DOCSLIB.ORG

Cloning and Characterization of the Orotidine-5'-Phosphate Decarboxylase Gene (URA3) from the Osmotolerant Yeast Candida Magnoliae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning and Characterization of the Orotidine-5'-Phosphate Decarboxylase Gene (URA3) from the Osmotolerant Yeast Candida Magnoliae J. Microbiol. Biotechnol. (2012), 22(5), 642–648 http://dx.doi.org/10.4014/jmb.1111.11071 First published online February 17, 2012 pISSN 1017-7825 eISSN 1738-8872 Cloning and Characterization of the Orotidine-5'-Phosphate Decarboxylase Gene (URA3) from the Osmotolerant Yeast Candida magnoliae Park, Eun-Hee1, Jin-Ho Seo2, and Myoung-Dong Kim1* 1School of Biotechnology and Bioengineering, Kangwon National University, Chuncheon 200-701, Korea 2Department of Agricultural Biotechnology, Seoul National University, Seoul 151-921, Korea Received: November 28, 2011 / Revised: January 10, 2012 / Accepted: January 11, 2012 We determined the nucleotide sequence of the URA3 gene amounts of erythritol [10, 12, 21]. A gene transformation/ encoding orotidine-5'-phosphate decarboxylase (OMPDCase) disruption system might be essential to understand the of the erythritol-producing osmotolerant yeast Candida underlying molecular mechanisms of osmotolerance and magnoliae by degenerate polymerase chain reaction and erythritol production in C. magnoliae. However, the genetic genome walking. Sequence analysis revealed the presence manipulation of C. magnoliae is limited by a lack of markers of an uninterrupted open-reading frame of 795 bp, encoding and efficient transformation methods, which implies that a 264 amino acid residue protein with the highest identity manipulation of this strain should involve the use of to the OMPDCase of the yeast Kluyveromyces marxianus. dominant drug-resistance markers. Although several dominant Phylogenetic analysis of the deduced amino acid sequence drug-resistance markers are available [33], little success revealed that it shared a high degree of identity with other has been achieved in Candida species, which frequently yeast OMPDCase homologs. The cloned URA3 gene exhibit drug resistance and show different codon usage successfully complemented the ura3 null mutation in preferences [1, 15]. Saccharomyces cerevisiae, revealing that it encodes a Genetic transformation systems employing auxotrophic functional OMPDCase in C. magnoliae. An enzyme activity markers (URA3, TRP1, HIS3, and LEU2) have been developed assay and reverse transcription polymerase chain reaction for different yeasts, because transformants can be easily indicated that the expression level of the C. magnoliae selected on drop-out media [18, 27-29]. The URA3 gene URA3 gene in S. cerevisiae was not as high as that of the S. encodes orotidine-5'-phosphate decarboxylase (OMPDCase), cerevisiae URA3 gene. The GenBank accession number which catalyzes the last step in the biosynthesis of for C. magnoliae URA3 is JF521441. pyrimidines [30], and has been used as a useful genetic Keywords: Candida magnoliae, URA3, orotitine-5'-phosphate marker for Saccharomyces cerevisiae and other yeasts [24, decarboxylase, complementation 25, 31]. One advantage of utilizing the URA3 gene as a selectable marker in gene transformation/disruption is that wild-type cells are not able to survive in medium containing 5-fluoro-orotic acid (5-FOA), which makes it possible to Erythritol, a four-carbon sugar alcohol, is a low caloric and develop a “Ura-blaster” for repeated use or recycling of the non-cariogenic sweetener that occurs naturally in algae, URA3 gene in “pop-in” and “pop-out” applications [2, 9]. fruits, and mushrooms [5]. Most ingested erythritol is not The present work describes the isolation and sequence metabolized by the human body and is excreted unchanged analysis of the URA3 gene from C. magnoliae (CmURA3) in the urine without changing blood glucose and insulin as the first step in the construction of a host-vector tool for levels [8, 19]. It also prevents dental caries because the an auxotrophic transformation system for this osmotolerant bacteria that cause dental caries are not able to utilize yeast. In addition, we compared the deduced amino acid erythritol as a carbon source [16]. sequence of the cloned URA3 gene with those of other Candida magnoliae JH110, an osmotolerant yeast strain yeasts to gain insight into the phylogenetic position of isolated from honeycomb [10, 32], is able to produce large C. magnoliae. The functionality of the cloned gene was *Corresponding author demonstrated by complementation of a URA3-negative S. Phone: +82-33-250-6458; Fax: +82-33-241-0508; cerevisiae strain. E-mail: [email protected] 643 Park et al. MATERIALS AND METHODS isopropanol]. The DNA was precipitated with absolute ethanol and then dissolved in TE buffer [10 mM Tris-HCl and 1 mM EDTA Strains and Culture Conditions (pH 8.0)]. Plasmid DNA was isolated and purified from E. coli C. magnoliae KFCC 10900 [11, 32] and S. cerevisiae BY4742 using the AccuPrep Plasmid Mini Extraction Kit (Bioneer, Korea). [MATa his3∆1 leu2∆0 lys2∆0 ura3∆0] were purchased from Plasmids pGEM-T (Promega, USA) and pRS314 (ATCC 77143) EUROSCARF (European Saccharomyces cerevisiae Archive for were used for general cloning and the complementation study, Functional Analysis). S. cerevisiae EH 13.15 [13] was used to prepare respectively. genomic DNA template for polymerase chain reaction (PCR) amplification of the S. cerevisiae URA3 gene (ScURA3). Escherichia Degenerate PCR and Genome Walking coli TOP10 (Invitrogen, USA) was used for plasmid DNA preparation The degenerate oligonucleotide primers CmURA3-DGF and CmURA3- and was routinely grown at 37oC. DGR (listed in Table 1) were designed based on the core consensus LB medium (0.5% bacto-yeast extract, 1% bacto-tryptone peptone, conserved regions, FEDRKF and RYQKAG, of yeast OMPDCases and 1% NaCl) supplemented with 100 µg/ml ampicillin was used [20, 22, 27, 31]. for plasmid DNA preparation. C. magnoliae was grown in YEPD PCR reactions were performed using 5 units of Diastar Taq (1% bacto-yeast extract, 2% bacto-proteose peptone, and 2% glucose) polymerase (Solgent, Korea). For the PCR, 1 µg of template DNA at 30oC for extraction of genomic DNA. S. cerevisiae cells carrying and 100 pmol of each primer were used. The reaction conditions o plasmid were grown in synthetic complete medium lacking uracil were 5 min at 95 C followed by 35 cycles of denaturation for 1 min o o (SC-URA-) or tryptophan (SC-TRP-), containing 2% glucose. The at 95 C, annealing for 1 min at 53 C, and extension for 1 min 30 s o S. cerevisiae transformants were grown in selective medium at 30oC at 68 C. The ~500 bp amplified fragment was cloned into the to an optical density at 600 nm (A600) of 0.8 and harvested by brief pGEM-T vector by TA cloning and sequenced. The complete open centrifugation for the OMPDCase enzyme activity assay. reading frame (ORF) and promoter and terminator regions were identified by genomic walking, which was performed with the DNA Nucleic Acid Isolation and Plasmids Walking SpeedUp Kit (Seegene, Korea) according to the manufacturer’s Yeast cells in the exponential growth phase were harvested by protocol. centrifugation, disrupted by vortexing with acid-washed glass beads (Sigma-Aldrich, USA), and the clarified lysate was applied to an Sequence Analysis anion-exchange column (Qiagen, Germany) that had been equilibrated Similarity searches for nucleotide and protein sequences were performed with 4 ml of QBT buffer [750 mM NaCl, 50 mM MOPS (pH 7.0), using the Web-based BLAST algorithm of the National Center for 15% isopropanol, and 0.15% Triton X-100]. The column was Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/ washed twice with 15 ml of QC buffer [1 M NaCl, 50 mM MOPS blast). The deduced amino acid sequence was obtained using the (pH 7.0), and 15% isopropanol], and the DNA was eluted with 5 ml translational tool of the Expert Protein Analysis System (ExPASY; of QE buffer [1.25 M NaCl, 50 mM Tris-HCl (pH 8.5), and 15% http://kr.expasy.org/tools/dna.html). Multiple amino acid sequences Table 1. Primers used in this study. Name Sequence (5'-3') Comments CmURA3-DGF TRSTYAARACNCAYATYG Degenerate PCR CmURA3-DGR GAYMGNAARTTTGCHG Degenerate PCR TSP1-cmURA3-5' ACGCGAGTACTCGCCCTT Genome walking TSP2-cmURA3-5' TCTTCGAGGCCAGACACAAT Genome walking TSP3-cmURA3-5' ATGTCCGCCCATTCGGCAAT Genome walking TSP1-cmURA3-3' CATTGTGTCTGGCCTCGAAGA Genome walking TSP2cmURA3-3' GTCGAGATTGCACGCTCGAA Genome walking TSP3cmURA3-3' GTTGGCCTCGACGACAAAGGC Genome walking ScURA3-F AATTGGATCCCTAGTGATTCACAGAAGTATG pME1043 construction ScURA3-R AATTGAATTCACTAGTGATTCACAGAAGTA pME1043 construction CmURA3-F AATTGGATCCTTCAACTTTTGCAACCCGCACGC pME1044 construction CmURA3-R AATTATCGATGCGCCGCCATTTTGTGGAAA pME1044 construction RT-cmURA3-F GGAACGTGCTGCTACTCATC RT-PCR RT-cmURA3-R TCAAAAGGCCTCTAGGTTCCT RT-PCR RT-scURA3-F GGATATTGGGTCCACCGT RT-PCR RT-scURA3-R GGCCAACGATGATGACGT RT-PCR RT-scACT1-F ATGGATTCTGAGGTTGCTG RT-PCR RT-scACT1-R AAAACGGCTTGGATGGAAA RT-PCR For degenerate primers CmURA3-DGF and CmURA3-DGR, R is A or G; S is C or G; Y is C or T; M is A or C; H is A or T or C; N is A or C or G or T. THE OROTIDINE-5'-PHOSPHATE DECARBOXYLASE GENE FROM CANDIDA MAGNOLIAE 644 were aligned using the CLUSTALW program, and the phylogenetic were used for 40 cycles of RT-PCR amplification. Aliquots of the tree was constructed with MEGA 5.0 using the neighbor-joining PCR product were separated on a 0.8% agarose gel. method. Bootstrap analysis was performed with 1,000 replicates to test the relative support for the branches in the phylogenetic tree. Codon usage analysis was performed using the Web-based tool RESULTS AND DISCUSSION Codon Usage Database (http://www.kazusa.or.jp/codon/). Isolation and Characterization of the C. magnoliae Cloning of CmURA3 and ScURA3 URA3 Gene A TRP1-marked centromere plasmid, pRS314 (4.78 kb), was used Degenerate PCR primers targeting conserved regions of to express CmURA3 and ScURA3. To obtain CmURA3 and ScURA3 the URA3 gene were designed based on a multiple alignment genes, including their own promoter and terminator regions, DNA of published yeast URA3 gene sequences (Table 1). A PCR - CmURA3 fragments compassing the region from 200 to +200 bp of product of approximately 0.5 kb was amplified (data not and ScURA3 were amplified by PCR using the primers listed in o shown) at an annealing temperature of 53 C, TA-cloned, Table 1.
Load more

Recommended publications
  • A High Throughput Approach for the Generation of Orthogonally Interacting Protein Pairs Justin Lawrie University of Nebraska-Lincoln, [email protected]
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications -- Chemistry Department Published Research - Department of Chemistry 1-17-2018 A high throughput approach for the generation of orthogonally interacting protein pairs Justin Lawrie University of Nebraska-Lincoln, [email protected] Xi Song University of Nebraska-Lincoln Wei Niu University of Nebraska-Lincoln, [email protected] Jiantao Guo University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/chemfacpub Part of the Analytical Chemistry Commons, Medicinal-Pharmaceutical Chemistry Commons, and the Other Chemistry Commons Lawrie, Justin; Song, Xi; Niu, Wei; and Guo, Jiantao, "A high throughput approach for the generation of orthogonally interacting protein pairs" (2018). Faculty Publications -- Chemistry Department. 122. https://digitalcommons.unl.edu/chemfacpub/122 This Article is brought to you for free and open access by the Published Research - Department of Chemistry at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications -- Chemistry Department by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. www.nature.com/scientificreports OPEN A high throughput approach for the generation of orthogonally interacting protein pairs Received: 20 September 2017 Justin Lawrie1, Xi Song1, Wei Niu2 & Jiantao Guo1 Accepted: 27 December 2017 In contrast to the nearly error-free self-assembly of protein architectures in nature, artifcial assembly of Published: xx xx xxxx protein complexes with pre-defned structure and function in vitro is still challenging. To mimic nature’s strategy to construct pre-defned three-dimensional protein architectures, highly specifc protein- protein interacting pairs are needed. Here we report an efort to create an orthogonally interacting protein pair from its parental pair using a bacteria-based in vivo directed evolution strategy.
    [Show full text]
  • Saccharomyces Cerevisiae
    Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Mitotic chromosome condensation in the rDNA requires TRF4 and DNA topoisomerase I in Saccharomyces cerevisiae Irene B. Castafio, 1 Pius M. Brzoska, Ben U. Sadoff, Hongying Chen, and Michael F. Christman ~'2 Department of Radiation Oncology, University of California, San Francisco, California 94143 USA DNA topoisomerase I (topo I) is known to participate in the process of DNA replication, but is not essential in Saccharomyces cerevisiae. The TRF4 gene is also nonessential and was identified in a screen for mutations that are inviable in combination with a top1 null mutation. Here we report the surprising finding that a top1 trf4-ts double mutant is defective in the mitotic events of chromosome condensation, spindle elongation, and nuclear segregation, but not in DNA replication. Direct examination of rDNA-containing mitotic chromosomes demonstrates that a top1 trf4-ts mutant fails both to establish and to maintain chromosome condensation in the rDNA at mitosis. We show that the Trf4p associates physically with both Smclp and Smc2p, the S. cerevisiae homologs of Xenopus proteins that are required for mitotic chromosome condensation in vitro. The defect in the top1 trf4-ts mutant is sensed by the MADl-dependent spindle assembly checkpoint but not by the RAD9-dependent DNA damage checkpoint, further supporting the notion that chromosome structure influences spindle assembly. These data indicate that TOP1 (encoding topo I) and TRF4 participate in overlapping or dependent steps in mitotic chromosome condensation and serve to define a previously unrecognized biological function of topo I.
    [Show full text]
  • Protein Fusions to the URA3 Gene of Yeast
    Copyright 0 1987 by the Genetics Society of America A New Type of Fusion Analysis Applicable to Many Organisms: Protein Fusions to the URA3 Gene of Yeast Eric Alani and Nancy Kleckner Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, Massachusetts 02138 Manuscript received April 15, 1987 Accepted June 1, 1987 ABSTRACT We have made constructs that join the promoter sequences and a portion of the coding region of the Saccharomyces cerevisiae HIS4 and GALI genes and the E. coli lac2 gene to the sixth codon of the S. cerevisiae URA3 gene (encodes orotidine-5’-phosphate(OMP) decarboxylase) to form three in frame protein fusions. In each case the fusion protein has OMP decarboxylase activity as assayed by complementation tests and this activity is properly regulated. A convenient cassette consisting of the URA3 segment plus some immediately proximal amino acids of HZS4C is available for making URA3 fusions to other proteins of interest. URA3 fusions offer several advantages over other systems for gene fusion analysis: the URA3 specified protein is small and cytosolic; genetic selections exist to identify mutants with either increased or decreased URA3 function in both yeast (S. cerevisiae and Schizosaccharomyces pombe) and bacteria (Escherichia coli and Salmonella typhimurium); and a sensitive OMP decarboxylase enzyme assay is available. Also, OMP decarboxylase activity is present in mammals, Drosophila and plants, so URA3 fusions may eventually be applicable in these other organisms as well. ROTEIN fusions between a gene of interest and KORNBERGand SIMMONS1955; ROSE, GRISAFIand P a gene whose activity can be monitored geneti- BOTSTEIN 1984). (C) OMP decarboxylase is small cally in vivo and assayed biochemically in vitro have (monomer 25 kD) and active as a dimer, and may been used to investigate a wide range of biological therefore be more tractable for some purposes than problems.
    [Show full text]
  • A System for Gene Cloning and Manipulation in the Yeast Candida Glabrata
    Gene, 142 (1994) 135-140 Q 1994 Eisevier Science B.V. All rights reserved. 0378-l 119~94~~07.~ 135 GENE 07830 A system for gene cloning and manipulation in the yeast Candida glabrata (AIDS; Immunocompromised; mutant; pathogenic fungi; plasmid; Torulopsis; transformation) Pengbo Zhou, Mark S. Szczypka, Rachel Young and Dennis J. Thiele Department qf Biological Chemistry, University of‘h4iehignn Medico! School, Ann Arbor, MI 48109-0606, USA Received by J.A. Gorman: 4 April 1993; Revised/Accepted: 22 September/5 October 1993; Received at publishers: 10 January 1994 SUMMARY The opportunistic pathogenic yeast, Ca~dida (Tor~~u~s~s)gZabrata, is an asexual imperfect fungus that exists largely as a haploid. Besides being a clinically important pathogen, this yeast also provides a model system for understanding basic biological mechanisms such as metal-activated metallothionein-encoding gene transcription. To facilitate molecular genetic studies in C. glabrata, we isolated a strain auxotrophic for uracil biosynthesis. The ura- mutation could be functionally compIemented by the URA3 gene of Saccharomyces cerevisiae, consistent with a defect in the C. glabrata URA3 gene in this strain. We also found that the centromere-based S. cereuisiae plasmid pRS316 could stably transform and replicate in multiple copies in C. glabrata. In contrast, high-copy-number S. cerevisiae plasmids containing the 2~ circle autonomous replication sequence were not able to replicate productively in C. glabrata. We cloned the C. glubrata URA3 gene, encoding orotidine-S-phosphate decarboxylase, by complementation of a ura3- strain of S. cereuisiae. The deduced amino-acid sequence is highly similar to that of the URA3 protein from S.
    [Show full text]
  • Isolation of a Candida Albicans Gene, Tightly Linked to URA3, Coding for a Putative Transcription Factor That Suppresses a Saccharomyces Cerevisiae Aft1 Mutation
    Yeast Yeast 2001; 18: 301±311. Research Article Isolation of a Candida albicans gene, tightly linked to URA3, coding for a putative transcription factor that suppresses a Saccharomyces cerevisiae aft1 mutation Micaela GoÂmez GarcõÂa1, JoseÂ-Enrique O'Connor2, Lorena Latorre GarcõÂa4, Sami Irar MartõÂnez1, Enrique Herrero3 and Lucas del Castillo Agudo4* 1 Departament de Bioquimica i Biologia Molecular, Facultat de Farmacia, Universitat de ValeÁncia, 46100 Burjassot, Spain 2 Centro de CitometrõÂa, Departament de Bioquimica i Biologia Molecular, Facultat de Medicina, Universitat de ValeÁncia, 46010 ValeÁncia, Spain 3 Departament de CieÁncies MeÁdiques BaÁsiques, Facultat de Medicina, Universitat de Lleida, Lleida, Spain 4 Departament de Microbiologia i Ecologia, Facultat de Farmacia, Universitat de ValeÁncia, 46100 Burjassot, Spain *Correspondence to: Abstract L. del Castillo. Agudo, Departament de MicrobiologõÂa i A pathogen such as C. albicans needs an ef®cient mechanism of iron uptake in an iron- EcologõÂa, Facultat de Farmacia, restricted environment such as is the human body. A ferric-reductase activity regulated by Avgda. Vicente AndreÂs EstelleÂs iron and copper, and analogous to that in S. cerevisiae, has been described in C. albicans. s/n, 46100 Burjassot, Spain. We have developed an in-plate protocol for the isolation of clones that complement an aft1 E-mail: [email protected] mutation in S. cerevisiae that makes cells dependent on iron for growth. After transformation of S. cerevisiae aft1 with a C. albicans library, we have selected clones that grow in conditions of iron de®ciency and share an identical plasmid, pIRO1, with a 4500 bp insert containing the URA3 gene and an ORF (IRO1) responsible for the suppression of the iron dependency.
    [Show full text]
  • Protein Moonlighting Revealed by Non-Catalytic Phenotypes of Yeast Enzymes
    bioRxiv preprint doi: https://doi.org/10.1101/211755; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Protein Moonlighting Revealed by Non-Catalytic Phenotypes of Yeast Enzymes Adriana Espinosa-Cantú1, Diana Ascencio1, Selene Herrera-Basurto1, Jiewei Xu2, Assen Roguev2, Nevan J. Krogan2 & Alexander DeLuna1,* 1 Unidad de Genómica Avanzada (Langebio), Centro de Investigación y de Estudios Avanzados del IPN, 36821 Irapuato, Guanajuato, Mexico. 2 Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, California, 94158, USA. *Corresponding author: [email protected] Running title: Genetic Screen for Moonlighting Enzymes Keywords: Protein moonlighting; Systems genetics; Pleiotropy; Phenotype; Metabolism; Amino acid biosynthesis; Saccharomyces cerevisiae 1 bioRxiv preprint doi: https://doi.org/10.1101/211755; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 ABSTRACT 2 A single gene can partake in several biological processes, and therefore gene 3 deletions can lead to different—sometimes unexpected—phenotypes. However, it 4 is not always clear whether such pleiotropy reflects the loss of a unique molecular 5 activity involved in different processes or the loss of a multifunctional protein. Here, 6 using Saccharomyces cerevisiae metabolism as a model, we systematically test 7 the null hypothesis that enzyme phenotypes depend on a single annotated 8 molecular function, namely their catalysis.
    [Show full text]
  • A Three-Hybrid System to Detect RNA-Protein Interactions in Vivo DHRUBA J
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 8496-8501, August 1996 Genetics A three-hybrid system to detect RNA-protein interactions in vivo DHRUBA J. SENGUPTA*t, BEILIN ZHANGt, BRIAN KRAEMERt, PASCALE POCHART*, STANLEY FIELDS*t, AND MARVIN WICKENSt§ *Department of Molecular Genetics and Microbiology, State University of New York, Stony Brook, NY 11794; tDepartments of Genetics and Medicine, Markey Molecular Medicine Center, University of Washington, Box 357360, Seattle, WA 98195; and tDepartment of Biochemistry, 420 Henry Mall, University of Wisconsin, Madison, WI 53706 Communicated by Larry Gold, NeXstar Pharmaceuticals, Boulder, CO, March 25, 1996 (received for review February 5, 1996) ABSTRACT RNA-protein interactions are pivotal in fun- system (5, 6) which detects protein-protein interactions. The damental cellular processes such as translation, mRNA pro- three-hybrid system presented here allows simple phenotypic cessing, early development, and infection by RNA viruses. properties of yeast, such as the ability to grow or to metabolize However, in spite of the central importance of these interac- a chromogenic compound, to be used to detect and analyze an tions, few approaches are available to analyze them rapidly in RNA-protein interaction. vivo. We describe a yeast genetic method to detect and analyze RNA-protein interactions in which the binding of a bifunc- tional RNA to each of two hybrid proteins activates transcrip- MATERIALS AND METHODS tion of a reporter gene in vivo. We demonstrate that this Plasmid Constructions and Nomenclature. Plasmid nomen- three-hybrid system enables the rapid, phenotypic detection of clature is as follows. Each plasmid is named by the protein or specific RNA-protein interactions.
    [Show full text]
  • Cloning Arg3, the Gene for Ornithine Carbamoyltransferase From
    Proc. NatL Acad. Sci. USA Vol. 78, No. 8, pp. 5026-5030, August 1981 Genetics Cloning arg3, the gene for ornithine carbamoyltransferase from Saccharomyces cerevisiae: Expression in Escherichia coli requires secondary mutations; production of plasmid 8-lactamase in yeast (transgenotic expression/eukaryotic regulation/arginine biosynthesis/penicillinase/arginine constitutive mutant) M. CRABEEL*, F. MESSENGUYt, F. LACROUTE*, AND N. GLANSDORFF* *Laboratorium voor Microbiologie, Vrije Universiteit Brussel and tlnstitut de Recherches du Ceria, 1, Ave. E. Gryson, B-1070 Brussels, Belgium; and *Institut de Biologie Moleculaire et Cellulaire, 14, rue R. Descartes, F-67084 Strasbourg Cedex, France Communicated by Adrian M. Srb, March 30, 1981 ABSTRACT The yeast arg3 gene, coding for ornithine car- For clarity, we use the genetic symbols argF and pyrF (pyr, bamoyltransferase (carbamoylphosphate:L-ornithine carbamoyl- pyrimidine) for the E. coli genes and arg3 and ura3 for the cor- transferase, EC 2.1.3.3), has been cloned on a hybrid pBR322-2- responding yeast genes. A preliminary report has been pub- ,um plasmid. The cloned gene gives a normal regulatory response lished in abstract form (6). in yeast. It is not expressed at 35WC when a mutation preventing mRNA export from the nucleus at this temperature is included in MATERIALS AND METHODS the genetic make-up of the carrier strain. In Escherichia coli, no functional expression can be observed from the native yeast arg3 Strains and Media. An arg3 mutant of S. cerevisiae strain gene. The study of a mutant plasmid (MI) producing low levels of X1278b (a mating type) and the nonisogenic ura3 mutant yeast carbamoyltransferase in E.
    [Show full text]
  • Candida Albicans Strains Heterozygous and Homozygous for Mutations in Mitogen-Activated Protein Kinase Signaling Components Have Defects in Hyphal Development
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 13223–13228, November 1996 Microbiology Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase signaling components have defects in hyphal development JULIA R. KO¨HLER*† AND GERALD R. FINK*‡ *Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142; and †Department of Infectious Disease, Children’s Hospital, Boston, MA 02115 Contributed by Gerald R. Fink, August 13, 1996 ABSTRACT The Candida albicans genes, CST20 and but suggests that serum induces hyphae by a Cph1- HST7, were cloned by their ability to suppress the mating independent pathway. defects of Saccharomyces cerevisiae mutants in the ste20 and The finding that the Candida CPH1 gene complemented ste7 genes, which code for elements of the mating mitogen- both the filamentation and mating defect of the Saccharomyces activated protein (MAP) kinase pathway. These Candida genes ste12 mutant, suggested that other members of a Candida are both structural and functional homologs of the cognate MAP kinase (MAPK) cascade could be isolated by suppres- Saccharomyces genes. The pattern of suppression in Saccha- sion of the corresponding Saccharomyces mutant. In this report romyces is related to their presumptive position in the MAP we describe the isolation of Candida homologs of STE20 and kinase cascade. Null alleles of these genes were constructed in STE7, two other kinases of the Saccharomyces mating MAPK Candida. The Candida homozygous null mutants are defective cascade. We constructed strains heterozygous and homozy- in hyphal formation on some media, but are still induced to gous for null alleles of these genes in Candida and found that form hyphae by serum, showing that serum induction of both heterozygotes and homozygotes show defects in hyphal hyphae is independent of the MAP kinase cascade.
    [Show full text]
  • Phosphate Decarboxylase Activity in Yeast: 5-Fluoro-Orotic Acid Resistance
    Mol Gen Genet (1984) 197:345-346 © Springer-Verlag 1984 Short communication A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance Jef D. Boeke 1, Francois LaCroute 2, and Gerald R. Fink 1 1 Massachusetts Institute of Technology and Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142, USA ~ Laboratoire de Genetique Physiologique, Strasbourg, France Summary. Mutations at the URA3 locus of Saccharomyces periments where low frequency events are selected, 5-FOA cerevisiae can be obtained by a positive selection. Wild-type resistant colonies may result from mutations in genes other strains of yeast (or ura3 mutant strains containing a plas- than ura3. In experiments where spontaneous or UV-in- mid-borne URA3 + gene) are unable to grow on medium duced 5-FOA resistant mutants were selected, only 5-10% containing the pyrimidine analog 5-fluoro-orotic acid, of the mutants were ura3 . We do not know how many whereas ura3 mutants grow normally. This selection, different classes of mutants can give rise to a 5-FOA resis- based on the loss of orotidine-5'-phosphate decarboxylase tant phenotype; however, ural, 2 and 4 mutants are sensi- activity seems applicable to a variety of eucaryotic and pro- tive to the drug whereas ura3 and ura5 mutants are resistant caryotic cells. (ura5 mutants are only partially resistant) (see also Jund and LaCroute 1979). 5-FOA medium can be used to simplify gene replace- ment by transformation. In this procedure, mutations are A 1.1 kb DNA fragment bearing the URA3 gene (Bach made in a cloned yeast gene inserted into the integrating et al.
    [Show full text]
  • Rapid Conversion of Replicating and Integrating Saccharomyces Cerevisiae Plasmid Vectors Via Cre Recombinase
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.03.367219; this version posted November 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Rapid conversion of replicating and integrating Saccharomyces cerevisiae plasmid vectors via Cre recombinase Daniel P. Nickerson1*, Monique A. Quinn1, and Joshua M. Milnes2,3 1Department of Biology, California State University, San Bernardino, CA 92407 2Department of Biochemistry, University of Washington School of Medicine, Seattle, WA 98195- 3750 3Present address: Washington State Department of Agriculture – Plant Protection Division, Yakima, WA 98902 *Corresponding author: [email protected] Key words: Cre recombinase, homologous recombination, plasmid, shuttle vector, overexpression, molecular cloning, genetic engineering, yeast Running title: Remodeling yeast vector replication loci bioRxiv preprint doi: https://doi.org/10.1101/2020.11.03.367219; this version posted November 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 ABSTRACT 2 Plasmid shuttle vectors capable of replication in both Saccharomyces cerevisiae and Escherichia 3 coli and optimized for controlled modification in vitro and in vivo are a key resource supporting 4 yeast as a premier system for genetics research and synthetic biology. We have engineered a 5 series of yeast shuttle vectors optimized for efficient insertion, removal and substitution of 6 plasmid yeast replication loci, allowing generation of a complete set of integrating, low copy 7 and high copy plasmids via predictable operations as an alternative to traditional subcloning.
    [Show full text]
  • Phosphate Decarboxylase in Yeast by Hybridization of Mrna To
    Proc. Nati. Acad. Sd. USA Vol. 76, No. 1, pp. 386-390, January 1979 Genetics Evidence for transcriptional regulation of orotidine-5'-phosphate decarboxylase in yeast by hybridization of mRNA to the yeast structural gene cloned in Escherichia coli (complementation/in vitro recombination/Saccharomyces cerevisiae/pyrimidine biosynthesis) MARIE-LOUISE BACH*t, FRANCOIS LACROUTEt, AND DAVID BOTSTEIN** *Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139; and tLaboratoire de Genetique Physiologique, Institut de Biologie Moleculaire et Cellulaire du Centre National de la Recherche Scientifique, 67084 Strasbourg, France Communicated by Boris Magasanik, August 18,1978 ABSTRACT From a large population of strains of Esche- MATERIALS AND METHODS richia coli carrying shear fragments of yeast (Saccharomyces cerevisiae) DNA attached by in vitro recombination to the Yeast and Bacteria. Pyrimidine auxotrophs of S. cerevisiae plasmid vector pMB9, two hybrid plasmids were selected that were all derived from the wild-type prototroph a strain FL100 relieve the pyrimidine requirement of nonreverting pyrF mu- (4, 5). The construction of the yeast/plasmid hybrids is fully tants of E. coli. An 1100-base-pair DNA fragment common to described elsewhere (6). All manipulations involving live in the two complementing plasmids was recloned into another vitro clones were done under P2,EK1 containment as suggested plasmid vector, pBR322; these new hybrids retained the ability by the National Institutes of Health guidelines (7). The bacterial to specify orotidine-5'-phosphate decarboxylase (orotidine-5'- phosphate carboxy-lyase, EC 4.1.1.23) synthesis in E. coli. Evi- strains all were derivatives of E. coli K-12. Strain DB6656 is dence is presented that this common fragment is yeast DNA and pyrF:.Mu trpam,lacZam hsdR.
    [Show full text]