Roles of Irx3/5 in Mouse Hindlimb Development

Roles of Irx3/5 in mouse hindlimb development

Danyi Li

A thesis submitted in conformity with the requirements for the degree of Masters of Science Graduate Department of Molecular Genetics University of Toronto

Roles of Irx3/5 in mouse hindlimb development

Danyi Li

Masters of Science

Department of Molecular Genetics University of Toronto

2011 Abstract

Iroquois (Irx) homeobox genes have important and redundant functions during embryogenesis. Irx3/5 double knock out (Irx3/5 KO) mouse embryos exhibit severe hindlimb phenotypes. In these mutant hindlimbs, digit 1 and tibia are absent, moreover femur and pelvis are hypoplastic. Here, we demonstrate that Irx3/5 are expressed in the hindlimb field prior to limb bud initiation, and are required at this early stage for the pattern formation along the anteroposterior axis. Their early function is involved in prepatterning and positioning the Shh expression domain. In addition, Irx3/5 KO mutant hindlimb buds have a mild outgrowth defect and increased cell death at early stages of limb development, which may explain the small hindlimb bud size in these mutant embryos. To examine whether Irx3/5-expressing cells are the origin of lost and affected structures in Irx3/5 KO mutant hindlimbs, targeting vectors with Cre genes inserted into the Irx5 locus have been generated.

Acknowledgments

I would like to take this opportunity to gratefully acknowledge the following people for their contributions and support throughout my Masters degree: my committee members Dr. Andrew Spence and Dr. Sabine Cordes for their valuable comments and suggestions; all the members of the Hui lab and Hopyan lab for being so supportive of my work, especially Mary Zhang, Rong Mo and Laurie Wyngaarden for their enormous technical guidance and instruction, Dr. Rui Sakuma for generating the mutant mice, and Olena Zhulyn, Sue Li, Niki Vakili, Jieun Kim and Kelvin Law for many valuable scientific discussions; and my parents and my husband for their supports and encouragement.

Finally, I would like to extend a special thank you to my supervisors Dr. Chi-chung Hui and Dr. Sevan Hopyan for their continuous guidance, support and encouragement. Their intelligence and dedication to research has inspired me to stay motivated and focused throughout this project.

iii

Table of Contents

Abstract ii Acknowledgment iii List of Figures and Tables vi List of Abbreviations vii

1 Introduction 1 1.1 An overview of vertebrate limb development and patterning 1 1.2 Models for P-D patterning of the limb: from Progress-zone to Differentiation-front 4 1.3 A-P patterning of the limb: Prepatterning the limb bud and Shh-activation network 5 1.4 Iroquois homeobox (Irx) genes: genomic organization and general functions 6 1.5 Irx3 and Irx5 have novel functions in mouse hindlimb development 9

2 Materials and Methods 15 2.1 Mice and genotyping 15 2.2 Whole-mount in situ hybridization 15 2.3 X-gal staining 16 2.4 Esr1Cre induction via tamoxifen administration 16 2.5 Cartilage staining 16 2.6 Western blotting 16 2.7 Measurement of limb bud size and Shh domain shift 17 2.8 Whole-mount immunohistochemistry 17 2.9 Cell death detection by LysoTracker Red Probe 17 2.10 Generation of targeting vectors 17

3 Results 19 3.1 Early expression pattern of Irx3 and Irx5 before mouse limb bud initiation 19 3.2 Conditional deletion of Irx3/5 at different stages before and during hindlimb bud initiation causes distinct hindlimb phenotypes 19 3.3 Elimination of Irx3 protein can be achieved within 48hr in conditional mutants following a single tamoxifen treatment 20 3.4 Irx3/5 KO hindlimb buds display a mild morphological defect during the early stage of hindlimb bud formation 21 3.5 Irx3/5 KO hindlimb buds have mild outgrowth defect during bud initiation stage and increased cell death at outgrowth stage 22 3.6 Prepatterning of Irx3/5 KO hindlimb bud is disrupted causing an anterior shift of Shh domain 23 3.7 Irx3/5 KO hindlimb bud is patterned with a more posterior fate after Shh activation 23 3.8 Generation of targeting vectors of Irx5::nlsCre and Irx5::CreERT2 24

4 Discussion 36 4.1 Temporal requirement for Irx3/5 in patterning the P-D axis of the hindlimb 36 4.2 Early function of Irx3/5 is required for hindlimb A-P axis prepatterning 38 4.3 A-P and P-D limb axes are linked prior to the establishment of the Shh-Fgf positive feedback loop 39 4.4 Potential interaction between Irx3/5 and AER-FGF signaling 40 iv

4.5 Potential interaction between Irx3/5 and SHH pathway 41 4.6 A model for Irx3/5 function in mouse hindlimb development 42

5 Future direction 45 5.1 Rationale 45 5.2 Specific Aims 45 5.2.1 Fate mapping of Irx3/5-expressing cells may reveal the origin of anterior hindlimb structures 45 5.2.2 Determine transcriptional functions of Irx3/5 in mouse hindlimb development and their downstream target genes 46 5.2.3 Determine protein-protein interactions between Irx3/5 and other key factors in hindlimb development 47 5.2.4 Determine interactions between Irx3/5 and SHH, FGF pathways 48

References 50

List of Figures and Tables

Figure 1.1: An overview of vertebrate limb development 11

Figure 1.2: Mechanisms of limb pattern formation 12

Figure 1.3: Genomic organization of Iroquois genes and protein structure 13

Figure 1.4: Irx3 and Irx5 have redundant and novel functions during mouse hindlimb development 14

Figure 3.1: Early expression pattern of Irx3 and Irx5 before mouse limb bud initiation 25

Figure 3.2: Tamoxifen inducible conditional KO mutant phenotype 27

Figure 3.3: Irx3 protein level in conditional KO mutant embryos 28

Figure 3.4: Early morphology of Irx3/5 KO hindlimb bud 29

Figure 3.5: Pitx1 and Tbx4 expression in hindlimb bud at initiation and outgrowth stages 30

Figure 3.6: Cell death is increased in E10.5 mutant hindlimb buds 31

Figure 3.7: Cell proliferation and outgrowth in E9.75 embryos 32

Figure 3.8: Prepatterning of Irx3/5 KO hindlimb bud is affected causing an anterior shift of ZPA-Shh 33

Figure 3.9: Consequence of ZPA-Shh shift 34

Figure 3.10: Irx5::nlsCre and Irx5::CreERT2 Targeting vectors 35

Figure 4.1: Summary of Irx3 protein level in conditional KO mutant before and during hindlimb bud development and the corresponding hindlimb cartilage phenotype 43

Figure 4.2: A model for Irx3/5 in mouse hindlimb development 44

Figure 5.1: Results-based prediction for fate-mapping studies in Irx5Cre;R26R and Irx5CreERT2;R26R embryos revealed by X-gal staining 49

Table 3.1: Hindlimb phenotype summary of conditional KO mutants with tamoxifen injection at E7 and E8 26

List of Abbreviations

5' Hoxd: 5'-located Hoxd gene A-P: anteroposterior AER: apical ectodermal ridge BMP: bone morphogenic protein D-V: dorsoventral EnR: Engrailed repressor domain Fgf: fibroblast growth factor Gli3R: Gli3 repressor Grem: Gremlin Hox: homeobox gene Irx: Iroquois homeobox gene kb: kilo basepair KO: knock out LPM: lateral plate mesoderm LTR: LysoTracker Red P-D: proximodistal RA: retinoic acid Shh: sonic hedgehog TALE: three amino acid extension loop TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labeling VP16: viral protein 16 ZPA: zone of polarizing activity

vii 1

1 Introduction

The limb bud is an excellent model to understand molecular mechanisms of embryogenesis because it is ① easily accessible, ② highly regulative, ③ a three dimensional structure with clear polarity along the three axes (the anteroposterior (A-P), dorsoventral (D-V) and proximodistal (P-D) axes (Fig 1.1B)), and ④ shares molecular mechanisms and pathways with the development of other segmented structures (e.g. different Hox gene combinations to specify different segments) (Koussoulakos, 2004).

Decades of studies have provided a wealth of information on the mechanism of limb development. By manipulating chick limb buds, in what have been called “cut and paste” experiments, early studies have defined group of cells controlling limb bud morphology. Many basic structures and concepts of the limb bud, which were the foundation of later genetic analysis, were discovered from these classical studies, such as the apical ectodermal ridge (AER) and the zone of polarizing activity (ZPA) (Fig 1.1C and see 1.1 for details). With the advantage of mouse genetics, functions of particular genes and pathways in limb development have been gradually revealed. The challenge now is to understand the interactions of genes and pathways that coordinate limb organogenesis, especially pattern formation, cell fate specification and differentiation.

1.1 An overview of vertebrate limb development and patterning

The vertebrate limb comes from lateral plate mesoderm (LPM) in the flank of the embryo (Searls et al., 1971) (Fig 1.1A). The limb field is a group of embryonic cells that give rise to the limb bud (Harrison, 1918; Rosenquist, 1971). Long before appearance of the limb bud, the location of the limb field is already determined. The forelimb and hindlimb fields are located at specific positions along the body axis under control of combinatorial Hox gene expression and other mechanisms (Burke et al., 1995; Cohn et al., 1997; McPherron et al., 1999; Marshall et al., 1996). Tbx5 and Tbx4 are two of the earliest markers detectable in the fore- and hindlimb fields respectively (Gibson-Brown et al., 1996). Following specification of limb fields, Fgf8 is activated in the intermediate mesoderm (IM) at corresponding levels (Crossley et al., 1996; Vogel et al., 1996), and controls Wnt expression in the adjacent LPM (Kawakami et al., 2001), resulting in restricted Fgf10 expression in the LPM of limb fields (Xu et al., 1998; Yonei-

Tamura et al., 1999). Meanwhile, cells in the LPM of the limb field start active cell division, whereas the flanking non-limb LPM cells divide more slowly, resulting in the formation of a noticeable limb bud (Searls et al., 1971).

The limb bud is composed of an ectodermal pocket and inner proliferating mesenchyme (Searls et al., 1971). The FGF10 protein in mesenchyme signals to the overlying ectoderm to activate Fgf8 expression and initiate AER induction (Ohuchi et al., 1997; Min et al. 1998, Sekine et al. 1999). The AER is a thickened ectodermal structure that runs along the distal limb bud tip, separating the dorsal and ventral ectoderm marked by Wnt7a and En-1 expression respectively (Riddle et al., 1995; Davis et al., 1988). FGFs secreted by the AER, including the sequentially expressed Fgf8, Fgf4, Fgf9 and Fgf17, are important for inhibiting apoptosis in the mesenchyme and promoting limb bud outgrowth (Sun et al., 2000; Sun et al., 2002; Mariani et al., 2008). In chick, an FGF-soaked bead transplanted into the distal tip was able to restore outgrowth and patterning of a limb bud from which AER had been removed (Niswander et al., 1993; Fallon et al., 1994). Recent studies suggest that AER-FGFs are also important for pattern formation along the P-D limb axis (see 1.2 for details) to specify stylopod (e.g. humerus), zeugopod (e.g. radius and ulna) and autopod (e.g. wrist bones, palm bones and digit bones) bones. Another important function of AER-FGFs is to maintain expression of Shh in ZPA (Niswander et al., 1994).

The ZPA is a group of cells in the limb bud posterior mesenchyme. These cells have the ability to induce mirror image duplication along the A-P axis when transplanted to the anterior mesenchyme of an intact limb bud in chick (Saunders et al., 1968, Tickle, 1981). SHH was identified as a polarizing molecule secreted by the ZPA (Riddle et al., 1993). Several genes are involved in regulating Shh activation in ZPA cells at an early stage of limb bud formation, called the prepatterning stage (see 1.3 for details). SHH is diffusible. A gradient of SHH is thought to be crucial for patterning along the A-P axis, especially for specification of digit identities. Limbs of Shh-null mouse embryos lack posterior elements; the only digit left is digit 1 (Chiang et al., 1996; Chiang et al., 2001; Kraus et al., 2001). Fate mapping studies show that digit 5, 4 and part of digit 3 are mostly derived from Shh-expressing cells (ZPA cells) depending on the length of time of exposure to SHH, and digit 2 is mainly derived from SHH-responding cells (Fig 1.2 D) (Ahn et al., 2004; Harfe et al., 2004). In response to SHH signaling, downstream targets such as Gli1 and Ptc1 are expressed, and the level of Gli3 repressor (GLI3R) is reduced (Yang et al., 1997; Wang et al., 2000). The GLI3R is a truncated form of GLI3 continuously processed from

3 the full length protein, GLI3FL, which functions as a transcriptional activator. As a consequence of the SHH gradient, a gradient of GLI3R is established across the A-P axis of the limb (Wang et al., 2000). Several studies suggest that an important function of graded SHH signaling in limb development is to counteract GLI3R-mediated repression and promote proliferation in the posterior mesenchyme thereby enabling the progression of limb outgrowth and organogenesis. For example, in mice, Shh;Gli3 DKO mutant limbs exhibit preaxial polydactyly similar to the phenotype of Gli3-/- and Gli3P1-4/P1-4 (no GLI3R) mutants (Hui et al., 1993; Schimmang et al., 1992; Litingtung et al., 2002; te Welscher et al., 2002; Wang et al., 2007). Marker analysis suggest that several genes in limb A-P patterning including 5’ Hoxd genes (e.g. Hoxd11/12/13) are controlled by Gli3 rather than Shh (Litingtung et al., 2002; te Welscher et al., 2002).

The AER and ZPA are two major signaling centers in limb bud development. Their maintenance requires establishment of the Shh-Grem1-Fgf epithelial-mesenchymal (e-m) feedback loop (Fig 1.1D) (Niswander et al., 1994). GREM1 antagonizes activity of BMPs. Upon activation of Shh in ZPA, Gremlin 1 (Grem1) is upregulated in posterior limb bud mesenchyme, resulting in reduction of BMP activity, thus promote upregulation of Fgf expression in AER (Michos et al., 2004; Zuniga et al., 1999). In Grem1 KO mouse embryo, the Shh-Fgf feedback loop is disrupted, leading to loss of structures in the autopod and zeugopod. Fgf4 expression is lost in AER of these mutants, Fgf8 expression is decreased and disorganized, and Shh expression is greatly reduced. Although expression of Bmps seems unchanged, their downstream targets Msx1 and Msx2 are upregulated (Khokha et al., 2003). On the other hand, mutants with decreased level of BMP signaling in the limb bud usually display an enlarged limb paddle and upregulated AER-Fgf expression (Reviewed by Robert, 2007). Together, these studies suggest that the Shh-Grem1-Fgf network is essential for regulation and maintenance of AER-Fgfs and ZPA-Shh.

After the early patterning stage of limb bud development, coordinated proliferation along the A- P and P-D axes leads to expansion of progenitor pools that give rise to primordia of stylopod, zeugopod and autopod. Cell proliferation is fast and uniform at the early stage of limb development, while cell death is not detectable in the limb bud (Fernandez-Teran et al., 2006). Increased cell death occurs in restricted areas during later stages, including the center proximal mesenchyme, anterior mesenchyme, AER and interdigit regions (Fernandez-Teran et al., 2006). As limb bud outgrowth proceeds distally, Sox9 expression is initiated in the proximal core mesenchyme, and leads to chondrogenic differentiation (Takahashi et al., 1998). Cartilage

4 structures appear first and develop in a proximal-to-distal sequence, and are replaced by bones at later stages. The morphology of mouse limb buds at different stages and the expression duration of Fgf8 and Shh are shown in Fig 1.1E.

1.2 Models for P-D patterning of the limb: from Progress-zone to Differentiation-front

The progress-zone model was the most popular model of limb P-D patterning in the past (Reviewed by Tabin et al., 2007). This model is based on several classical experiments on chick wing buds. One key piece of evidence is that removal of the AER at later stages of wing development causes truncations of more distal structures (Saunders, 1948). The progress-zone model suggests that signals from the AER, which are believed to be FGFs, maintain cells in the distal-most limb bud mesenchyme, defined as the progress zone (PZ), in a proliferative and undetermined state. Cells along the P-D axis are specified by a 'clock-type' mechanism as they exit the progress zone. Thus, the fate of cells is determined in a proximal-to-distal manner, and the function of AER-FGFs is “permissive” (only required for maintenance of the progress zone) (Summerbell et al., 1973). (Fig 1.2A)

Recent genetic studies, however, provide evidence that challenges this Progress-zone model. For example, in Gli3-/-;Plzf-/- mutant mouse embryos, hindlimb autopods can form in the absence of skeletal structures of the stylopod and zeugopod (Barna et al., 2005). Furthermore, studies in conditional mutants of AER-Fgfs indicate that elimination of Fgf8 and Fgf4 together can disrupt limb development completely, but transient early expression of the two genes is sufficient to specify the limb P-D axis, although subsequent formation of each segment (stylopod, zeugopod and autopod) is disrupted (Sun et al., 2002). Results of fate mapping experiments in chick limb buds support the concept that cells along the P-D axis are specified early, followed by subsequent expansion of progenitor pools (Dudley et al., 2002). These data support the concept that limb P-D axis is specified early. Further analysis of chick wing bud development has shown that in limb bud mesenchyme retinoic acid (RA) can induce proximal fate and AER-FGFs, which antagonize RA signaling, can induce distal fate. Implanting RA-soaked beads into distal mesenchyme of chick limb buds upregulates Hoxa11 (zeugopod marker) expression, downregulates Hoxa13 (autopod marker) expression, and induces ectopic expression of Meis1 which is normally expressed in proximal mesenchyme. Thus, by opposing activities of the

5 proximal signal RA and the distal signal AER-FGFs, the limb bud is specified along the P-D axis at early developmental stages. This is known as the two-signal model (Mercader et al., 2000; Mariani et al., 2008). In this model, the AER-FGFs are not only "permissive" signals, but also "instructive" (they are involved in pattern formation).

To reconcile molecular data with classical AER-removal experiments, the differentiation-front model was proposed (Fig 1.2B) (Tabin et al., 2007). This model incorporates features of the two- signal model. It suggests that early limb bud mesenchyme is controlled by proximal signals to give rise to proximal structures, but this “default” is modified by AER-FGF signals, which induce specification of distal fates. AER-FGFs keep the distal mesenchymal cells in a proliferative, undifferentiated state, while the proximal cells are progressively determined. The border between the determined proximal cells and the specified distal cells defines the differentiation front.

1.3 A-P patterning of the limb: Prepatterning the limb bud and Shh-activation network

Prepatterning of the limb bud along the A-P axis polarizes limb bud mesenchyme before Shh expression begins in ZPA (Fig 1.2C). It is important for Shh activation in the appropriate region. Gli3 and Hand2 are the first genes shown to be involved in prepatterning (te Welscher et al., 2002). At the prepatterning stage, Gli3 is expressed in anterior mesenchyme of the initiating limb bud, and Hand2 is expressed at the posterior margin. The mutual genetic antagonism between these two genes polarizes the limb bud, and, together with other prepatterning genes (e.g. Tbx2/3, 5’ Hoxd genes, Etv4/5), activates Shh in the posterior mesenchyme (Davenport et al., 2003; Suzuki et al., 2004; Zakany et al., 2004; Mao et al., 2009; Zhang et al., 2009).

One of key functions of Hand2 in limb development is to induce Shh expression (Fernandez- Teran et al., 2000; Charité et al., 2000). Hand2 conditional knockout mouse embryos exhibit various limb phenotypes depending on the stage when Hand2 is eliminated (Galli et al., 2010). When Hand2 is depleted before prepatterning, the mutant limb phenotype is similar to that of Shh-/- mutants as a consequence of failure to activate Shh expression. In these mutants, the Gli3 expression domain is posteriorly expanded. In contrast, if Hand2 depletion occurs after Shh activation, mutant limb structures are generally normal. In addition, ectopic expression of Hand2 in developing limb buds can induce ectopic Shh and cause polydactyly (Charité et al., 2000).

The major role of Gli3 in prepatterning is to restrict Hand2 expression, and thus Shh expression in the posterior limb bud (te Welscher et al., 2002). In Gli3-/- mouse embryos, Hand2 is expressed throughout limb bud mesenchyme (te Welscher et al., 2002), and Shh is ectopically activated in the anterior mesenchyme after its activation in the ZPA, causing preaxial polydactyly (Büscher et al., 1997). In addition, anterior genes such as Alx4 and Pax9 are greatly downregulated or not expressed, while posterior genes are expanded anteriorly, including Shh target genes (Gli1 and Ptc1), Grem1, Hand2, 5’ Hoxd genes, and Fgf4 in the AER (Litingtung et al., 2002; te Welscher et al., 2002).

Shh expression is controlled by multiple genes. Aside from Hand2, Tbx2, Tbx3 and 5’ Hoxd genes have been suggested to induce Shh expression (Davenport et al., 2003; Suzuki et al., 2004; Zakany et al., 2004). Tbx2 and Tbx3 are expressed in similar patterns. Both are expressed in anterior and posterior strips of limb buds. Tbx3-/- limb buds cannot activate Shh, and misexpression of Tbx2 can induce ectopic Shh expression (Davenport et al., 2003; Suzuki et al., 2004). 5’ Hoxd genes are expressed in posterior limb bud mesenchyme. Ectopic expression of these genes in the early anterior limb bud leads to ectopic mirror-image expression pattern of Shh along limb A-P axis (Zakany et al., 2004).

AER-Fgfs play dual roles in regulating Shh. Besides their function in maintaining Shh expression, they also act to prevent inappropriate anterior expansion of Shh. Recently, the function of two AER-FGF targets, Etv4 and Etv5, in repressing Shh has been described (Mao et al., 2009; Zhang et al., 2009). They function as transcriptional activators in limb mesenchyme adjacent to AER. Overexpression of a dominant repressor form of Etv4 results in polydactyly phenotype because of ectopic Shh expression throughout distal limb mesenchyme.

In summary, under complex regulation by a gene network at the prepatterning stage, the ZPA- Shh location is limited in the posterior mesenchyme of limb buds.

1.4 Iroquois homeobox (Irx) genes: genomic organization and general functions

The Iroquois homeobox (Irx) genes were first discovered in Drosophila from a screen for genes involved in sensory organ development (Dambly-Chaudière et al., 1992; Leyns et al., 1996). The first mutant identified showed a bristle phenotype in the notum resembling the hairstyle of

Iroquois American Indians - hence the name of the locus. Three Irx genes were identified within this locus: araucan (ara), caupolican (caup) and mirror (mirr) (Gómez-Skarmeta et al., 1996; McNeill et al., 1997). They encode highly related, putative transcription factors, representing a new family of the TALE (Three Amino acid Loop Extension) superclass of homeodomain proteins. In addition, the Irx proteins also share a unique structure in their C-terminal region, the Iro box, consisting of thirteen conserved amino acids. (Fig 1.3)

While in C. elegans there is only one Irx gene, in mammals there are six genes organized into two clusters (IrxA and IrxB clusters) within the genome (Fig 1.3). This is likely due to duplication of a three gene cluster during evolution (reviewed by Gómez-Skarmeta et al., 2002; Cavodeassi et al., 2001). The IrxA cluster, containing Irx1, Irx2 and Irx4, is located on chromosome 13 in mouse or chromosome 5 in human, and the IrxB cluster, containing Irx3, Irx5 and Irx6, is positioned on mouse chromosome 8 or human chromosome 16 (Bosse et al., 2000; Peters et al., 2000; Gómez-Skarmeta et al., 2002). Sequence analysis suggested that Irx1, Irx2 and Irx4 are similar to Irx3, Irx5 and Irx6, respectively. Paralogs of the family are transcribed in the same orientation (Irx1/Irx3, Irx2/Irx5 and Irx4/Irx6), with Irx1 and Irx3 in the opposite direction relative to the rest of the Irx family. Although paralogs (Irx1/Irx3 and Irx2/Irx5) are expressed identically in some tissues, in general, Irx1 expression resembles Irx2 while Irx3 and Irx5 share a similar expression pattern (Cohen et al., 2000; Houweling et al., 2001). This phenomenon is probably due to the presence of shared regulatory elements that control their expression (Cavodeassi et al., 2001; de la Calle-Mustiens et al., 2005).

Similar to many other TALE homeodomain proteins, Irx proteins function as cofactors of other transcription factors (Burglin, 1997). In Drosophila, the ability of Irx proteins to bind DNA as homo- or hetero-dimers with other members of their cluster has been illustrated (Bilioni et al., 2005). DNA binding sites of Irx proteins in Drosophila have been identified by using in vitro experiments (Gómez-Skarmeta et al., 1996). Recently, two groups used different methods to analyze binding preferences for different classes of homeodomains including the Iroquois homeodomain class (Noyes et al., 2008; Berger et al., 2008). One group used a bacterial one- hybrid system to analyze 84 homeodomains from Drosophila, and the other group characterized 168 mouse homeodomains using protein binding microarrays. These studies revealed common DNA sequences in which the homeodomains interact with; interestingly, there were difference in the binding preference of the Iroquois homeodomain class (taACA in Drosophila and ACATGT

8 in mice). It is not clear yet whether this difference is due to technique limitations or reflects a difference of Iroquois binding preference in different organisms. In addition, the physiological significance of these sites is still unclear.

In Drosophila neurogenesis, ara and caup bind to an enhancer and activate expression of achaete-scute genes (Gomez-Skarmeta et al., 1996). In mice, Irx4 interacts with the Vitamin D receptor and retinoic acid receptor to repress expression of slow MyHC3 in cardiac ventricles (Wang et al., 2001). Irx5 can repress expression of Kv4.2 in cardiac myocytes by recruiting chromatin remodeling factors to its promoter (Costantini et al., 2005). These studies suggested that Irx proteins can function as transcriptional activators and/or repressors during embryogenesis. Other gain-of-function studies using the dominant activator and/or repressor form of Irx proteins (e.g. VP16-Irx, EnR-Irx) suggested similar conclusions. In Xenopus, Xiro1 functions as a transcriptional repressor in neural differentiation. Overexpression of its dominant repressor form or its wild-type has similar effects, while its dominant activator form functions as dominant negative. One important function of Xiro1 is to inhibit Bmp4 expression by binding to its promoter. (Gómez-Skarmeta et al., 2001) Another study showed that Xiro1 can indirectly induce expression of Otx2 through a repressor function (Glavic et al., 2002). In chick embryos, chimeric protein containing the Irx4 homeodomain and the Engrailed repressor domain has the opposite effect to the wild-type Irx4 when overexpressed in heart, revealing a potential for Irx4 as a transcriptional activator during chick heart development (Bao et al., 1999). In chick hindbrain development, Irx2 can function as either a transcriptional activator or repressor, under the control of FGF signaling. In the presence of FGF8 signal, Irx2 is phosphorylated by MAP kinase and acts as an activator, while in the absence of FGF8 signal, Irx2 acts as a repressor. In cerebellum formation, the dominant repressor of Irx2, Irx2-EnR, functions as dominant negative, since its overexpression in the hindbrain resulted in loss of cerebellum structure (Matsumoto et al., 2004). In zebrafish embryos, both the dominant activator and repressor form of Iro7 can induce ngn1expression with different patterns. The dominant activator can induce widespread expression of ngn1 in dorsal ectoderm, while the dominant repressor is more efficient to induce ngn1 expression in the ventral ectoderm. (Itoh et al., 2002) In summary, these experiments illustrate that the Irx family members can function as transcriptional repressors or activators during embryogenesis.

1.5 Irx3 and Irx5 have novel functions in mouse hindlimb development

In the Hui laboratory, mouse Irx5 has been identified and cloned (Cohen et al., 2000). Double labeling experiments in Irx3LacZ mouse embryos (β-galactosidase staining and Irx5 RNA in situ hybridization) suggest that Irx5 and Irx3 share a similar pattern of expression during early embryogenesis (Cohen et al., 2000 and Rui Sakuma, unpublished data). For example, at E10.5, both genes are expressed in the central nervous system, heart, foregut, LPM and limb bud. In the developing limb bud, Irx3 and Irx5 expression is restricted to the anterior-proximal mesenchyme, and this expression pattern persists throughout later stages, indicating that the two genes may have overlapping functions in limb development (Fig 1.4A, Rui Sakuma, unpublished data).

Previous work suggest that inactivation of Irx5 or Irx3 results in viable and fertile animals that show mild defects in their heart and eye, with no observable limb patterning defects. Bone staining of E18.5 Irx3-/- embryos indicates that these mutants have slight defects in the scapula and pelvis. (Rui Sakuma and Rong Mo, unpublished data)

To examine whether Irx3 and Irx5 have redundant functions in limb development, an Irx3/5 double knock out (Irx3/5 KO) mouse line was generated (Rui Sakuma, unpublished data). Heterozygous animals are viable and fertile, but homozygous mutants die at E14.5 with defects in multiple organs. While compound mutant embryos (Irx3+/-5-/- and Irx3-/-5+/-) show only scapula and pelvic phenotype but no limb defects, Irx3/5 KO embryos exhibit a distinct hindlimb phenotype. Alcian blue staining of E14.5 Irx3/5 KO mutants reveals that mutant hindlimbs have defects in both proximal and distal elements: a tiny femur and lack of anterior-distal structures including tibia and digit 1 (and sometimes digit 2). (Fig 1.4C, Rong Mo, unpublished data)

At E11.5, Irx3/5 KO hindlimb buds are much smaller than those of wild-type littermates (Rui Sakuma, et al., unpublished data). Preliminary marker analysis suggests that Irx3/5 KO mutants lack anterior hindlimb mesenchyme during early stages of limb development. Pax9 expression, which marks the primordium of tibia and digit 1 (Peters et al., 1998), is lost in E11.5 mutant hindlimb buds (Fig 1.4B, Rui Sakuma, unpublished data), and expression of anterior gene, Alx4 (Qu et al., 1997; Takahashi et al., 1998), is greatly reduced (Rui Sakuma, unpublished data). In addition, expression domains of posterior genes, including Gli1 and Grem1, are expanded in the mutant hindlimb buds (Fig 1.4D, Rui Sakuma, unpublished data). These data suggests that major

10 signaling centers for limb development may be disrupted during early stages in mutant hindlimb buds. Expression of Shh and Fgf8 was examined in Irx3/5 KO embryos at E10.5. Although the size of the Shh domain in mutant hindlimb buds is comparable to that of wild type littermates, its location seems to be in a more anterior region (Fig 1.4D, Rui Sakuma, unpublished data). Fgf8 expression is restricted to the anterior part of AER in mutant hindlimb buds (Fig 1.4D, Rui Sakuma, unpublished data).

As Irx3/5 KO mutants cannot survive after E14.5, to study their limb phenotype at later stages, conditional mutants (Prx1-Cre; Irx3flox/flox5-/-) have been generated. In these mutants, Irx3 is specifically knocked out in limb bud mesenchyme by the Prx1Cre (Logan et al., 2002) in an Irx5-null background using the Cre-loxP system (Reviewed by Nagy, 2000). Strikingly, bone staining in these conditional mutants at E18.5 reveals no obvious patterning defects in their hindlimbs (Rong Mo, unpublished data). Since Prx1-Cre is mainly activated in hindlimb buds around E10 after hindlimb bud initiation (Logan et al., 2002), we conclude that the functional requirement of Irx3/5 in hindlimb development is early, prior to Prx1-Cre-mediated deletion.

Fate mapping studies suggest that posterior limb elements are derived from Shh-expressing and responding cells. However, the patterning mechanism and origin of anterior limb structures are not clear. Since Irx3/5 KO mutant embryos lack anterior hindlimb structures, this suggests that Irx3 and Irx5 may play important patterning roles in specification of the anterior hindlimb. My Master thesis project is to further characterize the early hindlimb bud phenotype of Irx3/5 KO mutants and study the molecular functions of these two genes in hindlimb development. In addition, I will attempt to determine the stage when they are required for hindlimb pattern formation.

Figure 1.1. An overview of vertebrate limb development

(A) A schematic diagram of the LPM, forelimb and hindlimb field in the chick embryo before limb bud initiation (B) Limb A-P and P-D axes and structures of the mouse forelimb (C) AER and ZPA in the developing limb bud (D) Shh-Grem1-Fgf8 e-m feedback loop (E) Morphologies of the developing mouse hindlimb bud at different stages and the duration of Shh and Fgf8 expression. (Logan, 2003; Towers, 2009; Zeller, 2009)

Figure 1.2. Mechanisms of limb pattern formation

Schematic diagram of the Progress-zone model (A) and the Differentiation-front model (B) (blue: stylopod territory, pink: zeugopod territory, yellow: autopod territory, dark yellow: distal signals, black lines: the progress zone, green dots: undifferentiated region) (C) Prepatterning of the A-P axis in limb buds and Shh-activation network (yellow: GLI3R, orange: 5’Hoxd, grey: Tbx2/3, red: SHH, green: FGF8) (D) Fate-mapping studies of Shh-expressing and Shh-responding cells: digit 3-5 from Shh-expressing cells and digit 2 from Shh-responding cells. (Zeller, 2009; McGlinn, 2006)

Figure 1.3. Genomic organization of Iroquois genes and protein structure

In human and mouse, there are 6 Irx genes located in 2 clusters (IrxA: Irx1/2/4, IrxB: Irx3/5/6). Arrows indicate directions of transcription. The Irx proteins share a highly conserved homeodomain (HD), and an Iro box motif (ib). (Gómez-Skarmeta J, 2002)

Figure 1.4. Irx3 and Irx5 have redundant and novel functions during mouse hindlimb development

(A) LacZ expression in developing limb buds of Irx3tauLacZ embryos at E10.5 and E12.5 is restricted to the anterior-proximal mesenchyme (Rui Sakuma). (B) Pax9 expression is lost in Irx3/5 KO hindlimb buds at E11.5 (Rui Sakuma). (C) Cartilage of E14.5 forelimb (FL) and hindlimb (HL) in wild-type, Irx3-5+/3-5-, Irx3+5-/3-5-, and Irx3/5 KO embryos revealed by alcian blue staining (Rong Mo). (D) Whole-mount in situ hybridization of Shh, Fgf8, Grem1 (Gre), Gli1 in wild-type and Irx3/5 KO E10.5 hindlimb buds (Rui Sakuma, et al.)

2 Materials and Methods 2.1 Mice and genotyping

Mice used in this study were housed in standard vented cages in conformity with the Toronto Center for Phenogenomics recommendations. For genotyping of the mice and embryos, earnotches, tail clips, or yolk sac were digested in 300ul of 50mM NaOH at 100°C for 10 minutes. NaOH was then neutralized by adding 100ul of 0.5M Tris (pH 8.0). 3ul of DNA solution was used for PCR genotyping.

2.2 Whole-mount in situ hybridization

Antisense RNA digoxigenin-dUTP-labeled riboprobes were generated from linearized DNA plasmids: Irx3, Irx5, Hand2, Gli3, Shh, Fgf8, Tbx2, Tbx4, Pitx1 and Fgf10. Probes were synthesized using a DIG-labeling kit (Roche) according to manufacturer’s instructions and precipitated in 0.1M LiCl, 75% ethanol at -80°C over two hours. The probes were dissolved in

50% formamide and 50% H2O and stored at -80°C . In brief, embryos were dissected in cold DEPC treated PBS and fixed in 4% PFA overnight, dehydrated through a series of MeOH/PBT solutions, bleached in 6% H2O2/MeOH solution and stored in MeOH at -20°C . After rehydration, embryos were treated with proteinase K, and digestion was stopped in 2mg/ml glycine in PBT. Then embryos were refixed in 0.2% Gluteraldehyde and 4% PFA. After incubation in hybridization buffer (50% formamide, 5x SSC pH4.5, 1% SDS and 50mg/ml heparin) at 63°C for 1.5hr, probes were added, and hybridization was performed overnight at 63°C . Following a series of post-hybridization washes at 63°C , embryos were further washed in MABT (100 mM maleic acid, 150 mM NaCl, pH 7.5, 0.1% Tween-20) solution. Prior to antibody incubation, embryos were blocked in 2%RBR (Roche) and 2% RBR/20% heat-inactivated sheep serum for 2hr at room temperature. After incubation with anti-DIG antibody (1:2000, Roche) at 4°C overnight, embryos were washed with MABT extensively. BM purple AP substrate (Roche) was used to develop color in dark, and the color reaction was stopped using 0.5mM EDTA in PBT solution. Embryos were then cleaned in MeOH and fixed in 4% PFA.

2.3 X-gal staining

Embryos were dissected in cold DEPC treated PBS and fixed in 2.7% formaldehyde, 0.02% NP-

40 in PBS. After fixation, embryos were washed in 2mM MgCl2, 0.02% NP-40 in PBS at 4°C , and then incubated overnight at 37°C with X-gal solution (1mg/ml X-gal, 2mM MgCl2, 0.02%

NP-40, 5mM K4Fe(CN)6.3H2O, 5mM K3Fe(CN)6 in PBS). After extensive washing in PBS, embryos were fixed in 4% PFA.

2.4 Esr1Cre induction via tamoxifen administration

Tamoxifen (20 mg/ml in sesame oil) was administered via gavaging with the following amount: 5.25mg/40g body weight at E7.5, 5.5mg/40g at E7.75, 6mg/40g at E8.25, 6.25mg/40g at E8.5, 6.5mg/40g at E8.75, and 7mg/40g at E9.5. Tamoxifen was administered around 8am~8:30am for E8.25, 12pm~1pm for E7.5, E8.5 and E9.5, and 5pm~6pm for E7.75 and E8.75.

2.5 Cartilage staining

E14.5 embryos were dissected in PBS and fixed in Bouin’s solution at 4°C overnight. Embryos were washed in 70% EtOH/0.1% NH4OH for several times and then twice in 5% acetic acid 1hr each at room temperature. 0.07% alcian blue (Aldrich) in 5% acetic acid were used as staining solution. After 2hr of staining, embryos were washed in 5% acetic acid and methanol several times, then cleared and stored in methyl-salicylate (Fluka).

2.6 Western blotting

E9.75 (hindlimb region), E10.5 (hindlimb buds) and E11.5 (hindlimb buds) from Esr1Cre;Irx3flox/-5EGFP/EGFP embryos and control littermates treated with tamoxifen at E9.5 were dissected in cold PBS and flash frozen in liquid nitrogen. Total cell lystes were prepared in RIPA buffer (50mM Tris pH7.4, 150mM NaCl, 5mM EDTA, 1mM EGTA, 0.1% SDS, 0.5% Doc, 1% NP-40, 25mM sodium pyrophosphate, 1mM sodium orthovadanate, 10mM NaF, 1mM β- glycerophosphate, and EDTA-free complete protease inhibitor cocktail (Roche)) followed by sonication. Proteins were separated on 8% SDS-PAGE and transferred to nitrocellulose for immunoblotting overnight at 4°C with Irx3 antibody generated by Vijitha Puviindran from our lab or Actin antibody (Oncogene). On the second day, nitrocellulose membranes were incubated

17 with peroxidase-conjugated secondary antibodies (Oncogene) and developed using the ECL detection system (Thermo Scientific).

2.7 Measurement of limb bud size and Shh domain shift

Hindlimb buds of E9.75 Irx3/5 KO embryos and control littermates were carefully photographed with the same magnification. Outlines of limb buds were drawn using tools in Adobe Photoshop and transformed to selection regions. Numbers of pixels of each selected region were recorded from information in Adobe Photoshop and standardized to those of control embryos using Microsoft Office Excel.

2.8 Whole-mount immunohistochemistry

Embryos were dissected in cold PBS and fixed in fixative (MeOH:DMSO 4:1) overnight at 4°C and then bleached with 6% H2O2 in fixative for 6hr. Embryos were rehydrated to 1% Tween-20 in PBS, followed by blocking in Sheep serum:DMSO 4:1, then incubated in antibody solution containing a 1:100 dilution of anti-phosphorylated H3 antibody (Cell Signaling) at 4°C overnight. After multiple washes in 1% Tween-20/PBS, embryos were incubated with 1:200 dilution of HRP-conjugated secondary antibody. Embryos were then washed and color reaction performed in H2O2 and DAB.

2.9 Cell death detection by LysoTracker Red Probe

Embryos were dissected in PBS and incubated with 5mM LysoTracker Red Probe (Invitrogen) in PBS at 37°C for 30 minutes. After multiple washes in PBS, embryos were fixed in 4% PFA and photographed using a fluorescent microscope.

2.10 Generation of targeting vectors

Irx5::nlsCre and Irx5::CreERT2 targeting vectors were generated by replacing nlsCre-pA and CreERT2-pA sequence into the AscI-PmeI sites in the Irx5::EGFP targeting vector (Rui Sakuma, unpublished data). The two Cre inserts were obtained by PCR from the pCAGGS-nlsCre (Ishida et al., 1999) and the pCre-ERT2 (Feil et al., 1997) vectors using primers: for nlsCre, forward GACTGGCGCGCCCCATGCCCGTGTGTGGCCATGGGCCCAAAGAAGAAG, reverse GTCAGCGGCCGCCAGGTCGAGGGATCTCCATA; for CreERT2, forward AAAAGGCGCGCCCCATGCCCGTGTGTGGCCATGTCCAATTTACTGACCG, reverse

AAAAGCGGCCGCCGACCAGACATGATAAGATAC. 1.6 kb EcoRI-EcoRI and 756 bp EcoRI-EcoRV fragments were purified from the Irx5G plasmid (containing 15.5kb Irx5 genomic sequence generated by Rui Sakuma, unpublished data) and ligated into pBluescript plasmid. nlsCre and CreERT2 inserts were digested by AscI and NotI and integrated into the locus of AscI- NotI site in the integrated plasmid. AscI-PmeI fragments (2.7 kb for nlsCre, 3.2 kb for CreERT2), which contain Cre inserts and part of Irx5 1st exon and 1st intron genomic sequence, were purified from the previous plasmids. Irx5::EGFP plasmid was digested by AscI and PmeI, followed by purification of the 7.3kb and 13kb fragments. After final three-piece ligation, plasmid obtained was verified by colony PCR of Cre inserts, sequencing through junctions and Cre inserts, and digestion analysis (AscI and PmeI, and EcoRI)

3 Results 3.1 Early expression pattern of Irx3 and Irx5 before mouse limb bud initiation

To examine the expression pattern of Irx3 and Irx5 before limb bud initiation, whole-mount RNA in situ hybridization in wild-type mouse embryos at E7.5 and E8.5 using Irx3 and Irx5 probes was performed. At E7.5, both transcripts were detected in embryonic and extraembryonic parts of the egg cylinder. Their expression in the embryonic part was excluded from the posterior-distal region (Fig. 3.1A, C). In E8.5 embryos, Irx3 and Irx5 were expressed in an overlapping pattern. Both showed strong expression in the headfold, neural tube and LPM as indicated by red arrowheads (Fig. 3.1B, D). Consistent with this, LacZ expression in Irx3::tauLacZ embryos was detected in a similar pattern to Irx3/5 RNA at both stages (Fig. 3.1 E, F). Since the LPM is the tissue from which limb buds originate, early expression of these genes at E8.5 suggests a potential early function for Irx3/5 in limb development.

3.2 Conditional deletion of Irx3/5 at different stages before and during hindlimb bud initiation causes distinct hindlimb phenotypes

To determine the temporal requirement for Irx3/5 in patterning hindlimb elements along the P-D axis, we deleted Irx3 using a tamoxifen inducible Cre-loxP system in an Irx5-null background (Esr1Cre; Irx3flox/-5-/-). Phenotypes of these mutant embryos were assessed following a single tamoxifen injection at different time points between E7.5 and E9.5.

Most conditional mutants were able to survive until E14.5, but some of them were dead at that stage, especially when tamoxifen was given at E7 and E8 (data not shown). All of the surviving mutants exhibited craniofacial defects similar to Irx3/5 KO embryos (Fig.3.2A), and some of them also had dorsal edema (data not shown). However, unlike Irx3/5 KO embryos exencephaly and liver hernia were never observed in these conditional mutants.

Alcian blue staining to highlight cartilage revealed a correlation between the hindlimb cartilage phenotype and stage of tamoxifen treatment. Early deletion caused defects in both proximal and

20 distal elements, and late deletion led to defects in proximal structures with preservation of distal parts, despite some phenotype variation and left-right asymmetry (Table 3.1 and Fig.3.2).

At E14.5, most conditional mutants that underwent tamoxifen treatment at or prior to E7.75 exhibited severe defects in the right hindlimb that phenocopied Irx3/5 KO embryos (n=5/7 and data not shown), including loss of digit 1 and the tibia, as well as hypoplastic femur and pelvis (Fig.3.2 A, B and data not shown). Interestingly, the left hindlimb phenotype was much less severe. Only one mutant exhibited the Irx3/5 KO hindlimb phenotype on the left side (Table 3.1).

When tamoxifen was injected at E8, digit 1 was not affected in most mutants (n=13/15), although some exhibited mild digit 1 hypoplasia on the right side (n=8/13). All digits in the left hindlimb were essentially normal (n=14/15). Phenotypes arising in the right tibia in these mutants were variable. Some had no tibia formation at all (n=4/15), while some had a hypoplastic tibia of only half of the normal size (n=2/15), and others had a tibia with a normal size in a curved shape (n=9/15). Their left tibias were mostly present and mildly affected (n=14/15). Femurs in these mutants were also affected but to a variable extent, while the pelvic phenotype was consistently severe (Table 3.1 and Fig.3.2A). Occasionally, mutants with tamoxifen treatment at E8 phenocopied Irx3/5 KO hindlimb defects (n=2/15).

In contrast to injection at earlier stages, tamoxifen treatment at E9.5 consistently caused mostly proximal deficiencies without severe distal anomalies. This included mild defects in the femur and severe defects in pelvic formation. Some mutants did exhibit a branched digit 1 in their right hindlimbs (n=3/8) (Fig.3.2A).

In summary, deletion of Irx3 in an Irx5-/- background at E7 phenocopied Irx3/5 KO hindlimb defects in both proximal and distal parts, while later deletion mainly affected more proximal structures. These data suggest that temporal requirement for Irx3/5 in patterning distal hindlimb structures is early, probably during or prior to the hindlimb bud initiation stage.

3.3 Elimination of Irx3 protein can be achieved within 48hr in conditional mutants following a single tamoxifen treatment

To determine how long it takes to achieve a complete elimination of Irx3 protein in conditional mutant embryos, Irx3 western blot was performed using embryo lysates from control and conditional mutants 6hr, 24hr and 48hr following tamoxifen treatment at E9.5.

Western blots using control embryo samples suggested that our Irx3 antibody is specific. No Irx3 protein was detectable in Irx3/5 KO embryo lysates. In addition, the quantity of Irx3 protein in wild-type and Irx3+/flox5+/- embryos was similar, while that of Irx3flox/-5-/- embryos was reduced by half (Fig.3.3A).

In conditional mutants given tamoxifen at E9.5 and dissected 6hr later (E9.75), Irx3 protein level was reduced to about 80% of Irx3flox/-5-/- control littermates despite variation among mutants (Fig.3.3B left panel). Irx3 protein level in conditional mutants 24hr following tamoxifen treatment was greatly reduced (30%~61% of control embryo) (Fig.3.3B middle panel). Irx3 protein was undetectable in conditional mutants 48hr postinjection. These results indicated that complete elimination of Irx3 at protein level can be achieved within 48hr after a single tamoxifen injection (Fig.3.3B right panel).

3.4 Irx3/5 KO hindlimb buds display a mild morphological defect during the early stage of hindlimb bud formation

To establish the stage at which Irx3/5 KO hindlimb bud morphology differs from wild-type, the size and shape of early hindlimb buds from E9.75 to E10.5 were carefully examined. Hindlimb buds can be first observed between somites 24 and 29 at the 29-somite stage (E9.75) in both wild-type and mutant embryos (Fig.3.4A and Marcil et al., 2003). At this initiation stage, the bud morphology of Irx3/5 KO mutants was not distinguishable from that of wild-type embryos. To confirm this finding, the size of mutant hindlimb buds was measured and compared to wild-type buds at the 29-somite stage. There was no obvious size difference between mutant and wild-type buds (Fig.3.4.B, C). However, an obvious bud morphology difference was observed from the 32- somite stage and onward (E10~E10.25). In mutant hindlimb buds, the anterior aspect was relatively flat along the proximodistal axis, and the bud size was slightly smaller than that of wild-type embryos (Fig.3.4A). These differences became progressively more noticeable later during development (Fig3.4A). These data suggest that the mutant hindlimb bud initiates normally and its morphological deficiency arises from around E10.0.

To determine if the hindlimb phenotype in Irx3/5 KO embryos is due to lack of expression of hindlimb specific factors Pitx1 and Tbx4 (Gibson-Brown et al., 1996; Lanctôt et al., 1997), whole-mount RNA in situ hybridization was performed in mutant and wild-type embryos at hindlimb initiation (E9.75) and outgrowth (E10.5) stages. Both genes were expressed in the

22 mutant hindlimb region at both stages in a similar domain and intensity compared to wild-type embryos (Fig.3.5), suggesting that the hindlimb specific defect in Irx3/5 KO mutants is not due to loss of Pitx1 or Tbx4 expression.

3.5 Irx3/5 KO hindlimb buds have mild outgrowth defect during bud initiation stage and increased cell death at outgrowth stage

To determine why the hindlimb bud of Irx3/5 KO embryos is smaller than that of wild-type embryos, cell death analysis was performed using LTR (LysoTracker Red) probe, which can detect the final stage of apoptosis in live embryos (Zucker et al., 1999). Consistent with previous reports using whole-mount TUNEL assay (Rallis et al., 2003), LTR signals can be detected in somites in both mutant and wild-type embryos (Fig.3.6). No obvious LTR positive cells can be detected in the hindlimb region at the bud initiation stage in either mutant or wild-type embryos (Fig.3.6A). However, at late E10.5 (~36 to 40-somite stage), increased cell death can be observed in a restricted pattern in the anterior-proximal region of the hindlimb bud and its adjacent LPM in mutants (Fig3.7.B). The consequence of this specific cell death is not yet determined, but it is probably related to the proximal defect in Irx3/5 KO hindlimb. Consistent with this possibility, this restricted cell death pattern is similar to that observed in Gli3-/-;Plzf-/- mutants which exhibit a severe proximal hindlimb defect (Barna et al., 2005).

To determine if cell proliferation is altered in mutant hindlimb bud, whole-mount immunohistochemistry of pH3 (phospho-histone H3) was performed in Irx3/5 KO and wild-type embryos at the hindlimb bud initiation stage. No obvious difference between mutant and wild- type was observed in pattern of proliferating cells in the hindlimb region (Fig.3.7A). The possibility of a mild proliferation and/or outgrowth defect in the initiating hindlimb bud cannot be excluded based on these data. To examine this issue further, an alternative approach was used by performing whole-mount RNA in situ hybridization in embryos at the hindlimb bud initiation stage, using outgrowth-related probes Fgf10 and Fgf8 (reviewed by Martin, 1998). The Fgf10 expression domain in the mutant was comparable to wild-type, but its expression level was slightly reduced (Fig.3.7B.c,d). Fgf8 expression is activated in the AER of mutant hindlimb buds at the 29-somite stage, but the length of the Fgf8 positive region, indicated by red arrowheads, was anteriorly truncated relative to wild-type embryos (Fig.3.7B.e,f).

In summary, these data suggest that Irx3/5 KO mutants exhibit a mild outgrowth defect at the hindlimb bud initiation stage, possibly due to reduction in expression of outgrowth genes such as Fgf10 and Fgf8. This observation and increased apoptosis observed at later somite stages may explain their smaller size by E10.5.

3.6 Prepatterning of Irx3/5 KO hindlimb bud is disrupted causing an anterior shift of Shh domain

Our data raise the interesting possibility that prepatterning of positional information in the Irx3/5 KO hindlimb bud is disrupted. To examine this hypothesis, whole-mount RNA in situ hybridization of Gli3, Hand2 and Tbx2 was performed in embryos at the prepatterning stage (29- somite to 31-somite stage, or E9.75 to E10.0). During this period, in mutant hindlimb buds, Gli3 expression was greatly reduced, especially in the posterior margin (Fig.3.8.B,C), while the posterior component of the expression domains of Hand2 and Tbx2 was anteriorly expanded (Fig.3.8.D-G). Expression of the 5’Hoxd genes Hoxd11 and Hoxd13 was not affected in mutant hindlimbs (data not shown). Interestingly, at this stage Irx3 expression is excluded from the posterior mesenchyme in mouse hindlimb buds (Fig.3.8.A).

Because Gli3, Hand2 and Tbx2 are important in establishing A-P polarity in the limb bud prior to the establishment of the ZPA (te Welscher et al., 2002; Suzuki et al., 2004), Shh expression was examined in the double mutants. The nascent Shh expression domain was detected in a more anterior location in Irx3/5 KO hindlimbs at the 36-somite stage by whole-mount RNA in situ hybridization. The center of the Shh domain in wild-type hindlimb buds was at the level of the posterior part of somite-29, while in mutants its location was anteriorly shifted towards the boundary between somite-28 and 29 (Fig.3.8.H-K).

These results demonstrate that Irx3/5 are crucial for appropriate localization of the Shh expression domain and for establishing A-P prepattern in the hindlimb.

3.7 Irx3/5 KO hindlimb bud is patterned with a more posterior fate after Shh activation

To determine the consequence of ZPA-Shh anterior shift, marker analysis of important anterior and posterior genes was performed in E10.5 embryos.

Since the level of Gli3 is important for establishing digit identity (Wang et al., 2007; Hill et al., 2009), the pattern and level of Gli3 expression in Irx3/5 KO hindlimb buds was examined subsequent to Shh activation. Whole-mount in situ hybridization for Gli3 at the 38-somite stage showed that its expression domain was smaller and restricted more anteriorly compared to wild- type (Fig.3.9.A,B). Western blot using anti-Gli3 antibody suggested that GLI3R level in the mutant hindlimb region was reduced compared to wild-type (Fig.3.9.G). Expression of Alx4, another anterior gene that is downregulated by Shh (Takahashi et al., 1998), was reduced in a similar way as Gli3 in mutant hindlimbs (data not shown).

To establish the expression pattern of posterior genes in Irx3/5 KO hindlimb buds, whole-mount in situ hybridization was performed using Hand2 and Tbx2 probes. The expression domain of both genes was anteriorly expanded in mutant hindlimb buds (Fig.3.9.C-F). This anterior expansion was also observed in the expression of other posterior genes in Irx3/5 KO hindlimb buds, including Hoxd11, Hoxd13, Grem1, Gli1 and Ptc1 (data not shown).

Thus, as a consequence of an anterior ZPA-Shh shift, expression of posterior fate markers was expanded and those for anterior markers reduced, indicating that the Irx3/5 KO hindlimb bud is patterned with a more posterior fate.

3.8 Generation of targeting vectors of Irx5::nlsCre and Irx5::CreERT2

In order to determine whether descendants of Irx3/5-expressing cells give rise to the structures affected in Irx3/5 KO hindlimbs (including digit 1, tibia, femur and pelvis), two targeting vectors with Cre genes inserted into the 1st exon of the Irx5 locus were generated. This was done by replacing the existing EGFP sequence at that site in the Irx5::EGFP targeting vector with Cre. The resulting Irx5::nlsCre vector contains a Cre gene with nuclear localization sequence (nls), and Irx5::CreERT2 contains a CreERT2 sequence which encodes a tamoxifen inducible Cre. Both vectors also contain puro and DTA cassettes, driven by PGK promoters, as positive and negative selection markers, respectively (Fig.3.10A). The final ligations were verified by PCR of Cre insertion, diagnostic enzyme digestion by EcoRI and the combination of AscI and PmeI, and sequencing across the ligation junctions and the Cre inserts (Fig.3.10B-D and data not shown).

The two targeting vectors can be used to generate transgenic mouse lines which can be crossed with the Rosa26::LacZ reporter strain (Soriano et al., 1999). By subsequently performing LacZ staining, the Irx5::nlsCre;Rosa26::LacZ embryos can be used to determine the Irx5-expressing cell descendants, and the Irx5::CreERT2;Rosa26::LacZ embryos will be useful in identifying the descendants of Irx5-expressing cells at different stages upon tamoxifen treatment.

Figure 3.1. Early expression pattern of Irx3 and Irx5 before mouse limb bud initiation Whole-mount in situ hybridization of Irx3 (A,B) and Irx5 (C,D) in wild-type E7.5 and E8.5 embryos. Both genes can be detected early in E7.5 embryos, and are expressed in the head fold, neural tube and LPM in E8.5 embryos. LacZ staining of Irx3taulacZ embryos at E7.5 and E8.5 (E,F) confirmed the expression pattern. Red arrowheads indicate their expression in the LPM.

Table. 3.1. Hindlimb phenotype summary of conditional KO mutants with tamoxifen injection at E7 and E8 Phenotype severity of each element is indicated with different color: red-severe, orange-less severe, yellow-mild, white-normal. Specific phenotypes in the tibia and digits are briefly described with words and number of digits.

Figure 3.2. Tamoxifen inducible conditional KO mutant phenotype Phenotype summary and alcian blue staining of hindlimb cartilage in E14.5 Esr1Cre; Irx3flox/-5-/- mutant embryos treated with tamoxifen at E7.75, E8.25 and E9.5 are shown in (A). All conditional KO mutants show craniofacial defects similar to Irx3/5 KO mutant embryos (bottom left panel in B). Contrast to their Irx3flox/-5-/- littermates (top panels in B), conditional KO mutants with tamoxifen treatment at E7.75 can phenocopy Irx3/5 KO hindlimb, including loss of digit 1 and tibia, as well as hypoplastic femur and pelvis. E8.25 treatment always causes a mild hindlimb phenotype, with mostly 5 digits and defects with varied severity in tibia (lost or curved) and femur. However, conditional KO mutants with E9.5 tamoxifen treatment have almost normal hindlimb structures except tiny pelvis, slightly affected femur and occasionally branched digit 1 in right hindlimb. Percentage of different hindlimb phenotypes in conditional KO mutants with tamoxifen treated at E7.75 and E8 (E8.25, E8.5 and E8.75), summarized in Table 1, is shown in (C) and (D). Severe phenotype similar to Irx3/5 KO is represented by red color, mild defect in yellow and normal phenotype in white. The hindlimb phenotype in these mutants sometimes shows left-right asymmetry.

Figure 3.3. Irx3 protein level in conditional KO mutant embryos (A) Western blot of Irx3 and actin in total lysates of E11.5 embryos. (B) Western blot of Irx3 and actin in lysates of total embryo or hindlimb region tissue in embryos with tamoxifen treatment at E9.5, indicate a mild decrease of Irx3 protein level in mutants 6hrs postinjection, while Irx3 level is greatly reduced in mutant HL region 24hrs after treatment despite of variation among mutants. 48hrs after tamoxifen treatment, Irx3 level in conditional KO mutants is undetectable. (WT: wild-type, 3/5 KO: Irx3/5 KO, flox/+: Irx3flox/＋5-/+, flox/-: Irx3flox/-5-/-, MT: Esr1Cre;Irx3flox/-5-/-)

Figure 3.4. Early morphology of Irx3/5 KO hindlimb bud (A) No obvious morphology difference can be observed between wild-type and Irx3/5 KO hindlimb buds during bud initiation stage. However, mutant hindlimb buds become smaller and flatter in anterior edge than wild-type as limb bud development progresses. Shape (B) and size (C) of Irx3/5 KO hindlimb bud is similar to wild-type at initiation stage.

Figure 3.5. Pitx1 and Tbx4 expression in hindlimb bud at initiation and outgrowth stages The hindlimb specific regulators Pitx1 (A) and Tbx4 (B) are expressed in Irx3/5 KO hindlimb buds at both initiation and outgrowth stages.

Figure 3.6. Cell death is increased in E10.5 mutant hindlimb buds (A) LTR signals in E10.0 embryos (30-31 somite) and (B) LTR positive cells are increased in the anterior-proximal region of hindlimb bud and the adjacent LPM in E10.5 Irx3/5 KO embryos (38-somite) especially in the right hindlimb bud. (Limb buds are shown in their dorsal views with anterior to the top and posterior to the bottom, except the bottom panels in B, which show lateral view of the left and right hindlimb buds.)

Fgf8 and (B) (B) and

view) lateral the ng

Red arrow heads indicate the the heads indicate arrow Red (

somite stage embryos somitestage

in 28 in

in E9.75embryos in

(limb buds are outlined in lower panels showi (limbpanels outlined lower in are buds

Fgf8

, ,

Fgf10

)

mount immunochemistry of pH3 mountof immunochemistry

. Cell proliferation and Cell . outgrowth

mount situ in of hybridization

hole

Figure 3. Figure (A) whol region. expression

(F, (F,

Tbx2

(D, E), E), (D,

Shh

somite stage (H to K). K). to (H somitestage

Hand2

(B,C), (B,C),

Gli3

anterior shift of ZPA of shift anterior

somite stage (B to G) and 35 somiteand G) to (B stage

expression domain, and black arrow heads indicates the indicates arrow black heads expressionand domain,

Tbx2

and and

embryos at 29 at embryos

Hand2

, ,

type

Gli3

, ,

embryos situ in RNA of embryos and Sakuma), Rui (by

wild

Irx3

KO hindlimb bud is affected causing affected is bud KOhindlimb

. Numbers and dotted lines in H to K label the somite levels, and blue lines suggest the span span the suggest lines blue and somite dotted levels, the and to H in lines label K Numbers .

KO and and KO

Irx3/5

Irx3taulacZ

Irx3/5

to K) to in

(H (H

Prepatterning of Prepatterning

Shh

domain.

galstaining E9.75 in

ure 3. ure

Shh

Fig X (A) and G), of span the to A in lines mark G Red hindlimb border of buds anterior of

embryos

type

wild

KO and

Irx3/5

in in

and Actin antibody. Actin and

Gli3

(E and F) and (E

Tbx2

using

, ,

lysate

(C and D) and (C

Hand2

, ,

(A and and B)(A

shift

Gli3

Shh

Consequence of ZPA of Consequence

37 somite stage. (G) Western blot of E10.5 hindlimb blot E10.5 of (G) region Western somite 37 stage.

ure 3. ure

hole mount in situ hybridization of of in mount hole situ hybridization

Fig W 35 at

Figure 3.10. Irx5::nlsCre and Irx5::CreERT2 Targeting vectors

(A) Targeting strategy of the Irx5::nlsCre and Irx5::CreERT2 targeting vectors. (B) Map of targeting vectors with the size and position of Cre insertion (marked with red color) and the sizes of each fragments by double digestion with AscI and PmeI and single digestion with EcoRI. (C,D) Agarose gel of fragments generated by PmeI/AscI double digestion and EcoRI digestion.

4 Discussion

In this study, I showed that Irx3 and Irx5 are novel and early regulators of mouse hindlimb development. They have overlapping expression pattern in the LPM prior to limb bud formation at E8.5. Analysis of hindlimb phenotypes in conditional mutants suggests their functions in the formation and patterning along the P-D and A-P limb axes are early. The hindlimb bud of Irx3/5 KO mutants, which only develop the posterior digits, is smaller than that of wild-type littermates probably due to decreased Fgf10 and AER-Fgf8 expression at the bud initiation stage and increased proximal restricted cell death at an later stage. Function of Irx3/5 is essential for the regulation of prepatterning gene expression. In Irx3/5 KO mutant hindlimb buds, expression of the anterior prepatterning gene, Gli3, is greatly reduced, while posterior prepatterning genes, Hand2 and Tbx2, are upregulated and anteriorly expanded, during the prepatterning stage. After Shh activation, location of the Shh domain is anteriorly shifted, and expression domains of SHH- regulated genes are changed, causing the limb bud to be patterned with a more posterior fate. I also generated the Irx5::nlsCre and Irx5::CreERT2 targeting vectors, for future fate mapping experiments. 4.1 Temporal requirement for Irx3/5 in patterning the P-D axis of the hindlimb

Our previous data suggest a patterning function for Irx3/5 in limb development along the P-D axis. Deletion of Irx3/5 after hindlimb bud initiation using the Prx1-Cre causes defects in the pelvic bones but did not affect formation of hindlimb skeletal structures (Rong Mo, unpublished data). Similar to this finding, Esr1Cre; Irx3flox/-5-/- embryos that were treated with tamoxifen at E9.5 exhibited no distal hindlimb defects but only mild femur and severe pelvic anomalies. Western blot analysis revealed that complete elimination of Irx3 protein in these conditional mutants is achieved within 48 hr following tamoxifen injection. This is consistent with previous reports suggesting that inducible Cre can translocate into the nucleus within 6 hr following tamoxifen treatment in mice and remain there for approximately 36 hr (Hayashi et al., 2002). The complete deletion of Irx3 in these conditional mutant embryos suggests that their normal hindlimb phenotype is not due to persistent residual expression of Irx3 throughout late stages of hindlimb development. When tamoxifen was given at E7 or E8, the conditional mutants did

37 exhibit hindlimb defects. These data indicate that Irx3/5 are mainly required in an early and limited developmental window for formation of hindlimb structures.

Our analysis revealed distinct temporal requirements for Irx3/5 in the formation of P-D limb elements. Early tamoxifen treatment at or prior to E7.75 led to severe hindlimb defects in both the proximal and distal regions, resembling Irx3/5 KO mutants. Interestingly, digit 1 was not affected in most conditional mutants treated with tamoxifen at E8.25. Since Irx3 protein should be completely eliminated by E10.25 in these embryos, this suggests that Irx3/5 function is dispensable for digit 1 specification after E10.25. Similarly, we found that tamoxifen treatment at E9.5 only resulted in a severe pelvic phenotype and mild femur defects, but not tibial or digit anomalies. Thus, Irx3/5 function is not required for tibial formation after E11.5 (48 h after tamoxifen treatment at E9.5) (Fig. 4.1). The phenotypic variation in conditional mutants with tamoxifen injection at the same stage may reflect differential Cre activity, and thus, deletion efficiency among individual embryos, which is a common phenomenon in Cre-mediated conditional mutants (Galli et al., 2010). An interesting interpretation from these experiments is that Irx3/5-expressing cells at different stages for limb development may give rise to different elements along the P-D axis. To examine this hypothesis, populations of Irx3/5-expressing cells that contribute to individual P-D elements need to be identified by fate mapping approaches.

Our results provide strong support for the idea that the autopod in the hindlimb is specified earlier than the zeugopod (i.e. digit 1 is specified earlier than tibia). This interpretation is in agreement with the Differentiation-front model (see 1.2 for details). Given that Irx3/5 are expressed throughout the anterior mesenchyme of initiating hindlimb buds and later become restricted to the anterior-proximal region during bud outgrowth, it is conceivable that Irx3/5 may have two functions. First, they may be involved in specifying the territory of limb anterior structures (see 4.2 for details). Second, since their dynamic expression pattern is similar to that of proximal genes Meis1 and Meis2 (Mercader et al., 2000), they may function as proximal cues. Supporting this notion, in P19 cells Irx3/5 are induced by the candidate proximal signal retinoic acid (Vijitha Puviindran, unpublished data). Under control of proximal cues, including Irx3/5, the initiating hindlimb bud might be patterned with a “default” proximal fate, which could then be modified by distal signals from the AER after activation of Fgf8, to adopt distinct distal fates. During limb bud outgrowth, Irx3/5-negative cells in the anterior mesenchyme (descendants of Irx3/5-expressing cells) first appear in the most distal region. Since they are closest to the AER,

38 they obtain the most distal fate. These cells are influenced by Irx3/5 shortest and by AER-FGF earliest, thus they are likely specified as progenitors of the anterior autopod. At later stages, when AER-Fgfs are expressed robustly, the Irx3/5-negative cells appear in the more proximal region. These more proximal cells, which are influenced by Irx3/5 longer and by AER-FGF to a lesser extent, obtain more proximal fate and are likely to give rise to the zeugopod. This patterning process must be completed in a short period because once cells are out of the “undifferentiated zone” controlled by the AER-FGFs, they will initiate chondrogenic differentiation. Later expression of Irx3/5 in the proximal region is likely important for the formation and/or maintenance of proximal elements. Since femurs are formed in Irx3/5 KO mutants although hypoplastic, and the expression of proximal marker Meis1 is not affected in the Irx3/5 KO hindlimb bud at E10.5 (data not shown), specification of the stylopod seems to be Irx3/5-independent. Increased cell death in the anterior-proximal region of mutant hindlimb buds at late E10.5 suggests that Irx3/5 function might be required for maintaining the progenitor population of the proximal elements.

4.2 Early function of Irx3/5 is required for hindlimb A-P axis prepatterning

Irx3/5 KO mutants lack anterior hindlimb structures (e.g. digit 1 and tibia), indicating that the two genes are involved in pattern formation along the A-P axis. At the hindlimb initiation stage, Irx3/5 are excluded from the posterior mesenchyme. In terms of A-P patterning, this expression pattern suggests at least two possible scenarios. One is that Irx3/5 are involved in determining the territory of future anterior structures. This is consistent with previous reports which suggested that Irx genes have important patterning functions to specify the identity of diverse territories in early development (reviewed by Cavodeassi et al., 2001). To examine this hypothesis, it is essential to perform fate mapping of Irx3/5-expressing cells and determine the structures that they give rise to. The second possibility is that the two genes function as prepatterning genes and their early expression in the hindlimb bud polarizes anterior limb mesenchyme with anterior fate.

As discussed above, the temporal requirement for Irx3/5 in formation of distal hindlimb elements is early. They are not required for digit 1 formation after E10.25. In addition, the hindlimb bud morphology defect arises at early E10 in double knockout embryos. These data suggest that

Irx3/5 are required at the hindlimb bud initiation stage, which is also the prepatterning stage (from hindlimb bud initiation at E9.75 to Shh activation at early E10.25). Similar to other known prepatterning genes, Irx3/5 are expressed in a restricted pattern during hindlimb bud prepatterning. Loss of Irx3/5 function affects expression patterns of prepatterning genes including Gli3, Hand2, Tbx2 and probably others, and results in a shift in location of the Shh domain towards the anterior of the hindlimb bud, which causes the limb bud to be patterned with a more posterior fate. These results support the hypothesis that Irx3/5 are involved in prepatterning of mouse hindlimbs and are key regulators for location of the ZPA. Consistent with this interpretation, the distal hindlimb phenotype in Irx3/5;Shh triple knockout mouse embryos is similar to that of Shh-/-, and anterior defects are rescued in some Irx3/5 KO; Shh+/- mutants, suggesting that Irx3/5 function in development of distal structures is Shh dependent (Niki Vikili, unpublished data).

My finding that the hindlimb phenotype in Irx3/5 KO mutants is to some extent due to disrupted prepatterning during early stages highlights the importance of prepatterning in A-P pattern formation in the limb. Although a great number of genes are involved in limb development, only a few of them are known to function during prepatterning. Most of the known prepatterning genes activate Shh expression, including Hand2, Tbx2, Tbx3, and 5’ Hoxd genes (Fernandez- Teran et al., 2000; Charité et al., 2000; Davenport et al., 2003; Suzuki et al., 2004; Zakany et al., 2004). Gli3 and two AER-FGF responding genes Etv4/5 were shown to restrict Shh expression in the posterior limb mesenchyme (te Welscher et al., 2002; Mao et al., 2009; Zhang et al., 2009). According to my data, Irx3/5 are two potential anterior prepatterning genes that control Shh expression posteriorly in mouse hindlimbs. In addition, these two genes are likely to be upstream of Gli3 during the limb bud initiation stage, since Gli3 expression level is reduced in the Irx3/5 KO hindlimb bud.

4.3 A-P and P-D limb axes are linked prior to the establishment of the Shh-Fgf positive feedback loop

Although the discussion above is focused on the specification of the A-P and P-D limb axes separately, it is known that the two axes are integrated during limb development. The key event is the establishment of the Shh-Fgf positive e-m feedback loop (Niswander et al., 1994). Our analysis in Irx3/5 mutants suggests that patterning along the two axes is linked prior to the Shh-

Fgf feedback loop. As discussed above, Irx3/5 function is required in the specification of both axes at an early stage. In Irx3/5 KO hindlimb buds, AER-Fgf8 expression is reduced at the limb bud initiation stage, and Shh location is activated more anteriorly, thus expression of both Fgf8 and Shh is affected before establishment of Shh-Fgf feedback loop.

4.4 Potential interaction between Irx3/5 and AER-FGF signaling

I showed that Irx3/5 KO hindlimb buds are smaller than that of wild-type at E10.5. While other mechanisms may exist (i.e. defects in cell migration), one possibility that matches this observation is the mild outgrowth defect in these mutant hindlimb buds at the initiation stage. Expression of genes important for outgrowth, Fgf10 in the mesenchyme and Fgf8 in the AER, is affected, suggesting a potential role of Irx3/5 in regulating FGF signaling in the developing limb bud.

The change in Irx3/5 expression pattern during early stages of hindlimb bud development also suggests a potential interaction between Irx3/5 and FGF signaling. Irx3/5 are initially expressed throughout anterior limb bud mesenchyme. However, at later stages after AER-Fgf8 activation, their expression is restricted to the proximal region. It is possible that Irx3/5 are also responding to the AER-FGF signaling and downregulated in the distal region of limb mesenchyme which is controlled by the AER-FGF. Irx3/5 may also be a downstream mediator of AER-FGF to inhibit cell death in the proximal limb mesenchyme. Previously, Sun and colleagues showed that in Msx2Cre;Fgf4;Fgf8 conditional double knockout mouse embryos, extensive apoptosis in the limb bud was only detectable in the proximal region (Sun et al., 2002). This region with massive cell death is similar to the expression domain of Irx3/5 at that stage. It would be interesting to examine the expression pattern of Irx3/5 in the Fgf4;Fgf8 deficient limb buds and determine if it overlaps with the extensive apoptosis domain.

During chick cerebellum development, the function of Irx2 is modulated by the FGF8/MAP kinase cascade (Matsumoto et al., 2004). Since the amino acid sequence of Irx5 is most related to Irx2 in mouse (Bosse et al., 2000), they may function through similar mechanisms. Phosphorylation status of Irx3/5 may be regulated by AER-FGF signaling, and thus their functions as an activator or repressor may be altered. Our lab has generated the Prx1Cre;Rosa26EnRIrx3 mouse line which overexpresses a dominant repressor form of Irx3 in limb mesenchyme during embryogenesis. Hindlimbs of these mice were roughly normal

41 although shorter than control littermates, but about 70% of them lacked digit 1 (Rong Mo, unpublished data). These data suggest that digit 1 formation in mouse hindlimbs may require the activator function of Irx3, and the repressor function of Irx3 may be essential for development of proximal elements. Several kinases and phosphatases are expressed in limb mesenchyme induced by AER-FGF signaling (Kawakami et al., 2003). Their activities may be important for regulating Irx3/5 phosphorylation. Western blot using Irx3 antibody in the lysate of developing hindlimb bud tissue consistently showed two specific bands, a lower band with weak signal at the position around 55kD (the predicted molecular weight of Irx3) and a much stronger higher band which may be the phosphorylated Irx3 (Fig 3.3). To explore this hypothesis further, analysis of the phosphorylation status of Irx3/5 and the corresponding activator or repressor function upon the activation of FGF signaling (e.g. the ERK and Akt pathways) should be performed.

4.5 Potential interaction between Irx3/5 and SHH pathway

My data suggest a role of Irx3/5 in regulating Gli3 expression and the location of Shh domain in mouse hindlimb bud. Conversely, Shh and Gli3 can also regulate Irx3/5 expression during embryogenesis. Irx3 expression domain is expanded in the Shh-/- neural tube (Dana Cohen, unpublished data). It is interesting to examine if this expansion can be also observed in the Shh-/- hindlimb buds. According to a recent paper, the regulatory region of Irx3 contains Gli-binding sites, indicating that its expression is regulated by Gli-transcription factors (Vokes et al., 2009). Indeed, RNA in situ hybridization data suggest that Irx3 expression is reduced in the Gli3-/- limb buds (data not shown).

We found that the hindlimb phenotypes in Irx3/5 mutants resemble Gli3 mutants in some aspects. First, although Gli3-/- mutants exhibit polydactyly phenotype, their anterior hindlimb structures are severely affected (digit 1 is missing and tibia is lost or hypoplastic) (Mo et al., 1997; Litingtung et al., 2002), which is similar to the Irx3/5 KO anterior hindlimb defects. In addition, some of the Esr1Cre;Irx3flox/-5-/- mutants with tamoxifen injection at E9.5 exhibited branched digit 1 in their hindlimbs, similar to the Gli3+/- limb phenotype which is likely due to insufficient GLI3R level in the anterior limb mesenchyme (Mo et al., 1997). To study the interaction between Irx3/5 and Gli3, the Irx3/5;Gli3 triple knockout mutant embryos were generated. Strikingly, there were almost no cartilage structures in hindlimbs of the triple knockout embryos at E14.5 (Rong Mo and Niki Vikili, unpublished data). Interestingly, this

42 severe hindlimb phenotype was rescued in Prx1Cre;Irx3flox/-5-/-;Gli3-/- conditional mutants, which exhibited anterior deficiency in distal structures and proximal defects similar to that of Irx3/5 KO embryos (Rong Mo, unpublished data). These data suggest a genetic interaction between Irx3/5 and Gli3, which is crucial for outgrowth and/or pattern formation of mouse hindlimb buds, and this interaction likely happens during prepatterning before the complete elimination of Irx3 in the hindlimb bud by Prx1Cre. To understand molecular mechanisms responsible for the striking hindlimb phenotype in Irx3/5;Gli3 triple mutants, marker analysis for key signaling centers in limb development and genes important for limb bud outgrowth should be performed. It is also necessary to determine at the molecular level whether Irx3/5 and Gli3 function in the same complex or in parallel to regulate downstream target genes.

4.6 A model for Irx3/5 function in mouse hindlimb development

My data and data from our lab support a model for the function of Irx3/5 in mouse hindlimb development. Before and during the hindlimb bud initiation stage, Irx3/5 are expressed throughout the anterior limb mesenchyme. At later stages, their expression becomes restricted to the anterior-proximal region in the developing limb bud. The function of Irx3/5 at early stage is required for prepatterning of the nascent hindlimb bud along the A-P axis prior to Shh activation in the ZPA. They regulate expression of Gli3, Hand2, Tbx2 and probably other prepatterning genes and the location of the Shh domain. It is likely that descendants of Irx3/5-expressing cells give rise to anterior-distal and proximal structures, while Shh responding cells contribute to the complimentary posterior elements. Irx3/5 are also required for patterning the P-D axis in a way that cells expressing these two genes longer and/or at later stages may give rise to the more proximal elements. This is likely achieved through interaction between Irx3/5 and AER-FGF signaling. (Fig 4.3)

Figure 4.1. Summary of Irx3 protein level in conditional KO mutant before and during hindlimb bud development and the corresponding hindlimb cartilage phenotype Red arrowheads and red lines suggest the beginning and end of prepatterning event requiring Irx3/5 function. Black arrowheads indicate the stage of tamoxifen treatment. Blue lines indicate the duration of Irx3 activity in the conditional mutants. Hindlimb phenotypes of embryos with different genotypes and treatments are shown in the right panel.

Figure 4.2. A model for Irx3/5 in mouse hindlimb development The early expression of Irx3/5 in the anterior mesenchyme of initiating limb buds is important for proper expression of prepatterning genes including Gli3, Hand2 (dHand) and Tbx2. Their early function is crucial for the specification of anterior-distal hindlimb structures, while their late expression is involved in the formation of proximal elements. They may also interact with the AER-FGF signaling pathway to pattern the P-D axis. (Red: Irx3/5-expressing cells and their descendants, Blue: Shh-expressing cells and their descendants, PG: pelvic girdle)

5 Future Direction 5.1 Rationale

The vertebrate limb is an excellent model to study pattern formation, cell fate specification and determination, as well as how interactions between signaling pathways control development. Previous studies revealed the importance and mechanisms of key structures and molecules (e.g. ZPA-SHH and AER-FGF) in limb development. However, not much is known about factors and molecular events during limb bud prepatterning before establishment of key signaling centers. Previous studies in Drosophila, Xenopus and Chick illustrated important functions for the Iroquois homeobox genes during embryogenesis. Using the mouse as a model, we discovered novel functions of Irx3/5 during hindlimb prepatterning and proposed a model for these genes in hindlimb development (see 4.6 for details). To further examine our model and understand the molecular mechanism for Irx3/5 during limb prepatterning, several key questions remain to be addressed. Do Irx3/5 descendants give rise to anterior limb structures? What are their downstream targets during limb prepatterning? How do they interact with other key molecules and signaling pathways to regulate their target genes?

Based on my data and data from others in the lab, I hypothesize that Irx3/5-expressing cells give rise to anterior-distal and proximal hindlimb elements that are lost and affected in the double knockout mutant. As transcription factors, Irx3/5 may function as both activators and repressors, determined by their phosphorylation status, which may be regulated by AER-FGFs. They form complexes with other transcription factors important for hindlimb development, probably including Pitx1, Tbx4, Gli3 and Hox proteins, to activate or repress downstream target genes involved in pattern formation, cell survival, differentiation and cell migration.

5.2 Specific Aims

5.2.1 Fate mapping of Irx3/5-expressing cells may reveal the origin of anterior hindlimb structures

My data suggest that Irx3/5-expressing cells at different stages during hindlimb development may contribute to different structures along the P-D axis (see 4.1 for details). To examine this

46 hypothesis and determine if Irx3/5-expressing cells can give rise to the anterior limb structures, genetic fate mapping of Irx3/5 descendants is necessary.

The strategy for our genetic fate mapping of Irx3/5-expressing cells is the same as used previously (Ahn et al., 2004; Harfe et al., 2004). The two targeting vectors I generated, Irx5::nlsCre and Irx5::CreERT2, can be used to generate transgenic mouse strains. By crossing these Cre lines with Rosa26::LacZ mice (Soriano et al., 1999), transgenic embryos (Irx5nlsCre;Rosa26LacZ and Irx5CreERT2;Rosa26LacZ) can be obtained and used for subsequent analysis. In Irx5nlsCre;Rosa26LacZ embryos, Cre is only expressed in Irx5- expressing cells and removes the floxed stop cassette upstream of LacZ gene. Thus, it is expected that at E14.5, the pelvis, tibia, digit1 and possibly part of digit 2 will all be LacZ positive. This result can prove that Irx5-expressing cells before and during hindlimb bud development give rise to the anterior-distal and proximal elements that are affected in the Irx3/5 KO hindlimbs. To identify descendants of Irx5-expressing cells at different stages during hindlimb bud development, Irx5CreERT2;Rosa26LacZ embryos can be treated with tamoxifen at different stages and stained with X-gal at E14.5. Since the activity of CreERT2, an inducible Cre recombinase, can be detected in the nucleus within 6hr and persists for about 36hr with the peak activity at ~24hr following single tamoxifen injection (Hayashi et al., 2002), LacZ expression can label cells that express Irx5 about 24hr after tamoxifen treatment. According to our data in conditional mutants, we expect that early tamoxifen injection (i.e. at and prior to E8.5) will result in a similar pattern to Irx5nlsCre;Rosa26LacZ embryos after X-gal staining at E14.5, whereas injection at a later stage (i.e. E9.5) may label the tibia, femur and pelvis, and injection at even later stage (i.e. E10.5) probably only label the femur and the pelvis. These data would reveal whether early Irx5-expressing cells contribute to both proximal and distal hindlimb structures and late Irx5-expressing cells only give rise to proximal elements. (Fig 5.1)

5.2.2 Determine transcriptional functions of Irx3/5 in mouse hindlimb development and their downstream target genes

As transcription factors, Irx3/5 may function as activators and/or repressors. To understand the mechanism underlying hindlimb phenotypes in Irx3/5 KO mutants and how Irx3 and 5 regulate their downstream targets, it is important to determine whether they mainly act as transcriptional activators and/or repressors during mouse hindlimb development. Our lab has generated a Rosa26EnRIrx3 mouse strain. In the presence of Cre, a dominant repressor form of Irx3

(EnRIrx3) will be expressed under control of the endogenous Rosa promoter. If Irx3 acts mainly as a transcriptional repressor during prepatterning, then Rosa26EnRIrx3 overexpression in initiating hindlimb buds should rescue the Irx3/5 KO phenotype. To examine this hypothesis, Esr1Cre;Irx3/5 KO;Rosa26EnRIrx3 mutant embryos will be generated and EnRIrx3 expression will be activated prior to prepatterning by tamoxifen treatment. Their hindlimb phenotypes will be assessed by in situ hybridization of prepatterning genes (i.e. Gli3, Hand2) in mutant hindlimb buds at E9.75-E10.25, and the morphology of mutant hindlimbs at later stages will be analyzed (e.g. if anterior structures are rescued at E14.5).

To determine downstream gene targets of Irx3/5, I plan to carry out a genome-wide microarray analysis and compare expression profiles between wild-type and Irx3/5 KO hindlimb bud tissues at prepatterning stage. Candidate gene targets will be validated by quantitative PCR. Not only will this study reveal potential targets of Irx 3/5 but this will also provide insight as to the gene expression profile during limb bud prepatterning. Depending on results from the above future experiment, I will focus on genes that are upregulated in mutants if Irx3 functions predominantly as a repressor or downregulated if it acts as an activator. Promoter regions of these genes will be analyzed to determine if potential Irx homeodomain binding sites exist. Chromatin immunoprecipitation will be performed to determine whether these are direct targets of Irx3/5.

5.2.3 Determine protein-protein interactions between Irx3/5 and other key factors in hindlimb development

Our lab has generated an Irx3-3M6H mouse line, which containing 3-Myc and 6-His motifs in the C-terminal of Irx3 protein (Niki Vikili, unpublished data). To determine protein binding partners of Irx3/5 for limb development, especially transcription factors (e.g. Pitx1/2, Tbx2/3/4/5, Gli3, 5’ Hoxd etc.) in vivo, I will first isolate Irx3-containing complexes by affinity purification (AP) with antibodies against Myc, His and Irx3 in hindlimb bud lysates from Irx3- 3M6H mouse embryos and determine purification efficacy. Comparison of each AP sample including negative controls such as lysates from wild-type limb buds will be performed by SDS- PAGE. Western blot with antibodies against candidate proteins (e.g. Pitx1/2, Tbx2/3/4/5, Gli3, 5’ Hoxd etc.) will also be performed. Ultimately, tandem mass spectrometry (MS) will be utilized to determine composition of complexes in order to identify Irx3 interacting proteins. Verified Irx3 interacting proteins will be analyzed by co-IP to determine whether interactions are direct or indirect.

5.2.4 Determine interactions between Irx3/5 and SHH, FGF pathways

The interesting hindlimb phenotypes in Irx3/5;Gli3 triple knockout and Irx3/5 KO;Shh+/- mutant embryos suggest potential genetic interactions between Irx3/5 and SHH pathways. In order to understand the underlying mechanism, marker analysis should be carried out in these mutants. Based on phenotypes of Irx3/5;Gli3 triple mutant hindlimbs, I predict that Shh and Fgf8 expression will be disrupted in mutant hindlimb buds. Since this interaction is likely to happen during prepatterning, genes involved in Shh and AER-Fgf8 activation (prepatterning genes, Tbx4, Pitx1, Fgf10, etc), should also be examined at hindlimb bud initiation stage. On the other hand, the Irx3/5 KO hindlimb phenotype is partially rescued in Irx3/5 KO;Shh+/-. To explain this phenomenon, expression of Shh and Gli3 should be determined after Shh activation in hindlimb buds. It is possible that the Shh location is still anteriorly shifted, but the protein level is reduced, and GLI3R level is increased comparing to Irx3/5 KO hindlimb buds. As a consequence, expression domains of Shh downstream targets such as Gli1 and Ptc1 and some Hox genes in the Irx3/5 KO;Shh+/- hindlimb buds will likely be smaller than that of Irx3/5 KO mutant, thus the A- P patterning in Irx3/5 KO;Shh+/- hindlimbs is restored to some extent.

As discussed in 4.4, the phosphorylation status of Irx3/5 may be modulated by FGF signals from the AER. To test this hypothesis, first, western blot analysis of Irx3 and Irx5 in lysates from wild-type hindlimb buds should be performed carefully. Phosphatase can be added into lysates, and western blot of Irx3 and Irx5 using the treated lysates can confirm the band positions of their phosphorylated and non-phosphorylated forms. Secondly, to determine whether AER-FGF signals regulate phosphorylation of Irx3/5, one approach is to test the ratio of phosphorylated to non-phosphorylated (P/NP) Irx3/5 protein level in AER-Fgf deficient (i.e. Msx2-Cre,Fgf9;Fgf8 DKO) limb buds. Another approach is to examine the P/NP ratio of Irx3/5 in the hindlimb bud tissue before and after Fgf8 activation in the AER. LPM tissues of the hindlimb field from 26- somite stage to 28-somite stage should be collected as the sample free of AER-Fgf8, and hindlimb buds at E10.5 or later are samples with robust Fgf8 expression in the AER.

Figure 5.1. Results-based prediction for fate-mapping studies in Irx5Cre;R26R and Irx5CreERT2;R26R embryos revealed by X-gal staining Light blue indicates the Irx5-expressing cells at the stage of Cre activation following tamoxifen treatment. Dark blue suggests the predicted patterns of LacZ positive elements in the hindlimbs of Irx5Cre;R26R and Irx5CreERT2;R26R embryos at E14.5.

References

Ahn S, et al. (2004). Dynamic changes in the response of cells to positive hedgehog signaling during mouse limb patterning. Cell. 118:505–516.

Bao Z, et al. (1999). Regulation of chamber-specific gene expression in the developing heart by Irx4. Science. 283:1161-1164.

Barna M, et al. (2005). Gli3 and Plzf cooperate in proximal limb patterning at early stages of limb development. Nature. 436:277-281.

Bellefroid E, et al. (1998). Xiro3 encodes a Xenopus homolog of the Drosophila Iroquois genes and functions in neural specification. EMBOJ 17:191-203.

Berger MF, et al. (2008). Variation in homeodomain DNA-binding revealed by highresolution analysis of sequence preferences. Cell. 133:1266–1276.

Bilioni A, et al. (2005). Iroquois transcription factors recognize a unique motif to mediate transcriptional repression in vivo. Proc Natl Acad Sci USA. 102:14671-14676

Bosse A, et al. (1997). Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech Dev. 69:169-181.

Bosse A, et al. (2000). Identification of a novel mouse Iroquois homeobox gene, Irx5, and chromosomal localization of all members of the mouse Iroquois gene family. Dev Dyn. 218:160- 74.

Burke AC, et al. (1995). Hox genes and the evolution of vertebrate axial morphology. Development. 121:333–46.

Büscher D, et al. (1997). Evidence for genetic control of Sonic hedgehog by Gli3 in mouse limb development. Mech Dev.62:175-82.

Capdevila J, et al. (2001) Patterning mechanisms controlling vertebrate limb development. Annu. Rev. Cell Dev. Biol. 17:87-132.

Cavodeassi F, et al. (2001). The Iroquois family of genes: from body building to neural patterning. Development. 128:2847-2855.

Charité J, et al. (2000). The bHLH transcription factor dHAND controls Sonic hedgehog expression and establishment of the zone of polarizing activity during limb development. Development. 127, 2461-2470.

Chiang C, et al. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature. 383:407–413.

Chiang C, et al. (2001). Manifestation of the limb prepattern: limb development in the absence of sonic hedgehog function. Dev. Biol. 236:421–435.

Cohn MJ, et al. (1997). Hox9 genes and vertebrate limb specification. Nature. 387:97–101.

Crossley PH, et al. (1996). Roles for FGF8 in the induction, initiation, and maintenance of chick limb development. Cell. 84:127–36.

Dambly-Chaudière C, et al. (1992). The determination of sense organs in Drosophila: a search for interacting genes. Int. J. Dev. Biol. 36:85-91.

Davenport TG, et al. (2003). Mammary gland, limb and yolk sac defects in mice lacking Tbx3, the gene mutated in human ulnar mammary syndrome. Development. 130:2263-2273.

Davis CA, et al. (1988). Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev. 2:1736–44.

De la Calle-Mustienes E, et al. (2005). A functional survey of the enhancer activity of conserved non-coding sequences from vertebrate Iroquois cluster gene deserts. Genome Res. 15:1061-1072.

Dudley AT, et al. (2002). A re-examination of proximodistal patterning during vertebrate limb development. Nature. 418:539–544.

Fallon JF, et al. (1994). FGF-2: apical ectodermal ridge growth factor for chick limb development. Science. 264:104–107.

Fernandez-Teran MA, et al. (2000). Role of dHAND in the anterior-posterior polarization of the limb bud: implications for the Sonic hedgehog pathway. Development. 127:2133-2142.

Fernandez-Teran MA, et al. (2006). Birth and Death of Cells in Limb Development: A Mapping Study. Dev. Dyn. 235:2521-2537.

Galli A, et al. (2010). Distinct Roles of Hand2 in Initiating Polarity and Posterior Shh Expression during the Onset of Mouse Limb Bud Development. PLoS Genet. 6:e1000901.

Gibson-Brown JJ, et al. (1996). Evidence of a role for T-box genes in the evolution of limb morphogenesis and the specification of forelimb/hindlimb identity. Mech. Dev. 56, 93-101.

Glavic A, et al. (2002). The homeoprotein Xiro1 is required for midbrain-hindbrain boundary formation. Development. 129:1069-1021.

Glavic A, et al. (2004). Interplay between Notch signaling and the homeoprotein Xiro1 is required for neural crest induction in Xenopus embryos. Development. 131:347-359.

Gómez-Skarmeta J, et al. (1996). araucan and caupolican, two members of the novel Iroquois complex, encode homeoproteins that control proneural and vein forming genes. Cell. 85:95-105.

Gómez-Skarmeta J, et al. (1998). Xiro, a Xenopus homolog of the Drosophila Iroquois complex genes, controls development at the neural plate. EMBOJ. 17:181-190.

Gómez-Skarmeta J, et al. (2001). The Wnt-activated Xiro1 gene encodes a repressor that is essential for neural development and downregulates Bmp4. Development. 128:551-560.

Gómez-Skarmeta J, et al. (2002). Iroquois genes: genomic organization and function in vertebrate neural development. Curr Opin in Genet & Dev. 2002:12:403–408.

Harfe BD, et al. (2004). Evidence for an expansion-based temporal Shh gradient in specifying vertebrate digit identities. Cell. 118:517–528.

Harrison, RG. (1918). Experiments on the development of the forelimb of Ambystoma, a self- differentiating equipotential system. J. Exp. Zool. 25:413–461.

Hayashi S, et al. (2002). Efficient Recombination in Diverse Tissues by a Tamoxifen-Inducible Form of Cre: A Tool for Temporally Regulated Gene Activation/Inactivation in the Mouse. Dev Biol. 244:305–318.

Hill P, et al. (2009). A SHH-independent regulation of Gli3 is a significant determinant of anteroposterior patterning of the limb bud. Dev Biol. 328:506-16.

Hui C, et al. (1993). A mouse model of Greig cephalo-polysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene. Nat Genet. 3:241–246.

Itoh M, et al. (2002). A role for Iro1 and Iro7 in the establishment of anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain boundary. Development. 129:2317-2327.

Kawakami Y, et al. (2001). WNT signals control FGF-dependent limb initiation and AER induction in the chick embryo. Cell. 104:891–900.

Kehl B, et al. (1998). mirror, a Drosophila homeobox gene in the Iroquois complex, is required for sensory organ and alula formation. Development. 125:1217-1227.

Koussoulakos, S. (2004). Vertebrate limb development: from Harrison's limb disk transplantations to targeted disruption of Hox genes. Anat. Embryol. 209:93-105.

Kraus P, et al. (2001). Some distal limb structures develop in mice lacking Sonic hedgehog signaling. Mech. Dev. 100:45–58.

Lanctôt C, et al. (1997). The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development. 124:2807-2817.

Leyns L, et al. (1996). Iroquois: a prepattern gene that controls the formation of bristles on the thorax of Drosophila. Mech. Dev. 59:63-72.

Litingtung Y, et al. (2002). Shh and Gli3 are dispensable for limb skeleton formation but regulate digit number and identity. Nature. 418:979–983.

Logan M, et al. (2002). Expression of Cre Recombinase in the Developing Mouse Limb Bud Driven by a Prxl Enhancer. Genesis. 33:77–80.

Logan M. (2003). Finger or toe: the molecular basis of limb identity. Development. 130:6401- 6410.

Marshall H, et al. (1996). Retinoids and Hox genes. FASEB J. 10:969–78.

Mao J, et al. (2009). Fgf-Dependent Etv4/5 Activity Is Required for Posterior Restriction of Sonic hedgehog and Promoting Outgrowth of the Vertebrate Limb. Dev Cell. 16:600-606.

Marcil A, et al. (2003). Pitx1 and Pitx2 are required for development of hindlimb buds. Development. 130:45-55.

Mariani FV, et al. (2008). Genetic evidence that FGFs have an instructive role in limb proximal– distal patterning. Nature. 453:401-405.

Martin GR. (1998). The roles of FGFs in the early development of vertebrate limbs. Genes Dev. 12: 1571-1586.

Matsumoto K, et al. (2004). The prepattern transcription factor Irx2, a target of the FGF8/MAP kinase cascade, is involved in cerebellum formation. Nature Neuroscience. 7:605-612.

McGlinn E, et al. (2006). Mechanistic insight into how Shh patterns the vertebrate limb. Curr Opin Genet & Dev. 26:426-432.

McNeill H, et al. (1997). mirror encodes a novel PBX-class homeoprotein that functions in the definition of the dorso-ventral border of the Drosophila eye. Genes Dev. 11:1073-1082.

McPherron AC, et al. (1999). Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat. Genet. 22:260–64.

Mercader N, et al. (2000). Opposing RA and FGF signals control proximodistal vertebrate limb development through regulation of Meis genes. Development. 127:3961-3970.

Michos O, et al. (2004). Gremlin-mediated BMP antagonism induces the epithelial– mesenchymal feedback signaling controlling metanephric kidney and limb organogenesis. Development. 131:3401–3410.

Min H, et al. (1998). Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes Dev. 12:3156–61.

Mo R, et al. (1997). Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development. 124:113-123.

Nagy A. (2000). Cre recombinase: the universal reagent for genome tailoring. Genesis. 26:99– 109.

Netter S, et al. (1998). White+ transgene insertions presenting a dorsal/ventral pattern define a single cluster of homeobox genes that is silenced by the polycomb-group proteins in Drosophila melanogaster. Genetics. 149:257-275.

Niswander L, et al. (1993). FGF-4 replaces the apical ectodermal ridge and directs outgrowth and patterning of the limb. Cell. 75:579–587.

Niswander L, et al. (1994). A positive feedback loop coordinates growth and patterning in the vertebrate limb. Nature. 371:609–612.

Noyes MB, et al. (2008). Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites. Cell. 133:1277–1289.

Ohuchi H, et al. (1997). The mesenchymal factor, FGF10, initiates and maintains the outgrowth of the chick limb bud through interaction with FGF8, an apical ectodermal factor. Development 124:2235–44.

Peters H, et al. (1998). Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev. 12:2735-47.

Plück A. (1996). Conditional mutagenesis in mice: the Cre/loxP recombination system. Int J Exp Pathol. 77:269-78.

Qu S, et al. (1997). Polydactyly and ectopic ZPA formation in Alx-4 mutant mice. Development. 124(20):3999-4008.

Rallis C, et al. (2003). Tbx5 is required for forelimb bud formation and continued outgrowth. Development. 130:2741-2751.

Riddle RD, et al. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell. 75:1401–1416.

Riddle RD, et al. (1995). Induction of the LIM homeobox gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate limb. Cell. 83:631-640.

Rosenquist GC. (1971). The origin and movement of the limb-bud epithelium and mesenchyme in the chick embryo as determined by radioautographic mapping. J. Embryol. Exp. Morphol. 25:85–96.

Saunders JW. (1948). The proximo-distal sequence of origin of limb parts of the chick wing and the role of the ectoderm. J. Exp. Zool. 108:363–404.

Saunders JW, et al. (1968). Ectoderm-mesenchymal interaction in the origins of wing symmetry. In Epithelial-Mesenchymal Interactions, ed. R Fleischmajer, RE Billingham, pp. 289–314. Baltimore: Williams & Wilkins.

Schimmang T, et al. (1992). Expression of the zinc finger gene Gli3 is affected in the morphogenetic mouse mutant extratoes (Xt). Development. 116:799–804.

Searls RL, et al. (1971) The initiation of limb bud outgrowth in the embryonic chick. Dev. Biol. 24:198–213

Sekine K, et al. (1999). Fgf10 is essential for limb and lung formation. Nat. Genet. 21:138–41.

Summerbell D, et al. (1973). Positional information in chick limb morphogenesis. Nature. 244:492–496.

Sun X, et al. (2000). Conditional inactivation of Fgf4 reveals complexity of signaling during limb bud development. Nat Genet. 25:83–86.

Sun X, et al. (2002). Functions of FGF signaling from the apical ectodermal ridge in limb development. Nature. 418:501-508.

Suzuki T, et al. (2004). Tbx Genes Specify Posterior Digit Identity through Shh and BMP Signaling. Dev Cell. 6:43–53.

Tabin C, et al. (2007). Rethinking the proximodistal axis of the vertebrate limb in the molecular era. Genes Dev. 21:1433–1442.

Takahashi I, et al. (1998). Compressive force promotes sox9, type II collagen and aggrecan and inhibits IL-1beta expression resulting in chondrogenesis in mouse embryonic limb bud mesenchymal cells. J Cell Sci. 111:2067-2076.

Takahashi M, et al. (1998). The role of Alx-4 in the establishment of anteroposterior polarity during vertebrate limb development. Development. 125:4417-25. te Welscher P, et al. (2002). Progression of vertebrate limb development through SHH-mediated counteraction of GLI3. Science. 298:827–830. te Welscher P, et al. (2002). Mutual genetic antagonism involving GLI3 and dHAND prepatterns the vertebrate limb bud mesenchyme prior to SHH signaling. Genes Dev. 16:421–426.

Tickle C. (1981). The number of polarizing region cells required to specifiy additional digits in the developing chick wing. Nature. 289:295–298.

Towers M, et al. (2009). Growing models of vertebrate limb development. Development. 136:179-190.

Vogel A, et al. (1996). Involvement of FGF-8 in initiation, outgrowth and patterning of the vertebrate limb. Development. 122:1737–50.

Vokes SA, et al. (2009). A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog-mediated patterning of the mammalian limb. Genes Dev. 22:2651-2663.

Wang B, et al. (2000). Hedgehog-regulated processing of Gli3 produces an anterior/posterior repressor gradient in the developing vertebrate limb. Cell. 100:423–434.

Wang C, et al. (2007). The Shh-independent activator function of the full-length Gli3 protein and its role in vertebrate limb digit patterning. Dev. Biol. 305:460-469.

Wang G, et al. (2001). Irx4 forms an inhibitory complex with the vitamin D and retinoic X receptors to regulate cardiac chamber-specific slow MyHC3 expression. J Biol Chem. 276:28835-41.

Xu X, et al. (1998). Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction. Development. 125:753–65.

Yang Y, et al. (1997). Relationship between dose, distance and time in Sonic Hedgehog- mediated regulation of anteroposterior polarity in the chick limb. Development. 124:4393–4404.

Yonei-Tamura S, et al. (1999). FGF7 and FGF10 directly induce the apical ectodermal ridge in chick embryos. Dev. Biol. 211:133–43.

Zakany J, et al. (2004). A Dual Role for Hox Genes in Limb Anterior-Posterior Asymmetry. Science. 304:1669-1672.

Zeller R, et al. (2009). Vertebrate limb bud development: moving towards integrative analysis of organogenesis. Nat Rev Genet. 10:845-58.

Zhang Z, et al. (2009). FGF-Regulated Etv Genes Are Essential for Repressing Shh Expression in Mouse Limb Buds. Dev Cell. 16:607-613.

Zucker R, et al. (1999). Apoptosis and Morphology in Mouse Embryos by Confocal Laser Scanning Microscopy. Methods. 18:473-480.

Zuniga A, et al. (1999). Signal relay by BMP antagonism controls the SHH/FGF4 feedback loop in vertebrate limb buds. Nature. 401:598–602.