DOCSLIB.ORG

Identification of the IRXB Gene Cluster As Candidate Genes in Severe

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of the IRXB Gene Cluster As Candidate Genes in Severe Biochemistry and Molecular Biology Identification of the IRXB Gene Cluster as Candidate Genes in Severe Dysgenesis of the Ocular Anterior Segment Myriam Chaabouni,*,1,2 Heather Etchevers,3,4 Marie Christine De Blois,1 Patrick Calvas,3 Marie Christine Waill-Perrier,1 Michel Vekemans,1 and Serge Pierrick Romana*,1 PURPOSE. Anterior segment ocular dysgenesis (ASOD) is a broad road genetic variability underlies disorders of the anterior heterogeneous group of diseases detectable at the clinical and Bsegment of the eye, collectively termed anterior segment molecular level. In a patient with bilateral congenital ASOD ocular dysgenesis (ASOD). PAX6, a major gene for all stages of including aniridia and aphakia, a complex chromosomal rear- eye development, has been found to be mutated in phenotyp- rangement, inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2), was char- ically variable cases of ASOD.1–5 In addition, other transcrip- acterized at the molecular level, to identify candidate genes tion factors are crucial for the coordinated development of the implicated in ASOD. cornea, iris, lens, and ciliary bodies, including members of the forkhead (FOX), PITX, and MAF families. METHODS. After negative sequencing of the PAX6, FOXC1, and Several studies have shown that patients with Rieger anomaly, PITX2 genes, we used fluorescence in situ hybridization (FISH) Peters’ anomaly or iris hypoplasia, which are dominant disorders, and Southern blot analysis to characterize the chromosomal have mutations in FOXC1 and PITX2,6–10 whereas mutations in breakpoints. Candidate genes were selected, and in situ tissue PITX3 can cause anterior segment mesenchymal dysgenesis.11–13 expression analysis was performed on human fetuses and em- FOXE3, with an evolutionarily conserved role in induction of the bryos. lens placode, is mutated in patients with aphakia and in patients RESULTS. Molecular analyses showed that the 16q12.2 break- presenting with ASOD clinical features.14–17 MAF has been impli- point in this rearrangement occurs in a 625-bp region centro- cated in congenital cataract.18–20 The number of identified genes meric to the IRX3 gene, which belongs to the IRXB cluster. In implicated in anterior segment development is increasing, reflect- situ hybridization expression studies showed that during early ing wide phenotypic as well as genetic heterogeneity. It is likely human embryonic development, the IRX3 gene is expressed in that these transcription factors regulate each other’s bioavailabil- the anterior segment of the eye. Of interest, it has been shown ity in both space and time. previously that a highly conserved noncoding region (HCNCR) The Iroquois family genes (IRX) encode homeoproteins, con- is located 300 kb centromeric to the IRX3 gene and induces, in served throughout the animal kingdom, that are involved in tissue a murine transgenic assay, an expression pattern fitting that of patterning and regional differentiation. Various knockdown ex- the IRX3 gene. periments and the endogenous expression patterns in vertebrate embryo models have demonstrated the implication, particularly CONCLUSIONS. The authors propose that the 16q12.2 break- of IRX3 and IRX5, in ocular morphogenesis.21–23 The six mam- point of this complex translocation is causally related to the malian IRX genes are organized in two clusters (IRXA and IRXB) ocular anterior segment dysgenesis observed in this patient. located on different chromosomes. IRXA and IRXB undoubtedly This translocation is assumed to separate the HCNCR from underwent duplication over the course of evolution.21,24–27 In the IRXB cluster genes, thus deregulating the IRXB cluster humans, IRX1, IRX2, and IRX4 of the IRXA complex are located and leading to the ASOD observed by a positional effect. on 5p15.3, whereas IRX3, IRX5, and IRX6 of the IRXB cluster are (Invest Ophthalmol Vis Sci. 2010;51:4380–4386) DOI: localized on 16q12.2. Thus far and despite their involvement in 10.1167/iovs.09-4111 the development of several organ systems,21,28–39 none of these IRX genes has been implicated in human disease. We describe herein a child with bilateral congenital dysgen- From the 1Service de Cytoge´ne´tique and 4INSERM U781, Hoˆpital esis of the anterior segment of the eye, including aphakia and Necker Enfants Malades, Paris, France; 2Service des Maladies He´re´di- aniridia, associated with a complex chromosomal abnormality: taires et Conge´nitales, Hoˆpital Charles Nicolle, Tunis, Tunisia; and inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2). The translocation 3INSERM (Institut National de le Sante´ et de la Recherche Me´dicale) breakpoint lies near the IRX3 gene. Moreover, we show that U563, CPTP (Centre de Physiopathologie de Toulouse Purpan), Hoˆpital IRX3 is expressed in the eye anterior segment during early Purpan, Toulouse, France. human embryonic development. We propose that this translo- Submitted for publication June 8, 2009; revised November 6, cation deregulates by a positional effect the expression of an 2009; accepted December 10, 2009. IRXB cluster gene(s), leading to the anterior segment dysgen- Disclosure: M. Chaabouni, None; H. Etchevers, None; M.C. De esis observed in this patient. Blois, None; P. Calvas, None; M.C. Waill-Perrier, None; M. Veke- mans, None; S.P. Romana, None *Each of the following is a corresponding author: Myriam MATERIAL AND METHODS Chaabouni, Service des Maladies He´re´ditaires et Conge´nitales, Hoˆpital Charles Nicolle, Boulevard du 9 Avril, 1006 Tunis, Tunisia; Case Report [email protected]. Serge Pierrick Romana, Service de Cytoge´ne´tique, Hoˆpital Necker The propositus was born of nonconsanguineous parents after a normal Enfants Malades, 149 rue de Se`vres 75015 Paris, France; pregnancy with no history of intrauterine infection or exposure to [email protected]. teratogenic agents, and delivery at term was uncomplicated. At birth, Investigative Ophthalmology & Visual Science, September 2010, Vol. 51, No. 9 4380 Copyright © Association for Research in Vision and Ophthalmology Downloaded from iovs.arvojournals.org on 09/28/2021 IOVS, September 2010, Vol. 51, No. 9 IRXB Genes and Anterior Segment Dysgenesis 4381 bilateral megalocornea, photophobia, and tearing were noticed. A Sequencing detailed ophthalmic examination performed with the subject under Direct sequencing of the coding regions of genes PITX2a, PITX2b, anesthesia at the age of 3 months showed bilateral corneal opacifica- PAX6, and FOXC1 in both forward and reverse directions was per- tion with epithelial edema, corneal central thinning, retrodescemetic formed. pigmentation, aniridia, secondary glaucoma, and vascularization of the cornea. IOP was 18 mm Hg in the right eye and 10 mm Hg in the left In Situ Tissue Expression Pattern one. No lens was found. The posterior segment of the eyes were normal. On ultrasound examination (20 MHz), neither the lenses nor IRX3 expression was examined in situ in human embryos and fetuses the irises were observable. No other malformation was detected. The with normal karyotypes between 29 days’ and 14.5 weeks’ develop- clinical features in our patient did not seem to fit a particular category. ment, obtained from terminated pregnancies in concordance with We conclude that these anomalies are compatible with a dysgenesis of French legislation (Acts 94-654 and 08-400) and with oversight by the the anterior segment of the eye with secondary glaucoma. Only the Necker hospital ethics committee. Primers were selected for PCR proband’s mother was examined. She had normal vision and no ab- amplification of a fragment of IRX3 cDNA. A T7 promoter sequence normality was found. No ocular abnormalities of the father were extension (TAATACGACTCACTATAGGGAGA) was added to the 5Ј end reported. of each primer (forward [F]: agcgatggctggggctcactcg; reverse [R]: TG- All analyses performed in this study were made after the parents’ GCCGCGCCGTCTAAGTTCTC), and RNA was synthesized in vitro with informed consent was obtained. The protocol of the study was in F and T7R for antisense and T7F and R for sense probes, using 35S- or compliance with the guidelines in the Declaration of Helsinki. digoxigenin-labeled UTP. Tissue fixation and sectioning and in situ hybridization were performed according to standard protocols.42 Classic and Molecular Cytogenetic Techniques RESULTS Metaphase chromosome spreads of the patient and his parents were prepared from peripheral blood lymphocytes and analyzed by using Classic banding techniques of the patient’s chromosomes classic banding techniques. An EBV-transformed lymphoblast cell line showed an apparently balanced rearrangement between chro- of the patient was established for chromosome, DNA, and RNA prep- mosomes 2 and 16 (Figs. 1A, 1B). Parental karyotypes were arations. normal. Thus, the chromosomal rearrangement occurred de BAC and PAC clones were selected from the UCSC Human Genome novo. FISH experiments, with the WCP2 and WCP16 centro- Browser (http://genome.ucsc.edu/ provided in the public domain by meric probes of chromosomes 2 and 16 and the 16p/16q and UCSC Genome Bioinformatics, University of California at Santa Cruz). 2p/2q subtelomeric probes, showed two normal chromosomes They were obtained from the French national sequencing center. BAC 2 and 16 and two derivatives of chromosomes 2 and 16, DNAs were extracted by using a classic phenol-chloroform method and confirming a translocation between the long arm of chromo- labeled using standard nick translation incorporating FITC, cyanine some 16 and the long arm of chromosome 2 (Fig. 1C). How- (Cy)3.5, Cy3, biotin-16-dUTP,
Load more

Recommended publications
  • A Feed-Forward Relay Between Bicoid and Orthodenticle Regulates the Timing Of
    bioRxiv preprint doi: https://doi.org/10.1101/198036; this version posted October 3, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A feed-forward relay between Bicoid and Orthodenticle regulates the timing of embryonic patterning in Drosophila Authors: Rhea R. Datta1, Jia Ling1, Jesse Kurland2,3, Xiaotong Ren1, Zhe Xu1, Gozde Yucel1, Jackie Moore1, Leila Shokri2,3, Isabel Baker1, Timothy Bishop1, Paolo Struffi1, Rimma Levina1, Martha L. Bulyk2,3, Robert J. Johnston4, and Stephen Small1,5,6* 1. Center for Developmental Genetics, Department of Biology, New York University, 100 Washington Square East, New York, NY 10003-6688, USA. 2. Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115, USA 3. Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115, USA. 4. Department of Biology, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218-2685, USA 5. Corresponding author * Correspondence: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/198036; this version posted October 3, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract The K50 homeodomain (K50HD) protein Orthodenticle (Otd) is critical for anterior patterning and brain and eye development in most metazoans.
    [Show full text]
  • Morphogen Rules: Design Principles of Gradient-Mediated Embryo Patterning James Briscoe1,* and Stephen Small2,*
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3996-4009 doi:10.1242/dev.129452 REVIEW Morphogen rules: design principles of gradient-mediated embryo patterning James Briscoe1,* and Stephen Small2,* ABSTRACT tissue patterning is controlled by a concentration gradient of a The Drosophila blastoderm and the vertebrate neural tube are morphogen, and that cells acquire positional information by directly archetypal examples of morphogen-patterned tissues that create measuring the concentration of morphogen to which they are precise spatial patterns of different cell types. In both tissues, pattern exposed. In this view, specific threshold concentrations establish formation is dependent on molecular gradients that emanate from boundaries of target gene expression, which foreshadow boundaries opposite poles. Despite distinct evolutionary origins and differences between cells of different fates. in time scales, cell biology and molecular players, both tissues exhibit Although they have evolved over the years to accommodate striking similarities in the regulatory systems that establish gene changing facts and fashions, these ideas have had a profound expression patterns that foreshadow the arrangement of cell types. influence on generations of developmental biologists. The molecular First, signaling gradients establish initial conditions that polarize the genetics revolution of the 1980s and 1990s led to the identification of tissue, but there is no strict correspondence between specific several molecules that behave as graded patterning signals (Driever morphogen thresholds and boundary positions. Second, gradients and Nüsslein-Volhard, 1988a; Ferguson and Anderson, 1992; Green initiate transcriptional networks that integrate broadly distributed and Smith, 1990; Katz et al., 1995; Riddle et al., 1993; Tickle et al., activators and localized repressors to generate patterns of gene 1985).
    [Show full text]
  • Odd-Paired Controls Frequency Doubling in Drosophila Segmentation by Altering the Pair-Rule Gene Regulatory Network
    Odd-paired controls frequency doubling in Drosophila segmentation by altering the pair-rule gene regulatory network Erik Clark* and Michael Akam Laboratory for Development and Evolution, Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2 3EJ, United Kingdom *Correspondence to: [email protected] The authors declare that no competing interests exist. 1 ABSTRACT 2 3 The Drosophila embryo transiently exhibits a double segment periodicity, defined by the expression of seven 4 “pair-rule” genes, each in a pattern of seven stripes. At gastrulation, interactions between the pair-rule genes 5 lead to frequency doubling and the patterning of fourteen parasegment boundaries. In contrast to earlier 6 stages of Drosophila anteroposterior patterning, this transition is not well understood. By carefully analysing 7 the spatiotemporal dynamics of pair-rule gene expression, we demonstrate that frequency-doubling is 8 precipitated by multiple coordinated changes to the network of regulatory interactions between the pair-rule 9 genes. We identify the broadly expressed but temporally patterned transcription factor, Odd-paired 10 (Opa/Zic), as the cause of these changes, and show that the patterning of the even-numbered parasegment 11 boundaries relies on Opa-dependent regulatory interactions. Our findings indicate that the pair-rule gene 12 regulatory network has a temporally-modulated topology, permitting the pair-rule genes to play stage- 13 specific patterning roles. 14 15 Keywords: pair-rule genes; segmentation; Drosophila; patterning; gene regulatory network; Odd-paired; Zic 16 17 18 INTRODUCTION 19 20 Segmentation is a developmental process that subdivides an animal body axis into similar, repeating units 21 (Hannibal & Patel 2013).
    [Show full text]
  • Defects in Brain Patterning and Head Morphogenesis in the Mouse Mutant Fused Toes
    Developmental Biology 304 (2007) 208–220 www.elsevier.com/locate/ydbio Defects in brain patterning and head morphogenesis in the mouse mutant Fused toes Isabelle Anselme a,1, Christine Laclef a,1, Magali Lanaud a,1, ⁎ Ulrich Rüther b, Sylvie Schneider-Maunoury a, a Biologie du Développement, CNRS UMR7622, Université Pierre et Marie Curie, 9 Quai Saint-Bernard, 75252 Paris Cedex 05, France b Institute for Animal Developmental and Molecular Biology, University of Düsseldorf, Universitätsstr. 1, 40225 Düsseldorf, Germany Received for publication 30 May 2006; revised 17 November 2006; accepted 12 December 2006 Available online 15 December 2006 Abstract During vertebrate development, brain patterning and head morphogenesis are tightly coordinated. In this paper, we study these processes in the mouse mutant Fused toes (Ft), which presents severe head defects at midgestation. The Ft line carries a 1.6-Mb deletion on chromosome 8. This deletion eliminates six genes, three members of the Iroquois gene family, Irx3, Irx5 and Irx6, which form the IrxB cluster, and three other genes of unknown function, Fts, Ftm and Fto. We show that in Ft/Ft embryos, both anteroposterior and dorsoventral patterning of the brain are affected. As soon as the beginning of somitogenesis, the forebrain is expanded caudally and the midbrain is reduced. Within the expanded forebrain, the most dorsomedial (medial pallium) and ventral (hypothalamus) regions are severely reduced or absent. Morphogenesis of the forebrain and optic vesicles is strongly perturbed, leading to reduction of the eyes and delayed or absence of neural tube closure. Finally, facial structures are hypoplastic. Given the diversity, localisation and nature of the defects, we propose that some of them are caused by the elimination of the IrxB cluster, while others result from the loss of one or several of the Fts, Ftm and Fto genes.
    [Show full text]
  • An Early Phase of Embryonic Dlx5 Expression Defines the Rostral
    The Journal of Neuroscience, October 15, 1998, 18(20):8322–8330 An Early Phase of Embryonic Dlx5 Expression Defines the Rostral Boundary of the Neural Plate Lu Yang,1,2 Hailan Zhang,1,3 Gezhi Hu,1,3 Hongyu Wang,1,2 Cory Abate-Shen,1,3 and Michael M. Shen1,2 1Center for Advanced Biotechnology and Medicine, and Departments of 2Pediatrics and 3Neuroscience and Cell Biology, University of Medicine and Dentistry of New Jersey–Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 Relatively little is known about the molecular events that specify alon and also appears to be unique for Dlx5 among members of the rostrocaudal axis of the neural plate. Here we show that a the Dlx family. Another distinctive feature of Dlx5 expression is member of the Distal-less (Dlx) homeobox gene family, Dlx5,is the occurrence of an alternative transcript (dDlx5), which en- one of the earliest known markers for the most rostral ecto- codes a truncated protein lacking the homeodomain, and rep- derm, before the formation of an overt neural plate. During late resents a significant fraction of total Dlx5 transcripts at all gastrulation Dlx5 expression becomes localized to the anterior embryonic stages that were examined. In contrast with full- neural ridge, which defines the rostral boundary of the neural length DLX5, the dDLX5 truncated protein is deficient in DNA- plate, and also extends caudolaterally, marking the region of binding activity and does not interact with the homeoprotein the presumptive neural crest. Subsequently, Dlx5 is expressed partner MSX1. Taken together, our findings suggest that Dlx5 in tissues (olfactory epithelium, ventral cephalic epithelium) that activity may be regulated via the expression of an alternative are believed to derive from the anterior neural ridge, based on transcript and demonstrate that Dlx5 marks the anterior bound- the avian fate map.
    [Show full text]
  • Developmental Biology 7Th
    9. The genetics of axis specification in Drosophila Thanks largely to the studies by Thomas Hunt Morgan's laboratory during the first decade of the twentieth century, we know more about the genetics of Drosophila than about any other multicellular organism. The reasons for this have to do with both the flies and the people who first studied them. Drosophila is easy to breed, hardy, prolific, tolerant of diverse conditions, and the polytene chromosomes of its larvae are easy to identify (see Chapter 4). The techniques for breeding and identifying mutants are easy to learn. Moreover, the progress of Drosophila genetics was aided by the relatively free access of every scientist to the mutants and the techniques of every other researcher. Mutants were considered the property of the entire scientific community, and Morgan's laboratory established the database and exchange network whereby anyone could obtain them. Undergraduates (starting with Calvin Bridges and Alfred Sturtevant) played important roles in Drosophila research, which achieved its original popularity as a source of undergraduate research projects. As historian Robert Kohler noted (1994), "Departments of biology were cash poor but rich in one resource: cheap, eager, renewable student labor." The Drosophila genetics program was "designed by young persons to be a young person's game," and the students set the rules for Drosophila research: "No trade secrets, no monopolies, no poaching, no ambushes." But Drosophila was a difficult organism on which to study embryology. Although Jack Schultz and others attempted to relate the genetics of Drosophila to its development, the fly embryos proved too complex and too intractable to study, being neither large enough to manipulate experimentally nor transparent enough to observe.
    [Show full text]
  • Dlx Homeobox Transcriptional Regulation of Crx and Otx2 Gene Expression During Vertebrate Retinal Development
    DLX HOMEOBOX TRANSCRIPTIONAL REGULATION OF CRX AND OTX2 GENE EXPRESSION DURING VERTEBRATE RETINAL DEVELOPMENT by Vanessa Indira Pinto A Thesis submitted to the Faculty of Graduate Studies of The University of Manitoba in partial fulfilment of the degree requirements for MASTER OF SCIENCE Department of Biochemistry & Medical Genetics University of Manitoba Winnipeg Copyright © 2010 Vanessa Indira Pinto Library and Archives Bibliothèque et Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l’édition 395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre référence ISBN: 978-0-494-70190-4 Our file Notre référence ISBN: 978-0-494-70190-4tdm NOTICE: AVIS: The author has granted a non- L’auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l’Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distribute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. The author retains copyright L’auteur conserve la propriété du droit d’auteur ownership and moral rights in this et des droits moraux qui protège cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation.
    [Show full text]
  • Precise Temporal Control of the Eye Regulatory Gene Pax6 Via Enhancer-Binding Site Affinity
    Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION The affinity of a binding site provides a mechanism to Precise temporal control of the respond to different concentrations of TFs. In develop- eye regulatory gene Pax6 via ment, the ability of CRMs that contain sites of differing affinities to interpret TF gradients has been studied in enhancer-binding site affinity Drosophilia melanogaster and other organisms for spatial 1,4 1,4 1 gradients (Driever et al. 1989; Struhl et al. 1989; Jiang and Sheldon Rowan, Trevor Siggers, Salil A. Lachke, Levine 1993; Scardigli et al. 2003; Segal et al. 2008), and Yingzi Yue,1 Martha L. Bulyk,1,2,3,5 in Caenorhabditis elegans and sea urchin for temporal and Richard L. Maas1,6 gradients (Lai et al. 1988; Gaudet and Mango 2002). For example, in C. elegans, altering PHA-4 DNA-binding 1Division of Genetics, Department of Medicine, Brigham sites to higher- or lower-affinity sequences altered the and Women’s Hospital and Harvard Medical School, Boston, onset of pharyngeal gene expression, with higher-affinity Massachusetts 02115, USA; 2Department of Pathology, Brigham sites directing expression earlier in development (Gaudet and Women’s Hospital and Harvard Medical, School, Boston, and Mango 2002). The ability to tune the timing of ex- Massachusetts 02115, USA; 3Harvard-Massachusetts Institute pression by modulating the affinity of the DNA-binding of Technology Division of Health Sciences and Technology site(s) for just one TF is conceptually appealing. However, (HST), Harvard Medical, School, Boston, Massachusetts it remains unclear whether such a simple mechanism 02115, USA could operate in the context of a complex vertebrate developmental enhancer.
    [Show full text]
  • Decoding Temporal Interpretation of the Morphogen Bicoid in the Early
    RESEARCH ARTICLE Decoding temporal interpretation of the morphogen Bicoid in the early Drosophila embryo Anqi Huang1†, Christopher Amourda1†, Shaobo Zhang1, Nicholas S Tolwinski2,3, Timothy E Saunders1,3,4* 1Mechanobiology Institute, National University of Singapore, Singapore, Singapore; 2Division of Science, Yale-NUS College, Singapore, Singapore; 3Department of Biological Sciences, National University of Singapore, Singapore, Singapore; 4Institute for Molecular and Cell Biology, Agency for Science Technology and Research, Singapore, Singapore Abstract Morphogen gradients provide essential spatial information during development. Not only the local concentration but also duration of morphogen exposure is critical for correct cell fate decisions. Yet, how and when cells temporally integrate signals from a morphogen remains unclear. Here, we use optogenetic manipulation to switch off Bicoid-dependent transcription in the early Drosophila embryo with high temporal resolution, allowing time-specific and reversible manipulation of morphogen signalling. We find that Bicoid transcriptional activity is dispensable for embryonic viability in the first hour after fertilization, but persistently required throughout the rest of the blastoderm stage. Short interruptions of Bicoid activity alter the most anterior cell fate decisions, while prolonged inactivation expands patterning defects from anterior to posterior. Such anterior susceptibility correlates with high reliance of anterior gap gene expression on Bicoid. *For correspondence: dbsste@ Therefore, cell fates exposed to higher Bicoid concentration require input for longer duration, nus.edu.sg demonstrating a previously unknown aspect of Bicoid decoding. DOI: 10.7554/eLife.26258.001 †These authors contributed equally to this work Competing interests: The authors declare that no Introduction competing interests exist. Morphogens are molecules distributed in spatial gradients that provide essential positional informa- tion in the process of development (Turing, 1990; Wolpert, 1969).
    [Show full text]
  • Role of Six3 and Pax6 in Regulating the Gene Networks Involved in Vertebrate Eye Development
    University of Windsor Scholarship at UWindsor Electronic Theses and Dissertations Theses, Dissertations, and Major Papers 2011 Role of Six3 and Pax6 in regulating the gene networks involved in vertebrate eye development Saqib Sachani University of Windsor Follow this and additional works at: https://scholar.uwindsor.ca/etd Recommended Citation Sachani, Saqib, "Role of Six3 and Pax6 in regulating the gene networks involved in vertebrate eye development" (2011). Electronic Theses and Dissertations. 299. https://scholar.uwindsor.ca/etd/299 This online database contains the full-text of PhD dissertations and Masters’ theses of University of Windsor students from 1954 forward. These documents are made available for personal study and research purposes only, in accordance with the Canadian Copyright Act and the Creative Commons license—CC BY-NC-ND (Attribution, Non-Commercial, No Derivative Works). Under this license, works must always be attributed to the copyright holder (original author), cannot be used for any commercial purposes, and may not be altered. Any other use would require the permission of the copyright holder. Students may inquire about withdrawing their dissertation and/or thesis from this database. For additional inquiries, please contact the repository administrator via email ([email protected]) or by telephone at 519-253-3000ext. 3208. Role of Six3 and Pax6 in regulating the gene networks involved in vertebrate eye development by Saqib S. Sachani A Thesis Submitted to the Faculty of Graduate Studies through Biological Sciences in Partial Fulfillment of the Requirements for the Degree of Master of Science at the University of Windsor Windsor, Ontario, Canada 2011 © 2011 Saqib S.
    [Show full text]
  • A Theoretical Framework for the Regulation of Shh Morphogen-Controlled Gene Expression Michael Cohen1, Karen M
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 3868-3878 doi:10.1242/dev.112573 RESEARCH ARTICLE A theoretical framework for the regulation of Shh morphogen-controlled gene expression Michael Cohen1, Karen M. Page2, Ruben Perez-Carrasco2, Chris P. Barnes3 and James Briscoe1,* ABSTRACT Support for the affinity threshold model came from experiments How morphogen gradients govern the pattern of gene expression in dissecting the molecular mechanism of gene regulation in the early developing tissues is not well understood. Here, we describe a Drosophila embryo (Driever et al., 1989; Jiang et al., 1993, 1992). statistical thermodynamic model of gene regulation that combines the Subsequent observations, however, were inconsistent with the activity of a morphogen with the transcriptional network it controls. model (Ochoa-Espinosa et al., 2005; reviewed by Cohen et al., Using Sonic hedgehog (Shh) patterning of the ventral neural tube as 2013). Moreover, binding sites in the enhancers of target genes for an example, we show that the framework can be used together with transcription factors (TFs) other than the MR-TF have been shown the principled parameter selection technique of approximate to influence gene expression (Hong et al., 2008; Ip et al., 1992; Bayesian computation to obtain a dynamical model that accurately Jaeger, 2004; Kanodia et al., 2012; Porcher and Dostatni, 2010). predicts tissue patterning. The analysis indicates that, for each target These additional TFs can be expressed uniformly throughout the gene regulated by Gli, which is the transcriptional effector of Shh tissue or controlled by graded signals. This led to the suggestion that signalling, there is a neutral point in the gradient, either side of which the response to a morphogen is the product of the structure of the altering the Gli binding affinity has opposite effects on gene transcriptional network comprising the target genes.
    [Show full text]
  • The Bicoid-Related Pitx Gene Family in Development
    Mammalian Genome 10, 197–200 (1999). Incorporating Mouse Genome © Springer-Verlag New York Inc. 1999 The bicoid-related Pitx gene family in development Philip J. Gage,1 Hoonkyo Suh,3 Sally A. Camper1,2 1Department of Human Genetics, University of Michigan Medical School, Ann Arbor, MI 48109-0638, USA 2Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48109-0638, USA 3Graduate Program in Neuroscience, University of Michigan Medical School, Ann Arbor, MI 48109-0638, USA Received: 18 August 1998 / Accepted: 11 November 1998 The important roles of homeobox genes in development of the residue 50 within the homeodomain. This residue, at residue 9 hindbrain and axial body are well established. More recently, it has within the recognition helix of the homeodomain, is the major become clear that certain subfamilies of homeobox genes play determinant of DNA binding specificity (Gehring et al., 1994; particularly important roles in the development of more anterior Hanes and Brent, 1989). Several members of this small subfamily structures. These have included the paired gene family in the eye are essential for axis and pattern formation (Ang et al., 1996). (Gehring, 1996; Hanson and Van Heyningen, 1995; Macdonald Pitx2 expresses multiple protein isoforms as a result of alternative and Wilson, 1996; Wehr and Gruss, 1996), the orthodenticle and splicing (Gage and Camper, 1997; Kitamura et al., 1997) and the distalless gene families in the fore- and midbrains (Acampora et use of different promoters (P. Gage and E. Semina, unpublished al., 1996; Acampora et al., 1995; Price et al., 1991; Simeone et al., results) (Fig.
    [Show full text]