Investigation and Characterization of the Homeobox Gene MEIS2 in Acute Lymphoblastic Leukemia

Institute of Experimental Cancer Research

Ulm University

Chair: Prof. Dr. med. Christian Buske

Dissertation

To obtain the Doctoral Degree in Medicine (‘Dr. med.’) at the Faculty of Medicine, Ulm University

Ekaterina Panina

Astrachan, Russia

2019

Acting Dean: Prof. Dr. rer. nat. Thomas Wirth First Reviewer: Prof. Dr. med. Christian Buske Second Reviewer: PD Dr. med. Martin Müller Day of Graduation: May 9th 2019 Table of Contents

List of abbreviations ...... III

List of genes ...... IX

1 Introduction ...... 1

1.1 Acute Lymphoblastic Leukemia ...... 1

1.2 Homeobox genes ...... 5

1.3 MEIS genes ...... 7

2 Materials and Methods ...... 13

2.1 Materials ...... 13

2.2 Methods ...... 22

3 Results ...... 38

3.1 Quantification of MEIS2 expression in ALL samples vs. those of healthy individuals ...... 38

3.2 Quantification of MEIS2 expression in leukemic cell lines ...... 41

3.3 Methylation assay ...... 42

3.4 Localization of MEIS2 protein in the cell ...... 44

3.5 Knockdown of MEIS2 in ALL cell lines Tanoue and Jurkat using shRNA ...... 45

3.6 Effects of Knockdown of MEIS2 on transfected ALL cell lines Jurkat and Tanoue ...... 48

3.7 RNA Seq ...... 56

4 Discussion ...... 62

5 Summary ...... 70

6 Bibliography ...... 71

Acknowledgements ...... 87

Curriculum Vitae...... 88

List of abbreviations

°C Degree Celcius

7-AAD 7-Aminoactinomycin

AML Acute Myeloid Leukemia

AML1-ETO Acute myeloid leukemia 1- eight twenty-one

ALL Acute Lymphoblastic Leukemia

APC Allophycocyanin

APS Ammonium Persulfate

BCR-ABL Breakpoint cluster region - Abelson

BM Bone Marrow

bp Base pair

BrdU Bromodeoxyuridine

BSA Bovine Serum Albumine

bZIP Basic Leucine Zipper Domain

cAMP Cyclic Adenosine Monophosphate

CDK Cycline Dependent Kinase

cDNA Copy DNA

CFC Colony Forming Cell

cm Centimeter

CML Chronic Myeloid Leukemia

CNS Central Nervous System

CO2 Carbondioxid

CRE Cyclic AMP Response Element

CREB cAMP Response Element Binding Protein

III

Ct Cycle treshold cyIgG Cytoplasmic Immunglobulin G cyIgM Cytoplasmic Immunglobulin M

DAPI 4’,6-Diamidino-2-Phenylindole ddH2O Double destilled water

DEPC Diethyl Pyrocarbonate

DMEM Dulbecco’s Modified Eagle Medium

DMSO Dimethylsulfoxid

DNA Deoxyribonucleic Acid dNTP Deoxynucleotide

DPBS Dulbecco’s Phosphate-Buffered Saline

DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen DTT Dithiothreitol

E2A-PBX1 E2alpha-pre B cell leukemia homeobox 1

ECL Enhanced chemiluminescence

EDTA Ethylenediaminetetraacetic Acid

EGF Epidermal growth factor

EGIL European Group for the Immunological Characterization of Leukemias FAB French-American-British

FBS Fetal Bovine Serum

FCM Flow Cytometry

FDR False Discovery Rate

FGF Fibroblast Growth Factor

FITC Fluorescein Isothiocyanate g Gram

G-CSF Granulocyte Colony Stimulating Factor

G1/G0-phase Gap 1/ Gap 0-phase

GTP Guanosine Triphosphate

H2O Dihydrogenmonoxid

HB Homeobox

HCl Hydrochloride

HD Homeodomain

HLA-DR Human Leukocyte Antigen-DR

HOX Homeobox

HRP Horseradish Peroxidase

IMDM Iscove’s Modified Dulbecco’s Medium kb Kilobase kDa Kilodalton

L Liter

LSC Leukemia Stem Cell

M Molar

M-CSF Macrophage colony stimulating factor

M-phase Mitose-Phase mA Milliampere

MALDI-TOF Matrix-Assisted Laser Desorption/Ionization- Time Of Flight MAPK Mitogen Activated Protein Kinase mg Milligram

MgCl2 Magnesiomdichloride

MHC Major Histocompatibility Complex mL Milliliter mM Millimolar mm Millimeter

MNC Mononuclear cells

MRD Minimal Residual Disease mRNA Messenger Ribonucleic acid

NaCl Sodiumchloride ng Nanogram nm Nanometer

NOD/SCID Non-Obese Diabetic/Severe Combined Immunodeficiency HSC Hematopoietic stem cell

P/S Penicillin/Streptomycin

PANTHER Protein Analysis Through Evolutionary Relationships PB Peripheral Blood

PCR Polymerase Chain Reaction

PDB Protein Data Bank pH Potential of Hydrogen

PI Propidium Iodide

PS Phosphatidylserine

PVDF Polyvinylidene Difluoride

RCSB Research Collaboratory for Structural Bioinformatics

RIPA Radioimmunoprecipitation Assay Buffer

RISC RNA-Induced Silencing Complex

RNA Ribonucleic Acid rpm Revolutions per minute

RPMI Roswell Park Memorial Insitute

RQ-PCR Real time Quantitative PCR

RT-PCR Real time PCR

SEM Standard error of the mean

S-phase Synthesis phase scr Scrambled

SDS Sodium Dodecyl Sulfate shRNA Small/short Hairpin RNA siRNA Small Interfering RNA

TBS Buffer Tris-buffered Saline Buffer

TBST Tris-Buffered Saline with Tween 20

TCR T-Cell Receptor

TCR alpha/beta T-Cell Receptor alpha/beta

TE Trypsin-EDTA

TEMED Tetramethylethylendiamin

TF Transcription factor

TGF Transforming Growth Factor

Tris Tris(hydroxymethyl)-aminomethane

U Unit

V Volt

VII

VCM Virus Containing Medium

VEGF Vascular Endothelial Growth Factor

WHO World Health Organization wt Wild type

µL Microliter

VIII

List of genes

ANKRD55 Ankyrin repeat domain 55

ANXA1 Annexin A1

BMYB MYB proto-oncogene like 2

BTG2 B-cell translocation gene 2

CD3D Cluster of differentiation 2 delta molecule

CDKN2B Cyclin dependent kinase inhibitor 2B

CLEC2D C-type lectin domain family 2 member D

CREB5 cAMP responsive element binding protein 5

CTTN Cortactin

DAZAP2 DAZ (deleted in azoospermia) associated protein 2

ETV6-RUNX1 ETS (E26 transfomation-specific) variant 6 – runt related transcription factor FCRLA Fc receptor like A

FKBP11 FK506 binding protein 11

FOXM1 Forkhead box M1

HLA-DRA Major histocompatibility complex, class II, DR alpha

HOX11L2 Homeobox 11 like 2

HOXA 7/9/11 Homeobox A 7/9/11

HOXB 10/13 Homeobox B 10/13

HOXD 12/13 Homeobox D12/D13

IFI30 Interferon gamma inducible protein 30

IGJ Immunglobulin J chain

INK4 Alias: CDKN2A - Cyclin-dependent kinase inhibitor 2A

IRF4 Interferon regulating factor 4

KLF4 Kruppel like factor 4

LRMP Lymphoid restricted membrane protein

MLL Mixed lineage leukemia

MN1 Meningeoma 1

MS4A1 Membrane spanning 4-domains A1

NDUFB7 NADH:ubiquinone oxidoreductase subunit B7

PBX Pre-B-cell leukemia transcription factor

PLEK Pleckstrin

PREP Propyl endopeptidase

PSMB5 Proreasome subunit beta 5

RAC2 Rac family small GTPase 2

Ras Rat Sarcoma Viral Proto-Oncogene

RB Retinoblastoma gene

RBB4 Retinoblastoma binding protein 4

RCSD1-ABL1 RCSD domain containing 1 – Abelson 1

TBP TATA-box binding protein

TCF3-PBX1 Transcription factor 3 - Pre-B-cell leukemia transcription factor 1 TEL-AML1 Telomere elongation – acute myeloid leukemia 1 protein TGF  Transforming growth factor beta

TGIF TGFB induced factor homeobox

TLX1 T-cell leukemia homeobox 1

TMSB10 Thymosin beta 10

1 Introduction

Hematopoiesis or the formation of blood with all its cellular components is a complex process that occurs during embryonic development as well as throughout the adulthood. The cellular components are being constantly replenished by a rare pool of pluripotent cells, the hematopoietic stem cells (HSCs), residing in the bone marrow [67]. These cells possess the ability to self-renew which means to generate daughter cells that retain the same properties as the parent cell. Further they are able to differentiate, giving rise to a hierarchy of multilineage and unilineage progenitors that lead to a production of fully differentiated and functional cells [29]. Dysregulation in self-renewal or differentiation can result in transformation of the HSC or another multipotent hematopoietic progenitor, leading to a clonal expansion [37]. Depending on during which stage of differentiation of the progenitor cell the transforming event occurs, different phenotypic leukemia subtypes can arise. Acute or chronic myeloid leukemia develops if the affected cells are common myeloid progenitors, similarly acute lymphoblastic leukemia (ALL) can arise from lymphoid progenitors. The clonal accumulation is sustained by so called leukemic stem cells (LSCs), best studied in acute myeloid leukemia (AML). LSCs are characterized by differentiation arrest, increased proliferation, enhanced self-renewal, decreased apoptosis and telomere maintenance [17,105,159].

1.1 Acute Lymphoblastic Leukemia

Acute lymphoblastic leukemia is a neoplastic disease of the hematopoietic system that results from multistep somatic mutations in a lymphoid progenitor cell during the early stages of its differentiation and maturation leading to a clonal expansion of the affected cell. The lesions occur in lymphoid progenitors that are committed to B- cell or T-cell pathways, resulting in a B-cell or T-cell leukemia.

The worldwide incidence is about 1-4.5 per 100.000 people and about 7.5 percent of adult leukemias are ALL [68,127]. In children leukemia accounts for about a third of all pediatric cancers and acute lymphoblastic leukemia accounts for about 80% of leukemias among children under the age of 15. The worldwide yearly incidence is 1-4,75 per 100,000 [63,69]. ALL shows a peak prevalence between the ages of 2 and 5, followed by falling rates during the later development and increases again in

1 the sixth decade [120]. ALL affects males more often than females and is more common in white population than in black population [135].

1.1.1 Classification of Acute Leukemias

There are several different types of leukemias that are divided according to their course in acute or chronic, and according to the transformed cell type in myeloid on the one side and lymphoid on the other. The classification of leukemias is based on the morphology, immunophenotype, karyotype, cytogenetic and molecular markers of the cells. The proper lineage assignment as well as cytogenetic classification is of great importance, allowing different approaches in therapy and thus defining the patient’s prognosis.

One of the classifications of the subtypes of ALL is based on the microscopic morphology of the cells and is done according to the French-American-British- Classification (FAB), classifying the ALL into three groups (L1, L2 and L3) [12]. However, the FAB-classification is nowadays of lesser clinical relevance due to new, more specific classification methods. Further stratification is performed through immunophenotyping by detecting surface or cytoplasmatic molecules distinct to different cell types using antibodies, thus classifying ALL cells immunologically [11]. In 2008 the World Health Organization (WHO) published a Classification of Tumors of the Hematopoietic and Lymphoid Tissues, where the former nomenclature based solely on immunologic markers and the morphology of the transformed cells, has been changed. As the rapidly emerging publications suggest that the genetic abnormalities play an increasing role in classification and prognosis of hematologic neoplasms, the WHO introduced in the new classification of 2016 the subdivision of B lymphoblastic leukemia into 7 distinct entities defined by specific recurring chromosomal alterations [146,155]. This is the first classification that used morphologic, cytochemical, immunophenotypic as well as genetic findings. In 2016 the WHO published a new revision of the classification of acute leukemias, introducing two more entities in the B-cell lymphoblastic leukemia such as B-ALL with intrachromosomal amplification of chromosome 21 as well as “BCR-ABL1-like” ALL with a similar expression/mutation profile as BCR-ABL-positive leukemias, thus highlighting the relevance of molecular genetic alterations in the genome of ALL cells [7].

1.1.2 Etiology, Pathogenesis and Prognostic factors

Only about 5% of leukemia cases are associated with predisposing congenital anomalies, such as Down syndrome [97], Bloom’s syndrome [124] and ataxia telangiectasia with a 70 times greater risk of leukemia [83]. There is also a correlation between exposure to ionizing radiation either postnatal [157] or in utero [31] and the development of leukemia. Other environmental factors are chemicals such as benzene metabolites and anticancer-drugs in particular such as inhibitors of topoisomerase II [4,49,79]. Recent studies suggest an influence of paternal smoking before the pregnancy as a potential risk factor for childhood acute lymphoblastic leukemia [106].

Although the exact pathogenic events of ALL are not fully understood yet, there are favored hypotheses, that assume that the initiation and progression of ALL is driven by acquired genetic abnormalities like successive mutations in genes responsible for normal cell differentiation, cell growth and cell cycle, leading to a block in differentiation, replicative immortality and a resistance to death signals in the context of apoptosis [56,122]. The underlying mutations can result out of chromosomal alterations such as numerical or structural aberrations, including translocations, inversions, deletions, amplifications or point mutations. The acquired mutations can affect oncogenes with a subsequent gain of function and tumor suppressor genes with recessive loss of function or generate fusion genes that activate kinases and altered transcription factors [122].

More than 75% of all cases of ALL harbor recurring cytogenetic or molecular alterations, especially such as chromosomal translocations [9]. In the B-ALL the most common rearrangements are t(9;22) BCR-ABL1 accounting for about 25% of adult and about 3 % pediatric B-ALL cases [122,124], leading to an constitutively activated tyrosine-kinase activity [128] and thus to growth factor independence [81]. Further fusion proteins resulting from translocations such as t(12;21) ETV6-RUNX1 (TEL-AML1) account for more than 20% of pediatric B-ALL cases. Other frequent translocations in ALL are t(1;19) TCF3-PBX1 (E2A-PBX1) and rearrangement of MLL at 11q2 [103,122]. Hyperdiploidy with more than 50 chromosomes is an aberration encountered in about 25% childhood B-ALL. In T-ALL the most commonly affected genes include the transcription factors like a HOX11

(TLX1)(10q24) overexpression, found in about 7% of pediatric and over 30% of adult T-ALL cases, and HOX11L2 (TLX2)(5q35), occurring in 20% of childhood and about 13% of adult T-ALL. [48] More than 50% of T-ALL cases show activating mutations affecting the NOTCH1 pathway. [162]

All these genetic rearrangements by themselves are insufficient to initiate acute leukemia, as seen in t(12;21), ETV6-RUNX1 rearrangements, that can be detected in about 1% of cord-blood samples of newborns, a frequency 100 times higher than the prevalence of ALL with this distinct fusion transcript [87]. This findings suggest the existence of a preleukemic clone in utero [50] and consequently the requirement of further accumulations of different mutations involving key genes, that control regulatory pathways for induction and progression to leukemia [171].

Leukemic cell genetics harbor important prognostic information. Features indicating a high risk of relapse are BCR-ABL1 fusion, severe hypodiploidy, intrachromosomal amplification of chromosome 21, 11q23 associated MLL gene rearrangements or a poor response to treatment after induction therapy [121,124,127]. The clinical factors with a high risk for a relapse are high leukocyte count and age at diagnosis, suggesting that the outcome of treatment in adults worsens with increasing age [119,124]. Interestingly infants younger than 12 months show a worse 5-year event free survival than older children. The previously poorer outcome of patients with male sex was improved due to enhanced and more effective treatment regimens [123,139]. Patients with hyperdiploidy (>50 chromosomes) and ETV6-RUNX1 gene fusion (formerly designated as TEL-AML1) have a favorable prognosis [9,120,124]. Another important prognostic variable is the initial response to treatment [108,119,120].

1.1.3 Clinical presentation

The symptoms patients often experience result from the extent of medullary extrusion by the rapidly proliferating leukemic cells. Due to the compression of healthy bone marrow patients develop anemia with symptoms such as shortness of breath, fatigue and pallor. Further neutropenia and thrombocytopenia and consequently clinical signs such as recurrent infections and petechial bleeding or bruising are common [61]. As the ALL spreads to extramedullary sites an infiltration of lymph nodes, spleen or liver resulting in lymphadenopathy, hepatosplenomegaly

4 or CNS-involvement is often observed. Another feature present in about fifty percent of patients is fever, which is induced by infections or by pyrogenic cytokines (e.g. interleukin-1, interleukin-6 and tumor necrosis factor) released from malignant cells [30]. Common laboratory findings are hyperleukocytosis (often >100 × 109 white cells /L) and neutropenia (<0,5 × 109 /L) [117] as well as elevated levels of serum lactate dehydrogenase [118]. The diagnosis of acute lymphoblastic leukemia is based on bone marrow aspiration, presenting over 25 per cent of lymphoblasts [155].

1.2 Homeobox genes

Homeobox (HB) genes are a highly conserved family of genes that encode transcription factors (TF) regulating trunk, tale and limb development as well as organogenesis during embryogenesis [102]. Their function was first discovered in Drosophila melanogaster but over time has been identified in virtually all animal species [3,42,82]. Over the past 40 years the fundamental role of homeobox genes in differential and developmental processes especially in hematopoiesis has been described [89].

Transcription factors encoded by homeobox genes, the so-called homeoproteins, share a common DNA-binding motif named the homeodomain (HD) that is encoded by the homeobox. The homeobox is a common sequence of about 180 bp long. The HD is about 60 amino acids long and consists out of three 훼-helices forming a helix turn helix type structure as illustrated in Fig. 1 [42].

Figure 1. Structure of the DNA binding homeodomain of homeobox-proteins consisting out of three alpha-helices. Helix 2 and helix 3 form a helix-turn-helix structure as determined by nuclear magnetic resonance spectrometry. Figure based on Gehring et al [43].

There are two classes of Homeobox genes. The Class I HB genes are the clustered genes (HOX) exerting their role for the formation of the anteroposterior body axis during embryogenesis. Duplication of the original HOX gene clusters has given rise to 13 paralogous groups organized into four clusters. Class II genes include the non- clustered genes that are dispersed throughout the genome, and act as cofactors of HOX genes or in concert with HOX genes as accelerators of leukemic disease [107].

The homeoproteins regulate downstream genes directly through DNA-binding or indirectly through interaction with other transcription factors [25,135]. The Homeobox genes display a wide range of properties beside activation or repression of downstream gene networks. In the past years HOX proteins have been linked to non-transcriptional functions such as DNA repair [133], DNA replication [27,93], translation [150] and protein degradation [13]. There is also emerging evidence showing an influence of Hox genes on proliferation und cell cycle progression of cells [129].

Studies with overexpression of murine HoxA9 gene, the most highly expressed Hox gene in CD34+ hematopoietic stem cells, showed an expansion of hematopoietic stem cells and proliferation of myeloid progenitors and subsequently leading to development of leukemia [5,148]. Similar results could be observed by overexpressing HoxB10 in murine bone marrow cells leading to acute myeloid

6 leukemia with a latency of 19 to 50 weeks [147]. A recent study on the expression levels of HOXA9 showed a downregulation in human breast cancer and was associated with tumor aggression, metastasis, and patient mortality [45]. In prostate cancer HOXB13 can play a role either as a tumor suppressor or an oncogene depending on type of the cancer cell. For example in androgen-independent prostate cancer cells an overexpression on HOXB13 promotes cell growth in contrast to androgen responsive cells, where it exerts a growth inhibitory effect [55,71]. The functional versatility on the one hand and the specificity on the other raise the question of how these effects can be achieved although all homeodomains of homeoproteins bind to a similar set of “AT”-rich binding sites on DNA. To increase specificity and stability of HOX proteins, they form complexes with other homeoproteins. The most frequent cofactors are the tree amino loop extension (TALE) proteins that include pre B-cell leukemia (PBX) and the myeloid ecotropic viral integration site (Meis) proteins. [5,91]. In general Hox homeodomain proteins from paralogous groups 1-10 form complexes with PBX, whereas HOX proteins from paralogous groups 10-13 physically interact with MEIS1 proteins [136].

1.3 MEIS genes

MEIS proteins are members of TALE superclass of homeoproteins. This superclass is characterized through the presence of an insertion of three additional amino acids in the loop between helix 1 and helix 2 within its homeodomain [19]. A three- dimensional structure of the MEIS2 protein is displayed in Fig. 2.

Figure 2. Three-dimensional structure of the MEIS2 protein. The front view is displayed on the left, the side view is displayed on the right. TALE proteins are characterized by a three amino loop extension within their homeodomain between the antiparallel helices 1 and 2 [19]; Image from the RCSB (Research Collaboratory for Structural Bioinformatics) PDB (Protein Data Bank) [77].

The TALE family comprises of several other genes including PBC, IRO, and TGIF. The Meis class constitutes of MEIS1, MEIS2, MEIS3, PREP1, and PREP2 that were identified by sequence similarity [102]. The Meis class is also referred to as the MEINOX family, due to the similarity of the conserved residues (Meis domain and Knox domain upstream of the HD) of the MEIS and KNOX class genes [19,39]. Meis stands for “myeloid ecotropic viral integration site” as its locus serves as a common integration site for virus in 15% of tumors arising in -2 mice. Viral integration into the Meis1 promotor sequence disrupts the normal expression of Meis1 acting as insertional mutagen and thus subsequently leading to myeloid leukemia [101].

The insertion of the three additional amino acids in the loop, although located in the homeodomain, does not affect DNA binding but acts as a binding site for other TFs forming heteromeric complexes that regulate gene expression [114]. The generally low binding affinity and selectivity of monomeric MEIS proteins is increased through interactions with other TFs of TALE superfamily especially PBX or the HOX proteins. Therefore, MEIS proteins harbor several interaction motifs. The previously described HD binds to a hexameric TGACAG sequence in the DNA, in contrast to

8 other homeodomain proteins especially the HOX family which usually bind to an “AT”-rich core [26,91]. MEIS proteins contain a PBX-interaction domain upstream the HD to form heterodimer complexes with PBX monomers and trimeric complexes with PBX and HOX proteins to cooperatively bind consensus DNA sequences [72]. MEIS and PBX can form complexes in the presence of DNA and even in vitro in absence of DNA [40]. Interestingly MEIS proteins partner with wild-type but not with chimeric PBX-proteins, formed by translocations [26,66,90,135,137]. Structural and functional analysis identified C-terminal domain of the MEIS1 protein, required for its transcriptional and oncogenic activity and is regulated by protein kinase A (PKA) that is thought to be dependent on coactivators of cAMP response element-binding protein [46,90,158].

TALE proteins show extensive alternative mRNA splicing. So far four splice variants for MEIS1 and eight splice variants for MEIS2 have been identified as illustrated in Fig. 3. The isoforms differ in their C-terminal domain. The MEIS2E variant lacks two thirds of its homeodomain and the complete C-terminal domain due alternative splicing resulting in an early termination codon TAA within its homeodomain. Thus it plays a role in protein-protein interaction, rather than transcriptional regulation through direct DNA-binding [41,165]. MEIS2E is thought to represent a negative form of MEIS2 by competing with the other full-length splice variants for binding to other homeobox proteins, for example PBX1 [63,165].

Figure 3. Eight (A-H) human MEIS2 gene splice variants. Boxes represent exons, lines represent introns. The red and the green boxes represent mutually exclusive exons 12 and 13, respectively. The framed area illustrated the highly conserved Homeobox domain. Figure based on D.Geerts et al. [41]

MEIS proteins show an involvement in neuroblastoma [41], breast cancer, where they are associated with a favorable prognosis [32], pancreatic [169] as well as eye [168] development. However, the function of MEIS homeobox proteins has been most extensively studied in leukemogenesis and hematopoiesis. The MEIS1 gene shows similarly to HOX genes high expression levels in most primitive CD34+ hematopoietic cells, and undergo increasing downregulation during further differentiation [8,69,85,111,112]. Several studies support the importance of Meis1 in hematopoiesis, showing that Meis1-deficient mice exhibit severe anemia, underdeveloped compartments of HSCs, impaired colony-forming ability of the HSCs as well as a complete agenesis of the megakaryocytic lineage [10,60].

The role of MEIS genes in enhancing cell proliferation and blocking cell differentiation is best demonstrated in leukemia. For example, the overexpression of HoxA9 and Meis1 simultaneously leads to acute myeloid leukemia in mice that received the retrovirally transduced primary bone marrow cells. Interestingly the overexpression of Meis1 alone fails to transform the bone marrow cells and overexpression of Hoxa9 alone lead to leukemia with long latency [75]. The influential role of MEIS1 in leukemogenesis is further supported by the detection of its high expression levels in human AML bone marrow cells where it was coexpressed with HOXA7 in 89,5% of the patients [1,69]. Meis1 exerts an accelerating role in inducing leukemic diseases when coexpressed with HoxA9 [74] or HoxD13 [113]. The exact function of Meis1 is still unknown but studies suggest that it is involved in suppression of differentiation and promotion of proliferation as seen in HoxA9-immortalized myeloid progenitors. While the previously HoxA9- immortalized cells could still differentiate in monocytes and neutrophils upon stimulation with macrophage (M-CSF) and granulocyte (G-CSF) colony stimulating factor, they displayed lack of differentiation after transduction with Meis1 and even showed higher proliferation rates after culturing medium with stem cell factor (SCF) [22]. In lymphoblastic leukemias, for example T-cell leukemias MEIS1 and MEIS2 are coexpressed with TLX1 [98]. Furthermore, especially in the subtype with MLL (mixed lineage leukemia) translocations, MEIS1 together with HOXA9 were found to be highly upregulated [36,132]. The functional analysis of Meis1 after retroviral downregulation in precursor B-cell leukemic line RS4;11 with MLL-rearrangement showed impaired engraftment in NOD/SCID mice and reduced proliferation of the

10 cells in vitro [105]. Moreover, in a recent work Meis1 was found to be essential for initiation and maintenance of MLL-mediated leukemic transformation and appears to be a rate-limiting regulator of MLL leukemia stem cell potential. Thereby Meis1 transcripts correlated with the shorter latency periods of MLL leukemia development induced by the different MLL fusion protein partners in murine models [164].

1.3.1 Meis2

MEIS2 is upregulated in metastatic pancreatic endocrine neoplasms in comparison to non-metastatic pancreatic endocrine neoplasms [58] and is associated with cleft palate and cardiac septal defects as well as varying degrees of intellectual disability [86]. In human lung cancer MEIS2 is suggested to act as a repressor of transforming growth factor 훽 type II receptor expression and thus leading to inactivation of TGF- 훽-induced tumor suppressor function [54]. The influence of MEIS1 in leukemogenesis has been comprehensively studied. But there is still scarce information about MEIS1 paralogue MEIS2 in leukemia, especially the involvement in acute lymphoblastic leukemia. MEIS2 is located on chromosome 15q14, a region associated with AML and CML (chronic myeloid leukemia) [143]. MEIS2 is found to be highly upregulated in patients with AML1-ETO acute myeloid leukemia. Conversely the analysis of MEIS1 showed low transcript levels [80].

A recent study assessed the expression of MEIS2 in in leukemia derived cell line compared to normal control cells and found high expression levels in leukemia derived cell lines. Interestingly after performing expression analysis with 14 samples of patients with acute lymphoblastic leukemia and 19 samples of healthy individuals, no variation in the expression of MEIS2 could be observed [130].

MEIS2 appears to play a role in the cell cycle. For instance, there is published work showing that MEIS2 together with PBX1 can be recruited by KLF4 and bind as complex to p15 promotor, a known cell cycle inhibitor, and thus increasing the expression of p15 and promoting antiproliferative effects. Thus KLF4, a zinc finger protein, can exert either a tumor suppressor or an oncogene function depending on differential interactions with additional factors such as MEIS2 or PBX1 [16]. The effect of decreased MEIS2 expression RNA-mediated knockdown in retinal progenitor cells was demonstrated in a recent paper, showing a decreased mitotic

11 index of retinal progenitor cells. After simultaneous blocking of Meis1 and Meis2 expression, the influence on different cell cycle proteins was analyzed, revealing a strong reduction of the cyclin D1 expression, a protein controlling the progression of cells through G1 phase of the cell cycle [59]. The crucial role of MEIS2 for neuroblastoma cells was depicted in a work, showing an M-phase arrest in MEIS2 depleted neuroblastoma cells as well as accompanied deregulation of genes controlling cell cycle progression [166]. A recent study showed a crucial role of Meis2 in MN1 (Meningeoma 1) - induced myeloid leukemia, leading to impaired cell growth, self-renewal and impairment in differentiation in vitro upon Meis2 knockdown in contrast to Meis1 knockdown [76].

All these data indicate an influence of MEIS2 in oncogenesis and assigning the gene a role in regulation of cell cycle and cell proliferation. However, the significance of MEIS2 in leukemogenesis needs still to be investigated. Moreover, the involvement of MEIS2 in acute lymphoblastic leukemia is still not described.

The goal of this work is to investigate the involvement of the TALE homeobox protein MEIS2 in acute lymphoblastic leukemia and to interrogate its function in leukemic cells.

Therefore, MEIS2 expression was analyzed in bone marrow samples of patients with acute lymphoblastic leukemia as well as in ALL cell lines. To gain first insights into the regulation of MEIS2 expression, DNA methylation analysis was performed. The effect of a stable knockdown of MEIS2 in cell lines using shRNA in respect of proliferation, colony forming ability, apoptosis as well as cell cycle was assessed.

Further, in order to detect changes in the transcriptome as a consequence of a reduced MEIS2 expression, RNA sequencing was performed and validated using Taqman real time quantitative PCR.

2 Materials and Methods

2.1 Materials

Table 1. Technical Equipment

Technical Equipment Supplier

7900HT Fast real-time PCR System Applied Biosystems, Foster City, CA, USA

BD LSRFortessa™ BD Biosciences, Heidelberg, Germany

Biophotometer plus Eppendorf, Hamburg, Germany

Cytospin* 4 Cytocentrifuge Thermo Fisher Scientific, Waltham, WA, USA C.B.S. Scientific Company, San Diego, CA, Elektrophorese DCX-700 USA VWR International GmbH, Darmstadt, Elektrophorese horizontal B21 Germany VWR International GmbH, Darmstadt, Elektrophorese vertikal CTV400 Germany

Eppendorf 5415R Eppendorf, Hamburg, Germany

Eppendorf 5810R Eppendorf, Hamburg, Germany

Galaxy 170S Incubator New Brunswick Scientific, Edison, NJ, USA

Innova 44 Incubator Shaker New Brunswick Scientific, Edison, NJ, USA

NanoDrop® ND-1000 Thermo Fisher Scientific, Waltham, WA, USA Spectrophotometer peqSTAR 96 Universal Gradient PEQLAB Biotechnology GmbH, Erlangen, Thermocycler Germany VWR International GmbH, Darmstadt, Perfect Blue Gelsystem Mini L4 Germany Semi Dry Blotter, Large Format 33x45 Cleaver Scientific, Warwickshire, United cm Kingdom

Thermomixer comfort Typ 5355E Eppendorf, Hamburg, Germany

Vortex-Genie 2 Scientific Industries, Bohemia, NY, USA Carl Zeiss MicroImaging GmbH, Göttingen, Zeiss Axiovert 40 C Germany

Table 2. Technical Equipment

Consumable supplies Supplier

0.45 µm filters for 50 mL Falcon tubes BD Biosciences, Heidelberg, Germany

1.5 & 2 mL Eppendorf Tubes Eppendorf, Hamburg, Germany

10 cm Cell + tissue culture dish Sarstedt, Nümbrecht, Germany 5 mL Polystyrene round-bottom tube with BD Biosciences, Heidelberg, Germany cell-strainer cap (5 mL FACS tube) GE Healthcare, Little Chalfont, United Amersham Hyperfilm Kingdom BD 50 mL Polypropylene conical tube BD Biosciences, Heidelberg, Germany

BRAND Disposable cuvettes, 2,5 ml Sigma-Aldrich, St. Louis, MO, USA Corning Cell culture dish (35mm & 100 Corning Incorporated, Corning, NY, USA mm) Costar® stripette (5 mL, 10 mL, 25 mL) Corning Incorporated, Corning, NY, USA GE Healthcare, Little Chalfont, United Filterpaper Kingdom Gel Casettes Invitrogen, Carlsbad, CA, USA Carl Roth GmbH + Co. KG, Karlsruhe, Inoculation loop Germany MicroAmp Fast optical 96-well Applied Biosystems, Foster City, CA, USA reactionplate with barcode 0.1 mL MicroAmp Optical Adhesive Film Applied Biosystems, Foster City, CA, USA Millex syringe driven filter unit (0.45 and Millipore, Billerica, MA, USA 0.22 µm) BioRad Laboratories Inc., Hercules, CA, Nitrocellulose Membrane Roll USA

Peha-soft® nitrile FINO HARTMANN, Heidenheim, Germany

Petri dish for bacteriology Sarstedt, Nümbrecht, Germany GE Healthcare, Little Chalfont, United PVDF Membrane Kingdom SafeSeal-Tips professional (10 µL, 20 Biozym Scientific GmbH, Hessisch µL, 200 µL, 1000 µL) Oldendorf, Germany Thermo Fisher Scientific, Waltham, WA, Shandon (white) filter cards 200/Box USA Suspension – Culture – Plate 6, 12 & 24 Greiner Bio-one GmbH, Frickenhausen, – well, sterile, with lid Germany Tissue Culture Flask T25 & T75CN Sarstedt, Nümbrecht, Germany

Table 3. Solutions and Media

Solutions and Media Supplier

DMEM High Glucose (4.5 g/l) PAA Laboratories GmbH, Pasching, Austria

Dulbecco’s PBS PAA Laboratories GmbH, Pasching, Austria

Foetal bovine serum (FBS) PAN Biotech, Aidenbach, Germany

IMDM PAA Laboratories GmbH, Pasching, Austria STEMCELL Technologies, Cologne, Methocult H4430 Germany Penicillin/Streptomycin PAA Laboratories GmbH, Pasching, Austria

RPMI 1640 PAA Laboratories GmbH, Pasching, Austria

Table 4. Kits and Reagents

Kits and Reagents Supplier Thermo Fischer Scientific, Waltham, MA, 20X TBS Buffer USA Carl Roth GmbH + Co. KG, Karlsruhe, Acrylamide A 30% Germany Carl Roth GmbH + Co. KG, Karlsruhe, Acrylamide B- 2% Germany Agarose Sigma-Aldrich, St. Louis, MO, USA Amersham ECL Prime Western Blotting GE Healthcare Europe GmbH, Freiburg, Detection Reagent Germany APS (Ammonium Persulfate) PanReac AppliChem, Darmstadt, Germany

BD Pharmingen™ APC BrdU Flow Kit BD Biosciences, Heidelberg, Germany BD Pharmingen™ PE Annexin V BD Biosciences, Heidelberg, Germany Apoptosis Detection Kit Bio-Rad Protein Assay Dye Reagent Bio-Rad Laboratories GmbH, München, Concentrate Germany Calbiochem, Merck Chemicals GmbH, Camptothecin Darmstadt, Germany Chloroform Sigma-Aldrich, Taufkirchen, Germany DAPI (4',6-Diamidino-2-Phenylindole, Thermo Fischer Scientific, Waltham, MA, Dihydrochloride) USA

ddH2O Ulm University, Ulm, Germany Applied Biosystems/Ambion, Austin, TX, DEPC-treated Water USA DMSO Sigma-Aldrich, St. Louis, MO, USA

DNase I, Amplification Grade Invitrogen, Carlsbad, CA, USA

Ethanol (99.5% purity) Sigma-Aldrich, St. Louis, MO, USA

FuGENE® HD Transfection Reagent Promega, Madison, USA

Gel Loading Dye, Blue (6x) New England BioLabs, Ipswich, MA, USA VWR International GmbH, Darmstadt, GelRed™ 10000x Germany GIBCO 0.05% Trypsin-EDTA (1x), Invitrogen, Carlsbad, CA, USA phenol red Glycine BioFroxx GmbH, Einhausen, Deutschland

Continuation on page 17

Continuation Table 4.

Kits and Reagents Supplier Isopropanol Sigma-Aldrich, Taufkirchen, Germany

Methanol Sigma-Aldrich, St. Louis, MO, USA

Phosphatase Cocktail I and II Sigma-Aldrich, St. Louis, MO, USA

Platinum® Taq DNA Polymerase Kit Invitrogen, Carlsbad, CA, USA

Polybrene Sigma-Aldrich, St. Louis, MO, USA

ProLong® Gold Antifade Mountant Thermo Fischer Scientific, Waltham, MA, USA Puromycin dihydrochloride Sigma-Aldrich, St. Louis, MO, USA

RNAse A Invitrogen, Carlsbad, CA, USA

SDS VWR International GmbH, Darmstadt, Germany Skim Milk Powder Fluka Analytical, Sigma-Aldrich, Taufkirchen, Germany Spectra Multicolor Broad Range Protein Thermo Fischer Scientific, Waltham, MA, Ladder USA SuperScript III First-Strand Synthesis Invitrogen, Carlsbad, CA, USA System for RT-PCR Taq DNA Polymerase Kit Invitrogen, Carlsbad, CA, USA

TaqMan® Universal PCR Master Mix, No Applied Biosystems, Foster City, CA, USA AmpErase® UNG TEMED (N,N,N',N'- PanReac AppliChem, Darmstadt, tetramethylethylenediamine) Germany Tris 1 M and 1,5 M; Affymetrix USB, Thermo Fischer Scientific, (Tris(hydroxymethyl)aminomethane) Waltham, MA, USA Triton X-100 Sigma-Aldrich, St. Louis, MO, USA

TRIzol® Reagent Invitrogen, Carlsbad, CA, USA

Trypan blue Invitrogen, Carlsbad, CA, USA Tween, Polyoxyethylene 20 Sorbitane PanReac AppliChem, Darmstadt, mono-Laurate Germany

Table 5. Plasmids

Plasmids Supplier

Gift from Dr.Claudia Scholl (DKFZ pMD2.G (Addgene plasmid) Heidelberg) Gift from Dr.Claudia Scholl (DKFZ psPAX (Addgene plasmid) Heidelberg) MISSION® shRNA Plasmid DNA; SHCLND-NM_002399; TRCN0000016044; Sequence: Sigma-Aldrich, St. Louis, MO, USA CCGGCCCATGATTGACCAGTCAAATCT CGAGATTTGACTGGTCAATCATGGGTT TTT MISSION® pLKO.1-puro Empty Vector Sigma-Aldrich, St. Louis, MO, USA Control Plasmid DNA “Scrambled”: MISSION® pLKO.1-puro Sigma-Aldrich, St. Louis, MO, USA Non-Target shRNA Control Plasmid DNA

Table 6. Antibodies

Antibodies Supplier

Meis2 (63-T); mouse monoclonal IgG1; Santa Cruz Biotechnology, Inc., Dallas, TX, Sc-81986 E3110 USA Goat anti-mouse IgG-HRP; Sc-2005, Santa Cruz Biotechnology, Inc., Dallas, TX, F0710 USA β-Actin Antibody (C4), mouse monoclonal Santa Cruz Biotechnology, Inc., Dallas, TX, IgG1; Sc-47778, C2310 USA Goat anti-Mouse IgG (H+L) Secondary Thermo Fischer Scientific, Waltham, MA, Antibody, Alexa Fluor® 488 conjugate USA

Table 7. Primers

Primers Supplier

HsMEIS2; Life Technologies assay ID: Life Technologies, Thermo Fisher Hs00542638_m1 Scientific, Waltham, WA, USA Hs RAC2; Life Technologies assay ID: Life Technologies, Thermo Fisher Hs01036635_s1 Scientific, Waltham, WA, USA Hs CREB2; Life Technologies assay ID: Life Technologies, Thermo Fisher Hs00191719_m1 Scientific, Waltham, WA, USA HS CTTN; Life Technologies assay ID: Life Technologies, Thermo Fisher Hs01124225_m1 Scientific, Waltham, WA, USA Life Technologies, Thermo Fisher Hs TBP; Catalog #: 4333769F Scientific, Waltham, WA, USA

2.1.1 Patient Samples

Patient RNA was isolated from the aspirated bone marrow cells or leukemic peripheral blood cells of 26 untreated pediatric patients and 17 adult patients with newly diagnosed acute lymphoblastic leukemia (ALL) from the Department of Pediatrics and Adolescent Medicine in University Medical Center Ulm (Department of Internal Medicine III, University Hospital Ulm). The RNA extraction was performed by the research group in the same department. Informed consent for the use of the taken cell samples was obtained from all patients. The approval of the Ethics committee of University of Ulm was obtained and has the following application numbers: 182/2004, 18/16 and 148/10. Further available details of the patients are summarized in the following table 8.

Table 8. Characteristics on patient samples used for further analysis. The continuous number are used for the purpose of anonymization. Age group is divided in two categories, adult and pediatric. Further the samples are subdivided according to the immunophenotypic subgroup according to the EGIL (European Group for the Immunological Characterization of Leukemias) classification [11]. In the last column, the information about the karyotype is provided. Abbreviations: ALL = acute lymphoblastic leukemia, c-ALL = common acute lymphoblastic leukemia, na = not available

Continuous patient number Age group Immunophenotypic classification 1 Adult c-ALL 2 Adult c-ALL 3 Adult c-ALL 4 Adult c-ALL 5 Adult c-ALL 6 Adult c-ALL 7 Adult c-ALL 8 Adult c-ALL 9 Adult c-ALL 10 Adult c-ALL 11 Adult c-ALL 12 Adult mature B-ALL

Continuation on page 20

Continuation Table 8

Continuous patient number Age group Immunophenotypic classification 13 Adult pre-B-ALL 14 Adult pre-B-ALL 15 Adult Precursor B-ALL 16 Adult Precursor B-ALL 17 Adult Precursor-T-ALL 18 Pediatric c-ALL 19 Pediatric c-ALL 20 Pediatric c-ALL 21 Pediatric c-ALL 22 Pediatric c-ALL 23 Pediatric c-ALL 24 Pediatric c-ALL 25 Pediatric c-ALL 26 Pediatric c-ALL 27 Pediatric c-ALL 28 Pediatric c-ALL 29 Pediatric c-ALL 30 Pediatric pre-B ALL 31 Pediatric pre-B ALL 32 Pediatric pre-B ALL 33 Pediatric pre-B ALL 34 Pediatric pre-B ALL 35 Pediatric Precursor B-ALL 36 Pediatric Precursor B-ALL 37 Pediatric Precursor B-ALL 38 Pediatric Cortical T-ALL 39 Pediatric Cortical T-ALL 40 Pediatric Cortical T-ALL 41 Pediatric pre-T ALL 42 Pediatric pre-T ALL 43 Pediatric mature T ALL

2.1.2 Human Cell Lines

Human cell lines were obtained and cultured according to the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) guidelines. Further information about the used cell lines is provided in Table 9.

Table 9. Human cell lines used in this work. In the first column, the names of the cell lines are provided. The second column classifies the cell lines according to the type of leukemia they originated from. The following columns depict the surface or cytoplasmatic proteins of the cells and in the next column the associated cytogenetic alterations.

Name Classification Immunophenotype Cytogenetics

human hypodiploid karyotype with 4% polyploidy - 45(42- CD3 -, CD10 +, CD13 -, 45)<2n>XX, -14, B cell CD19 +, CD20 -, CD34 - t(8;13)(q24;q21.2), KOPN-8 precursor , CD38 +, CD80 -, t(11;19)(q23;p13), leukemia CD138 -, HLA-DR +, der(13)t(13;14)(p11;q11) - cyIgG -, cyIgM +; carries t(11;19) effecting MLL- MLLT1 (MLL-ENL) fusion - matches published karyotype human hyperdiploid karyotype with 12% polyploidy - 47/48<2n>X, -Y/XYqh+, +7, +14,

dup(1)(q21.1/21.2q23.1/23.2), CD3 -, CD10 +, CD13 -, B-Cell t(2;4)(q2?2;q2?5), del(6)(q27), CD19 +, CD20 +, CD34 Tanoue Leukemia FAB t(8;14)(q24;q32), del(13)(q34), -, CD37 (+), CD38 +, L2 add(22)(q13) - extensive cyCD79a +, CD138 +, subclonal variation - carries HLA-DR (+) t(8;14), +7, and dup(1q) typical of B-ALL/Burkitt lymphoma - resembles published karyotype human flat-moded hypotetraploid karyotype with CD2 +, CD3 +, CD5 +, 7.8% polyploidy - 87(78- CD6 +, CD7 +, CD8 -, T-Cell 91)<4n>XX, -Y, -Y, -5, -16, -17, - Jurkat CD13 -, CD19 -, Leukemia 22, add(2)(p21)/del(2)(p23)x2 - TCRalpha/beta +, sideline with additional TCRgamma/delta -; der(5)t(5;10)(q11;p15), del(9)(p11)

Continuation on page 22

Continuation Table 9

human near-tetraploid karyotype CD2 -, CD3 +, CD4 +, with extensive subclonal CD5 +, CD6 +, CD7 +, variation - 90(88-101)<4n>XX, - CD8 -, CD13 -, CD14 -, X, -X, +20, +20, CCRF- T-Cell CD15 +, CD19 -, CD33 - t(8;9)(p11;p24)x2, CEM Leukemia , CD34 -, HLA-DR -, der(9)del(9)(p21- TCRalpha/beta +, 22)del(9)(q11q13-21)x2 - TCRgamma/delta - sideline with +5, +21, add(13)(q3?3), del(16)(q12) CD2 +, cyCD3 +, human flat-moded smCD3 -, CD4 +, CD5 hypertetraploid karyotype - 89- T-Cell +, CD6 +, CD7 +, CD8 99<4n>XXYY, +4, +7, +8, +20, MOLT-4 Leukemia +, CD13 -, CD19 -, +20, del(6)(q16)x2, CD34 +, TCRalpha/beta der(7)t(7;7)(p15;q11)x2 - closely -, TCRgamma/delta - related to MOLT-3

2.2 Methods

2.2.1 Cell culture

Cell thawing: Cells stored in liquid nitrogen or at -80°C were thawed in a 37°C waterbath and washed twice with DPBS to remove the DMSO of the freezing medium thoroughly. After thawing the cells were resuspended in RPMI containing either 10% (Jurkat, CCRF-CEM, Tanoue, KOPN-8) or 20% (MOLT-4) heat inactivated FBS according to the cell requirements and respectively 1% of penicillin/streptomycin (P/S), followed by subsequent transferring either on a 6-well- suspension or a 6-well-adherent culture dish. The cells were stored in an incubator at following conditions: 37°C and 5% CO2.

Maintaining of cells: For adherent cells like lenti-X cells, upon reaching a cell confluency of about 80% the following steps were passed to obtain a confluency of 20-30%. After removing media and thoroughly washing with DPBS, adherent cells were treated with 2 ml of 0.05% Trypsin-EDTA (TE) to detach them from the surface of the culture dish. After applying TE the cells were incubated for 2-3 minutes at 37°C. Cells were resuspendend in required medium or if necessary were sub- cultured.

Suspension cells were transferred to either a 15ml or 50ml falcon tube, centrifuged at 1200 rpm for 5 minutes and resuspended in an appropriate volume of medium to sustain the required cell density. The cells were transferred to either an adherent culture dish or a cell culture flask.

Standard culture conditions were 37°C and 5% CO2.

Freezing of cells: The cells were harvested using the same methods as mentioned in 2.2.3 and were washed twice with DPBS. After pelleting the cells were resuspended in freezing medium containing 90% h.i.fFBS and 10% Dimethylsulfoxid (DMSO) and transferred into 2ml cryotubes. The tubes were frozen either at -80°C or, if long-term storage was necessary, in liquid nitrogen. In order to count cells 2µl were taken out of the cell suspension and were thoroughly mixed with 18µl of Trypan Blue. 10µl were applied to the edge of the Neubauer counting chamber which was previously covered by a coverslip provided with the chamber. The cell-stain-suspension is sucked into the void due to capillary action. Trypan blue is not absorbed in viable cells with intact cell membranes in comparison to dead cells, which absorb the stain and appear blue under the light microscope. This dye exclusion method enables the user not only to determine the number of cells but also to evaluate the viability of the cells.

2.2.2 Localization assay

Localization assay of MEIS2 protein was performed in the ALL cell line Jurkat and Tanoue. Cytospins of the cells were performed. Afterwards the cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature and membrane permeabilization using 0.1% Triton-X for 5 min at RT was performed. The cells were washed with PBS and incubated for one hour at RT in 10% BSA and 5% serum from the host species of the secondary antibody; in this case, goat serum was used. After washing with PBS, the cells are incubated with the primary antibody (anti-MEIS2; 63-T from Santa Cruz) at a 1:300 dilution at 4°C overnight. After another washing step the cells were incubated with a secondary antibody for 45 minutes at RT in the dark. The secondary antibody was goat anti-mouse IgG antibody which is conjugated with Alexa Fluor® 488. The nuclei were stained with 4´,6-diamidino-2- phenylindole (DAPI) as a nuclear counterstain. After washing, the cells were

23 mounted with fluorescence antifade mounting medium under a cover slip. The fluorescence signals of the proteins were visualized under a fluorescence microscope (Carl Zeiss microscope).

2.2.3 RNA extraction

After harvesting at least 106 cells, the cells were resuspended in 1 ml TRIzol® in Eppendorf tubes, homogenized by pipetting up and down several times and incubated at room temperature for 5 minutes. After adding 200µl of chloroform per 1ml Trizol used for homogenization, the tubes were vortexed for 10 seconds until the solution became turbid and incubated at room temperature for 2-3 minutes. Afterwards the samples were centrifuged at 12,000 × g for 15 minutes at 4°C. After centrifuging, the homogenate separates in three layers: 1. upper clear aqueous phase containing RNA, 2. middle interphase, 3. lower pink phase containing DNA and proteins. The upper layer was pipetted up thoroughly and transferred into a new Eppendorf tube. To precipitate the RNA 500-600µl of isopropanol was added to the aqueous phase, incubated at room temperature for 10 minutes and was centrifuged at 12, 000 × g for 10 minutes at 4°C. After centrifuging a white pellet became visible. The isopropanol was thoroughly removed without disturbing the precipitates RNA and to wash the pellet 500µl of 75% ethanol was added and centrifuged at 7,500 × g for 5 minutes at 4°C. The ethanol was discarded. The washing step was performed twice. After the second washing the opened Eppendorf tubes were air dried for 10 minutes. The RNA pellet was resuspended in 20-50µl DEPC treated water regarding the used cell amount and put for 10 minutes in a heat block which was preheated up to 55°C. After resolving the RNA in DEPC treated water, the RNA concentration and quality was analyzed by NanoDrop® ND-1000 Spectrophotometer.

Quantification of RNA/ DNA samples: The concentration of RNA is measured photometrically at a nucleic acid specific wavelength of 260 nm and simultaneously at 280 nm. The purity was determined by the ratio of absorbance at 260 nm (A260) to absorbance at 280 nm (A280), values above 1.8 were considered as good purity.

DNase treatment: Prior to analysis by RT-PCR and qPCR the extracted RNA was treated with DNase I, Amplification Grade (Invitrogen®) to prevent DNA

24 contamination. DNase I is a ribonuclease, which digests double- and single- stranded DNA to oligodexyribonuleotides. The following protocol was used: 1µg RNA, 1µl 10X DNase I reaction buffer and 1µl DNase I, Amplification Grade (1U/µl) were added to an RNase-free microcentrifuge tube on ice. The tube was filled up with DEPC-treated water to final volume of 10µl and was incubated at room temperature for 15 minutes. To inactivate the DNase 1 µl of 25 mM EDTA was added to the reaction mixture and heated at 65°C for 10 minutes. The sample was then immediately used for cDNA synthesis.

2.2.4 cDNA Synthesis

Complementary DNA (cDNA) was synthesized using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen®). For each sample, the following protocol was used: 1 µl of 50 ng/µl random hexamers, 1 µl of 10mM dNTP was added to 0,5 µg RNA, filled up to 10 µl with DEPC-treated water and incubated at 65°C for 5 minutes. A mastermix containing the following reagents was prepared and 10 µl of which were added to the reaction mixture: 2µl of 10X RT Buffer, 4µl of 25 mM MgCl2, 2µl of 0,1M DTT, 1µl of RNaseOUT (40 U/µL) and 1µl of SuperScript™ III RT (200 U/µL). RNase OUT, an RNase inhibitor, was added to prevent target RNA degradation. The reaction mixture was gently mixed, collected by brief centrifugation and incubated under following conditions: 10 minutes at 25°C, 50 minutes at 50°C (cDNA synthesis) and 5 minutes at 85°C to terminate the reaction. The samples were stored at -20°C until use.

2.2.5 Quantification of gene expression using Taqman® real-time PCR assay

To measure gene expression a quantitative real-time PCR using Taqman probes was performed. The RNA extraction and purification as well as the cDNA synthesis was prepared according to the previously described protocols. For each target gene as well as the housekeeping gene the following mixture was prepared: 10 µL TaqMan® Universal PCR Master Mix, 8 µL nuclease free water, 1 µL random Hexamer cDNA (equivalent to 50 ng RNA) and 1 µL gene specific primer probe mix (TaqMan® assay).

The PCR was run under standard conditions for 40 cycles under following settings:

After each PCR the Ct-values (threshold cycle) of gene of interest were determined

25 and compared to the Ct-values of an endogenous reference gene. ΔCt-values were calculated by subtracting the Ct-values of the reference gene from the gene of interest. ΔCt-values are inversely correlated with gene expression, indicating a higher expression with lower values. The used reference gene was a housekeeping gene named TBP (TATA-Box binding protein) which plays a role in RNA transcription. Each reaction was run in triplicates in a 96-well-plate und analyzed by the SDS 2.3 real-time analysis software.

2.2.6 Stable knockdown of MEIS2

To investigate the role of MEIS2 a stable knockdown using short hairpin RNA (shRNA) complementary to the sequence of MEIS2 was performed. The knockdown associated experiments were repeated five times. The plasmids containing either the shRNA or a scrambled sequence and the empty vector were obtained from Sigma-Aldrich®. The pLKO.1 vector contains several elements which allow a correct transcription and function of the plasmid (Figure 4).

U6 cppt hPGK RRE puroR

(Ψ)Psi SIN/3‘ LTR pLKO.1-puro RSV 5´ LTR

f1 ori pUC ori

ampR

Figure 4. Schematic representation of the pLKO.1-puro vector. U6 = RNA polymerase III promotor of the U6 small nuclear RNA gene (U6), Cppt = central polypurine tract, hPGK = human phosphoglycerate kinase eukaryotic promotor, puroR = puromycin resistance gene, SIN/3´LTR = 3´ self inactivating long terminal repeat, f1 ori = f1 origin of replication, ampR = ampicillin resistance gene, pUC ori = pUC (plasmid University of California) origin of replication, RSV/5´LTR = Rous Sarcoma Virus/ 5´long terminal repeat, Psi = RNA packaging signal, RRE = rev response element. Figure based on Stewart et al. [145] and Sigma-Aldrich [138].

An RNA polymerase III promotor of the U6 small nuclear RNA gene (U6) provides high level expression of the shRNA. The shRNA in the plasmid is introduced into the target cell (Jurkat, Tanoue) by infecting the cell with a lentivirus vector. The lentivirus is built using the envelope and packaging plasmids pMD2.G and psPAX after treating the 293T-lenti cells with FuGene, a transfection reagent. The virus is assembled in 293T-lenti cells and is released into the medium, which is subsequently collected. The target cells are transduced using the virus containing medium (VCM). To facilitate the cell infection and the following transduction Polybrene, a cationic polymer which neutralizes the charge repulsion between the virion and the anionic cell surface of the target cell, is added to the VCM. Once the virus has entered the cell and integrated the vector in the host DNA, the shRNA is transcribed in the nucleus by the RNA polymerase III driven by the human U6 promotor resulting in a hair-pin shaped pre-shRNA. The five thymidine repeat sequence serves as a termination signal for the RNA polymerase III.

The DNA sequence of the shRNA construct containing a sense, loop and an antisense part, forms, once transcribed into RNA, a hair-pin shape due to complementary sequences. The pre-shRNA is then processed by Drosha, an RNase III enzyme and is exported from the nucleus into the cell plasma by Exportin 5 where it underlies further cleavage by Dicer into short interfering RNA (siRNA). The siRNA is then processed by a multiprotein complex called RISC (RNA-induced silencing complex), which unwinds the double stranded siRNA and incorporates the antisense strand whereas the sense (passenger) is degraded. When the transcript of the targeted gene binds to the complementary siRNA-RISC complex the RISC cleaves the targeted mRNA, thus providing a knockdown of the target gene. The lenti virus stably integrates its genome into the target cell DNA thus providing a stable knockdown by passing it on to progeny cells [99,145].

2.2.7 Lentiviral Transfection

To obtain virus containing media (VCM) 293T lenti cells were transfected. Two days prior to transfection 293T-Lenti cells were plated out on a 10 cm corning dish with 10 ml DMEM containing 15% FBS and 1% penicillin/streptomycin. After reaching 80% confluency the cells were infected. For each infection an Eppendorf tube was prepared containing 282µl DMEM, 18µl FuGENE®, three micrograms of the helper plasmid pMD2.G, three micrograms of the helper plasmid psPAX and three micrograms of one of the three different plasmids (shMEIS2, the control plasmid with scrambled sequence or the empty vector control pLKO.1). The mixture was gently mixed, incubated at room temperature for 15-45 minutes and added dropwise to 6 ml growth medium (DMEM+15%FBS+1%P/S).

The growth medium of the 293T-Lenti cells was gently removed and the cells were washed with 10 ml PBS to remove debris. Afterwards 6 ml of the media/plasmid mix was slowly added to the cells and the cells were placed in the incubator at standard condition overnight. In the morning, the medium was removed and the 3 ml DMEM now containing 30% FBS and 1% P/S were slowly added to the cells and placed in the incubator until next morning. After 24 hours, the media containing the freshly produced virus was collected, aliquoted in Eppendorf tubes and stored at -80°C. The 293T-Lenti cells were replenished with 3 ml growth medium (DMEM+30%FBS+1%P/S). The collection step was repeated in the next morning

28 and afterwards the cells were discarded.

2.2.8 Lenti-viral Transduction of ALL cells and Puromycin selection

Target cells were thawed and cultured until the cells started to undergo the logarithmic phase of growing. The used cell lines were Tanoue and Jurkat. Upon arrival of the needed cell number, one million cells for each experiment arm were pelleted and resuspended with 1,5 ml of growth medium (RPMI+10% FBS+1% P/S), which was previously mixed with 1 µl of Polybrene® (stock concentration 8 mg/ml) per 1 ml of added VCM. The cell-media suspension was transferred onto 6-well- plates. The aliquoted VCM tubes were thawed and 500 µl each were added to the cells. After thoroughly mixing, the cells were placed into the incubator at 37°C and

5% CO2 overnight. In the morning, the media was changed and the cells incubated at standard condition for 24 hours. The next morning the media was removed and the cells were washed with 10 ml PBS and pelleted. To select the cells that successfully integrated the construct into nucleus, the cells were resuspended with 4 ml growth media, to which previously puromycin at a concentration of 4 ng/ml has been added. To control the process of cell selection the same number of untreated Jurkat and Tanoue cells were taken additional to the transduced cells. The cells were incubated at standard conditions for 4-5 days until the untreated cells died.

Puromycin is toxic to eukaryotic cells due premature chain termination during translation. However, the pLKO.1 plasmid provides a marker gene with a puromycin resistance that permits the survival of the cells which have successfully integrated the construct into their DNA [145].

2.2.9 Synchronization of the cells by double thymidine block

The media containing the cells was poured out and discarded leaving a thin layer of cells on the inner surface of the culture flask. The flask was filled up with 10 ml growth medium (RPMI+10% FBS+ 1% P/S) and incubated for 2 days under standard conditions until the cells arrived the log-phase. Two million cells were taken out, pelleted and resuspended in 5 ml regular growth medium containing 2 mM Thymidine. During this first block the culture flasks were left for 20 hours for Jurkat and 18 hours for Tanoue in the incubator at standard conditions. After the first block the cells were washed with 10 ml PBS and resuspended in 5 ml fresh regular growth

29 medium to release the cells from the block for 9 hours. Afterwards the cells were prepared for the second block by transferring the cells into thymidine containing medium for 18 hours for both cell lines. After the second block the cells were released by washing with 10 ml PBS and adding 10 ml regular growth media. Prior to synchronizing the actual transduced cells, the method including the blocking time was established for each of the used cell lines regarding their doubling time. During the establishment, the synchrony was monitored by FACS using propidium-iodide staining of the cells before the first block, after the first and again after the second block.

Propidium-iodide staining: For PI-staining 105 cells were washed with PBS and fixed with 70% absolute ethanol. Ethanol is a dehydrating fixative and at the same time permeabilizes the cell membrane. To prevent clustering of the cells, the suspension was vortexed at half speed during the supplementation of ethanol following an incubation time on ice for 15 minutes. After incubation, the cells were pelleted at 1500 rpm for 5 minutes and resuspended in 500 µl of the previously prepared stock of PI-solution. The following components of the PI-solution were resolved in PBS: 50 µg/ml of PI from a stock solution (2.5 mg/ml), 0.1mg/ml RNase A and 0.05 % Triton X-100. RNase cleaves single-stranded RNA to avoid binding of PI to RNA. Triton X-100 is a detergent which also permeabilizes the cell membrane. After adding the PI-staining solution the cells were incubated in the dark at 37°C for 40 minutes. The cells then were supplemented with 3 ml PBS and pelleted at 1500 rpm for 5 minutes. After removing the supernatant, the cells were resuspended in 500 µl PBS for flow cytometry analysis.

Confirmation of the knockdown on RNA Level: The extent of the knockdown was measured using Taqman® real-time PCR after the extraction of RNA from 106 cells and the subsequent cDNA synthesis.

2.2.10 Apoptosis Assay

To investigate the apoptosis in cells before and after the knockdown of Meis2 a FITC Annexin V Apoptosis Detection Kit I was used. The assay was performed according to the manufacturer´s protocol and analyzed using flow cytometry. During the programmed cell death phosphatidylserine (PS) is translocated from the inner side of the membrane onto the surface of the cell. Fluorochrome-labeled Annexin V that

30 has a high affinity to PS is incubated with the cells and can be detected using flow cytometry, thus enabling to quantify the cells undergoing apoptosis [23,35].

2.2.11 Cell Cycle Assay

To characterize and enumerate the cells which pass through different cell cycle positions (G0/1-, S-, or G1/M phase) an APC BrdU Flow kit was used. The assay was performed according to the manufacturer´s protocol and analyzed using flow cytometry. Bromodeoxyuridine is an analog of the DNA precursor thymidine and is incorporated during the assay into newly synthesized DNA of cells entering and progressing the S-phase of the cell cycle. The BrdU is visualized by staining the cells with an anti-BrdU fluorescent antibody and analyzed using flow-cytometry. To facilitate the analysis of distinct cell cycle phases additional dye such as 7-aminoactinomycin D (7-AAD) that binds to total DNA is used [34,47,154].

2.2.12 Proliferation assay

To investigate the effects of the knockdown of MEIS2 on cell proliferation a proliferation assay with the transduced cells were performed. Therefore 5 x 103 cells, of each experimental arm (shMEIS2, pLKO.1 scrambled, pLKO.1 empty vector and untreated cells) were transferred onto a 6-well-plate with 4 ml growth media. The cells were counted after 48, 96 and 144 hours using a Neubauer improved counting chamber. The proliferation assay was performed in five biological replicates.

2.2.13 Human colony forming cell (CFC) assay

To study the ability of transduced leukemic cells to proliferate and form colonies a CFC-assay was performed. Therefore 300 cells were washed in PBS, pelleted, resuspended 300 µl of media (IMDM, 2% FBS), were mixed with 3 ml of methylcellulose-based media (H4330 from stem cell technologies) and 1,1 ml of the suspension was transferred onto two 35 mm culture dishes. The two culture dishes were placed together with an uncovered dish containing 3 ml sterile water on a 100 mm culture dish. After covering, the 100 mm dish was incubated for 14-16 days at

37°C and 5 % CO2. Afterwards the colony on each plate were counted under the microscope.

2.2.14 Protein Extraction and Western Blot

Protein extraction: For total protein extraction 2×106 cells were washed with PBS, pelleted and resuspended in 150 µl of the cell lysis buffer containing the following reagents: 350 µl of 2xRIPA (Radioimmunoprecipitation assay buffer) Buffer, 7 µl of Phosphatase inhibitor cocktail I, 7 µl of Phosphatase inhibitor cocktail II, 100 µl of

7x Protease inhibitor and 236 µl distilled H20 (GIBCO). The RIPA Buffer contains the ingredients listed in the table (Table 10) below. The suspension of lysed cells was centrifuged at 4°C at 12 000 rpm for 15 minutes and the supernatant containing the proteins was transferred into fresh Eppendorf tubes and were either immediately used or stored at -80°C.

Table 10. Ingredients used for preparation of RIPA Buffer. Abbreviations: Tris- HCl = Tris(hydroxymethyl)-aminomethane Hydroxychloride, SDS = Sodium dodecyl sulfate, mM = milimolar, NaCl = Sodiumchloride, pH = potential of hydrogene

Components Concentration/Percentage

Tris-HCl, pH 7,5 50 mM

NaCl 150 mM

Triton X-100 1,0 %

Sodium deoxycholate 0,5 %

SDS 0,1 %

Measuring of protein concentration using the Bradford assay: The protein concentration was determined photometrically, measuring the absorption at a wavelength of 595 nm. At first a standard calibration curve was constructed by plotting the absorption values against the used amount of BSA (Bovine serum albumin) of a known concentration. After plotting, the slope and the intercept with the y-axis was determined. To obtain the concentration of the protein of interest, the measured absorption values were divided by the slope value. For absorption measurement 1 µl of the protein solution was mixed with 100 µl of 150 mM NaCl and 900 µl of BioRAD Protein assay dye reagent which was previously diluted at a ratio of 1:5, transferred into cuvettes and measured by Biophotometer plus from Eppendorf.

Western Blot: To investigate the knockdown on protein level a SDS-polyacrylamide- gel electrophoresis (SDS-PAGE) with subsequent Western blotting was performed.

Preparation of the gel: To obtain a proper separation of the proteins an appropriate amount of acrylamide depending on the molecular size of the protein of interest should be added. For MEIS2 with a molecular size of 52 kDa, 10 ml of separating gel containing 12% acrylamide was chosen. The components used for the preparation of the gel are shown in Table 11. After vortexing the solution for 5 seconds 5 ml of the still liquid gel was immediately transferred into Invitrogen Empty Gel Cassettes and filled up with 2 ml isopropanol to obtain an even rim. Once the gel solidified the isopropanol was discarded and the resolving gel was filled up with 2 ml of the stacking gel. The following table contains the used components as well as the amount. After pouring the gel a 10-well comb was inserted.

Table 11. Components used for the preparation of separating gel with a volume of 10 ml and stacking gel with a volume of 3 ml. Abbreviations: dH2O = destilled water, Tris = Tris(hydroxymethyl)-aminomethan, pH = potential of hydrogene, SDS = Sodium dodecyl sulfate, APS = Ammonium Persulfate, TEMED = Tetramethylethylendiamin, µl = microliter

Amount for 10 ml of Amount for 3 ml of Components Separating Gel (µl) Stacking Gel (µl)

dH2O 1780 1870

1.5 M Tris pH 8.8 2500 -

1 M Tris pH 6.8 - 380

Rothiphorese® Gel A 3570 487

Rothiphorese® Gel B 1490 203

10% SDS 100 30

10% APS 100 30

TEMED 4 3

Preparing and loading of the protein samples: For the preparation of the proteins 25

µg of the protein lysate were taken, filled up to 35 µl with dH2O and mixed with 7 µl of Laemmli buffer (2x). The mixture was placed in a heat block at 95°C for 5 minutes to denature the proteins. The gel was placed into the electrophoresis apparatus and

33 filled with Tris-glycine electrophoresis buffer containing: 30 g Tris Base (25 mM),

144 g Glycine (192 mM) and 10 g SDS (0.1 %), topped up to 1 liter ddH2O. After heating, the samples were briefly vortexed and loaded into the bottom of the wells, also including the protein ladder. The gel was run at first at 70 V for 30 minutes to allow the samples to run through the stacking gel and then at 100 V for 1,5-2 hours.

Semi-dry blotting transfer: After separation of the protein the cassette was opened, the gel was carefully removed using a plastic forceps and placed onto 3 layers of blotting paper and a nitrocellulose membrane, that were previously soaked in transfer buffer. All the layers were transferred on the cathode plate and covered with another three layers of soaked blotting paper. The anode plate was then carefully placed onto the blotting paper-gel assembly. The Transfer buffer contained the following components: 10% methanol, 24 mM Tris and 182 mM glycine. Afterwards an electric field of 300 mA for 45 minutes was applied.

Visualization of proteins: After the transfer, the nitrocellulose membrane was placed in a plastic box with the protein side facing up. To avoid unspecific binding of the antibody to the nitrocellulose membrane, the membrane was blocked using 5 % milk in 1x TBS (Tris Buffer Saline). Therefore 12 ml of the milk was applied onto the membrane and placed on a shaker for 1 hour. After the blocking and discarding of the milk, the anti-Meis2 antibody was added to the membrane. The antibody was diluted in a ratio of 1:200 in 2,5 % milk in 1x TBS. The membrane was incubated overnight at -4°C on shaker. On the next morning the antibody-milk solution was assembled and stored at -20°C and the membrane was washed tree times at room temperature on a shaker with 1xTBS with 0,1 % Tween (TBST). After the last wash the secondary horseradish peroxidase (HRP)-conjugated antibody (goat anti mouse) was added. The antibody was diluted at ratio of 1:2000 in 2,5 % milk in 1xTBS. The membrane was incubated for 2 hours at room temperature on a shaker and then was washed three times with TBST. The membrane was then incubated in 2 ml of the GE detection Kit for 1 minute and wrapped in seran wrap foil and placed in a light protected box prior to detection.

Developing of the blot: For development of the blot an ECL-film was placed on to the blot for 30 seconds and was then ran through the film developer. The exposure was repeated, varying the time needed to obtain an optimal detection.

To verify if the lanes were evenly loaded a loading control was performed. The previously developed blot was incubated for 45 minutes at 65°C on shaker with 20 ml of stripping buffer containing the components listed in Table 12. Afterwards it was washed 5 times with TBS and the visualization and developing steps were performed as mentioned above except for the first antibody. A mouse anti-β-actin antibody was used at a dilution ratio of 1:6000.

Table 12. Components used for the preparation of the stripping buffer. Abbreviations: SDS = Sodium dodecyl sulfate, Tris-HCl = Tris(hydroxymethyl)- aminomethane Hydroxychloride, ddH2O = double destillied water ml =milliliter, pH = potential of hydrogene

Components Amount in ml (for 100 ml Stripping Buffer)

SDS 10 % 20

Tris-HCl 1 Molar, pH 6,8 6,25

ß-Mercaptoethanol 0,8

ddH2O 72,95

2.2.15 RNA Sequencing

RNA Sequencing was performed using the Illumina HiSeq 2000 as a Single End 50 base pair read for Jurkat Scrambled, Jurkat shMEIS2-44, Tanoue Scrambled and Tanoue shMEIS2-44. Therefore, libraries were performed using TruSeq RNA Sample Preparation Kit V2. Afterwards the samples were transferred on the flowcell using the cBot System (Illumina). ‘Trim galore!’ was used to trim illumina sequencing [94]. Thereafter high quality raw Fastq files, with a Phred score 20 or higher, were aligned to the human hg19 RefSeq using ‘TopHat’, a fast splice junction mapper for RNA-Seq reads. Using ‘Cufflinks’ and ‘R packages’ a differential expression analysis was performed [126,152]. To validate the results obtained using RNA-Seq technology a qtPCR of differentially expressed genes was performed using Taqman-probes.

2.2.16 Quantitative Methylation Analysis

Nine patient samples were sent to German Cancer Research Center in Heidelberg (DKFZ Heidelberg) to perform a quantitative DNA methylation analysis using the

EpiTyper - MassARRAY system from Sequenom Inc. The assay was kindly performed by Dr. Rainer Claus at DKFZ Heidelberg. Therefore 500-100 ng of column-purified genomic DNA was treated with bisulfite solution using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA). During the treatment unmethylated cytosins are converted to thymines while methylated cytosins remain without a change. Target DNA regions were amplified using PCR and transcribed in vitro into RNA and subsequently treated with an endoribonuclease. The unmethylated cytosins have been converted to uracil by hydrolytic deamination, while methylated cytosins remained unaltered, resulting in cleavage products with different masses. The base-specifically cleaved RNA fragments using U-specific RNase A were analyzed by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry [33,110]. The extent of methylation of two CpG islands were analyzed. Fig. 5 shows the schematic representation of the MEIS2 locus and the localization of the CpG islands (MEIS2-3 and MEIS2 upstream) that were analyzed.

Figure 5. Schematic representation of the MEIS2 gene locus on chromosome 15q14 and the location of the two CpG islands that were analyzed. The dark gray boxes represent the two CpG islands upstream od the gene locus (MEIS2-3 and MEIS2 upstream). The light gray box represents the beginning of the first exon of MEIS2.

2.2.17 Software and Statistical Analysis

Tables and figures such as bar, line charts and scatter plots were generated using Microsoft Excel 2016 and GraphPad Prism 7 software. Figures used to display BrdU

36 assay as well as Apoptosis assay results were generated using Flowjo. Further figures were designed using Microsoft PowerPoint 2016. Statistical analysis was performed using GraphPad Prism 7 software using Mann-Whitney-U-Test. Real Time PCR using Taqman probes was performed on an 7900HT Fast real-time PCR System. The raw data was processed using the SDS Software 2.3.

3 Results

3.1 Quantification of MEIS2 expression in ALL samples vs. those of healthy individuals

We performed a real-time quantitative PCR with samples of 43 adult and pediatric patients with acute lymphoblastic leukemia as well as healthy controls. Hereby three samples with mononucleated cells (MNC) and three CD34 positive samples from BM of healthy individuals, as well as two samples of sorted sub-populations of CD19+ and CD3+ cells from peripheral blood were used to analyze for MEIS2 expression. In total 26 pediatric and 17 adult leukemic samples were analyzed. The samples were subdivided according to the immunophenotypic subgroups of ALL as proposed by the European Group for the Immunological Characterization of Leukemias (EGIL) [11]. Samples were normalized with the housekeeping gene TATA-binding-protein (TBP).

To interpret the results properly it should be kept in mind that the ∆Ct values are inversely correlated to the expression of the gene.

38 out of 43 patient samples as well as the MNCs and sorted sub-populations from normal PB showed MEIS2 expression. Expression of MEIS2 in all ALL samples was increased 2.4- fold compared to the total MNC’s and 1.3- fold compared to CD19+ cells (Fig. 6). When organized based on their immunophenotypic classification, MEIS2 was highly expressed in pre-B- as well as mature B- and mature T-ALL, although in the latter subgroups the number of patients was low as illustrated in Fig. 7. If subdivided into adult and pediatric leukemia, there was a significant difference in the expression of MEIS2 with higher expression in pediatric samples in comparison to adult ALL patients as depicted in Fig. 7. There was also a significantly higher expression of MEIS2 in pediatric samples in comparison to healthy MNCs.

Figure 6. Scatter plot with means and standard error of the mean (SEM) illustrating the quantification of MEIS2 expression in 43 patient samples subdivided according to age as well as the lymphocytic lineage. In five patients, no expression of MEIS2 was detected. These patients are not displayed. On the y-axis, the expression of MEIS2 is displayed using ∆Ct values. ∆Ct values are inversely correlated to the expression of the gene. The expression of MEIS2 is significantly higher in pediatric B-ALL than in adult B-ALL. Further pediatric B-ALL shows a significantly higher expression of MEIS2 compared to healthy MNCs. * = p<0.05 (Mann-Whitney-U test); Abbreviations: MNC = mononuclear cells, ALL = acute lymphoblastic leukemia, CD = cluster of differentiation, TBP = TATA binding protein, MEIS2 = myeloid ecotropic integration site, Ct = cycle threshold

Figure 7. Scatter plot with means and SEM illustrating the quantification of MEIS2 expression in 43 patient samples subdivided according the immunophenotypic classification compared to healthy controls. In five patients, no expression of MEIS2 was detected. These patients are not displayed. As healthy controls four MNC samples, two samples each sorted for CD3+, CD19+ cells and three samples of sorted CD34+ cells were used. Each symbol represents a patient sample. On the y-axis the expression of MEIS2 is displayed using ∆Ct values. ∆Ct are inversely correlated to the expression of the gene. There was no significant difference in expression among the different groups. Abbreviations: cort. T-ALL= cortical T-ALL; c B-ALL= common B-ALL, pro B-ALL = precursor B-cell ALL, MNC = mononuclear cells, ALL = acute lymphoblastic leukemia, CD = cluster of differentiation, TBP = TATA binding protein, MEIS2 = myeloid ecotropic integration site, Ct = cycle threshold, SEM = standard error of the mean

3.2 Quantification of MEIS2 expression in leukemic cell lines

As we observed high expression of MEIS2 in ALL samples, we further analyzed the expression of MEIS2 in a panel of five acute lymphoblastic leukemia cell lines. Tanoue, and KOPN-8 are B-cell acute lymphoblastic leukemia. Jurkat, MOLT-4 and CCRF-CEM represent T-cell acute lymphoblastic leukemia.

The quantification was performed three times. The average values with the corresponding standard error of the mean (SEM) values are displayed in Fig. 8. Most cell lines show high expression levels of MEIS2 normalized to the housekeeping gene TATA binding protein (TBP). There was no expression of MEIS2 detected in KOPN-8, although TBP was expressed in all three experiments, suggesting a correct performance of the experiment.

Figure 8. Quantification of MEIS2 expression in leukemic cell lines in three experiments. Mean values and SEM are displayed. Tanoue and KOPN-8 represent B-ALL cell lines; Jurkat, CCRF-CEM, MOLT-4 represent T-ALL cell lines; High expression of MEIS2 was detected in virtually all cell lines. In KOPN-8 no MEIS2 expression was detected; Ct = cycle threshold, ALL = acute lymphoblastic leukemia, TBP = TATA binding protein; (#) = no expression of MEIS2 detected. ∆Ct values are inversely correlated to the expression of the gene.

3.3 Methylation assay

Epigenetic alterations especially promotor methylation in CG-rich sites, the so called CpG-islands or CpG shores are known to regulate transcription of genes. Promotor regions showing high levels of methylation show lower expression of genes [140,170].

To gain first insights in the regulation of MEIS2 expression nine patient samples were analyzed using EpiTyper - MassARRAY system from Sequenom Inc. (kindly performed by the German Cancer Research Center (DKFZ) in Heidelberg, Dr. Rainer Claus). The methylation status of two CpG-islands was interrogated in some random ALL samples (n=9). Two patient samples (166 and 140) were obtained during the time of relapse. MEIS2-3 and MEIS2 upstream stand for CpG-islands upstream of the MEIS2 promotor. The position of the CG-rich regions is displayed in Fig. 5 in the Methods section.

The methylation status of the two investigated CpG-islands in nine patient samples is displayed in the bar diagram (Fig. 9). The bars represent the extent of methylation in percent of the CpG-dinucleotides. The x-axis in Fig. 9(A) represents the identification numbers of the nine patients. To assess the correlation between MEIS2 transcription and the methylation of CpG-sites a RT-qPCR using Taqman probes was performed. The promotor methylation correlated in eight of nine samples with MEIS2 expression as depicted in Fig. 9(B) with an exception of one ALL sample (probe 161). All these eight samples correlated with low expression and high promoter methylation and vice-versa. In patient 161 both CpG-islands showed low methylation levels around 7% despite no MEIS2 expression.

Methylation status A.

90 Meis2-3 80 Meis2 70 upstream 60 50 40

30 CpG methylation CpGmethylation in percent 20 10 0 126 130 141 149 151 159 161 163 166

MEIS2 expression B. 7,00

5,00

3,00

1,00 # # # # #

-1,00

-3,00

ΔCt MEIS2 ΔCt MEIS2 (normalized TBP) to -5,00

-7,00 126 130 141 149 151 159 161 163 166

Figure 9. Methylation status (A) and corresponding MEIS2 expression (B) in nine patient samples. The extent of CpG methylation in eight of nine cases correlates with transcription of MEIS2. In one patient (161) no correlation between promotor methylation and expression of MEIS2 could be found. ∆Ct values are inversely correlated to the expression of the gene; Ct = cycle threshold, ALL = acute lymphoblastic leukemia, TBP = TATA binding protein, CpG = Cytosine- phosphatidyl-Guanine; (#) = no expression of MEIS2 detected.

3.4 Localization of MEIS2 protein in the cell

As we observed high expression of MEIS2 in ALL patients as well as ALL cell lines, we determined the localization of MEIS2 in ALL cell lines. This analysis was performed in ALL cell lines Jurkat and Tanoue to visualize the subcellular localization of MEIS2. Therefore, a primary MEIS2-antibody and a secondary antibody with a conjugated green dye was used. DAPI (4′,6-diamidino-2- phenylindole), a blue fluorescent DNA-stain, was used to visualize the nucleus as it binds to AT regions of double-stranded DNA. The results are displayed in Fig. 10. In both cell lines, B-ALL cell line Tanoue as well as T-ALL cell line Jurkat, MEIS2, as a transcription factor, seems to be localized mainly in the nucleus and to some extent in the cytoplasm shows also green staining, suggesting that MEIS2 exhibits functions in the cytoplasm. Similar staining patterns could be observed for both cell lines.

Figure 10. Localization assay of MEIS2 for B-ALL cell line Tanoue and T-ALL cell line Jurkat. Nucleus staining with DAPI (blue), MEIS2 staining with a green fluorescence dye. The third picture shows an overlay of the two pictures before. Staining of the protein MEIS2 shows the presence of the protein in the nucleus as well as thy cytoplasm in B-ALL cell lines Tanoue and T-ALL cell line Jurkat. DAPI =

4’, 6- Diamidin-2-phenyldiol.

3.5 Knockdown of MEIS2 in ALL cell lines Tanoue and Jurkat using shRNA

Due to high expression of MEIS2 and favorable maintenance and growing conditions, the B-cell leukemia cell line Tanoue and T-cell leukemia cell line Jurkat were infected with lentivirus that contained vectors either with shRNA, an empty vector pLKO.1 or a scrambled vector respectively. The shRNA was targeted against the sequence of MEIS2 to induce stable silencing of the gene. The scrambled vector contained a scrambled shRNA sequence to act as a negative control. The empty vector pLKO.1 is a plasmid without any shRNA that we also used as a negative control.

Following the lenti-viral silencing of MEIS2 the extent of the reduction of expression on the RNA level was measured using qRT-PCR. Similarly, the reduction on the protein level was assessed using Western Blot analysis. To study the influence of reduced MEIS2 on cell biology functional assays such as proliferation assay, colony forming assay, apoptosis and cell cycle assay were performed. To understand the obtained results as well as to gain further insight in the possible protein network around MEIS2, RNAseq analysis was performed and validated using qtRT-PCR.

3.5.1 Analysis of MEIS2 silencing using qRT-PCR

Initially, the extent of the reduction of expression of MEIS2 after shRNA mediated knockdown was measured using qRT-PCR with TBP as the reference gene. The cells were previously selected by adding puromycin to the growth medium. Due to a “built in” puromycin resistance gene in the plasmid, only the cells with a successful integration of the plasmid survived. The extent of the knockdown is given in percentages using obtained ∆Ct values and displayed in Fig.11. The mean reduction of expression of MEIS2 in six performed experiments in comparison to the negative control was about 47% for the T-ALL cell line Jurkat and 57% for B-ALL cell line Tanoue.

Figure 11. Relative expression of MEIS2 in ALL cell lines Jurkat and Tanoue after lentivirus mediated knockdown using shRNA in comparison to scrambled vector as a negative control in six experiments. Mean values and the SEM are depicted. The quantification was performed using RQ-Taqman-PCR. The experiment was performed six times. The extent of the knockdown is displayed in percentages: 47% downregulation of MEIS2 in Jurkat and 57% downregulation of MEIS2 in Tanoue. The knockdown was stronger in the B-ALL cell line Tanoue with reduction of expression by 57 % at the RNA level. There was a significant difference in MEIS2 expression between the scrambled control and the samples harboring the shRNA construct. (*) = p-values<0,001 for shMEIS2 vs. scrambled for Jurkat and Tanoue respectively.

3.5.2 Analysis of MEIS2 knockdown on protein level using Western Blot

The cells of T-ALL cell line Jurkat and B-ALL cell line Tanoue were harvested after knockdown and selected with puromycin to determine the knockdown of MEIS2 on the protein level. A representative western blot analysis illustrated in Fig.12 showed a considerable reduction of the protein amount in the transfected cell lines. 훽-Actin was used thereby as a loading control. As displayed in Fig. 12 the bands around 52 kDa from the cell lysate of transfected cells are barely visible, indicating a reduction of MEIS2 protein as a result of the knockdown. In contrast, the negative controls such as the empty vector pLKO.1 and the scrambled vector still show prominent bands. The comparison to ß-actin shows an equal protein loading, indicating that the differences in the intensity in the bands are indeed the result of reduced protein translation.

The intensive dark bands around 55-60 kDa represent unspecific bands according to the manufacturer of the antibodies.

Figure 12. Western Blot analysis of Jurkat and Tanoue after performing a knockdown of MEIS2. pLKO.1 and scrambled vector represent the negative controls. In the upper row cell lysates incubated with an anti-MEIS2 antibody are illustrated. The intensive dark bands around 55-60 kDa, marked with an asterix (*) represent unspecific binding according to the manufacturer of the antibodies. The bands around 52 kDa represent the MEIS2 protein. The lighter bands of the shMEIS2 samples point to the reduced protein expression of MEIS2 after the virus mediated knockdown. In the row below cell lysates incubated with anti-훽-actin antibody acting as a loading control are illustrated; kDa = kiloDalton, shMEIS2 = construct with shRNA direct against MEIS2; pLKO.1 = empty vector; scrambled = construct with a scrambled sequence

3.6 Effects of Knockdown of MEIS2 on transfected ALL cell lines Jurkat and Tanoue

To determine the effects of the knockdown of MEIS2 on transfected cells various assay were performed such as assays measuring colony forming ability, proliferation, apoptosis and cell cycle.

3.6.1 Effect of MEIS2 Knockdown on colony forming ability of transfected cells

To assess the capacity of the transfected cells to form colonies a CFC-assay was performed. The colony forming ability of cells that were transfected with shRNA construct against MEIS2 was compared to both negative controls. Cells that were transfected with an empty vector pLKO.1 and the plasmid with the scrambled sequence represent the negative controls.

The initially planted 300 cells for every construct formed over the time of 14 days. As illustrated in Fig. 13 the cells harboring the shMEIS2 construct formed in both cell lines barely a third of the amount of colonies derived from the cells transfected with the scrambled vector, indicating that the reduction of MEIS2 leads to impaired colony forming capacity. The effect was observed in both cell lines. Knock down of MEIS2 showed a reduction of 65% of colonies in T-cell leukemia Jurkat and 69 % in B-cell leukemia Tanoue compared to the scrambled vector as shown in Fig. 13. The difference in colony numbers between cells harboring the shMEIS2 construct and the controls represented by the empty vector pLKO1 and the scrambled vector was significant.

Figure 13. Assessment of the colony forming capacity (CFC) of cells with MEIS2 knockdown in comparison to negative controls analyzed in two previously transfected ALL cell lines Jurkat and Tanoue in four experiments. Mean values and SEM are displayed. After 14 days, there were significantly less colonies on plates with cells harboring shRNA directed against MEIS2 in comparison to the empty vector and scrambled construct. The effect is present in both cell lines. (*) = p-value < 0.05, (**) = p-value < 0,005 (Mann-Whitney-U test); shMEIS2 = construct with shRNA direct against MEIS2; pLKO.1 = empty vector; scrambled = construct with a scrambled sequence, SEM = standard error of the mean

3.6.2 Effect of MEIS2 knockdown on proliferation of transfected cells

In order to examine the effect of MEIS2 knockdown on the proliferation of the transfected ALL cell lines Jurkat and Tanoue, we determined the proliferation rate by counting the cells after 48, 96 and 144 hours. The cell growth curves of the initially planted 50×103 cells for each construct and each cell line, respectively, are demonstrated in Fig. 14 and Fig. 15.

The growth rate of cells with silenced MEIS2 gene was markedly reduced compared to control cells harboring the empty vector pLKO.1 and scrambled vector. The difference was not statistically significant for the T-ALL cell line Jurkat, although clearly showing a trend. In the B-ALL cell line Tanoue the difference at 144 hours, calculated using Mann-Whitney test, was statistically significant between the cells with silenced MEIS2 and the scrambled vector. The results suggest that decreased expression levels of MEIS2 are associated with growth inhibition.

Figure 14. Proliferation assay with infected cell lines Jurkat after MEIS2 knockdown. The figures demonstrate cell growth of T-ALL cell line Jurkat after planting 50k cells on day zero. The cells were counted after 48h, 96h, and 144h. Cells infected with an empty vector pLKO.1 and the scrambled vector represent negative controls. ns = not significant (Mann-Whitney-U test); ALL = acute lymphoblastic leukemia, shMEIS2 = construct with shRNA direct against MEIS2; pLKO.1 = empty vector; scrambled = construct with a scrambled sequence, h = hours

Figure 15. Proliferation assay with infected cell lines Tanoue after MEIS2 knockdown. The figures demonstrate cell growth of the B-ALL cell line Tanoue after planting 50k cells on day zero. The cells were counted after 48h, 96h, and 144h. Cells infected with an empty vector pLKO.1 and the scrambled vector represent negative controls. ns = not significant, * = p < 0,05 (Mann-Whitney-U test); ALL = acute lymphoblastic leukemia, shMEIS2 = construct with shRNA direct against MEIS2; pLKO.1 = empty vector; scrambled = construct with a scrambled sequence, h = hours

3.6.3 Investigation of lower proliferation rate of cells with MEIS2 Knockdown using Apoptosis Assay

Given the result of the proliferation assay indicating that reduction of MEIS2 expression in T-ALL as well as B-ALL cell lines has an influence on proliferative properties of transfected cells we performed an apoptosis assay to narrow down the possible causes for the alteration in proliferation after silencing MEIS2.

The number of apoptotic cells comprised out of late apoptotic and early apoptotic cells shows a change only in decimal value in both cell lines as illustrated in Fig. 16A. and 16B. The cells infected with a scrambled vector represent hereby negative controls as the construct does not affect the expression of MEIS2. These results suggest no major influence of reduced MEIS2 expression levels on apoptosis.

Figure 16. Apoptosis Assay of the T-ALL cell line Jurkat (A) and B-ALL cell line Tanoue (B) after knocking down MEIS2. Jurkat scrambled are cell acting as negative controls, as they harbor the scrambled vector that does not influence the expression of MEIS2. Following the knockdown there was no increase in apoptotic cells; shMEIS2 = construct with shRNA direct against MEIS2, FITC = Fluorescein isothiocyanate, PI = propidium iodide

3.6.4 Investigation of lower proliferation rate of cells with MEIS2 Knockdown using Cell Cycle Assay

Previous experiments showed decreased proliferation rates in cells with silenced MEIS2 and it was not possible to pinpoint the effect on changes in apoptosis as demonstrated in chapter 3.6.3 using an Apoptosis Assay. In order to further understand the function of MEIS2, a cell cycle assay was performed with the transfected ALL cell lines Jurkat and Tanoue. Cells harboring the construct with the scrambled vector were used as controls. The cells were harvested on the last day of the proliferation assay. The cell cycle of the cells was synchronized with double- thymidine block prior to BrdU incorporation analysis. The results of the FACS analysis following BrdU-staining are illustrated in Fig.17 and 18. In the T-ALL cell line Jurkat a difference in the number of cells that were progressing the G0 -or G1 - phase of the cell cycle after the knockdown of MEIS2 was observed. The cells harboring the construct directed against MEIS2 contain a larger portion of cells that are residing in G0/G1-phase than the negative controls with the scrambled vector.

About 10% more cells are residing in G0/G1-phase in MEIS2 silenced cells than in the controls, thus showing that a knockdown of MEIS2 leads to a G1-arrest of the cells. A markedly higher percentage of cells residing in G0/G1-phase could be observed in the B-ALL cell line Tanoue as demonstrated in Fig.18. FACS analysis revealed an about 8% reduced fraction of cells progressing to the S-phase.

Moreover, the cell cycle assay showed about 20% more cells that entered the G0/G1- phase after knocking down MEIS2 in comparison to the controls. The results suggest that reduced MEIS2 transcripts lead to an alteration in cell cycle progression by arresting the cells in the G1-phase.

Figure 17. Cell Cycle Assay using BrdU of the T cell lymphoblastic leukemia cell line Jurkat after MEIS2 Knockdown. Cells were harvested during the last day of proliferation assay and were synchronized using double thymidine block to simultaneously enter the cell cycle. “Jurkat scrambled” served as control. FACS analysis showed about 8% more cells that entered the G0/G1-phase in comparison to the controls. Abbreviations: 7-AAD = 7-Aminoactinomycin, APC = Allophycocyanin, shMEIS2 = construct with shRNA direct against MEIS2

Figure 18. Cell Cycle Assay using BrdU (Bromodeoxyuridine) of the B cell lymphoblastic leukemia cell line Tanoue after MEIS2 Knockdown. Cells were harvested during the last day of proliferation assay and were synchronized using double thymidine block to simultaneously enter the cell cycle. “Tanoue scrambled” served as control. FACS analysis showed an increase in population in the G0/G1- phase of about 20 % after MEIS2 knockdown in comparison to the controls and an accompanied decrease of cells in both S- and G2/M-Phase as illustrated in the density plots. Abbreviations: 7-AAD = 7-Aminoactinomycin, APC = Allophycocyanin, shMEIS2 = construct with shRNA direct against MEIS2

3.6.5 RNA Seq

RNA sequencing using Illumina HiSeq 2000 was performed in the B-ALL cell line Tanoue after MEIS2 knockdown. This experiment was conducted in duplicates. The analyzed arms included cells harboring the shMEIS2-44 construct, cells with a scrambled vector and untreated cells, further referred to as wild type cells. The threshold for p-values was set to 0.05. In addition, FDR (false discovery rate)- adjusted p-values or q-values were used. The threshold for the q-values was set to 0.05. Twenty-three genes were statistically significant differentially expressed after MEIS2 knockdown (Table 13). As illustrated in the heatmap (Fig. 20) similar expression profiles could be observed in both runs as the sequencing was performed in duplicates. As depicted in the dendrogram in Fig. 19 wild type cells as well as scrambled cells, both serving as negative controls, shows same expression pattern as was expected.

Figure 19. The dissimilarity of the shRNA cluster compared to the control clusters, SCR and WT, are displayed using a dendrogram. The hierarchical clustering distance is displayed on the x-Axis. The negative controls SCR and WT showed similar expression profile. SCR = scrambled, WT = wild type

Figure 20. Heatmap illustrating 24 significant differentially expressed genes after MESI2 knockdown. Greentones indicate downregulation, red tones upregulation of genes. CTTN, BTG2 and CREB5 show an upregulation following MEIS2 knockdown, illustrated in red, whereas RAC2 shows a marked downregulation, illustrated in green. Abbreviations: shRNA = short hairpin RNA, scr = scrambled, wt = wild type.

The differentially expressed genes are involved in various pathways or exhibit various molecular functions as illustrated in Table 13 and Table 14. The information was obtained using the PANTHER Gene Ontology Data base and analyzed according the involvement of the genes in biological processes, molecular function and pathways. For eight differentially expressed genes an involvement in cellular processes such as cell cycle could be found. After the knockdown, an alteration of expression in several genes known to play a role in different pathways could be detected. The pathways involve T- and B-cell activation as well as TGF-beta signaling, FGF signaling, Ras or p38MAPK pathways.

Table 13. Analysis using PANTHER classification system of the 23 significant genes that were differentially expressed in B-ALL cell line Tanoue after MEIS2 knockdown. The genes were analyzed according their involvement different pathways. The number of the involved genes are displayed in brackets.

Pathways Involved genes n = 6

Axon guidance mediated by Slit/Robo RAC2

Axon guidance mediated by netrin RAC2

Axon guidance mediated by semaphorins RAC2

B cell activation RAC2

Cytoskeletal regulation by Rho GTPase RAC2

EGF receptor signaling pathway RAC2

FGF signaling pathway RAC2 Heterotrimeric G-protein signaling CREB5 pathway-Gi alpha and Gs alpha mediated Huntingtonpathway disease RAC2 Inflammation mediated by chemokine and RAC2 cytokine signaling pathway Integrin signaling pathway RAC2

Ras Pathway RAC2

T cell activation RAC2, CD74, HLA-DRA, CD3D

TGF-beta signaling pathway FKBP11 Transcription regulation by bZIP CREB5 transcription factor VEGF signaling pathway RAC2

p38 MAPK pathway RAC2

Table 14. Analysis using PANTHER classification system of the 23 significant genes that were differentially expressed in B-ALL cell line Tanoue after MEIS2 knockdown. The genes were analyzed according their involvement in biological processes and molecular function. The number of the involved genes are displayed in brackets.

Biological Processes Involved genes n = 17 cellular component organization or PLEK, CTTN biogenesis PLEK, RAC2, MS4A1, CD3D, CREB5, cellular process CTTN, FKBP11, BTG2 immune system process IRF4, IGJ, HLA-DRA, FCRLA, CLEC2D

localization RAC2 IRF4, IFI30, NDUFB7, CREB5, CTTN, metabolic process ANXA1, FKBP11 response to stimulus HLA-DRA, MS4A1, CD3D

Molecular Function Involved genes n = 12 IRF4, RAC2, IGJ, CREB5, CLEC2D, binding CTTN, FKBP11 catalytic activity RAC2, IFI30, NDUFB7, FKBP11

receptor activity MS4A1, CD3D

structural molecule activity PLEK, CTTN

3.6.6 Validation of the RNA-Seq results using qRT-PCR

From the 23 significant genes that were differentially expressed in the B-ALL cell line Tanoue after MEIS2 knockdown, four have been validated using qRT-PCR that includes MEIS2 as well. The analyzed genes are CTTN, CREB5 and RAC2. Therefore, RNA from the same experiments was used, meaning also duplicates.

Using RNA sequencing the expression of CTTN and CREB5 was shown to be markedly upregulated whereas MEIS2 and RAC2 were downregulated following the MEIS2 knockdown. The results of the RNAseq assay were validated and confirmed in duplicates using qRT-PCR. RAC2 showed a 2,69-fold downregulation after the MEIS2 knockdown, as detected using the RNA-Seq method and confirmed through

RT-qPCR. In contrast, the expression of CTTN and CREB5 was increased following MEIS2 knockdown, as depicted in lower delta Ct values in cells harboring the shRNA construct. Delta Ct values, as displayed in the bar diagram in Fig. 21A., inversely correlate to the expression of genes. Fig. 21B. summarizes the expression results obtained by RNA-Seq and qRT-PCR for the four genes. The expression data obtained through both methods showed strong positive correlation with a correlation coefficient r = 0,91 as delineated is Fig. 22, supporting the reproducibility and consistency of the obtained results.

A. B.

14,00 RT-qPCR validation n=3 RNA- qRT-PCR Seq

12,00 CTTN up up CREB5 up up 10,00 RAC2 down down

8,00 MEIS2 down down

6,00

SCR ct values ctvalues

4,00 shMEIS2 Delta

2,00

0,00

-2,00

-4,00 CTTN CREB5 RAC2 MEIS2

Figure 21. A. Validation by qRT-PCR of the expression results obtained through RNA Seq in B-ALL cell line Tanoue. After the knockdown of MEIS2 the expression of MEIS2 and RAC2 is downregulated in comparison with the scrambled control. In contrast, the expression of CTTN and CREB5 is increased following MEIS2 knockdown, as depicted in lower ∆Ct values in cells harboring the shRNA construct. ∆Ct values are inversely correlated to the expression of the gene. Figure 21B summarizes the results obtained by both methods. The downregulation of MEIS2 and simultaneously RAC2 as well as the upregulation of CTTN and CREB5 was detected by RNA-Sequencing and confirmed by qRT-PCR; SCR=scrambled vector.

Correlation Coefficent (r = 0,91)

3 CTTN 2,5

PCR 2 - CREB5 1,5 1 0,5 0 -0,5 0 MEIS2 1 2 3 4 5 6 7 8 -1 -1,5 -2 RAC2 -2,5

Average Average fold expression qRT RNA-Seq Log2 fold expression

Figure 22. Correlation plot depicting the strong positive correlation (r = 0,91) between the expression of the four validated genes (MEIS2, RAC2, CTTN, CREB5) by qRT-PCR and the expression detected by RNAseq.

4 Discussion

Homeobox genes are well studied for their role in normal development and the importance of their dysregulation in leukemogenesis. MEIS2 is one such homeobox gene and is known to play a crucial role in differentiation during embryogenesis, development of limbs and various organs. An involvement of MEIS proteins in oncogenesis has also been suggested. Recent studies detected overexpression of MEIS proteins in breast cancer [32], ovarian cancer [161] or neuroblastoma [41]. The role of MEIS proteins have been studied in hematopoiesis and leukemogenesis. For instance, Meis1-deficient mice embryos exhibit disturbances in definitive hematopoiesis, displaying a lack of megakaryocytes or show quantitatively underdeveloped HSC (hematopoietic stem cell) compartments [10,60]. In terms of leukemogenesis, overexpression of both Meis1 and HoxA9 induces leukemia in mice [75]. MEIS1 is expressed in AML cells [1,69] and is shown to be overexpressed in distinct subtypes of ALL, such as ALL with t(4;11) [132] or other MLL-rearranged leukemias [36], but little is known about the MEIS1 paralogue MEIS2, especially its role in leukemogenesis. MEIS2 is found to be highly upregulated in patients with AML1-ETO acute myeloid leukemia [80]. Our group could recently show that the co- expression of MEIS2 with AML-ETO induces acute myeloid leukemia [80,156]. But there are scarce data about MEIS2 expression in other types of leukemia, especially in acute lymphoblastic leukemia. In this study, we could show that MEIS2 is highly expressed in bone marrow cells of patients with acute lymphoblastic leukemia compared to healthy donors. Microarray analysis performed by Haferlach et al. [53] using ALL bone marrow samples of patients as well healthy donors confirmed our data. MEIS2 was overexpressed in leukemic samples compared to healthy bone marrow cells. In the microarray analysis MEIS2 expression showed high heterogeneity between the different ALL subtypes, an observation that we could also confirm, in contrast to another study by Rosales-Avina [130]. In the mentioned study although a significantly higher expression of MEIS2 could be observed between leukemia derived cell lines and differentiated controls, no such difference could be found in patient ALL samples.

The investigation of the possible regulation mechanisms in MEIS2 expression using promotor methylation assay in nine patients for two CpG-islands showed that the

62 promotor methylation of MEIS2 was highly correlated to its expression in eight of nine samples.

Based on these findings we performed further investigations in ALL cell lines Tanoue (B-ALL) and Jurkat (T-ALL) which had highest expression of MEIS2. Using small hairpin RNA directed against MEIS2 we performed a stable knockdown in both cell lines.

The effects of the stable knockdown were further assessed in a proliferation assay, CFC assay, apoptosis and cell cycle assay in Jurkat and Tanoue. The depleted MEIS2 expression lead to a significant decrease in proliferation activity in both of the cells lines. We observed that the percentage of proliferation inhibition was cell line dependent as high levels of proliferation inhibition were observed in the B-ALL cell line Tanoue compared to the T-ALL cell line Jurkat. The response of the cells in terms of proliferation inhibition inversely correlated with MEIS2 expression, suggesting that higher levels of MEIS2 promote proliferation, consistent with previously published data by Zha et al. in 2014, showing similar results after incubating neuroblastoma cell lines with shRNA targeted against MEIS2 [166].

To assess the clonogenic capacity of leukemia cells a colony formation assay using methylcellulose-based media was performed and both the cell lines showed a marked reduction in colonies in cells with MEIS2 knockdown compared to scramble shRNA vector as well as empty vector control pLKO.1 vector. Our findings confirm the recently published results from our group on MEIS2 in acute myeloid leukemia cell lines regarding the relation between the aberrant expression of the TALE transcription factor MEIS2 and proliferation as well as colony formation [156].

To investigate the reason behind the significantly lower number of cells harboring the shRNA construct during the proliferation assay further assays were conducted. Possible reasons for this observation is an influence of decreased MEIS2 expression on cell survival i.e. apoptotic activity or perturbation in proliferation. To assess the former one, a flow-cytometric apoptosis assay was performed using the molecular processes of the cells during apoptosis. In our experiments, there was no significant difference in the number of cells undergoing apoptosis between the populations harboring the shMEIS2 construct in comparison to the scrambled shRNA and the empty vector controls. Thus, we conclude that the decreased

63 expression of the transcription factor MEIS2 does not induce apoptosis, but rather leads to a non-apoptotic death, a conclusion that was also drawn by Zha et al. in 2014 investigating MEIS2 in neuroblastoma cell lines. To confirm the results on molecular levels Zha et al. used immunoblotting showing no cleavage of pro- caspase 3 following MEIS2 depletion. Overexpression of BCL2, an anti-apoptotic protein, failed to protect the neuroblastoma cells from death following MEIS2- knockdown [166].

To verify that no methodical or technical errors during our apoptosis assay were made, we treated Jurkat cells with camptothecin, a cytotoxic substance that irreversibly binds to DNA-topoisomerase complex and induces apoptosis [116]. After treatment with camptothecin there was a clear increase in population of cells undergoing early apoptosis (Annexin +/PI -) and dead cells (Annexin +/PI +), indicating that no error was performed during the experiment and that the difference in the number of cells after the proliferation assay is indeed due to an alteration in proliferation activity rather than to an induced cell death.

To strengthen the hypothesis, we conducted a cell cycle assay using a two-dye flow cytometric analysis after incubating the cells with 7-amino-actinomycin D (7-AAD) and bromodeoxyuridine (BrdU). Knockdown of MEIS2 resulted in a significant increase of cells in G0/G1-phase and a decrease in cells undergoing the S-phase. This effect could be observed in B-ALL cell line Tanoue as well as in the T-ALL cell line Jurkat. These results suggest an involvement of MEIS2 in the regulation or progression of the cell cycle. The used assay allows to detect cycling cells duplicating the DNA and to quantify whole DNA in a cell, thus enabling to differentiate between G0/G1-, S- and G2/M-phase. To subdivide between G0 and G1 phase further assays with a molecular approach are needed. We assume that the increase in the cell population in the G0/G1 phase is due to a cell cycle arrest following MEIS2 protein level reduction. However, in the previously mentioned work by Zha et al [166] that examined the effect of MEIS2 knockdown in neuroblastoma cell lines, it could be shown that the neuroblastoma cells undergo a M-phase arrest. This was demonstrated cytometrically in a cell cycle assay using propidium idodide and by co-immunofluorescence staining with antibodies against phosphorylated histone H3 and -tubulin, a component of mitotic spindles [57,115]. Mitotic cells displayed multipolar spindles and consequently aberrant mitosis. To address the

64 molecular basis of the shown M-phase arrest, the authors performed a microarray analysis and could show a downregulation of genes after MEIS2 knockdown such as RBBP4, BMYB, and FOXM1 that control the G2-M checkpoint as well as mitotic sister chromatid segregation. A disruption in normal function of these processes is known to lead to a mitotic catastrophe [24,73]. Our observations showing that knockdown of MEIS2 results in an increase of cell populations in the G0/G1-phase are divergent to previous reports, yet stand in line with the assumption that proteins of the MEIS family exhibit pleiotropic effects. It appears that the MEIS2 function depends on environmental conditions i.e. cell type and cooperating cofactors. For example, other transcription factors, e.g. Klf4 (Kruppel-like factor 4) can recruit MEIS2 and another cofactor PBX1 to function as transcriptional activators in the p15 promotor region. In the human liver cancer cell line HepG2 knockdown of MEIS2 and PBX, also a homeobox protein, resulted in downregulation p15 and an increase in cells entering S-phase. The cyclin-dependent kinase inhibitor p15 is encoded by a tumor suppressor gene CDKN2B and controls the G1-phase progression [16,96]. A further study showed that the TALE homeobox protein Meis1, a paralogue of Meis2, is a critical regulator of murine postnatal cardiomyocyte cell cycle arrest. Meis1 transcriptionally activates CDK inhibitors from INK4 (p16) and CIP/KIP families (p21) leading to a cell cycle arrest and thus indirectly promoting terminal differentiation of the cardiomyocytes. These reports support the assumption of pleiotropic effects of MEIS proteins.

To investigate the molecular background of the effects on proliferation and cell cycle observed in our experiments we performed RNA sequencing in the B-ALL cell line Tanoue. We compared differentially expressed genes between the cells harboring the shMEIS2-construct and the scrambled vector as well as untreated Tanoue wild type cells. We identified 14 and 20 genes that showed a significant differential expression in cells with MEIS2 knockdown in comparison to the scrambled vector and untreated cells respectively. Both arms showed an overlap in 11 genes, ten of which were significantly downregulated following MEIS2 knockdown such as RAC2 and CD74. The antiproliferative proteins BTG2 and CREB5 were significantly upregulated after MEIS2 knockdown. The RNAseq data was validated using qRT- PCR with Taqman-probes for CTTN, CREB5, RAC2 as well as MEIS2 confirming

65 the results obtained through RNAseq. Interestingly, the differential regulation of genes could well explain the results with regard to proliferation and cell cycle.

Ras-related C3 botulinum toxin substrate protein (RAC2), a member of Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins and Rho GTPase subfamily, showed a four-fold downregulation following MEIS2 knockdown. RAC proteins are involved in the assembly of actin-myosin fibers, lamellipodia formation and membrane ruffling [6,88]. Expression of RAC2 appears to be restricted to hematopoietic cells, whereas RAC1 and RAC3 are widely expressed. It is assumed that the isoforms share common but redundant functions [153]. There is emerging evidence that RAC proteins exhibit transforming ability. Fibroblasts that constitutively expressed activated Rac induced palpable tumors in mice when inoculated subcutaneously and showed correlation between tumor-growth rate and Rac expression [125]. Activating mutations of RAC GTPases were found in several human cancers and cancer cell lines [70]. An overexpression of Rac2 in murine hematopoietic cells led to an increased proliferation, coherent with our observations of proliferation inhibition due to MEIS2 knockdown and associated downregulation of RAC2. Divergent to our data, the expression of a dominant negative mutation of Rac2 resulted in an increased apoptotic activity [51]. Further, the microinjection of constitutively activated Rac in quiescent murine fibroblasts resulted in a stimulation of cell cycle progression through G1 and consecutive DNA synthesis [78,104]. These observations stand in line with our experiments demonstrating a marked downregulation of RAC2 following MEIS2 knockdown which resulted in an increase of cell population in the G1/G0-phase.

The B-cell translocation gene 2 (BTG2), a member of the antiproliferative (APRO) gene family with reported antiproliferative and tumor suppressive properties [92], showed a 7.5-fold upregulation following MEIS2-knockdown. Overexpression of BTG2 exhibit different biological effects such as growth arrest [84,149] and differentiation of bone marrow precursor cells and leukemic cells [109]. BTG2 is shown to be downregulated in many human cancers [92] and the overexpression of BTG2 inhibited proliferation and cell growth in gastric [167], pancreatic [92] as well as lung [160] cancer cells thus underlining the antiproliferative properties of BTG2. Furthermore, BTG2 induces an arrest in the G1 phase through different pathways, an observation that stands in line with our results. The BTG2 expression is regulated

66 by a p53-mediated mechanism [131]. The tumor suppressor gene tp53 can upregulate BTG2 and downregulate cyclin D1, thus leading to a cell cycle arrest at G1/S-phase via pRB-pathway [52,84,100]. Further, BTG2 can induce downregulation of cyclin E and thus cause a cell cycle arrest in the absence of p53, Rb and cyclin D1 [84]. However, our RNA seq data has not revealed any significant changes in any cyclin molecule expression. Thus, the underlying mechanism of BTG2 upregulation after MEIS2-knockdown in acute lymphoblastic leukemia has still to be investigated. BTG2 induction appears to be not cell-cycle-dependent, but rather after a stimulus such as differentiation or DNA damage [100]. BTG2 is induced by cAMP and the promotor of BTG2 is found to be enriched with cyclic AMP response elements (CRE) [38], a noteworthy observation considering that following MEIS2 knockdown, RNAseq analysis showed a significant upregulation of CREB5 (cAMP response element binding protein 5), a transcription factor which belongs to the CRE (cAMP response element)-binding protein family [141]. As the name already suggests CREB proteins bind to cAMP-response-elements (CRE) within target genes. CREB5, which is highly homologous with CRE-BP1, binds to CRE as a homodimer or a heterodimer with CRE-BP1 and exerts functions as a CRE- dependent trans-activator [18]. Once CREB proteins are activated, the transcription of different genes involved in cell growth and survival as well others such as proto- oncogenes or cell cycle genes (cyclin A1 and cyclin D2) is induced [2,28,141,163]. Interestingly, CREB showed a two-three fold overexpression in primary AML cells and CREB5 overexpression was found in a subgroup of ALL with RCSD1-ABL1- fusion protein [18,134]. In the study by Shankar et al. [134] knockdown of CREB by RNAi led to suppression of cell proliferation and survival. Surprisingly, we observed a reduced cell proliferation and a cell cycle arrest although the expression of CREB5 increased several-fold after MEIS2-knockdown. CREB exerts its functions through many target genes. Impey et al. could identify BTG2, a cAMP regulated gene, as a CREB target [64].

Although CREB proteins, especially their overexpression, are seemed to be linked to oncogenesis and leukemogenesis, in our case downregulation of MEIS2 led to significant upregulation of CREB5 and BTG2. Considering the reports of BTG2 being a target of CREB proteins, it is fairly to assume, that the interaction of these proteins may stimulate alterations in the cell cycle leading to perturbation in

67 proliferation and a cell cycle arrest in ALL cells, thus rendering the previously described role in promoting oncogenesis through uncontrolled proliferation [141]. The possible interactions need to be further investigated and validated to understand the mechanisms behind the observations.

Another finding following MEIS2 knockdown in ALL cell lines was a markedly reduced expression of CD74 (cluster of differentiation 74). CD74 is an integral membrane protein and functions as a major histocompatibility complex (MHC) class II chaperone. CD74 is expressed in normal tissues on HLA (human leukocyte antigen) II positive cells such as lymphocytes [44]. Overexpression of CD74 was observed in different hematologic and solid cancers such as multiple myeloma [20], chronic lymphocytic leukemia [21], non-small cell lung cancer [95] or gastric cancer [65]. In chronic lymphocytic leukemia CD74 is overexpressed and is shown to act as a survival receptor by initiating a cascade through induction of NF-kB-activation leading to DNA synthesis, S-phase entry, cell division and induction of anti-apoptotic proteins of Bcl-2 family [140]. An inhibition of this cascade leads to decreased cell survival [14]. These observations stand in line with our results of reduced proliferation of acute lymphoblastic leukemia cells after MEIS2 knockdown and consequent CD74 downregulation.

Overexpression of CD74 is shown to stimulate cell growth and cell survival through different pathways. Recent studies evaluated CD74 as potential target for immunotherapy. A monoclonal, humanized anti-CD74 antibody, hLL1 (milatuzumab), is shown to cause growth inhibition and induction of apoptosis in B- cell lines when cross-linked with an antihuman immunoglobulin G (IgG) second antibody [144]. There are already ongoing Phase I studies to evaluate the safety and efficacy of the drug in patients with multiple myeloma [151]. Thus, MEIS2 overexpression is associated with increased expression of CD74, a gene whose effects are potentially druggable.

In summary our results demonstrate that, MEIS2 is highly expressed in patient ALL samples as well as in leukemic cell lines. The depletion of MEIS2 leads to proliferation inhibition and reduced clonogenic capacity, based on the observation of a cell cycle arrest in G0-phase indicating that these cell lines require MEIS2 for their survival. RNA seq data point to a regulatory network of genes involved in cell

68 cycle regulation and cell proliferation; the function and the expression of the genes seem to be connected to MEIS2 expression in ALL cell lines and are influenced upon downregulation of MEIS2. A physical interaction between CREB5, BTG2 and MEIS2 is probable since the promotor of BTG2 is rich in cAMP responsive elements (CRE) and both, BTG2 and CREB5 (CRE binding protein 5), displayed a marked upregulation following MEIS2 knockdown. MEIS1, the paraloque of MEIS2, contains a C-terminal domain that is required for leukemia induction [90]. This domain exerts transcriptional activity and is regulated by protein kinase A (PKA), which is thought to be dependent on the coactivator of cAMP response element-binding protein [46]. Latest studies could also determine a carboxy-terminal transcriptional activation domain for Meis2 with a 74% identity and 80% similarity to the C-terminal domain of Meis1 [63]. Thus, an interaction of the mentioned proteins can be assumed but need to be confirmed by further experiments. These results provide new insights into the role of a not well studied Hox cofactor in ALL and will fuel further studies to understand the transcriptional regulation of interacting partners of MEIS2 in these leukemias.

5 Summary

MEIS2, a transcription factor encoded by MEIS2, a homeobox gene, is known to play as a crucial role in differentiation during embryogenesis, development of limbs and various organs. Our group could recently show that the co-expression of MEIS2 with AML-ETO (Acute Myeloid Leukemia 1/Eight-Twenty One oncoprotein) can induce acute myeloid leukemia in mice. But there are scarce data about MEIS2 involvement in acute lymphoblastic leukemia (ALL). In this study, we aimed to characterize MEIS2 in acute lymphoblastic leukemia. We could show that MEIS2 is aberrantly expressed in bone marrow samples of patients with acute lymphoblastic leukemia in comparison to healthy controls. In addition, we demonstrated that MEIS2 is significantly higher expressed in pediatric samples than adult ALL samples. A methylation analysis of two CpG islands showed that in eight of nine patients MEIS2 expression inversely correlated to the extent of promotor methylation. Knockdown of MEIS2 in acute lymphoblastic leukemia cell lines Tanoue (B-ALL) and Jurkat (T-ALL) showed a significant proliferation inhibition and reduced clonogenic capacity. Flow cytometric analysis of knockdown cells did not show marked differences in apoptosis, however, cell cycle assays revealed a cell cycle arrest in the G0-phase following MEIS2 knockdown, suggesting a role of MEIS2 in cell cycle progression/regulation. RNAseq after knockdown of MEIS2, resulted in significantly differentially expressed genes belonging to pathways involved in B- and T- cell activation, transcription regulation by bZIP transcription factor, EGF- FGF-, TGF-beta, VEGF-signaling as well as RAS- and p38- MAPK pathway. Genes like RAC2 and CD74 showed a marked downregulation and genes like CREB5 and CTTN were upregulated following MEIS2-knockdown, which was further validated by qRT-PCR.

Altogether our data shows an important role of MEIS2 in acute lymphoblastic leukemia, given the high expression of MEIS2 in ALL samples and the dependency of ALL cell lines on MEIS2 for their proliferation and survival. Further studies to identify the collaborating and interacting partners of MEIS2 in these leukemias will be of importance to understand the mechanism underlying the aberrant expression and function of MEIS2.

6 Bibliography

[1] Afonja O, Smith JE, Cheng DM, Goldenberg AS, Amorosi E, Shimamoto T, Nakamura S, Ohyashiki K, Ohyashiki J, Toyama K, Takeshita K: MEIS1 and HOXA7 genes in human acute myeloid leukemia. Leuk. Res.: 849–855 (2000).

[2] Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C: A dominant- negative inhibitor of CREB reveals that it is a general mediator of stimulus- dependent transcription of c-fos. Mol. Cell. Biol.: 967–77 (1998).

[3] Akam M: Hox and HOM: homologous gene clusters in insects and vertebrates. Cell: 347–349 (1989).

[4] Alexander FE, Patheal SL, Biondi A, Brandalise S, Cabrera M, Chan LC, Chen LZ, Cimino G, Cordoba JC, Gu LJ, Hussein H, Ishii E, Kamel AM, Labra S, Magalha IQ, Mizutani S, Petridou E, Oliveira De MP, Yuen P, Wiemels JL, Greaves MF: Transplacental Chemical Exposure and Risk of Infant Leukemia with MLL Gene Fusion Transplacental Chemical Exposure and Risk of Infant Leukemia with. Cancer Res.: 2542–2546 (2001).

[5] Alharbi RA, Pettengell R, Pandha Hs, Morgan R: The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia: 1000–1008 (2012).

[6] Allen WE, Jones GE, Pollard JW, Ridley AJ: Rho, Rac and Cdc42 regulate actin organization and cell adhesion in macrophages. J. Cell Sci.: 707–720 (1997).

[7] Arber DA, Orazi A, Hasserjian R, Borowitz MJ, Le Beau MM, Bloomfield CD, Cazzola M, Vardiman JW: The 2016 revision to the World Health Organization classi fi cation of myeloid neoplasms and acute leukemia. Blood: 2391–2406 (2016).

[8] Argiropoulos B, Yung E, Humphries RK: Unraveling the crucial roles of Meis1 in leukemogenesis and normal hematopoiesis. Genes Dev.: 2845–2849 (2007).

[9] Armstrong SA, Look TA: Molecular genetics of acute lymphoblastic leukemia. J. Clin. Oncol.: 6306–6315 (2005).

[10] Azcoitia V, Aracil M, Martínez-A C, Torres M: The homeodomain protein Meis1 is essential for definitive hematopoiesis and vascular patterning in the mouse embryo. Dev. Biol. : 307–320 (2005).

[11] Bene MC, Castoldi G, Knapp W, Ludwig WD, Matutes E, Orfao A, van’t Veer MB: Proposals for the immnological classification of acute leukemias.

Leukemia: 1783–1786 (1995).

[12] Bennett JM., Catovsky D, Daniel MT, Flandrin G, Galton D. A., Gralnick H. R., Sultan C.: Proposals for the classification of the acute leukaemias. French- American-British (FAB) co-operative group. Br. J. Haematol.: 451–458 (1976).

[13] Bergiers I, Bridoux L, Nguyen N, Twizere JC, Rezsöhazy R: The Homeodomain Transcription Factor Hoxa2 Interacts with and Promotes the Proteasomal Degradation of the E3 Ubiquitin Protein Ligase RCHY1. PLOS: 1–12 (2013).

[14] Binsky I, Haran M, Starlets D, Gore Y, Lantner F, Harpaz N, Leng L, Goldenberg DM, Shvidel L, Berrebi A, Bucala R, Shachar I: IL-8 secreted in a macrophage migration-inhibitory factor- and CD74-dependent manner regulates B cell chronic lymphocytic leukemia survival. PNAS: 13408-13413 (2007).

[16] Bjerke GA., Hyman-Walsh C, Wotton D: Cooperative transcriptional activation by Klf4, Meis2 and Pbx1. Mol. Cell. Biol.: 3723–3733 (2011).

[17] Bonnet D, Dick JE: Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med.: 730– 737 (1997).

[18] De Braekeleer E, Douet-Guilbert N, Guardiola P, Rowe D, Mustjoki S, Zamecnikova A, Al Bahar S, Jaramillo G, Berthou C, Bown N, Porkka K, Ochoa C, De Braekeleer M: Acute lymphoblastic leukemia associated with RCSD1-ABL1 novel fusion gene has a distinct gene expression profile from BCR-ABL1 fusion. Leukemia: 1422–1424 (2013).

[19] Bürglin TR: Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Res.: 4173–4180 (1997).

[20] Burton JD, Ely S, Reddy PK, Stein R, Gold DV, Cardillo TM, Goldenberg DM: CD74 Is Expressed by Multiple Myeloma and Is a Promising Target for Therapy: Clin Cancer Res.: 6606–6611 (2004).

[21] Butrym A, Majewski M, Dzietczenia J, Kuliczkowski K, Mazur G: High CD74 expression correlates with ZAP70 expression in B cell chronic lymphocytic leukemia patients. Med. Oncol.: 1-6 (2013).

[22] Calvo KR, Knoepfler PS, Sykes DB, Pasillas MP, Kamps MP: Meis1a suppresses differentiation by G-CSF and promotes proliferation by SCF: potential mechanisms of cooperativity with Hoxa9 in myeloid leukemia. Proc. Natl. Acad. Sci. U. S. A.: 13120–13125 (2001).

[23] Casciola-Rosen L, Rosen A, Petri M, Schlissel M: Surface blebs on apoptotic

cells are sites of enhanced procoagulant activity: implications for coagulation events and antigenic spread in systemic lupus erythematosus. Proc. Natl. Acad. Sci. U. S. A.: 1624–1629 (1996).

[24] Castedo M, Perfettini JL, Roumier T, Andreau K, Medema R, Kroemer G: Cell death by mitotic catastrophe: a molecular definition. Oncogene: 2825–2837 (2004).

[25] Chang CP, Brocchieri L, Shen WF, Largman C, Cleary ML: Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus. Mol. Cell. Biol.: 1734–1745 (1996).

[26] Chang CP, Jacobs Y, Nakamura T, Jenkins NA, Copeland NG, Cleary ML: Meis proteins are major in vivo DNA binding partners for wild-type but not chimeric Pbx proteins. Mol. Cell. Biol.: 5679–5687 (1997).

[27] Comelli L, Marchetti L, Arosio D, Riva S, Abdurashidova G, Falaschi A: The homeotic protein HOXC13 is a member of human DNA replication complexes. Cell Cycle: 454-459 (2009).

[28] Desdouets C, Matesic G, Molina CA, Foulkes NS, Sassone-Corsi P, Brechot C: Cell Cycle Regulation of Cyclin A Gene Expression by the Cyclic AMP- Responsive Transcription Factors CREB and CREM. Mol Cell Biol: 3301– 3309 (1995).

[29] Dick JE: Stem cells: Self-renewal writ in blood. Nature: 231–233 (2003).

[30] Dinarello CA, Bunn PA Jr: Fever. Semin Oncol: 288-298 (1997).

[31] Doll R, Wakeford R: Risk of childhood cancer from fetal irradiation. Br. J. Radiol.: 130–139 (1997).

[32] Doolan P, Clynes M, Kennedy S, Mehta JP, Germano S, Ehrhardt C, Crown J, O’Driscoll L: TMEM25, REPS2 and Meis 1: Favourable prognostic and predictive biomarkers for breast cancer. Tumor Biol.: 200–209 (2009).

[33] Ehrich M, Nelson MR, Stanssens P, Zabeau M, Liloglou T, Xinarianos G, Cantor CR, Field JK, van den Boom D: Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry. Proc. Natl. Acad. Sci. U. S. A.: 15785–15790 (2005).

[34] Endl E, Steinbach P, Knüchel R, Hofstädter F: Analysis of cell cycle-related Ki-67 and p120 expression by flow cytometric BrdUrd-Hoechst/7AAD and immunolabeling technique. Cytometry: 233–241 (1997).

[35] Engeland Van M, Ramaekers FCS, Schutte B, Reutelingsperger CPM: A novel assay to measure loss of plasma membrane asymmetry during

apoptosis of adherent cells in culture. Cytometry: 131–139 (1996).

[36] Ferrando AA, Armstrong SA, Neuberg DS, Sallan SE, Silverman LB, Korsmeyer SJ., Look TA: Gene expression signatures in MLL-rearranged T- lineage and B-precursor acute leukemias: Dominance of HOX dysregulation. Blood: 262–268 (2003).

[37] Fialkow PJ, Singer JW, Raskind WH: Clonal Development, Stem-cell Differentiation, And Clinical Remissions In Acute Nonlymphocytic Leukemia. N. Engl. J. Med.: 468–473 (1987).

[38] Fletcher BS, Lim RW, Varnum BC, Kujubu DA, Koski RA, Herschman HR: Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters. J. Biol. Chem.: 14511–14518 (1991).

[39] Fognani C, Kilstrup-Nielsen C, Berthelsen J, Ferretti E, Zappavigna V, Blasi F: Characterization of PREP2, a paralog of PREP1, which defines a novel sub-family of the MEINOX TALE homeodomain transcription factors. Nucleic Acids Res.: 2043–2051 (2002).

[40] Fujino T, Yamazaki Y, Largaespada D a, Jenkins N a, Copeland N G, Hirokawa K, Nakamura T: Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes. Exp. Hematol.: 856–863 (2001).

[41] Geerts D, Revet I, Jorritsma G, Schilderink N, Versteeg R: MEIS homeobox genes in neuroblastoma. Cancer Lett.: 43–50 (2005).

[42] Gehring WJ, Affolter M, Bürglin T: Homeodomain proteins. Annu. Rev. Biochem.: 487–526 (1994).

[43] Gehring WJ, Müller M, Affolter M, Percival-Smith A, Billeter M, Qian YQ, Otting G, Wüthrich K: The structure of the homeodomain and its functional implications. Trends Genet.: 323–329 (1990).

[44] Georgouli M, Papadimitriou L, Glymenaki M, Patsaki V, Athanassakis I: Expression of MIF and CD74 in leukemic cell lines: Correlation to DR expression destiny. Biol. Chem.: 519–528 (2016).

[45] Gilbert PM, Mouw JK, Unger MA, Lakins JN, Gbegnon MK, Clemmer VB, Benezra M, Licht JD, Boudreau NJ, Tsai KKC, Welm AL, Feldman MD, Weber BL, Weaver VM: HOXA9 regulates BRCA1 expression to modulate human breast tumor phenotype. J. Clin. Invest.: 1535–1550 (2010).

[46] Goh SL, Looi Y, Shen H, Fang J, Bodner C, Houle M, Ng ACH, Screaton RA, Featherstone M: Transcriptional activation by MEIS1A in response to protein kinase a signaling requires the transducers of regulated CREB family of CREB

co-activators. J. Biol. Chem.: 18904–18912 (2009).

[47] Gratzner HG, Leif RC: An immunofluorescence method for monitoring DNA synthesis by flow cytometry. Cytometry: 385–389 (1981).

[48] Graux C, Cools J, Michaux L, Vandenberghe P, Hagemeijer a: Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from thymocyte to lymphoblast. Leukemia: 1496–510 (2006).

[49] Greaves MF: Aetiology of acute leukaemia. Lancet: 344–349 (1997).

[50] Greaves MF, Maia AT, Wiemels JL, Ford AM: Review article Leukemia in twins : lessons in natural history. Bood: 2321–2333 (2003).

[51] Gu Y, Jia B, Yang FC, D’Souza M, Harris CE, Derrow CW, Zheng Y, Williams DA: Biochemical and Biological Characterization of a Human Rac2 GTPase Mutant Associated with Phagocytic Immunodeficiency. J. Biol. Chem.: 15929– 15938 (2001).

[52] Guardavaccaro D, Corrente G, Covone F, Micheli L, D’Agnano I, Starace G, Caruso M, Tirone F: Arrest of G1-S progression by the p53-inducible gene PC3 is Rb dependent and relies on the inhibition of cyclin D1 transcription. Mol. Cell. Biol.: 1797–1815 (2000).

[53] Haferlach T, Kohlmann A, Wieczorek L, Basso G, Te Kronnie G, Béné MC, De Vos J, Hernández JM, Hofmann WK, Mills KI, Gilkes A, Chiaretti S, Shurtleff SA, Kipps TJ, Rassenti LZ, Yeoh AE, Papenhausen PR, Liu WM, Williams PM, Foà R: Clinical utility of microarray-based gene expression profiling in the diagnosis and subclassification of leukemia: Report from the international microarray innovations in leukemia study group. J. Clin. Oncol.: 2529–2537 (2010).

[54] Halder SK, Cho YJ, Datta A, Anumanthan G, Ham AJL, Carbone DP, Datta PK: Elucidating the mechanism of regulation of transforming growth factor β Type II receptor expression in human lung cancer cell lines. Neoplasia: 912– 922 (2011).

[55] Hamid SM, Cicek S, Karamil S, Ozturk MB, Debelec-Butuner B, Erbaykent- Tepedelen B, Varisli L, Gonen-Korkmaz C, Yorukoglu K, Korkmaz KS: HOXB13 contributes to G1/S and G2/M checkpoint controls in prostate. Mol. Cell. Endocrinol.: 38–47 (2014).

[56] Hanahan D, Weinberg RA: The Hallmarks of Cancer. Cell: 57–70 (2000).

[57] Hans F, Dimitrov S: Histone H3 phosphorylation and cell division. Oncogene 20: 3021–3027 (2001).

[58] Hansel DE, Rahman A, House M, Ashfaq R, Berg K, Yeo CJ, Maitra A: Met

proto-oncogene and insulin-like growth factor binding protein 3 overexpression correlates with metastatic ability in well-differentiated pancreatic endocrine neoplasms. Clin. Cancer Res.: 6152–6158 (2004).

[59] Heine P, Dohle E, Bumsted-O’Brien K, Engelkamp D, Schulte D: Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development. Development: 805–811 (2008).

[60] Hisa T, Spence SE, Rachel RA, Fujita M, Nakamura T, Ward JM, Devor- Henneman DE, Saiki Y, Kutsuna H, Tessarollo L, Jenkins NA, Copeland NG: Hematopoietic, angiogenic and eye defects in Meis1 mutant animals. EMBO J.: 450–459 (2004).

[61] Hoelzer DF: Neoplastic Diseases of the Blood, Diagnosis and treatment of adult acute lymphoblastic leukemia, in Wiemik PH, Goldman JM, DUtcher JP, Kyle RA, Neoplastic Diseases of the Blood, 5th Edition, 331-354, New York (2013).

[62] Howlader N, Noone AM, Krapcho M, Garshell J, Neyman N, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, Cho H, Mariotto A, Lewis DR, Chen HS, Feuer EJ, Cronin KA. SEER Cancer Statistics Review, 1975-2010, National Cancer Institute. Bethesda, MD, https://seer.cancer.gov/csr/1975_2010/, based on November 2012 SEER data submission, posted to the SEER web site, (2013); (20.11.2015)

[63] Hyman-Walsh C, Bjerke GA., Wotton D: An autoinhibitory effect of the homothorax domain of Meis2. FEBS J.: 2584–2597 (2010).

[64] Impey S, Mccorkle SR, Cha-molstad H, Dwyer JM, Yochum GS, Boss JM, Mcweeney S, Dunn John J, Mandel Gail, Goodman Richard H, York New: Defining the CREB Regulon : A Genome-Wide Analysis of Transcription Factor Regulatory Regions Emory School of Medicine.: 1041–1054 (2004).

[65] Ishigami S, Natsugoe S, Tokuda K, Nakajo A, Iwashige H, Aridome K, Hokita S, Aikou T: Invariant chain expression in gastric cancer: Cancer Lett.: 87–91 (2001).

[66] Jacobs Y, Schnabel CA, Cleary ML: Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity. Mol. Cell. Biol.: 5134–5142 (1999).

[67] Jagannathan-Bogdan M, Zon LI.: Hematopoiesis. Development 140: 2463– 2467 (2013).

[68] Kaatsch P, Spix C: Annual Report 2013/2014 (1980-2013). German Childhood Cancer Registry GCCR (1980-2013). Insitute Of Med. Biostat. Epidemiol. Informatics Univ. Johannes Gutenb. Univ. Mainz (2014).

http://www.kinderkrebsregister.de/typo3temp/secure_downloads/26650/0/22 cb72c5a76a0e46c1fe00358768d9ab8ecd3c1e/jb2014_s.pdf (10.11.2015)

[69] Kawagoe H, Humphries RK, Blair A, Sutherland HJ, Hogge DE: Expression of HOX genes, HOX cofactors, and MLL in phenotypically and functionally defined subpopulations of leukemic and normal human hematopoietic cells. Leuk. Off. J. Leuk. Soc. Am. Leuk. Res. Fund, U.K: 687–698 (1999).

[70] Kawazu M, Ueno T, Kontani K, Ogita Y, Ando M, Fukumura K, Yamato Azusa, Soda M, Takeuchi K, Miki Y, Yamaguchi H, Yasuda T, Naoe T, Yamashita Y, Katada T, Choi YL, Mano H: Transforming mutations of RAC guanosine triphosphatases in human cancers. Proc. Natl. Acad. Sci. U. S. A.: 3029–34 (2013).

[71] Kim YR, Oh KJ, Park RY, Xuan Nguyen T, Kang TW, Kwon DD, Choi C, Kim MS, Nam KI, Ahn KY, Jung C: HOXB13 promotes androgen independent growth of LNCaP prostate cancer cells by the activation of E2F signaling. Mol. Cancer: 1-14 (2010).

[72] Knoepfler PS, Calvo KR, Chen H, Antonarakis SE, Kamps MP: Meis1 and pKnox1 bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in oncoprotein E2a-Pbx1. Proc. Natl. Acad. Sci. U. S. A.: 14553– 14558 (1997).

[73] Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, Baehrecke EH, Blagosklonny MV, El-Deiry WS, Golstein P, Green DR, Hengartner M, Knight RA, Kumar S, Lipton SA, Malorni W, Nunez G, Peter ME, Tschopp J, Yuan J, Piacentini M, Zhivotovsky B, Melino G: Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell Death Differ.: 3–11 (2009).

[74] Kroon E, Thorsteinsdottir U, Mayotte N, Nakamura T, Sauvageau G: NUP98- HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. EMBO J.: 350–361 (2001).

[75] Kroon E, Krosl J, Thorsteinsdottir U, Baban S, Buchberg AM, Sauvageau G: Hoxa9 transforms primary bone marrow cells through specific collaboration with Meis1a but not Pbx1b. EMBO J.: 3714–3725 (1998).

[76] Lai CK, Norddahl GL, Maetzig T, Rosten P, Lohr T, Milde LS, Von Krosigk N, Docking TR, Heuser M, Karsan A: Meis2 as a critical player in MN1-induced leukemia. Bllod Cancer J.: 1-14 (2017).

[77] Lam R, Soloveychik M, Battaile KP, Romanov V, Lam K, Beletskaya I, Gordon E, Pai EF, Chirgadze NY: Crystal structure of the homeobox domain of human

homeobox protein Meis2; PDBe ID 3k2a; www.rcsb.org (26.06.2018)

[78] Lamarche Nathalie, Tapon Nicolas, Stowers Lisa, Burbelo Peter D., Aspenström Pontus, Bridges Tina, Chant John, Hall Alan: Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65(PAK) and the JNK/SAPK MAP kinase cascade. Cell: 519–529 (1996).

[79] Lamm SH, Walters AS, Wilson R, Byrd DM, Grunwald H: Consistencies and inconsistencies underlying the quantitative assessment of leukemia risk from benzene exposure. Environ. Health Perspect.: 289–297 (1989).

[80] Lasa A, Carnicer MJ, Aventín A, Estivill C, Brunet S, Sierra J, Nomdedéu JF: MEIS 1 expression is downregulated through promoter hypermethylation in AML1-ETO acute myeloid leukemias. Leukemia: 1231–1237 (2004).

[81] Laurent E, Talpaz M, Kantarjian H: The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis. Cancer Res.: 2343–2355 (2001).

[82] Lewis EB: A gene complex controlling segmentation in Drosophila. Nature: 565–570 (1978).

[83] Liberzon E, Avigad S, Stark B, Zilberstein J, Freedman L, Gorfine M, Gavriel H, Cohen IJ, Goshen Y, Yaniv I, Zaizov R: Germ-line ATM gene alterations are associated with susceptibility to sporadic T-cell acute lymphoblastic leukemia in children. Genes Chrom Cancer: 161–166 (2004).

[84] Lim IK, Lee MS, Ryu MS, Park TJ, Fujiki H, Eguchi H, Paik WK: Induction of growth inhibition of 293 cells by downregulation of the cyclin E and cyclin- dependent kinase 4 proteins due to overexpression of TIS21. Mol. Carcinog.: 25–35 (1998).

[85] Longobardi E, Penkov D, Mateos D, De Florian G, Torres M, Blasi Francesco: Biochemistry of the tale transcription factors PREP, MEIS, and PBX in vertebrates. Dev. Dyn.: 59–75 (2014).

[86] Louw JJ, Corveleyn A, Jia Y, Hens G, Gewillig M, Devriendt K: MEIS2 involvement in cardiac development, cleft palate, and intellectual disability. Am. J. Med. Genet. A: 1142–1146 (2015).

[87] Ma Y, Dobbins SE, Sherborne AL, Chubb D, Galbiati M, Cazzaniga G, Micalizzi C, Tearle R, Lloyd AL, Hain R, Greaves M, Houlston RS: Developmental timing of mutations revealed by whole-genome sequencing of twins with acute lymphoblastic leukemia. Proc. Natl. Acad. Sci. U. S. A.: 7429– 7433 (2013).

[88] Mackay DJG., Hall A: Rho GTPases. J. Biol. Chem.: 20685–20688 (1998).

[89] Magli MC, Largman C, Lawrence HJ: Effects of HOX homeobox genes in

blood cell differentiation. J. Cell. Physiol.: 168–177 (1997).

[90] Mamo A, Krosl J, Kroon E, Bijl J, Thompson A, Mayotte N, Girard S, Bisaillon R, Beslu N, Featherstone M, Sauvageau G: Molecular dissection of Meis1 reveals 2 domains required for leukemia induction and a key role for Hoxa gene activation. Blood: 622–629 (2006).

[91] Mann RS, Lelli KM, Joshi R: Chapter 3 Hox Specificity. Unique Roles for Cofactors and Collaborators. Curr. Top. Dev. Biol.: 63–101 (2009).

[92] Mao B, Zhang Z, Wang G: BTG2: A rising star of tumor suppressors. Int. J. Oncol.: 459–464 (2015).

[93] Marchetti L, Comelli L, Innocenzo BD, Puzzi L, Luin S, Arosio D, Calvello M, Mendoza-Maldonado R, Peverali F, Trovato F, Riva S, Biamonti G, Abdurashidova G, Beltram F, Falaschi A: Homeotic proteins participate in the function of human-DNA replication origins. Nucleic Acids Res.: 8105–8119 (2010).

[94] Martin M.: Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal: 10-12 (2011).

[95] Mcclelland M, Zhao L, Carskadon S, Arenberg D: Expression of CD74, the Receptor for Macrophage Migration Inhibitory Factor in Non-Small Cell Lung Cancer. Am. J. Pathol.: 638–646 (2009).

[96] McNeal AS, Liu K, Nakhate V, Natale CA, Duperret EK, Capell BC, Dentchev T, Berger SL, Herlyn M, Seykora JT, Ridky TW: CDKN2B loss promotes progression from benign melanocytic nevus to melanoma. Cancer Discov.: 1072–1085 (2015).

[97] Mezei G, Sudan M, Izraeli S, Kheifets L: Epidemiology of childhood leukemia in the presence and absence of Down syndrome. Cancer Epidemiol.: 479– 489 (2014).

[98] Milech N, Gottardo NiG, Ford J, D’Souza D, Greene WK, Kees UR, Watt PM: MEIS proteins as partners of the TLX1/HOX11 oncoprotein. Leuk. Res.: 358– 363 (2010).

[99] Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B, Eisenhaure TM, Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA, Stockwell BR, Hacohen N, Hahn WC, Lander ES, Sabatini DM, Root DE: A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen. Cell: 1283–1298 (2006).

[100] Montagnoli A, Guardavaccaro D, Starace G, Tirone F: Overexpression of the nerve growth factor-inducible PC3 immediate early gene is associated with

growth inhibition. Cell Growth Differ.: 1327–1336 (1996).

[101] Moskow JJ, Bullrich F, Huebner K, Daar IO, Buchberg AM: Meis1, a PBX1- related homeobox gene involved in myeloid leukemia in BXH-2 mice. Mol. Cell. Biol.. 5434–5443 (1995).

[102] Mukherjee K, Bürglin TR: Comprehensive analysis of animal TALE homeobox genes: New conserved motifs and cases of accelerated evolution. J. Mol. Evol.: 137–153 (2007).

[103] Mullighan CG: The molecular genetic makeup of acute lymphoblastic leukemia. Hematology Am. Soc. Hematol. Educ. Program: 389–396 (2012).

[104] Olson MF, Ashworth A, Hall A: An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1. Science: 1270–1272 (1995).

[105] Orlovsky K, Kalinkovich A, Rozovskaia T, Shezen E, Itkin T, Alder H, Ozer HG, Carramusa L, Avigdor A, Volinia S, Buchberg A, Mazo A, Kollet O, Largman C, Croce CM, Nakamura T, Lapidot T, Canaani E: Down-regulation of homeobox genes MEIS1 and HOXA in MLL-rearranged acute leukemia impairs engraftment and reduces proliferation. Proc. Natl. Acad. Sci. U. S. A.: 7956–7961 (2011).

[106] Orsi L, Rudant J, Ajrouche R, Leverger G, Baruchel A, Nelken B, Pasquet M, Michel G, Bertrand Y, Ducassou S, Gandemer V, Lutz P, Saumet L, Moreau P, Hemon D, Clavel J: Parental smoking, maternal alcohol, coffee and tea consumption during pregnancy, and childhood acute leukemia: the ESTELLE study. CCC: 1003-1017 (2015).

[107] Owens BM, Hawley GH: HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis. Stem Cells: 364–379 (2002).

[108] Panzer-Grümayer ER, Schneider M, Panzer S, Fasching K, Gadner H: Rapid molecular response during early induction chemotherapy predicts a good outcome in childhood acute lymphoblastic leukemia. Blood: 790–794 (2000).

[109] Passeri D, Marcucci A, Rizzo G, Billi M, Panigada M, Leonardi L, Tirone F, Grignani F: Btg2 enhances retinoic acid-induced differentiation by modulating histone H4 methylation and acetylation. Mol. Cell. Biol.: 5023–5032 (2006).

[110] Paulin R, Grigg GW, Davey MW, Piper AA: Urea improves efficiency of bisulphite-mediated sequencing of 5’-methylcytosine in genomic DNA. Nucleic Acids Res.: 5009–5010 (1998).

[111] Pillay LM, Forrester A Michael, Erickson T, Berman JN, Waskiewicz AJ: The Hox cofactors Meis1 and Pbx act upstream of gata1 to regulate primitive

hematopoiesis. Dev. Biol.: 306–317 (2010).

[112] Pineault N, Helgason CD, Lawrence HJ, Humphries RK.: Differential expression of Hox, Meis1, and Pbx1 genes in primitive cells throughout murine hematopoietic ontogeny. Exp. Hematol.: 49–57 (2002).

[113] Pineault N, Buske C, Feuring-Buske M, Abramovich C, Rosten P, Hogge DE, Aplan PD, Humphries RK: Induction of acute myeloid leukemia in mice by the human leukemia-specic fusion gene NUP98-HOXD13 in concert with Meis1. Blood: 4529–4538 (2003).

[114] Piper DE, Batchelor AH, Chang CP, Cleary ML, Wolberger C: Structure of a HoxB1-Pbx1 heterodimer bound to DNA: role of the hexapeptide and a fourth homeodomain helix in complex formation. Cell: 587–597 (1999).

[115] Piperno G, LeDizet M, Chang XJ: Microtubulues Containing Acetylated alpha- Tubulin in Mammalian Cells in Culture. J Cell Biol: 289–302 (1987).

[116] Pommier Y, Pourquier P: Mechanism of action of eukaryotic DNA topoisomerase I and drugs targeted to the enzyme. Biochim Biophys Acta: 83–105 (1998).

[117] Pui CH: Acute lymphoblastic leukemia, Chapter 93 (1409-1430) in Kaushansky K, Lichtman MA, Beutler E, Williams Hematology, 8th Edition, McGraw-Hill Education/Medical (2010).

[118] Pui CH, Dodge RK, Bowman P, Ochs J, Dahl GV, Abromowitch M, Look AT, Kalwinsky D, Mirro J, Murphy SB: Serum Lactate Dehydrogenase Level Has Prognostic Value in Childhood Acute Lymphoblastic Leukemia. Blood: 778– 782 (1985).

[119] Pui CH, Evans W: A 50-Year Journey to Cure Childhood Acute Lymphoblastic Leukemia. Semin Oncol: 185–196 (2013).

[120] Pui CH, Evans WE: Treatment of acute lymphoblastic leukemia. N. Engl. J. Med.: 166–178 (2006).

[121] Pui CH, Mullighan CG, Evans WE, Relling MV: Pediatric acute lymphoblastic leukemia: where are we going and how do we get there? Blood: 1165–1174 (2012).

[122] Pui CH, Relling MV, Downing JR: Acute lymphoblastic leukemia. N. Engl. J. Med.: 1535–1548 (2004).

[123] Pui CH, Sandlund JT, Pei D, Campana D, Rivera GK, Ribeiro RC, Rubnitz JE, Razzouk BI, Howard SC, Hudson MM, Cheng C, Kun LE, Raimondi SC, Behm FG, Downing JR, Relling MV, Evans WE: Improved Outcome for Children with Acute Lymphoblastic Leukemia: Results of Total Therapy Study XIIIB at St

Jude Children’ s Research Hospital. Blood: 2690–2696 (2004).

[124] Pui CH, Leslie L Robison A Thomas Look: Acute lymphoblastic leukaemia. Lancet: 1030–1043 (2008).

[125] Qiu RG, Chen J, Kirn D, McCormick F, Symons M: An essential role for Rac in Ras transformation. Nature: 457–459 (1995).

[126] R Development Core Team: R: A language and environment for statistical computing, Vienna, Austria (2014), http://www.R-project.org/.

[127] Redaelli A, Laskin BL, Stephens JM, Botteman MF, Pashos CL: A systematic literature review of the clinical and epidemiological burden of acute lymphoblastic leukaemia (ALL). Eur. J. Cancer Care (Engl).: 53–62 (2005).

[128] Ren R: Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia. Nat. Rev. Cancer: 172–183 (2005).

[129] Rezsohazy R, Saurin AJ, Maurel-Zaffran C, Graba Y: Cellular and molecular insights into Hox protein action. Development: 1212–1227 (2015).

[130] Rosales-Aviña JA, Torres-Flores J, Aguilar-Lemarroy A, Gurrola-Díaz C, Hernández-Flores G, Ortiz-Lazareno PC, Lerma-Díaz JM, de Celis R, González-Ramella Ó, Barrera-Chaires E, Bravo-Cuellar A, Jave-Suárez LF: MEIS1, PREP1, and PBX4 Are Differentially Expressed in Acute Lymphoblastic Leukemia: Association of MEIS1 Expression with Higher Proliferation and Chemotherapy Resistance. J. Exp. Clin. Cancer Res.: 1-12 (2011).

[131] Rouault JP, Falette N, Guéhenneux F, Guillot C: Identification of BTG2, an antiproliferative p53-dependent component of the DNA damage cellular response pathway. Nat Genet.: 482–486 (1996).

[132] Rozovskaia T, Feinstein E, Mor O, Foa R, Blechman J, Nakamura T, Croce C M, Cimino G, Canaani E: Upregulation of Meis1 and HoxA9 in acute lymphocytic leukemias with the t(4:11) abnormality. Oncogene: 874–878 (2001).

[133] Rubin E, Wu X, Zhu T, Cheung JCY, Chen H, Lorincz A, Pandita RK, Sharma GG, Ha HC, Gasson J, Hanakahi LA, Pandita TK, Sukumar S: A Role for the HOXB7 Homeodomain Protein in DNA Repair. Cancer Res. 1527–1536 (2007).

[134] Shankar DB, Cheng JC, Kinjo K, Sandoval S, Sakamoto KM, Shankar DB: The role of CREB as a proto-oncogene in hematopoiesis. Cancer Cell: 351– 362 (2005).

[135] Shanmugam K, Green NC, Rambaldi I, Saragovi HU, Featherstone MS: PBX

and MEIS as non-DNA-binding partners in trimeric complexes with HOX proteins. Mol. Cell. Biol.: 7577–7588 (1999).

[136] Shen WF, Montgomery JC, Rozenfeld S, Moskow JJ, Lawrence HJ, Buchberg AM, Largman C: AbdB-like Hox proteins stabilize DNA binding by the Meis1 homeodomain proteins. Mol. Cell. Biol.: 6448–6458 (1997).

[137] Shen WF, Rozenfeld S, Kwong A, Köm ves LG, Lawrence HJ, Largman C: HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells. Mol. Cell. Biol.: 3051–3061 (1999).

[138] Sigma Aldrich, St. Louis, MO, USA: https://www.sigmaaldrich.com/life- science/functional-genomics-and-rnai/shrna/library-information/vector- map.html#References (09.02.2018)

[139] Silverman LB, Gelber RD, Dalton VK, Asselin BL, Barr RD, Clavell LA, Hurwitz CA, Moghrabi A, Samson Y, Schorin MA, Arkin S, Declerck L, Cohen HJ, Sallan SE: Improved outcome for children with acute lymphoblastic leukemia : results of Dana-Farber Consortium Protocol 91-01. Blood: 1211–1218 (2001).

[140] Singal R, Gordon DG: DNA Methylation. Blood: 4059–4070 (1999).

[141] Siu YT, Jin DY: CREB - a real culprit in oncogenesis. FEBS J.: 3224–3232 (2007).

[142] Starlets D, Gore Y, Binsky I, Haran M, Harpaz N, Shvidel L, Becker-Herman S, Berrebi A, Shachar I: Cell-surface CD74 initiates a signaling cascade leading to cell proliferation and survival. Blood: 4807–4816 (2006).

[143] Steelman S, Moskow JJ, Muzynski K, North C, Druck T, Montgomery JC, Huebner K, Daar IO, Buchberg AM: Identification of a conserved family of Meis1-related homeobox genes. Genome Res.: 142–156 (1997).

[144] Stein R, Qu Z, Cardillo TM, Chen S, Rosario A, Horak ID, Hansen HJ, Goldenberg DM: Antiproliferative activity of a humanized anti-CD74 monoclonal antibody , hLL1 , on B-cell malignancies. Blood: 3705–3711 (2004).

[145] Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS, Sabatini DM, Chen ISY, Hahn WC, Sharp PA, Weinberg RA, Novina CD: Lentivirus- delivered stable gene silencing by RNAi in primary cells Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA: 493–501 (2003).

[146] Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J: WHO Classiﬁcation of Tumours of Haematopoietic and Lymphoid Tissues (Revised 4th Edition), IARC: Lyon, France: IARC. Chapter 12, Precursor

lymphoid neoplasms: 199-213 (2017).

[147] Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK: Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol. Cell. Biol.: 495–505 (1997).

[148] Thorsteinsdottir U, Mamo A, Kroon E, Jerome L, Bijl J, Lawrence HJ, Humphries K, Sauvageau G: Overexpression of the myeloid leukemia – associated Hoxa9 gene in bone marrow cells induces stem cell expansion. Blood: 121–129 (2002).

[149] Tirone Felice: The gene PC3TIS21/BTG2, prototype member of the PC3/BTG/TOB family: Regulator in control of cell growth, differentiation, and DNA repair? J. Cell. Physiol.: 155–165 (2001).

[150] Topisirovic I, Kentsis A, Perez JM, Guzman ML, Jordan CT, Borden KLB: Eukaryotic Translation Initiation Factor 4E Activity Is Modulated by HOXA9 at Multiple Levels. Mol Cell Biol.: 1100–1112 (2005).

[151] Touzeau C, Moreau P, Dumontet C: Monoclonal antibody therapy in multiple myeloma. Leukemia: 1039–1047 (2017).

[152] Trapnell C, Pachter L, Salzberg SL: TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics: 1105–1111 (2009).

[153] Troeger A, Williams DA.: Hematopoietic-specific Rho GTPases Rac2 and RhoH and human blood disorders. Exp. Cell Res.: 2375–2383 (2013).

[154] Vanderlaan M, Thomas CB: Characterization of monoclonal antibodies to bromodeoxyuridine. Cytometry: 501–505 (1985).

[155] Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, Harris NL, Le Beau MM, Hellström-Lindberg E, Tefferi A, Bloomfield CD: The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: Rationale and important changes. Blood: 937–951 (2009).

[[156] Vegi NM, Klappacher J, Oswald F Mulaw MA, Mandoli A, Thiel VN, Bamezai S, Feder K, Martens JHA., Rawat VPS, Mandal T, Quintanilla-Martinez L, Spiekermann K, Hiddemann W, Döhner K, Döhner H, Stunnenberg HG, Feuring-Buske Mi, Buske C: MEIS2 Is an Oncogenic Partner in AML1-ETO- Positive AML. Cell Rep.: 498-507 (2016).

[157] Wakeford R, Little MP, Kendall GM: Risk of childhood leukemia after low-level exposure to ionizing radiation. Expert Rev Hematol.: 251–254 (2010).

[158] Wang GG, Pasillas MP, Kamps MP: Meis1 programs transcription of FLT3

and cancer stem cell character, using a mechanism that requires interaction with Pbx and a novel function of the Meis1 C-terminus. Blood: 254–264 (2005).

[159] Warner JK, Wang JCY, Hope KJ, Jin L, Dick JE: Concepts of human leukemic development. Oncogene: 7164–7177 (2004).

[160] Wei S, Hao C, Li X, Zhao H, Chen J, Zhou Q: Effects of BTG2 on proliferation inhibition and anti-invasion in human lung cancer cells. Tumor Biol.: 1223– 1230 (2012).

[161] Welsh JB, Zarrinkar PP, Sapinoso LM, Kern SG, Behling CA, Monk BJ, Lockhart DJ, Burger RA, Hampton GM: Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer. Proc. Natl. Acad. Sci. U. S. A.: 1176–1181 (2001).

[162] Weng AP, Ferrando AA, Lee W, Morris JP, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC: Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science: 269–271 (2004).

[163] White PC, Shore AM, Clement M, Mclaren J, Soeiro I, Lam E, Brennan P: Regulation of cyclin D2 and the cyclin D2 promoter by protein kinase A and CREB in lymphocytes. Oncogene: 2170–2180 (2006).

[164] Wong P, Iwasaki M, Somervaille TCP, So Chai WE, Cleary ML.: Meis1 is an essential and rate-limiting regulator of MLL leukemia stem cell potential. Genes Dev.: 2762–2774 (2007).

[165] Yang Y, Hwang CK, D’Souza UM, Lee SH, Junn E, Mouradian MM: Three- amino acid extension loop homeodomain proteins Meis2 and TGIF differentially regulate transcription. J. Biol. Chem. : 20734–20741 (2000).

[166] Zha Y, Xia Y, Ding J, Choi JH, Yang L, Dong Z, Yan C, Huang S, Ding HF: MEIS2 is essential for neuroblastoma cell survival and proliferation by transcriptional control of M-phase progression. Cell Death Dis.: 1-10 (2014).

[167] Zhang L, Huang H, Wu K, Wang M, Wu B: Impact of BTG2 expression on proliferation and invasion of gastric cancer cells in vitro. Mol. Biol. Rep.: 2579– 2586 (2010).

[168] Zhang X, Friedman A, Heaney S, Purcell P, Maas RL.: Meis homeoproteins directly regulate Pax6 during vertebrate lens morphogenesis. Genes Dev.: 2097–2107 (2002).

[169] Zhang X, Rowan S, Yue Y, Heaney S, Pan Y, Brendolan A, Selleri L, Maas RL.: Pax6 is regulated by Meis and Pbx homeoproteins during pancreatic

development. Dev. Biol.: 748–757 (2006).

[170] Zilberman Daniel: The human promoter methylome. Nat. Genet.: 442–443 (2007).

[171] Zuckerman T, Rowe JM: Pathogenesis and prognostication in acute lymphoblastic leukemia. F1000Prime Rep.: 1-5 (2014).

Acknowledgements

First of all, I would like to thank Prof. Buske for the opportunity to perform my thesis at the Institute for Experimental Cancer Research and the International Graduate School of Molecular Medicine Ulm as well as the “Deutsche Forschungsgemeinschaft” (DFG) for the financial support in the context of the “Excellence Initiative”.

Further, I would like to express my gratitude to Josef Klappacher for his help during my very first steps in the laboratory and of course Naidu Vegi for his ideas, advice and the constant support.

A special “thank you” goes to my parents for the opportunity and the freedom to achieve my goals as well as their unconditional love and support. Спасибо!

Curriculum Vitae Ekaterina Panina Personal Details Place/Date of birth Astrachan (Russia) 20.03.1989

Professional Training Since 08/2015 Residency in the Department of Hematology, Oncology, Palliative Care, Rheumatology and Infectious Diseases, Internal Medicine III, University Hospital of Ulm (Professor Dr. med. Hartmut Döhner)

Academic Education 09/2008-05/2015 University of Ulm, Medical School

Higher Education 09/2001-07/2008 General Qualification for University Entrance (Abitur) Kepler-Gymnasium Freudenstadt 02/2001-07/2001 Realschule Dornstetten 09/2000-02/2001 Hauptschule Dornstetten 09/1996-02/2000 Gymnasium Nr. 4, Astrachan (Russia)

Dissertation 08/2011 bis 08/2018 Dissertation „Characterization and Investigation of the Homeobox Gene MEIS2 in Acute Lymphoblastic Leukemia“ im Institut für Experimentelle Forschung in Ulm (Professor Dr. med. Christian Buske)

Grants/Awards 08/2011 bis 05/2012 Grant from the German Research Foundation (Deutsche Forschungsgemeinschaft - DFG) in the context of the „Excellence Initiative“ and participance in the “Promotionsprogramm Experimentelle Medizin“ of the International Graduate School of Molecular Medicine Ulm 12/2018 Abstract Achievement Award of the American Society of Hematology (ASH)

Additional Skills Languages German - fluent, Russian - fluent, English - fluent, French – business fluent

Memberships: Since 2018 European Hematology Association (EHA)

Publications: 2019: Contribution - Conferences: Ekaterina Panina, Stegelmann Frank, Heike L. Pahl, Steffen Koschmieder, Martin Bommer, Phillippe Schafhausen, Uwe Platzbecker, Martin Griesshammer, Tim H. Brümmendorf, Hartmut Döhner, Lars Bullinger, Konstanze Döhner. Genomic Landscape and Molecular Risk in Patients with DIPPS Low- and Intermediate-1- Risk Primary Myelofibrosis: A Study of the German Study Group for Myeloprliferative Neoplasms (GSG-MPN), Abstract EHA Annual Conference 2019; Amsterdam, Netherlands. Nikolaus Jahn*, Ekaterina Panina*, Lars Bullinger, Anna Dolnik, Julia Herzig, Tamara J. Blätte, Axel Benner, Agnes Gambietz, Julia Krzykalla, Insa Gathmann, Richard A. Larson, Francesco Lo-Coco, Sergio Amadori, Thomas W. Prior, Joseph M. Brandwein, Frederick R. Appelbaum, Bruno C. Medeiros, Martin S. Tallman, Eva Tiecke, Celine Pallaud, Gerhard Ehninger, Michael Heuser, Arnold Ganser, Richard M. Stone, Christian Thiede, Hartmut Döhner, Clara D. Bloomfield*, and Konstanze Döhner*, Genetic Landscape of FLT3-mutated Acute Myeloid Leukemia (AML) Patients Treated within the RATIFY Trial: CALGB 10603 (ALLIANCE), Abstract EHA Annual Conference 2019; Amsterdam, Netherlands. *Equal contribution Konstanze Döhner, Christian Thiede, Nikolaus Jahn, Ekaterina Panina, Agnes Gambietz, Thomas W Prior, Guido Marcucci, Dan Jones, Jürgen Krauter, Michael Heuser, Francesco Lo Coco, Tiziana Ottone, Josep Nomdedeu, Sumithra J Mandrekar, Lucas Huebner, Kristine Laumann, Susan M. Geyer, Rebecca B. Klisovic, Andrew Wei, Jorge Sierra, Miguel A. Sanz, Joseph M. Brandwein, T. M. M de Witte, Joop H. Jansen, Dietger Niederwieser, Frederick R. Appelbaum, Bruno C Medeiros, Martin S. Tallman, Richard F. Schlenk, Arnold Ganser, Hubert Serve, Gerhard Ehninger, Sergio Amadori, Insa Gathmann, Axel Benner, Celine Pallaud, Richard A. Larson, Richard M. Stone, Hartmut Döhner and Clara D. Bloomfield. Prognostic and predictive impact of NPM1/FLT3-ITD genotypes as defined by 2017 European LeukemiaNet (ELN) risk categorization from randomized patients with acute myeloid leukemia (AML) treated within the International RATIFY Study (ALLIANCE 10603), Abstract EHA Annual Conference 2019; Amsterdam, Netherlands.

2018: Contribution - Conferences: Ekaterina Panina, Frank G. Rücker, Lars Bullinger, Anna Dolnik, Julia Herzig, Verena I. Gaidzik, Peter Paschka, Veronica Teleanu, Nikolaus Jahn, Laura K. Schmalbrock, Daniela Weber, Lena Kubanek, Tamara J. Blätte, Jörg Westermann, Thomas Kindler, Michael Lübbert, Helmut R. Salih, Felicitas Thol, Michael Heuser, Arnold Ganser, Hartmut Döhner, and Konstanze Döhner. Assessment of the Genomic Landscape of Intermediate Risk Acute Myeloid Leukemia as Defined by

2010 ELN Risk Classification. Abstract, ASH Annual Meeting 2018; San Diego, USA. Nikolaus Jahn*, Ekaterina Panina*, Lars Bullinger, Anna Dolnik, Julia Herzig, Tamara J. Blätte, Axel Benner, Julia Krzykalla, Insa Gathmann, Richard A. Larson, Francesco Lo-Coco, Sergio Amadori, Thomas W Prior, Joseph M. Brandwein, Frederick R. Appelbaum, Bruno C. Medeiros, Martin S. Tallman, Eva Tiecke, Celine Pallaud, Gerhard Ehninger, Michael Heuser, Arnold Ganser, Richard M. Stone, Christian Thiede, Hartmut Döhner, Clara D. Bloomfield, Konstanze Döhner. Comprehensive Molecular Profiling of FLT3-Mutated Acute Myeloid Leukemia (AML) Patients Treated within the Ratify Trial (Alliance C10603). Abstract, ASH Annual Meeting 2018; San Diego, USA. *Equal contribution Ekaterina Panina, Frank G. Rücker, Anna Dolnik, Daniela Weber, Veronika Teleanu, Nikolaus Jahn, Laura Schmalbrock, Mridul Agrawal, Tamara J. Blätte, Peter Paschka, Verena I. Gaidzik, Julia Herzig, Michael Kühn, Jörg Westermann, Michael Lübbert, Wolff Schmiegel, Stephan Kremers, Richard Greil, Felicitas Thol, Michael Heuser, Arnold Ganser, Hartmut Döhner, Lars Bullinger*, Konstanze Döhner*. Disclosure of high-risk molecular markers in intermediate risk acute myeloid leukemia (AML). Abstract, EHA Annual Conference 2018; Stockholm, Sweden.

2017 Contribution - Conferences: Mridul Agrawal, Nikolaus Jahn, Anna Dolnik, Sibylle Cocciardi, Laura Schmalbrock, Tamara J. Blätte, Verena I. Gaidzik, Ekaterina Panina, Michael Lübbert, Walter Fiedler, Thomas Fischer, Peter Brossart, Mohammed Wattad, Richard F. Schlenk, Felicitas Thol, Michael Heuser, Arnold Ganser, Peter Paschka, Hartmut Döhner, Lars Bullinger and Konstanze Döhner.Clonal Dynamics of Signaling Gene Mutations in Core-Binding Factor Acute Myeloid Leukemia (CBF-AML) - Impact of Dasatinib Treatment. Abstract, ASH Annual Meeting 2017; Atlanta, USA. Laura K. Schmalbrock , Sibylle Cocciardi, Anna Dolnik, Mridul Agrawal, Frauke Theis, Nikolaus Jahn, Tamara J. Blaette, Verena I. Gaidzik, Peter Paschka, Ekaterina Panina, Walter Fiedler, Helmut Salih, Gerald Wulf, Ulrich Germing, Michael Lübbert, Felicitas Thol, Michael Heuser, Richard A. Larson, Arnold Ganser, Richard F Schlenk, Richard M. Stone, Hartmut Döhner, Konstanze Döhner, Lars Bullinger. Clonal Evolution of FLT3-ITD positive AML in Patients Treated with Midostaurin in Combination with Chemotherapy within the CALGB 10603 (RATIFY) and AMLSG 16-10 Trials. Abstract, ASH Annual Meeting 2017; Atlanta, USA. Nikolaus Jahn, Mridul Agrawal, Anna Dolnik, Sibylle Cocciardi, Laura Schmalbrock, Tamara J. Blätte, Verena I. Gaidzik, Peter Paschka, Daniela Weber, Ekaterina Panina, Andrea Kündgen, Mohammed Wattad, Gerhard Held, Heinz A. Horst, Felicitas Thol, Michael Heuser, Arnold Ganser, Richard F. Schlenk, Hartmut Döhner, Lars Bullinger and Konstanze Döhner. The Genetic Heterogeneity of t(8;21)(q22;q22.1) Acute Myeloid Leukemia revealed by High-Throughput Targeted Sequencing. Abstract, ASH Annual Meeting 2017; Atlanta, USA.