Protein Phosphatase 1 Inhibitor-1 Deficiency Reduces

BASIC RESEARCH www.jasn.org

Protein Phosphatase 1 Inhibitor-1 Deﬁciency Reduces Phosphorylation of Renal NaCl Cotransporter and Causes Arterial Hypotension

† ‡ Nicolas Picard,* Katja Trompf,* Chao-Ling Yang, R. Lance Miller,§ Monique Carrel,* | ‡ Dominique Lofﬁng-Cueni,* Robert A. Fenton, David H. Ellison, and Johannes Lofﬁng*

*Institute of Anatomy, University of Zurich, Zurich, Switzerland; †Paris Cardiovascular Research Center, Institut National de la Santé et de la Recherche Médicale Unit 970, Université Paris-Descartes, Paris, France; ‡Department of Medicine, Oregon Health and Science University, Portland, Oregon; §National Heart Lung Blood Institute, National Institutes of Health, Bethesda, Maryland; and |Department of Biomedicine, Aarhus University, Aarhus, Denmark

ABSTRACT The thiazide-sensitive NaCl cotransporter (NCC) of the renal distal convoluted tubule (DCT) controls ion homeostasis and arterial BP. Loss-of-function mutations of NCC cause renal salt wasting with arterial hypotension (Gitelman syndrome). Conversely, mutations in the NCC-regulating WNK kinases or kelch- like 3 protein cause familial hyperkalemic hypertension. Here, we performed automated sorting of mouse DCTs and microarray analysis for comprehensive identification of novel DCT-enriched gene products, which may potentially regulate DCT and NCC function. This approach identified protein phosphatase 1 inhibitor-1 (I-1) as a DCT-enriched transcript, and immunohistochemistry revealed I-1 expression in mouse and human DCTs and thick ascending limbs. In heterologous expression systems, coexpression of NCC with I-1 increased thiazide-dependent Na+ uptake, whereas RNAi-mediated knockdown of endogenous I-1 reduced NCC phosphorylation. Likewise, levels of phosphorylated NCC decreased by approx- 2 2 imately 50% in I-1 (I-1 / ) knockout mice without changes in total NCC expression. The abundance and phosphorylation of other renal sodium-transporting proteins, including NaPi-IIa,NKCC2,andENaC,did not change, although the abundance of pendrin increased in these mice. The abundance, phosphorylation, 2 2 and subcellular localization of SPAK were similar in wild-type (WT) and I-1 / mice. Compared with WT 2 2 mice, I-1 / mice exhibited significantly lower arterial BP but did not display other metabolic features of NCC dysregulation. Thus, I-1 is a DCT-enriched gene product that controls arterial BP, possibly through regulation of NCC activity.

J Am Soc Nephrol 25: 511–522, 2014. doi: 10.1681/ASN.2012121202

The distal convoluted tubule (DCT) plays a pivotal hormones (e.g., aldosterone, angiotensin II, and va- role in the renal control of ion homeostasis and BP.1 sopressin), and metabolic factors (e.g., alkalosis).1,2 The DCT reabsorbs approximately 10% of the fil- Several human tubulopathies (genetic and ac- tered NaCl load and is significantly involved in re- quired) have been attributed to dysfunctions of nal potassium (K+), calcium, magnesium, and acid/ base handling.1 The thiazide-sensitive NaCl co- Received December 18, 2012. Accepted August 28, 2013. transporter (NCC) is the major apical sodium (Na+) transport pathway in the DCT. In the late DCT, N.P. and K.T. contributed equally to this work. NCC abundance overlaps with the expression of Published online ahead of print. Publication date available at the epithelial sodium channel (ENaC), which is www.jasn.org. the apical sodium reabsorption pathway in the con- Correspondence: Prof. Johannes Loffing, University of Zurich, necting tubule and collecting duct. NCC activity and Institute of Anatomy, Winterthurerstrasse 190, CH-8057 Zurich, hence, DCT salt transport are regulated by a variety Switzerland. Email: johannes.loffi[email protected] of factors, including dietary ion intake, plasma Copyright © 2014 by the American Society of Nephrology

J Am Soc Nephrol 25: 511–522, 2014 ISSN : 1046-6673/2503-511 511 BASIC RESEARCH www.jasn.org the DCT. Loss-of-function mutations of NCC (Gitelman ENaC-positive late DCTs (Figure 1, A and B). Kidneys of these syndrome) cause renal salt wasting with hypotension, hypoka- mice were digested with collagenase and processed for COPAS lemic alkalosis, and hypocalciuria,3 whereas increased NCC as described in Concise Methods. Fluorescent emission and activity because of mutations within the NCC-regulating time of flight (as an indicator of tubule size) for each tubule with-no-lysine kinase 1 (WNK1) or WNK4 (familial hyper- fragment were plotted (Figure 1C). A selection window for kalemic hypertension) are associated with severe salt-sensitive sorting was set to collect three separate fractions, namely hypertension, hyperkalemia, metabolic acidosis, and hypercal- EGFP-positive tubules (EGFP+), EGFP-negative tubules 2 ciuria.4 Increased NCC expression has been linked to renal Na+ (EGFP ), and all types of tubules (ALL) (Figure 1C). Subse- retention in liver cirrhosis,5 diabetes mellitus,6 b-adrenergic quent analysis of gene expression and protein abundance stimulation,7 and immunosuppressive treatment.8 The confirmed a strong enrichment of DCT cells in the EGFP+ clinical significance of the DCT is also emphasized by clinical samples (Figure 1, D and E). The DCT-specificNCCwas trials that confirmed the DCT as an important target for an- highly enriched in the EGFP+ samples compared with all tu- tihypertensive therapy.9 bules, whereas markers for proximal tubules (sodium-dependent The identification of the WNKs as regulators of NCC4 was phosphate cotransporter IIa [NaPi-IIa]), thick ascending key for our current understanding of the molecular mecha- limbs (sodium-potassium-2-chloride cotransporter-2 nisms that control NCC. WNK1 and WNK4 are serine/ [NKCC2]), and connecting tubules and collecting ducts threonine kinases that interact in a complex cascade with the (AQP2) were almost absent from the EGFP+ fraction. The STE20-related proline-alanine-rich kinase (SPAK) to regulate weak band for bENaC (Figure 1E) likely relates to slight con- NCC phosphorylation (e.g., Thr44, Thr53, Thr58, and Ser71 taminations of early DCT samples, with attached late DCTs in mouse NCC) and finally, activity.8,10–12 In addition to the expressing bENaC.27 WNK–SPAK pathway, several other proteins were identified To identify DCT-enriched gene products, we performed 2 to control NCC, including parvalbumin (PV),13 serum and comparative transcriptome analysis of sorted EGFP+,EGFP , glucocorticoid-inducible kinase Sgk1, ubiquitin ligase and ALL fractions using Whole Mouse Genome Microarrays 2 Nedd4–2,14–16 kelch-like 3 (KLHL3),17,18 cullin 3,17,18 and (Agilent Technologies). EGFP+/ALL and ALL/EGFP expres- protein phosphatase (PP) 4.19 sion ratios were determined for each gene product. The known Remarkably, several of the above listed regulatory proteins DCT markers PV,27 transient receptor potential-melastatin 6 are highly abundant in the DCT (e.g.,WNK4,KS-WNK1, (TRPM6),28 and NCC29 are strongly enriched in EGFP+ samples 2 SPAK, PV, and KLHL3). Therefore, we hypothesized that the but absent from the EGFP samples (Supplemental Table 1). DCT may express a particular set of DCT-enriched gene prod- In contrast, gene expression for proximal tubule markers, ucts, of which at least some participate in the regulation of such as aquaporin-1, NaPi-IIa, and megalin, was almost ab- NCC-mediated sodium absorption. Encouraged by previous sent in the EGFP+ fraction compared with the ALL tubule gene expression analysis on freehand-isolated renal tubules in sample (Supplemental Table 1). To define DCT-enriched 2 the works by Chabardès-Garonne et al.,20 Cheval et al.,21 and genes, the EGFP+/EGFP ratio was calculated for each gene. Pradervand et al.,22 we aimed at identifying DCT-enriched The 100 genes with the most prominent DCTenrichment are gene products using a transcriptomic approach. We used com- presented in Supplemental Table 2. plex object parametric analysis and sorting (COPAS) of renal Among these genes, we found known regulators of NCC, 2 tubules, which was developed by Miller et al.,23 to isolate DCTs such as PV,13 KLHL3,17,18 and WNK1,30 with EGFP+/EGFP on a large scale. Among others, we identified the PP1 inhibitor- ratios of 935, 36, and 35, respectively (Supplemental Table 2). 1 (I-1) to be highly enriched in the DCT. I-1 is encoded by the Although not among the first 100 gene products, WNK4 Ppp1r1a gene and forms a small, 171-aa-long cytosolic pro- and SPAK are also significantly enriched in the EGFP+ versus 2 tein24 that was the first identified endogenous inhibitor of EGFP fraction (ratios of 22 and 13, respectively). We then PP1.25 Here we show that I-1 affects the phosphorylation of analyzed the list specifically for gene products that may interact NCC in vitro and in vivo. I-1 deficiency reduces NCC phos- with or counterbalance the action of these kinases. In this re- 2 phorylation and lowers arterial BP in mice. gard, I-1, which is markedly enriched (EGFP+/EGFP ratio of 47) in DCT, was found to be an interesting candidate.

RESULTS I-1 Is Localized in the DCT and Thick Ascending Limb Immunoblotting (IB) with an I-1 antibody confirmed the Identification of DCT-Enriched Genes expression of I-1 at the protein level in kidneys of wild-type 2 2 For large-scale isolation of mouse DCTs by COPAS, we used a (WT) but not I-1 / mice (Figure 2A). The specific band of transgenic mouse model expressing the enhanced green the expected size of 28 kDa was very strong in sorted EGFP+ 2 fluorescent protein (EGFP) under the control of the PV tubules of WTmice, weak in EGFP tubules, and moderate in promoter (PV-EGFP).26 Immunofluorescent labeling of kid- all tubule samples consistent with a significant enrichment of ney cryosections from these mice confirmed the orthotopic I-1 in DCTs (Figure 2B). Immunohistochemistry (IHC) re- expression of EGFP in the PV-positive early DCTs but not the vealed several I-1–positive renal tubules in the renal cortex of

512 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 www.jasn.org BASIC RESEARCH

2 2 WT but not I-1 / mice (Figure 2C). Detailed analysis of consecutive cryosections stained with antibodies against I-1, NCC, and calbindin D28k (CB28K) showed that I-1 protein is highly abundant in the cytoplasm of NCC- and CB28K-positive DCT cells. I-1isalsoabundantintheprecedingcortical (Figure 2D) and medullary thick ascending limb (TAL) (not shown). A similar distribution pattern was revealed in human kidneys (Supplemental Figure 1).

I-1 Regulates NCC Phosphorylation To test the possible role of I-1 in controlling NCC phosphorylation, I-1 RNA interfer- ence knockdown experiments were performed in human embryonic kidney (HEK) cells stably expressing NCC8 (Figure 3A). We first showed that HEK cells exhibit endogenous I-1 and its target PP1. Knock- down of I-1 by small interfering RNA substantially reduced the abundance of NCC phosphorylated at Thr53 but not the total abundance of NCC. These results suggest that I-1 is part of a novel pathway controlling NCC phosphorylation. Totest for functional effects, we injected Xenopus oocytes with cRNAs encoding NCC together with PP1a, the catalytic subunit of PP1, or a constitutively active variant of I-1 (T35D).31 I-1 (T35D) substantially increased 22Na uptake (Figure 3B). PP1a slightly reduced 22Na uptake, but the differences did not reach statistical significance. The heterologous overexpression of PP1a may not have been sufficient to overcome the known high activity of endogenous PP1 in the oocyte.32 To confirm that I-1 can exert similar effects in vivo, we analyzed NCC phosphor- 2 2 ylation in kidneys of WT and I-1 / mice using antibodies against total NCC and

tubes in the right panel. (D) NCC gene expression levels were assessed by real-time PCR 2 Figure 1. COPAS allows efficient isolation of EGFP-expressing DCTs. (A and B) for EGFP+,EGFP , and ALL tubules samples Representative immunostainings of renal cryosections from PV-EGFP mice stained for (n=4 mice). (E) Immunoblots of EGFP+ tubules (A) NCC or (B) bENaC. The EGFP signal colocalizes with NCC-positive early DCT (400 tubules/lane) and kidney lysates detect- (DCT1–D1) but not ENaC-positive late DCT (DCT2–D2), and ENaC-positive con- ing NCC, bENaC, and other nephron seg- necting tubules (CNs). Arrows indicate the transitions (A) from TAL (T) to D1 and (B) ments markers (i.e., NaPi-IIa, proximal tubule; from D1 to D2. (C) EGFP+ tubules were sorted using COPAS. Fluorescent emission NKCC2, thick ascending limb; AQP2, con- and relative size (measured by an axial light loss detector and called time of flight) necting tubule/collecting duct) confirmed the were measured for each tubular segment from the tubular suspension. A selection strong enrichment of NCC-positive DCTs in 2 window for sorting was set to collect EGFP+ (green), EGFP (red), or ALL (blue) tu- EGFP+ tubules. GAPDH, glyceraldehyde-3- bules. Representative pellets for sorted 400 tubules for each fraction are shown in phosphate dehydrogenase.

J Am Soc Nephrol 25: 511–522, 2014 I-1 Controls NCC Phosphorylation 513 BASIC RESEARCH www.jasn.org

2 2 I-1 / Mice Manifest Features of Mild NCC Deficiency 2 2 To determine whether I-1 / mice exhibit metabolic features suggesting NCC dysfunction, we performed metabolic studies. On standard diet, blood ion concentrations, blood pH, blood bicarbonate, and urinary ion excretion rates were similar to the values in WTmice (Tables 1 and 2). Likewise, plasma aldosterone levels and urinary aldosterone excretion were sim- 2 2 2 2 ilar for WT and I-1 / mice. Even on a low Na+ diet, I-1 / mice could rapidly reduce their urinary Na+ excretion (Figure 4B), and urinary ion and aldosterone excretion did not differ between genotypes, even after 14 days of Na+ restriction (Table 2). Nevertheless, on both standard and low Na+ diets, I-1– deficient mice tended to have lower plasma K+ levels than 2 2 WT mice. NCC / mice must be challenged with dietary K+ deprivation to exhibit frank hypokalemia.34 Therefore, we fed 2 2 WT and I-1 / mice a low K+ diet (0.05% K+) for 4 days. In 2 2 2 2 contrast to the NCC / mice,34 I-1 / mice were able to reduce urinary K+ excretion similar to WT mice (Figure 4C). 2 2 Plasma K+ values remained lower in I-1 / than WTmice, but differences still did not reach statistical significance (Figure 4D). To further test for the in vivo activity of NCC, we 2 2 performed a hydrochlorothiazide (HCTZ) test. WT and I-1 / mice were injected with either vehicle or HCTZ; urinary Na+ excretion was measured for the subsequent 6 hours and expressed as the differences between thiazide- and vehicle-induced natriuresis. Statistical differences between genotypes were not detected on either standard or low Na+ diet (Figure 4E). Never- + 2/2 Figure 2. I-1 is highly abundant in mouse DCT and TAL. (A) theless, on low Na diet, I-1 mice had a tendency for a Immunoblot analysis for I-1 in kidney and brain lysates from WT decreased HCTZ response (P=0.08 unpaired t test, WT versus 2 2 2 2 and I-1 / mice. A band of the expected size (28 kD) is detected I-1 / ). 2 2 in kidney and brain of WT mice but not I-1 / mice. Actin is used 2 2 as a loading control. (B) Immunoblot analysis of COPAS-sorted Compensatory Upregulation of Pendrin in I-1 / Mice tubules (400 tubules for each lane) for the nonselected (all tu- 2 To test whether upregulation of other ion transport pathways bules), EGFP ,andEGFP+ tubule fractions shows significant + may compensate for reduced NCC phosphorylation and enrichment of I-1 in the EGFP tubules. (C) Immunohistochem- + 2 2 activity, we analyzed the abundance of several Na transport- istry reveals I-1 in kidney tubules of WT but not I-1 / mice. (D) Immunostaining of consecutive cryosections from WT mice shows ing proteins expressed along the nephron (Figure 4F, Supple- a cytoplasmic I-1 localization in NCC- and CB28K-positive early mental Table 3). The abundance of the NaPi-IIa of proximal DCTs (D1; no or weak CB28K) and late DCTs (D2; strong CB28K) tubules, the NKCC2 of thick ascending limbs, and the ENaC and in the NCC-negative TAL (T). Scale bars, ;20 mm. and the sodium-driven bicarbonate-chloride exchanger of principal and intercalated cells in the renal collecting system (i.e., connecting tubule and collecting duct) were not altered 2 2 in kidneys of WT versus I-1 / mice. However, pendrin, NCC phosphorylated at Thr53, Thr58, Ser71, and Ser89.33 the apical bicarbonate-chloride exchanger in nontype A in- Similar to the results in HEK293 cells, total NCC abundance tercalated cells, was found to be more abundant in kidneys of 2 2 2 2 was similar in WTand I-1 / kidneys, whereas the phosphor- I-1 / than WT mice (Figure 4F, Supplemental Table 3). ylation of NCC at all analyzed phosphorylation sites was significantly reduced (Figure 3, C and D). I-1 Deficiency Does Not Affect NKCC2 Phosphorylation Because I-1 is also expressed in the TAL and because NKCC2 is 2 2 Lower BP in I-1 / Mice homologous to NCC, we looked more specifically to the effect NCC plays an important role in BP regulation, which is of I-1 deficiency on NKCC2 in an additional set of mice. By IB evidenced by high or low BP in mice with activated or suppressed and IHC, we could not detect any significant differences 2 2 NCC, respectively.2,11,12 Therefore, we hypothesized that I-1 de- between WT and I-1 / mice for the abundance and subcel- 2 2 ficiency should lower BP. Indeed, I-1 / mice have significantly lular localization of total NKCC2 and phospho-NKCC2 (Fig- lower systolic BP than WT mice on both standard (0.8% Na+) ure 5, A–C). To further exclude any downregulation of and low Na+ (0.05% Na+) diets (Figure 4A). NKCC2, we performed a furosemide test. Interestingly, the

514 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 www.jasn.org BASIC RESEARCH

I-1 Deficiency Does Not Affect SPAK Phosphorylation SPAK is thought to represent the final step in the WNK pathway controlling NCC phosphorylation. To test whether I-1 may interfere with the WNK/SPAK pathway, we analyzed the abundance, phosphorylation, and subcellular localization of SPAK in 2 2 kidneys of WT and I-1 / mice using antibodies directed against total SPAK and SPAK phosphorylated at Ser373. Neither the total abundance nor the phosphorylation level of SPAK was different between 2 2 WT and I-1 / mice, which were assessed by IB and IHC (Figure 6). Likewise, mRNA expression of the upstream SPAK regulators WNK4 and kidney-specificWNK1 were not different between genotypes (Supplemental Table 4).

DISCUSSION

The shortness and hidden localization of the DCT in the renal labyrinth complicate analyses of DCT function and underlying regulatory mechanisms. Using freehand microdissection, previous studies estab- Figure 3. I-1 regulates NCC activity and phosphorylation. (A) Immunoblot analysis of lished transcriptome data for the renal HEK293 cells with tetracycline-inducible NCC overexpression (Flp-InNCC) reveals 21,22 endogenous expression of I-1 and PP1a. Small interfering RNA (siRNA) knockdown of I- distal convolution, but the gradual 1 (I-1 siRNA) reduces endogenous I-1 protein abundance compared with no siRNA– transition from the DCT to the connecting and control siRNA–treated cells. Although the reduced I-1 abundance does not affect tubule makes it almost impossible to pre- PP1a and total NCC abundance, it decreases NCC phosphorylation on threonine 53 cisely define the border between these (pT53 NCC). (B) Thiazide-sensitive 22Na uptake was measured in oocytes over- functionally different segments. Moreover, expressing NCC. Coexpression of NCC with the catalytic subunit of PP1 (PP1a) does the low yield of microdissection requires not significantly reduce thiazide-sensitive 22Na uptake. Coexpression of NCC with amplification of obtained cDNAs, which 22 constitutively active I-1 (I-1 T35D) profoundly stimulates thiazide-sensitive Na up- bears the risk of increased false-positive take. Together, the data suggest that enhancing the basal level of phosphatase ac- and false-negative results. In the present tivity in the oocyte has little effect but that inhibiting this activity has a substantial study, we combined the early DCT specific- effect; n=3 for each condition (mean6SEM); significance (by ANOVA) is shown 2/2 ity of PV-EGFP expression with the high (*P,0.05). (C) Immunoblot analysis of kidney membrane fractions from WT and I-1 mice was used to quantify the abundance of total NCC and NCC phosphorylated at yield of COPAS to obtain rather pure threonine 53 (pT53 NCC), threonine 58 (pT58 NCC), serine 71 (pS71 NCC), and serine DCT preparations on a large scale without 89 (pS89 NCC). (D) Densitometric analysis from NCC immunoblots that were nor- the need for any further cDNA amplifica- 2 2 malized to b-actin protein levels and expressed for I-1 / mice in percent of control. tion. IB and transcriptomic analysis con- Mean6SEM (n=7). Statistical significance was calculated with unpaired t test firmedthehighdegreeofpurityofthe (*P,0.05; ***P,0.001). isolated DCT samples. Differential hybrid- 2 ization and analysis of ALL, EGFP ,and EGFP+ tubules further confirmed the reli- 2 2 natriuretic response to furosemide was even increased in I-1 / ability of our approach and permitted us to identify DCT- 2 2 mice (Figure 5D). Because I-1 / mice have a lowered BPand an enriched gene products. As expected, the known DCT-specific unchanged NKCC2 phosphorylation, this response is unlikely genes NCC, TRPM6, and PV showed the most significant en- related to an increased NKCC2 function, but rather, it is richment in our DCT preparations. Other than these three 2 2 consistent with the reduced NCC activity in I-1 / mice, strongly enriched genes, about 300 other genes were found to which perhaps lowered the capacity of the DCT to absorb be more than 10-fold enriched in the DCT. Among these DCT- the furosemide-induced sodium load. enriched genes are the known NCC regulators SPAK,35

J Am Soc Nephrol 25: 511–522, 2014 I-1 Controls NCC Phosphorylation 515 BASIC RESEARCH www.jasn.org

WNK4,36 KS-WNK1,30 and KLHL-3.17,18 Interestingly, several of the other DCT- enriched genes are known to be involved in the control of cell growth and differentia- tion during development (e.g., Sfrp1, Sox9, Lrrn1, Prox1, and Sall3). The high expression levels of these developmental genes in the adult DCT may relate to the particular structural plasticity of the DCT to growth stimuli.37 NCC is activated by phosphorylation through the WNK–SPAK pathway.35 Usu- ally, the activity of kinases is counterbal- anced by phosphatases. Prior studies sug- gested that PP4 regulates NCC.19 Here we reportthatPP1,PP2,andPP3arealso highly expressed in DCT cells. The specificity and catalytic activity of phosphatases are modulated by the interaction with specific regulatory and inhibitory subunits.38 In this study, we identified the I-1 to be highly enriched in the mouse and human DCTs as well as the TAL. The latter is consistent with previous data that showed a localization of I-1 in the medullary and cortical TALs.39,40 I-1 is also expressed in brain, skeletal muscle, and heart, where it is thought to contribute to synaptic plasticity,41 muscle glycogen metabolism,42 and cardiac contractility and excitability.24 Us- ing three independent experimental sys- + Figure 4. I-1 deficiency lowers arterial blood pressure but has little or no effect on Na , tems, we now provide evidence that I-1 and K+ diet adaptation, HCTZ response, and renal ion transporter abundances. (A) 2/2 also regulates renal NCC function. In Systolic BP was measured with the tail-cuff method in WT and I-1 male and female Xenopus laevis oocytes, coexpression of I-1 mice on standard (0.3% Na+; open square) or low (0.05% Na+; filled circle) Na+ diets. and NCC profoundly increases thiazide- Measurements were done for 4 consecutive days. Each data point corresponds to an + average of 4 days. Statistical analysis was performed using two-way ANOVA test for sensitive Na uptake, whereas knockdown fi each dietary period (variables were the genotype and time). *P,0.05; **P,0.01 (n=10 of I-1 in HEK293 cells as well as I-1 de - 2 2 per group). (B) Urine Na+ excretion in WT and I-1 / mice before and after the switch ciency in mice led to a pronounced reduc- from standard to low Na+ diet. No statistical difference was found between the two tion in NCC phosphorylation. The similarity groups (n=6 per group). Urine Na+ excretion was normalized to creatinine excretion. of the data in the HEK293 cells in vitro and 2 2 (C) Urine K+ excretion in WT and I-1 / mice before and after the switch from standard the kidney in vivo indicates that the re- (0.8% K+) to low (0.05% K+)K+ diet. No statistical differences were found between the duced NCC phosphorylation is a cell- + two groups (n=8 per group). Urine K excretion was normalized to creatinine excre- autonomous effect of I-1 deficiency. We + + tion. (D) Plasma K was measured after 4 days on low K diet by blood sampling from have recently shown that ex vivo incubation 6 2/2 + the heart. Values are means SEM. I-1 mice had slightly lower plasma K values of DCTs with the PP1 and PP2a inhibitor than WT mice, but a significant statistical difference was not reached (P=0.24, t test; calyculin A drastically increases NCC phos- n=8 per group). (E) Effect of HCTZ injection (50 mg/kg body wt intraperitoneally) on 2 2 33 urinary Na+ excretion in WT (open bars) and I-1 / (filled bars) mice that were kept for phorylation. Given that I-1 is a rather fi 14 days on either standard or low Na+ diet. Urines were collected for 6 hours after speci c inhibitor of PP1 with no effects injection of either vehicle or HCTZ. The thiazide-sensitive component of urinary Na+ excretion is presented as the difference between HCTZ- and vehicle-induced natriuresis within the first 6 hours postinjection. Data are shown as mean6SEM. No sta- 2 2 tistically significant difference between WT and I-1 / was found (P=0.79 for standard analysis was normalized to b-actin protein Na+; P=0.08 for low Na+ diet, t test; n=8–9 mice in each group). (F) Immunoblot levels for each blot (Supplemental Tables 1–4). 2 2 analysis of kidney membrane fractions from WT and I-1 / mice showing the abun- Statistical significance was calculated with t test dance of major apical Na+ transporting pathways along the nephron. Densitometric (*P,0.05).

516 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 www.jasn.org BASIC RESEARCH

2 2 Table 1. Physiologic blood parameters in WT and I-1 / littermates on a standard (0.3% Na+) and low Na+ (0.05% Na+) diet Standard Diet Low Na+ Diet Parameter 2 2 2 2 WT I-1 / P Value WT I-1 / P Value pH 7.1560.02 (9) 7.1660.02 (8) NS 7.1560.02 (10) 7.1760.02 (9) NS pCO2 (mmHg) 56.7462.31 (9) 55.1663.72 (8) NS 58.7062.23 (10) 58.1061.75 (9) NS 2 HCO3 (mM) 18.9760.54 (9) 18.7160.71 (8) NS 19.7460.67 (10) 20.4460.63 (9) NS K+ (mM) 3.4060.14 (9) 3.3060.11 (8) NS 3.9860.25 (10) 3.5660.19 (9) NS Na+ (mM) 142.5760.57 (9) 142.2260.52 (8) NS 148.6066.70 (10) 148.8960.54 (9) NS 2 Cl (mM) 106.8661.10 (9) 106.0061.36 (8) NS 112.4060.99 (10) 110.6760.53 (9) NS Ca2+ (mM) 0.7360.06 (9) 0.7360.08 (8) NS 0.7460.06 (10) 0.7060.06 (9) NS Mg2+ (mM) 0.8860.12 (4) 0.8760.03 (4) NS ND ND Aldosterone (ng/L) 402.43635.13 (10) 505.99661.23 (9) NS ND ND Hematocrit (%) 44.760.8 (9) 43.860.8 (8) NS 45.660.9 (10) 46.361.0 (9) NS Values are means6SEM. Statistical signiﬁcance between WT and knockout on the same diet is assessed by unpaired t test. ND, not determined.

2 2 Table 2. Physiologic urinary parameters in WT and I-1 / littermates on a standard (0.3% Na+) and low Na+ (0.05% Na+) diet Standard Diet Low Na+ Diet Parameter 2 2 2 2 WT I-1 / P Value WT I-1 / P Value Urine volume (ml) 1.4460.15 (9) 1.5360.21 (9) NS 1.2660.21 (10) 1.6060.22 (10) NS UNa+/UCreat 28.1961.39 (9) 32.2261.45 (9) NS 1.8361.03 (6) 4.1761.65 (8) NS UK+/UCreat 165.5627.6 (9) 181.8627.2 (9) NS 118.0619.9 (9) 138.2622.4 (10) NS UAldo/UCreat 3.7662.53 (9) 4.2961.11 (9) NS 17.7963.52 (7) 14.9662.53 (10) NS UCa2+/UCreat 0.28960.058 (9) 0.32060.045 (9) NS ND ND Values are means6SEM. Statistical significance between WT and knockout on the same diet is assessed by unpaired t test. U, urinary; Creat, creatinine; Aldo, aldosterone; ND, not determined. on PP2a and PP2b (also called PP3),38 it is tempting to spec- hyperaldosteronism, hypomagnesaemia, and hypocalciuria. 2 2 ulate that the observed effects of I-1 are mediated by PP1. However, I-1 / mice tend to have a reduced thiazide re- Consistent with an involvement of PP1 in NCC regulation, sponse on dietary Na+ restriction and a trend for slightly low- preliminary yeast two-hybrid and coimmunoprecipitation ered plasma K+ concentrations. Moreover, they have a lower data indicated that PP1 physically interacts with NCC (R.A.F., BP on standard and low Na+ diet. As such, the phenotype 2 unpublished observations). In the oocyte expression sys- resembles the one seen in SPAK+/ mice, which also have re- tem, PP1 was shown to also control NKCC1.43 The effect on duced NCC phosphorylation levels and arterial hypotension NKCC1 seemed to be mediated by both direct dephosporyla- without any significant abnormalities for plasma and urine tion of the transporter and dephosphorylation of NKCC1- electrolytes, plasma aldosterone, and thiazide response.46 2 activating SPAK. In our study, we did not test by which mechanism Likewise, NCC+/ mice (D.L.-C., unpublished observation) I-1 controls NCC dephosphorylation, but the unchanged phos- and humans heterozygous for NCC mutations have low 2 2 phorylation levels of SPAK1 in I-1 / mice indicate that I-1 does BP47 without frank Gitelman disease.48 Also, thiazides are not exert its effects through reducing phosphorylation and ac- known to efficiently reduce BP without provoking obvious tivation of the SPAK pathway. extracellular volume depletion in many patients.49 However, Interestingly, although I-1 is also highly abundant in the because I-1 is expressed in heart and arterial vessels, we cannot 2 2 2 2 TAL, I-1 / mice do not show any significant effect on the rule out that the lowered BP in I-1 / mice is of extrarenal phosphorylation levels of NKCC2. The TAL expresses it in origin, although previous studies reported only rather small (if addition to I-1 high levels of another endogenous PP1 inhib- any) effects of I-1 deficiency on heart ejection fraction and no itor named DARPP-32 (Ppp1r1b),39,40 which may compensate effects on aortic contractility.50 2 2 for the loss of I-1 in the TAL. Another reason for the mild phenotype of I-1 / mice I-1 deficiency does not completely abrogate NCC phos- could be rooted in the compensatory upregulation of other phorylation in the kidney. The maintenance of a certain level of ion transporting pathways along the nephron. Previous stud- 2 2 NCC phosphorylation may explain the rather mild phenotype ies suggest that NCC / mice compensate, in part, by acti- 2 2 of the I-1 / mice. In contrast to patients with Gitelman syn- vating the epithelial sodium channel ENaC.51,52 Moreover, 2 2 drome and NCC-deficient mice as well as NCC knock-in NCC / mice exhibit an enhanced abundance of the bicarbonate- mice bearing a Gitelman mutation (Ser707/X)44 and SPAK- chloride cotransporter pendrin,53 which when deleted in 2 2 2 2 deficient mice,45,46 the I-1 / mice have no secondary NCC / mice, led to lethal salt wasting.54 Consistent with the

J Am Soc Nephrol 25: 511–522, 2014 I-1 Controls NCC Phosphorylation 517 BASIC RESEARCH www.jasn.org

vitro and in vivo. Loss of I-1 expression lowers arterial BP without other cardinal features of complete NCC deficiency, such as hypokalemic alkalosis and hypomagnese- mia. As such, I-1 deficiency resembles the phenotype seen in human heterozygotes for NCC mutations, which also have reduced BP,47 but no other symptoms char- acteristic of Gitelman syndrome.48 Because several patients with a full Gitelman phenotype have only one or even no alleles with NCC mutations, it might be interesting to analyze these patients for mutations in I-1 or other identified DCT-enriched genes. Thus, I-1 represents a new gene involved in regulation of NCC and BP that might be affected in hereditary and acquired renal tubulopathies.

Figure 5. I-1 deficiency does not affect NKCC2 abundance and phosphorylation. (A) 2 2 Immunoblot analysis of kidney membrane fractions from WT and I-1 / mice for total CONCISE METHODS NKCC2 and phosphorylated NKCC2 (pNKCC2). (B) Densitometric analysis was normalized to b-actin protein levels. No statistical difference was detected between Animals groups (t test; n=5 per group). (C) Representative immunostainings for NKCC2 and For COPAS sorting, we used adult (10–12 weeks 2/2 pNKCC2 on consecutive cryosections of WT and I-1 mouse kidneys. NKCC2 and old) male and female PV-EGFP transgenic pNKCC2 are found in the apical membrane of the TAL (T). No differences are seen 26 2 2 mice. I-1–deficient mice were a gift from between WT and I-1 / mice. Scale bars, ;20 mm. (D) Effect of furosemide injection P. Greengard.41 Both mouse strains were kept (40 mg/kg body wt intraperitoneally) on urinary Na+ excretion in WT (open bars) and 2 2 I-1 / (filled bars) mice. Urines were collected for 6 hours after injection of either in a homogenetic C57BL/6J background. All vehicle or furosemide. The furosemide-sensitive component of urinary Na+ excretion mice were maintained on a standard rodent is presented as the difference between furosemide- and vehicle-induced natriuresis diet with free access to food and water. For within the first 6 hours postinjection. Data are shown as mean6SEM (n=9 for each diet experiments, mice were kept on semisyn- group). Statistical significance was assessed by t test (*P,0.05). thetic diets (Sniff, Soest, Germany) with either low sodium (0.05% Na+) or low potassium (0.05% K+) concentrations. For the control 2 2 unchanged aldosterone levels in I-1 / mice, we did not detect groups, NaCl or KCl was supplemented to these diets to reach either any evidence for an altered ENaC regulation. However, the pendrin standard sodium (0.3% Na+) or standard potassium (0.8% K+)contents. protein abundance was found to be upregulated, which could For blood sampling and organ harvesting, mice were anesthetized with a have contributed to the compensated phenotype. mixture of Ketamine (Narketan 10, 80 mg/kg body wt; Chassot, Belp, The inhibitory action of I-1 on PP1 depends on protein Switzerland)andXylazine(Rompun,33mg/kgbodywt;Bayer,Lever- kinase A-mediated phosphorylation of I-1 at a threonine kusen, Germany). Daily urine sampling on different diets was performed residue at position 35.24,38 The DCT is target for several hor- in metabolic cages (Tecniplast, Buguggiate, Italy). Mice were kept on the mones that use cAMP and protein kinase A as signaling mol- diets for at least 14 days. All animal experiments were performed ac- ecules.55 Future work will have to establish how much I-1 cording to Swiss Animal Welfare laws, with approval of the local participates in the hormonal control of NCC and which mo- veterinary authority (Kantonales Veterinäramt Zürich). lecular mechanism might be involved. Moreover, it remains elusive if I-1 in the kidney also regulates the function of pro- COPAS Sorting and Microarray Analysis of Sorted DCT teins other than NCC. Supplemental Materials and Methods has a detailed description of the In conclusion, our study provides proof of concept that the protocol. COPAS sorting was adapted from the work by Miller et al.23 search for DCT-enriched genes may reveal novel regulators of The microarray data were deposited in the National Center for Biotech- DCTand NCC function, although enrichment in the DCT does nology Information Gene Expression Omnibus database (accession not necessarily mean that the gene product is of major number GSE51935). importance and it may not have multiple functions and targets in the DCT cells. In this study, we identified the phosphatase Hydrochlorothiazide and Furosemide Treatment 2 2 inhibitor I-1 as a DCT-enriched gene product and a novel WTand I-1 / mice were kept for 14 days on 0.3% Na+ or 0.05% Na+ molecular player controlling the phosphorylation of NCC in diet and then placed in metabolic cages. At day 4 in the metabolic

518 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 www.jasn.org BASIC RESEARCH

12:00 AM for 5 consecutive days. At least 20 subsequent BP recordings were taken and aver- aged for each mouse. The average values per mouse and per day were used to calculate a mean systolic BP per mouse for 4 consecutive days.

IHC Mouse kidneys were fixed by vascular perfusion of 3% paraformaldehyde in phosphate buffer and processed for immunohistochemistry as described.56 Human kidney samples were ar- chived tissue. Cryosections were analyzed with a Leica fluorescence microscope. Cryosec- tions were examined with a fluorescence microscope (Leica DM6000B). Images were acquired with a charge-coupled device camera and processed by Adobe Photoshop CS3.

IB Membrane protein fractions were prepared, resolved on SDS polyacrylamide gels, and blotted on nitrocellulose membranes.57 Binding of Figure 6. I-1 deficiency does not affect SPAK abundance and phosphorylation. (A) 2 2 Immunoblot analysis of total kidney lysates from WT and I-1 / mice for total SPAK and the primary antibody was visualized using In- – SPAK phosphorylated at Ser373 (pSPAK). Lysates from isolated DCTs were run in fra Red Dye conjugated secondary antibodies parallel and revealed SPAK and pSPAK at 70 kD. (B) Densitometric analysis was nor- (LI-COR Biosciences) and an Odyssey infra- malized to b-actin protein levels. No statistical difference between genotypes was red-scanner detection system (LI-COR Bio- detected with t test (n=5 mice per group). (C) Representative immunostainings for sciences). 2 2 NCC, SPAK, and pSPAK on consecutive cryosections of WT and I-1 / mouse kidneys. SPAK and pSPAK are clearly visible in NCC-negative TAL (T) and NCC-positive DCT Antibodies 2/2 ; (D). No differences are seen between WT and I-1 mice. Scale bars, 20 mm. Primary and secondary antibodies were diluted for IHC and IB in PBS with 0.1% BSA and LI- COR Blocking Buffer, respectively. Antibodies cage, each mouse received a single intraperitoneal injection of vehicle used were rabbit anti–I-1 (IHC: 1/1000, IB: 1/20,000; Epitomics), (1:1 mixture of 0.9% NaCl solution with methanol or polyethylen- rabbit anti–NaPi-IIa (IB: 1/5000),58 rabbit anti-NKCC2 (IB: glycol 300 for 0.3% Na+ or 0.05% Na+ diet, respectively), and urine 1/10,000),56 rabbit anti-total NCC27 (IHC: 1/8000), rabbit anti-total was collected for the next 6 hours; 24 hours later, mice received either NCC58 (IB: 1/2000), rabbit anti–phospho-Thr53 NCC57 (IB: HCTZ (50 mg/kg; Sigma-Aldrich) or furosemide (Furo, 40 mg/kg; 1/5000), rabbit anti–phospho-Thr58 NCC58 (IB: 1/5000), rabbit Sigma-Aldrich), and urine was collected again for a 6-hour period. anti–phospho-Ser71 NCC58 (IB: 1/10,000), rabbit anti–phospho- Ser89 NCC58 (IB: 1/10,000), mouse anti-CB28K (IHC: 1/20,000; Biochemical Measurements Swant, Bellinzona, Switzerland), rabbit anti-aENaC58 (IHC and IB: Blood gas and blood ions were measured with the ABL825Flex Blood 1/10,000), rabbit anti-bENaC (IB: 1/40,000)56,anti-gENaC56 (IB: Gas Analyzer (Radiometer, Copenhagen, Denmark). Blood magne- 1/20,000), rabbit anti-pendrin59 (IB: 1/5000), rabbit anti–sodium- sium was measured by atomic absorption spectrophotometry (Per- driven bicarbonate-chloride exchanger60 (IB: 1/500), rabbit anti- kinElmer Apparatus, Model 3110; PerkinElmer, Cortabeuf, France). SPAK (IHC and IB: 1/500, 07–2271; Milipore), and rabbit anti-human Plasma and urine aldosterone levels were measured with a radioim- phospho-SPAK (Ser373; IHC and IB: 1/500, 07–2273; Milipore). munoassay using commercially available kits (DRG Diagnostics, For detection of phosphorylated NKCC2, we used a novel rabbit Marburg, Germany, and DPC Dade Behring, La Défense, France, phosphoform-specific antibody (IHC and IB: 1/500). The antiserum respectively). Urinary creatinine was assessed by the Jaffe method. against rat NKCC2 phosphorylated at T96 and T101 was generated Urinary electrolytes (Na+,K+,andCa2+) were measured by ion chro- by immunizing rabbits with the following phosphorylated peptide: matography (Metrohm Ion Chromatograph, Herisau, Switzerland). QTPFGHNTPMC by Genscript. The C-terminal cysteine was added for conjugation to carrier protein and attachment of the peptide to BP Recordings the affinity purification column for subsequent affinity purification Systolic BP was recorded on conscious mice using the noninvasive tail- of the antisera against the phospho- and the corresponding nonphos- cuff method (Visitech). Mice were habituated to the instrument for 4 phopeptide. Secondary antibodies were goat anti-rabbit IgG coupled consecutive days. Then, BP was measured daily between 10:00 and to Alexa 555 dye (1/2000; Invitrogen), goat anti-mouse IgG coupled

J Am Soc Nephrol 25: 511–522, 2014 I-1 Controls NCC Phosphorylation 519 BASIC RESEARCH www.jasn.org to Alexa 488 dye (1/1000; Molecular Probes), and donkey anti-sheep N.P. is supported by grants from the Société française d’Hy- IgG coupled to IRDye 800CW (1/20,000; Rockland, Gilbertsville, pertension Artérielle and Fondation du Rein and Agence Nationale de PA). The characterization of the novel antibody against phosphoryla Recherche Programme Grant BLANC 2010-R10164DD. Funding lated NKCC2 is shown in Supplemental Figure 2. The specificity of to R.A.F. is provided by the Danish Medical Research Council and the antibodies for phosphorylated NCC forms was confirmed by de- Lundbeck Foundation. The laboratory of D.H.E. is supported by phosphorylation of tissue homogenates and using kidneys of NCC- Grants R01 DK51496 and R01 1RO1 DK095841 from the National deficient mice as negative controls (Supplemental Figure 3). The Institutes of Health and Merit Review funds from the Department SPAK and pSPAK antibodies were characterized by comparing their of Veterans Affairs. The laboratory of J.L. is supported by Swiss binding patterns with total lysates of isolated DCTs and whole-mouse National Science Foundation Project Grants 310000-122243/1 kidneys. The phosphoform specificity of the pSPAK antibody was and 310030_143929/1, the National Centre of Competence in Re- confirmed by using dephosphorylated kidney protein homogenates search Kidney.CH, and the Zurich Centre for Integrative Human (Supplemental Figure 4). Physiology. Part of the COPAS data was published in abstract form at the HEK293 Cells with Inducible NCC Expression Cells Annual Meetings of the American Society of Nephrology in San The Flp-In T-REx HEK NCC cell line, which was described pre- Diego, CA, October 27–November 1, 2009, and Denver, CO, November viously,8 is maintained in high-glucose DMEM containing 10% vol/vol 16–21, 2010. FBS, 200 mg/ml hygromycin, 15 mg/ml blasticidin, and penicillin/ This study is part of the thesis of K.T., who received salary support streptomycin. NCC is induced by incubating the cells with tetracy- from the EMDO Foundation. cline (1 mg/ml) followed by cell lysis and IB. Toknock down endogenous I-1 expression, HEK cells were transfected using Lipofectamine 2000 – (Invitrogen) with 20 40 nM I-1 small interfering RNA oligonucleotides DISCLOSURES (59-CCACATCTAAGTCCACTT; Invitrogen) according to the manufacturer’sprotocol. None.

Oocyte Experiments REFERENCES The uptake of 22Na was performed as described previously.61 T7 RNA polymerase (mMESSAGE mMACHINE; Ambion) was used to make 1. Reilly RF, Ellison DH: Mammalian distal tubule: Physiology, patho- cRNA. Sorted Xenopus oocytes were injected with 50 nl water con- physiology, and molecular anatomy. Physiol Rev 80: 277–313, 2000 taining 5 ng NCC with or without 5 ng PP1a and constitutive active I-1 2. Gamba G: The thiazide-sensitive Na+-Cl- cotransporter: Molecular bi- (ppp1r1a) T35D variant, which is noted in the figures. For each ology, functional properties, and regulation by WNKs. Am J Physiol experimental condition, 10–20 oocytes were injected; 3 days after in- Renal Physiol 297: F838–F848, 2009 jection, oocytes were incubated in chloride-free medium for 3–4 hours 3. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitleman HJ, Lifton at 18°C before Na uptake was measured. The n value given in the figures RP: Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic represents the number of independent experiments. alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. Nat Genet 12: 24–30, 1996 4. Wilson FH, Disse-Nicodème S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard JM, Feely MP, ACKNOWLEDGMENTS Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, Lifton RP: Human hypertension caused by mutations in WNK kinases. Science 293: 1107–1112, 2001 We acknowledge the expert technical help of Agnieszka Wengi and 5. Yu Z, Serra A, Sauter D, Loffing J, Ackermann D, Frey FJ, Frey BM, Vogt Claudia Sündermann. We thank the Flow Cytometry Facility, the B: Sodium retention in rats with liver cirrhosis is associated with in- Center for Microscopy and Image Analysis, the Zurich Integrative creased renal abundance of NaCl cotransporter (NCC). Nephrol Dial Transplant 20: 1833–1841, 2005 Rodent Physiology Facility, and the Functional Genomics Center 6. Song J, Knepper MA, Verbalis JG, Ecelbarger CA: Increased renal Zurich of the University of Zurich for their excellent support. The ion ENaC subunit and sodium transporter abundances in streptozotocin- chromatography measurements were done by Udo Schnitzbauer, induced type 1 diabetes. Am J Physiol Renal Physiol 285: F1125– who is working in the group of Dr. Carsten Wagner. Measurements of F1137, 2003 plasma aldosterone levels in the Institute of Clinical Chemistry 7. Mu S, Shimosawa T, Ogura S, Wang H, Uetake Y, Kawakami-Mori F, Marumo T, Yatomi Y, Geller DS, Tanaka H, Fujita T: Epigenetic modu- (University Hospital Zurich) were organized and supervised by lation of the renal b-adrenergic-WNK4 pathway in salt-sensitive hy- Monika Seiler and Dr. Katharina Spanaus, respectively. Dr. Hannah pertension. Nat Med 17: 573–580, 2011 Monyer, Dr. Paul Greengard, and Dr. Gary Shull provided the PV- 8. Hoorn EJ, Walsh SB, McCormick JA, Fürstenberg A, Yang CL, Roeschel EGFP–transgenic and I-1– and NCC-deficient mice, respectively. Dr. T, Paliege A, Howie AJ, Conley J, Bachmann S, Unwin RJ, Ellison DH: Brigitte Kaissling provided human kidney samples and Dr. Michael The calcineurin inhibitor tacrolimus activates the renal sodium chloride cotransporter to cause hypertension. Nat Med 17: 1304–1309, 2011 Hengartner gave access to his COPAS machine. Antibodies against 9. Davis BR, Cutler JA, Gordon DJ, Furberg CD, Wright JT Jr., Cushman NaPi-IIa and pendrin were gifts from Dr. Jürg Biber and Dr. Carsten WC, Grimm RH, LaRosa J, Whelton PK, Perry HM, Alderman MH, Ford Wagner, respectively. CE, Oparil S, Francis C, Proschan M, Pressel S, Black HR, Hawkins CM;

520 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 www.jasn.org BASIC RESEARCH

ALLHAT Research Group: Rationale and design for the Antihyperten- 24. Wittköpper K, Dobrev D, Eschenhagen T, El-Armouche A: Phospha- sive and Lipid Lowering Treatment to Prevent Heart Attack Trial (ALL- tase-1 inhibitor-1 in physiological and pathological b-adrenoceptor HAT). Am J Hypertens 9: 342–360, 1996 signalling. Cardiovasc Res 91: 392–401, 2011 10. Bergaya S, Vidal-Petiot E, Jeunemaitre X, Hadchouel J: Pathogenesis of 25. Cohen PT: Protein phosphatase 1—targeted in many directions. J Cell pseudohypoaldosteronism type 2 by WNK1 mutations. Curr Opin Sci 115: 241–256, 2002 Nephrol Hypertens 21: 39–45, 2012 26. Meyer AH, Katona I, Blatow M, Rozov A, Monyer H: In vivo labeling of 11. Uchida S: Pathophysiological roles of WNK kinases in the kidney. parvalbumin-positive interneurons and analysis of electrical coupling in Pflugers Arch 460: 695–702, 2010 identified neurons. J Neurosci 22: 7055–7064, 2002 12. Welling PA, Chang YP, Delpire E, Wade JB: Multigene kinase network, 27. Loffing J, Loffing-Cueni D, Valderrabano V, Kläusli L, Hebert SC, Rossier kidney transport, and salt in essential hypertension. Kidney Int 77: BC, Hoenderop JG, Bindels RJ, Kaissling B: Distribution of transcellular 1063–1069, 2010 calcium and sodium transport pathways along mouse distal nephron. 13. Belge H, Gailly P, Schwaller B, Loffing J, Debaix H, Riveira-Munoz E, Am J Physiol Renal Physiol 281: F1021–F1027, 2001 Beauwens R, Devogelaer JP, Hoenderop JG, Bindels RJ, Devuyst O: 28. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, Renal expression of parvalbumin is critical for NaCl handling and Hoenderop JG: TRPM6 forms the Mg2+ influx channel involved in in- response to diuretics. Proc Natl Acad Sci U S A 104: 14849–14854, testinal and renal Mg2+ absorption. J Biol Chem 279: 19–25, 2004 2007 29. Ellison DH, Biemesderfer D, Morrisey J, Lauring J, Desir GV: Immuno- 14. Arroyo JP, Lagnaz D, Ronzaud C, Vázquez N, Ko BS, Moddes L, cytochemical characterization of the high-affinity thiazide diuretic re- Ruffieux-Daidié D, Hausel P, Koesters R, Yang B, Stokes JB, Hoover RS, ceptor in rabbit renal cortex. Am J Physiol 264: F141–F148, 1993 Gamba G, Staub O: Nedd4-2 modulates renal Na+-Cl- cotransporter via 30. Yang CL, Angell J, Mitchell R, Ellison DH: WNK kinases regulate thia- the aldosterone-SGK1-Nedd4-2 pathway. J Am Soc Nephrol 22: 1707– zide-sensitive Na-Cl cotransport. JClinInvest111: 1039–1045, 2003 1719, 2011 31. Chen G, Zhou X, Florea S, Qian J, Cai W, Zhang Z, Fan GC, Lorenz J, 15. Fejes-Tóth G, Frindt G, Náray-Fejes-Tóth A, Palmer LG: Epithelial Na+ Hajjar RJ, Kranias EG: Expression of active protein phosphatase 1 in- channel activation and processing in mice lacking SGK1. Am J Physiol hibitor-1 attenuates chronic beta-agonist-induced cardiac apoptosis. Renal Physiol 294: F1298–F1305, 2008 Basic Res Cardiol 105: 573–581, 2010 16. Rozansky DJ, Cornwall T, Subramanya AR, Rogers S, Yang YF, David LL, 32. Wu JQ, Guo JY, Tang W, Yang CS, Freel CD, Chen C, Nairn AC, Zhu X, Yang CL, Ellison DH: Aldosterone mediates activation of the Kornbluth S: PP1-mediated dephosphorylation of phosphoproteins at thiazide-sensitive Na-Cl cotransporter through an SGK1 and WNK4 mitotic exit is controlled by inhibitor-1 and PP1 phosphorylation. Nat signaling pathway. J Clin Invest 119: 2601–2612, 2009 Cell Biol 11: 644–651, 2009 17. Boyden LM, Choi M, Choate KA, Nelson-Williams CJ, Farhi A, Toka HR, 33. Sorensen MV, Grossmann S, Roesinger M, Gresko N, Todkar AP, Tikhonova IR, Bjornson R, Mane SM, Colussi G, Lebel M, Gordon RD, Barmettler G, Ziegler U, Odermatt A, Loffing-Cueni D, Loffing J: Rapid Semmekrot BA, Poujol A, Välimäki MJ, De Ferrari ME, Sanjad SA, dephosphorylation of the renal sodium chloride cotransporter in re- Gutkin M, Karet FE, Tucci JR, Stockigt JR, Keppler-Noreuil KM, Porter sponse to oral potassium intake in mice. Kidney Int 83: 811–824, 2013 CC, Anand SK, Whiteford ML, Davis ID, Dewar SB, Bettinelli A, 34. Morris RG, Hoorn EJ, Knepper MA: Hypokalemia in a mouse model of Fadrowski JJ, Belsha CW, Hunley TE, Nelson RD, Trachtman H, Cole Gitelman’s syndrome. Am J Physiol Renal Physiol 290: F1416–F1420, TR, Pinsk M, Bockenhauer D, Shenoy M, Vaidyanathan P, Foreman JW, 2006 Rasoulpour M, Thameem F, Al-Shahrouri HZ, Radhakrishnan J, Gharavi 35. Richardson C, Rafiqi FH, Karlsson HK, Moleleki N, Vandewalle A, AG, Goilav B, Lifton RP: Mutations in kelch-like 3 and cullin 3 cause Campbell DG, Morrice NA, Alessi DR: Activation of the thiazide-sen- hypertension and electrolyte abnormalities. Nature 482: 98–102, 2012 sitive Na+-Cl- cotransporter by the WNK-regulated kinases SPAK and 18. Louis-Dit-Picard H, Barc J, Trujillano D, Miserey-Lenkei S, Bouatia-Naji OSR1. J Cell Sci 121: 675–684, 2008 N, Pylypenko O, Beaurain G, Bonnefond A, Sand O, Simian C, Vidal- 36. Lalioti MD, Zhang J, Volkman HM, Kahle KT, Hoffmann KE, Toka HR, Petiot E, Soukaseum C, Mandet C, Broux F, Chabre O, Delahousse M, Nelson-Williams C, Ellison DH, Flavell R, Booth CJ, Lu Y, Geller DS, Esnault V, Fiquet B, Houillier P, Bagnis CI, Koenig J, Konrad M, Landais Lifton RP: Wnk4 controls blood pressure and potassium homeostasis P, Mourani C, Niaudet P, Probst V, Thauvin C, Unwin RJ, Soroka SD, via regulation of mass and activity of the distal convoluted tubule. Nat Ehret G, Ossowski S, Caulfield M, Bruneval P, Estivill X, Froguel P, Genet 38: 1124–1132, 2006 Hadchouel J, Schott JJ, Jeunemaitre X: KLHL3 mutations cause familial 37. Kaissling B, Loffing J: Cell growth and cell death in renal distal tubules, hyperkalemic hypertension by impairing ion transport in the distal associated with diuretic treatment. Nephrol Dial Transplant 13: 1341– nephron. Nat Genet 44: 456–460, 2012 1343, 1998 19. Glover M, Mercier Zuber A, Figg N, O’Shaughnessy KM: The activity of 38. Cohen P: The structure and regulation of protein phosphatases. Annu the thiazide-sensitive Na(+)-Cl(-) cotransporter is regulated by protein Rev Biochem 58: 453–508, 1989 phosphatase PP4. Can J Physiol Pharmacol 88: 986–995, 2010 39. Meister B, Fryckstedt J, Schalling M, Cortés R, Hökfelt T, Aperia A, 20. Chabardès-Garonne D, Mejéan A, Aude JC, Cheval L, Di Stefano A, Hemmings HC Jr, Nairn AC, Ehrlich M, Greengard P: Dopamine- and Gaillard MC, Imbert-Teboul M, Wittner M, Balian C, Anthouard V, cAMP-regulated phosphoprotein (DARPP-32) and dopamine DA1 ag- Robert C, Ségurens B, Wincker P, Weissenbach J, Doucet A, Elalouf JM: onist-sensitive Na+,K+-ATPase in renal tubule cells. Proc Natl Acad Sci A panoramic view of gene expression in the human kidney. Proc Natl USA86: 8068–8072, 1989 Acad Sci U S A 100: 13710–13715, 2003 40. Fryckstedt J, Aperia A, Snyder G, Meister B: Distribution of dopamine- 21. Cheval L, Pierrat F, Dossat C, Genete M, Imbert-Teboul M, Duong Van and cAMP-dependent phosphoprotein (DARPP-32) in the developing Huyen JP, Poulain J, Wincker P, Weissenbach J, Piquemal D, Doucet A: and mature kidney. Kidney Int 44: 495–502, 1993 Atlas of gene expression in the mouse kidney: New features of glo- 41. Allen PB, Hvalby O, Jensen V, Errington ML, Ramsay M, Chaudhry FA, merular parietal cells. Physiol Genomics 43: 161–173, 2011 Bliss TV, Storm-Mathisen J, Morris RG, Andersen P, Greengard P: 22. Pradervand S, Zuber Mercier A, Centeno G, Bonny O, Firsov D: A Protein phosphatase-1 regulation in the induction of long-term po- comprehensive analysis of gene expression profiles in distal parts of the tentiation: Heterogeneous molecular mechanisms. JNeurosci20: mouse renal tubule. Pflugers Arch 460: 925–952, 2010 3537–3543, 2000 23. Miller RL, Zhang P, Chen T, Rohrwasser A, Nelson RD: Automated 42. Nimmo GA, Cohen P: The regulation of glycogen metabolism. Purifi- method for the isolation of collecting ducts. Am J Physiol Renal Physiol cation and characterisation of protein phosphatase inhibitor-1 from 291: F236–F245, 2006 rabbit skeletal muscle. Eur J Biochem 87: 341–351, 1978

J Am Soc Nephrol 25: 511–522, 2014 I-1 Controls NCC Phosphorylation 521 BASIC RESEARCH www.jasn.org

43. Gagnon KB, Delpire E: Multiple pathways for protein phosphatase 1 R, Eladari D: Pendrin regulation in mouse kidney primarily is chloride- (PP1) regulation of Na-K-2Cl cotransporter (NKCC1) function: The N- dependent. JAmSocNephrol17: 2153–2163, 2006 terminal tail of the Na-K-2Cl cotransporter serves as a regulatory scaf- 54. Soleimani M, Barone S, Xu J, Shull GE, Siddiqui F, Zahedi K, Amlal H: fold for Ste20-related proline/alanine-rich kinase (SPAK) AND PP1. J Double knockout of pendrin and Na-Cl cotransporter (NCC) causes Biol Chem 285: 14115–14121, 2010 severe salt wasting, volume depletion, and renal failure. Proc Natl Acad 44. Yang SS, Lo YF, Yu IS, Lin SW, Chang TH, Hsu YJ, Chao TK, Sytwu HK, Sci U S A 109: 13368–13373, 2012 Uchida S, Sasaki S, Lin SH: Generation and analysis of the thiazide- 55. Morel F: Sites of hormone action in the mammalian nephron. Am J sensitive Na+ -Cl- cotransporter (Ncc/Slc12a3) Ser707X knockin mouse Physiol 240: F159–F164, 1981 as a model of Gitelman syndrome. Hum Mutat 31: 1304–1315, 2010 56. Wagner CA, Loffing-Cueni D, Yan Q, Schulz N, Fakitsas P, Carrel M, 45. McCormick JA, Mutig K, Nelson JH, Saritas T, Hoorn EJ, Yang CL, Wang T, Verrey F, Geibel JP, Giebisch G, Hebert SC, Loffing J: Mouse Rogers S, Curry J, Delpire E, Bachmann S, Ellison DH: A SPAK isoform model of type II Bartter’s syndrome. II. Altered expression of renal so- switch modulates renal salt transport and blood pressure. Cell Metab dium- and water-transporting proteins. Am J Physiol Renal Physiol 294: 14: 352–364, 2011 F1373–F1380, 2008 46. Yang SS, Lo YF, Wu CC, Lin SW, Yeh CJ, Chu P, Sytwu HK, Uchida S, 57. Sorensen MV, Grossmann S, Roesinger M, Gresko N, Todkar AP, Sasaki S, Lin SH: SPAK-knockout mice manifest Gitelman syndrome and Barmettler G, Ziegler U, Odermatt A, Loffing-Cueni D, Loffing J: Rapid impaired vasoconstriction. J Am Soc Nephrol 21: 1868–1877, 2010 dephosphorylation of the renal NaCl cotransporter in response to oral 47. Ji W, Foo JN, O’Roak BJ, Zhao H, Larson MG, Simon DB, Newton-Cheh K+ intake. Kidney Int 83: 811–824, 2013 C, State MW, Levy D, Lifton RP: Rare independent mutations in renal 58. Custer M, Lötscher M, Biber J, Murer H, Kaissling B: Expression of Na-P salt handling genes contribute to blood pressure variation. Nat Genet (i) cotransport in rat kidney: Localization by RT-PCR and immunohis- 40: 592–599, 2008 tochemistry. Am J Physiol 266: F767–F774, 1994 48. Cruz DN, Simon DB, Nelson-Williams C, Farhi A, Finberg K, Burleson L, 59. Wagner CA, Finberg KE, Stehberger PA, Lifton RP, Giebisch GH, Gill JR, Lifton RP: Mutations in the Na-Cl cotransporter reduce blood Aronson PS, Geibel JP: Regulation of the expression of the Cl-/anion pressure in humans. Hypertension 37: 1458–1464, 2001 exchanger pendrin in mouse kidney by acid-base status. Kidney Int 62: 49. Ellison DH, Loffing J: Thiazide effects and adverse effects: Insights from 2109–2117, 2002 molecular genetics. Hypertension 54: 196–202, 2009 60. Leviel F, Hübner CA, Houillier P, Morla L, El Moghrabi S, Brideau G, 50. Carr AN, Sutliff RL, Weber CS, Allen PB, Greengard P, de Lanerolle P, Hassan H, Parker MD, Kurth I, Kougioumtzes A, Sinning A, Pech V, Kranias EG, Paul RJ: Is myosin phosphatase regulated in vivo by inhibitor- Riemondy KA, Miller RL, Hummler E, Shull GE, Aronson PS, Doucet A, 1? Evidence from inhibitor-1 knockout mice. JPhysiol534: 357–366, 2001 Wall SM, Chambrey R, Eladari D: The Na+-dependent chloride-bi- 51. Brooks HL, Sorensen AM, Terris J, Schultheis PJ, Lorenz JN, Shull GE, carbonate exchanger SLC4A8 mediates an electroneutral Na+ re- Knepper MA: Profiling of renal tubule Na+ transporter abundances in absorption process in the renal cortical collecting ducts of mice. J Clin NHE3 and NCC null mice using targeted proteomics. JPhysiol530: Invest 120: 1627–1635, 2010 359–366, 2001 61. Yang CL, Zhu X, Ellison DH: The thiazide-sensitive Na-Cl cotransporter 52. Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, is regulated by a WNK kinase signaling complex. JClinInvest117: Bloch-Faure M, Hoenderop JG, Shull GE, Meneton P, Kaissling B: Al- 3403–3411, 2007 tered renal distal tubule structure and renal Na(+) and Ca(2+) handling in a mouse model for Gitelman’ssyndrome.J Am Soc Nephrol 15: 2276–2288, 2004 53. Vallet M, Picard N, Loffing-Cueni D, Fysekidis M, Bloch-Faure M, This article contains supplemental material online at http://jasn.asnjournals. Deschênes G, Breton S, Meneton P, Loffing J, Aronson PS, Chambrey org/lookup/suppl/doi:10.1681/ASN.2012121202/-/DCSupplemental.

522 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 511–522, 2014 Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary materials and methods

Isolation of single tubular fragments using the complex object parametric analyzer biosorter (COPAS) To prepare single renal tubular fragments, mice were anesthetized with Ketamin (Narketan 10, 80 mg/kg body wt; Chassot, Belp, Switzerland) and Xylazine (Rompun, 33 mg/kg body wt; Bayer, Leverkusen, Germany). Mice were perfused through the heart with 10ml of cold PBS then with 10ml of digestion solution (1mg/ml, Worthington ; 1mg/ml hyaluronidase, Sigma ; 0.1mg/ml DNaseI, SIGMA prepared in ice-cold KREBS : 145 mM NaCl, 10 mM HEPES, 5 mM KCl, 1 mM NaH2PO4, 2.5 mM

CaCl2, 1.8 mM MgSO4, 5 mM glucose, pH 7.3). Renal cortex from both kidneys was dissected under a stereomicroscope. Samples were finely minced and digested in 10 ml of fresh digestion solution at 37°C for 15 minutes. The tubular digest was first filtered through 250- and 212-µm nylon sieves. The flow-through was then filtered with a 100-µm and a 40-µm cell strainer (Becton Dickinson Labware, Franklin Lakes, NJ). The tubules retained by the 40-µm cell strainer were diluted with ice-cold Krebs to a total volume of 50 ml. All sortings were performed with a complex object parametric analyzer and sorter (COPAS) instrument (Union Biometrica, Somerville, MA). As already described for sorting fluorescent renal collecting ducts1, the following instrument settings were used: delay 8, width 5, photomultiplier tube (PMT) 700, sheath fluid pressure 4.2-4.5. The sample fluid pressure was set to maintain a sort frequency of 20–40 events/s (sample pressure 5.40–5.90). The mixer speed was 80%. Sorted tubules were collected directly into ice-cold KREBS containing 0.05% BSA (Fluka). They were centrifuged at 800g for 10minutes and the pellet was used for RNA and protein expression analysis.

Preparation of total RNA and cDNA from sorted tubules RNA extraction was performed with RNAqueous-Micro extraction kit (Applied Biosystems/Ambion, Switzerland). Immediately after sorting, pelleted tubules were resuspended in 50 µl of elution buffer provided by the manufacturer. RNA isolation and DNase treatment was performed according to the manufacturer’s recommendations.

Gene expression profiling – Agilent Microarray hybridization and analysis The quality of the isolated RNA was determined with a NanoDrop ND 1000 (NanoDrop Technologies,Delaware, USA) and a Bioanalyzer 2100 (Agilent, Waldbronn, Germany). Total RNA samples (600ng) were reverse-transcribed into

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

double-stranded cDNA in presence of RNA poly-A controls, RNA Spike-In Kit, One- Color (Agilent p/n 5188-5282). The double-stranded cDNA were in vitro transcribed in presence of Cy3-labelled nucleotides using a Low RNA Input Linear Amp Kit+Cy dye, one-color kit (Agilent P/N 5188-5339, Waldbronn, Germany). The Cy3-labeled cRNA was purified using a RNeasy mini kit, Qiagen (p/n. 74104 or 74106) and its quality and quantity was determined using NanoDrop ND 1000 and Bioanalyzer 2100. Only cRNA samples with a total cRNA yield higher than 2 μg and a dye incorporation rate between 9 pmol/ μg and 20 pmol/ μg were considered for hybridization. Cy3-labeled cRNA samples (1.65 μg) were mixed with a Agilent Blocking Solution, subsequently randomly fragmented to 100-200 bp at 65°C with Fragmentation Buffer, and resuspended in Hybridization Buffer using a Gene Expression Hybridization Kit (Agilent p/n 5188-5242). Target cRNA Samples (100μl) were hybridized to Whole mouse Genome 4x44k OligoMicroarrays (Agilent) for 17h at 65°C. Arrays were then washed using Agilent GE Wash Buffers 1 and 2, according to the manufacturer instructions. An Agilent Microarray Scanner (Agilent p/n G2565BA) was used to measure the fluorescent intensity emitted by the labeled target.

Array Data Processing and quality control Raw data processing was performed using the Agilent Scan Control and the Agilent Feature Extraction Software Version 10. Quality control measures were considered before performing the statistical analysis. These included, inspection of the array hybridization pattern (absence of scratches, bubbles, areas of non hybridization), proper grid alignment, performance of the spike in controls (linear dynamic range between 5 orders of magnitude) and number of green feature non-uniformity outliers (below 100 for all samples). Expression values were imported into Gene-spring 10 (Agilent Technologies, USA).

Real-Time PCR cDNA was synthesised by reverse transcription of 200 ng of RNA using random primers and ImpromII Reverse Transcription Kit (Promega, Madison, WI) following instructions of the manufacturer. Real-time PCR was performed on a ABI Prism 7700 cycler (Applied Biosystems) with the iQ SYBR Green Supermix (Biorad), 2 ng of reverse transcribed RNA per well and the following primers were used to measure gene expression of NCC: forward 5’ TGACCTGCATTCATTCCTCA 3’, reverse 5’ GAAGCGAACAGGTTCTCCAG 3’; GAPDH: forward 5’CCTGCTTCACCACCTTCTT- GA3’, reverse 5’ CATGGCCTTCCGTGTTCCTA 3’; NKCC2: forward 5’

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

GGATCCAACCAATGACATCC 3’, reverse 5’ TTTGCAATGGCAATGAGAAGG 3’; WNK1 Kidney Specific 2: forward 5’ TGCTGCTGTTCTCAAAAGGATTGTA 3’, reverse 5’ TTCAGGAATTGCTACTTTGTCAAAACTG 3’; WNK4 2: forward 5’ GCGGAGGAGGTGGCT 3’, reverse 5’ GCCACTGGCTGGTAGTCA 3’; Renin: forward 5’ ATCTTTGACACGGGTTCAGC 3’, reverse 5’ TGATCCGTAGTGGA- TGGTGA. Relative mRNA gene expression was measured after normalization to GAPDH gene expression: Ratio = 2Ct (GAPDH–Target)

Immunohistochemistry Mouse kidneys were fixed with 3% paraformaldehyde in phosphate buffer perfused through the descending aorta as previously described3. Cryosections were pretreated with blocking solution (Normal Goat Serum 10% in PBS with 0.1% bovine serum albumin (BSA)) for 60 min. Sections were incubated overnight at 4°C with primary antibodies diluted in PBS with 0.1% BSA then washed in PBS for 15 min. and incubated with secondary antibody for 2 hours at room temperature. After washing with PBS, sections were coverslipped using DAKO-Glycergel (Dakopatts) containing 2.5% 1,4-diazabicyclo[2.2.2]octane (Sigma) as a fading retardant. For characterization of the phospho-NKCC2 antibody, paraffin-embedded kidneys of mice and rats were processed for immunohistochemistry according to standard procedures. Immunohistochemistry images were acquired with a Leica DFC490 charged-coupled device camera attached to a Leica DM 6000 fluorescence microscope (Leica, Wetzlar, Germany).

Sample preparation and analysis for immunoblots COPAS sorted tubules were centrifuged at 750 g for 5 min. The pellet was lysed in 10 µl SDS loading buffer (10 mM Tris·HCl, pH 6.8, 1% SDS, 2% dithiothreitol, 13% glycerol, and bromophenol blue) and stored at -20°C. Kidneys were homogenized in icecold K-HEPES buffer (200 mM mannitol, 80 mM HEPES, 41 mM KOH, pH 7.5) containing phosphatase and protease inhibitor cocktails (Roche), centrifuged at 2000g for 15 min at 4°C and the pellet was resuspended in K-HEPES buffer (200 mM mannitol/80 mM K-HEPES/41 mM KOH/pH 7.5 supplemented with antiproteases (Complete tablets from Roche). To prepare kidney membrane fraction, the kidney lysate was centrifuged at 100000g for 1h at 4°C. The pellet was then resuspended in K-HEPES. After measurement of protein concentration (Optima), electrophoresis was initially carried out (Mini Protean Tetra Cell, Biorad) on a 8% polyacrylamide gel for either sorted tubules (400 tubules per lane) or 30μg of protein from whole lysates or membrane fractions from total mouse kidney membrane fraction on 8%

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

polyacrylamide gel. Proteins were transferred to a nitrocellulose membrane (Whatman, Bottmingen, Switzerland) with a BioRad Mini-Trans-Blot Cell system (100V, 2 hours). After transfer, membranes were blocked with Odyssey blocking buffer (LI-COR Biosciences) and incubated overnight at 4°C with prediluted antibodies in Odyssey blocking buffer. After washing the primary antibodies, Goat anti mouse Alexa Fluor 680-conjugated IgG (dilution 1:15000 in blocking buffer, LI- COR Biosciences) or goat anti rabbit Alexa Fluor 800CW-conjugated IgG (dilution 1:15000 in blocking buffer LI-COR Biosciences) was added for 1 h at room temperature before visualization and analysis by the Odyssey IR imaging system (LI- COR Biosciences). Densitometric quantifications were also performed with the Odyssey IR imaging system. Densitometric values were first normalized to their respective actin values. This ratio was then normalized to the mean of the control group which was arbitrarily set to 100. Results are expressed as mean ± standard error (S.E).

Characterization of antibodies against NCC and SPAK Lysates from isolated DCTs or whole kidneys from wild type and NCC deficient animals4 were resolved by immunoblotting as described above. To confirm the specificity of the NCC and SPAK antibodies for their phosphosites, kidney protein lysates were treated with Calf Intestinal Phosphatase (NEB) for 1 h at 37°C.

Legends

Supplementary figure 1: I-1 in human kidney Representative images of immunostainings of cryosections from human kidneys stained for NCC (A) or I-1 (B). I-1 is highly abundant in NCC-positive DCTs (D). I-1 is also expressed in TALs (T). Bar ~40 μm.

Supplementary figure 2: Characterization of phosphoform-specific antibodies against NKCC2 (A) Dotblotting of the pNKCC2 antibody demonstrated high affinity to the pNKCC2 peptide (QTPFGHNTPMC), but weak affinity to the non-phosphorylated NKCC2 peptide (QTFGHNTMC) or the closely related pT53/pT58 NCC peptide (MRTPFGYNTPID). (B) Western blotting of rat and mouse kidney samples detected a glycosylated smear of approximately 170kDa representing pNKCC2. These protein bands were not observed following pre-incubation of the antibody with the

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

phosphorylated immunizing peptide. (C) Immunohistochemistry on paraffin sections of rat and mouse kidney demonstrated strong labeling at the apical pole of thick ascending limb cells. No labeling of similar sections was detected following pre- incubation of the antibody with the phosphorylated immunizing peptide. Images were taken at low magnification from the border between inner stripe of outer medulla to the inner medulla (ISOM/IM), and at higher magnifications from the inner stripe of outer medulla (ISOM). Immunohistochemistry on paraffin sections of mouse brain demonstrated that the pNKCC2 antibody does not detect NKCC1 in the choroid plexus, which can be readily displayed with an antibody against NKCC1. Overviews with higher magnifications shown as inserts.

Supplementary figure 3: Characterization of phosphoform-specific antibodies against NCC Peptides against the NCC epitopes CLYMRTFGYN (pT53NCC), CFGYNTIDVV (pT58NCC), CHYANSALPGE (pS71NCC) and CADLHSFLKE (pS89NCC) were raised in rabbits and plasma antibodies were affinity purified against the corresponding phospho- and non-phosphopeptide (Pineda)5. To confirm the specificity of the antibodies for NCC, kidney protein lysates from Wild-Type (WT) and NCC deficient mice (NCC-/-) were resolved by immunoblotting using the purified antibodies. Protein lysates were also incubated (+) with Calf Intestinal Phosphatase (CIP ; New England Biolabs) for 1h at 37°C. Controls without CIP (-) were incubated at 37°C or at room temperature. The phosphoform-specificity of the antibodies was confirmed when the specific bands for NCC disappeared in the phosphatase-treated samples. The band detected by the antibody against total NCC was not sensitive to the phosphatase treatment. Detection of β-actin served as loading control.

Supplementary figure 4: Characterization of phosphoform specific antibody against SPAK and against total SPAK (A) To confirm the specificity of the antibody for phospho SPAK (pSPAK), total kidney (TK) protein lysates from wild type mice were incubated with (+) or without (-) Calf Intestinal Phosphatase (CIP; New England Biolabs) for 1h at 37°C and resolved by immunoblotting. COPAS sorted DCTs (400 tubules) were also blotted to confirm the strong expression of pSPAK in this segment. (B) Immunoblots using SPAK and pSPAK antibodies with total kidney lysates (TK) and sorted DCT were performed in parallel using the same membrane. Both antibodies recognized the same band at the expected height of SPAK (arrows) both in TK and DCT. The arrowhead indicates the

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

line along which the membrane was cut into two pieces that were incubated either with the SPAK or the pSPAK antibodies.

Supplementary Table 1: Gene expression of renal tuble markers in EGFP+, EGFP- and all tubules sorted by COPAS Gene expression of renal tubule markers in EGFP+ tubules, all tubules (ALL) and EGFP- tubules were extracted from the total list of gene identified after array data processing in Genespring 10. Datas are shown as average normalized intensities for each group (n=4 for each group). Comparative ratio analyses of gene expression for ALL versus EGFP-, EGFP+ versus EGFP- and EGFP+ versus ALL allowed to identify highly enriched genes in the DCT.

Supplementary Table 2: Highly enriched gene products in the EGFP+ (DCT) tubules. Datas are shown as the average normalized intensities for each gene product comparing the EGFP+ tubules, all kind of tubules (ALL) and EGFP- tubular gene expression (n=4 for each group). Comparative ratio analysis of gene expression for ALL versus EGFP-, EGFP+ versus EGFP- and EGFP+ versus ALL allowed to identify highly enriched gene products in the DCT. The first hundred most enriched genes were ordered according to the magnitude of the EGFP+ versus EGFP- ratio. A few genes were represented on the microarray with more than one spot. Those genes are listed only once and for the spot that appeared first on the list of the most enriched gene products.

Supplementary Table 3: Densitometric quantification of immunoblots Immunoblot analysis of kidney membrane fractions from WT and I-1-/- mice were used to quantify renal sodium transporter abundances. Densitometric analysis from the immunoblot presented in figure 4F, was performed with the LICOR Odyssey infrared-scanner detection system. Each band was normalised to -actin protein levels. The average for each protein was set to 100% for WT and expressed for I-1-/- mice in percent of the WT values. Statistical analyses were performed with unpaired student t-test comparing the two groups. (mean ± SE, n = 7 per group) * p < 0.05, *** p < 0.001 vs control.

Supplementary Table 4: Renal gene expression in I1-/- mice Gene expression of NKCC2, NCC, Renin, kidney-specific WNK1, and WNK4 were assessed by real time PCR on cDNA from WT and I-1-/- mice (n = 6 per group). Gene

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

expression was normalised to GAPDH expression. No statistical difference was found comparing gene expression from WT and I-1-/- mice.

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

References

1. Miller, RL, Zhang, P, Chen, T, Rohrwasser, A, Nelson, RD: Automated method for the isolation of collecting ducts. Am J Physiol Renal Physiol, 291: F236-245, 2006. 2. O'Reilly, M, Marshall, E, Macgillivray, T, Mittal, M, Xue, W, Kenyon, CJ, Brown, RW: Dietary electrolyte-driven responses in the renal WNK kinase pathway in vivo. J Am Soc Nephrol, 17: 2402-2413, 2006. 3. Wagner, CA, Loffing-Cueni, D, Yan, Q, Schulz, N, Fakitsas, P, Carrel, M, Wang, T, Verrey, F, Geibel, JP, Giebisch, G, Hebert, SC, Loffing, J: Mouse model of type II Bartter's syndrome. II. Altered expression of renal sodium- and water- transporting proteins. Am J Physiol Renal Physiol, 294: F1373-1380, 2008. 4. Schultheis, PJ, Lorenz, JN, Meneton, P, Nieman, ML, Riddle, TM, Flagella, M, Duffy, JJ, Doetschman, T, Miller, ML, Shull, GE: Phenotype resembling Gitelman's syndrome in mice lacking the apical Na+-Cl- cotransporter of the distal convoluted tubule. J Biol Chem, 273: 29150-29155, 1998. 5. Sorensen, MV, Grossmann, S, Roesinger, M, Gresko, N, Todkar, AP, Barmettler, G, Ziegler, U, Odermatt, A, Loffing-Cueni, D, Loffing, J: Rapid dephosphorylation of the renal sodium chloride cotransporter in response to oral potassium intake in mice. Kidney international, 83: 811-824, 2013.

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary figure 1: I-1 in human kidney A B

T T

D D

D D D D

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary figure 2: Characterization of phosphoform-specific antibody against NKCC2

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary figure 3: Characterization of phosphoform-specific antibodies against NCC

CIP + + - - WT NCC-/- WT NCC-/-

Total NCC

Actin

CIP + + - - CIP + + - - NCC-/- WT NCC-/- WT WT NCC-/- WT NCC-/- pT53 pT58 NCC NCC Actin Actin

CIP + + - - CIP + + - - WT NCC-/- WT NCC-/- NCC-/- WT NCC-/- WT pS71 pS89 NCC NCC Actin Actin

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary figure 4: Characterization of antibodies against SPAK

A CIP - + TK TK DCT

pSPAK ï 70kD

Actin ï 42kD

B SPAK pSPAK

DCT TK TK TK DCT ð ï 70kD

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary Table 1: Gene expression of renal tuble markers in EGFP+, EGFP- and all tubules sorted by COPAS

Average Raw Intensity RATIOS Description Gene Symbol GenBank ID All EGFP- EGFP+ All/EGFP- EGFP+/EGFP- EGFP+/All aquaporin 1 Aqp1 NM_007472 84866,1 93721,4 3251,6 0,91 0,03 0,04 low density lipoprotein receptor-related protein 2 (megalin) Lrp2 XM_130308 249372,3 267185,4 12660,9 0,93 0,05 0,05 solute carrier family 34, member 1(NaPi-IIa) Slc34a1 NM_011392 206126,2 216446,1 9562,4 0,95 0,04 0,05 solute carrier family 12, member 1 (NKCC2) Slc12a1 NM_183354 25033,4 27476,1 45187,2 0,91 1,64 1,81 uromodulin (Tamm-Horsfall glycoprotein) Umod NM_009470 128325,9 98263,3 374249,7 1,31 3,81 2,92 parvalbumin Pvalb NM_013645 2860,0 35,8 33507,1 79,84 935,35 11,72 solute carrier family 12, member 3 (NCC) Slc12a3 NM_019415 36663,5 961,9 300176,2 38,12 312,08 8,19 transient receptor potential cation channel, subfamily M, member 6 Trpm6 NM_153417 927,2 50,3 12394,7 18,43 246,36 13,37 potassium inwardly-rectifying channel, subfamily J, member 1 (ROMK) Kcnj1 NM_019659 74288,2 27920,0 303140,6 2,66 10,86 4,08 sodium channel, nonvoltage-gated, type I, alpha (αENaC) Scnn1a NM_011324 5444,6 3366,5 29019,4 1,62 8,62 5,33 sodium channel, nonvoltage-gated 1 beta (βENaC) Scnn1b NM_011325 1698,9 1632,6 3375,2 1,04 2,07 1,99 sodium channel, nonvoltage-gated 1 gamma (γENaC) Scnn1g NM_011326 5785,5 5421,4 8529,2 1,07 1,57 1,47 transient receptor potential cation channel, subfamily V, member 5 Trpv5 AK085479 699,3 425,2 3305,2 1,64 7,77 4,73 solute carrier family 26, member 4 (pendrin) Slc26a4 NM_011867 45439,5 48686,0 20500,7 0,93 0,42 0,45 aquaporin 2 Aqp2 NM_009699 7760,8 9031,4 754,0 0,86 0,08 0,10

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary Table 2: Highly enriched gene products in the EGFP+ (DCT) tubules.

Average Raw Intensity RATIOS

Description Gene Symbol GenBank ID All EGFP- EGFP+ All/EGFP- EGFP+/EGFP- EGFP+/All Probe ID

A_51_P500156 parvalbumin Pvalb NM_013645 2860.0 35.8 33507.1 79.84 935.35 11.72

A_51_P445985 solute carrier family 12, member 3 Slc12a3 NM_019415 36663.5 961.9 300176.2 38.12 312.08 8.19

A_52_P184322 transient receptor potential cation channel, subfamily M, member 6 Trpm6 NM_153417 927.2 50.3 12394.7 18.43 246.36 13.37

A_51_P412966 leucine rich repeat protein 1, neuronal Lrrn1 NM_008516 709.0 44.7 9062.1 15.86 202.74 12.78

A_52_P197722 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 Hmgcll1 NM_173731 307.0 21.1 4165.9 14.53 197.17 13.57

A_52_P425317 RIKEN cDNA 4933406C10 gene 4933406C10Rik AK016682 147.9 138.2 26843.8 1.07 194.30 181.48

A_52_P405655 sal-like 3 (Drosophila) Sall3 AK045051 1054.5 80.0 13758.4 13.18 172.00 13.05

A_51_P433989 mitogen activated protein kinase 10 Mapk10 NM_009158 211.8 14.4 2439.6 14.75 169.83 11.52

A_52_P137678 ankyrin 2, brain Ank2 NM_178655 198.9 16.3 2760.4 12.22 169.60 13.88

A_52_P577484 SRY-box containing gene 9 Sox9 NM_011448 323.3 28.6 4511.6 11.32 157.91 13.96

A_51_P301537 Mus musculus RIKEN cDNA 4933413N12 gene (4933413N12Rik), mRNA [XM_128561] 4933413N12Rik XM_128561 111.7 102.2 15239.3 1.09 149.17 136.48

A_51_P487487 spermatogenesis associated glutamate (E)-rich protein 4d Speer4d NM_025759 257.9 18.0 2515.6 14.37 140.12 9.75

A_51_P290626 gulonolactone (L-) oxidase Gulo NM_178747 183.0 15.2 2086.8 12.03 137.16 11.40

A_51_P361448 scavenger receptor class A, member 5 (putative) Scara5 NM_028903 168.8 14.6 1975.2 11.52 134.83 11.70

A_52_P146513 Unknown NAP102411-1 null 151.5 12.1 1608.8 12.53 133.04 10.62

A_52_P474089 calpain 6 Capn6 NM_007603 126.6 11.0 1452.8 11.52 132.27 11.48

A_52_P531731 hypothetical protein 6430537F04 6430537F04 AK032394 129.0 13.8 1748.5 9.34 126.54 13.55 Mus musculus similar to spermatogenesis associated glutamate (E)-rich protein 4b; sperm- A_52_P330868 associated glutamate (E)-rich protein 4b; spermatogenic-associated glutamate (E)-rich protein 4b XM_354792 XM_354792 117.1 10.1 1269.0 11.63 126.02 10.84 (LOC380883), mRNA [XM_354792] A_52_P220933 predicted gene, ENSMUSG00000033219 ENSMUSG0000003N32M_19198666 133.6 12.4 1353.1 10.77 109.08 10.13

A_51_P182131 RIKEN cDNA 5330417C22 gene 5330417C22Rik BC022655 84.0 9.1 969.0 9.18 105.94 11.54

A_52_P563908 prospero-related homeobox 1 Prox1 AK038396 378.7 49.6 5009.2 7.63 100.89 13.23

A_52_P564706 BC024495 secreted frizzled-related sequence protein 1 {Mus musculus}, complete [TC1002499] TC1002499 null 345.8 42.8 4291.0 8.08 100.23 12.41

A_51_P283507 ATP-binding cassette, sub-family A (ABC1), member 13 Abca13 AK044229 4885.7 573.4 53386.6 8.52 93.10 10.93

A_51_P511000 Mus musculus RIKEN cDNA C130090K23 gene (C130090K23Rik), mRNA. C130090K23Rik NM_145560 3803.4 422.8 38506.3 9.00 91.08 10.12

A_51_P240476 dynein, axonemal, heavy chain 1 1 Dnahc11 NM_010060 240.0 31.9 2842.7 7.53 89.15 11.84

A_51_P368210 phytanoyl-CoA hydroxylase interacting protein Phyhip NM_145981 260.4 26.4 2288.7 9.88 86.85 8.79

A_51_P211786 carbohydrate (chondroitin 4) sulfotransferase 13 Chst13 AK004401 127.6 16.8 1365.1 7.61 81.41 10.70

A_51_P352296 secreted frizzled-related protein 1 Sfrp1 NM_013834 8523.7 1039.0 81385.9 8.20 78.33 9.55

A_51_P295621 ADAMTS-like 3 Adamtsl3 AK081635 34.9 8.5 661.1 4.10 77.75 18.96

A_52_P642005 calmodulin binding transcription activator 1 Camta1 AK122383 693.6 112.6 8012.3 6.16 71.15 11.55

A_51_P515046 Unknown A_51_P515046 null 91.4 16.0 1033.6 5.72 64.64 11.31

Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630035I16 A_52_P851214 Clstn2 AK049981 9.5 13.4 864.4 0.71 64.46 90.90 product:unclassifiable, full insert sequence. Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, A_52_P1020368 1700049G17Rik AK048799 81.3 65.4 3917.2 1.24 59.90 48.19 clone:C230070P17 product:unclassifiable, full insert sequence.

A_51_P419286 basic leucine zipper transcription factor, ATF-like 3 Batf3 NM_030060 716.4 113.4 6727.4 6.32 59.35 9.39

A_52_P452667 prominin 2 Prom2 NM_178047 2549.5 412.0 24255.6 6.19 58.87 9.51

A_51_P505967 sperm associated antigen 6 Spag6 NM_015773 167.4 34.6 2030.9 4.83 58.64 12.13

A_51_P322473 RIKEN cDNA 2310042D19 gene 2310042D19Rik NM_172417 473.9 85.3 4928.7 5.56 57.79 10.40

A_51_P466857 V-set and transmembrane domain containing 2A Vstm2a NM_145967 882.5 164.1 9181.2 5.38 55.93 10.40

A_52_P97699 RIKEN cDNA D430019H16 gene D430019H16Rik BC058677 661.0 128.7 6969.7 5.14 54.16 10.54

A_52_P153019 prostaglandin F receptor Ptgfr NM_008966 3112.8 620.2 32934.1 5.02 53.10 10.58

A_52_P529660 Mus musculus leucine rich repeat containing 52 (Lrrc52), mRNA. Lrrc52 XM_136373 45.5 12.0 629.1 3.78 52.28 13.81

A_51_P147942 insulin-like growth factor 1 Igf1 NM_010512 143.6 27.4 1428.3 5.24 52.15 9.95

A_51_P264934 matrilin 4 Matn4 NM_013592 260.6 44.2 2204.9 5.90 49.94 8.46

A_51_P341543 defensin beta 7 Defb7 NM_139220 7.2 10.4 502.1 0.70 48.32 69.35

A_52_P91720 SLIT and NTRK-like family, member 4 Slitrk4 NM_178740 90.4 8.3 402.1 10.83 48.17 4.45

A_52_P144818 protein phosphatase 1, regulatory (inhibitor) subunit 1A Ppp1r1a NM_021391 2544.2 519.5 24174.5 4.90 46.53 9.50

A_52_P585339 hypothetical protein 9830132L24 9830132L24 AK036546 48.3 11.1 514.0 4.35 46.39 10.65

A_51_P175988 5-hydroxytryptamine (serotonin) receptor 3A Htr3a NM_013561 40.7 10.0 462.4 4.07 46.17 11.36

A_52_P536434 insulin-like growth factor 1 Igf1 NM_184052 122.3 26.8 1191.7 4.56 44.48 9.75

A_51_P465082 TOX high mobility group box family member 3 Tox3 NM_172913 2993.6 646.2 28597.5 4.63 44.25 9.55

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Average Raw Intensity RATIOS

Description Gene Symbol GenBank ID All EGFP- EGFP+ All/EGFP- EGFP+/EGFP- EGFP+/All Probe ID

A_51_P184508 spermatogenesis associated glutamate (E)-rich protein 5, pseudogene 1 Speer5-ps1 AK005695 230.7 49.7 2157.1 4.65 43.44 9.35

A_51_P220317 cell division cycle associated 7 like Cdca7l NM_146040 103.0 23.5 1020.6 4.37 43.35 9.91

A_51_P172085 Rho GDP dissociation inhibitor (GDI) gamma Arhgdig NM_008113 135.9 26.2 1115.6 5.19 42.61 8.21

A_51_P335146 histocompatibility 60 H60 AF084643 10.2 11.5 473.9 0.89 41.26 46.46

A_51_P302566 monoamine oxidase B Maob NM_172778 1169.1 286.3 11744.3 4.08 41.03 10.05

A_51_P433237 cadherin 3 Cdh3 NM_007665 202.3 59.0 2389.4 3.43 40.50 11.81

A_51_P264527 RIKEN cDNA B230317C12 gene B230317C12Rik NM_019833 799.6 166.3 6721.4 4.81 40.41 8.41

A_52_P426740 RAB27A, member RAS oncogene family Rab27a NM_023635 1065.8 271.4 10746.5 3.93 39.59 10.08

A_51_P380078 Fc fragment of IgG binding protein Fcgbp BC026653 44.9 10.1 396.7 4.46 39.35 8.83

A_51_P104977 expressed sequence C77713 C77713 C77713 34.9 12.1 473.4 2.88 39.09 13.57

A_52_P16482 calcium channel, voltage-dependent, beta 4 subunit Cacnb4 NM_146123 743.3 220.1 8288.2 3.38 37.66 11.15

A_51_P385974 receptor-associated protein of the synapse Rapsn NM_009023 272.7 67.0 2501.1 4.07 37.35 9.17

A_51_P273170 nucleolar protein 3 (apoptosis repressor with CARD domain) Nol3 NM_030152 2201.3 541.8 19634.3 4.06 36.24 8.92

A_52_P305539 kininogen 2 Kng2 NM_201375 61.0 16.4 592.3 3.71 36.01 9.71

A_51_P227785 kelch-like 3 (Drosophila) Klhl3 AK033046 1913.4 491.3 17584.5 3.89 35.79 9.19

A_52_P87804 major facilitator superfamily domain containing 4 Mfsd4 NM_172510 2772.1 733.3 25844.8 3.78 35.24 9.32

A_52_P566653 WNK lysine deficient protein kinase 1 Wnk1 AK044849 950.4 273.1 9503.3 3.48 34.79 10.00

A_52_P207314 Mus musculus HtrA serine peptidase 4 (Htra4), mRNA. Htra4 XM_284398 151.1 46.8 1606.9 3.23 34.31 10.64

A_51_P125383 ankyrin repeat and SOCS box-containing protein 11 Asb11 NM_026853 221.7 59.1 2025.4 3.75 34.29 9.14

A_52_P638337 RIKEN cDNA 5031410I06 gene 5031410I06Rik NM_207657 42.2 9.3 317.5 4.52 34.06 7.53

A_51_P466633 solute carrier family 16 (monocarboxylic acid transporters), member 7 Slc16a7 NM_011391 13644.9 3199.6 108758.6 4.26 33.99 7.97

A_51_P469688 synaptotagmin XVII Syt17 NM_138649 307.5 87.8 2962.4 3.50 33.72 9.63

A_52_P280448 Unknown TC1045172 null 385.6 109.4 3677.0 3.52 33.60 9.54

A_52_P94482 tweety homolog 1 (Drosophila) Ttyh1 NM_021324 70.6 16.3 533.5 4.32 32.68 7.56

A_51_P206225 urocanase domain containing 1 Uroc1 NM_144940 4328.1 1096.3 35765.4 3.95 32.62 8.26

A_52_P519943 fatty acid desaturase domain family, member 6 Fads6 BC044804 156.7 49.2 1603.1 3.19 32.61 10.23

A_52_P434073 ligand of numb-protein X 1 Lnx1 BC040367 84.0 18.3 594.3 4.58 32.39 7.07

A_52_P322181 adrenergic receptor, beta 1 Adrb1 AK039569 577.8 189.7 6120.2 3.05 32.26 10.59

A_51_P436269 glutamate receptor, ionotropic, NMDA2C (epsilon 3) Grin2c NM_010350 215.8 48.1 1549.3 4.48 32.18 7.18

A_52_P423810 metallothionein 1 Mt1 BC027262 1653.2 574.8 18262.7 2.88 31.77 11.05

A_51_P212592 RIKEN cDNA E430002G05 gene E430002G05Rik NM_173749 2309.7 672.4 20865.4 3.43 31.03 9.03

A_52_P489495 G87803 protein K04F10.5 [imported] - Caenorhabditis elegans, partial (3%) [TC975904] TC975904 null 1300.8 376.6 11400.7 3.45 30.27 8.76

A_52_P154918 RIKEN cDNA C230095G01 gene C230095G01Rik NM_178768 1817.9 551.1 16503.6 3.30 29.95 9.08

A_51_P302398 RIKEN cDNA 1700028J19 gene 1700028J19Rik AK006462 736.2 218.3 6486.0 3.37 29.71 8.81

Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130006F20 A_52_P707535 Tiam2 AK047848 102.9 28.9 851.7 3.56 29.50 8.28 product:unclassifiable, full insert sequence.

A_52_P419455 adenosine A2b receptor Adora2b NM_007413 344.4 111.6 3200.1 3.09 28.66 9.29

A_52_P88007 solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 Slc6a7 NM_201353 44.7 11.2 321.1 3.97 28.58 7.19

A_52_P321140 defensin beta 1 Defb1 NM_007843 17432.9 4517.5 128391.1 3.86 28.42 7.36

A_51_P299149 glutathione peroxidase 6 Gpx6 NM_145451 2312.2 750.7 21225.8 3.08 28.28 9.18

IGFB_MOUSE Insulin-like growth factor IB precursor (IGF-IB) (Somatomedin). [Mouse] {Mus A_52_P351116 TC1060680 null 46.1 15.9 449.3 2.90 28.23 9.75 musculus}, complete [TC1060680] Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130096P14 A_52_P939420 product:weakly similar to L1 REPETITIVE SEQUENCE-ENCODED ORF-2 (FRAGMENT) [Mus Ap3b1 AK038350 8.1 9.6 267.6 0.84 27.90 33.20 musculus], full insert sequence. A_51_P247883 collagen, type V, alpha 2 Col5a2 NM_007737 913.5 329.4 9177.9 2.77 27.86 10.05

A_51_P199168 cell death-inducing DNA fragmentation factor, alpha subunit-like effector A Cidea NM_007702 209.2 17.2 479.7 12.15 27.86 2.29

A_51_P233153 Ca2+-dependent activator protein for secretion 2 Cadps2 NM_153163 1226.9 389.8 10834.4 3.15 27.79 8.83

Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, A_51_P138496 Tdrd3 AK046037 47.3 14.9 413.1 3.17 27.69 8.73 clone:B230337C21 product:hypothetical protein, full insert sequence.

A_51_P363338 protein kinase C, mu Prkcm NM_008858 1576.2 504.0 13936.0 3.13 27.65 8.84

A_51_P309854 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 Kcnn2 NM_080465 315.5 115.5 3119.7 2.73 27.02 9.89

A_52_P420608 gene model 1631, (NCBI) Gm1631 NM_201366 36.4 16.0 428.9 2.28 26.81 11.78

A_51_P351062 outer dense fiber of sperm tails 4 Odf4 NM_145746 254.4 70.0 1860.2 3.64 26.59 7.31

A_52_P182298 relaxin 1 Rln1 Z27088 175.8 45.4 1198.1 3.88 26.42 6.82

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary Table 3: Densitometric quantification of immunoblots

WT I-1-/- Total NCC 100  4.5 111.5  6.3 pT53 NCC 100  6.1 41.7  3.7 *** pT58 NCC 100  12.7 44.5  5.8 *** pS71 NCC 100  8.5 51.9  8.7 *** pS89 NCC 100  13.9 54.4  6.1 * NaPi2a 100  5.0 101.5  16.3 NKCC2 100  5.6 86.2  14.7 ENaC (90kD) 100  7.3 100.0  6.7 ENaC (30kD) 100  12.5 123.6  11.9 ENaC 100  10.8 79.6  4.2 ENaC (85kD) 100  5.8 107.9  6.4 ENaC (70kD) 100  7.8 103.4  2.5 Pendrin 100  6.1 119.1  2.8 * NDCBE 100  4.1 106.6  2.8

Picard, Trompf et al. I-1 controls NCC phosphorylation Supplement

Supplementary Table 4: Renal gene expression in I1-/- mice

WT I-1-/- NKCC2 0.0399  0.0009 0.0404  0.0043 NCC 0.554  0.017 0.601  0.018 Renin 0.0386  0.0032 0.0455  0.0036 WNK1 Kidney-Specific 0.0482  0.0018 0.0531  0.0027 WNK4 0.0511  0.0020 0.0516  0.0029