for statistical partial genomic DNA of evaluation, it can be seen that in contact trials the deltamethrin-resistant strain showed higher sodium channel gene contact escape response (27.3% within 30 mins) compared with the permethrin-selected To investigate whether alteration of the sodium strain. The difference in escape response was channel gene was involved in resistance not observed in non-contact trials. The mechanism, a 400 bp of genomic DNA percentage of the mosquitoes remaining in the sequence comprising the S6 trans-membrane exposure chambers under contact and non- segment of domain II (IIS6) in the sodium contact conditions are shown in Figures 4 and channel gene was PCR-amplified and 5 respectively. sequenced. The result revealed that the
156 Dengue Bulletin – Volume 31, 2007 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
Figure 4: Escape pattern of permethrin- and deltamethrin-resistant populations in contact trial with 0.25 g/m2 permethrin
100
90 ambers h 80
posure c 70 x e
% Mosquitoes remaining in 60 01234 567 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Time (minutes)
Permethrin-resistant Deltamethrin-resistant Lab-susceptable
Figure 5: Escape pattern of permethrin- and deltamethrin-resistant populations in non-contact trial with 0.25 g/m2 permethrin
100 ambers h 90 posure c x
80
70
% Mosquitoes remaining in e 60 01234 567 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Time (minutes)
Permethrin-resistant Deltamethrin-resistant Lab-susceptable
Dengue Bulletin – Volume 31, 2007 157 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
Table: Escape response and percent mortalities of permethrin- and deltamethrin-resistant populations when exposed to 0.25 g/m2 in contact and non-contact trials Treated Control % Mortality chamber chamber
Treatment Control Test Strain chamber chamber condition No. % No. % tested escaped tested escaped Did Did Escaped not Escaped not escape escape Contact Permethrin-resistant 99 11.1 98 7.1 0 1 0 1 Deltamethrin-resistant 99 27.3 97 10.3 1 2 0 3.1 Lab-susceptible 96 25.0 93 43.0 8.3 44.8 1.1 5.4 Non- 99 6 100 6 1 2 2 2 contact Deltamethrin-resistant 99 2 100 6 0 3.1 0 1 Lab-susceptible 95 35.8 95 26.3 0 20 4.2 6.3
The percentage of mortality of the escaped From this study the lower irritancy response mosquitoes was a little lower than those in the permethrin-selected strain was probably remaining in the test chamber for the two strains, due to its higher levels of resistance to this both in contact and non-contact trials (Table). insecticide, which may have influenced the escape response because of increased duration of exposure time with this insecticide. Similar Discussion results were observed with Anopheles gambiae by Chandre et al.[8] These authors demonstrated PCR and sequencing of the that resistant mosquitoes could tolerate higher- partial genomic DNA of dose permethrin and stayed longer than sodium channel gene susceptibles. For a repellency test by non-contact trials, The results suggested that other mechanisms, the response was not significantly different such as the increase of detoxification enzymes, between the two strains. This may be due to may be involved in the resistance, or another site of point mutation which is not commonly repellency effect which was much weaker than associated with resistance to pyrethroids in that of the irritancy effect. many insect species may be involved in Ae. Even though the permethrin-resistant strain aegypti resistance. This requires further studies. of Ae. aegypti, which has increased metabolic detoxification enzymes involved in its Behavioural test resistance, does not change the target-site insensitivity but it showed a behavioural In our experiment, the study was designed to resistance to permethrin. This study provides know the contact and non-contact responses important information because the biochemical of the permethrin-resistant strain and the resistance in mosquito vectors can mediate deltamethrin-resistant strain of mosquitoes to their behavioural response to that insecticide permethrin. So, no bait or similar attractant was when applied as a space spray or on surface- used to avoid any confusion in the results. treated areas for adult control.
158 Dengue Bulletin – Volume 31, 2007 Behavioural responses of deltamethrin- and permethrin-resistant strains of Aedes aegypti
References
[1] Miller TA. Mechanism of resistance to JC, Hemingway J. Pyrethroid and DDT cross- pyrethroids insecticides. Parasitology Today. resistance in Aedes aegypti is correlated with 1988; 4(7): S8-S12. novel mutations in the voltage-gated sodium channel gene. Med Vet Entomol. 2003 Mar; [2] Paeporn P, Supaphathom K, Srisawat R, 17(1): 87-94. Komalamisra N, Deesin V, Ya-umphan P, Leeming Sawat S. Biochemical detection of [6] Martinez-Torres D, Chandre F, Williamson MS, pyrethroid resistance mechanism in Aedes Darriet F, Bergé JB, Devonshire AL, Guillet P, aegypti in Ratchaburi province, Thailand. Trop Pasteur N, Pauron D. Molecular Biomed. 2004 Dec; 21(2): 145-51. characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector [3] Soderlund DM, Knipple DC. The molecular Anopheles gambiae s.s. Insect Mol Biol. 1998 biology of knockdown resistance to pyrethroid May; 7(2): 179-84. insecticides. Insect Biochem Mol Biol. 2003 Jun; 33(6): 563-77. [7] Chareonviriyaphap T, Prabaripai A, Sungvornyothrin S. An improved excito- th [4] Ballinger-Crabtree ME, Black WC 4 , Miller repellency test chamber for mosquito BR. Use of genetic polymorphisms detected behavioral tests. J Vector Ecol. 2002 Dec; 27(2): by the random-amplified polymorphic DNA 250-2. polymerase chain reaction (RAPD-PCR) for differentiation and identification of Aedes [8] Chandre F, Darriet F, Duchon S, Finot L, aegypti subspecies and populations. Am J Trop Manguin S, Carnevale P, Guillet P. Med Hyg. 1992 Dec; 47(6): 893-901. Modifications of pyrethroid effects associated with kdr mutation in Anopheles gambiae. Med [5] Brengues C, Hawkes NJ, Chandre F, McCarroll Vet Entomol. 2000 Mar; 14(1): 81-8. L, Duchon S, Guillet P, Manguin S, Morgan
Dengue Bulletin – Volume 31, 2007 159 Perceived self-efficacy to plan and execute an environmental action plan for dengue control among Filipino University students
Jeffrey L. Lennon
Liberty University, Department of Health Sciences and Kinesiology, Lynchburg, VA 24502, USA
Abstract
This study sought to evaluate the change in the perceived self-efficacy in students exposed to a training module with field exercise to conduct an environmental action plan for dengue control. Eighteen education students at a Filipino university participated in the study. A pretest-post-test design was employed. Evaluation was conducted through a nine-point self-efficacy scale. Field exercises were conducted on the grounds of the university campus. The results demonstrated statistically significant increases in perceived self-efficacy scores.
Keywords: Dengue control; Environmental action plan; Self-efficacy; Students.
Introduction their students are able to carry out dengue control activities, such as environmental action Dengue fever/dengue haemorrhagic fever (DF/ plans for their own homes and neighbourhoods. DHF) is at present the leading mosquito-borne viral disease worldwide.[1] Dengue especially Mosquito larval control through source [2] reduction of mosquito breeding sites remains affects school-age children and youth. [6] Schools, especially in the tropical and a primary emphasis in dengue control. Various subtropical dengue-endemic areas, are international projects lay stress on source reduction for dengue control at the community frequently the breeding sites for Aedes aegypti, [7] the carrier of the dengue virus.[3,4] Teachers level and at schools. and students therefore potentially provide key A number of studies have described the links between the schools, the students and mobilization of schoolchildren through the community in dengue control.[5] Teachers involvement of teachers. In the English- have the potential not only to be trainers to speaking Caribbean, teachers trained children their students in dengue control but also can as community-change agents through an serve as role models on their school campus environmental health model.[8] In Colombia, grounds. In addition, teachers can serve as eleventh graders, after 20 hours of training, facilitators for community action, especially as conducted community-wide dengue control
E-mail: [email protected]
160 Dengue Bulletin – Volume 31, 2007 Perceived self-efficacy to plan and execute environmental plan for dengue control communication. One creative approach was future teachers to increase self-efficacy of the use of calendars in classrooms by mosquito larval prevention and control teachers.[9] In Malaysia, schoolchildren measures to control dengue. Therefore, this distributed weekly worksheets to study sought to examine whether university households.[10] In Puerto Rico, fourth graders education students (future teachers) may had a dengue educational booklet integrated increase their perceived self-efficacy to into class work. Their teachers received specific conduct dengue-related mosquito control training as a part of the programme.[11] In measures through the use of environmental Honduras, primary-school children, after action plan training and experiential field receiving training by teachers, conducted activity to control mosquito breeding sites in household mosquito control surveys. Also in a university setting. In this study, perceived the study, parents and teachers had an increased self-efficacy is operationalized to be defined awareness about mosquito control.[12] as the beliefs one has in one’s capability to However, no study has been done to show execute an environmental action plan as later that teachers, or students who had been described in this study. This refers to the self- trained, had undergone field exercises to reported self-efficacy without validation prepare them in dengue control, let alone through behavioural indicators. examine the participants’ confidence levels through their experience. Materials and methods The health behaviour theory provides a framework to conduct health education and Participants health promotion programmes.[13] Self- efficacy, a construct of Social Cognitive Theory, Eighteen students from the Foundation is a powerful predictor of behaviour.[14,15] University College of Education course entitled, One’s efficacy beliefs are central to this “Personal and Community Hygiene” in construct. According to Bandura, “Perceived Dumaguete city, Philippines, a dengue- self-efficacy refers to beliefs in one’s endemic city participated in the study in 2005. capabilities to organize and execute the The student group included 14 females and courses of action required to produce given attainments.”[15] Self-efficacy significantly four males and had no previous exposure to increased in two dengue-related studies, one the environmental action plan. Participation in in Thailand,[16] and the other in the the evaluation of the study activities was Philippines.[17] In Thailand, self-efficacy to voluntary. All the students participated till the carry out source-reduction measures to reduce completion of the exercise. The majority of mosquito breeding sites increased through a the students were primary-school trainees community-based programme.[16] Self-efficacy while the remainder were secondary-school to perform dengue prevention and control trainees. The breakdown of the number of first-, measures significantly increased as a result of second- and third-year students was seven, the play of a board game among Filipino nine and two respectively. There were no elementary and high-school students.[17] fourth-year students, as all of them had previous exposure to the environmental action plan. The No study has yet demonstrated the use of an average age of the students was approximately environmental action plan for teachers or 20 years.
Dengue Bulletin – Volume 31, 2007 161 Perceived self-efficacy to plan and execute environmental plan for dengue control
Materials campus. Each designated campus area had its own environmental action plan. However, A nine-item self-efficacy questionnaire was there was a core set of environmental distributed to the participants. This problems common to all environmental action questionnaire covered such topics as plans in this study. This included such topics confidence in the following: regular removal as the identification of disposable water of disposable containers, cover reusable containers and covering of open containers. containers, change water in flower vases, Three days later the students received a post- removal of used tyres, turn over open coconut test of the self-efficacy questionnaire. shells, participation in environmental clean-up, as well as identification of mosquito breeding sites. It was previously distributed to elementary Data analysis and high school student trainees,[17] as well as student-teachers.[18] This questionnaire was pre- For reliability, a Cronbach’s alpha was calculated tested with student-teachers at a seminar. on the questions of the pretest questionnaire Similarly, an environmental action-plan format by SPSS 15.0 for Windows. The possible was also utilized by the students. This format differences between the pretest and post-test was also previously conducted by education self-efficacy scores were analysed by paired t- students[19] as well as discussed in training for test. All t-tests were two tailed. Statistical student-teachers.[18] significance was set at the .05 level. The analyses were calculated on MS-Excel.
Procedures Results Prior to attending a teaching session on the use of an environmental action plan for The Cronbach’s alpha for reliability for the self- dengue-related mosquito control, students efficacy questionnaire was .92. This score were given the self-efficacy questionnaire. The indicated that the study’s results were reliable. teaching session opened with a learner- Behavioural capability (knowledge) was centred, problem-posing self-discovery, action- assessed through the successful completion of oriented module addressing mosquito larval all steps of the environmental action plan by control, and thus the need of source all groups. This included identification of the reduction. The training included visual survey core environmental problem sets in all and area mapping of potential mosquito environmental action plans. breeding sites, followed by instruction on creation of environmental action plans for the The results of the two-tailed paired t-test control of potential mosquito breeding sites. with a critical t of 2.111 revealed a significant The action plan steps included: identification difference between mean self-efficacy scores, of mosquito breeding sites, number of t(17)=2.517; p<0.0222. The sample mean mosquito breeding sites, action to be taken, self-efficacy score for the post-test was how frequently the control activity should be significantly higher than the pretest (for pretest, undertaken, and by whom. The following day mean=5.574, variance=2.296; for post-test, the students were assigned in groups to mean=6.439, variance=.419). The increased conduct visual surveys, mapping and creation difference in the mean scores was .865. This of environmental action plans in and around resulted in a 15.52% increase of mean scores, designated buildings and areas around the from pretest to post-test.
162 Dengue Bulletin – Volume 31, 2007 Perceived self-efficacy to plan and execute environmental plan for dengue control
Discussion not necessarily elevate self-efficacy. Some activities may demonstrate initial observable This study’s results demonstrated a significant behavioural changes. However, without a high increase in the perceived self-efficacy mean level of perceived self-efficacy, the sustainability scores of dengue-related environmental control of such activities may falter. Consequently, measures from the pretest to the post-test. This increasing perceived self-efficacy may be suggested that the training accompanied with important before investing time, energy and field exercise to conduct the environmental activities in a dengue control programme. action plan for the control of mosquito breeding sites was effective as a means to increase This study demonstrated that university perceived self-efficacy to carry out education students were able to increase their environmental control activities through the use perceived self-efficacy to perform dengue of environmental action plans. control activities through a single training and simple environmental action plan activity. This study had its limitations in its small Education students eventually become student- size, the absence of a control group, as well as teachers, and, in time, teachers. Increasing the absence of environmental clean-up one’s perceived self-efficacy to perform specific behavioural observations. However, since dengue-related mosquito control activities higher-level education students at this during the university course may aid future university had undergone training in the teachers to potentially increase their skills to environmental action plan for dengue control, carry out dengue control activities. This will the group of students in this study remained a put future teachers in a better position to valuable sample of education students become school and community leaders for the previously unexposed to the environmental control of dengue. action plan for dengue control.
Why the concern about perceived self- Acknowledgements efficacy or efficacy beliefs related to dengue control? Typically, sustained self-efficacy, and, The author thanks the administration of the additionally, sustained positive environmental Foundation University for permission to behavioural change, ought to be the concern. conduct this study. Thanks are also due to Dr However, before one can get to these Thelma Florendo, Dean of Foundation important issues it is desirable to get a University College of Education, for her programme’s start on a firm footing. According cooperation, and to Dr Paplito dela Rama for to Bandura, “Efficacy beliefs influence goals statistical assistance. Also, thanks to Chona F. and aspirations. The stronger the perceived self- Lennon and Daniel A. Lennon for their efficacy, the higher the goals people set for technical assistance. Comments and themselves and the firmer their commitment suggestions from Dr David Coombs were to them. Self-efficacy beliefs shape the greatly appreciated. The support for this study outcomes people expect their efforts to by the International Technical Assistance Group produce.”[14] That is why Bandura stresses the is gratefully acknowledged. The author held a importance of self-efficacy as an indicator of faculty appointment at the Foundation behavioural intent. A new or special activity University, and was course professor while this may heighten enthusiasm or spark interest, but study was conducted.
Dengue Bulletin – Volume 31, 2007 163 Perceived self-efficacy to plan and execute environmental plan for dengue control
References
[1] World Health Organization. Dengue [9] Luna JE, Chain I, Hernandez J, Clark GG, prevention and control. Report by the Bueno A, Escalante R, Angarita S, Martinez A. Secretariat of Fifty-fifth World Health Assembly, Social mobilization using strategies of AA/19, Provisional Agenda Item 13.14 dated education and communication to prevent 4 March 2002. dengue fever in Bucaramanga, Colombia. Dengue Bulletin. 2004, 28: Suppl.17-21. [2] Gubler DJ. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev. 1998 Jul; 11(3): 480- [10] Suhaili MR, Hosein E, Mokhtar Z, Ali N, Palmer 96. K, Isa MM. Applying communication-for- behavioral-impact (COMBI) in the prevention [3] Strickman D, Kittayapong P. Dengue and its and control of dengue in Johor, Bahru, Johore, vectors in Thailand: introduction to the study Malaysia. Dengue Bulletin. 2004; 28: and seasonal distribution of Aedes larvae. Am Suppl.39-43. J Trop Med Hyg. 2002 Sep; 67(3): 247-59. [11] Clark GG, Gubler DJ. Seda H, Perez C. [4] Kusumawathie PHD. Larval infestation of Development of pilot programmes for dengue Aedes aegypti and Ae. albopictus in six types prevention in Puerto Rico: a case study. of institutions in a dengue transmission area in Dengue Bulletin. 2004; 28: Suppl.48-52. Kandy, Sri Lanka. Dengue Bulletin. 2005; 29: 165-168. [12] Avila Montes GA, Martínez M, Sherman C, Fernández Cerna E. [Evaluation of an [5] Lennon JL. Students’ perceptions about educational module on dengue and Aedes mosquito larval control in a dengue-endemic aegypti for schoolchildren in Honduras]. Rev Philippine City. Dengue Bulletin. 2004; 28: Panam Salud Publica. 2004 Aug; 16(2): 84- 196-206. 94. Spanish. [6] World Health Organization. Scientific Working [13] Glanz K, Lewis FM, Rimer BK. Linking theory, Group on Dengue, 3-4 April 2000, Geneva, research and practice. In Glanz K, Lewis FM, Switzerland: Scientific Working Group on Rimer BK, eds. Health behavior and health Dengue, Meeting. Geneva: WHO, 2000. education: theory, research and practice. 2nd Document TDR/DEN/SWG/00.1. edn. San Francisco: Jossey-Bass Publishers, [7] Parks WJ, Lloyd LS, Nathan MB, Hosein E, 1997. p. 19-35. Odugleh A, Clark GG, Gubler DJ, Prasittisuk [14] Bandura A. Health promotion by social C, Palmer K, San Martin J-L, Siversen SR, cognitive means. Health Educ Behav. 2004 Apr; Dawkins Z, Renganathan E. International 31(2): 143-64. experiences in social mobilization and communication for dengue prevention and [15] Bandura A. Self-efficacy: the exercise of control. control. Dengue Bulletin. 2004; 28: New York: WH Freeman and Company, 1997. Suppl.1-7 p. 1-34. [8] Nathan MB, Lloyd L, Wiltshire A. Community [16] Therawiwat M, Fungladda W, Kaewkungwal participation in environmental management J, Imamee N, Steckler A. Community-based for dengue vector control experiences from approach for prevention and control of the English-speaking Carribbean. Dengue dengue hemorrhagic fever in Kanchanaburi Bulletin. 2004; 28: Suppl.13-16. Province, Thailand. Southeast Asian J Trop Med Public Health. 2005 Nov; 36(6): 1439-49.
164 Dengue Bulletin – Volume 31, 2007 Perceived self-efficacy to plan and execute environmental plan for dengue control
[17] Lennon JL, Coombs DW. The utility of a board University of Alabama at Birmingham, John J. game for dengue haemorrhagic fever health Sparkman Center for International Public education. Health Education. 2007; 107: 290- Health Education. 306. [19] Lennon JL. Knowledge of dengue [18] Lennon JL. Dengue control in the Philippines: haemorrhagic fever by Filipino University health education strategies for dengue control Students. Dengue Bulletin. 1996; 20: 82-86. for schools and communities. 2001,
Dengue Bulletin – Volume 31, 2007 165 Short note
Dengue presenting as Guillain Barre Syndrome
Ira Shah
Department of Paediatrics, B.J. Wadia Hospital for Children, Parel, Mumbai-400012, India
Dengue fever (DF) has been increasingly On examination, he was conscious and reported among children in Mumbai. The oriented. He had hypotonia with reduced common clinical and laboratory features seen power in all four limbs (lower limb involved in dengue-infected children are: fever, more as compared to the upper limb). He had thrombocytopenia, elevated serum diaphragmatic weakness though respiration transaminases, elevated partial thromboplastin was not laboured. Superficial and deep tendon time (PTT), hypotension, vomiting, reflexes were absent though gag reflex was haemoconcentration, leukopenia and present. There was no cranial nerve hepatomegaly.[1] Though dengue virus (DENV) involvement or sensory involvement. Other is a member of the Flaviviridae group of viruses systemic examination was normal. Thus, he which include a number of neutropic viruses,[2] was diagnosed as a case of ascending immune-mediated central nervous system’s progressive motor polyneuropathy, most likely (CNS) involvement following dengue infection Guillain Barre Syndrome. His haemogram has been rarely reported. Reports of only four revealed thrombocytopenia [Platelet = children of Guillain Barre Syndrome (GBS) due 1 04 000/cumm] and normal haemoglobin and to DENV have been published.[3-6] We report WBC count. His serum electrolytes liver a 2-year-old boy who presented with GBS due function tests and renal function tests were to dengue infection. normal. HIV ELISA and HBsAg were negative. Nerve conduction velocity showed absent ‘F’ waves in lower limbs suggestive of axonal Case report radiculopathy. Dengue IgM by Panbio Kit was positive. [1.33 AI (Positive = > 0.9 AI)]. The A 2-year-old boy born of non-consanguineous child was given intravenous immunoglobulin marriage presented in the monsoons with (IVIg) (2 gm/kg) following which his weakness weakness of lower limbs since day 1. The improved and he had regained full power in weakness was progressive and now had even upper limb and power of grade 3 in lower involved the upper limb. He had fever with limbs after 15 days of IVIg. His diarrhoea four days back. There was no history thrombocytopenia resolved within seven days of any immunization or injections taken in the of presentation. Thus, this child had dengue recent past. He had been immunized till age. polyneuropathy.
E-mail: [email protected]; Tel.: 91-22-23693509
166 Dengue Bulletin – Volume 31, 2007 Dengue presenting as Guillain Barre Syndrome
Discussion of enhanced dengue infection, leading to cross- reacting antibodies and demyelination.[2,7] GBS, Dengue is a common arboviral infection affecting in the form of polyradiculopathy of a primarily patients in South-East Asia, including India, and demyelinating nature with an associated axonal [3,4] South America. CNS involvement is known with component, has been found as was seen in this viral infection though its actual frequency is our patient who had absent “F” waves in lower unknown.[2,4] The common CNS manifestations limbs suggestive of axonal radiculopathy. are altered sensorium and seizures[2,7] and DHF and DSS are characterized by thought to be due to prolonged dengue thrombocytopenia. We found that 92.3% of haemorrhagic fever (DHF) with fluid patients infected with DF have extravasation, cerebral oedema, hyponatremia, thrombocytopenia.[9] Similarly, our patient had liver failure, renal failure and direct neurotropic fever prior to the episode of GBS and effect of dengue virus.[2,8] Immune-mediated thrombocytopenia at the time of presentation nervous system involvement has been described in the monsoon season (a time when dengue in the form of GBS and post-infectious- tends to peak in Mumbai), which made us disseminated encephalitis rarely.[4] GBS is a post- suspect dengue-associated GBS which was infectious polyradiculopathy known to occur confirmed by positive dengue IgM test. post-gastrointestinal infection with Campylobacter jejuni and other infective agents, Previous reports have found complete like Mycoplasma, human cytomegalovirus recovery of dengue-associated GBS with (CMV), Ebstein-Barr virus and herpes virus. It intravenous immunoglobulin (IVIg) as was also rarely occurs due to demyelination post-dengue found in our patient, suggesting that cross- infection. The nerve injury in GBS is mediated reacting antibodies from a previous dengue by immunological mechanisms. DHF and infection may be responsible for the illness. dengue shock syndrome (DSS) occur due to immunopathological mechanisms whereby Thus, in conclusion, one should rule out secondary exposure to dengue viruses lead to a dengue-associated GBS in areas endemic for more severe disease. Immune enhancement is dengue whether, or not they have other features thought to play a major role in the pathogenesis of the disease.
References
[1] Cam BV, Fonsmark L, Hue NB, Phuong NT, [4] Esack A, Teelucksingh S, Singh N. The Guillain- Poulsen A, Heegaard ED. Prospective case- Barré syndrome following dengue fever. West control study of encephalopathy in children Indian Med J. 1999 Mar; 48(1): 36-7. with dengue hemorrhagic fever. Am J Trop Med Hyg 2001 Dec; 65(6): 848-51. [5] Sainte-Foie S, Niel L, Moreau JP, Ast-Ravallec, Chippaux A. A case of polyradiculoneuritis [2] Sulekha C, Kumar S, Philip J. Guillain-Barre associated with dengue in a patient native to syndrome following dengue fever. Indian French Guiana. Bull Soc Pathol Exot. 1993; Pediatr. 2004 Sep; 41(9): 948-50. 86(2): 117-8; discussion 119. French. [3] Palma-da Cunha-Matta A, Soares-Moreno SA, [6] Cardosa MJ. Dengue haemorrhagic fever: Cardoso-de Almeida A, Aquilera-de Freitas V, questions of pathogenesis. Curr Opin Infect Carod-Artal FJ. Neurological complications Dis. 2000 Oct; 13(5): 471-475. arising from dengue virus infection. Rev Neurol. 2004 Aug 1-15; 39(3): 233-7. Spanish.
Dengue Bulletin – Volume 31, 2007 167 Dengue presenting as Guillain Barre Syndrome
[7] Lum LC, Lam SK, Choy YS, George R, Harun F. [9] Shah I, Deshpande GC, Tardeja PN. Outbreak Dengue encephalitis: a true entity? Am J Trop of dengue in Mumbai and predictive markers Med Hyg. 1996 Mar; 54(3): 256-9. for dengue shock syndrome. J Trop Pediatr. 2004 Oct; 50(5): 301-5. [8] Chaturvedi UC, Dhawan R, Khanna M, Mathur A. Breakdown of the blood-brain barrier during dengue virus infection of mice. J Gen Virol. 1991 Apr; 72 (Pt 4): 859-66.
168 Dengue Bulletin – Volume 31, 2007 Short note
An unusual case of brainstem encephalitis
Ira Shah
Department of Paediatrics, B.J. Wadia Hospital for Children, Parel, Mumbai-400012, India
Dengue is the commonest arboviral infection altered sensorium, inability to stand and squint that affects mankind. Infection by any of the since day 1. Her younger brother was also four serological types of dengue viruses (DENV- admitted with fever and was diagnosed to have 1 to 4) cause dengue fever (DF), dengue dengue. She had no convulsions. On haemorrhagic fever (DHF) or dengue shock examination, she was conscious and oriented syndrome (DSS). In recent years, there have and had meningeal signs with positive been reports of neurological complications Macewan’s sign. Her vital parameters were associated with dengue in Asia and South normal. Fundus showed papilledema. She had America, though their frequency still remains right lateral palsy and tone and power were unknown.[1-7] The encephalopathy associated normal. Deep tendon reflexes were brisk and with dengue infection has been postulated to right planter was extensor. She had ataxia with be due to prolonged DHF with fluid intention tremors. Other systemic examination extravasation, cerebral oedema, hyponatremia, was normal. Thus, she was suspected to have liver failure, renal failure and a possible direct brainstem encephalitis or posterior fossa tumor neurotropic effect of dengue virus.[1,4,8,9] Though with raised ICT. Her haemogram revealed central nervous system (CNS) manifestations thrombocytopenia (platelet 84 000/cumm) with have been reported in adults, reports in children normal haemoglobin and WBC count. Liver are rare and have only been reported in three transaminases were deranged (SGOT = 121 IU/ studies,[1,3,5] and none from India. We studied L), SGPT = 60 IU/L); serum electrolytes, renal a 10-year-old girl who presented with brainstem function tests and blood sugar was normal. MRI encephalitis, thrombocytopenia, elevated liver brain did not show any space-occupying lesion transaminases and positive dengue IgM with and showed only inflammatory changes in right complete resolution of her symptoms within maxillary, ethmoid and sphenoid sinuses. With three days of the onset of the disease. MRI ruling out posterior fossa tumor, cerebrospinal fluid (CSF) analysis was done which showed aseptic meningitic picture (3 Case report polymorphs, 19 lymphocytes/cumm; 52 mg/dl – sugar; proteins = 10.3 mg %). CSF culture A 10-year-old girl born of non-consanguineous was negative. In view of thrombocytopenia, marriage presented in monsoons with fever since deranged liver enzymes and meningitis and her eight days, projectile vomiting since five days, brother suffering from dengue, her dengue IgM
E-mail: [email protected]; Tel.: 91-22-23693509
Dengue Bulletin – Volume 31, 2007 169 An unusual case of brainstem encephalitis by capture ELISA was done, which was positive possible direct neutropic effect of dengue virus[9] {1.2 OD units (positive = > 0.9 OD units)}. and localized invasion of the CNS. Similar Blood culture and leptospira IgM ELISA were localized CNS manifestation in the form of negative. Thus, this child was diagnosed as a brainstem encephalitis with raised intracranial case of dengue brainstem encephalitis. She was tension and CNS leukocorrhia was seen in our treated with Mannitol and all her symptoms patient. A case report by Lum et al.[4] has isolated resolved within three days. Her repeat platelet dengue virus (DENV-2 and 3) from the CSF of count and liver transaminases were normal. affected patients, suggesting direct invasion of Thus, here is a case of dengue presenting as the brain and neurovirulent properties of the brainstem encephalitis. dengue virus.
Cam et al.[1] have determined that patients Discussion with dengue encephalitis have significantly elevated liver enzymes with cerebral oedema. Dengue virus is a member[2] of the Flaviviridae Similar findings were noted in our patient where group of viruses, which include a number of the child had elevated liver transaminases and neurotropic viruses such as Japanese encephalitis complete CNS recovery with Mannitol. In fact, virus, St. Louis encephalitis virus and tick-borne in our patient, the presence of encephalitis virus. In recent years, we and others thrombocytopenia with history of her brother have reported neurological manifestations in suffering from dengue made us suspect dengue patients with DHF and DSS characterized by encephalitis. In a previous study, we had found depression of consciousness with normal CSF that 92.3% of patients affected by dengue had analysis[1,10] and complete recovery in survivors. thrombocytopenia, and this combination of In fact, in a study published by us, we found thrombocytopenia, elevated liver transaminases that almost 48.7% of patients had altered and fever is very characteristic of dengue in sensorium on presentation with higher Mumbai.[10] predominance in the DSS group as compared to the DHF group (77.8% vs 25%, P = 0.0035). Thus, it would be wiser to investigate However, most of the patients had additional patients with encephalitis and encephalopathy features such as bleeding manifestations, in dengue-endemic areas for dengue infection, hepatomegaly and serositis. Isolated CNS irrespective of the fact whether they have other involvement is a rarity as seen in our patient. features of the disease or not.
The encephalopathy was thought to be due In conclusion, it can be stated that dengue to cerebral oedema, anoxia, haemorrhage, encephalitis is rare but neutropism of the virus hyponatremia, hepatic failure, microcapillary is known. It can masquerade as other types of haemorrhage and release of toxic substances.[1] viral encephalitis, but its clinical course and However, recent reports have demonstrated a outcome is usually favourable.
References
[1] Cam BV, Fonsmark L, Hue NB, Phuong NT, [2] Solomon T, Dung NM, Vaughn DW, Kneen R, Poulsen A, Heegaard ED. Prospective case- Thao LT, Raengsakulrach B, Loan HT, Day NP, control study of encephalopathy in children Farrar J, Myint KS, Warrell MJ, James WS, with dengue hemorrhagic fever. Am J Trop Med Nisalak A, White NJ. Neurological Hyg. 2001 Dec; 65(6): 848-51.
170 Dengue Bulletin – Volume 31, 2007 An unusual case of brainstem encephalitis
manifestations of dengue infection. Lancet. [7] Ramos C, Sánchez G, Pando RH, Baquera J, 2000 Mar 25; 355(9209): 1053-9. Hernández D, Mota J, Ramos J, Flores A, Llausás E. Dengue virus in the brain of a fatal [3] Kankirawatana P, Chokephaibulkit K, case of hemorrhagic dengue fever. J Neurovirol. Puthavathana P, Yoksan S, Apintanapong S, 1998 Aug; 4(4): 465-8. Pongthapisit V. Dengue infection presenting with central nervous system manifestation. J [8] Miagostovich MP, Ramos RG, Nicol AF, Child Neurol. 2000 Aug; 15(8): 544-7. Nogueira RM, Cuzzi-Maya T, Oliveira AV, Marchevsky RS, Mesquita RP, Schatzmayr HG. [4] Lum LC, Lam SK, Choy YS, George R, Harun F. Retrospective study on dengue fatal cases. Clin Dengue encephalitis: a true entity? Am J Trop Neuropathol. 1997 Jul-Aug; 16(4): 204-8. Med Hyg. 1996 Mar; 54(3): 256-9. [9] Chaturvedi UC, Dhawan R, Khanna M, Mathur [5] Palma-da Cunha-Matta A, Soares-Moreno SA, A. Breakdown of the blood-brain barrier Cardoso-de Almeida A, Aquilera-de Freitas V, during dengue virus infection of mice. J Gen Carod-Artal FJ. Neurological complications Virol. 1991 Apr; 72 (Pt 4): 859-66. arising from dengue virus infection. Rev Neurol. 2004 Aug 1-15; 39(3): 233-7. Spanish. [10] Shah I, Deshpande GC, Tardeja PN. Outbreak of dengue in Mumbai and predictive markers [6] Hommel D, Talarmin A, Deubel V, Reynes JM, for dengue shock syndrome. J Trop Pediatr. Drouet MT, Sarthou JL, Hulin A. Dengue 2004 Oct; 50(5): 301-5. encephalitis in French Guiana. Res Virol. 1998 Jul-Aug; 149(4): 235-8.
Dengue Bulletin – Volume 31, 2007 171 Short note
Dengue presenting as viral myocarditis
Ira Shah
Department of Paediatrics, B.J. Wadia Hospital for Children, Parel, Mumbai-400012, India
Dengue fever (DF) is endemic in India and suspected to have viral myocarditis with causes dengue fever, its severe form dengue cardiogenic shock. His investigations showed haemorrhagic fever (DHF) and dengue shock lymphopenia with thrombocytopenia syndrome (DSS). Hypotension due to (haemoglobin = 12.9 gm/dl, WBC = 7200/ intravascular depletion due to capillary leak is cumm, absolute lymphocyte count = 720/ common in DHF and DSS. However, cumm, platelet count = 1 27 000/cumm) with myocardial dysfunction is also seen with DHF/ absent C-reactive protein and no growth on DSS and could be responsible for hypotension blood culture. His serum CPK levels were and shock.[1] Cardiac involvement in the form elevated (344 IU/L) and CPK-MB fraction was of decreased left ventricular performance[2] also elevated {71 units/L (normal = upto 25 and arrhythmias[3,4] are known. However, units/L)}. Serum LDH was also elevated (972 isolated myocarditis has rarely been seen with IU/L). His renal function tests, liver function dengue virus.[5] We report an 11-year-old boy tests and blood sugar were normal. who presented with viral myocarditis due to Echocardiography showed left ventricular dengue infection, with complete recovery dilatation with systolic dysfunction and within three months. fractional shortening of 22%. His dengue IgM by ELISA was positive {0.95 AI (Positive = > 0.9 AI)} and leptospira IgM and peripheral Case report smear for malaria were negative. He was thus diagnosed as a case of dengue myocarditis. An eleven-year-old boy born of non- Intravenous immunoglobulin (2 gm/kg) was consanguineous marriage presented with given following which his left ventricular vomiting since two days and fever since day functions improved with fractional shortening one. He had no skin rash or bleeding from any of 31% and ejection fraction of 62%. He was site. On examination, he had tachycardia (heart gradually tapered off the ionotropic support and rate = 110/min) with hypotension (BP = 85/ discharged. On follow up after three months, 50 mm of Hg) with prolonged capillary refill he was asymptomatic and a repeat and bilateral basal crepitations. There were no echocardiography showed normal left signs of dehydration. Other systemic ventricular dimensions and functions with examination was normal. He was immediately fractional shortening of 37% and ejection treated with Dobutamine and IV fluids. He was fraction of 74%.
E-mail: [email protected]; Tel.: 91-22-23693509
172 Dengue Bulletin – Volume 31, 2007 Dengue presenting as viral myocarditis
Discussion dysfunction in the form of reduced ejection fraction and decreased end-diastolic volume [2] Viral myocarditis may lead to cardiogenic shock are noted in patients with dengue. Similar due to fulminant cardiac failure, recurrent echocardiographic findings were noted in our wheezy episodes (mistaken as bronchial patient. Viral myocarditis may respond asthma), bronchiolitis and rhythm favourably to routine anti-failure measures, disturbance.[5] Serum enzymes such as SGOT, steroid therapy and intravenous CPK, LDH are elevated and echocardiography immunoglobulins (IVIG), with complete shows left ventricular dilatation with global reversal of echocardiographic findings within [5] dyskinesia.[5] Our patient also presented with months. Similarly, our patient had a cardiogenic shock due to cardiac failure, had favourable response to IVIG and anti-failure elevated CPK and LDH, and echocardiography measures and had complete recovery after showed left ventricular dilatation with systolic three months of the onset of symptoms. dysfunction confirming the diagnosis of myocarditis. Viral myocarditis is known to occur In conclusion, viral myocarditis may be a commonly with Coxsackie virus B1 and B4 and manifestation of dengue, though relatively rarely with dengue virus[5,6]. Our patient had a uncommon as an isolated feature, and its positive dengue IgM test, confirming the response to therapy is favourable. diagnosis of dengue myocarditis. Cardiac
References
[1] Wali JP, Biswas A, Chandra S, Malhotra A, [4] Promphan W, Sopontammarak S, Aggarwal P, Handa R, Wig N, Bahl VK. Cardiac Pruekprasert P, Kajornwattanakul W, involvement in Dengue Haemorrhagic Fever. Kongpattanayothin A. Dengue myocarditis. Int J Cardiol. 1998 Mar 13; 64(1): 31-6. Southeast Asian J Trop Med Public Health. 2004 Sep; 35(3): 611-3. [2] Khongphatthanayothin A, Suesaowalak M, Muangmingsook S, Bhattarakosol P, [5] Gowrishankar K, Rajajee S. Varied Pancharoen C. Hemodynamic profiles of manifestations of viral myocarditis. Indian J patients with dengue hemorrhagic fever during Pediatr 1994 Jan-Feb; 61(1): 75-80. toxic stage: an echocardiographic study. Intensive Care Med. 2003 Apr; 29(4): 570-4. [6] Kabra SK, Juneja R, Madhulika, Jain Y, Singhal T, Dar L, Kothari SS, Broor S. Myocardial [3] Horta Veloso H, Ferreira Júnior JA, Braga de dysfunction in children with dengue Paiva JM, Faria Honório J, Junqueira Bellei haemorrhagic fever. Natl Med J India. 1998 NC, Vicenzo de Paola AA. Acute atrial Mar-Apr; 11(2): 59-61. fibrillation during dengue hemorrhagic fever. Braz J Infect Dis. 2003 Dec; 7(6): 418-22.
Dengue Bulletin – Volume 31, 2007 173 Short note
Defrost-water-collection trays of refrigerators – A potential breeding habitat of Aedes aegypti in dengue- and chickungunya-infested areas of southern India
R. Srinivasan , T. Mariappan and P. Jambulingam
Vector Control Research Centre (Indian Council of Medical Research), Puducherry 605006, India
Arthropod-borne viral diseases like dengue defrost trays of refrigerators in both these towns. fever (DF) and its severe form, dengue To understand the importance of this habitat in haemorrhagic fever (DHF), and chikungunya the proliferation of this vector mosquito during fever are known to occur throughout the tropics different seasons, a total of three surveys were the world over. These diseases are increasing carried out: one each during the south-west alarmingly in the South-East Asian countries.[1] monsoon season (June-August 2004), north- Dengue epidemics are being reported from east monsoon period (October-December different parts of India since 1963.[2,3,4,5] For 2004) and during summer (March-May 2005). the control of dengue outbreaks, management In houses ranging from 746–792, the number of Aedes aegypti, the vector species, through of refrigerators examined ranged from 29–335. source reduction remains the mainstay. Hence, Water was emptied into an enamel tray an assessment of the breeding sources of this employing either a siphon or pipette and mosquito is essential in order to devise and absolute count of larvae and pupae, if any, was develop a suitable control strategy. made, brought to laboratory, reared to adults and identified to species, following a standard Ae. aegypti is mainly a domestic species key.[8] The breeding of Aedes mosquitoes was of urban areas, but it has now spread to rural, found in 39 trays (1.6–8.4%) in Puducherry and suburban and urban areas as well. This species 8 trays (4.8–6.9%) in Cuddalore (Table). Aedes prefers to breed in man-made containers aegypti was the only species obtained from the holding stored water or rainwater in domestic and peri-domestic environments. pupae collected from defrost-water-collection trays in refrigerators from both the areas. The During epidemic investigations in larvae and pupae recorded were significantly Puducherry (earlier known as Pondicherry) and high (p>0.05) during the summer period in both Cuddalore during 2004-05, a rare phenomenon the towns as compared to the other two of Ae. aegypti breeding was observed in the seasons.
E-mail: [email protected]
174 Dengue Bulletin – Volume 31, 2007 Defrost-water-collectopm trays as larval habitats of Ae. aegypti
Table: Breeding status of Aedes aegypti in defrost-water-collection trays of refrigerators
Cuddalore Puducherry South- North- South- North- west east Summer west east Summer monsoon monsoon monsoon monsoon
No. of houses sampled 792 790 759 753 776 746 No. of trays examined 35 29 125 184 117 335 Tray with water (%) 31.4 13.8 33.6 34.8 22.2 37.0 Ae. aegypti breeding (%) 0 6.9 4.8 1.6 6.8 8.4 No. of larvae 2 83 398 659 139 801 No. of pupae 0 8 59 39 16 147
It is evident that the defrost water- which augment the population under collection trays in refrigerators inside houses favourable conditions. play an important role, as an alternative source for breeding in the absence of the preferred sites during summer. Since these are invisible Acknowledgements breeding sites, these are easily overlooked. This highlights the need for creating awareness We thank Dr P.K. Das, Director, Vector Control among communities about this important Research Centre (VCRC), for the facilities breeding site of Ae. aegypti. Emptying the water provided for this study. The support of technical content in these trays and destroying the eggs, personnel of the Vector Biology and Control which tolerate desiccation, by scrubbing the Unit, who rendered assistance in the field, is trays at weekly intervals could reduce the foci, gratefully acknowledged.
References
[1] World Health Organization, Regional Office Guru PY, Sharma R, Gupta NP. An investigation for South-East Asia. Prevention and control of of the aetiology of the 1971 outbreak of febrile dengue and dengue haemorrhagic fever – illness in Jaipur City, India. Indian J Med Res. Comprehensive guidelines. New Delhi: WHO- 1973 Dec; 61(12): 1737-43. SEARO, 1999. Document WHO Regional [6] Gubler DJ. Aedes aegypti and Aedes aegypti- Publication SEARO No. 29. borne disease control in the 1990s: top down [2] Reuben R, Kaul HN, Soman RS. Mosquitoes or bottom up. Charles Franklin Craig Lecture. of arbo-viral importance. Mosquito-borne Dis Am J Trop Med Hyg. 1989 Jun; 40(6): 571-8. Bull. 1988; 5: 48-54. [7] Vector Control Research Centre. Annual report [3] Yadav RL, Narasimham MVVL. Dengue/DHF 2004:1-62. and its control in India. Dengue News, 1992; [8] Barraud PJ, Christophers SR. The fauna of 17: 3.8. British India including Ceylon and Burma, [4] Rao CV. Dengue fever in India. Indian J Pediatr. Diptera V, family Culicidae, tribes Megarhinini 1987 Jan-Feb; 54(1): 11-4. and Culicini. London: Taylor and Francis; 1934. Vol 1st ed. p. 463. [5] Padbidri VS, Dandawate CN, Goverdhan MK, Bhat UK, Rodrigues FM, D’Lima LV, Kaul HN,
Dengue Bulletin – Volume 31, 2007 175 Short note
Point-of-care diagnostics for dengue, chikungunya, Japanese encephalitis and West Nile virus infection
Subhash C. Arya and Nirmala Agarwal
Sant Parmanand Hospital, 18 Alipore Road, Delhi-110054
The global resurgence of dengue in otherwise sample was positive for two infections, viz. JEV naive locations has been associated with and West Nile virus (WNV).[6] concurrent dissemination of identical vector- borne viral diseases. Concurrent infection by There has been no chemotherapy available dengue virus (DENV) and chikungunya virus for patients with JEV, DENV, CHIKV or WNV. (CHIKV) has been known for several Such cases require appropriate clinical decades.[1] Nevertheless, recent global CHIKV management and public health response. During dissemination[2] or its local re-emergence[3] after the initial stage of illness the clinical presentations a gap has been intriguing. Increased are ambiguous and are accompanied by viremia. intercontinental travel has blown up the ghost These cases are highly infectious with their blood of the traditional endemic foci of CHIKV and teeming with viral RNA. If bitten by the mosquito has resulted in CHIKV patients being found in vector, they would contribute to disease the United States.[4] Moreover, there could dissemination. Moreover, they are likely to be even be coincidental episodes of the Japanese offered empirical doses of antibiotics by the encephalitis virus (JEV) infection. During the clinicians. Any point-of-care indication about JEV, early 1940s, there were dengue outbreaks in DENV, CHIKV or WNV would be imperative Guam, followed, during 1947, by the from the clinical and public health perspective. concurrent epidemics of mumps virus and JEV. That would necessitate initiating appropriate anti- Serological investigations in children aged 10 vector measures attuned to vector biology. years or less during 1953 had revealed Vectors transmitting JE and dengue/chikungunya/ neutralizing antibody to JEV, and DENV-1 and - West Nile fever would be controlled by entirely 2 among those born before 1947.[5] different strategies.
In India, during 1997, concurrent infection A commercial diagnostic kit for the field was detected in Haryana state in the north of diagnosis of Japanese encephalitis (JE) antiviral the country. In a follow-up study of a dengue IgM has been evaluated recently.[7] Rather than outbreak, out of 30 serum samples collected, a multi-step, time-consuming format, the on- eight cases were found positive for dengue IgM the-spot point-of-care diagnostic would address antibodies, two were positive for all the three the ground realities in the JE-endemic areas. infections, viz. DENV, JEV and WNV, while one Without prejudice to the conventional enzyme-
E-mail: [email protected]
176 Dengue Bulletin – Volume 31, 2007 Dengue, chikungunya, Japanese encephalitis and West Nile virus linked immunosorbent assay (ELISA), a simpler the Bio-Check Plus Dengue G/M Cassette Test on-the-spot diagnostic would assist health care (Brittney). Recent introduction of a rapid, providers better. Obviously, immunoglobulin M immunochromatographic kit for chikungunya has (IgM)-based assays would be adequate for both been a positive feature.[9] JE and chikungunya. Nevertheless, for dengue, additional markers would be essential. The International organizations including the immunological response during the secondary World Health Organization, the Programme for or tertiary dengue episodes is secondary rather Appropriate Technology in Health (PATH) and than a primary one. The initial immunological the Centers for Disease Control and Prevention response would be towards IgG production (CDC) would be obliged to encourage rather than IgM. Dengue non-structural antigen, standardization of a concurrent point-of-care NS1, has been reported to be better than IgM diagnostic for JE, dengue, chikungunya and in cases of primary or secondary infections.[8] West Nile fever. A multifaceted but cost- Immunochromatographic assay kits for a point- effective rapid assay format would be a valuable of-care dengue IgG and IgM detection have armour for clinicians and public health been popular for a while, namely, the Panbio personnel to diagnose dengue, chikungunya, Dengue Duo IgM and IgG Rapid Strip test, and Japanese encephalitis and West Nile fever.
References
[1] Myers RM, Carey DE. Concurrent isolation dengue, through 1957. Am J Trop Med Hyg. from patient of two arboviruses, Chikungunya 1958 Jul; 7(4): 441-67. and dengue type 2. Science. 1967 Sep 15; 157(794): 1307-8. [6] Katyal R, Bhardwaj M, Harit AK, Sharma SK, Kumar K, Gill KS. Dengue, Japanese [2] Simon F, Parola P, Grandadam M, Fourcade encephalitis and West Nile flaviviral infections S, Oliver M, Brouqui P, Hance P, Kraemer P, Ali detected during a dengue outbreak in Sonepat Mohamed A, de Lamballerie X, Charrel R, district, Haryana state, India. Dengue Bulletin. Tolou H. Chikungunya infection: an emerging 2004 Dec; 28: 24-28. rheumatism among travelers returned from Indian Ocean islands. Report of 47 cases. [7] Jacobson JA, Hills SL, Winkler JL, Mammen Medicine (Baltimore). 2007 May; 86(3): 123- M, Thaisomboonsuk B, Marfin AA, Gibbons 37. RV. Evaluation of three immunoglobulin M antibody capture enzyme-linked [3] AbuBakar S, Sam IC, Wong PF, MatRahim N, immunosorbent assays for the diagnosis of Hooi PS, Roslan N. Reemergence of endemic Japanese encephalitis. Am J Trop Med Hyg. Chikungunya, Malaysia. Emerg Infect Dis. 2007 2007 Jul; 77(1): 164-8. Jan; 13(1): 147-9. [8] Kumarasamy V, Chua SK, Hassan Z, Wahab [4] Centers for Disease Control and Prevention AH, Chem YK, Mohamad M, Chua KB. (CDC). Update: chikungunya fever diagnosed Evaluating the sensitivity of a commercial among international travelers–United States, dengue NS1 antigen-capture ELISA for early 2006. MMWR Morb Mortal Wkly Rep. 2007 diagnosis of acute dengue virus infection. Mar 30; 56(12): 276-7. Singapore Med J. 2007 Jul; 48(7): 669-73. [5] Hammon WM, Tigertt WD, Sather GE, Berge [9] CTK Biotech. Onsite Rapid Test for the TO, Meiklejohn G. Epidemiologic studies of detection of Chikungunya fever. San Diego, CA: concurrent virgin epidemics of Japanese B CTK Biotech. (http://www.ctkbiotech.com/ encephalitis and of mumps on Guam, 1947- Default.aspx?tabid=118 – accessed 11 August 1948, with subsequent observations including 2008).
Dengue Bulletin – Volume 31, 2007 177 Short note
Role of helplines for dissemination of information during an outbreak of dengue fever in Delhi, India, in 2006: An experience
Bir Singh, Anil Goswami, Neena Chawla and Sosamma Shyam
Centre for Community Medicine, All India Institute of Medical Sciences, New Delhi-110029, India
Outbreaks of dengue fever (DF) and dengue public about the outbreak. Anybody having fever haemorrhagic fever (DHF) have been reported rushed to a health facility or the local private in various parts of India during the last four practitioner thinking that the fever may be due decades.[1] Delhi has been endemic for DF/DHF to dengue. Reports of chikungunya fever from for quite some time and still maintains high the states of Tamil Nadu and Kerala in south India vulnerability due to a large number of internal made the situation worse. A few cases of migrants and international tourists visiting the chikungunya were reported in Delhi too. Capital and the extensive breeding potential the city provides to Aedes aegypti mosquitoes.[2] Though some public information Delhi recorded epidemics of dengue fever advertisements issued by the Municipal during 1967, 1970, 1982, 1988, 1991, 1992 Corporation of Delhi, the New Delhi Municipal and 1996.[1,3] During the 1988 outbreak of DF/ Council and the Ministry of Health and Family DHF, about 33% mortality was reported among Welfare appeared in the national and regional children admitted in hospitals,[4] while during dailies and on radio and television for 1996, 10 252 cases were hospitalized and 423 dissemination of information on dengue fever deaths were recorded.[3] This epidemic peaked and chikungunya fever and their prevention and in September when an Aedes aegypti larval management, there was a clear gap in meeting house index (HI) of 43.70% was recorded. these information needs – especially on the management of fever. As a result, a large In 2001, there were 3306 cases with 53 attendance of patients with fever and deaths; in 2002, the number was 1926 cases suspected dengue fever was recorded at major and 33 deaths. In 2003, there was a large hospitals of the city, particularly the All India [5] outbreak with 12 754 cases and 215 deaths. Institute of Medical Sciences (AIIMS) which The 2006 outbreak started in August and bore the brunt of this patient load.[7] peaked in October. As of end-November 2006, it was estimated that 10 344 cases and 162 AIIMS is considered to be a premier deaths due to severe forms of dengue (i.e. medical institute in India. Though envisaged [6] DHF/DSS) had taken place. to be a tertiary care/referral hospital when it was established in 1956, but owing to its As is generally the case, there was growing reputation for providing quality health widespread panic and apprehension in the general
178 Dengue Bulletin – Volume 31, 2007 Role of helplines during the 2006 Delhi outbreak care, it has been attracting a large number of received were responded to within a patients in its outpatient department (OPD) time frame of 6-8 hours. and Emergency services. For example, in 2005, the attendance in its OPD was a whopping 16 30 479 patients.[8] This included a large Observations percentage of patients who don’t qualify to be Both these services were operated for six called as “referred patients”. weeks starting from the first week of October In the dengue outbreak of 2006, even 2006 to the second week of November 2006. though the Government of Delhi had made By mid-November, the outbreak was almost arrangements for the management of fever/ over. Some of the highlights of these helplines suspected dengue cases in about 33 hospitals are as follows: of the city, a large number of patients – about • No. of calls/queries received: During 1000 to 1200 per day – reported at AIIMS the six weeks of the operations, the starting from the first week of October to mid- telephone helpline received 378 calls, November,[7] stretching its human resources while 79 queries were received on the and infrastructural facilities to the maximum. Internet. One important method of containment of • Geographical distribution of the dengue outbreak was considered to be callers: 263(69.5%) of the callers were dissemination of correct information to the from the Capital and 98(26%) were general pubic on the preventive aspects of from outside Delhi. Rest of the callers these diseases as well as on the management did not reveal their place of residence. of fevers. Allaying the fear and panic setting in Residents of south and west Delhi the general public was the real need. AIIMS dominated (50%) among those who took several important steps in this direction. called from Delhi. The details are Apart from distributing 18 000 information given in Table 1. booklets, 10 000 handbills and pamphlets and putting up banners, it started two helplines to Table 1: Geographical distribution of augment public education efforts: telephone callers • Telephone helpline: It was a manned Area No. of callers (%) telephone service that functioned from 10 AM to 10 PM every day – including South Delhi 84(22.22%) holidays. A trained public health West Delhi 105(27.77%) educator, supported by a qualified medical doctor and a public health East Delhi 46(12.16%) specialist, manned this service. This North Delhi 19(5.02%) helpline (Phone no. 011-26589712) Central Delhi 09(2.38%) was subsequently converted into a 24- hour helpline in 2007. Outside of Delhi 98(25.92%) • Internet (E-mail) helpline: To help Didn’t specify 17(4.49%) those who are net savvy, an Internet Total 378(100%) (E-mail) helpline (dengueprevention@ gmail.com) was also started. Questions
Dengue Bulletin – Volume 31, 2007 179 Role of helplines during the 2006 Delhi outbreak
Table 2: Frequently asked questions*
Telephone Internet (E-mail) Type of question asked helpline helpline Frequency Frequency Advice about management of someone with fever in the family 200(52.91%) 45(56.96%) What is the treatment of dengue? 117(30.9%) 26(32.91%) What are the signs and symptoms of dengue? 57(15.07%) 25(31.64%) Blood tests for diagnosis of dengue? 22(5.82%) 15(18.98%) How to take care of a patient with fever? 35(9.25%) 10(12.65%) Differences between dengue and chikungunya 12(3.17%) 10(12.65%) General queries about the outbreak 34(8.99%) 09(11.39%) Prevention 57(15.0%) 24(30.37%) Cause 17(4.4 %) 10(12.65%) (n=378) (n=78)
*Multiple questions
• Frequently asked questions: On the television played a dominant role in telephone helpline as well as the E- making people aware about the mail helpline, the most frequently availability of the helpline and the phone asked questions pertained to seeking number. 144(38%) persons came to guidance and advice about someone know about it from various television in the family who had fever. About channels. For 105(27.7%) persons, the 32.9% of the E-mail helpline users and source of information was newspapers, about 30.9% of the telephone helpline while for others the sources were: users wanted to know about banners at AIIMS 25(6.6%), radio treatment of DF/DHF. About 30.3% 45(11.9%), word of mouth 30(7.9%) and of the E-mail helpline users and 15% the city’s telephone system Mahanagar of the telephone helpline users were Telephone Nigam Limited (MTNL) keen to know about the prevention phone enquiry 29(7.6%) (Table 3). methods of these diseases. The rest of the helpline users wanted to know about other aspects of these diseases/ Figure: Week-wise distribution of telephone outbreak (Table 2). callers
• Frequency of calls: As can be seen 250 from the Figure, almost 51%(193) of 193 the calls were received during the first 200 week of the starting of the service. 150 This was also the time when the outbreak was reaching its peak. As the 100 84 weeks passed by, the number of calls 44 50 31 gradually declined. 16 10 0 • Source of information about the 1st week 2nd week 3rd week 4th week 5th week 6th week telephone helpline: It was found that
180 Dengue Bulletin – Volume 31, 2007 Role of helplines during the 2006 Delhi outbreak
Table 3: Source of information about the One of the major problems in an outbreak of a telephone helpline (first response) communicable disease that can be fatal is the panic and apprehension that sets in in the general Source No. (%) populace – mainly due to lack of adequate and Television 144(38.0%) easily available and technically correct information. As most of the helpline-users Newspapers 105(27.7%) wanted to know about “What to do and where MTNL phone enquiry 29(7.6%) to go because someone in their family had Banners at AIIMS 25(6.6%) fever”, it is important that all available means of mass communication should be effectively Word of mouth 30(7.9%) utilized by health care managers to provide correct Radio 45 (11.9%) information. Helplines, especially on telephone, Total 378 (100%) can be very effective because of their easy, personalized and reassuring approach. This can supplement other methods of disseminating Discussion information effectively. Hence, such helplines must be operated in crisis situations. Local It is evident that these types of helplines do fulfill language should be the mode of communication a felt need of the community in a crisis situation. on this type of service.
References
[1] Yadava RL, Narsimham MVVL. Dengue/dengue [5] Ministry of Health and Family Welfare haemorrhagic fever and its control in India. Government of India. Annual Report 2005- Dengue Newsletter. 1992; 17: 3-8. 06. New Delhi: MOH&FW, 2006. p. 59-74. [2] Kalra NL, Kaul SM, Rastogi RM. Prevalence of [6] Personal communication: PL Joshi, Director, Aedes aegypti and Aedes albopictus – Vectors National Vector-borne Diseases Control of dengue and dengue haemorrhagic fever in Programme, Government of India, 24 north, north-east and central India. Dengue November 2006. Bulletin .1997; 21: 84-92. [7] All India Institute of Medical Sciences. Press [3] Kaul SM, Sharma RS, Sharma SN, Panigrahi releases on dengue updates from AIIMS from N, Phukan PK, Shiv Lal. Preventing dengue October 2-18 October 2006 and published and DHF: The role of entomological in the Times of India and other dailies from surveillance. J Comm Dis. 1998; 30: 187-192. New Delhi. [4] Kabra SK, Verma IC, Arora NK, Jain Y, Kalra V. [8] All India Institute of Medical Sciences. Annual Dengue haemorrhagic fever in children in Report 2005-06: New Delhi, AIIMS, 2006. Delhi. Bull World Health Organ. 1992; 70(1): 105-8.
Dengue Bulletin – Volume 31, 2007 181 Book review
Report of the WHO consultation on integrated vector management (IVM)
WHO Headquarters, Geneva, Switzerland, 1-4 May 2007
WHO/CDS/NTD/VEM/2007.1
The consultation on integrated vector (3) Action must be evidence-based, so it is management (IVM) took place at the essential to intensify applied research headquarters of the World Health Organization and monitoring and evaluation to assess (WHO) in Geneva, Switzerland, from 1 to 4 May the impact and performance of vector 2007. Its purpose was to bring together experts control, both to refine implementation in IVM from country, regional and global levels of IVM and to provide data for advocacy. to advance the development and promotion of (4) Develop an institutional framework to the IVM approach, as set out in the Global promote, further develop, implement strategic framework for integrated vector and scale up IVM, including national [1] management, by reviewing current status and legislative frameworks. developing a practical strategic plan for the next three years. The main conclusion of the meeting was that now is the time to tap the preventive power The four key recommendations of the of vector control, given the serious risks of consultation were: increasing transmission of vector-borne diseases related to climate change, population movement (1) In order to fully embed IVM in all control and environmental degradation, and the major programmes dealing with vector-borne opportunities for financial support. diseases, concerted efforts should be made, through advocacy and social The next steps will be to promote and mobilization, to articulate the need for implement the strategic plan, propose WHO and benefits of IVM and to mobilize appoint a panel of experts on IVM to guide its resources for implementation. development, organize a follow-up meeting with wider representation of other sectors and disease (2) The current human resource and control programmes and develop the IVM infrastructure base for IVM is inadequate concept through the homepage of the VEM web to meet increasing demands. This must site. be addressed urgently, through capacity- building, and both needs-based training and institutional development, to ensure Reference those trained receive continued [1] World Health Organization. Global strategic mentoring and support, and can function framework for integrated vector management. in systems where their skills are most Geneva, WHO, 2004. Document WHO/CDS/ effectively applied. CPE/PVC/2004.10.
182 Dengue Bulletin – Volume 31, 2007 Book review
Report of the Scientific Working Group meeting on dengue
Geneva, 1-5 October 2006
TDR/SWG/08
Dengue is the most rapidly spreading vector tangible benefits for people in disease endemic borne disease. An estimated 50 million dengue countries within the coming years as well as infections occur annually and approximately 2.5 outline a strategic vision for applied and basic billion people live in dengue endemic research from which benefits would be felt in countries. Because of the rapidly increasing the medium to long term. public health importance of this disease, in 1999 dengue was incorporated in the portfolio As a result of major demographic changes, of the UNICEF, UNDP, World Bank, WHO rapid urbanization on a massive scale, global Special Programme for Research and Training travel and environmental change, the world, in Tropical Diseases (TDR). The 2002 World particularly the tropical world, faces enormous Health Assembly Resolution WHA55.17 urged future challenges from emerging infectious greater commitment to dengue among diseases. Dengue epitomizes these challenges. Member States and WHO; of particular In the early years of the 21st Century we are significance is the 2005 Revision of the collectively failing to meet the challenge posed International Health Regulations (WHA58.3), by dengue as the disease spreads unabated which includes dengue as an example of a and almost 40% of the world’s population now disease that may constitute a public health lives at risk of contracting the disease. There is emergency of international concern. currently no specific clinically useful diagnostic test, no drugs, and no vaccine, and we have It was against this background that the failed to widely or effectively implement Dengue Scientific Working Group of 60 experts existing vector control and clinical management from 20 countries including WHO staff from measures that we know would help to reduce four Regions and Headquarters met in Geneva the vector population and reduce case fatality in October 2006 to review existing knowledge rates. Yet there has never been a more on dengue and establish priorities for future optimistic time to be involved in dengue and dengue research aimed at improving dengue dengue research, and interest in the disease treatment, prevention and control. The goal has attracted a new generation of talented and of the Scientific Working Group was to outline committed clinicians and scientists. Modern a research agenda by identifying bottlenecks science, from clinical medicine to basic research and making detailed and specific research on pathophysiology, drug and vaccine discovery, recommendations. The SWG wanted to through to the social and behavioural sciences identify areas of research that could lead to and vector biology and control, offers a unique
Dengue Bulletin – Volume 31, 2007 183 Report of the Scientific Working Group on dengue, 2006 opportunity to make a tangible and substantial Global dengue research impact on dengue over the next decade. But in order to achieve what is possible, a paradigm agenda shift is required in our current approach. The dengue research community needs to: push The priority dengue research areas are organized for much greater implementation of existing around four major research streams, which will knowledge to reduce case fatality rates, extend provide evidence and information for policy- basic and clinical research to understand the makers and control programmes and lead to underlying pathophysiology, aid diagnostics and more cost-effective strategies that will reverse drug discovery and further improve clinical the epidemiological trend. outcome, speed up the development of vaccine candidates including moving as quickly Stream 1: Research related to as possible to efficacy trials, and gather evidence for implementing best practices for reducing disease severity and control of the vector. case fatality
All of this is possible in the next ten years. Optimization of clinical management But to achieve this, dengue needs a much stronger voice within dengue endemic countries An efficient out-patient system and clinical and and within the global public health community laboratory indicators of early dengue virus to persuade society, funding agencies and infection, plasma leakage and shock, as well policy-makers of the importance of the disease. as an effective and safe method of managing We are at a critical epidemiological juncture in severe haemorrhage, dengue in pregnancy, and infectious, particularly viral, emerging diseases patients with co-morbidity, need to be validated at the start of the 21st Century, and in many in order to scale up the use of improved ways dengue serves as a model for how we treatment guidelines. might meet that challenge. The lessons learned from dengue will have implications for a It is recommended to analyse: number of other diseases and our approach to • New methods and guidelines for triage their control. The implementation of the best and out-patient care. of existing knowledge and practice supplemented by future research applied in • The validity, role and accessibility of an integrated, holistic fashion can be expected available and new diagnostics. to significantly change the lives of individuals • The predictive value of prognostic living in dengue-endemic countries in the markers (host and viral, non-invasive coming years. The Scientific Working Group measurement of vascular leakage). hopes this research agenda will help provide a • Standardized approaches to strategic plan for how we might collectively determining and documenting severe achieve the aims of reducing morbidity and disease and response to treatment. mortality based on better understanding of the pathophysiology associated with dengue, on • Best practices for the treatment of implementation strategy, and on reduction of dengue including early treatment to virus transmission. reduce severity, treatment of
184 Dengue Bulletin – Volume 31, 2007 Report of the Scientific Working Group on dengue, 2006
established shock, and effective and • The mechanisms of virus entry and safe management of haemorrhage. cellular/tissue tropism. • The impact of co-morbidities on • T and B cell responses and their disease severity, and the effect of relation to immunopathology and pregnancy. protection. • The causes of dengue deaths • Genetic predisposition to dengue. (including treatment failures). Stream 2: Research related to Process and impact evaluation of transmission control through staff training improved vector management
Training programmes in case management can Development and evaluation of vector help to rapidly reduce case fatality. However, control tools and strategies training has to be standardized and adapted to the prevailing local health care system and best The effectiveness of powerful vector control practice has to be identified and implemented tools has been compromised by issues of in dengue-endemic countries. delivery, coverage and acceptability. Promising new tools and approaches need to be It is recommended to analyse: evaluated.
• The process and impact of existing/ It is recommended to analyse: future training programmes. • The efficacy of new vector control Critical issues in dengue pathogenesis tools and strategies in different contexts. A better understanding of dengue pathogenesis • Combinations of new and/or existing will provide a foundation for future rational tools in different contexts. clinical interventions. In particular we need to • The scaling up of successful pilot understand the changes underlying: endothelial projects to state or national level. permeability in plasma leakage, dengue virus diversity, and immune response to dengue Surveillance and response viruses. Strengthening of surveillance systems through It is recommended to analyse: development and validation of reliable risk • The physiological and molecular indicators and the application of information mechanisms leading to vascular leak technology is needed for improved decision- and haemorrhage. making. • The host genetic factors associated It is recommended to analyse: with dengue severity. • The dengue viral factors and antigenic • Improved methods and their subtypes related to tropism, epidemic application/standardization in potential, and virulence. operational contexts. • The mechanisms of antibody-mediated • The development and utilization of enhancement and protection. early warning and response systems.
Dengue Bulletin – Volume 31, 2007 185 Report of the Scientific Working Group on dengue, 2006
• The triggers that will allow effective It is recommended to analyse: response to incipient epidemics. • Viral-encoded proteins for drug, • The contribution of information diagnostics and vaccine design. technology to decision-making. • New (including natural) products or existing licensed drugs. Stream 3: Research related to primary and secondary prevention Stream 4: Health policy research Vaccines contributing to adequate public health response Vaccines offer the greatest hope for dengue prevention and there are several candidates in There is a contradiction between the high clinical development. The identification of priority afforded to dengue at political level and vaccine components that are suitably safe and the low level of resources allocated to dengue immunogenic, and of immune correlates of prevention and control programme activities. protection, should accelerate successful vaccine Health policy research will facilitate a redress development and regulatory approval. of this imbalance.
It is recommended to analyse: It is recommended to analyse:
• New vaccine candidates, adjuvants, • Tools for rational decision-making and and vaccination strategies. adequate prioritization of dengue, such as studies of dengue burden and costs • Correlates of protective immunity for of illness. use as an endpoint in vaccine trials. • Factors leading to success or failure of • Immune responses in vaccine trials national programmes. and natural infections. • Decision-making that results in • Prospects for phase 3 and 4 vaccine declaration of state of emergency. evaluation trials in multiple field sites. • The importance and burden of dengue • Issues associated with future vaccine in less studied regions (e.g. Africa). usage and coverage, including cost- effectiveness studies of implementation. Conclusion The Scientific Working Group hopes this Drugs research agenda will help provide a strategic plan for how we might collectively achieve the Anti-dengue drugs may have prophylactic (e.g. aims of reducing dengue morbidity and outbreak prevention) and therapeutic (e.g. mortality and its negative socioeconomic prevention of severe disease) uses, including impact. Donors and the research community potential for impact on incidence and severity are encouraged to take part in this major of ensuing disease. Anti-viral drug discovery for programme and to contribute through timely dengue has accelerated in recent years along information to the database TDR is establishing with our knowledge of ‘drugable’ targets in the for keeping track of research activities and virus. relevant findings.
186 Dengue Bulletin – Volume 31, 2007 Book review
Outbreak and spread of chikungunya
Weekly Epidemiological Record, No. 47, 2007, 82, 409-416
http://www.who.int/wer
Chikungunya is a mosquito-borne disease first outbreaks during the 1960s, were followed by described during an outbreak in the southern relatively little transmission after 1973. part of the United Republic of Tanzania in Chikungunya outbreaks are often separated by 1952. The name chikungunya derives from a periods of >10 years when infection is not root verb in the Kimakonde language meaning apparent. For example, in Indonesia, “to become contorted” and it describes the chikungunya occurred sporadically until 1985 stooped appearance of sufferers with arthralgia. after which there were no reports until a series The causative agent is an alphavirus of the family of outbreaks between 2001 and 2007. Togaviridae. Since the first description of chikungunya, there have been numerous outbreaks in Africa, India and South-East Asia, Recent outbreaks, 2001–2007 the principal vectors being Aedes mosquitoes, of which Aedes albopictus and Ae. aegypti are Starting in February 2005, a major outbreak the most important. Chikungunya often occurred among islands in the western part of produces a mild illness that may be confused the Indian Ocean, affecting the Comoros, with dengue, since symptoms include fever, Madagascar, Mayotte, Mauritius, La Réunion headache, arthralgia, myalgia and rash. Although and the Seychelles (Figure). In La Réunion, by serious complications are uncommon, arthralgia June 2006 there had been an estimated can be debilitating and may persist for months 266 000 cases, accounting for roughly one third or even years after infection; in elderly people, of the population. Chikungunya continued to chikungunya can be a contributing factor to circulate in La Réunion in 2007, albeit at a death. In immunologically naive populations, much reduced level. The major vector in La where mosquito vectors are numerous, Réunion is Ae. albopictus, which appears to epidemic outbreaks may occur affecting many have displaced Ae. aegypti on much of the thousands of people. Outside of epidemics and island as it has also in some other regions. wherever serological surveillance is lacking, the During this period, there were an estimated diagnosis of chikungunya may easily be missed. 9000 cases of chikungunya in the Seychelles, Chikungunya circulated in West and East Africa 7290 in Mayotte and about 6000 in Mauritius. at relatively low levels until 1999–2000 when Associated with this outbreak in the Indian around 50 000 people became infected during Ocean islands, there were a large number of an outbreak in the Democratic Republic of the imported cases of chikungunya in Europe, Congo. Evidence from India suggested that occurring in returning tourists and visitors,
Dengue Bulletin – Volume 31, 2007 187 Outbreak and spread of chikungunya
Figure: Geographical distribution of chikungunya cases 2001–2007 (data are presented as reporting period followed by the estimated number of cases, where data are available)
particularly those returning from La Réunion. were estimated at 45% in some areas. The Metropolitan France experienced the largest outbreak was first noticed in Andhra Pradesh number of cases: between April 2005 and and it subsequently spread to Tamil Nadu. August 2006, there were 808 imported cases Thereafter, Kerala and Karnataka were affected; of chikungunya confirmed by serology. The subsequently, the outbreak spread northwards temporal change in numbers reflected the rise as far as Delhi. During 2007, up until 12 and decline of the epidemic in La Réunion, October, a further 37 683 cases had been with a peak of 178 cases in March 2006. reported by national authorities, largely in areas Elsewhere in Europe, cases were reported from not involved in the previous year’s epidemic. Germany, Italy, Norway and Spain. In India, the persistent and disabling arthralgia following infection has been of particular Ae. albopictus has been inadvertently concern. In some areas, the outbreak was introduced into several European countries during associated with high densities of Ae. albopictus, the past 30 years; these countries include Albania, but Ae. aegypti is thought to be the major vector Belgium, Bosnia, Croatia, France, Greece, Italy, elsewhere. During 2006, there were also Montenegro, the Netherlands, Serbia, Slovenia, outbreaks in the Andaman and Nicobar islands, Spain and Switzerland. Although Ae. albopictus Malaysia, and by November 2006, chikungunya occurs in the departments of Alpes-Maritimes and had appeared in Sri Lanka. Between January Var in France, where cases of chikungunya that 2001 and April 2007, Indonesia reported 15 207 originated in La Réunion have been diagnosed, chikungunya cases from 7 provinces, with a there has been no evidence of local transmission. peak in 2003. During 2006, there were 9 imported cases of chikungunya in the Caribbean, During 2006, there was a large outbreak of involving Martinique, French Guyana and chikungunya in India, with 1.39 million officially Guadeloupe; these mainly occurred in travellers reported cases spread over 16 states; attack rates
188 Dengue Bulletin – Volume 31, 2007 Outbreak and spread of chikungunya from the Indian Ocean islands. The Caribbean affected area of Kerala (India) and returned to is an area of active dengue transmission, the Italy in mid-June, developing symptoms shortly vectors of which are also vectors of chikungunya, thereafter. The peak of the outbreak occurred hence the region is vulnerable to local in the third week of August. Epidemiological transmission. In 2006, in the United States, 37 data suggest that transmission took place at 4 cases of chikungunya were confirmed in different localities in Emilia-Romagna, and the returning travellers, 32 from India, 3 from Sri virus has been isolated from local Ae. albopictus Lanka, 1 from La Réunion and 1 from Zimbabwe. mosquitoes. In 2006, in the United States, 35 cases of chikungunya were confirmed in returning It has been confirmed that European Ae. travellers, 2 returning from La Réunion and 33 albopictus are susceptible to infection with from India. The United States is also vulnerable chikungunya virus from the Indian Ocean to local transmission owing to the wide outbreak. Samples of this mosquito, collected distribution of Ae. albopictus. Large areas of as eggs from the Alpes-Maritimes, France, have Central and South America are similarly been reared in the laboratory and the adult vulnerable owing to the presence of abundant females experimentally infected by feeding on populations of both Ae. aegypti and Ae. blood containing a strain of chikungunya virus albopictus. derived from La Réunion. When Ae. albopictus were examined 12–14 days after engorgement, In 2007, there was an outbreak of 27/35 (77%) showed evidence of infection in chikungunya in Gabon, mainly affecting the head. Such a high infection rate supports Libreville. Symptoms included headache, severe the view that this strain of the virus is well adapted arthralgia and skin rash. Up until 24 June, a total to transmission by this mosquito species. In the of 17 618 cases had been reported, with 808 same experiments, 33/49 (67%) Ae. detritus hospitalizations. During a mosquito survey in became infected. This species commonly bites Libreville in November 2006, Ae. albopictus was humans and has a wide distribution in the found for the first time in Gabon, and virus was Palaearctic Region, breeding in coastal and inland subsequently isolated from field populations of saline water. Ae. caspius, another species from this species collected at the time of the the Palaearctic Region found in brackish water, outbreak. Ae. aegypti is also common in the city, showed an infection rate of 4/16 (25%). A single but none of the specimens collected at the same female Ae. vittatus survived the incubation period time were positive for chikungunya virus. and was found to be infected. This study raises the possibility that these other mosquito species In August 2007, the first cases of may play a role in transmission during an outbreak indigenous transmission of chikungunya in of chikungunya. Europe were reported from a largely rural area in the provinces of Ravenna and Forlì-Cesena Genotyping of viral isolates has provided in the Emilia-Romagna region of north-east Italy. useful information on the possible origins of the Ae. albopictus is widespread and numerous outbreak in the Indian Ocean islands as well as within much of Italy. Between 15 June and 21 evidence for the circulation in that outbreak of September 2007, 292 suspected cases of viruses with a high evolutionary potential. During chikungunya were identified in the region outbreaks, arboviruses such as chikungunya through a programme of active surveillance; diversify due to mutation, leading to several many have been laboratory-confirmed. The identifiable strains. Chikungunya virus has its index case is presumed to be a person from origins in continental Africa and is related to the the region who travelled to a chikungunya- virus responsible for o’nyong-nyong. The
Dengue Bulletin – Volume 31, 2007 189 Outbreak and spread of chikungunya chikungunya virus circulating in the outbreak in areas and in shady city parks. Ae. aegypti is more the Indian Ocean islands represents a distinct closely associated with human habitation and clade within the East-Central-South African exploits indoor breeding sites, including flower phylogroup, compatible with its recent origin in vases, water storage vessels and concrete water the African region. However, evidence from tanks in bathrooms, as well as the same artificial genotyping suggests that some time after the habitats outdoors as Ae. albopictus. virus reached La Réunion, before transmission rates rose steeply, a mutation occurred that enabled more effective transmission by Ae. Control measures albopictus. If this hypothesis were confirmed, it could help explain the rapid spread and A key factor in the increasing geographical range dissemination of chikungunya after it reached and prevalence of Ae. albopictus has been the La Réunion. The viral genotype involved in the globalization of trade, particularly the large outbreak in India is from the same lineage transportation of used tyres between countries as that seen in La Réunion, whereas previous and continents. Both Ae. aegypti and Ae. outbreaks in India have involved an Asian albopictus have drought-resistant eggs that genotype of the virus. remain viable over periods of several weeks, enabling them to survive lengthy journeys with Although the 2 major mosquito species, sea-borne freight, and on aircraft or long- Ae. aegypti and Ae. albopictus, have been distance road transport. For these reasons, some implicated in the larger outbreaks of countries have introduced a ban on the chikungunya, within Africa, several other importation of used tyres. Both mosquito mosquito vectors have been implicated, species are competent vectors of other including species of the Ae. furcifer-taylori group arboviruses, including dengue, so there are and Ae. luteocephalus. In this region, various wider public health concerns about the primates have been implicated as reservoir accidental transfer of these species between hosts. Elsewhere in Africa, little is known of countries and continents. the possible role animals have as reservoirs or of other mosquitoes as vectors. It will be impossible to eliminate Ae. albopictus with current technologies in areas Whereas Ae. aegypti is confined to the where it has become well established (the tropics and subtropics (approximately within the Americas, Cameroon, Italy and Nigeria). In 10° isotherms), Ae. albopictus also occurs such regions, efforts should concentrate on extensively in temperate and even cold– reducing vector density in order to reduce the temperate regions, thereby extending the risk of transmission. Where a newly introduced geographical range over which chikungunya Ae. albopictus population is detected transmission may occur. Ae. albopictus exploits sufficiently early, concerted efforts, including a wider range of breeding sites than Ae. aegypti. the use of insecticide applications, are required These include bromeliads, coconut husks, cocoa to prevent this species becoming established; pods, bamboo stumps, tree holes and rock pools there are examples of the successful use of in addition to outdoor artificial containers, this approach. In areas at high risk for the including vehicle tyres, various discarded introduction of Ae. albopictus, good vector containers and saucers beneath plant pots. This surveillance is required since there is only a diversity of larval habitats explains the abundance short window of opportunity to eliminate new of Ae. albopictus in rural as well as periurban foci before they become established.
190 Dengue Bulletin – Volume 31, 2007 Outbreak and spread of chikungunya
Chikungunya poses considerable problems mosquito nets. The potential risks of for public health authorities once an outbreak transmission through donation of blood or has commenced. The major environmental organs should also be considered. measures used to reduce sources of mosquito breeding may not be fully implemented within the timescale of an outbreak. Few public health Personal protection programmes are up to the task of responding to large epidemics of arboviruses, but those For individual protection during outbreaks of countries with good routine programmes of chikungunya, clothing that minimizes skin vector surveillance and control are better able exposure to the day-biting vectors is advised. to mitigate the effects of an outbreak. Repellents may be applied to exposed skin or to clothing. Repellents should contain DEET Measures to reduce the number of water- (N, N-diethyl- 3-methylbenzamide), IR3535 (3- containing receptacles may contribute [N-acetyl-N-butyl]-aminopropionic acid ethyl significantly to a reduction in emergent ester) or icaridin (1-piperidinecarboxylic acid, mosquitoes, but such action needs to be based 2-[2-hydroxyethyl]-1-methylpropylester). They on sound knowledge of the ecology of the should be applied in strict accordance with label immature stages of the mosquito in that specific instructions. Insecticide-treated mosquito nets location. During an arbovirus outbreak, a afford good protection for those who sleep reduction in transmission may require the during the day, particularly young children. application of insecticides as space sprays, as Where indoor biting occurs, mosquito coils or residual applications on surfaces in and around other insecticide vaporizers may also reduce container habitats where mosquitoes alight, and biting. as larvicides to kill the immature stages. Source reduction will be particularly difficult in rural areas where numerous natural, as well as man- Surveillance made, breeding sites may occur. Nevertheless, reducing the number of containers in and Accurate data on the extent of infection in the around the home is to be encouraged, and human population requires the use of the most important health messages for the immunological testing, such as enzyme-linked public relate to actions that can be taken to immunosorbent assays (ELISA) for the detection reduce the number of habitats. of immunoglobulin M and immunoglobulin G anti-chikungunya antibodies. Various reverse In urban areas, used-tyre dumps enable transcriptase–polymerase chain reaction (RT- large-scale breeding, particularly of Ae. PCR) methods are available; they are of variable albopictus, and require focused control sensitivity and some will detect very low levels measures, including the application of of viral transcripts. Some are suited to clinical insecticides. In the longer term, investment in diagnosis and others to surveys. RT-PCR products recycling programmes for tyres should be from clinical samples may also be used for encouraged. In hospitals and other health-care genotyping of the virus, allowing comparison settings where chikungunya (and dengue) with virus from various geographical sources. patients may be treated, vector control measures should be routinely applied and In areas of particular risk, routine vector intensified during outbreaks. Viraemic patients surveillance is essential for effective vector should be nursed in screened wards or under control, as identified above.
Dengue Bulletin – Volume 31, 2007 191 Book review
Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations#
Dana A. Focksa and Neal Alexanderb
aInfectious Disease Analysis, Gainesville, Florida, USA bInfectious Diseases Epidemiology Unit, London School of Hygiene and Tropical Medicine, London, UK
Rationale The objective of this multicountry study was to evaluate the practicality of the survey method Dengue fever and the potentially lethal and whether it can consistently identify and haemorrhagic form of dengue are a fast growing classify particularly productive classes of public health problem worldwide (50 million container, and so provide guidance on cases with 500 000 manifesting shock and/or development of targeted control strategies. As haemorrhage each year), and particularly will be discussed in greater detail, containers important in the Americas and Asia. The only may be classified on any number of criteria such known strategy for reducing dengue transmission as descriptive name, volume, use, is to reduce the vector population, which is abandonment, location indoors or out, etc. The achieved through interventions in domestic and results from this study will have important peri-domestic water containers. However, little consequences for the development of improved is known about the efficacy of interventions dengue control strategies. targeted to specific classes of water-holding container, and there is uncertainty about the It is important to emphasize that best indicators to use for measuring the success operationally, pupal/demographic surveys are of interventions on vector populations. expected to be conducted infrequently, perhaps only at the beginning of a process to TDR financed a multicountry study identify the epidemiologically important involving nine Latin American, Asian, and container classes to target. When targeted African countries, based on the rationale that interventions via community participation certain water containers are particularly methods are under way, the primary survey productive of the dengue vector, Aedes aegypti goal would be simply to determine the actual (L.), and that, therefore, an intervention amount of intervention in place without larvae targeted to these containers would bring vector or pupae being counted. densities below the threshold for epidemic transmission. This pupal/demographic survey This document summarizes the large method was described recently.[1] amount of data created by the nine study teams
# For complete details, please access the original document TDR/IRM/DEN/06.1
192 Dengue Bulletin – Volume 31, 2007 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations with the goal of serving as a reference text for estimation of this important variable.[2] Because other researchers as well as for control pupae can be counted and are highly correlated programmes which are expected to adopt the with the standing crop of adults, a survey targeted intervention technique. The document method involving counting pupae and people reflects the fact that today, most dengue has been developed.[3] Mechanistic and control efforts are based on suppression of Ae. mathematical models of dengue transmission aegypti and not on eradication; these efforts have been developed that allow estimation of would benefit from answers to the following transmission thresholds in terms of Ae. aegypti questions: pupae per person as a function of temperature and herd immunity; it is only this statistic that • How much suppression is adequate can provide estimates of how much reduction to be prophylactic for dengue is necessary to be prophylactic for dengue outbreaks in a particular location (Table outbreaks (Table 2). The practical challenges 2)? of obtaining this statistic and its usefulness in • How do we monitor the degree of developing targeted strategies are the subject suppression achieved in ongoing of this paper. programmes? Several authors have recently made the Some have recently been advocating an case that use of the traditional Stegomyia additional question: indices as epidemiologic indicators of dengue transmission risk should be abandoned as they • Given that the epidemiological have a number of serious shortcomings.[1] The importance of a particular class of argument is that a pupal and demographic container is the product of the average survey that provides an estimate of the number adult productivity and the abundance of pupae per person in a community by class of that class of container in the of container, e.g. drums, flower vases and pots, environment, how do we select cisterns, abandoned containers, discarded tyres, subsets of containers for intervention is more appropriate for assessing risk and such that we minimize labour and directing control operations. The ratio of pupae costs while maximizing reduction of per person is used for several reasons: adults? And finally, • Unlike any of the other mosquito life- cycle stages, it is possible to actually • In developing a targeted strategy, how count the number of Ae. aegypti pupae many households must be surveyed in most domestic environments (for to be confident that the important exceptions, see summary of the Viet container classes have been Nam study below). identified? • Container-inhabiting Stegomyia pupae Answering the first question involves an are easily and inexpensively separated understanding of transmission thresholds – from other genera and identified to what they represent and how they are species as pupae or adults. estimated. Thresholds are a function of many • Because pupal mortality is slight and factors, but a key factor is the ratio of the well-characterized, the number of numbers of adult Ae. aegypti and people, hence pupae is highly correlated with the the need for a survey method that permits number of adults.
Dengue Bulletin – Volume 31, 2007 193 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations
• The statistic of pupae per person can sum of the number of people living in the be related to transmission risk and residences inspected. Sorting the list of container provide target levels of reduction classes by their associated number of pupae per required in control efforts.[2] person quickly identifies the productive and non- The survey method being evaluated in these productive classes of container. studies is called the pupal/demographic survey, While exhaustive counts of pupae in every so named because we count both pupae and container are certainly more labour intensive the number of people associated with them. In than simply noting whether a container has practice, such a survey involves visiting 100 or larvae and/or pupae (as in the various traditional more residences (see section on survey size Stegomyia indices), the pupal/demographic requirements below), usually by two inspectors survey permits us to know the number of equipped with nothing more than a few litres pupae per person associated with the various of clean water, a sieve,* some largemouth classes of container in the environment. This pipettes, a white enamel pan, and small shell statistic, Ae. aegypti pupae per person by class vials. The inspectors request permission to of container, is not an index after the fashion examine the water-holding containers in a of the Stegomyia indices, rather it is the house, and enquire as to the number of people epidemiologically significant statistic, the ratio living in the house (or sleeping there the previous of hosts and vectors; published transmission night). With permission, they proceed to strain thresholds permit us to appreciate this statistic the contents of each container at the location, in the context of estimates of herd immunity re-suspending the sieved contents in a small and ambient temperatures.[2] What each of the amount of clean water in the enamel pan, from studies summarized below demonstrates is that where the pupae from each container are some classes of container are more important pipetted into a labelled vial. If there are other by virtue of their production of Ae. aegypti container-inhabiting species in the area besides adults than others, and that this leads logically Ae. aegypti, the contents of each vial are to the development of targeted interventions. transferred to small cups covered with bridal An earlier publication provides a discussion of veil secured with a rubber band; these are held the utility of other indices for dengue risk in the lab until the adults emerge, when they assessment and control.[2] can be identified. As a minimum, the data recorded for each container include the type of The objectives of this document are to: container (drum, bottle, etc.), location (indoors, outdoors, under vegetation, etc.), method of • Summarize the key findings from the filling (manually, by rain, roof runoff, etc.), and nine study sites of the multicountry the number of pupae by species. These inputs project on pupal/demographic survey are used to develop a classification scheme (see methodology. container classification section below). Data are usually summarized by container class on a • Outline the prospects and limitations spreadsheet; for each container class found, of this survey methodology. simply add up the number of pupae associated • Draw conclusions and propose further with that type in the survey, and divide by the research and implications for dengue prevention and control programmes.
*USA standard sieve series, number 30 sieve (equivalent to ASTM designation E11, 600 μm [0.0243"] opening)
194 Dengue Bulletin – Volume 31, 2007 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations
Key findings of the longterm (>5 years) and repeated longitudinal pupal/demographic surveys in Iquitos, Peru,[3] multicountry study and Yogyakarta, Indonesia, indicate that pupal production by container type is remarkably • The pupal/demographic survey stable over time and suggest, as stated above, identifies epidemiologically important that only an initial, high quality survey may be and unimportant types of container required. • Containers and sites can be classified using different schema Calibrated sweep net surveys may provide a method for estimating absolute numbers of • Distribution of Ae. aegypti pupae per pupae for some types of container. However, container is strongly clumped calibration factors determined in one location • A potentially important class of should be used with great caution in another container, the rare but extremely area, where subtle differences in climate, productive container elevation, methods of handling water, etc., may • Survey size requirements to develop influence productivity, and hence accuracy. a targeted control strategy Further research Prospects and limitations of the pupal productivity survey Evaluate dengue control strategies methodology using transmission thresholds and pupal/demographic survey • Results are useful in developing methodology targeted source reduction/control strategy for dengue Since the appearance of dengue haemorrhagic fever in South-East Asia in the 1960s and its • Difficulty of surveying large containers subsequent spread to the Americas and Oceania, several control strategies have been advocated. Conclusions, further research, Ultra low volume (ULV) spray applications applied and implications for dengue through national control programmes were given prominence for several decades. While it was prevention and control documented that the sprays certainly killed adult programmes mosquitoes, their use in controlling epidemics was harder to demonstrate. Transitory but Conclusions infrequent depressions in adult mosquito survival simply could not suppress dengue transmission The studies have confirmed that the pupal/ in endemic locations. As appreciation of the demographic survey provides the necessary inadequacies of ULV grew in the public health data for developing targeted strategies. The community, the focus of control efforts turned method certainly requires more labour than do to involving affected communities, and much was the traditional Stegomyia indices, but on a cost/ made of community participation for the purpose benefit analysis, the traditional measures fail of source reduction and/or control. Yet because, regardless of cost, they cannot inform experience, with the exception of the two vertical targeted strategy nor can they be used for and national programmes of Singapore and Cuba, transmission risk assessment. Unpublished has been disappointing. Some thought the
Dengue Bulletin – Volume 31, 2007 195 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations problem lay with an inadequate understanding fails, it is critical to know whether failure is on the part of the communities and that, with attributable to inadequate control in targeted time and education, dengue control could be containers or if the problem lies with the notions achieved. Others suggested that another factor of targeted intervention and transmission was at work—that the public was in fact threshold. conducting a cost–benefit analysis with regard to dengue—and simply concluded that preventing mosquito breeding in all containers every day Estimate the amount of suppression indefinitely was, as indicated by practice, simply required in interventions using not worthwhile from a labour/time perspective. transmission thresholds The promise of targeted source reduction and control, building on the significant Mechanistic models of the dynamics of dengue accomplishments to date in the area of community have been used to estimate transmission participation, lies with reducing the labour and thresholds (the number of Ae. aegypti pupae costs in the cost–benefit calculation. With few per person) as a function of pre-existing exceptions, evaluations of community-based antibody levels in the human population (herd interventions were based on sociological evidence immunity) and ambient air temperature (Table such as an increase in knowledge, change in 1).[2] The threshold, an epidemiological concept practice, etc., and not on measurements of central to infectious disease control, is simply transmission or disease prevalence. Perhaps this the breaking or tipping point; at levels below is understandable in light of the time and effort threshold, infection rates and viral persistence required to change human behaviour with regard decline in the human population. Threshold to cigarettes, seat belts, etc. levels were estimated to range between 0.5 and 1.5 Ae. aegypti pupae per person for an In light of the foregoing comments, the ambient air temperatures of 28 °C and initial chief research recommendation of this seroprevalence of 0% to 67%. The concept of summary is to conduct targeted interventions transmission threshold has given us a new and with the dependent variable being some hopefully useful tool for monitoring targets for measure of transmission. Studies with source reduction/control efforts. Moreover, in significant funding can measure transmission terms of risk assessment, transmission directly using longitudinal serosurveys of infants thresholds provide estimates of the level of and adolescents using the prevalence of anti- elimination or control necessary to preclude dengue IgM as a proxy; other studies will have transmission (Table 2). In targeted to rely on case data. In addition, evaluations interventions, attempts should be made to of interventions should monitor the actual reduce the number of Ae. aegypti pupae per impact on pupal production in the targeted person to below the threshold estimate. Note containers.** If a targeted intervention effort in table 2 that several locations would require >70% reduction in adult production to be **A current evaluation in Yogyakarta, Indonesia, using prophylactic. pyriproxyfen to prevent adult emergence involves: weekly visual inspection of targeted containers for It goes without saying that we see the presence or absence of the compound; exceeding the threshold as being a necessary laboratory bio-assay of water collected from treated containers in the field; and laboratory observation of but not sufficient cause of transmission. The field- collected pupae for emergence success and table of transmission thresholds (Table 1) takes deformities. Transmission is monitored using: case into account the degree of susceptibility in the data, and seroprevalence of IgM in children and human population (and indicates the possible infants measured every three months.
196 Dengue Bulletin – Volume 31, 2007 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations
Table 1: Transmission thresholds in terms of should be used, e.g. 33%, to estimate the Ae. aegypti pupae per person as a function of target level of reduction in number of pupae ambient temperature and prevalence of per person. dengue antibody. This table shows the estimated number of Ae. aegypti pupae per The Cuban team noted that two measures, person required to result in a 0% probability the number of Ae. aegypti pupae per person of a 0% or greater rise in seroprevalence of and the number of pupae per hectare, were dengue antibody during the course of a year highly correlated (89%); they suggested that resulting from monthly viral introductions of a ‘pupae per person’ does not require single viraemic individual[2] documentation of human density and is, therefore, perhaps the more desirable statistic. Transmission threshold by initial It is important to note, however, that ‘pupae Temperature seroprevalence of antibody (°C) per hectare’ (an index) cannot be related to 0% 33% 67% risk of transmission because, among other 22 7.13 10.70 23.32 factors such as temperature and herd 24 2.20 3.47 7.11 immunity, dengue infection is a function of the 26 1.05 1.55 3.41 ratio of vector and host abundance, i.e. of pupae per person. The difference in cost is 28 0.42 0.61 1.27 minimal, but only ‘pupae per person’ permits 30 0.10 0.15 0.30 estimation of the degree of reduction 32 0.06 0.09 0.1 necessary to effect control (Tables 1 and 2).[2] Reprinted from: Focks DA et al.,[2] with permission High correlation between pupae per person from the American Society of Tropical Medicine and and pupae per hectare was also noted in the Hygiene. Peru study, and in Iquitos it was difficult to estimate the number of people per house with consequences of inadequately knowing the much confidence. herd immunity level). But transmission thresholds obviously make no statement about the presence or type of viruses that may or Continue evaluation of calibrated may not be circulating or introduced. sweep nets Transmission thresholds are useful for risk assessment and risk reduction. In the absence Based on the experiences of some study groups, of virus and a control programme, they speak obtaining absolute pupal counts in some types of receptivity to virus; in the endemic situation, of large container is a significant problem, they provide targets and end points for targeted suggesting that efforts to evaluate the calibrated source reduction/control programmes. In sweep net method are warranted. The Viet Nam targeted interventions, account should be taken team was able to identify the same container of seasonal variations in transmission threshold types to be targeted as identified by the pupal/ due to temperature fluctuation, and strategies demographic survey method. If the linear should provide sufficient reduction in Ae. relationship between abundance of late instars aegypti production to suppress transmission. In and pupae is consistent, it may be possible to dengue endemic areas where herd immunity use sweep net counts to estimate pupal levels (prevalence of anti- dengue IgG by abundance and evaluate strategies in terms of serotype) are unknown, conservative estimates reduction in pupae per person.
Dengue Bulletin – Volume 31, 2007 197 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations
Develop better classification examples of the utility of thinking in terms of schemes for containers, and new covariates of production and should be methods to locate rare but studied and applied to local surveys. Rapid especially productive containers location of especially productive classes of at house and block scales container could serve to further reduce the labour associated with targeted strategies. When rare but especially productive containers (REPCs) are encountered, priority should be given to: Implications for dengue prevention and control • elucidating the factors responsible for the anomalous production programmes • identifying the common features The results of these studies are encouraging— among REPCs discovered during the they suggest that control of transmission may survey (location, association with be possible with the treatment or elimination vegetation, type of container with of only a small portion of the large number of respect to material, use/non-use, etc.) classes of water-holding container found in the • developing a classification scheme environment. Each study identified the that includes factors to facilitate the important classes of container to be controlled, locating of REPCs without exhaustive and also the classes that could safely be ignored. survey. Commonly, the more productive classes were larger containers that were stable through time, The fact that REPCs are infrequently found, a feature that may make them more amenable that they appear as anomalies and are not to control with biological control agents or typical, should not mean serious consideration chemicals. Given that all control programmes is not given to this potentially important class are resource limited, this new and quantitative of container. Rare they may be, but most understanding of productivity can lead to reasonably sized surveys discover one or more targeted interventions that may be sustainable REPCs often accounting for a significant because control that relies on targeted strategy proportion of production. In addition to requires substantially less labour. A TDR discovering common factors associated with supported multicentre study on the cost- REPCs which might be useful in developing a effectiveness of targeted vs. non-targeted search strategy targeting them, another interventions will provide answers to this important question is whether their production question. is stable over time. If it is stable (the likely case) then we should probably always include an REPC class in our surveys to keep us mindful Reducing the number of breeding of their existence and importance, helping us containers will not cause an increase to think in terms of answering the three points above. in productivity of the remaining containers The container classification schemes developed in the studies in Peru, Puerto Rico, A common concern regarding targeted strategies and other countries, involving the concepts of is the notion that, immediately following the abandonment, location with respect to elimination of one or more classes of container, vegetation or placement, etc., are very good more oviposition, and hence more adult
198 Dengue Bulletin – Volume 31, 2007 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations
Table 2: Comparison of observed numbers of Ae. aegypti pupae per person in various dengue-endemic or dengue-receptive locations with estimated transmission thresholds based on average summertime temperatures and an initial seroprevalence of %. The column ‘% control’ is the degree of reduction in pupae per person necessary to reduce the observed field level to that of the threshold
Location Temp (°C)a Pupae per personb Thresholdc Ratiod % Controle Reynosa, Mexicof 29.4 2.75 0.26 10.4 90 Mayaguez, Puerto Ricof 26.6 1.73 1.05 1.7 40 Trinidad (20 sites) 27.0 22.7g 0.86 26.4 96 El Progreso, Honduras 29.1 0.34 0.31 1.1 10 San Juan, Puerto Ricof 27.8 2.75 0.58 4.7 79 Bangkok, Thailand 29.2 1.69 0.29 5.8 83 a Temp refers to average temperature during the months of June–August or December–February in locations above and below the equator, respectively. b Pupae per person refers to the average number of Ae. aegypti pupae per person observed in the survey. c Threshold refers to the estimated number of Ae. aegypti pupae per person that will preclude epidemic transmission. These estimates were derived from dengue transmission models. Because the models are stochastic, around this tipping point or transmission threshold, multiple model runs under the same conditions typically have little or no subsequent transmission following the introduction of a single viraemic individual times per year. The values shown in the table are based on thresholds assuming an initial seroprevalence of %. d Ratio is the ratio of observed pupae per person and the estimated temperature—and seroprevalence-specific threshold. e % Control is the degree of reduction in pupae per person necessary to reduce the observed field level to that of the threshold. f Unpublished studies conducted by Focks in collaboration with others. Surveys in Puerto Rico and Mexico were limited and preliminary. g Observed range: .4–6 .4 pupae per person; the island-wide average is used for calculation. Reprinted from: Focks DA et al.,[2] with permission from the American Society of Tropical Medicine and Hygiene. production, will occur in the remaining 100 females (10 days x 10 containers x 1 new containers. However, adult production is in female per day per container). Further, lets equilibrium with, and is a function of, the rate assume an average fecundity of 25 eggs per at which food arrives (or is produced) in the day per female. Expected daily oviposition at container; adult production is not a function of, our location would be 2500, or 250 eggs per nor is it limited by, the rate of oviposition. In container—each day 250 eggs are laid, yet each the population dynamics of Ae. aegypti there is day only 2 adults emerge from each container. a surfeit of eggs and a paucity of food.[4] The high rate of mortality between oviposition Consider a location with ten containers, each and emergence is due to a number of factors producing an average of two adults per day. If including egg predation and density-dependent we assume an even sex ratio and an average larval mortality; there are simply more eggs laid lifespan of about 10 days, these 10 containers than the larval environment can support. As there would be associated with a standing crop of are no density-dependent survival factors in the
Dengue Bulletin – Volume 31, 2007 199 Multicountry study of Aedes aegypti pupal productivity survey methodology: Findings and recommendations adult stage, elimination of 25% or 50% of adult biological control agents, or insect growth production results in a similar reduction in the regulators, neither the number of oviposition standing crop of adults.[5] sites nor the amount of food declines. Our treatment has eliminated the production in In a targeted source reduction campaign, some containers, thereby lowering the standing in addition to removing the waterholding crop of adults and oviposition. One might containers, the associated Ae. aegypti larval wonder if productivity would go down in food is removed from the environment and untreated containers, oviposition rates in them productivity of the environment goes down, being somewhat lower, as a lower number of as does the standing crop of adults. Any females is associated with the same number transient rise in oviposition in untreated of containers. Simulation and field studies in containers is met with increased density- Kenya suggest that until adult populations are dependent larval mortality as productivity is a reduced by >40%, container productivity will function of food availability—recall the large not be limited by lowered oviposition rates ratio of daily oviposition and emergence. In because food-based density-dependent larval contrast, in an intervention involving larvicides, mortality decreases.[4]
References
[1] Focks DA. A review of entomological sampling [4] Subra R, Mouchet J. The regulation of methods and indicators for dengue vectors. preimaginal populations of Aedes aegypti, Geneva, World Health Organization, 2003. Diptera: Culicidae, on the Kenya coast: 2. Document TDR/IDE/Den/03.1. Food as a main regulatory factor. Annals of Tropical Medicine and Parasitology. 1984; 78: [2] Focks DA et al. Transmission thresholds for 63–70. dengue in terms of Aedes aegypti pupae per person with discussion of their utility in source [5] Focks DA et al. Dynamic life table model for reduction efforts. American Journal of Tropical Aedes aegypti (L.) (Diptera: Culicidae). Analysis Medicine& Hygiene. 2000; 62:11–18. of the literature and model development. Journal of Medical Entomology. 1993; 30: [3] Focks DA, Chadee DD. Pupal survey: An 1003–1017. epidemiologically significant surveillance method for Aedes aegypti: An example using data from Trinidad. American Journal of Tropical Medicine and Hygiene. 1997; 56: 159– 167.
200 Dengue Bulletin – Volume 31, 2007 Instructions for contributors
Dengue Bulletin welcomes all original research Dengue and dengue haemorrhagic fever. papers, short notes, review articles, letters to CAB International, New York, NY, the Editor and book reviews which have a direct 1997, 1-22. or indirect bearing on dengue fever/dengue (3) Nguyen Trong Lan, Nguyen Thanh haemorrhagic fever prevention and control, Hung, Do Quang Ha, Bui Thi Mai including case management. Papers should not Phuong, Le Bich Lien, Luong Anh Tuan, contain any political statement or reference. Vu Thi Que Huong, Lu Thi Minh Hieu, Tieu Ngoc Tran, Le Thi Cam and Manuscripts should be typewritten in Nguyen Anh Tuan. Treatment of English in double space on one side of white dengue haemorrhagic fever at A4-size paper, with a margin of at least one Children’s Hospital N.1, Ho Chi Minh inch on either side of the text and should not City, 1991-1996. Dengue Bulletin. exceed 15 pages. The title should be as short 1997; 22: 150-161. as possible. The name of the author(s) should appear after the title, followed by the name of Figures and tables (Arabic numerals), with the institution and complete address. The e- appropriate captions and titles, should be mail address of the corresponding author should included on separate pages, numbered also be included and indicated accordingly. consecutively, and included at the end of the text with instructions as to where they belong. References to published works should be Abbreviations should be avoided or explained listed on a separate page at the end of the at the first mention. Graphs or figures should paper. References to periodicals should include be clearly drawn and properly labelled, the following elements: name and initials of preferably using MS Excel, and all data clearly author(s); title of paper or book in its original identified. language; complete name of the journal, publishing house or institution concerned; and Articles should include a self-explanatory volume and issue number, relevant pages and abstract at the beginning of the paper of not date of publication, and place of publication more than 300 words explaining the need/gap (city and country). References should appear in knowledge and stating very briefly the area in the text in the same numerical order (Arabic and period of study. The outcome of the research numbers in parenthesis) as at the end of the should be complete, concise and focused, article. For example: conveying the conclusions in totality. Appropriate keywords and a running title should also be (1) Nimmannitaya S. Clinical spectrum and provided. management of dengue haemorrhagic fever. The Proceedings of the Articles submitted for publication should International Conference on Dengue be accompanied by a statement that they have Haemorrhagic Fever, Kuala Lumpur, not already been published, and, if accepted September 1-3, 1983:16-26. for publication in the Bulletin, will not be submitted for publication elsewhere without (2) Gubler DJ. Dengue and dengue the agreement of WHO, and that the right of haemorrhagic fever: Its history and republication in any form is reserved by the resurgence as a global public health WHO Regional Offices for South-East Asia problem. In: Gubler DJ, Kuno G (ed.), (SEARO) and the Western Pacific (WPRO).
Dengue Bulletin – Volume 31, 2007 201 Instructions for contributors
One hard copy of the manuscript with Manuscripts received for publication are original and clear figures/tables and a computer subjected to in-house review by professional diskette/CD-ROM indicating the name of the experts and are peer-reviewed by experts in software should be submitted to: the respective disciplines. Papers are accepted on the understanding that they are subject to The Editor editorial revision, including, where necessary, Dengue Bulletin condensation of the text and omission of WHO Regional Office for South-East Asia tabular and illustrative material. Indraprastha Estate Mahatma Gandhi Road Original copies of articles submitted for New Delhi 110002, India publication will not be returned. The principal Telephone: 91-11-23370804 author will receive 10 reprints of the article Fax: 91-11-23379507, 23370972 published in the Bulletin. A pdf file can be E-mail: [email protected] supplied on request.
202 Dengue Bulletin – Volume 31, 2007 The endemicity of dengue fever and dengue haemorrhagic fever (DHF) in countries of the South-East Asia (SEA) and the Western Pacific regions continues to rise. During 2007, in the SEA Region, Indonesia, Thailand and Myanmar contributed 62.89%, 25.14% and 6.10% dengue cases respectively, both in morbidity and mortality. When compared with 2006, the number o case in all three countries showed an increasing trend. Nepal which reported 25 cases for the first time in 2006 reported only three cases in 2007. DENV-2 was found to be circulating in Nepal. In view of this scenario, WHO developed the biregional Asia-Pacific Strategic Plan (20082015) for Prevention and Control of Dengue in 2007. The thrust of this plan will be to strengthen systems in countries to predict and prevent epidemics, improve early recognition and management of cases, support prevention of dengue through integrated vector management and on community participation and research.
The WHO South-East Asia Regional Office, in collaboration with the Western Pacific Regional Office, jointly publish the annual Dengue Bulletin. The current Volume 31 (2007) of Dengue Bulletin includes contributions from WHO's SEA Region (5); the Western Pacific Region (8); and the American Region (4).
South-EastSouth-East AsiaAsia RegionRegion WesternWestern PacificPacific RegionRegion South-East Asia Region Western Pacific Region ISSN 0250- 8362