Genetics: Early Online, published on August 23, 2019 as 10.1534/genetics.119.302416
1
1 Maintenance of melanocyte stem cell quiescence by GABA-A signaling in larval
2 zebrafish
3
4 James R. Allen1*, James B. Skeath1, Stephen L. Johnson1†
5
6 1Department of Genetics, Washington University School of Medicine, St. Louis, Missouri,
7 63110, USA
8
9 *Corresponding Author
10 † Deceased
11 Dedication: This paper is dedicated to the late Dr. Stephen L. Johnson.
12
13
14
15
16
17
18
19
20
21
22
23
Copyright 2019. 2
1
2
3 Running Title: GABA-A inhibits zebrafish pigmentation
4 Key Words: GABA, melanocyte, GABA-A receptors, quiescence, zebrafish,
5 pigmentation, inhibition, CRISPR
6 Corresponding Author:
7 Department of Genetics, Room 6315 Scott McKinley Research Building, 4523 Clayton
8 Avenue, Washington University School of Medicine, St. Louis, MO, 63110
9 Ph: 314-362-05351, E-mail: [email protected]
10
11
12
13
14
15
16
17
18
19
20
21
22
23 3
1 Abstract:
2 In larval zebrafish, melanocyte stem cells (MSCs) are quiescent, but can be recruited to
3 regenerate the larval pigment pattern following melanocyte ablation. Through
4 pharmacological experiments, we found that inhibition of GABA-A receptor function,
5 specifically the GABA-A rho subtype, induces excessive melanocyte production in larval
6 zebrafish. Conversely, pharmacological activation of GABA-A inhibited melanocyte
7 regeneration. We used CRISPR-Cas9 to generate two mutant alleles of gabrr1, a subtype
8 of GABA-A receptors. Both alleles exhibited robust melanocyte overproduction, while
9 conditional overexpression of gabrr1 inhibited larval melanocyte regeneration. Our data
10 suggest that gabrr1 signaling is necessary to maintain MSC quiescence and sufficient to
11 reduce, but not eliminate, melanocyte regeneration in larval zebrafish.
12
13 Introduction:
14 Vertebrate animals often rely on undifferentiated precursors to regulate growth and
15 homeostasis of specific tissues. These precursors, adult stem cells (ASCs), undergo long-
16 term self-renewal throughout the lifetime of the organism to maintain the growth and
17 regenerative potential of their target tissue. ASCs are found in many tissues including
18 blood, muscle, skin, and nervous system (Bertrand, Kim et al. 2007, Cheung and Rando
19 2013, Nishimura, Jordan et al. 2002, Ma, Bonaguidi et al. 2009). While some ASCs
20 continually proliferate to maintain their target tissue, others remain quiescent or dormant
21 and must be recruited in order to enter a proliferative state, often induced by depletion of
22 differentiated cells in their respective tissues (Li and Bhatia 2011). Understanding the 4
1 pathways that maintain ASC quiescence and that recruit quiescent ASCs to proliferate is
2 critical to elucidate vertebrate tissue growth and homeostasis.
3
4 Zebrafish pigmentation, specifically melanocyte development, is an excellent model
5 system to dissect the genetic and molecular basis of ASC quiescence and recruitment.
6 Both adult melanocytes and melanocytes that regenerate appear to derive from
7 recruitable melanocyte stem cells (MSCs) (Johnson, Africa et al. 1995, Rawls and
8 Johnson 2000). For example, genetic studies indicate that the embryonic melanocyte
9 pattern develops from direct-developing melanocytes and is complete by 3 days post
10 fertilization (dpf) (Hultman, Budi et al. 2009). Under normal conditions, few new
11 melanocytes develop from 3 dpf until the onset of metamorphosis at approximately 15 dpf
12 (Hultman and Johnson 2010). However, when embryonic melanocytes are removed via
13 laser or chemical treatment during this time, a rapid and complete regeneration of the
14 melanocyte pattern occurs through activation of cell division in melanocyte precursors,
15 MSCs (Yang, Sengelmann et al. 2004, Yang and Johnson 2006). MSCs normally lie
16 dormant during larval zebrafish pigmentation, but can be recruited upon loss of
17 differentiated melanocytes. The pathways that regulate MSC quiescence and recruitment
18 are poorly understood.
19
20 Forward genetic studies have helped clarify the genetic regulatory hierarchy that controls
21 melanocyte production and MSC proliferation in zebrafish. These studies highlight the
22 importance of three genes in zebrafish pigmentation – the receptor tyrosine kinase
23 erbb3b, the transcription factor mitfa, and the receptor tyrosine kinase kita. Adult zebrafish 5
1 mutant for erbb3b, named picasso, exhibit defective melanocyte stripe formation, even
2 though larval erbb3b mutants exhibit a wild-type pigment pattern (Budi, Patterson et al.
3 2008). Critically, when picasso mutant zebrafish are challenged for melanocyte
4 regeneration during larval stages, melanocyte regeneration is completely abrogated,
5 suggesting that regenerating melanocytes require erbb3b function, while early embryonic
6 melanocytes do not (Hultman, Budi et al. 2009). This finding led to a model wherein a
7 subset of migratory neural crest cells directly differentiate into embryonic melanocytes
8 (direct-developing melanocytes), and other erbb3b-dependent neural crest cells establish
9 undifferentiated melanocyte precursors, MSCs, that persist throughout zebrafish adult life
10 and can be recruited to form new (stem-cell derived) melanocytes throughout larval and
11 adult stages (Dooley, Mongera et al. 2013).
12
13 Additional insight into MSCs arose from experiments using a temperature-sensitive
14 mutation of melanocyte inducing transcription factor a (mitfa), which is required for all
15 melanocyte development and survival across vertebrate biology (Lister, Robertson et al.
16 1999, Levy, Khaled et al. 2006). These studies revealed that mitfa function was required
17 for the embryonic pigment pattern, but was not required for the survival of MSCs
18 (Johnson, Nguyen et al. 2011). Therefore, while required for melanocyte survival, mitfa
19 function is not required for the survival of MSCs that can regenerate larval melanocytes
20 and produce the adult pigment pattern.
21
22 The receptor tyrosine kinase kita plays key roles during zebrafish pigment patterning.
23 Removal of kita function, as seen in the sparse mutant, results in a roughly 50% loss of 6
1 larval melanocytes, but the adult melanocyte pattern is largely normal (Parichy, Rawls et
2 al. 1999). Thus, kita function is required for the development of direct developing
3 melanocytes. kita does, however, regulate MSC function. For example, kita function is
4 required for melanocyte regeneration during larval stages and for melanocyte
5 regeneration in the caudal fin at all stages (Rawls and Johnson 2001, Rawls and Johnson
6 2003, O'Reilly-Pol and Johnson 2013).
7
8 GABA is a major inhibitory neurotransmitter that transduces its signal by binding to and
9 activating GABA receptors, such as the GABA-A receptor class (Bormann 2000). GABA-
10 A receptors are voltage-gated chloride channels. When activated, they allow Cl- ions to
11 move down their electrochemical gradient into the cell, which hyperpolarizes the cell and
12 inhibits action potential propagation along axons (Sigel and Steinmann 2012). Although
13 GABA is best known to function as a neurotransmitter, prior studies indicated that GABA
14 can inhibit the proliferation of murine embryonic stem cells and peripheral neural crest
15 stem cells (Young and Bordey 2009, Teng, Tang et al. 2013). A role for GABA signaling
16 in regulating vertebrate pigment patterning, however, has not been shown.
17
18 Here, we show that pharmacological and genetic inhibition of GABA-A receptor function
19 leads to excessive melanocyte production during larval zebrafish development, with the
20 newly produced melanocytes likely arising from MSCs. Conversely, we show that
21 pharmacological or genetic activation of GABA-A signaling inhibits melanocyte
22 regeneration. Our work shows that GABA-mediated signaling promotes MSC quiescence 7
1 during zebrafish development and highlights the importance of membrane potential and
2 bioelectric sensing in regulating pigment patterning in vertebrates.
3
4 Materials and Methods:
5 Zebrafish stocks and husbandry
6 Adult fish were raised and maintained at 14L:10D light-to-dark cycle according to
7 previously standardized protocols (Westerfield 2000). To facilitate melanocyte
8 quantification, homozygous mlpha fish was used as wild-type and all experiments were
9 performed in a homozygous mlpha genetic background unless otherwise indicated
10 (Sheets, Ransom et al. 2007). To perform our melanocyte differentiation assay, we used
11 mlpha fish carrying Tg(fTyrp1:GFP)j900 (Tryon and Johnson 2012). To genetically ablate
12 melanocytes, we used mlpha fish homozygous for the temperature-sensitive mitfavc7
13 mutation (Johnson, Nguyen et al. 2011). The kitab5 allele in a mlpha background was
14 used in the study to test lineage specificity within MSCs (Parichy, Rawls et al. 1999). We
15 used the mlpha background to generate our two CRISPR-based mutations in gabrr1.
16 Embryos of each genotype used in the present study were generated from in vitro
17 fertilization.
18 Pharmacological reagents and drug screening
19 Our initial screen used a drug repurposing panel (Pfizer) containing approximately 500
20 unique compounds to identify melanocyte promoting drugs. In this panel, each compound
21 was supplied as a 30 mM stock solution in 96-well plates. We subsequently diluted each 8
1 compound into 2mM working solutions for further testing across multiple doses generally
2 ranging between 1-100 µM in 96 well plates. With this approach, we identified three
3 compounds that increased melanocyte number: PF-04138835, an AKT inhibitor; PF-
4 04269339-01, a 5-HT1A receptor partial agonist; and CP-615003-27, a GABA-A receptor
5 antagonist. All other drugs used in the study were purchased from commercial vendors
6 (Table S1). Each drug was handled according to manufacturer’s guidelines, but in general
7 each compound was dissolved in a solvent (dimethyl sulfoxide: DMSO or water) to a stock
8 concentration of 20 mM. For drug experiments, 10-12 embryos were placed into 24-well
9 plates with approximately 2 mL egg water (60 mg / L Instant Ocean: 0.06 ppt). The stock
10 solution of each drug was then diluted and added to 2 ml Egg water to a final vehicle
11 concentration of 0.5% DMSO or water (Table S1). For our melanocyte differentiation
12 assay, we used phenylthiocarbamide (PTU) at a final concentration of 200 µM in egg
13 water. Experiments were performed as parallel duplicates for each drug treatment.
14 Melanocyte counting
15 We focused our analysis of melanocyte development on the larval dorsal stripe. We
16 quantified melanocytes along the dorsum, beginning with the melanocytes located
17 immediately caudal to the otic vesicle and along the stripe to the posterior edge of the
18 caudal fin. Each larvae was analyzed once as a biological replicant for the indicated
19 experiment, and no further analysis on individual fish as technical replicants were used in
20 this study. Larvae with severe morphological defects, such as cardiac edema, were
21 excluded from analysis.
22 Generation of CRISPR/Cas9-mediated gabrr1 mutations 9
1 We used a previously described software tool to design guide ribonucleic acids (gRNAs)
2 that target the gabrr1 locus (E-CRISP: http://www.e-crisp.org/E-CRISP/(Heigwer, Kerr et
3 al. 2014)). We chose a gRNA (Table S2) that targeted a highly conserved stretch of
4 residues within the gabrr1 coding sequence (Wang, Hackam et al. 1995). Briefly, we
5 cloned our gabrr1 gRNA sequence into pT7-gRNA (Addgene: plasmid # 46759; Table
6 S2). We used the mMessage mMachine T7 RNA synthesis kit (Thermo Fisher: #AM1344)
7 to synthesize non-capped guide RNA targeting gabrr1. We used the mMessage
8 mMachine SP6 RNA synthesis kit (Thermo Fisher: #AM1340) to generate capped Cas9
9 mRNA from pCS2-nCas9n (Jao, Wente et al. 2013). Using a Olympus SZ40 microscope,
10 we injected one-to-two cell stage embryos with solution containing gabrr1 guide RNA (75-
11 100 ng/µl), Cas9 mRNA (300-400 ng/µl), and phenol red (1%). Injected embryos were
12 reared to adulthood, and sperm samples were screened for Cas9-induced mutations. The
13 genotyping assay was performed by amplifying a 500 bp amplicon flanking the gabrr1
14 target locus (Table S2), digesting with T7 endonuclease I (NEB: #M0302S) and Hpy166II
15 (NEB: #R0616S), then analyzing with gel electrophoresis. T7-digested F0 founders with
16 putative gabrr1 lesions were outcrossed to mlpha and reared to adulthood. F1 individuals
17 were genotyped with Hpy166II and sequenced to identify mutation, outcrossed to
j900 18 Tg(fTyrp1:GFP) , and analyzed for PTU melanocyte differentiation. F1 individuals were
19 intercrossed and F2 progeny were genotyped with Hpy166II and sequenced to identify
20 homozygous gabrr1 mutant fish. Homozygous F2 fish were outcrossed to
j900 21 Tg(fTyrp1:GFP) to generate clutches of F3 heterozygotes, or intercrossed to generate
22 clutches of homozygous embryos for analysis.
23 Generation of hsp70l:gabrr1 transgenic line 10
1 We generated a stable transgenic line to conditionally overexpress gabrr1 under the
2 heat shock promoter Tg(hsp70l:gabrr1)j972. We used PCR-based methods to clone the
3 full-length gabrr1 cDNA (Table S2) downstream of hsp70l promoter (Pac1 site) in pT2-
4 hsp70l (Halloran, Sato-Maeda et al. 2000; Tyron and Johnson 2014) using Infusion HD
5 cloning kit (Takara Bio: #638909). We used the mMessage mMachine SP6 RNA
6 synthesis kit to synthesize capped transposase mRNA from pCS-TP (Kawakami,
7 Takeda et al. 2004). To create a germline integrated hsp70l:gabrr1, we injected
8 embryos at the one or two cell stage with solution containing pT2-hsp70l:gabrr1 plasmid
9 (25-50 ng/µl), transposase mRNA (50-75 ng/µl), and phenol red (1%). Injected F0
10 animals were screened at 1-2 dpf for the clonal marker xEf1 :GFP, indicating genomic
11 integration of the construct. GFP+ embryos were reared to adulthood, outcrossed to
12 mlpha, and the resulting progeny were screened for germline transmission of the
13 xenopus EF1 :GFP clonal marker (Johnson and Krieg 1995). We established one
14 stable hspl:gabrr1 transgenic line: Tg(hsp70l:gabrr1)j972.
15 Heat shock induction
16 Adult zebrafish carrying Tg(hsp70l:gabrr1)j972 were outcrossed to mlpha strains to
17 generate clutches of Tg(hsp70l:gabrr1)j972/+; mlpha. From 1-3 dpf, embryos were then
18 treated with the melanocyte pro-drug 4-hydroxyanisole (Sigma: M18655; 4-HA: 10 mg/ml
19 in DMSO) to ablate melanocytes. At 3 dpf, 4-HA was washed away, embryos were placed
20 in 50 ml conical tubes, and heat shocked at 37 °C in a water bath for 30 minutes. The
21 heat shock treatment was repeated every 24 hours at 3, 4, and 5 dpf. At 6 dpf, the 11
1 experiment was terminated and larvae were fixed in 3.7% formaldehyde for melanocyte
2 quantification.
3 Microscopy and imaging
4 To screen for transgenic markers, embryos were anesthetized in tricaine mesylate and
5 screened for GFP expression using an epifluorescence stereomicroscope (Nikon
6 SMZ1500). Images of representative larvae were taken with a Zeiss AxioCam MrC Digital
7 Camera (Zeiss AxioVision imaging software). Images were then analyzed and processed
8 using Fiji software (Schindelin, Arganda-Carreras et al. 2012).
9 Statistical analysis
10 In each experiment, we performed single factor ANOVA ( : 0.01) to compare the means
11 of each experimental group. We then performed Tukey’s HSD post hoc tests to determine
12 which groups were significantly different from their corresponding control. All statistical
13 tests and reported p-values were calculated in Microsoft Excel.
14 Data availability
15 Strains and plasmids are available upon request. The authors affirm that all data
16 necessary for confirming the conclusions of the article are present within the article,
17 figures, and tables.
18
19 Results:
20 12
1 GABA-A antagonists increase melanocyte production in larval zebrafish
2
3 We sought to explore the molecular regulation of MSC quiescence by searching for drugs
4 that result in excess melanocyte development in the larval zebrafish. Previously, our lab
5 found that the larval pigment pattern develops from direct-developing melanocytes and is
6 largely complete by 3 dpf, but that melanocytes that develop after 3 dpf or those that
7 regenerate the pigment pattern following melanocyte ablation develop from MSCs
8 (Hultman, Budi et al. 2009, Hultman and Johnson 2010). We took advantage of this
9 finding and designed a small molecule screen to identify compounds that increase
10 melanocyte output after 3 dpf. Our screen used larvae expressing the melanocyte marker
11 fTyrp1:GFPj900, and incubated them in a solution containing the screened compound and
12 the melanin inhibiting drug PTU. Newly generated melanocytes were uniquely identified
13 based on the lack of melanin (mel-) and expression of GFP (GFP+), the mel-, GFP+
14 melanocytes. We focused on the dorsal larval stripe because we previously found that
15 less than two new melanocytes develop within this region between 3 dpf and 6 dpf
16 (Hultman and Johnson 2010). This infrequent development of new melanocytes provided
17 a low background that allowed us to screen for compounds that induced even a small
18 increase in melanocyte production.
19
20 We screened over 500 compounds from a Pfizer repurposing panel and identified a
21 GABA-A receptor antagonist (CP-615003-27) that increased melanocyte production
22 between 3 and 6 dpf. Consistent with previous findings from our lab, zebrafish treated
23 with a vehicle control developed on average 1.05 mel-, GFP+ melanocytes in the dorsal 13
1 larval stripe (Fig. 1B, 1F). Larvae treated with the GABA-A antagonist CP-615003-27
2 developed on average 4.0 newly formed mel-, GFP+ melanocytes in the same region (Fig.
3 1C, 1F), a significant increase over vehicle control treated fish (Fig. 1F). To confirm the
4 effect of GABA-A inhibition on melanocyte production and development, we tested two
5 other GABA-A antagonists. Zebrafish treated with the GABA-A antagonist Picrotoxin
6 developed on average 3.7 mel-, GFP+ melanocytes (Fig. 1D, 1F), and zebrafish treated
7 with the GABA-A rho antagonist TPMPA developed on average 4.1 mel-, GFP+
8 melanocytes (Fig. 1E, 1F). Our finding that inhibition of GABA-A receptors through distinct
9 GABA-A antagonists increases melanocyte production suggested that GABA-A signaling
10 regulates MSC quiescence in larval zebrafish.
11
12 GABA-A antagonist induced melanocytes derive from MSCs
13
14 We next asked whether the newly formed melanocytes that develop following GABA-A
15 antagonist treatment arise from a melanocyte stem cell or precursor lineage. Our previous
16 work supported a model that melanocytes within the dorsal stripe primarily develop from
17 undifferentiated MSCs or melanocyte precursors after 3 dpf, suggesting that GABA-A
18 antagonists induce MSCs to produce new melanocytes. However, it remained formally
19 possible that pharmacological inhibition of GABA-A signaling could activate aberrant
20 melanocyte development from a non-stem cell source through an unknown mechanism.
21 To distinguish between these mechanisms, we treated zebrafish embryos with either
22 DMSO or the erbb3 inhibitor AG1478 from 8-48 hours post fertilization (h.p.f.), washed
23 out the drug, and then treated the larvae with solution containing PTU and a GABA-A 14
1 antagonist from 3-6 dpf (Fig. 2A). AG1478-mediated inhibition of erbb3 activity has been
2 previously shown to inhibit melanocyte regeneration and metamorphic melanocyte
3 development in zebrafish (Hultman, Budi et al. 2009 , Budi, Patterson et al. 2008). Early
4 treatment with this small molecule is thought to block establishment of MSCs, removing
5 the developmental source of new melanocytes (Dooley, Mongera et al. 2013). Therefore,
6 if new melanocytes arise from MSCs, we predicted that prior AG1478 treatment would
7 inhibit the ability of GABA-A antagonists to induce melanocyte production.
8
9 For this analysis, we focused on two representative GABA-A antagonists: TPMPA and
10 Picrotoxin. After each drug treatment, individual larvae were scored for average mel-,
11 GFP+ melanocytes in the dorsal stripe, which we interpret as newly developed
12 melanocytes in the presence of PTU. Zebrafish larvae treated with DMSO and vehicle
13 control developed 1.76 mel-, GFP+ melanocytes, while larvae treated with AG1478 and
14 vehicle control developed 0.32 mel-, GFP+ melanocytes (Fig. 2B). This result suggested
15 that the AG1478 treatment effectively blocked late (3-6 dpf) melanocyte production. Thus,
16 our PTU assay could detect relatively small changes in melanocyte production, which
17 allowed us to confidently test the combinatorial effects of AG1478 and GABA-A
18 antagonists on melanocyte production. Larvae treated with DMSO and the GABA-A
19 antagonist TPMPA developed 4.1 mel-, GFP+ melanocytes, but larvae treated with
20 AG1478 and TPMPA developed only 0.28 mel-, GFP+ melanocytes. Similarly, larvae
21 treated with DMSO and Picrotoxin developed 5.2 mel-, GFP+ melanocytes, but larvae
22 treated with AG1478 and Picrotoxin developed only 0.17 mel-, GFP+ melanocytes (Fig. 15
1 2B). We conclude that GABA-A antagonists induce melanocyte production from erbb3-
2 dependent undifferentiated melanocyte precursors.
3
4 Pharmacological activation of GABA-A signaling inhibits melanocyte regeneration
5
6 Our data support the model that inhibition of GABA-A receptor signaling increases
7 melanocyte production from undifferentiated precursors. This provided a clear prediction
8 that activation of GABA-A signaling would inhibit melanocyte production. To test this
9 hypothesis, we chose to treat larvae homozygous for the temperature sensitive mitfavc7
10 allele with drugs that activate GABA-A receptor signaling. When raised at a restrictive
11 temperature (32 C), the temperature sensitive nature of the mitfavc7 allele prevents
12 melanoblast survival, and mitfavc7 larvae develop no melanocytes. When shifted to a
13 permissive temperature (25 C), mitfa function is restored and mitfavc7 larvae exhibit a near
14 complete regeneration of the larval pigment pattern (Johnson, Nguyen et al. 2011). The
15 homozygous mitfavc7 allele then provided us with temporal control of melanocyte
16 development and regeneration to test the effects of GABA-A receptor activation.
17
18 To determine if GABA-A agonists inhibit melanocyte production, we reared mitfavc7 larvae
19 to 3 dpf at 32 C, and then down-shifted to 25 C in the presence of a GABA-A receptor
20 drug (Fig. 3A). As a measure of melanocyte regeneration following downshift, we scored
21 larvae for the number of dorsal stripe melanocytes present as a developmental stage
22 equivalent to 6 dpf when zebrafish are grown continuously at 28.5 C (Kimmell, Ballard et
23 al., 1995). Mitfavc7 larvae treated with vehicle control regenerated 42.2 dorsal 16
1 melanocytes (Fig 3B, 3H). However, mitfavc7 larvae treated with the endogenous ligand
2 GABA or the GABA-A rho agonist GABOB regenerated only 21.2 and 26.8 dorsal
3 melanocytes, respectively (Fig. 3C-D, 3H). The reduction of melanocyte regeneration
4 following treatment of GABA-A agonists suggested that direct activation of GABA-A
5 signaling partially inhibited melanocyte regeneration. To further challenge this idea, we
6 treated mitfavc7 larvae with drugs that indirectly activated GABA-A receptor signaling and
7 challenged for melanocyte regeneration. Larvae treated with the GABA-A partial agonists
8 L-838,417 (Fig. 3E, 3H) and MK 0343 (Fig. 3G, 3H) regenerated, on average, 16 dorsal
9 melanocytes and 18.1 dorsal melanocytes respectively. Similarly, larvae treated with the
10 GABA reuptake inhibitor CI-966, which increases synaptic concentrations of GABA (Ebert
11 and Krnjevic 1990), regenerated only 20.4 dorsal melanocytes (Fig. 3F, 3H). The effects
12 of these GABA-A activating drugs were not restricted to the dorsal stripe, and appeared
13 to reduce pigmentation across the ventral and lateral regions of the larvae as well (Fig.
14 S1). Our data suggest that pharmacological activation of GABA-A receptor signaling
15 inhibits melanocyte production from MSCs.
16
17 GABA-A rho 1 is necessary for restriction of melanocyte production in larval
18 zebrafish
19
20 To validate our pharmacology results, we sought to genetically remove GABA-A signaling
21 and assess the impact on melanocyte production. Here, we focused on the GABA-A rho
22 receptor subtype, as the GABA-A rho subtype-specific drug TPMPA yielded a robust
23 increase in melanocyte production (Fig. 1F). Fortunately, GABA-A rho receptors are 17
1 homo-pentameric, allowing us to target a single gene to disrupt receptor function
2 (Martinez-Delgado, Estrada-Mondragon et al. 2010). To target GABA-A rho receptor
3 function, we used a CRISPR-based strategy to target the GABA-A rho 1 (gabrr1) gene.
4 We specifically targeted a region in the ligand-binding domain that is critical for zinc
5 inhibition to increase the likelihood of disrupting endogenous protein function (Wang,
6 Hackam et al. 1995). Using a PCR- and restriction enzyme-based method, we identified
7 two putative gabrr1 alleles with altered DNA sequence at the targeted site (Fig. 4A).
8 Sequence analysis and protein alignments of both alleles revealed two gabrr1 in-frame
9 mutations (Fig. 4A, 4B), both of which delete the conserved residues VHS from position
10 146-148 of the polypeptide sequence, with one allele gabrr1j247, also substituting the
11 lysine at position 149 to glutamic acid (Fig. 4B).
12
13 To determine if genetic reduction of gabrr1 function altered melanocyte development,
j900 14 we outcrossed carriers of each gabrr1 mutation to fTyrp1:GFP , treated the F1 progeny
15 with PTU from 3-6 dpf, and quantified newly generated dorsal melanocytes. Both alleles
16 demonstrated a robust dominant excess melanocyte phenotype. Zebrafish heterozygous
17 for the gabrr1j247 allele developed 9.56 mel-, GFP+ dorsal melanocytes (Fig. 4C, 4E), a
18 five-fold increase over wild-type siblings (Fig. 4C, 4D). Zebrafish heterozygous for the
19 gabrr1j248 allele developed 7.81 mel-, GFP+ melanocytes (Fig. 4C, 4F), while trans-
20 heterozygous gabrr1j247/248 fish developed 9.72 mel-, GFP+ melanocytes on average.
21 These results suggest the two gabrr1 alleles function as dominant-negative alleles,
22 although it remains possible they are haploinsufficienct for gabrr1 function. The gabrr1
23 mutant phenotypes mirror the excess melanocyte phenotype observed upon 18
1 pharmacological inhibition of GABA-receptor function (Fig. 1). We observe no gross
2 change to adult melanocyte patterns in either heterozygous or homozygous adult mutant
3 fish, suggesting the melanocyte pigment pattern recovers during the adult transition and
4 that melanocyte patterning is most sensitive to gabrr1 signaling during larval
5 development. We infer that gabrr1 function is necessary to inhibit excessive melanocyte
6 production in the larval zebrafish, suggesting that GABA signaling through gabrr1 is a key
7 regulatory pathway that normally maintains melanocyte stem cell quiescence in larval
8 zebrafish.
9
10 GABA-A rho 1 is sufficient to reduce, but not inhibit, melanocyte regeneration in
11 larval zebrafish
12
13 Our observation that gabrr1 function is necessary to inhibit melanocyte production led us
14 to test whether over-expression of gabrr1 was sufficient to inhibit melanocyte
15 regeneration. To address this question, we cloned the gabrr1 cDNA under control of the
16 heat shock promoter element hsp70l within the Tol2 germ-line transformation vector and
17 obtained a stable transgenic line: Tg(hsp70l:gabrr1)j972 (Suster, Kikuta et al. 2009). We
18 then treated Tg(hsp70l:gabrr1)j972 and control larvae with the drug 4-HA from 1-3 dpf to
19 ablate melanocytes, washed the drug out, induced heat shock at 37 C, and then
20 quantified melanocyte regeneration at 6 dpf (Fig. 5A). Heat shocked wild-type and non-
21 heat shocked Tg(hsp70l:gabrr1)j972 larvae regenerated on average 49.9 and 51.1
22 melanocytes respectively, whereas heat shocked Tg(hsp70l:gabrr1)j972 larvae
23 regenerated on average 32.3 melanocytes, a roughly 40% reduction in melanocyte 19
1 production (Figure 5B; 5C). Thus, overexpression of gabrr1 can repress production of
2 melanocytes during periods of regeneration. The over-expression of gabrr1 also
3 appeared to inhibit melanocyte production both ventrally and laterally, but this effect was
4 not as obvious as the effect of the dorsal stripe (Fig. S3). Expression of gabrr1 then
5 appears partially sufficient to inhibit melanocyte regeneration in larval zebrafish.
6
7 Kita signaling and gabrr1 function within the same MSC lineage
8
9 We next determined whether kita function was required for GABAergic maintenance of
10 melanocyte stem cell quiescence. Zebrafish heterozygous for the kitab5 null allele
11 regenerate only about 50% of the larval pigment pattern, suggesting a reduction of the
12 melanocyte stem cell pool consistent with the effects of kit haploinsufficiency observed in
13 mammals (Geissler, Ryan et al. 1988, O'Reilly-Pol and Johnson 2013). To test for
14 possible interactions between kita and gabrr1, we asked whether kita haploinsufficiency
15 inhibited the melanocyte over-production phenotype observed in gabrr1 mutants. We
16 generated control and kitab5/+; gabrr1j247/+ double-heterozygous larvae, reared them to 3
17 dpf, treated them with PTU, and then scored for excess melanocyte production at 6 dpf.
18 As previously observed, wild-type larvae developed 2 excess melanocytes between 3-6
19 dpf, kitab5/+ larvae developed 1.5 excess melanocytes, and gabrr1j247/+ developed 9
20 excess melanocytes on average (Figure 6). Of note, kitab5/+; gabrr1j247/+ larvae developed
21 on average 1.5 excess melanocytes, indicating that the gabrr1 mutant melanocyte over-
22 production phenotype depends entirely on normal kita function, suggesting that GABA-A
23 mediated MSC quiescence is restricted within kita-dependent melanocyte lineages. 20
1
2 Discussion:
3
4 Our work provides evidence that GABAergic signaling promotes MSC quiescence in
5 larval zebrafish. Both pharmacological and genetic studies indicate that reduction of
6 GABA-A rho signaling increases melanocyte production, whereas over-expression of
7 GABA-A rho signaling inhibits melanocyte production. Although both classical and recent
8 studies implicate membrane potential in pigmentation and stem cell proliferation, to our
9 knowledge, our study is the first to uncover such a role for GABA-A receptor signaling in
10 vertebrate pigment biology. Below, we propose a model for how GABA-A signaling
11 regulates melanocyte development, discuss the nature of the GABA-A rho mutants, and
12 place our work in the context of old and new studies that highlight the importance of
13 membrane potential and cell excitability in regulating stem cell proliferation and
14 pigmentation.
15 Our work indicates that GABAergic signaling, directly or indirectly, maintains the MSC in
16 a quiescent state. Prior studies suggest that differentiated larval melanocytes inhibit
17 melanocyte differentiation by suppressing MSC proliferation. For example, chemical or
18 laser ablation of differentiated larval melanocytes induces melanocyte regeneration by
19 promoting the cell division of stem-cell like melanocyte progenitors. In this context, our
20 work provides a conceptual model for how the presence of differentiated melanocytes
21 promotes MSC quiescence and how their absence triggers MSC proliferation and
22 melanocyte production. Our pharmacological and genetic data support a model wherein
23 melanocytes release the neurotransmitter GABA, which activates gabrr1 receptors on the 21
1 melanocyte stem cell, maintaining the MSC in a quiescent state. Conversely, loss of
2 melanocytes would trigger a reduction in GABA concentration and relieve gabrr1-
3 mediated quiescence, triggering MSC proliferation and melanocyte production. Currently,
4 this highly speculative model requires precise mapping of the cells that express GABA
5 and gabbr1 in the melanocyte lineage to test its validity. Our data do not rule out that
6 GABAergic signaling could act indirectly to regulate MSC quiescence, as melanocytes
7 could release a non-GABA signal, which triggers a GABA to GABA receptor relay in
8 adjacent cells and tissues that ultimately promotes MSC quiescence. Clearly, additional
9 work is required to address whether GABAergic signaling directly or indirectly controls
10 MSC quiescence, but the presence of GABA synthesis enzymes, such as GAD67 mRNA,
11 in human melanocytes hints that GABA signaling may be an evolutionarily conserved
12 mechanism that regulates vertebrate pigmentation (Ito, Tanaka et al. 2007).
13
14 Dominant-negative nature of gabrr1 mutant alleles
15
16 Both gabrr1 alleles exhibit essentially identical melanocyte over-production phenotypes
17 when in the heterozygous, trans-heterozygous, or homozygous state, a phenotype similar
18 to that observed upon pharmacological inhibition of GABA-A signaling. Both gabrr1 alleles
19 remove a highly conserved triplet of amino acids in the ligand-binding domain of the
20 receptor (Wang, Hackam et al. 1995). Thus, each allele likely produces a non-functional
21 subunit. Although it is formally possible that these mutant alleles are haplo-insufficient,
22 we favor the model they act in a dominant negative manner since GABA-A rho receptors
23 are known to function as homo-pentamers. Thus, if the mutant form of the protein is 22
1 expressed at roughly wild-type levels, and can assemble into GABA-A rho pentamers,
2 only a tiny fraction of these pentamers would be composed of five wild-type subunits,
3 providing a rational explanation for the dominant nature of the gabrr1 mutant alleles.
4
5 Do multiple extrinsic pathways regulate MSC quiescence?
6
7 When challenged for regeneration, zebrafish larvae produce hundreds of new
8 melanocytes to repopulate the pigment pattern. These new melanocytes derive from a
9 pool of established precursors, MSCs. Though usually quiescent, MSCs are capable of
10 producing hundreds of new melanocytes throughout development. Using clonal analysis,
11 we previously estimated that the developing zebrafish establishes between 150-200
12 MSCs before 2 dpf (Tryon, Higdon et al. 2011). The MSC pool, though quiescent, then
13 maintains abundance in number and regenerative capability. Complete abrogation of the
14 mechanisms that maintain MSC quiescence would then be expected to generate excess
15 melanocytes proportional to the regenerative capabilities of all MSCs, i.e. generate
16 hundreds of excess melanocytes. Pharmacological or genetic inhibition of GABA-A
17 signaling, however, yields only 8-10 excess melanocytes on average (Fig. 1; Fig. 4).
18 Thus, the full regenerative capability of larval zebrafish likely involves the concerted
19 actions of multiple pathways that converge on activation of MSC proliferation.
20
21 Our genetic studies with kita and gabrr1 suggest GABA-A signaling may regulate a kita-
22 dependent pool of MSCs (Tu and Johnson 2010). For example, our prior work indicated
23 that haploinsufficiency for kita reduces the available MSC pool by about 50% (O'Reilly- 23
1 Pol and Johnson 2013). But, haploinsufficiency for kita completely suppressed the over-
2 production of melanocytes caused by reduced gabrr1 function, suggesting that normal
3 kita signaling is required for all GABA sensitive MSCs, but that not all larval MSCs within
4 are sensitive to either kita or GABA-A signaling. The requirement of kita signaling within
5 the gabrr1-driven melanocyte lineage of zebrafish may then be indicative of regulatory
6 pathways that suppress melanocyte production in a region-specific manner.
7
8 Which pathways function in parallel with gabrr1 to suppress MSC proliferation remain
9 unclear. Recent work completed during the course of our study suggest the endothelin
10 receptor Aa (ednraa) acts in parallel to gabrr1 to maintain MSC quiescence. For example,
11 loss of ednraa function leads to ectopic melanocyte production (via a MSC intermediate)
12 specifically within the ventral trunk of larval zebrafish, whereas we find that genetic
13 reduction of gabrr1 function increased MSC-derived melanocyte production in the dorsal
14 stripe (Camargo-Sosa, Colanesi et al. 2019), even though pharmacological or genetic
15 activation of gabrr1 signaling appeared to reduce pigmentation in a larval-wide manner.
16 These studies support the idea that distinct genetic pathways maintain MSC quiescence
17 in a region-specific manner throughout zebrafish development. Clearly, additional work is
18 needed to determine whether other pathways act with gabbr1 and ednraa to promote
19 MSC quiescence, but our work hints that GABA-A mediated quiescence may be a
20 hallmark of vertebrate pigment biology.
21
22 Bioelectric regulation of MSC quiescence and proliferation
23 24
1 GABA receptors function as ligand-gated channels that regulate membrane potential,
2 suggesting changes in membrane potential trigger the observed changes in melanocyte
3 patterning and MSC quiescence and proliferation. Inhibition of gabbr1 function, which
4 should depolarize the cell, induced melanocyte production through an MSC intermediate.
5 In this context, we note that prior work observed severe hyperpigmentation in xenopus
6 larvae due to melanocyte over-proliferation and over-production via pharmacological
7 depolarization of glycine gated chloride channels (Blackiston, Adams et al. 2011). In
8 addition, application of GABA and GABA-A agonists, which hyperpolarizes cells by
9 promoting Cl- influx, inhibits proliferation of embryonic stem cells and peripheral neural
10 crest stem cells in mice (Young and Bordey 2009, Teng, Tang et al. 2013). Moreover, in
11 the mouse neocortex, neural progenitors become increasingly hyperpolarized as they
12 produce their characteristic cell lineages (Vitali, Fievre et al. 2018). Of note, artificially
13 hyperpolarizing neural progenitor cells induced the premature production of late-stage
14 cell types, revealing a functional link between changes in membrane potential and
15 temporal birth order of cells in the neocortex. Changes in the membrane potential of stem
16 and progenitor cells can then alter cell division patterns and cellular behavior, supporting
17 the idea that gabrr1-mediated regulation of membrane potential underlies its role in
18 regulating early melanocyte patterning in zebrafish. Future work that can systematically
19 assess the effect of membrane potential on the development of stem cells and their
20 progeny in a broad range of tissues is required to reveal the extent to which this
21 phenomenon occurs in vertebrate biology.
22
23 Acknowledgements: 25
1 We thank Brian Stephens and Sinan Li for fish husbandry during the majority of the study.
2 We are especially grateful to the Washington University School of Medicine Genetics
3 Department and Washington University Zebrafish Facility for providing critical support in
4 completing this research. We thank Rob Tryon and Ryan McAdow for assistance and
5 guidance generating mutant and transgenic lines. We thank Michael Nonet, Cristina
6 Strong, Charles Kaufman, and Douglas Chalker for critical comments on the manuscript.
7 James R. Allen was a Howard Hughes Medical Institute Gilliam Fellow during the course
8 of this study. This work was funded by NIH RO1-GM056988 to S.L.J. J.B.S was supported
9 by NIH RO1-NS036570.
10
11 Competing Interests:
12 The authors declare no competing financial interests.
13 References:
14 Bertrand, J. Y., A. D. Kim, E. P. Violette, D. L. Stachura, J. L. Cisson and D. Traver 15 (2007). "Definitive hematopoiesis initiates through a committed erythromyeloid 16 progenitor in the zebrafish embryo." Development 134(23): 4147-4156. 17 18 Blackiston, D., D. S. Adams, J. M. Lemire, M. Lobikin and M. Levin (2011). 19 "Transmembrane potential of GlyCl-expressing instructor cells induces a neoplastic-like 20 conversion of melanocytes via a serotonergic pathway." Dis Model Mech 4(1): 67-85. 21 Bormann, J. (2000). "The 'ABC' of GABA receptors." Trends Pharmacol Sci 21(1): 16- 22 19. 23 24 Budi, E. H., L. B. Patterson and D. M. Parichy (2008). "Embryonic requirements for 25 ErbB signaling in neural crest development and adult pigment pattern formation." 26 Development 135(15): 2603-2614. 27 28 Camargo-Sosa, K., S. Colanesi, J. Muller, S. Schulte-Merker, D. Stemple, E. E. Patton 29 and R. N. Kelsh (2019). "Endothelin receptor Aa regulates proliferation and 30 differentiation of Erb-dependent pigment progenitors in zebrafish." PLoS Genet 15(2): 31 e1007941. 32 26
1 Cheung, T. H. and T. A. Rando (2013). "Molecular regulation of stem cell quiescence." 2 Nat Rev Mol Cell Biol 14(6): 329-340. 3 4 Dooley, C. M., A. Mongera, B. Walderich and C. Nusslein-Volhard (2013). "On the 5 embryonic origin of adult melanophores: the role of ErbB and Kit signalling in 6 establishing melanophore stem cells in zebrafish." Development 140(5): 1003-1013. 7 8 Ebert, U. and K. Krnjevic (1990). "Systemic CI-966, a new gamma-aminobutyric acid 9 uptake blocker, enhances gamma-aminobutyric acid action in CA1 pyramidal layer in 10 situ." Can J Physiol Pharmacol 68(9): 1194-1199. 11 12 Geissler, E. N., M. A. Ryan and D. E. Housman (1988). "The dominant-white spotting 13 (W) locus of the mouse encodes the c-kit proto-oncogene." Cell 55(1): 185-192. 14 15 Halloran MC, Sato-Maeda M, Warren JT, Su F, Lele Z, et al. (2000) Laser-induced gene 16 expression in specific cells of transgenic zebrafish. Development 127(9): 1953–60. 17 18 Heigwer, F., G. Kerr and M. Boutros (2014). "E-CRISP: fast CRISPR target site 19 identification." Nat Methods 11(2): 122-123. 20 21 Hultman, K. A., E. H. Budi, D. C. Teasley, A. Y. Gottlieb, D. M. Parichy and S. L. 22 Johnson (2009). "Defects in ErbB-dependent establishment of adult melanocyte stem 23 cells reveal independent origins for embryonic and regeneration melanocytes." PLoS 24 Genet 5(7): e1000544. 25 26 Hultman, K. A. and S. L. Johnson (2010). "Differential contribution of direct-developing 27 and stem cell-derived melanocytes to the zebrafish larval pigment pattern." Dev Biol 28 337(2): 425-431. 29 30 Ito, K., K. Tanaka, Y. Nishibe, J. Hasegawa and H. Ueno (2007). "GABA-synthesizing 31 enzyme, GAD67, from dermal fibroblasts: evidence for a new skin function." Biochim 32 Biophys Acta 1770(2): 291-296. 33 34 Jao, L. E., S. R. Wente and W. Chen (2013). "Efficient multiplex biallelic zebrafish 35 genome editing using a CRISPR nuclease system." Proc Natl Acad Sci U S A 110(34): 36 13904-13909. 37 38 Johnson, A. D. and P. A. Krieg (1995). "A Xenopus laevis gene encoding EF-1 alpha S, 39 the somatic form of elongation factor 1 alpha: sequence, structure, and identification of 40 regulatory elements required for embryonic transcription." Dev Genet 17(3): 280-290. 41 42 Johnson, S. L., D. Africa, C. Walker and J. A. Weston (1995). "Genetic control of adult 43 pigment stripe development in zebrafish." Dev Biol 167(1): 27-33. 44 27
1 Johnson, S. L., A. N. Nguyen and J. A. Lister (2011). "mitfa is required at multiple 2 stages of melanocyte differentiation but not to establish the melanocyte stem cell." Dev 3 Biol 350(2): 405-413. 4 5 Kawakami, K., H. Takeda, N. Kawakami, M. Kobayashi, N. Matsuda and M. Mishina 6 (2004). "A transposon-mediated gene trap approach identifies developmentally 7 regulated genes in zebrafish." Dev Cell 7(1): 133-144. 8 9 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) "Stages of 10 embryonic development of the zebrafish." Developmental Dynamics 203: 253–310. 11 12 Levy, C., M. Khaled and D. E. Fisher (2006). "MITF: master regulator of melanocyte 13 development and melanoma oncogene." Trends Mol Med 12(9): 406-414. 14 15 Li, L. and R. Bhatia (2011). "Stem cell quiescence." Clin Cancer Res 17(15): 4936- 16 4941. 17 18 Lister, J. A., C. P. Robertson, T. Lepage, S. L. Johnson and D. W. Raible (1999). "nacre 19 encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived 20 pigment cell fate." Development 126(17): 3757-3767. 21 22 Ma, D. K., M. A. Bonaguidi, G. L. Ming and H. Song (2009). "Adult neural stem cells in 23 the mammalian central nervous system." Cell Res 19(6): 672-682. 24 25 Martinez-Delgado, G., A. Estrada-Mondragon, R. Miledi and A. Martinez-Torres (2010). 26 "An Update on GABArho Receptors." Curr Neuropharmacol 8(4): 422-433. 27 28 Nishimura, E. K., S. A. Jordan, H. Oshima, H. Yoshida, M. Osawa, M. Moriyama, I. J. 29 Jackson, Y. Barrandon, Y. Miyachi and S. Nishikawa (2002). "Dominant role of the 30 niche in melanocyte stem-cell fate determination." Nature 416(6883): 854-860. 31 32 O'Reilly-Pol, T. and S. L. Johnson (2013). "Kit signaling is involved in melanocyte stem 33 cell fate decisions in zebrafish embryos." Development 140(5): 996-1002. 34 35 Parichy, D. M., J. F. Rawls, S. J. Pratt, T. T. Whitfield and S. L. Johnson (1999). 36 "Zebrafish sparse corresponds to an orthologue of c-kit and is required for the 37 morphogenesis of a subpopulation of melanocytes, but is not essential for 38 hematopoiesis or primordial germ cell development." Development 126(15): 3425-3436. 39 40 Rawls, J. F. and S. L. Johnson (2000). "Zebrafish kit mutation reveals primary and 41 secondary regulation of melanocyte development during fin stripe regeneration." 42 Development 127(17): 3715-3724. 43 44 Rawls, J. F. and S. L. Johnson (2001). "Requirements for the kit receptor tyrosine 45 kinase during regeneration of zebrafish fin melanocytes." Development 128(11): 1943- 46 1949. 28
1 2 Rawls, J. F. and S. L. Johnson (2003). "Temporal and molecular separation of the kit 3 receptor tyrosine kinase's roles in zebrafish melanocyte migration and survival." Dev 4 Biol 262(1): 152-161. 5 6 Schindelin, J.; Arganda-Carreras, I. & Frise, E. et al. (2012), "Fiji: an open-source 7 platform for biological image analysis", Nature methods 9(7): 676-682. 8 9 Sheets, L., D. G. Ransom, E. M. Mellgren, S. L. Johnson and B. J. Schnapp (2007). 10 "Zebrafish melanophilin facilitates melanosome dispersion by regulating dynein." Curr 11 Biol 17(20): 1721-1734. 12 13 Sigel, E. and M. E. Steinmann (2012). "Structure, function, and modulation of GABA(A) 14 receptors." J Biol Chem 287(48): 40224-40231. 15 16 Suster, M. L., H. Kikuta, A. Urasaki, K. Asakawa and K. Kawakami (2009). 17 "Transgenesis in zebrafish with the tol2 transposon system." Methods Mol Biol 561: 41- 18 63. 19 20 Teng, L., Y. B. Tang, F. Sun, S. M. An, C. Zhang, X. J. Yang, H. Y. Lv, Q. Lu, Y. Y. Cui, 21 J. J. Hu, L. Zhu and H. Z. Chen (2013). "Non-neuronal release of gamma-aminobutyric 22 Acid by embryonic pluripotent stem cells." Stem Cells Dev 22(22): 2944-2953. 23 24 Tryon, R. C., C. W. Higdon and S. L. Johnson (2011). "Lineage relationship of direct- 25 developing melanocytes and melanocyte stem cells in the zebrafish." PLoS One 6(6): 26 e21010. 27 28 Tryon, R. C. and S. L. Johnson (2012). "Clonal and lineage analysis of melanocyte stem 29 cells and their progeny in the zebrafish." Methods Mol Biol 916: 181-195. 30 31 Tryon RC, Johnson SL. Clonal analysis of kit ligand a functional expression reveals 32 lineage specific competence to promote melanocyte rescue in the mutant regenerating 33 caudal fin. PLoS One. 2014;9:e102317 34 35 Tu, S. and S. L. Johnson (2010). "Clonal analyses reveal roles of organ founding stem 36 cells, melanocyte stem cells and melanoblasts in establishment, growth and 37 regeneration of the adult zebrafish fin." Development 137(23): 3931-3939. 38 39 Vitali, I., S. Fievre, L. Telley, P. Oberst, S. Bariselli, L. Frangeul, N. Baumann, J. J. 40 McMahon, E. Klingler, R. Bocchi, J. Z. Kiss, C. Bellone, D. L. Silver and D. Jabaudon 41 (2018). "Progenitor Hyperpolarization Regulates the Sequential Generation of Neuronal 42 Subtypes in the Developing Neocortex." Cell 174(5): 1264-1276.e1215. 43 44 Wang, T. L., A. Hackam, W. B. Guggino and G. R. Cutting (1995). "A single histidine 45 residue is essential for zinc inhibition of GABA rho 1 receptors." J Neurosci 15(11): 46 7684-7691. 29
1 2 Westerfield, M. (2000). The Zebrafish Book. A Guide for The Laboratory Use of 3 Zebrafish (Danio rerio). 4 5 Yang, C. T. and S. L. Johnson (2006). "Small molecule-induced ablation and 6 subsequent regeneration of larval zebrafish melanocytes." Development 133(18): 3563- 7 3573. 8 9 Yang, C. T., R. D. Sengelmann and S. L. Johnson (2004). "Larval melanocyte 10 regeneration following laser ablation in zebrafish." J Invest Dermatol 123(5): 924-929. 11 12 Young, S. Z. and A. Bordey (2009). "GABA's control of stem and cancer cell 13 proliferation in adult neural and peripheral niches." Physiology (Bethesda) 24: 171-185. 14
15 Figure Legends:
16
17 Figure 1: GABA-A antagonists increase melanocyte production in larval zebrafish.
18 (A) Schematic of experimental timeline for PTU melanocyte differentiation assay. Drugs
19 and PTU are added to zebrafish embryos between 3 – 6 dpf. (B-E) Images of
20 representative 6 dpf larvae treated with vehicle control (B) or GABA-A antagonists CP-
21 615003-27 (40 µM; C), Picrotoxin (100 µM; D), and TPMPA (100 µM; E). (F)
22 Quantification of the average number of melanin-, GFP+ dorsal melanocytes for each
23 treatment group ± variation. (Vehicle control: 0.92±1.15, N=84; CP-615003-27:
24 4.27±2.12, N=81; Picrotoxin: 3.76±1.38, N=55; TPMPA: 4.10±2.14, N=52). Following
25 single-factor ANOVA, each experimental group was compared to vehicle control using
26 Tukey-HSD. *** indicate a statistical difference was found in our analysis (Tukey-HSD;
27 p<0.001).
28
29 Figure 2: GABA-A antagonist-induced melanocytes derive from MSCs. (A)
30 Schematic of experimental timeline for drug treatment. (B) Quantification of the average 30
1 melanin-, GFP+ dorsal melanocytes in each group ± variation. (Vehicle control: 1.76±1.26,
2 N=39; Vehicle control + AG1478: 0.32±0.48, N=28; TPMPA: 4.14±1.43, N=29; TPMPA +
3 AG1478: 0.28±0.54, N=25; Picrotoxin: 5.2±0.99, N=30; Picrotoxin + AG1478: 0.17±0.38,
4 N=30). Following single-factor ANOVA, each experimental group was compared to
5 vehicle control using Tukey-HSD. *** indicate a statistical difference was found in our
6 analysis (Tukey-HSD; p<0.001).
7 Figure 3: Pharmacological activation of GABA-A signaling inhibits melanocyte
8 regeneration. (A) Schematic of experimental timeline for drug treatment. Images of
9 representative mitfavc7 7 dpf larvae treated with vehicle control (B), GABA (50 mM; C),
10 GABOB (100 µM; D), L, 838-417 (100 µM; E), CI-966 HCL (20 µM; F), and MK 0343 (100
11 µM; G). (H) Quantification of the average number of dorsal melanocytes in each drug
12 treatment group ± variation. (Vehicle control: 42.2±9.38, N=78; GABA: 21.2±10.4, N=42;
13 GABOB: 26.8±7.71, N=41; L,838-417: 16±11.2, N=42, CI-966 HCL: 20.4±7.81, N=43; MK
14 0343: 18.1±9.55, N=35). Following single-factor ANOVA, each experimental group was
15 compared to vehicle control using Tukey-HSD. *** indicate a statistical difference was
16 found in our analysis (Tukey-HSD; p<0.001).
17
18 Figure 4: gabrr1 mutations exhibit a dominant excess melanocyte phenotype during
19 larval stages. (A) Partial sequence alignment of wild-type and CRISPR mutagenized
20 gabrr1 genomic locus in zebrafish. (B) Partial peptide alignment of vertebrate gabrr1
21 homology reference protein (human: NP_002033; mouse: NP_032101; zebrafish:
22 NP_001020724) within the ligand binding domain, with the predicted amino-acid
23 sequence of the two gabrr1 alleles generated in the study. (C) Quantification of the 31
1 average number of melanin-, GFP+ dorsal melanocytes in each treatment group ±
2 variation. (Wild Type: 2.04±0.94, N=51; gabrr1j247/+: 9.56±1.48, N=39; gabrr1j247/j247:
3 9.13±1.41, N=15 gabrr1j248/+: 7.81±1.17, N=48; gabrr1j248/j248: 10.2±2.54, N=13;
4 gabrr1j247/j248: 9.72±1.99, N=29). Representative images of 6 dpf wild-type (D), gabrr1j247/+
5 (E), gabrr1j248/+ (F) and gabrr1j247/j248 (G) larvae. Following single-factor ANOVA, each
6 experimental group was compared to vehicle control using Tukey-HSD. *** indicate a
7 statistical difference was found in our analysis (Tukey-HSD; p<0.001).
8
9 Figure 5: Over-expression of gabrr1 inhibits melanocyte regeneration in larval
10 zebrafish. (A) Schematic of experimental timeline. Arrows indicate timing of three 30
11 minute 37 °C heat shock treatments. (B) Quantification of average dorsal melanocytes in
12 each treatment group ± variation. (mlpha + heat shock: 49.9±6.01, N=32;
13 Tg(hsp70l:gabrr1)j972: 51.1±6.86, N=38; Tg(hsp70l:gabrr1)j972+ heatshock: 32.3±5.54,
14 N=46). Images of representative mlpha + heat shock (C), Tg(hsp70l:gabrr1)j972 (D), and
15 Tg(hsp70l:gabrr1)j972 + heatshock (E) larvae. Following single-factor ANOVA, each
16 experimental group was compared to vehicle control using Tukey-HSD. *** indicate a
17 statistical difference was found in our analysis (Tukey-HSD; p<0.001).
18
19 Figure 6: gabrr1 mediated maintenance of MSC quiescence is sensitive to kita
20 dosage. Quantification of the average number of melanin-, GFP+ dorsal melanocytes in
21 gabrr1j247/+ and kitab5/+ ± variation. (Wild-type: 2.35±1.03, N=42; kitab5/+: 0.88±0.81, N=56;
22 gabrr1j247/+: 9.55±1.43, N=40; kitab5/+; gabrr1j247/+: 0.87±0.87, S.E.M: 0.11, N=60).
23 Following single-factor ANOVA, each experimental group was compared to vehicle 32
1 control using Tukey-HSD. *** indicate a statistical difference was found in our analysis
2 (Tukey-HSD; p<0.001).
3
4 Table S1: List of GABA-A receptor pharmacology used in the study. Each drug was
5 obtained from the indicated manufacturer and handled according to vendor guidelines.
6
7 Table S2: Sequences of primers and oligos used in the study. Each primer or oligo
8 was purchased from Integrated DNA Technologies (IDT).
9
10 Figure S1: Pharmacological activation of GABA-A reduces larval pigmentation
11 across the body. (A-D) Images of representative mitfavc7 7 dpf larvae treated with vehicle
12 control (A), L,838-417 (B), CI-966 HCL (C), and MK 0343 (D).
13
14 Figure S2: gabrr1 mutations have no visible effect on ventral pigmentation. (A-D)
15 Images of representative 6 dpf wild-type (A), gabrr1j247/+ (B), gabrr1j248/+ (C), and
16 gabrr1j247/j248(D) larvae.
17
18 Figure S3: Over-expression of gabrr1 partially reduces ventral pigmentation. (A-C)
19 Images of representative 6 dpf heat shocked mlpha (A), Tg(hsp70l:gabrr1)j972 (B), and
20 Tg(hsp70l:gabrr1)j972 + heat shock (C). Figure 1: GABA-A antagonists increase melanocyte production in larval zebrafish
Drug panel A. PTU
0 dpf 3 dpf 6 dpf B. C.
Vehicle control CP-615003-27 D. E.
Picrotoxin TPMPA F. *** GABA-A antagonists dorsal melanocytes / larvaedorsal melanocytes / + + / GFP / - - Melanin
Vehicle CP-615003-27 Picrotoxin TPMPA control B. A. Melanin- / GFP+ dorsal melanocytes / larvae AG1478 0 Figure 2: GABA-AFigure 2:antagonist induced melanocytes derive from MSCs dpf Vehiclecontrol + - + - + -
AG1478 *** 2 2 dpf TPMPA *** 3 dpf GABA-A antagonist PTU Picrotoxin *** 6 dpf 32°C A. GABA-A drug 0 dpf 25°C
3 dpf 6 dpf B. C. B.
Vehicle Control GABA D. E.
GABOB L,838-417 F. G.
CI-966 HCL MK 0343 H.
*** Dorsal larvaeDorsal melanocytes /
Vehicle GABA GABOB L-838,417 CI-966 HCL MK 0343 control Figure 3: Pharmacological activation of GABA-A signaling inhibits melanocyte regeneration A. B.
allele Human (159-168) FFVHSKRSFI Mouse (160-169) FFVHSKRSFI Wild-type TTTTTTGTCCACTCCAAGCGCTCCTTCATCC Zebrafish (144-153) FFVHSKRSFI
gabrr1j247 TTTTT------CGAGCGCTCCTTCATCC gabrr1j247 mutation: FF---ERSFI (K149E) gabrr1j248 TTTTT------CAAGCGCTCCTTCATCC gabrr1j248 mutation: FF---KRSFI C. *** dorsal melanocytes / larvaedorsal melanocytes / + + / GFP / - - Melanin
Wild Type gabrr1 j247/+ gabrr1 j247/j247 gabrr1 j248/+ gabrr1 j248/j248 gabrr1 j247/j248 D. E.
Wild-type gabrr1j247/+ F. G.
gabrr1j248/+ gabrr1j247/j248
Figure 4: gabrr1 mutations exhibit a dominant excess melanocyte phenotype during larval stages (37 shock Heat B. A. °C) Dorsal melanocytes / larvae FigureOver-expression 5: gabrr1of inhibitsmelanocyte regeneration 0 mlpha dpf + 4-HA Tg(hsp70l: 3 dpf
- gabrr1 NS 4 dpf ) 5 j972 dpf Tg(hsp70l: gabrr1 *** + ) j972 E. D. C. Tg(hsp70l Tg(hsp70l :gabrr1) :gabrr1) mlpha: j972 C) :shock heat (37° C) shock heat (37° j972 :noshock heat - +
Melanin / GFP dorsal melanocytes / larvae sensitive kit to dosage gabrr1Figure6: mediated maintenance of MSC quiescence is Wild Type Wild *** Kita b5/+ gabrr1 j247/+ *** Kita b5/+ b5/+ ;gabrr1 j247/+ Table S1: List of GABA-A receptor pharmacology used in the study. Table S2: Sequences of primers and oligos used in the study. A.
Vehicle Control B. B.
L,838-417L,838-417
C. CI-966 HCL
CI-966 HCL D.
MK 0343
Supplemental Figure 1: Pharmacological activation of GABA-A reduces larval pigmentation across the body. A. B.
Wild Type gabrr1j247/+ C. D.
gabrr1j248/+ gabrr1j247/j248
Supplemental Figure 2: gabrr1 mutations have no visible effect on ventral pigmentation. A.
mlpha: heat shock (37°C) MK 0343 B.
Tg(hsp70l:gabrr1)j972: no heat shock C.
Tg(hsp70l:gabrr1)j972: heat shock (37°C)
Supplemental Figure 3: Over-expression of gabrr1 partially reduces ventral pigmentation.