US00913962OB2

(12) United States Patent (10) Patent No.: US 9,139,620 B2 Yuen et al. (45) Date of Patent: Sep. 22, 2015

(54) FELINE MORBILLIVIRUS AND USES (58) Field of Classification Search THEREOF None (71) Applicants: Kwok-Yung Yuen, Hong Kong (CN); See application file for complete search history. Patrick Chiu-Yat Woo, Hong Kong (CN); Susanna Kar-Pui Lau, Hong (56) References Cited Kong (CN) U.S. PATENT DOCUMENTS (72) Inventors: Kwok-Yung Yuen, Hong Kong (CN); Patrick Chiu-Yat Woo, Hong Kong 4,444,887 A 4, 1984 Hoffmann (CN); Susanna Kar-Pui Lau, Hong 4,522,811 A 6/1985 Eppstein et al. Kong (CN) (Continued) (73) Assignees: THE GOVERNMENT OF THE FOREIGN PATENT DOCUMENTS HONG KONG SPECIAL ADMINISTRATIVE REGION OF GB 2220211 A 4f1990 THE PEOPLE'S REPUBLIC OF WO WO-91,10741 A1 7, 1991 CHINA, Hong Kong (CN); (Continued) VERSITECH LIMITED, Hong Kong OTHER PUBLICATIONS (CN) Rozenblatt et al., “Sequence Homology within the Morbilliviruses.” (*) Notice: Subject to any disclaimer, the term of this Journal of Virology, vol. 52, No. 2: pp. 684-690 (1985).* patent is extended or adjusted under 35 (Continued) U.S.C. 154(b) by 0 days. (21) Appl. No.: 13/746,947 Primary Examiner — Zachariah Lucas (22) Filed: Jan. 22, 2013 Assistant Examiner — M. Franco Salvoza (65) Prior Publication Data (74) Attorney, Agent, or Firm — Leason Ellis LLP. US 2013/0230529 A1 Sep. 5, 2013 (57) ABSTRACT Described herein are isolated paramyxovirus, a morbillivirus Related U.S. Application Data (FmoPV), nucleic acid molecules, polypeptides and antibod (60) Provisional application No. 61/588,778, filed on Jan. ies related to FmoPV and uses thereof. In certain embodi 20, 2012. ments, the FmoPV is a feline morbillivirus. Also described herein is a recombinant FmoPV comprising a modified (51) Int. C. FmoPV gene or gene segments and uses thereof. Also CI2O 1/70 (2006.01) described is a recombinant FmoPV for the prevention and/or CI2O I/68 (2006.01) treatment of diseases related to FmoPV or a delivery vector. Also described herein is a diagnostic assay for FmoPV, natu (Continued) ral or artificial variants, analogs, or derivatives thereof. Also (52) U.S. C. described herein is a vaccine and a kit containing the vaccine CPC ...... C07K 14/115 (2013.01); A61K39/12 for the prevention and treatment of FmoPV infection. Also (2013.01); C07K 14/005 (2013.01); C07K provided is a diagnostic kit comprising nucleic acid mol 16/1027 (2013.01); CI2N 7/00 (2013.01); ecules for the detection of FmoRV. (Continued) 9 Claims, 45 Drawing Sheets

388 ::$8:38:

88:8 US 9,139.620 B2 Page 2

(51) Int. Cl. Bartet al., “Feline infectious pneumonia: a short literature review and C07K I4/15 (2006.01) a retrospective immunohistological study on the involvement of C07K 6/10 (2006.01) Chlamydia spp. and distemper virus'. Vet J, 2000, vol. 159, pp. 220-230. GOIN33/68 (2006.01) Chatziandreou et al., “Relationships and host range of human, CI2N 7/00 (2006.01) canine, simian and porcine isolates of simian virus 5 (parainfluenza A6 IK 39/2 (2006.01) virus 5), J Gen Virol, 2004, vol. 85, pp. 3007-3016. C07K I4/005 (2006.01) Herrewegh et al., “Feline coronavirus type II strains 79-1683 and CO7H21/04 (2006.01) 79-1146 originate from a double recombination between feline A61 K39/00 (2006.01) coronavirus type I and canine coronavirus'. J. Virol, vol. 72, pp. 4508-4514. (52) U.S. Cl. Siegl et al., “Characteristics and taxonomy of Parvoviridae.”. CPC ...... CI2O 1/701 (2013.01); G0IN33/6893 Intervirology, 1985, vol. 23, pp. 61-73. (2013.01); A61 K 2039/55566 (2013.01); C07K Truyen “Evolution of canine parvovirus—a need for new vaccines?'. 2317/76 (2013.01); C12N 2760/18421 Vet Microbial, 2006, vol. 117, pp. 9-13. (2013.01); C12N 2760/18422 (2013.01); C12N King et al., “Virus Taxonomy: Ninth report of the International Com 2760/18434 (2013.01) mittee on Taxonomy of Viruses', 2012, pp. 111-122, pp. 235-248, Elsevier, San Diego, US. (56) References Cited Knipe et al., "Fields Virology', 2007, pp. 1551-1586, Lippincott Williams and Wilkins, Philadelphia, U.S.A. U.S. PATENT DOCUMENTS Lau et al., “Identification of a novel feline picornavirus from the domestic cat'. J. Virol, 2011. 4,716,111 A 12/1987 Osband et al. Lau et al., “Severe acute respiratory syndrome coronavirus-like virus 5,057,540 A 10, 1991 Kensil et al. in Chinese horseshoe bats'. Prac Natl AcadSci USA, 2005, vol. 102, 6,309,647 B1 * 10/2001 Paoletti et al...... 424,199.1 pp. 14040-14045. Woo et al., “Characterization and complete genome sequence of a FOREIGN PATENT DOCUMENTS novel coronavirus, coronavirus HKU1, from patients with pneumo nia”, J Virol, 2005, vol. 79, pp. 884-895. WO WO-96,33735 A1 10, 1996 WO WO-96,34096 A1 10, 1996 Guindon et al., “New algorithms and methods to estimate maximum WO WO-98.16654 A1 4f1998 likelihood phylogenies: assessing the performance of PhyML 3.0.”. WO WO-98.24893 A2 6, 1998 Syst Biol, 2010, vol. 59, pp. 307-321. WO WO-98,46645 A2 10, 1998 Woo et al., “Relative rates of non-pneumonic SARS coronavirus WO WO-98,50433 A2 11/1998 infection and SARS coronavirus pneumonia’, Lancet, 2004, vol. 363, pp. 841-845. OTHER PUBLICATIONS Li et al., “Differential Susceptibility of different cell lines to Swine origin influenza A H1N1, seasonal human influenza A H1N1, and Barrett, “Morbillivirus infections, with special emphasis on avian influenza A H5N1 viruses”. J. Clin Virol, 2009, vol. 46, pp. morbilliviruses of carnivores'. Vet Microbiol, 1999, vol. 69, pp. 3-13. 325-330. Chua et al., "Nipah virus: a recently emergent deadly Peiris et al., "Clinical progression and viral load in a community paramyxovirus', Science, 2000, vol. 288, pp. 1432-1435. outbreak of coronavirus-associated SARS pneumonia: a prospective Halpinet al., “Isolation of Hendra virus frompteropid bats: a natural study”. Lancet, 2003, vol. 36I, pp. 1767-1772. reservoir of Hendra virus”, 2000, J Gen Virol, vol. 81, pp. 1927-1932. Chan et al., “Wild type and mutant 2009 pandemic influenza A Moreno-Lopez et al., "Characterization of a paramyxovirus isolated (H1N1) viruses cause more severe disease and higher mortality in from the brain of a piglet in Mexico', Arch Virol, 1986, vol. 91, pp. pregnant BALB/c mice', 2010, PLoS One, vol. 5, pp. e13757. 221-231. Susta et al...An in situ hybridization and immunohistochemical study Osterhaus et al., “Morbillivirus infections of aquatic mammals: of cytauxZoonosis in domestic cats'. Vet Pathol, 2009, vol. 46, pp. newly identified members of the genus'. Vet Microbiol, 1995, vol. 44. 1197–1204. pp. 219-227. Miyazaki et al., "Tubulointerstitial nephritis causes decreased renal Philbey et al., “An apparently new virus (family Paramyxoviridae) expression and urinary excretion of cauxin, a major urinary protein of infectious for pigs, humans, and fruit bats'. Emerg Infect Dis, 1998, the domestic cat'. Res Vet Sci, 2007, vol. 82, pp. 76-79. vol. 4(2), pp. 269-271. Chard et al., “Full genome sequences of two virulent strains of peste Tidona et al..."Isolation and molecular characterization of a novel des-petits ruminants virus, the Cote d'Ivoire 1989 and Nigeria 1976 cytopathogenic paramyxovirus from tree shrews'. Virology, 1999, strains”, Virus Res, 2008, vol. 136, pp. 192-197. vol. 258, pp. 425-434. Visser et al., “Fusion protein gene nucleotide sequence similarities, Stone et al., “Fatal cetacean morbillivirus infection in an Australian shared antigenic sites and phylogenetic analysis suggest that phocid offshore bottlenose dolphin (Tursiops truncatus)'', Aust VetJ, 2011, distemper virus type 2 and canine distemper virus belong to the same vol. 89, pp. 452-457. virus entity”, J Gen Virol, 1993, vol. 74, pp. 1989-1994. Young et al., “Serologic evidence for the presence in Pteropus bats of Terai et al., “Felis domesticus papillomavirus, isolated from a skin a paramyxovirus related to equine morbillivirus'. Emerg Infect Dis, lesion, is related to canine oral papillomavirus and contains a 1.3 kb 1996, vol. 2, pp. 239-240. non-coding region between the E2 and L2 open reading frames'. J Lau et al., “Human parainfluenza virus 4 outbreak and the role of Gen Virol, 2002, vol. 83, pp. 2303-2307. diagnostic tests”. J. Clin Microboil, 2005, vol.43, pp. 4515-4521. Whittemore et al., “Antibodies against Crandell Rees feline kidney Lau et al., "Clinical and molecular epidemiology of human (CRFK) cell line antigens, alpha-enolase, and annexin A2 in vacci parainfluenza virus 4 infections inhongkong: Subtype 4B as common nated and CRFK hyperinoculated cats'. J. Vet Intern Med, 2010, vol. as subtype 4A. J Clin Microbiol, 2009, vol. 47, pp. 1549-1552. 24, pp. 306–313. Virtue et al., “Paramyxoviruses infecting humans: the old, the new Lappin et al., “Investigation of the induction of antibodies against and the unknown”. Future Microbiol, 2009, vol. 4, pp. 537-554. Crandell-Rees feline kidney cell lysates and feline renal cell lysates Lau et al., “Identification and complete genome analysis of three after parenteral administration of vaccines against feline viral novel paramyxoviruses, Tuhoko virus 1, 2 and 3, in fruit bats from rhinotracheitis, calicivirus, and panleukopenia in cats'. Am J Vet Res, China'', Virology, 2010, vol. 404, pp. 106-116. 2005, vol. 66, pp. 506-511. Woo et al., "Complete genome sequence of a novel paramyxovirus, Lappin et al., “Interstitial nephritis in cats inoculated with Crandell Tailam virus, discovered in Sikkim rats', J Virol, 2011, vol. 85, pp. Rees feline kidney cell lysates', J Feline Med Surg, 2006, vol. 8(5), 13473-13474. pp. 353-356. US 9,139.620 B2 Page 3

(56) References Cited Hoffmann et al., “A DNA transfection system for generation of influenza A virus from eight plasmids”. Proc Natl AcadSci USA, OTHER PUBLICATIONS 2000, vol. 97(11), pp. 6108-61.13. Wang et al., “Cloning of the canine RNA polymerase I promoter and Kul et al., “Natural peste des petits ruminants virus infection: novel pathologic findings resembling other morbillivirus infections'. Vet establishment of reverse genetics for influenza A and B in MDCK Pathal, 2007, vol. 44, pp. 479-486. cells'. Virology, 2007, vol. 4, pp. 102. Liess et al., “Studies on the Pathogenesis of Rinderpest in Experi Sambrook et al., “Molecular Cloning: A Laboratory Manual”. Cold mental Cattle. I. Correlation of Clinical Signs, Viraemia and Virus Spring Harbor Laboratory Press, 3° Edition, Cold Spring Harbor, Excretion by Various Routes'. J Hyg (Lond), 1964, vol. 62, pp. New York, U.S.A. 81-100. Tao et al., “Replacement of the Ectodomains of the Hemagglutinin Saito et al., “Detection of canine distemper virus by reverse Neuraminidase and Fusion Glycoproteins of Recombinant transcriptase-polymerase chain reaction in the urine of dogs with Parainfluenza Virus Type 3 (PIV3) with Their Counterparts from clinical signs of distemperencephalitis'. Res Vet Sci, 2006, vol. 80, PIV2Yields Attenuated PIV2 Vaccine Candidates”,Journal of Virol pp. 116-119. ogy, 2000, vol. 74(14), pp. 6448-6458. Marschallet al., “Avian influenza AH5N1 infections in cats'.J Feline Durbinet al., “Human parainfluenza virus type 3 (PIV3) expressing Med Surg, 2008, vol. 10, pp. 359-365. the hemagglutinin protein of measles virus provides a potential Martina et al., “Virology: SARS virus infection of cats and ferrets'. method for immunization against measles virus and PIC3 in early Nature, 2003, vol. 425, pp. 915. infancy”, Journal of Virology, 2000, vol. 74(15), pp. 6821-6831. Van Riel et al., “Highly pathogenic avian influenza virus H7N7 Skiadopoulos et al., “Three amino acid substitutions in the L protein isolated from a fatal human case causes respiratory disease in cats but of the human parainfluenza virus type 3 cp45 live attenuated vaccine does not spread systemically”. Am J Pathol, 2010, vol. 177, pp. candidate contribute to its temperature-sensitive and attenuation phe 218.5-2190. notypes”,Journal of Virology, 1998, vol. 72(3), pp. 1762-1768. Chomel et al., "Zoonoses in the bedroom”. Emerg Infect Dis, 2011, Teng et al., “Recombinant respiratory syncytial virus that does not vol. 17, pp. 167-172. express the NS1 or M2-2 protein is highly attenuated and immuno Karlin et al., “Methods for assessing the statistical significance of genic in chimpanzees”, Journal of Virology, 2000, vol. 74(19), pp. molecular sequence features by using general scoring schemes'. 9317-9321. Proc Natl AcadSci USA, 1990, vol. 87(6), pp. 2264-2268. Kensil et al., “Vaccine Design: Subunit & Adjuvant Approach'. Karlin et al., “Applications and statistics for multiple high-scoring Powell & Newman, Plenum Press, 1995, New York, U.S.A. segments in molecular sequences'. Proc Natl AcadSci USA, 1993, Stoute et al., “A preliminary evaluation of a recombinant vol. 90(12), pp. 5873-5877. circumsporozoite protein vaccine against Plasmodium falciparum Altschulet al., “Basic local alignment search tool”, J Mol Biol, 1990, malaria. RTS.S Malaria Vaccine Evaluation Group', N Engl.J Med, vol. 215(3), pp. 403-410. 1997, vol. 336(2), pp. 86-91. Altschulet al., “Gapped BLAST and PSI-BLAST: a new generation Woo et al., “Feline morbillivirus, a previously undescribed of protein database search programs”, Nucleic Acids Res, 1997, vol. paramyxovirus associated with tubulointerstitial nephritis in domes 25(17), pp. 389-402. tic cats'. Proc Natl AcadSci USA, 2012, vol. 109(14), pp. 5435-5440. Myers et al., "Optimal alignment in linear space'. Comput Appl Audit Commission, “Control of pet animals(Chapter 4). Agriculture, Biosci, 1988, vol. 4(1), pp. 11-17. Fisheries and Conservation Department, Housing Department, Mar. Quinlivan et al., “Attenuation of Equine Influenza Viruses through 29, 2010, Hong Kong, China (www.aud.gov.hk/pdf ele54ch04.pdf). Truncations of the NS1 Protein'. Journal of Virology, 2005, vol. 79, pp. 8431-8439. * cited by examiner

U.S. Patent Sep. 22, 2015 Sheet 2 of 45 US 9,139,620 B2

Figure 2-1 FmoPV 761U Cats/Hong Kong/2009 16050 bp

ACCACACAAAGATGTTTGTGACCTATTCTAACGACAAGACTATTATTAAATATTTAGGAA TAACGATTCCATTAGTGAGGTGAGGGGGAGGAATCAGGTATTCCACAATGTCTAGTCTAT TGAGGTCACTTGCTGCATTTAAGAGACATAGGGAGCAACCAACAGCACCGTCAGGTTCGG GTGGTG CAATTAAAGGATTGAAAAATACAATTATTGTTCCAGTTCCAGGGGATACAGTAA TTACTACAAGGTCTAATTTGTTATTTAGATTAG TTTATATAATAGGCAATCCGGATACAC CTTTAAGCACCTCGACGGGAGCAATAATATCATTGTTGACCTTATTTGTCGAATCTCCAG GTCAATTAATTCAAAGAATTGCTGATCACCCTGATOCAGTTTTTAAATTGGTAGACGTCA TTCCTGAACCTGGTAATCCTGGAGAATTAACTTTTGCATCTCGAGGGATTAATTTAGACA AGCAAGCTCAACAATACTTTAAATTGGCTGAGAAAAATGATCAGGGGTATTATGTTAGCT TAGGATTTGACAACCCACCAAATGATGACGATATAACATCTAGTCCTGAGATATTCAATT ATATCCTGGCATCTGTACTTGCACAAGTTTGGATTCTTCTGGCAAAAGCTGTGACTGCTC CAGATACGGCTGCTGAAGCCGAAAATCGTAGATGGATTAAATTAATGCAACAACGTAGGG TGGATGGTGAACTGAGATTGAGCAAGGGATGGCTAGATTTGGTGAGAAACAAGATTGCGT CAGATATTACAATAAGGCGATTCATGGTAGCATTAGTTCTTGACATCAAACGTTCTCCTG GGACAAGACCCAGGATAGCTGAAATGATTTGTGATATTGATAATTATATTGTAGAGGCAG GGCTTGCAAGTTTCTTGTTAACTATTAAATTTGGCATAGAGACACGTTATCCAGCACTGG CACTACATGAGTTTTCTGGAGAACTAGCCACTATTCACGGGCTTATGAAATTGTACCAAT CTATGGGGGAAATGGCACCATACATGGTAATTCTGGAAAATTCAATCCAAACCAGGTTTA GTGCAGGGTCTTATCCTCTGCTATGGAGTTATGCCATGGGTGTCGGGGTGGAGCTTGAAA GATCAATGGGTGGACT CAATTTCACTAGAAGCTTCTTTGACCCTACATATTTCAGACTTG GTCAAGAGATGGTGAGGAGATCTTCACGGATGGTTAATAGTTCATTTGCGAGAGAACTTG GCCTATCTGATCATGAAACACAACTGGTCAGCCAGATTGTCAATTCGGGAGGTGAATCTG GGATACCTAAATTTGATGGATTCAGAGCAAATCCAACAACTTTTCTAGGAACCAAAGATA ACATAAATGATAGAGGTGAAGATCACGTCAAATTCGATATCAGGGTTACCTGGTCCACTAT TACCCAGCCGTGACCTAAATCTTTCAGGTGATTCATATGGAATTAATAGTGGTGTGAAAA U.S. Patent Sep. 22, 2015 Sheet 3 of 45 US 9,139,620 B2

Figure 2-2 ATGICAGTGACAAACTGAATGAAGGAGTAGGTCCAGACCATGATGTGTCCAGTTCTCCCA TGGAAGAATTGAGAAGATTGGTTGAGTCCACCAACAGAATAGACACCAAACAGCCAGAAG CTTCAGGTGTCACCAACCATTATAATGATACTGACCTTCTAAAATAATATGAGCATACCC TAATTGCTTATTATGCA ACTCAAATTAAGAAAAACTTAGGACCTCAAGGTTCACAACTOT TGGCATATCACTAAAATACAGTCAGCTCTTCACCCACCACATGTCCTCTCACCAAATCCA GCAAGTCAAACATGGCCTCGAATCTTTACAAGAGATCAAAAACAACCCTCCGTCTTCCCA AGATGTCAATCTTGCCAGGGAGATTTACGAATCCATTAGACAAACAGGAACATCTTCAGT GCAAGGAGGAGCCATTGCGGGAGATAATATTACGTCAGGGGGTAACAATGACTCAATGTA TACCCAAGGACCAAGTCCTCCTATTTCAAGTGTTAACAAGAATATCGAAGGACCTACTGG ATTCGATCATTCAGGACTATGGGATCCAGAGGGTA ACCTCTGCATGCTATTCGAAAGCGA TGATGATGAAAACCATTATTCAGAGATTAATGGCCGGTCTTCCGCTATCGAAGGACTGGA TGAACAGGATAATGAGAACTCAATTATTAAACAACCAGGAAATCAGTGTACTGAGGGAGT GTCTAAG ACTGATTCATCTCTTAGTCCCAGGAAACTACACTATCTGTTGGGGGATCTGA TATACCTGGGGCAGGAATATCAACCTGTGCCTCTTTGGATATAACTGTAAATGAACTCGA AGATGCAACTGTAAGAAATAGCAACAATATGAAAGGGAACTGGCCAATTCCTAAATTACT TGTTAAGCCGCCACCTAGGGTAAAAACAAGCGTTGATCACAGTAATCCATTAAAAGGGGC CACACGAGGCAAATTAGCCTCACCTGGGATGGAGACTACATTATTCGAGAGGAGTGGTGC AACCCCATCTGTACACCCATATACTCA ACCTGCAAGCGACTTCAATGTAGGTGCAAGCAA TGTCCATCAACCTGCCCTAAATGTGAATAATAATTGCAATGATGGTAGGGTAACAGCGCC TAACTCACATAAAGATATCGAGGGTGAGTCTGAAATATCTATTCAAGATATATATAACTT GATTCTTGGATTTAAG GATGATTACAGGAAATTATCAAACAAATTAGATATGGTATTAGA GATGAAACAAGACATTGACAATCTAAAAAAGAATAGTGCTAAAGTGCAATTGGCTCTATC AACTATTGAGGGACATCTATCCAGTGTTATGATTGCCATCCCTGGTTCACGTATTGATTC CACAGGGGATGAGGAAAAGGATCAGATAAATTCTGACTTAAAACCACTGCTAGGAAGGGA TCATTGTAGAGCATTTCGAGAAGTTACCAATCCTCTAGATGAGTCTTCACTAGCCAATTC TCCAACAAAACATGTTGCCAAGGTAAACAAAAACTGCACTCTTCAGAAGATCAACAAGAA CCAAACATCTGCAATCAAATTTGTTCCTAGTGACA GTCATGCAAGCACATCAACCATCAG ATCAATTATCAGGTCATCTAATCTCCATCAGGATTTGAAAACAA AATTGCTCACAATTCT U.S. Patent Sep. 22, 2015 Sheet 4 of 45 US 9,139,620 B2

Figure 2-3 ATCCCAGATTAGAGGGGCAGACAATATTAGAGAATTCTATGAAAAGGTTATGATATTAAT AAAGAATAAGAA"TAAAEAT ACAAATCTACA'"CAT"'A'AGGTTGAAT"'G'I'CTTCAAT AAGATTTGGTCAGTFTCATATATATGGTTATTGATTTGTGATAATTATAAAAAACTTAGG AGCTAAAGGTTACTCACTCATATACAGCATGACTO AGATATTCA ACCTTGATO AGAGCTC ATGGTCAGTCA AAGGGATACTAGATCCGTTAACACCTGATACCTATCCTGATGGTCGACT AGTGCCTAAAGTTCGAGTTATCGATCCGGGTCTAGGACATCOCAAGAGTGGGGGGTATAT GTACCTACTTCTTCATGGTGTCATAGAAGATAGTGAGACTATAATTAGCCCGAAAGGAAG AGCATTTCCTGCATTCCCATTAGGAGTGGGTCAATCAACTGAAAACCCGGAAG ACTTGTT TAAGGAAATATTAACTCTCA ACATCGTGACTCGTAGGACTGCTGGATTTAATGAGAAATT GGTTTATTATAATACCACACCTCTACATTTACTGACCCCCTGGAAAAAAGTGTTGGCATA TGGAGGCATTTTTAATGCTAATCAGGTCTGCAGTGATACAAGTTCCATACCAATAGACAT TCCACAAAAATTTAGGCCAGTATATTTGACTGTTACAAAATTATCTGATGATGGCTATTA TCAGATCCCAAAGATGATTCAAGATTTCAAATCGTCAAATTCTGTTGCATTCAACATCCT TGTG CATCTGTCAATGGGCATAAATTTACTTGACCAATCCAAGGACCCTAGATTAAGAAA TGCTGCAGAAACTGTGATCACATTTATGATTCATATTGGAAACTTAAACGGAAGAGTAA TAAGTCTTACTCACCTGAATATTGCAAGAGGAAAATAATGAGGCTGGGTTTAATATTCTC ATTAGGTO CAATTGGTGGCACAAGCTTGCATATTAGATGTACAGGTAAGATGAGCAAACG ACTACAGGCTTATTTAGGATTCAAAAGGACTTTATGTTACCCTTTGATGTATGTTAATGA AGGGCTGAACAAGACCCTGTGGAGAAGTGAATGCAGAATAGAGAAGGTTCAAGCAGTCTT ACAGCCATCAGTCCCGAATGAATTTAAGATATATGATGATGTTATTATTGATAATACCAA TGGTCTCTTCAAGATTAAATAGACTATAACAATAATAAACAGCTACTAAATAGTATTATG TATTTAAGTGTACACTGATAATTGCGAATAAAATACACCAGATTAATAACAGTATAGAGT TAAGATCTAATTGATATGTGGGTTGGTACTCGATCATTTATTAGCTCTACTGATTATCTA TATCTTGAATCACCAAATGTAAGAGCATCA ACACGTAATAAGTTTTGGATTGCTAGATTG ACACTTAATTCTCAGAACTAGAATACCCAGATTGTCA AACCTATAACCTTGTTAGATTCA TTAAAGTTAGATTCTTGTAATGTTGATCAATTATCACTTGACCAATTATAAAAAACTAAG GACCTAATGTAATAGGAACCCAAA CTCCATCCAGTGAGCTCTAAATCGCCATGCTTGAAT ATTAATTTATCTAGGGCCTGTCTA ACTCAGAACAAAGATCACAACTAGAGTCTAAAGGAG U.S. Patent Sep. 22, 2015 Sheet 5 of 45 US 9,139,620 B2

Figure 2-4 TGGGTCAAGTCTGAACAATTATCAAGAGCCGAGATTCAAAACTGATTCCTCCTTAAACTC AGAACCCTAACAATATATCATCCACTCA ACATCATGAACAGAAT"TAAGGITATGATAATT AGTTCTTTATTATTATCAGATATTACGATTGCACAAATAGGTTGGGATAATTTGACTTCG ATTGGAGTTATAAGTACTAAG CAATACGACTATAAAATAACTACTCTGAACACTGACCAG TTAATGGTTATAAAGATGGTTCCTAATATATCATCAATCATTAATTGCACTA AACTCGAA TTAACAAAATATAGAGAGTTAGTCTCAGGGATCATTAGACCAATAAATGAGTCATTAGAA TTAATGAATTCATACATTAACATGAGAGCAGGTTCAGAGAGATTTATAGGGGCTGTAATA GCTGGTOTAGCCTTAGGAGTGGCAACTGCAGCACAAATAACATCAGGGATTGCCCTACAT AATTCAATTATGAACAAAAAACAAATACAAGAATTGAGGAAGGCTCTTAGTACTACCAAC AAAGCAATTGATGAAATAAG GATTGCAGGTGAAAGAACATTAATAGCAATTCAAGGTGTA CAGGATTATATTAATAATATAATTATCCCTATGCAGGACAAA CTCCAATGTGATATTTTA TCATCACAACTTTCTGTTGCTTTACTCAGATATTATACAAATATACTA ACACTTTTTGGG CCAAGTATACGGGATCCTATTACTAGTACAATTTCAGTACAAGCACTCAGTCAAGCATTC AATGGTAATCTTCAGGCATIGCTTGATGGACTGGGGTATACTGGGAGAGACTTACGTGAT CTTCTAGAGAGTAAATCTATCACTGGCCAGATAATTCATGCAGATATGACTGATTTGTTC CTTGTTTTGAGAATAAATTATCCTTCCATAACTGAGATGCAGGGAGTAACAATATATGGG CTCAATTCAATTACATATCATATTGGGCCTGAAGAGTGGTATACCATTATGCCTGATTTT ATTGCTGTTCAGGGTTTTTTAATATCTAATTTTGATGAGAGAAAGTGTTCAGTAACTAAA TCA ACTATATTGTGCCAACAAAATTCAATTTACCCAATGTCAACAGAGATGCAA AGATGT ATTAAGGGCGAGATA AGATTCTGTCCAAG ATCCAAGGCAATTGGGACATTAGTTAATCGG TTTATATTGACCAAAGGTAATTTAATGGCTAATTGTTTAGGGATTATATGCAGATGTTAT ACTTCAGGACAAGTTATAACACAAGACCCAAGTAAATTGATTACGATAATATCGCAAGAG GAGTCCAAGGAAGT"TGGTGTIGATGGTATTCGTATTATGGTAGGACCTAGAAAATTACCA GATATTACCTTTAATGCTAGGTTGGAAATTGGTGTACCAATATCATTGACCAAATTCGAT GTCGGGACTGATTTAGCGATTGCTTCAGCTAAACTTAATAATTCTAAGGCATTGTTAGAG CAATCAGATAAGATTTTAGATTCAATGTCTAAATTGGATTCTATGAATTCAAGAATAATA GGATTAATCTTAG CAATTATGATAATCTTTATAATCATTATTACTATTATCTGGATCATA TATAAAAAATGTAGGAATAAAGATAATAAATTCACGTACTTCAATTGAACCGCTCTACATA U.S. Patent Sep. 22, 2015 Sheet 6 of 45 US 9,139,620 B2

Figure 2-5 CCCCCTTCTTATAACTCACCTCATAGTGTGGTTAAGTCTATTTGACCACTGACCATATGA TCCACTC'TAATAAGTCCAATGAAACTATCAATTAATAAA"I'GGTAGGCAAGAGIAT"I' GATTGTATAATATACTCCTTTAAACTAGATAGTGATAAAGGGTTATAGATGATTTCAGTT ATTTTAATATAATCATATATTGATTTATTATCTTACAIGACTATATGTAATGAATTA TGTGTCATCAATTAATAGCTTAATAATATCGTTTAATGTACTTATATTGATGGATAGATG TGTTATATTGTAATCAAGGATTTAGTATTTAGAAAAGGAAACAGTTTAATTTGTTGTTAA TTAGTTATTGTGTATTCAATTAGAAAAAACTTAGGAATCCATGTTAATAAAAATTIATTA TCATGGAGTCCAACAATATTAAGTATTACAAAGATTCTAGCCGGTACTTTGGTAAAATAT TAGATGAACACAAAACAATTAATAGTCAATTC, TACAGTTTCAGTATCAAGGTAATTACCA TTATTGCTATTATTGTAAGCCTGATTGCAACAATAATAACTATTATCAATCGCCACTAGTO GGAGAACTACCCTAAATAGTAATACAGACATACTACTCAGCCAACGAGATGAGATTCATA ACATCCAAGAAATGATATTTCATCGTATTTATCCTTTGATAAATGCTATGAGTACAGAGC TAGGACTTCATATTCCTACCTTATTGGATGAACTTACTAAAGCGATTGACCAGAAAATTA AAATAATGCATCCTCCTGTGGACACTGTGACTTCTGACCTTAATTGGTGCATCAAACCCC CTAATGGAATTATCATAGACCCAAAAAGTTATTGTGAGAGTATGGAATTGTCTAAAACTT ATGAACTCTTACTTGACCAGTTAGATGTCTCAAGAAACAAATCACTTATTATAAATAGAA AGAATATCAACCAGTGCCAATTAGTTGATAATTCAAAGATCATTTTTGCTACTGTCA ACA TACAATCTACACCGAGGTTTTTAAACTTTGGTCACACGGTCAGCAATCAACGTATAACAT TTGGTCAAGGAACATATAGTAGTACTTATGTTATAACTATCCAAGAAGATGGAGTAACTG ATGTTCAATATCGAGTOTTTGAGATCCGATATATTTCTGATCAGTTTGGTGTATTCCCCT CCTTAATAGTATCGAGAGTGTTGCCGATACOTATOCTATTAGGAATGGAATCCTGTACCT TGACAAGTGATAGACTAGGCGGGTATTTTTTATGTATGAATACACTGACACOATCTATAT ATGATTATGTTAGCATAAGGGATTTGAAATCACTTTATATAACAATCCCTCATTATGGTA AAGTTAATTATACTTACTT'TAATTTTGGTAAGATCAGGAGCCCACATGAGATTGATAAAA TTTGGTTAACATCTGATAGAGGCCAAATTATCTCTCGTTATTTTGCAGCATTTGTTACCA TTACAATTCGGAACTATAATAATTATCCCTACAAATGCTTAAATAACCCATGTTTTGACA ACTCTCACAATTACTOTAGAGGATGGTATAAAAACATAACACGAACTGATGATOTTCCGA TATTAGCATACTTATTGGTTGAAATGTATGATGAGGAGGGACCTTTAATTACACTTGTGG U.S. Patent Sep. 22, 2015 Sheet 7 of 45 US 9,139,620 B2

Figure 2-6 CAATACCACCTTACAATTATACAGCTCCATCTCATAATTCTCTTTACTATGATGACAAAA "I"IAATAAATTAATAATGACTACATCICACAAGG''TATA'''CAAATCAA CGAGGGCATG AGGTAATTGTTGGCGATAATTTGAAGGCTATCCTCTTAAACAGATTGTCTGATGAACATC CTA ACCTGACTGCCT"GTAGACTCAATCAGGGTATTAAGGAGCAATACAAGTCTGACGGAA CAATAATTTCAAATTCTGCACTTATTGATATACAAGAACGAATGTACATTACAGTTAAAG CTATTCCACCAGCAGGTAACTATAACTTTACAGTTGAGTTGCATTCTAGATCAAACACAT CCTATGTATCGTTACCAAAACAGTTTAATGCTAAGTATGACAAATTACATCTTGAGTGCT TTAG CTGG GACAAATCCTGGTGGTGTGCTCTGATACCCCAGTTTTCATTAAGTTGGAATO AATCCCTTTCTGTTGATACTGCCATTTTCAATTTAATAAGCTGTAAATGAACACATCAAT CTATAGTTGATAGTTGTCAAAACATTAGCTAATTTGGGTTTAAGAAATAGGAAAATGAAA TTACCAATATCTAATTAGATGTATGTTCAAGCTAAATTACAAAAAACTTAGGAGTCAGAG ACTTCGTTGCAATGGACCAGTCAGACTACCAAGATATTCTATACCCGGAAGTACATCTTA ACAGTCCTATAGTAATTTCCAAATTAGTAGGTATTTTACAATACCCCCAAATTCCTCATA ATCAACAATTATCAGACCGTACAATTATCAAGAATATTCAATTTAGATTAAGGAACGGAT TTAATAGTTCAAGGGTACAGGTACTATCAGCTATGGGTGAAATTATCAACAAAATTAGAA ATAAATATCCTAATTATTTACACATACCTTACCCTGAATGCA ACCAAAAACTATTTCCAA TAGTAGATCCAGAACTAACATCAAAATTAGAATCTCTTCTAAACAAAGGTGACACACTGT ATCTCAAGATTCGATCAGATATCATAAAATGTTTTGATAGATTGAAAATGAAAATGAATA TAAAGAATGATCTTCTTAATGACAATAGTCAATTGATTCTAGATCTTCCTTTAATTATCA AAGGATCTCAGTGGTTCTTCCCTTTTTTATTCTGGTTTTCTATCAAAACTGAAACTAGAA GCTGTATTCCCCAAAATCAAAAG ACTCGTGTTAGATCACAATATCGGCCTCACTTATCAG AGACTA AGAGAATTACATTGGTTCTTACATCTGATCTGATTACAATATTTGATCATATTA ATAAATGTATATITTATCTGACTTTTGACATGCTGT'TAATGTATTGCGATGTGATAGAAG GTCGGTTAATGACTGAAACAGCTATGAGCTTGGACTGTCGGTTTACCAATCTATTGCCAA GAGTGCAATATATGTGGGATTTACTAGATGGAATGTTTGAAAGTTTAGGCAATCAATTAT AITCAGTATTGCATTATTAGAGCCTCTTTCTCTTGCTTATTTGCAATTGATAGATGCAG ATCCACAGATTCGGGGAACATTCTTGCATCACTGCTTTTCCGAGTTAGAAGAAATTATAT TTGACAAAACCCCTTTTGATCCTTTTGTGTATGAAAATTTAATTAATGGGCTTGATTACA U.S. Patent Sep. 22, 2015 Sheet 8 of 45 US 9,139,620 B2

Figure 2-7 TTTATTTGACAGGTGATATTCATCTAACTGCAGAAGTTTTTTCTTTTTTTAGAAGTTTTG Gl'CACCTII"TT"TAGAGCCACAAAAIGCTGCTAATAATGAAGGAAGTATATGAATAAGC CTAAGGTAATATCATATCAGACTTTAATGCAAGGACATGCGATTTTTTGCGGTATTATAA TAAATGGATTTAGAGACCGCCACOGGGGAACATCGCCTCCTGTGGACTTACCAAATCATO CATCTGCTGTAATTAGAAATGCCCAGTTATCTGGAGAAGGGTTAACATCTGAACAATGTG CTCA ACACTCGAGATCCTTTTGTCGATTTAGATTTAAATGTTTTATGCCATTGAGTCTAG ATAGTGACCTTACAATGTACCTTAGAGACAAGGCGCTGTCACCTGTCAGAAATGAGTGGG ATTCAGTTTATGCTAAGGAGTATTTAAGGTATAATCCAGGATTACCCACAAGTTCCAGAA GATTGGTAAATGTATTCTTAGAAGATGATAAGTTTGACCCATATGAAATGATCATGTACG TGATAAATGGTGATTACTTA AGAGACAA AGAGTTTAACCTTTCATACAGCCTTAAAGAGA AAGAAATTAAAGAGGTAGGTCGATTGTTTGCTAAAATGACCTATAAGATGAGGGCTTGTC AAGTAATAGCTGAAAACCTGATTGCCAATGGAGTAGGGAAGTTTTTCAAAGATAATGGAA TGG CAAAAGATGAACATAAATTAACTA AGACGTTACACAAATTAGCCATTTCACGTGTAC CTAAAGATAATTCTA AACTTATTTAGATGAATGTTGGGACCAAGTAATTCGACAATGTT CAAGTAGTACACAGATAAGGGAACAGACTATGAATTCACAATCAAATAGGGAAATTGAAT CAAAGTCTTCTAGGGCACGTCTTAATAATAGAGATATCTTAAAGGGCAAGAGAGATTCGA ACAAACAAGTAAAGTATCCTTCAA ACACCGAGTATTATGAGACTATCAGTAGTTTCATAA CTACTGACCTTAAAAAGTATTGTCTTAACTGGCGATATGAATCAAGTAGTATGTTTGCAC AGAGACTTAATGAAATTTATGGACTGCCTGGATTTTTCCAGTGGCTTCACAAGATTTTGG AGAAATCTGTTCTATACGTTAGTCATCCATCTAGTCCACCTGACTTTGATCAACATGTCG ATATAGAATCAGTCCCAAATGACCATATCTTTATCAAGTACCCGATGGGTGGAATAGAGG GGTTCTGTCAAAAATTATGGACCATTAGTACAATTCCGTTCCTATATTTAGCAGCTTTTG ATACAGGGGTTAGAATCTCATCATTGGTTCAAGCC(ATAACCAGGCAATTGCAGTAACCA AAAGAGTTCCGTCATCTTGGAGTTACTCAAAGAAAAAGGAAGAATCAACTAAAATAACAA CACAATATTTTCTTAATTTAAGACAACGCTTACACGATATAGGTCATGAATTGAAAGCAA ATGAGACTATATATCCTCTCATTTCTTTGTTTACTCTAAAGGTATTTATTATGATGGAA TACTTCTCTCCCAGGCACTTAAAAGTATTGCAAGATOTGTCTTTTGGTCTGAA ACGATTG TTGATGAGACTAGGTCAGCTTGCAGTAATATATCTACGACACTCGCAAAGGCAATTGAAA U.S. Patent Sep. 22, 2015 Sheet 9 of 45 US 9,139,620 B2

Figure 2-8 GGGGTTATGATAAATTTGTGGCGTACGCTATCAATATTTATAAAACAATACATCACGTCGT "IGATI'GCATEGICC"I"TACGA"AATCC ACTATGACACCAGACA"TACAGAACCT"'C' ACAAGAGTTTAGATCTACTTAAGAATCTA GTTCTGATTCCTGCACCATTAGGGGGCATGA ACTATATGAACATGAGCAGGTTATTTGTTAGGAATATAGGAGATCCCATTACTGCTTCAT TTGCTGATATAAAGCGCATGATTGAATGTGGGTTGTTAGGATGTAGTATTCTGTCACAAA TAATGTACCAAAAATGTGGTTCCTCCAAATACTTAGACTGGGCTAGTGATCCT"TATTCAA TAAACCTTCCTTATAGCCAAAGTATGACCAAGGTTTTAAAAAATGTAACGGCAAGATATG TACTTATGCATAGTCCCAACCCTATGCTCAAAGATTTGTTCCATGAAAAGTCTCAGGAAG AAGATGAAATCCTTGCTGAGTTTCTGTTAGACCGACACTTAATAATCCCTAGAGCAGCAC ACGAGATTTTATCAAATTCACTAACAGGTGCTAGAGAATCTATAG CAGGTATGCTTGACA CTACTAAGGGTTTAATCCGTGCTAGTATGTCA AGAGGTGGGTTGACCTCATCACTTGTTT TAAAATTATCA ACATATGATTACCAACAGTTTAGAACATGTCTTGAATGGCTTTATGCTC CTACTACGGGAATTGCTGTAACGCGTTGATTCTTCCTCTGTATTCTTAGCTAAGACCATCC GGAAGAGAATGTGGGTTCACCTAACTAAAGGAAGGGAGATTTATGGGTTAGAAGTACCTG ACATTTTGGAATGTATGCAAAACAATATTATTGTTGATCACGAAGATTGTTACTCATGTA TTCAAGCATCAAGATATTATACATGGTTTTTTGTACCTTCAAATTGTCAACTCGATCAAA TAAATAAGTCAACAAATTCTCTCCGAGTACCTTATGTTGGATCAACAACTGAAGAAAGGA GTGATATGAAGTTGTCATATGTGAGGTCACCTAGTCGGCCACTTAAAGCAGCAGTTCGAA TTGCAGCAGTATATACATGGGCTTATGGTGATGATAATTTGTCTTGGCATGAAGCTTGGT ATTTAGCAAGGACTAGAGCAAATATTACTTTTGACGAACTCAAATTAATAACACCTATAG CTACATCTACAAATTTAGCACATAGATTGACAGATAGAAGCACTCAAGTTAAATATTCAG GAACTTCTTTAGTAAGAGTGGCACGCTATACAACAATATCTAATGATAATATGTCGTTCA TTATTAATAACAAAAAAGTCGATACTAATTTTGTCTACCAGCAAGGAATGTTATTAGGTT TGAGTATATTACAATATATATTCAGATACTGTACAAGTACTGGACAGTCAA ACACTGTAA TTCACTTACATGCAGATGTTAATTGTTGTATAGTACAGATGACTGATCAGCCTTATACAC CAAGCTTAACAAAAAAGCTACCTGATATTAGGCCCATTAATAATAAACTGATATATGATC CCGCTCCTATAATCGATACCGATGCAGCTAGGCTATATTCCCAAAAATACCTGTCACATT TAATAGATTTCCCAAGTTGGTCAACTACTCAGCTTAACACAGTGTTGGCGAAAGTGGTGG U.S. Patent Sep. 22, 2015 Sheet 10 of 45 US 9,139,620 B2

Figure 2-9 CGGTATCCATTGTAGAATTAATTACAAAAGCTAGTAAAGACCATCTCAATGAGATAATAG CAGTTGT"TGGTGATGATGATATCAATAGCT"TTATTACAGAAT"ITCTACT"TGI"TGATCCAC GTCTGTTTACACTATATTTAGGCCAATACACATCATTACAATGGGCATATGAAGTCCATT ATCATAGACCAGTGGGTA AATACCAGATOGCTGAACTGTTGCATAATTTCCTGTCA AGAG CTAGTAGAGGTATATTCACCATATTGACCAATGCCTTTAGCCACCCCAGAGTCTACAAAA GATTCTGGGAGTGTGGTTTATTGGAGCCTATTTATGGGCCCTATATAGGAAGTCAAAATC TACATAATGCAATGATTGATTATATCTATAATGCATACATTACTTATTGGATGCITATT TATCTGATCAAGTAGATGATACTGATATTATA ATATGTGAAACAGAGGACACATGTTTGG CGAATCGAATTGACAATTATCAAAGCAGACACTTAGCTGTGCTATAGATCTGTATTGTG ATTCCACTAGATGTCCCAATATAAAAGGGGCAGATACAATTATGAGAAACTCAATTCTTA GATCTTTCATTGATAATGAGAGGAGAACAAATCCACTCGGTTTGACATGGAACCTTGACC CCTTACTCGTGGATCATTTTAGCTGTTCTATTACGTATCTGAGGAGAGGTATTATTAAAC AGATGAGGTTAAGATTTGATCCAAGTGTATCGTTGGAACTATCTAGGATGATTAAGCCTG ATGCGGTTTATCAAGCACCTAAAATTCCGTCTTCATGGGCTCTTATAGATATCAACCCTO AAGTAAATGACCTTAATGTAATTTTTGGAGAGCTGAATAGCAAATCGGAAAGACATTCCTA TTGGACAGATTAGGATACACAATTATGAAATACATGCATATAGGAGGATCGGAGTTAATT CAACTGCATGTTATAAAGCTCTAGAGCTATTGTCTGTTCTAAATCGGTTTATGTCTAATC CATCAGGTGCATTGTTTTTAGGTGAAGGAGCAGGATCAATGCTGGTCACATACCGTGCTT TTGTCCCATTTAAGACAATTTATTATAATAGTGGTATTTCAGTTCAAAATGTTCAGGGCC AGAGAGAATTGAGTCTATATCCATCTGAAGTGGCACTAGTTGACAACAAAAATCGCTTGG CTAATGACCCCAATATCAAAGTCTTGTTCAATGGTAAACCAGAGTCTACGTGGGTTGGAA ACATCGACTGTTTTGCTTATATTCTTAGCCACATTGAGACCTCAAGCTTGACATTGATAC ATA GTGATATTGAGTCCAGCTTAAGCAAGACGAAGAATAAAATTCTTGAGGAGCTGTGCC ACATTCTGTCAATGGCACTCATTTTGGGGAAAATCGGATCTTTATTAGTTGTCAAGTTAT TACCAAGGGTCGGTGACTATACGTATTCATTTTGCAGGTATGCATCGGAATTCTATCAAC AAAGCCTCCTTGTTTTACCTAGGTTTAGTAACATGTCATCATCTGAGGTTTACTATATAG GGATTCACCTCAATACAAATCGATTGATTGATCCTGATAGAATAGTACAATACATAGTTA GAAATTTACA ACCAACTCCAGTTACATTTTTCTCCTATATTTTTGAAACTA AGTATAGAA U.S. Patent Sep. 22, 2015 Sheet 11 of 45 US 9,139,620 B2

Figure 2-10 ATAATATGGTTACAAATTATGGACTGTGCTTGTCAGACGGACACAAAAGTGATTACCTGT CATCAATTACAAAAATAGAGAACG'"TC"TCIGICATOTCGG"TAGAAI"T(AATGGACCTA AGATTATACAGCAATTATCAGGACATGACTATGCTAATGGGGAGACTAGTCTAGAATCAA GTATAATGATATTACTTAGAGAATATCTTAATGCAACTATACAAGGCCGGGAAACATTAG GCTTGTTTTCACCTTACCCAGTCTTACATGAGAGTCAGTTAAGAGAAATTAATAAGTGTA TTGCATTGAAATATGTTGTATATCTACTCTTTTATTCAAGCTCTACATTATCTAGTAAAC AAATAATGAGTAATCTTAGAAAGGGAATATTGATGTATGATTTGAGAGATGAATTTTTCA TATCAAGATTGTCAGCAAATTACAAGAAAAAGGTGATGTCACAAGAAGTCAAAACTACCT GGATCTTTAATCTTGATACTCCGACACGAAAAGCATTATATAAGITAGTAGGTTATTCAT TAATAATTAATCATGTATGATGATAGAGTATGATTATCCATCTTTAAAAGAGTA AGATAA TATCAGATGTATGATAACCAATTAAGTATTACTTTTGAATTGAAAGGTTGCTCAATTACA CGCTTTTTTAGTAATCGGGTTTTTATTCCAATTAGGGCAATTAGAAAAAACTTCAACGGT TAGTCGAGCCCGAATTCATTCCATATAAGTTATATTTATAATCTTGGATAAG ACTTTTGT TTAGAATTATAACAGTAATACTAATTTATGAATGGAAGACAATTGATATCTAGTGTGAAT TTTATGTTTATGTGTCTTAAACCTTATACTCACTATAATTGTTCTTTATTTGAGAATTTA ATTATAGGTGTTTATGTGTTATGTGATCOGAACCATCAGTGCTGACATTATTAATAACCA TAGGTATTGTATGGGATAGTGTTTATTTACTACCAATGTACAATCTCATATGTCGGACCC CTCA ACCTCCTCCTTATAGTTGAGTTTTCTGGAAAAACACAAAAGATGATCTTGAGTAAT TGTACGGACCTATAGCTTTCTTTGTCTGGT U.S. Patent Sep. 22, 2015 Sheet 12 of 45 US 9,139,620 B2

Figure 3-1 FmoPV 776U Cats/Hong Kong/2009 16050 bp ACCAGACAAAGATGTCTGTGACCTATTCTAACGACAAGATTATTACTAAATATTTAGGAA TAACGATTCCATTAGTGAGGTGAGGAGGAGGAAICAGGTATTCCACAATGTCTAGTCTAT TGAGGTCACTTGCTGCATTTAAGAGA CATAGGGAGCA ACCAACAGCACCGTCAGGTTCACG GTGGTACAATTAAAGGATTGAAAAATACAATTATTGTTCCGGTTCCAGGGGATACAGTAA TTACTACAAGGTCTAATTTGTTATTTAGATTAGTTTATATAATAGGCAATCCGGATACAC CTTTAAGCACCTCGACGGGAGCAATAATATCATTGTTGACCCTATTTGTCGAATCTCCAG GTCAATTAATTCAAAGAATTGCTGATGACCCTGATGCAGTTTTTAAATTGGTAGAGGTCA TTCCTGAAGCTGGTAATCCTGGAGAATTAACTTTTGCATCTCCAGGGATTAATTTAGACA AGCAAGCTCAACAATACTTTAAATTGGCTCAGAAAAATGATCAGGGGTATTATGTTAGCT TAGGATTTGAGAACCCTCCAAATGATGACGATATA ACATCTAGTCCTGAGATATCAATT ATATCCTGGCATCTGTACTTGCACAAGTTTGGATTCTTCTGGCAAAAGCTGTGACTGCTC CAGATACGGCTGCTGAACCCGAAAATCGTAGATGGATTAAATTAATGCAACAACGTAGGG TGGATGGTGAACTGAGATTGAGCAAAGGATGGCTAGATTTAGTGAGAAACAAGATTGCGT CAGATATTACAATAACGCGATTCATGGTAGCATTAGTTCTTGACATCAAACGTTCTCCTG GGACAAG ACCCAGGATAGCTGAAATCATTTGTGATATTGATAATTATATTGTAGAAGCAG GGCTTCCAAGTTTCTTATTAACCATTAAATTTGGCATAGAAACACGTTATCCAGCACTGG CACTACATGAGTTTTCTGGAGAACTAGCCACTATTGACGGGCTTATGAAATTGTACCAAT CTATGGGGGAAATCGCACCATACATGGTAATTCTGGAAAACTCAATCCAAACCAGGTTTA GTGCAGGGTCTTATCCTCTGCTATGGAGTTATGCAATGGGTGTCGGGGTGGAGCTTGAAA (ATCAATCGGGTGGACT CAATTTCACTAGAAGCTTCTTTGACCCGACATATTTCAGACTTG GTCAAGAGATGGTOAGOAGATCTTCACG (GATGGTTAATAGTTCATTTGCGAGAGAACTTG GCCTATCTGAGCATGAAACACAACTGGTCAGCCAGATTGTCAATTCGGGAGGTGAATCCG GGATACCTAAATTTGATGGATTCAGAGCAAATCCAACAACTTTTCTAGGAACCAAGGATA ACATAGATGATAGAGGTGAAGATCAGTCAAATTCGATATCAGGGTTACCTGGTCCACTAT TACCCAGCCGTGACCTAGATCTTTCCGGTGATTCATATGGAATTAATAGTGGTGTGAAAA ATGTCAGTGACAAACTGAATGAAGGAGTAGGTCCAGACCATGATGTGTCCAGTTCTGCCA U.S. Patent Sep. 22, 2015 Sheet 13 of 45 US 9,139,620 B2

Figure 3-2

TGGAAGAATTGAGAAGATTGGTTGAGTCTACCAACAGAATTGACACCAAACAGCCGGAAG CTTCACGTGTCACCAACCATTATAATGATACTGACCTTCTAAAATAATATGAGCATACCC TAATTGATTATGATACAACTCAAATTAAGAAAAACTTAGGACCTCAAGGTTCACAACTGT TGGCATATCACCAAAACACAGTCAGCTCTTCACCCACCCCATGTCCTCTCACCAAATCCA ACAAGTCAAACATGGCCTCGAATCTTTACAAGAGATCAAAAGCA ACCCTCCGCCTTCCCA AGATGTCAATCTTGCCAGGGAGATTTACGAATCCATTAGACAAACAGGAACATCTTCAGT GCAAGGAGGAGCCATTGCGGGAAATAATATTACGTCAGGGGGTAACAATGACTCAATGTA TAGCCAAGGACCAAGTCCTCCTATTTCAAGTATTAACAAGAATATCGAAGGACCTACTGG ATTCGATCATTCACGACTATGGGATCCAGAGGGTAACCTCTGCATGCTATTCGAAAGCCA TGATGATGAAAACCATTATTCAGAGATTAATGGCCGGTCTTCCACTATCGAAGGACTGGA TGAACAGGATAATGAGAACT CAATTATTAAACAACCAGGAAATCAGTGTACTGAGGGAGT GTCTA AGACTGATTCATCTCCTAGTTCCCAGGAAACTACACTATCTGTTGGGGGATCTGA TATACCTGGGACAGGAATATCA ACCTGTGCCTCTTTGGATATAACTGTAAATGAACTCGA AGATGCAACTGTAAGAAATAGCAACAATATGAAAGGGAACTGGCCAATTCCTAAATTACT AGTTAAGCCGCCACCTAGGGTAAAATCAAGTGTTGATCACAGTAATCCATTAAAAGGGGC CACAGAAGGGAAATTAGCCTCACCTGGGATGGAGACTACATTATTCGAGAAGAGTGGTGC AACCCCATCTGTACACCCATATACTCA ACCTCCAAGCGACTTCAATGTAGGTGCAAGCAG TGTCCATCAACCTGCCCTAAATGTGAATAATAATTGCAATGACGGTAGGGTAACAGCGCC TAACTCACATAAAGATATCGAGGGTAAGTCTGAAATATCTATTCAAGATATATATAACTT GATTCTTGGATTTAAGGATGATTACAGGAAATTATCAAACAAATTAGATATGGTATTAGA GATGAAACAAGACATTGACAATCTTAAAAAGAATAGTGCTAAA GTG CAATTAGCTCTATC AACTATTGAGGGACATCTATCCAGTGTTATGATTGCTATCCCTGGTTCAGGTATTGATTC CACAGGGGATGAGGAAAAGGACCAGATAAATTCTGACTTAAAACCACTGCTAGGAAGGGA TCATTGTAGAGCATTTCOAGAAGTTACCAATCCTCTAGATGAGTCTTCACTAGCCAATTC TCCAACAAAACATGTTGCCAAGGTAAACAAGAACTGCACTCTTCAGAAGATCAACAAGAA CGAAACATCTGCAATCAAATTTGTTCCTAGTGACAGTCATGCAAGCACATCAACCATCAG GTCAATTATCAGGTCATCTAATCTCGATCAGGATTTGAAAACAAAATTGCTCACAATTTT ATCCCAGATAAGAGGTGTAGACAATATTAGAGAATTCTATGAAAAGGTTATGATATTAAT U.S. Patent Sep. 22, 2015 Sheet 14 of 45 US 9,139,620 B2

Figure 3-3

AAAGAATAAGAATTAAATATTACAAATCTACATGCATTATAGGTTGTAATTGTCTTCAAT AAGATTTGGTCAGTTTCATATATATGGTTATTGATTGTGATAATTATAAAAAACTTAGG AGCTAAAGATTACTCAGTCATATACAGCATGACTGAGATATTCA ACCTTGATGAGAGCTC ATGGTCAGTCAAAGGGACACTAGATCCGCTA ACACCTGATACCTATCCTGATGGTCGACT AGTGCCTAAAGTTCGAGTTATCC ATCCGGGTCTAGGACATCCCAAGAGTGGGGGGTATAT GTACTACTTCTTCATGGGTCATAGAAGATAGTO AGACTATAATTACGTCCGAAAGGAAG AGCATTTGGTGCATTCCCATTAGGAGTGGGTCAATCA ACTGAAAACCCGGAAG ACTTGTT TAAGGAAATATTAACTCTCA ACATCGTGACTCGTAGGACTGCTGGATTTAATGAGAAATT GGTTTATTATA ATACCACACCTCTACATTTACTGACCCCCTGGAAGAAAGTGTTGGCATA TGGAGGCATTTTTAATGCTAATCAGGTCTGCAGTGATACAAGTTCCATACCAATAGACAT TCCACAAAAATTTAGGCCAGTATATTTGACTGTTACAAAATTATCTGATGATGGCTATTA TCAGATCCCAAAGATCATTCAAGATTTCAAATCGTCAAATTCTCTTGCATTTAACATCCT TGTGCATCTGTCAATGGGCACAAATTTACTTGACCAATCCAAGGACCCTAGATTAAGAAG TGCTGCAGAAACTGTGATCACATTTATGATTCATATTGGAAACTTTAAACGGAAGAGTAA TAACGTCTTACTCACCTGAATATTGCAAGAGGAAAATAATGAGGCTTGGTTTAATATCTC ATTAGGTGCAATTGGTGGCACAAGCTTGCATATTAGATGTACAGGTA AGATGACCAAACG ACTACAGGCTTAI"I"TGGGATTCAAAAGGACT"I"TATGTTACCCTTTGATGTATGTTAATGA AGGGCTGAACAAG ACCCTGTGGAGAAATGAATGCAGAATAGAGAAGGTTCAAGCAGTCCT ACAGCCATCAGTCCCGAATGAGTTTAAGATATATGATCATGTTATTATTGATAATACCAA TGGTCTCTCCAAGATTAAATAGACTATAACAATAATAAACCGCCACCAAATGGTACCATG IATTCAAGTGTACACTGACAATTGCGAATAAAATATACCAGATTAACAACAGTATAGAGT TAAGATCTAATTGATATGTGGGTTGGTACTCGATCATTTATTAGCTCTACTGATTATCTA TATCCTAAATCACCAAATATA AGAGCATCA ACAGGTAATAAGTTTCCGATTGCTAGATTA ATACT'TAATTCTCAGAACTAGAATACACAGATTGTCAA ACCTATAATCTTGTTAGATTCA TTAAAGTTAGATTCTTGTAATGTTGATCAATTATCACTCGAGCAATTATAAAAAACTAAG GACCTAATGTAATAGGAGCCCAAATTCCATCCAGTGAGCTTTAAATCGCCATGCTTAAAC ATTAATTTGTCCAGGGCCTATCTAACTCAGAACAAAGATCACAACTAGAGTCTGAACGAG TGGGTTAAGTCTGAATAATTATTAAGAGTTGAGATTTAAAACTGATTCCTTCTTAAATTT U.S. Patent Sep. 22, 2015 Sheet 15 of 45 US 9,139,620 B2

Figure 3-4

AGAATTTTAATAATATATCATCCATTCAATATCATGAACAGCATTAAGGTTATAATAATT AGTTCTTTATTACTATCAGATATTACGATTGCACAAATAGGTTGGGATAATTGACTCC ATTGGACTTATA AGTACTAAGCAATACC3ACTATAAAATAACTACTCTGAACACTGACCAG TTAATGGTTATAAAGATCGTTCCTAATATATCATCAATCATTAATGCACTA AACTCCAA TTAACAAAATACAGAGAGTTACTCTCAGCCATCATTAGACCAATAAATGAGTCATTACAA TTAATGAATTCATACATTAACATGAGAGCAGGTTCAGAGAGATTCATAGGGGCTGTAATA GCTGGTGTAGCCTTAGGAGTGGCAACTGCAGCACAAATAACATCAGGGATTGCCCTACAT AATTCAATTATGAACAAAAAACAGATACAAGAATTGAGGAAGGCTCTTAGTACTACTAAC AAAG CAATTGATGAAATAAGGATTGCAGOTOAAAGAACATTAATAGCAATTCAAGGTOTA CAGGATTATATTAATAATAAATTATCCCTATGCAGGACAAA CTCCAATGTGATATTTTA TCATCACAACTTTCTOTTCCTTTACTCAGATATTATACAAATATATTAACAGTTTTTGGG CCAAGTATACGGGATCCTATTACTAGTACAGTTTCACTACAGGCACTCACGTCAAGCATTC AATGGTAATCTTCACGGCATTGCTTGATGGATTGGGATATACTGGGAAAGACTTACGTGAT CTTCTAGAGAGTAAATCTATCACTGGCCAGATAATTCATGCAGATATGACTGATTTGTTC CTTGTTCTGAGAATAAATTATCCTTCTATAACTGAGATGCAGGGAGTAACAATATATGGG CTCAATTCAATTACATATCATATTGGGCCTGAAGAGTGGTATACCATTATGCCTGATTTT ATTCCTGTTCAGGG"""T"TAATATCTAATTTGATGAGAGAAAGTGT"I'CAATAACTAAA TCAAGTATATTGTGCCAACAAAATTCAATTTACCCAATGTCAACAGAGATGCAA AGATGT ATTAACGGCGAAATAAGATTCTGTCCAAGATCCAAGGCAATTGGGACATTAGTCAATCGG TTATATTGACCAAAGGTAATTGATOGCTAATTGTTTAGGGATTATATGCAGATGITAT ACTTCACGCCAAGTTATA ACACAAGACCCTAGTAAATTGATCACGATAATATCGCAAGAG (AGTGCAAGGAACTTGGTGTTGATGGTATCCGTATTATGGTAGGACCTAGAAAATTACCA GATATTACCEITAACGCTAGGTTGGAAATTCGTGTACCGATATCATTAAGCAAATTAGAT GTCGGGACTGATTTAGCGATTGCTTCAGCTA AACTTAATAATTCTAAGCCATTGTTAGAG CAATCAGATAAGATTTTGGATTCAATGTCTAAATTGGATTCTATGAACTCAAGAATAATA GGGTTAATCTTAG CAATTATGATAATCTTTATAATCATTATTACTATTATCTGGATCATG TATAAGAAATCTAAGAATAAAGATAATAAATTCACGTACTTCAATTGAACCGCTCTACATA CCCCCTTCTTATAACTCACCTCATAGTGTGGTTAAATCTATTTGAGTACTGACTATATGA U.S. Patent Sep. 22, 2015 Sheet 16 of 45 US 9,139,620 B2

Figure 3-5

TCCACTGTAATAAGTCCAATGAAAGTATCAATTAATAATATTGGTAGTGCAATAAGTATT GATTGTATAATATACTCCTTTAAACTAGATAGTGATAAAGGGTTATAGATCATTTCACGTC ACTTTAATATAATCATATATTGGTTTTATTATCTTGCATAACTATTATGTAATTGAATTA TGTATCATCAATTAATAGCTTAATAATATGTTTTAATATACTTATATTGATAGATAAATG TGTTATATTGTAATCAAGGAGTTGGTATTAGAAGAGGAA AGAGTTAAAITTGTTGTTAA TTACTTATTGTGTATTCAATTAGAAAAAACTTAGGAATCCATGTTAATAGAAATTTATTA TCATGGAGTCCAACAATATTAAGTACTACAAAGATTCTAGCCGGTACTTTGGTAAAATAT TAGATGAACACAAAACAATTAATAGTCAATTATACAGTTTGAGTATCAAGGTAATTACCA TTATTGCTATTATTGTAAGCCTGATTGCAACAATAATAACTATTATCAATGCCACTAGTG GGAGAACTACCCTAAATAGTAATACAGACATACTACTCAGCCAACGAGATGAGATTCATA ACATCCAAGAAATGATATTTGATCGTATTTATCCTTTGATAAATGCTATGAGTACAGAGC TAGGACTICATATTCCTACCTTATTGGATOAACTTACTAAAGCGATTGACCAGAAAATTA AAATAATGCATCCTCCTGTGGACACTGTGACTTCTGACCTTAATGGTGCATCAA ACCCC CTAATGGAATTATCATAGACCCAAAAAGTTATTGTGAGAGTATGGAATTGTCTAAAACTT ATGAATTGTTACTTGACCAGTTAGATGTCCAAGAAAGAAATCA CTTATTATAAATAGAA AGAATATTAACCAATGCCAATTAGTIGATAATTCAAAGATCATTTTTGCCACTGTCA ACA TACAATCTACACCGAGGTTTTTAAACTTTGGTCACACGGTCAGCAATCA ACGTATAACAT TTGGTCAAGGAACATATAGTAGTACTTATGTTATAACTATCCAAGAAGATGGAGTAACTG ATGTTCAATATCGAGTGTTTCACATCGGATATATTTGTGATCAGTTTGGTGTATTCCCCT CCTTAATAGTATCGAGAGTOTTGCCGATACGCATGCTATTAGAAATGGAATCCTGTACCT TGACAAGTGATAGACTAGGCGGGTATTTTTTATGTATGAATACACTGACACGATCTATAT ACGATTATGTTAGCATAAGGGATTTGAAATCACTTTATATAACAATCCCTCATTATGGTA AAGTTAATTATACTTACTTTAATTTTGGTA AGATCAGGAGCCCACATGAGATTGATAAAA TTTGGTTAACATCTGATAGAGGCCAAATTATCTCTGGTTATTTTGCAGCATTTCTTACCA TTACAATTCGGAACTATAATAATTATCCCTACAAATGCTTAAATAACCCATGTTTGACA ACTCTCAGAATTACTGTAGAGGATGGTATAAAAACATA ACAGGAACTGATGATGTTCCGA TATTAGCATACTTATTGGTTGAAATGTATGATGAACAGGGACCTTTAATTACACTTGTGG CAATACCACCTTACAATTATACAGCTCCATCTCATAATTCTCTTTACTATGATGACAAAG U.S. Patent Sep. 22, 2015 Sheet 17 Of 45 US 9,139,620 B2

Figure 3-6

TTAATAAATTAATAATGACTACATCTCACATAGGTTATATTCAAATCAATGAGGTGCATO AGGTAATTCTTGGCGATAATTTGAAGGCTATCCTCTTAAACAGATTATCTGATGAACATC CTA ACCTGACTGCCTGTAGACTCAATCAGGGTATTAAGGAGCAATACAAGTCTGACGGAA CAATAATTTCAAATTCTGTACTTATTGATATACAAGAACGAATGTACATTACAGTTAAAG CTATTCCACCAGCAGGTAACTATAACTTTACAGTTGAGTTGCATTCTAGATCAAACACAT CTTATGTATCCTTGCCAAGACAGTTTAATGCTAAGTATGACAAATTACATCTTGACTGCT TTAGCTGGGACAAATCCTGGTGGTGTGCTCTGATACCTCAGTTTTCATTAAGTTGGAATG AATCCCTTTCTGTTGATACTGCCATTTTCAATTTAATAAGCTGTCAATGAACACATCAAT CTATAGTTGATAGTTGTCAAAACATTAGCCAATTTGGGTTAAAGAAATAGGAAAATGAAA TTATCAATATCTAATTAGATOTATGTTCAAGCTAAATTACAAAAAACTTAGGAGTCAGAG ATTTCGTTGCAATGGAGCAGTCAGACTACCAAGATATTCTATACCCGGAAGTACATCTTA ACAGTCCTATAGTAATTTCCAAATTA (TAGGTATTTTAGAATATGCCCAAATTGGTCATA ATCA ACAATTATCAGACCGTACAATTATCAAGAATATTCAATTTAGATTAAGGAACGGAT TTAATAGTTCAAGGGTACAGGTACTATCA ACTATGGGTGAAATTATCAACAAAATTAGAA ATAAATATCCTAATTATTTACACATACCTTACCCTGAATGCA ACCAAAAACTATTTCGAA TAGTAGATCCAGAACTA ACATCAAAATTAGAATCTCTTCTAAACAAAGGTGACACACTGT ATCTCAAGATTCGATCAGATATCATAAAGTGTTTTGATAGATTGAAAATGAAAATGAACA TAAAGAATGATCTTCTCAATGACAATAGTCAATTGATTCTAGATCTTCCTTTAATTATCA AAGGATCTCAGTGGTTCTTCCCTTTTTTATTTTGGTTTTCTATCAAAACTGAAACTAGAA GCTGTATTCGCCAAAATCAAAAG ACTCGTGTTAGATCACAATATCGGCCTCACTTATCAG AGACTA AGAGAATTACATTGGTTGTTACATCTGATCTGATTACAATATTTGATCATATTA ATAAATCTATATTTTATTTGACTTTTGACGATGCTGTTAATGTATTGCGATGTGATAGAAG GTCGGTTAATGACTGAAACAGCTATGAGCTTGGACTGTCGGTTTACCAATCTATTGCCAA GAGTGCAATATATGTGGGATTTACTAGATGGAATGTTTGAAAGTTTAGGCAATCAATTAT ATTCACTTATTGCATTATTAGAGCCTCTTTCTCTTGCTTATTTGCAATTGATAGATGCAG ATCCACAGATTCGGGGAACATTCCTGCATCACTGCTTTTCCGAGTTAGAAGAAATTATAT TTGACAAAACCCCTTTTGATCCTTTCCTATATGAAAATTTAATTAATGGACTTGATTACA TTTATTGACAGATGATATTCATCTAACTGCAGAACTTTTTTCTTTTTTTAGAAGTTTTG U.S. Patent Sep. 22, 2015 Sheet 18 of 45 US 9,139,620 B2

Figure 3-7

GTCATCCTTTTTTAGA ACCACAAAATGCTGCCAATAATGTAAGGAAGTATATGAATAAAC CTA AGGTAATCTCATATCAGACTTTAATGCAAGGACATGCGATTTTTTCCGGTATTATAA TAAATGGATTTAGAGATCGCCACGGGGGAACATGGCCTCCTGTAGAGTTACCAAATCATG CATCTGCTGTAATTAGAAATGCCCAGTTATCTGGAGAAGGGTTAACATCTGAACAATGTG CTCA ACACTGGAGATCCTTCTGTGGATTTAGATTTAAATGTTTTATGCCATTGAGTCTAC ACAGTGACCTTACAATGTACCTTAGAGACAAGGCGTTATCACCTGTCAGAAATGAGTGGG ATTCAGTTTATGCTA AGGAGTATTTA AGATATAATCCAGGATTACCCACAAGTTCCAGAA GATTGGTAAATGTATTCTTAGAAGATGATAAGTTTGATCCATATGAAATGATCATGTACG TGATAAATGGTGATTACTTAAGAGACAA AGAGTTTAACCTTTCATACAGCCTTAAAGAGA AAGAAATTAAAGAGGTAGGTCGATTGTTCGCTAAAATGACCTATAAAATGAGGGCTTGTC AAGTAATAGCTGAAAACCTGATTGCCAATGGAG TAGGGAAGTTTTTCAAAGATAATGGAA TGGCAA AAGATGAACATAAATTAACTAAAACGTTACACAAATTAGCCATTTCAGGTGTAC CTA AAGATAATTCTCA ACTTTATTTAGATGAATGTTGGGAGCAAGTAATTCGACAATGTT CAAGTAGTACACAGATAAGGGAACAGGCTATGAATTCACAATCAAATAGGGAAATTGAAT CAAAGTCTTCTAGGGCACGTCTTAATAATAGAGATATCTTAAAGGGCAAGAGAGATTCGA ACAAACAAATAAAGTATCCTTCAA ACACCGAGTATTATGAGACTATCAGTAGTTTCATAA CTACTGACCTTAAAAAGTATTGTCTTAACTGGCGATATGAATCAAGTAGTGTATTTGCAG AGAGACTTAATGAGATTTATGGACTGCCTGGATTTTTCCAGTGGCTTCACAAGATTTTGG AGAAATCTOTTCTATACGTTACTGATCCATATAGTCCACCTGACTTGATCA ACATATCG ATATAGAATCAGTCCCAAACGACCATATCTTTATCAAGTACCCGATGGGTGGAATAGACG GGTTCTGTCAAAAATTATGGACCATTAGTACAATTCCGTTCCTATATTTAGCAGCTTTTG ATACAGCCGTTAGAATCTCATCATTAGTTCAAGGCGATAACCAGGCAATTGCAGTGACCA AAAGAGTTCCGTCATCTTGGAGTTATTCAAAGAAAAAGGAAGAATCAACTAAAATAACAA CACAGTATTTTCTTAATTTAAGACAACGCTTACACGACATAGGTCATGAATTGAAAGCAA ATGACACTATTATATCCTCTCATTTCTTTGTTTACTCTAAAGGTATTTATTATGATGGAA TACTTCTCTCCCAGGCACTTAAAAGTATTGCAAGATGTGTCTTCTGGTCTGAAACGATTG TTGATGAGACTAGOTCAGCTTGCAGTAACATATCTACGACACTCGCAAAGGCAATTGAAA GGGGTTATGATAAATTTGTGGCGTACGCTATCAATATTTATAAAACAATACATCAGGTGT U.S. Patent Sep. 22, 2015 Sheet 19 Of 45 US 9,139,620 B2

Figure 3-8

TGATTGCATTGTCCTTTACGATTAATCCTACTATGACACCAGACATCACAGAACCTTTCT ACAAGAGTTTAGATCTACTTAAGAATCTAGTCCTGATTCCTGCACCATTAGGGGGCATGA ACTATATGAACATGAGCAGGTTATTTGTTAGGAATATAGGAGATCCCATTACTGCTTCAT TTGCTGATATAAAGCGCATGATTGAATGTGGGTTGTTAGGATGTAGTATTCTGTCACAAA TAATGTACCAAAAATGTGGTTCCTCTAAATACTTAGACTGGGCTAGTCATCCITATTCAA TAA ACCTTCCTTATAGCCAAAGTATGACCAAGGTTTTAAAAAATGTAACGGCAAGATATG TACTTATGCATAGTCCCAACCCTATGCTCA AAGATTTGTTCCATGAAAAGTCTCAGGAAG AAGATGAAATCCTTGCTGAGTTTCTGTTAGACCGACACTTAATAATCCCTAGAGCAGCAC ACGAAATTTTATCAAATTCAGTA ACAGGTGCTAGAGAATCTATAGCAGGTATGCTTGACA CTACTAACGGGTTTAATCCGTGCTAGTATGTCAAGAGGTGGGTTGACCTCATCACTTGTTT TAAAATTATCAACATATGATTACCAACAGTTTAGAA CATGTCTTGAATGGCTTTATGCTC CTACTACGGGAATTGCTGTA AGCGTTCATTCTTGCTCTOTATTCTTAGCTA AGACCATCC GGAAGAGAATGTGGGTTCACCTAACTA AAGGAAGGGAGATTTATGGGTTAGAAGTACCTG ACATTTTGGAATGTATG CAAAACAATATTATTGTTGATCACGAAGATTGTTACTCATGTA TCAAGGATCAAGATATTATACACGTTTTTTGTACCTTCAAATTGTCAA CTCGATCAAA TAAATAAGTCA ACAAATTCTCTCCGAGTACCTTATGTTGGATCAACAACTGAACAAAGGA GTCATATGAAGTTGTCATATGTAACGTCACCTAGTCGGCCACTTAAAGCAGCAGTTAGGA TTGCAGCAGTATATACATGGGCTTATGGTGATGATAATTTGTCTTGGCATGAAGCTTGGT ATTTAGCAAGGACTAGAGCAAATATTACTTTTGACGAACT CAAATTAATAACACCTATAG CTACATCTACA. AACTTAGCACATAGATTGACGGATAGA AGCACTCAAGTTAAATATTCAC GAACTTCTTTAGTAAGAGTGGCACGCTATACAACAATATCTAATGATAATATGTCGTTCA TTATTAATAACAAGAAAGTCGATACTAATTTTGTCTACCAGCAAGGAATGTTATTAGGTT TGAGTATATTGGAATACATATTCAGATACTGTACAAGTACTGGACAGTCAAACACTGTAA TTCACTTACATGCAGATGTTAATTGTTGTATAGTACAGATGACTGATCAGCCTTATACAC CAAGTTTAACAAAAAAGCTACCTGATATTAAGCCCATTAATAATAAACTGATATATGATC CGGCTCCTATAATCGATACTGATGCAGCTAGGCTATATTCCCAAAAGTACCTGTCACATT TAATAGATTTCCCAAGTTGGTCAACTA CTCAGCTTAACACAGTATTGGCGAAAGTAGTGG CGGTATCTATTGTGGAATTAATTACAAAAGCGAGTAAAGACCATCTCAATGAGATAATAG U.S. Patent Sep. 22, 2015 Sheet 20 of 45 US 9,139,620 B2

Figure 3-9 CAGTTGTTGGTGATGATGATATCAATAGCTTTATTACAGAATTTCTACTTGTTGATCCAC GTCTGTTTACACTATATTTAGGCCAATACACATCATTACAATCGGCATATGAACTCCATT ATCATAGACCAGTGGGTAAATACCAGATGGCTGAAGTGTTGCATAATTTCCTGTCAAGAC CTAGTAGAGGTATATTCAGTATATTGACCAATGCCTTTAGCCACCCCAGAGTCTACAAAA GATTCTGGGAGTGTCGTTTATTGGAGCCTATTTATGGGCCCTATATAGGAAGTCAAAATC TACATAATGCAATGATTGATTATATCTATAATGCATACATTACTTATTTCGATGCTTATT TATCTGATCA AG TAGATGATACTGATATTATAATATGTGAAACACAGGAGACATGTTTCG CGAATCGAATTGACAATTATCAAAGCAGACACTTAGCTGTGCTTATAGATCTGTATTGTG ATTCCACTAGATGTCCCAATATAAAAGGGGCAGATACAATTATGAGAAATTCAATTCTTA GATCTTTCATTGATAATGAGAGGAGAACAAATCCACTTGGTTTGACATGGAACCTTGACC CGTTACTTGTGGATCACTTTAGCTGTTCTATTACGTATCTGAGGAGAGGTATTATTAAAC AGATGAGGTTA AGATTGATCCAAGTGTATCCCTGGAACTATCTAGOATGATTAAACCTG ATGCGGTTTATCAAGCACCTAAAATTCCGTCTTCATGGGCTCTTATAGATATCAACCCTG AAGTAAATGACCTTAATGTAATTTTIGGAGACCTGAATAGCAAGTGGAAAGATATCCCTA TTGGACAGATTAGAATACACAATTATGAAATACATGCATATAGGAGGATTGGAGTTAATT CAACTGCCTGTTATAAAGCTCTAGAGCIATTATCTGTTCTAAATCGGTTTATGCCTA AIC CATCAGGTGCATTGTTTTTAGGTGAAGGAGCAGGATCAATGCTGGTCACATACCGTGCTT TTGTCCCATTTAAGACAATTTATTACAATAGTGGTATTTCACGTTCAAAATGTTCACGGGCC AGAGAGAATTGACTCTATATCCATCTGAACTGGCACTAGTTGACAACAAAAATCGCTTGG CTAATGACCCTAATATCAA AGTCTTGTTCAATGGTAAGCCAGAGTCTACGTCGGTTGGAA ACATCGACTGTTTTGCTTATATTCTTAGCCA CATTGAGACCTCAAGCTTGACATTGATAC ATAGTGATATTGAGTCCACCTTAAGCAAGACCAAGAATAAAATTCTTGAGGAGCTGTGCC ACATTCTGTCAATGGCACTCATTTTGGGGAAAATCGGATCTTTATTAGTTGTTAAGTTAT TACCAAGGGTCGGTGACTATA CGTATTCATTTTGCAGGTATGCATCGGAATTCTATCAAC AAAGCCTCCTTGTTTTACCTAGGTTTAGTAACATGTCATCATCTGAGGTTTACTATATAG GAATTCACCTCAATACAAATCGATTGATTGATCCTGATAGAATAGTACAATACATAATTA GAAATTTACA ACCAA CTCCAGTTACATTTTTGTCCTATATTTTTGAAACTAAGTATAGGA ATAATATGGTTACAAATTATGGACTGTGCTTGTCAGACGGACACAAAAGTGATTACCTGT U.S. Patent Sep. 22, 2015 Sheet 21 of 45 US 9,139,620 B2

Figure 3-10

CATCAATTACAAAAATAGAGAATGTTCTCCTGTCATGTGGGTTAGAATTGAATGG ACCTA AGATTATACAGCAATTATCAGGACATGACAIGCTAATGGGGAGACTAGTCTAGAATCAA GTATAATGATATTAG TAGGGAATATCITAATGCAACTATACAGGGCCGGGAAACATTAG GCTTGTTTTCACCTTACCCAGTCTTACATGAGAGTCAGTTAAGAGAGATTAATAAGTGTA TTGCATTGAAATATGTTGTATATCTACCTTTATTCAAACTCTACATTATCTAGTAAAC AAATAATGAGTAATCTCAGAAAGGGAATATTGATOTATOATTTGAGAGATGAATTTTTCA TATCA AGATTGTCAGCAAATTACAAGAAAAAGGTGATGTCACAGGAAGTCAAG ACTACCT GGATCTTTAATATTGATACTCCGACACGAAAAGCATTATATAAGTTAGTAGGTTATTCAT TAATAATTAATCATGTATGATCATAGAGTGTGATTATCCATCTTTTAGAGAGTAAGATAA TATCAGATGTATGATAACCAATTAAGTATTGCTTTTGAATTGAAAGGTTGCTCAATTACA CGCTTCTTTAGTAATCGGGTTTTTATTCCAATTAAG GCAATTAGAAAAAACTTCAACAGT TAGTCGAGCCCGAATTCATTTCATATAAGTTATATTTATAATC"TGGATAAG ACTTTTGT TTAGAATTATAACAGTAATACTAATTTATGAATGGAAGACAATTGATATCTAGTGTGAAT TTCATGCTTATGTGTCCTTAACCTTATACTCACGATCATTATTCTTTATTTGAGAATTTA ATTATAGGTGTTTATGTGTTATGTGATGGGAACCATCAATGCTGACATTATTAATAACCA TAGGTATTGTATGAGATAATGTTTATTTACTACCAATGTACAATCTCATATGTCCGACCC CITAACCTCCTCCTTATAGI"ICAGTTTTCTGGAAAAACACAAAAGATGATCTTGAGTAAI TGTACGGACCTATAGCTTTCTTTGTCTGGT U.S. Patent Sep. 22, 2015 Sheet 22 of 45 US 9,139,620 B2

Figure 4-1 FmoPV M252A Cats/China/2010 16050 bp ACCACACAAAGATGTCTGTGACCTATTCTAACGACAAG ACTATTATTAAATATTTAGGAA TAACGATTCCATTAGTGGGGTGAGGGGAAGGAATCAGGTATTCCAGAATGTCGAGTCTAC TGAACTCACTTGCCGCATTTAAAAGACATAGAGAGCA ACCAACTACACCCTCACGTTCAG GTGGTACAATTAAAGGATTGAAAAACACAATTATTGTTCCAGTACCAGGGCATACAGTAA TTACCACGAGGTCTAATTTGTTATTTAGATTAGTTTATATAATAGGCAATCCAGATACGC CTCTAAGCACCTCGACGGGAGCAATAATATCATTATTGACCCTATTCGTCGAATCCCCAG GTCAATTAATTCAAAGAATTGCCGATGACCCTGATGCAGTTTTTAAATTAGTAGAGGTCA TTCCTGAAGCTGGTAATCCTGGAGAATTGACTTTTGCATCTCGAGGGATTAATTTAGATA AGCAAGCCCAACAATACTTTAAACTGGCTGAGAGAAATGATCAGGGGTATTATGTTAGCT TAGGATTTGAGA ACCCACCAAACGATGATGATATAACATCTAGTCCTGAGATATT'TAATT ATATTTTGGCATCTGTACTTGCGCAAGTTTCGATTCTTCTGGCAAAAGCTGTGACTGCTC CCGATACAGCTGCTGAAGCTGAAAACCGTAGATGGATTAAATTGATGCAACAACGTCCGG TGGATGGTGAATTAAGATTGACTAAAGGATGGCTAGATTTGGTGAGAAATAAAATTGCGT CAGATATTACAATAAGACGATTTATGGTGGCATTAGTCCTTGACATCAA ACGTTCTCCTG GGACAAG ACCCAGAATAGCTGAAATGATTTGTGATATTGATAATTATATTGTAGAGGCAG GGCTTGCAAGTTTCTTGTTAACTATTAAATTTCGCATAGACACACGTTATCCACCATTGG CATTGCATGAGTTCTCTGGAGAATTAGCTACTATTGAGGGACTTATGAAATTGTACCAAT CTATGGGAGAAATCGCACCATATATGGTAATTCTGGAAAATTCAATTCAAACCAGGTTTA GTGCCGGGTCTTATCCTTTCCTATGGACTTATGCCATGGGCGTTCGTGTGGAGCTTGAAA GATCGATCGGTGGACTTAATTTTACTAGGAGCTTCTTTGACCCTACGTACTTCAGACTTG GTCAAGAGATGGTGAGA AGATCTTCAGGGATGGTTAATAGTTCATTTGCGCGAGAACTTG GGCTATCTGAACATGAGACACAACTTGTCAGCCAAATTGTTAATTCGGGAGGTCAATCTG GGATACCTAAATTTGATGGATTCAGAGCAAATCCAACAACCTTTCTAGOAACCAAAGATA ATATTAATGATAAAGGTGAGGATCAGTCAAGTTCACTATCAGGGTTACCTGGTCCATTAT TACCCAGTCGTGACCTAACTCATCCAGGTGATTCATATGGAGCAGATGATGGTGTGAAAA ATGTCAGTAATAAATTGAGTGAACGAATAAGTCCAGATCATGATGTGTCTAGCTCTGCCA U.S. Patent Sep. 22, 2015 Sheet 23 of 45 US 9,139,620 B2

Figure 4-2

TGGAAGAATTGAGGAGCTTAGTTGACTCTACCAACAGAATTGACACCAAAAAGCCGGAAG CTCCAGGTGTCACCAACCATTATAATGACACCGACCTTTTAAGATAATATGAGTATATCT TATTTGATCATCATACAATTCAAATTAAGAAAAACTTAGGACCTCAAGGTTCACAACTGT TGGCACATCACTGAGATATAGTCAATTCTTTACCCACCACATGTCCTCTCACCAGATTCA ACAAGTCAAACATGGCCTCCAATCTTTACA AGAGATCAAAAACAACCCTCCGTCTTCCAA AGATGTCGATCTTGOCAGGGAGATTTACGAATCCATTAGACAAACAGGAACATCTTCACT GCAAGGAGGAGCCATTGCGGGAGATAATATTACGTCAGGGGGTAACAATCACTCAATGCA TAGCCAAGGACCAAGTTCTCCTATTTCAAGTGTTAACAAGAATATCGAAGGATCTACTGG ATTCGATCATTCAGOACTATGGGATTCAGAGGGTAACCTCTGCATGITATTCGAAAGCGA TGATCATGAAAACCATTATTCAGAGATTAATGGCCGGTCTCCCGCTATCCAAGGATTGGA TGAACAGGATACTGAGAA CTCAATTATTAAACAACCAGGAAATCAGTGTACTGAGGGAGT GTCTAAG ACTAATTCACCTTCTAGTCCCCAGGAAACTACACTATCTGTTGGGGGATCTAA TATACCTGGGACACGGAATATCAACCTGTGCCTCTTTGGATATAACTGTAAATGAACTTGA GGATGCAACTATAAGAAACAGCGACAATATGAAGGGAAACTGGCCAATTCCGAAATTACT TGTTAAGCCGCCACCTAGGGCAAGATCA AGCATTGATCATAG CAATCCATTAAAAGGGGC CACAGGAGGGAAATTAGTCTCACCTGGGATGGACACTACATTATTCGAGAAGAGTGGTGC AACCCTATCTGTACACCCATCFACTCA ACCTGCA AGCGACTTCAATGTAAATGTAAGCAA TGTCCATCAACCTGCCCCAAGTGTGAATAATGATTACAGAGACAGTGAGGTAACAGTGCT TAACTTACATAAAGATATTGAGGATAAGTCTGAAATATCTATACAGGATATATATAACTT GATTCTTC:GATTTAAGGATGATTATAGGAAATTATTAAACAAATTAGATATCGTATTAGA GATGAAACAAGACATTGACAATCTAAAAAAGAGTAGTGCTAAGGTACAATTGGCATTGTC AACTATTGAAGGACATCTATCTAGTGTTATGATTGCCATCCCTGGTTCAGGTATTGATTC CACTGGGCAAGAGAAAAAGGATCAGATGAATTCTGACTTAAAACCATTATTAGGGAGGGA TCATTGTAGAGCATTTCGAGAAGTTACTAATCCTCTAGATGAGTCGTTACTGGCCAATTC TCCAACAAAACATGTTGCCAAAATAGACAAGAATTGCACTCTTCAGAAAATCAACAAGAA TGAAACATCTGCAATCAAGTTTGTTCCCAATGATAGTCATGCAAGCACATCGACCATCAA ATCAATTATCAGGTCATCTAATCTCCATCACGATTTGAACACAAAATTGCTCACAATTCT ATCCCAAATTAGAGGGACAGAGAATGTTAAAGAATTTTATGAGAAGGTCATGATATTGAT U.S. Patent Sep. 22, 2015 Sheet 24 of 45 US 9,139,620 B2

Figure 4-3

AAACAATAAGAACTAAATATCACCAATCTACATGCACTATGAGTTGTAATTGTCTTCACGT AGAATTTAGTTGATTTAATACATACTGTTGTTGATTGTAATAATTATAAAAAACTTAGG AGCTAAAGGCTACTCAGTCATATACAACATGACTGAGATATTCACTCTTGATO AGAGCTC ATGGTCAATCAAAGGAACACTTGATCCGCTAACACCTGATATCTATCCTGATGGGAGACT CGTGCCCAAAGTTCGGGTTATCGATCCGGGCCTAGGAGATCGCAAGAGTGGGGGATATAT GTATCTACTTCTCCATGGTGTCATAGAAGACAGCGAGA ACATCATTAGTCCAAAGGGGAG AGCATTTGGGGCATTCCCATTAGGAGTGGGTCAATCA ACTGAAAACCCAGAAGATTTGTT TAAGGAAATATTAACTCTCAATATCGTGACTCGTAGAACTGCTGGATTTAATGAGAAGTT AGTTTATTATAATACCACACCTATACATTTACTGACCCCCTGGAAAAAGGTGTTGGCATA TGGAAGCATCTTTAATGCTAATCAGGTCTGCAGTGATACAAGCTCTATACCAATAGATAT TCCACAAAACTTAGACCTGTATATTTGACTGTTACAAAATTATCTGATGATGGCTATTA "CAGATACCAA AGATGATTCAAGATTTCAAATCGTCAAATTCTGTTGCATTCAA CATCCT TGTGCATCTATCAATGGGTACAAATTTACTTGACCAATCCAAAG ACTCTCGATTAAGAAA TGCTGGGGAAACTGTGATTACATTTATGATTCATATTGGGAACTTCAAACGGAAGAGTAA TAAATCTTATTCACGCGGAATACTGCAAGAGGAAAATAATGAGGCTTGGTTTCGATATTCTC ATTACGTCCAATTGGTGGCACAAGCTTACATATTAGATGCACAGGTAAGATGAGCAA ACG ACTACAGGCCTACTTAGGATTCAA AAGGACTTTATGTTACCCTCTGATGTATGTAAATGA AGGGCTAAATAAAACACTGTGGAGAAATGAATGTAGAATAGAGAAGGTTCAAGCAGTCTT ACAGCCATCTGTTCCAAATGAATTTAAGGTATATGATGATGTCATTATTGACAATACCAA TGGTCTCTTCAAGATTAAATAGGTTATAACCGTAACAAACAGCTAATAAATGGTATTATG TATTTAAGTGTACACTGATAATTGTGAATAAAATACATTGGGTTAATAACGGTATAGAGT TAAAATCTAATTGATATGTGGGTTAATGCTTAAACACTTATTAGCTCTATTGATTATCTA TATCTTGAGTTATCTAATATCAGAGTATCAA CATOTAATCAGTTTAAACTTGTTGGATTA ACGTTCAATTATTATAACCAGAATACACAAATTGTTAAACTTATAATTCTCTTAGATTCA TTCAAGTTGAACTTATGTAGGGTTAACCAATTATCATTCGAGCAATTATAAAAAACTA AG (SATCTAATGTAGTAGGAACCTAAA CTCCATCCAGTGAGCTCAAAATCACCACACTCAAAT ATCAATTTGTCTAGGGCCTGTCTAACTCAAAACAAAGCTCATAACCAGGATCCAGACGAG TGGGTTAAATCTGAATAACTATTAGGAATTGAGATTTTAAATTGATTCTCTCTTAACTCT U.S. Patent Sep. 22, 2015 Sheet 25 of 45 US 9,139,620 B2

Figure 4-4

AAAGTTTTAGTAATATAGCATCAATTCAGCACCATGAACAGAATTAAAGTTATAATAATT AGTTCTTTGTTATTATCAGATATTACGATTGCACAAATAGGCTGGGATAATTTAACTTCG ATTGGGGTTATAAGTACTAAGCAGTACAACTATAAAATAACTACTCTAAATACTAATCAG TTGATGGTTATAAAGATGGTTCCCAATATATCGTCAATCATTAATTGCACTAAACTTGAA TTGATAAAATATAGAGAGTTAGTCTCAGGGATCATTAGACCAATAAATGACTCATTAGAA TTAATGAACTCATACATTAATATGAGAGTAGGTTCAGAGAGATTTATAGGGGCTGTAATA GCTGGAGTAGCATTAGGAGTGGCA ACTGCAGCACAAATAACATCAGGGATTGCCCTACAT AATTCAATTATGAACAAAAAACAGATACAAGAGTTGACGAAGGCTCTTAGTACTACCAAC AAAGCAATTGATGAAATAAG GATTGCAGGTGAACGAACATTAATGGCAGTACAAGGTGTA CAGGATTATATCAATAATATAATTGTCCCTATGCAGGACAAACTCCAATGTGATATTTTA TCATCACAGCTTTCTGTTGCATTACTCAGATATTATACAAATATATTAACAGTCTTTGGA CCAAGTATACGAGATCCTATCACTAGCACGATTTCGGTACAAGCACTTAGTCAAGCATTC AATCGTAATCTTCACGCACTACTTGACGGACTAGOATATACTGGGAGAGACTTACATGAC CTTCTAGAGAGTAAATCTATCACTGGTCAGATAATTCATGCAGATAGACTGATTTGTTC CTTGTTCTGAGAATTAATTACCCTTCCATAACTO AGATGCAGGGAGTAACAAATATGAA CTGAATTCAATTACATATCATATTGGGCCTGAAGAGTGGTATACTATTATGCCTGATTTT ATACCTGTICAGOGTTTTTTAATATCTAATTTTGATGAAAGAAAGTGTTCAATAACTAAA TCGAGTGTAATATGCCAACAAAATTCAATTTACCCGATGTCAGCAGAGATCCAAAGATOT ATTAAGGGCGAAATAAGATTCTCTCCAAGATCTAAGGCAATTGGGACGTTAGTTAATCGG TTCATATTGACCAAAGGTAATTTAATGGCTAATTGTCTGGGAATTATATGCAGATGTTAT ACCTCAGGCCAAGTTATA ACACAGGACCCCAGTAAGTTAATTACAATAATATCACAAGAG GAGTGCAAAGAAGTCGGTGTTGATGGTATCCGTATTATGGTAGGACCTAGAAAATTACCA GATATTACCTTTAATGCTAGGTTAGAAATTGGTGTACCGATATCATTAAG CAAATTAGAT GTCGGAAATGATTTAGCAATTGCTTCACGCTA AGCTTAATAATTCCAAAGCATTGTTAGAG CAATCAGATAAGATTCTGGGTTCTATGTCTAAGTTGGATTCTATTAATTCAAGAATTATA GGATTAATCTTAGCAATCATGATAATCTTTATAATTATTGTTACCATTATCTGGATCATA TATAAAAATTGTAGAAATAAAGATACTAAATTCAGTACTTCAATTGAACCGCTCTACATA CCCCCTTCTTATAACTCACCTCATAGTGTGGTCAAGTCTATTTGAGTACTGACCATATGA U.S. Patent Sep. 22, 2015 Sheet 26 of 45 US 9,139,620 B2

Figure 4-5

TTTACTGTAATAAGTCCAGTGGAAGTATCAATTGACAATACTGGTAGTATAATGAATATT GAATATATAATATACTCTCTTAAATTGGATAGTGATAAAGAGTTATAGATGATTGCAATC ATTTTAATATAATTATATATTGATTTGATTACCTGGTATAATTCTTATGCAATTGAATTA TGTGTCATCAATTAATAGCT'TAATAGCACTGTTTTATACACTTATGTTGATAGATAGATG TGTTATATTGTAATCAAGGATTAGTATCTAGAAGAGGAAAGAGTTCAATTGGTTCTTAA TTGGTTATTGTGTATTCAATTAGAAAAAACTTAGGAATCCATGTTAATAAAAACTCATTA. TCATGGAGTCCAATAATGTTAAATATTACAAGGATTCTAACCGATACTTTGGTAAAATAT TAGATGAACACAAAACAATTAATAGTCAATTGTACAGCTTAAGTATTAAAGTAATTACCA TTATTGCCATAATTOTAACGCCTAATTGCAACAATAATGACTATTATTAATGCCACAAGTG GGAGCACTCCCCTAAACAGTAATACAGACATACTGCTTAGCCAAAGAGATGAGATTCATA ATATCCAAGAAATGATATTTGATCGTATTTATCCITTGATAAATGCTATGAGTACAGAGT TAGGACTTCATATTCCTACCTTATTGGATGAACTTACTAAAGCGATTGACCAAAAGATTA AAATAATGAATCCCCCTATTGACACTGTGACGTCTGATCTTAATTGGTGCATCAAA CCCC CTAACGGAATTATTATAGACCCGAAGGGTTATTGTGAGAGTATGGAATTCTCCAAAACTT ATAAATTACTACTTGACCAATTAGATGTCTTAAGAAAGAAATCACTCATTATAAATAGAA AGAATATTAACCAGTGTCAATTAGTTGATGATTCAA AGATCATTTTTGCTACTGTCA ACA TACAATCTACACCGAGGTTT"TTGAATTTTGGTCACACAGTCAGCAATCAA CGTATAACAT TTGGTCAAGGAA CATATAGTAGTACTTATGTTATAACTATCCAAGAAGATGGGATAACTG ATCTTCAATATCGAGTTTTTGAAATCGGGTATATCTCTGATCAGTTTGGTGTTTTCCCCT CCTTAATAGTATCCAGAGTGTTOCCTATACGCATGCTATTAGGAATGGAATCCTGTACCT TGACAAGTGACAGACTAGGTGGGTATTTCTTGTGTATGAATACACTGACACGATCTATAT ATGATTATGTTAGCATAAGGGATTTGAAATCATTATATATAACACTCCCTCATTATGGTA AGGTTAATTATACTTACTTGATTTTGGTA AGATCAGAAGCCCACATGAAATAGATAAAA TTTGGTTAACATCTO AGAGGGGCCAAATTATTTCTGGTTATTTTGCAGCATTTGTTACCA TTACAATTCGGAATTATAATAATTATCCCTACAAATGTTTAAATAATCCATGCTTTGACA ACTCTGAGAATTACTGTAGAGGGTGGTATAAAAACATAACAGGTACTGACGATGITCCGA TATTAOCATACCTATTACTTGAAATCTATGATGAACAAGGACCTTTAATTACACTTGTAG CAATCCCGCCTTACAATTATACAGCTCCATCTCATAATTCTCTTTACTATGATGATAAAA U.S. Patent Sep. 22, 2015 Sheet 27 Of 45 US 9,139,620 B2

Figure 4-6

TCAATAAATTGATAATGACTACATCTCACATAGGTCATATTCAAGT'TAATCACGTCCATG AGGTGATTGTTGGCGATAATTTAAAGGCTATCCTCCTAAACAGATTATCTGATGAACATC CTAATCTTACTGCCTGTAGACTCAATCAGGGCATAAGGAGCAGTACAGGTCTGACGGAA CAATAATTTCAAATTCTCCACTTATTGATATACAAGAACGGATGTATATTACAATTAAAG CTGTTCCACCAGTGGGTAACTATAACTTACACTTGAATIOCATTCTAGATCAAACACAT CTTATCTATTGTTACCAAAACAGTTTAATGCTA AATACGACAAATTACATCTTGAGTGCT TTAGCTGGGACAAATCTTGGTGGTGCGCCTTGATACCTCAGTTTTCATAAGTTCGAATG AATCCCTTCTGTTGATACTGCTATTTTTAATTTAATAAGTTGTAAATGAATATGTCAAC TGATAGTTGATAGTTGTCAAAACATCAGCTAATTGACATTAAAGAAATAAAAAAATGAAA TTATCA AGATTTGACTAGATGTATACTCAAGCTA AATTACAAAAAACTTAGGAGTCAGAG ACTTCGTTCCAATGGAGCAGTCAGACTACCAAGATATTCTATATCCTGAGGTACATCTTA ACAGTCCTATAGTAATCTCTAAATTAGTAGGTATTTTAGAATATGCCCGAATTGCTCACA ATCA ACAACTATCAGACCATACAATTATCAAGAATATTCAATTTAGATTAAGAAATGGCT TTAATAGTCCAAGGATACAGACACTATCAACTATGGGTGAAATCATCAACAAAATTAAAA GCAA ACACCCCAATTATTTACA CATACCTTACCCCOAATGTAACCAAAAGCTATTTCGAA TAGTAGATCCAGAACTGACATCAAAATTGGAATCTCTTCTGAACAAAGGTGATACACTCT ATCTCAAAATTCGGTCAGATATCATAAAATCGCTTTGATAGATTGAAAATGAAGATGAACA TAAGGAATGATCTTCTTAATGACAATAGTCAATTAATTCTGGATCTTCCTTTAATTCTCA AAGGATCTCAGTGGTTCTTCCCGTTTTTATTTTGGTTTTCGATTAAAACTGACACTAGAA GCTGTATCCGACAAAATCAAAAAGCTCGTGTTAGATCACAATATCGGCCTCACTTATCAG AGACTA AGAGAATTACATTGGTTGTTACATCTGATCTAATTACGATATTTGATCATATTA ATAAATOTATATTTTATCTGACTTTTGAGATGTTGTTAATGTATTGCGATGTGGTAGAAG GTAGATTAATGACTGAAACAGCTATGAGCTTGGATTGTCGATTTATCAATCTATTGCCAA GAGTCCAATATATGTGGGATTTGCTAGATGGAATGTTTGAAAGTTTAGGTAATCAATTAT ATTCACTTATTGCATTGTTAGAGCCTCTTTCTCTTGCTTATTTGCAATTAATAGATGCAG ATCCACAGATTCGGGGAACATTCTTC CATCACTGTTTTTCAGACT"TAGAAGAAATTATAT TTGACAAGTCTCCTTTTGATCCTTTTGTGTATGAAAATTTAATTAATGGACTAGATTATA TTTATTTGACAGATGATATTCATCTAACTGCAGAACTTTTTTCTTTTTTTAGGAGCTTTG U.S. Patent Sep. 22, 2015 Sheet 28 of 45 US 9,139,620 B2

Figure 4-7

GTCATCCTTTTTTAGAAGCACAAAATGCTGCTAATAATGTGAGGAAGTATATGAATAAGC CTAAAGTGATCTCATACCAGACTCTAATGCAAGGACATGCGATTTTCTGTGGTATTATAA TAAATGGATTTAGAGATCGCCATGGGGGAACATGGCCTCCTOTAGAGTTACCAAATCATG CATCTGCTGTAATTAGAAATGCCCAGCTATCTGGAGAAGGGTTAACATCTGAACAATGTG CTCA ACACTCGAGATCCTTTTGTGGATTTAAATTTAAAIGTTTTATGCCACTGAGTCTAG ATAGTGACCTTACAATGTACCTTCGGGACAAGGCGTTGTCACCTGTCAAAAGTGAGTGGG ATTCTGTTTATGCGAAAGAGTATTTAAGATACAATCCAGGATTACCTACAAGCTCTAGAA GACTAGTGAATGTATTCTTAGAAGATGATAAGTTTGATCCATATGAAATGATCATGTACG TGATAAATGGTGATTACTTAAGAGACAAAGAGTTTAATCTTTCATACAGTCTTAAAGAGA AAGAGATCAAAGAGGTAGGTCGATTGTTCGCCAAAATGACTTATAAAATGAGGGCTTGCC AAGTAATAGCTGAAAACCTGATTGCCAATGGAGTAGGGAAGTTCTTCAA AGATAATGGAA TGGCAA AAGATGAACATAAACTAACTAAAACGTTACACAAATTAGCCATTCACGTCTAC CTA AAGATAATTCTCA ACTTTATTTAGATGAATGCTGGGAGCAAGTAGTTCGACAATGCT CAAGTAGTACACAGATAGGAGAACAGACTATGAATTCACAATCGAAGAGGGCAATTGAAT CAAAGTCTTCTAGATCACATCGAAATAATACGGATATCTTAAGGGGCAGGAGAGATTTGA ATAAACAGATAAAGTACCCTTCCAACACCGAGTATTATGAGACTATTAGTAGTTTCATAA CTACTGACCTTAAAAAGTACTGTCTTAATTCGCGATATGAATCAAGTAGTGTGTTTGCAG AGAGACTTAATGAAATTTATGGATTGCCTGGGTTTTTTCAGTGGCTTCACAAAATATTGG AGAAATCTGTTTTATACGTTAGCGATCCGTCTAGTCCACCTGATTTTGATCGACATATCC ATATAGAATCAGTTCCGAATGACCATATCTTTATTAAGTACCCGATGGGTGGAATAGAGG GGTTCTGTCAAAAATTATGGACTATTAGTACGATTCCATTCCTATATTTAGCAC CTTTTG ATACAGGAGTTACAATCTCATCATTGGTTCACGGGCGATAATCAGGCAATTGCAGTGACCA AAAGAGTTCCATCATCTTGGAGTTACTCAAAGAAAAAGGAAGAATCAACTAA AATAACAA CACAATATTTCCTTAATTTA AGACAACGCTTACACGACATAGGTCATGAATAAAAGCAA ATGAGACTATTATATCCTCTCATTTCTTTGTTTACTCTAAAGGTATTTATTACGATGGAA TACTTCTCTCTCAAGCACTTAAAAGTATTGCAAGATGTGTTTTTTGGTCTGAAACAATTG TTGATGAAACTAGATCAGCTTGCAGTAATATATCTACGACACTTGCAAAGGCAATTGAAA GGGGTTATGATAAATTTGTGGCATATGCTATTAATATTTATAAAACAATACATCAAGTTT U.S. Patent Sep. 22, 2015 Sheet 29 Of 45 US 9,139,620 B2

Figure 4-8

TGATTGCATTATCTTTTACGATTAATCOTACTATGACACCACACATTACAGAACCTTTCT ACAAAAGTTTCCATCTACTTAAAAATCTAGTTCTAATCCCTGCACCATTGGGAGCCATGA ATTATATGAACATCGAGCAGGTTATTTGTTAGGAACATAGGTGACCCCATTACTGCTTCAT TTGCTGATATAAAGCGCATGATCGAATGTGGGTTATTAGGATGTAG CATTCTGTCACAGA TAATGACCAAAAAGTGGTTCCTCTAAATACTTAGACTGGGCTACTGATCCTTACT'CAA TAA ACCTTCCTTATAGCCAAAGTATGACCAAGGTCTTAAAAAATGTAACAGCA AGATATG TACTTATCCATAGCCCCAATCCTATGCCAAAGATTTGTTCCATGAAAAGTCACAAGAAG AAGATGAAATCCTTGCTGAATTTCTGTTAGACCGACACTTAATAATCCCTAGAGCAGCAC ACGAAATTTTATCAAATTCAGTGACAGGTGCTAGGGAATCTATAGCAGGTATGCTTGACA CTACTAAGGGTTTAATCCGTGCTAGTATGTCAAGAGGTGGGCTGACATCATCACTAGTTT TAAAATTATCAA CATATGACTACCAACAGTTTAGAACGTGTCTTGAATGGCTTTATGCTC CTATCACGGGAATTGCTCTA AGCGTTGATTCTTGTTCTGTATTCTTAGCTAAGACCATCC AAAGAGAATGTGGGTTCATCTAACTAAGGGAAGGGAGATTTACGGGTTGGAGGTACCTG ACATTTTGGAATGCATGCAAAACAATATAATTATTGATCATGAAGATTGTTACTCATGTA TTCAAGGATCAA AATATTATACATGGTTTTTTGTACCTTCAAATTGTCAACTCGATCAGA TAAATAAGTCAACAAATTCTCTCCGAGTACCTTATGTTCGATCAACAACTGAACAAAGGA GTGATATGAAGTTGTCATATGTGACGTCACCAAG TAGACCACTTAAAGCAGCAGTCCCAA TTCCAGCAGTATATACATGGGCTTATGGTGATGATGATTTATCCTGGCATGAGGCTTGGT ATTTGGCAAGGACTAGGGCAAATATTACATTTGATGAACTCAAATTAATAACACCTATAG CTACATCTACTAATTTGGCACATAGGTTGACGAGATAGAAGTACTCAAGTTAAATATTCAG GGACTTCCTTAGTAAGAGTGGCACGCTATACAACAATATCTAATGATAACATGTCGTTCA CTATTAACAACAGGAAAGTCGATACTAATTTTGTCTACCAGCAAGGGATGTTATTAGGCT TGAGTATACTCGAATACATATTCAGATACTGTACAAGTACTGGACAATCAAACACTGTAA TTCACTTACATGCAGATGTTAATTCTTGTATAGTACAGATGACTGATCAGCCTTATACGC CAAGCTTAACTAAGAAGCTACCTGATATCAA ACCCATCAATAATAAATTGATATATGATC CGGCTCCTATAATTGATACTGATGCAGCTAGGTTGTATTCTCAAAAATATCTGTCACATC TAATAGATTTTCCAAGTTGGTCAACTACTCAGCTTAACACAGTGTTGGCAAAAGTGGTAG CAGTATCTATAGTAGAATTGATCACAAAAGCGAGTAAAGACCATCTCAATGAGATAATAG U.S. Patent Sep. 22, 2015 Sheet 30 of 45 US 9,139,620 B2

Figure 4-9

CGGTTGTTGGTGATGATGATATCAATAGCTTTATTACAGAATTTCTACTTGTTCATCCAC GTTTCGTTTACACTATACTTAGGCCAATACATGTCTTACAATGGGCATATCAAATCCATT ATCATAGACCAGTGGGCAAGTACCAGATGGCCGAAGTATTACATAATTTGCTGTCAAGAG CTACTAGAGGCATATTTAGCATATTGACCAATGCCTTTAGCCATCCCCGGGTCTATAAAA GATTCTCGGGAATGTGGTTTATTGGAGCCTATTTATGGGCCTTATATAGGAAGTCAAAATC TACATACTGCAGTGATTGATTATATCTATAATGCATATCTTACTTATITGGATCCITATI' TATCTGATCAAGTAGATGATACTGATATATAATCTGTGAAACAGAGGAGACATGTTTAG CAAATAGAATTGACAATTACCAAAGTAGACACCTAGCTGTACTCATAGACITGTACTGCG ATTCCACTAGATGCCCCAATATAAAAGGGTCAGATACAATTATGAGAAATTCAATCCTTA CATCCTTCATTGATAATGAGAGGAAAACAAACCCACTCGGTTTGACATGGAATCTTGATC CATTACTTGTGGATCACTTTAGCTGTTCTATTACATATCTAAGGAGAGGTATTATTAAAC AGATGAGATTAAGATTTGACCCAAGCGTATCTCTTGAATTATCTAGAATGATTAAACCTC. ATGTGATTTATCAAGCACCTAAAGTTCCGTCCTCATGGGCTCTTATAGATATCAACCCTG AAGTAAATGACCTTAATACAATTTTTGGAGAGCTTAATAGCAAGTGGAAAGACATCCCTA TAGGACAAATCAGAATCCAAAATTATGAAATACATGCATATAGGAGGATTGGAGTTAATT CAACTGCATGTTATAAGGCTTTAGAGCTATTATCTGTTCTAAATCGGTTCATGTCTAACC CATCAGGTOCAT"TGTTTTTAGGTGAAGGGGCAGGATCGATCCTGGTCACATATCGTCCCT TTATTCCATTCAAGACAATTTATTATAATAGTGGTATTTCAGTTCAAAATGTTCAGGGTC AGAGAGAATTAAGTCTATATCCATCTGAACTGGCACTAGTTGATAACAAAAATCGCTTGG CTAATGACCCTAATATCAAAGTCTOTTTAATGGTAAGCCAGAGTCTACATGGGTTGGAA ATATTGACTGTTTTGCTTATATTCTTAGCCATATTGAGACTTCAAGCTTGACATTGATAC ATAGTGATATTGACTCCAGCTTGACCAAGACAAAGAATAAAATTCTTGAGGAGCTGTGCC ATA"TCTGTCAATGGCACTCATTTTGGGAAAGATCGGATCTTTATTAGTTGTTAAGTTGC TACCAAGGGTCAGTGATTATACGTATTCATTTTCCAAATATGCATCAGAGTCTATCAAC AAAACTTTCTTGTTCTGCCTAGATTTAGTAACATGTCATCATCTGAGGTTTACTACATAG GAATTCACCTTAATACAAATCGATTGATTCACCCTGATAGAATAGTACAATACATAATTA AAATTTACAACCTACTCCAGTTACATTTTTATCCTACATTTTTCAAACTAAGTATCGAA ATAATATGGTTACAAATTATGGACTATGCTTGTCAGACGGACACAAAAGTGATTACTTGT U.S. Patent Sep. 22, 2015 Sheet 31 of 45 US 9,139,620 B2

Figure 4-10 CATCAATTACAAAAATAGAGAGTGTTCTTCTGTCATGTGGGTTACAATTGAACGGACCTA AGATTATACAGCAATTATCAGGACATGACTATGCCAGTGGAGAGACTAGTCTGGAATCAA GTATAATGATATTACTTAGAGAATATCT'TAATGCAACTATACAAGGCCGGGAAACATTAG GCTTGTTTTCACCTTACCCGGTCCTTCATGAGAGTCAGTTAAGAGAAATCAATAAGTGTA TTCTATTGAAGTATATTGTATATCTCCTCTTTTATTCAAA CTCTACATTATCTACTAAAC AAATAATGAGTAATCTTAGAAAAGGAATATTGATGTATGATTTGAGAGATGAGTTTTTCA TATCAAGATTGTCAGCAAATTACAAGAAAAAAGTAATGTCACAGGAAGTTAAG ACTACCT GGATATTTAATATTGATACTCCGACACGAAAGGCGTTATATAAGTTAGTAGGTTACTCAT TAATAATTAATCACATATGAAGGTTGGGCATGGTTATTCATTTTTTAAGGAGTA AGATAA GACTTGATATATGATAACTGATTAAACATTACCTCTGAATTGAACGATTGCTCAATTACA TGGTTTTTGAGTAATTGACATTTTATTCCAATTAGTACAATTAGAAAAAACTTCAA CAGT TCATTGAGCCTTAATTACTCCATACTAGCTATATTTATAAGCTCGGATAAAACTTTGGT TTGAAATTATAACAGTCATACCAATCTATCAAGGAAACACAATTGATGTCTAGTATGAAG TTCATATTTATATGTTTTTAATCTTATACCCACTCTAATTAGTTCCTATTTAAGAATTAA ATTATAGATG'TAACAT'GTTATATAATGGGAACCATCAATOCTGCTATTGTTGGTAACTA TAGGCATTGTATTAGATAATGTTTATTTCTTAGAAATGTG CAATCTCATACGTCGGACCC CTCAGCCTCCCCCTTATAGTTGCGTGATTTGAAAAAACACAAAAAATAATCATGAATGGG TGTACGTACCTATAGCTTTCTTTGTCTGGT

U.S. Patent Sep. 22, 2015 Sheet 33 of 45 US 9,139,620 B2

RE 6

U.S. Patent Sep. 22, 2015 Sheet 34 of 45 US 9,139,620 B2

eue6N U.S. Patent Sep. 22, 2015 Sheet 35 of 45 US 9,139,620 B2

eue6d.

U.S. Patent

eue6VN

!OZERHT15DIH U.S. Patent Sep. 22, 2015 Sheet 37 Of 45 US 9,139,620 B2

eue6({

U.S. Patent Sep. 22, 2015 Sheet 38 of 45 US 9,139,620 B2

U.S. Patent Sep. 22, 2015 Sheet 39 of 45 US 9,139,620 B2

(Ieue6

U.S. Patent Sep. 22, 2015 Sheet 41 of 45 US 9,139,620 B2

ERE

U.S. Patent Sep. 22, 2015 Sheet 42 of 45 US 9,139,620 B2

E

U.S. Patent Sep. 22, 2015 Sheet 43 of 45 US 9,139,620 B2

38

US 9,139,620 B2 1. 2 FELINE MORBILLIVIRUS AND USES species jumping of viruses among these two kinds of animals THEREOF is not uncommon. For coronaviruses, feline coronavirus and canine coronavirus are classified under the same species CROSS-REFERENCE TO RELATED Alphacoronavirus 1, and feline coronavirus type II Strains APPLICATIONS were generated by double homologous recombination between feline coronavirus type I strains and canine coro The present application claims the benefit of U.S. patent navirus (17). For parvoviruses, the fatal canine parvovirus application Ser. No. 61/588,778, filed Jan. 20, 2012, which is that emerged in the 1970s also originated from a feline par hereby incorporated by reference in its entirety. vovirus, feline panleukopaenia virus (18.19). As for herpes 10 viruses, canid herpesvirus 1 and felid herpesvirus 1 are SEQUENCE LISTING closely related and are classified under the genus Varicellovi rus (20). Furthermore, for papillomaviruses, canine oral pap The instant application contains a Sequence Listing which illomavirus and feline papillomavirus are also closely related has been submitted in ASCII format via EFS-Web and is and are classified under the genus Lambdapapillomavirus hereby incorporated by reference in its entirety. Said ASCII 15 (21). Dogs are well-known hosts of a paramyxovirus, canine copy, created on Apr. 30, 2013, is named Sequence Listing distemper virus, in the genus Morbillivirus (22), but no 2748US1.txt and is 108,282 bytes in size. paramyxoviruses have ever been discovered in domestic cats. Many feline diseases have no known causes. For example, INTRODUCTION the cause of most cases offeline tubulointerstitial nephritis is hitherto unknown and therefore treatment is mainly Support Described herein are isolated paramyxovirus, a morbillivi ive and prevention is difficult. Tubulointerstitial nephritis rus (FmoPV), isolated nucleic acids encoding the genome of (“TIN) involves primary injury to renal tubules and intersti FmoPV. isolated amino acid sequences of FmoPV proteins, tium and is the most common cause of renal failure and one of antibodies to FmoPV and its proteins, and uses thereof. In the leading causes of deaths in cats. However, the cause of certain embodiments, the modified FmoPV is a feline mor 25 most cases of feline TIN remains unknown and therefore billivirus. Also described herein is a recombinant FmoPV treatment is mainly supportive and prevention is difficult. comprising a modified FmoPV gene or gene segments and the With millions of cats in households around the world, the use of such a virus. The recombinant FmoPV may be used in disease burden from TIN is great. For example, in the United the prevention and/or treatment of diseases related to FmoPV States of America, it is estimated that there are 75 million or as a delivery vector. Also described herein is a diagnostic 30 household cats, while there are an estimated 8 million house assay for the FmoPV. In certain embodiments, the FmoPV hold cats in United Kingdom (data from Chomel BB, Sun B., causes kidney disease. In certain embodiments, the kidney Zoo noses in the bedroom. Emerg Infect Dis. 2011 February: disease is in felines. In certain embodiments, the kidney dis 17(2):167-72.). The capability to diagnose, treat or prevent ease is tubulointerstitial nephritis (“TIN). Also described feline kidney or other diseases would have a great benefit. herein is a quantitative assay for the detection of the FmoPV. 35 The citation of any reference herein should not be con natural or artificial variants, analogs, or derivatives thereof. In Strued as an admission that Such reference is available as certain embodiments, the quantitative assay is reverse tran “prior art” to the instant application. scription and polymerase chain reaction (RT-PCR). Also described herein is a vaccine and a kit containing the vaccine 2. SUMMARY OF THE INVENTION for the prevention and treatment of FmoPV infection. 40 Described herein is a diagnostic kit that comprises nucleic In one aspect, provided herein are nucleic acid sequences acid molecules for the detection of the FmoPV. comprising or consisting of a wild-type or a modified FmoPV gene segment (genomic RNA) or the complement thereof 1. BACKGROUND OF THE INVENTION (antigenomic RNA). Also described herein are isolated 45 nucleic acids encoding the genome of FmoPV, polypeptides Paramyxoviruses are enveloped, negative-sense single encoded by portions of the isolated FmoPV, nucleic acids, stranded RNA viruses that are divided into two subfamilies, primers, vectors, host cells, antibodies to FmoPV and to Paramyxovirinae and Pneumovirinae. Viruses in the subfam FmoPV polypeptides, immunogenic compositions, diagnos ily Paramyxovirinae have been associated with a number of tic methods, Screening assays, methods of treatment and emerging diseases in humans and various animals in the past 50 related uses. two decades (1-9). There are currently five genera within the In one aspect, described herein is a novel paramyxovirus in Subfamily Paramyxovirinae, namely Respirovirus, Rubulavi the genus Morbillivirus, a feline morbillivirus (hereinafter rus, Morbillivirus, Henipavirus and Avula virus, although “FmoPV) from domestic cat (Felis catus). Also described Some members of the subfamily remain unclassified. Among herein is that this novel FmoPV virus is associated with members of Paramyxovirinae, measles virus, mumps virus, 55 tubulointerstitial nephritis (TIN) in cats. and human parainfluenza viruses 1 to 4 are most well known In one aspect, the modified FmopV gene segment com human paramyxoviruses which cause outbreaks of respira prises FmopV nucleic acid sequence and also a heterologous tory to systemic infections (10-12). Three novel rubulavi nucleotide sequence. In some embodiments, the first and ruses, Tuhoko virus 1, 2 and 3, from fruit bats in mainland second heterologous nucleotide sequences encode different China and a novel unclassified paramyxovirus, Taillam virus, 60 peptides or polypeptides. In other embodiments, the first and from Sikkim rats in Hong Kong were recently reported (13. second heterologous nucleotide sequences encode the same 14). Despite the presence of paramyxoviruses in a variety of peptide or polypeptides. In specific embodiments, a FmoPV animals, no paramyxoviruses have been naturally observed in comprising a modified FmoPV gene segment described cats, although there is controversial evidence that cats may be herein achieves titers of approximately 3x10 pfu/ml, 3.5x infected with parainfluenza 5 virus (15,16). 65 10 pfu/ml, 4x10pfu/ml, 5x10 pfu/ml, 1x10°pfu/ml, 5x10° Cats and dogs are the most common domestic animals and pfu/ml, 1x107 pfu/ml, 5x107 pfu/ml, 1x10 pfu/ml, 5x10 pets worldwide. As a result of their close relatedness, inter pfu/ml, 1x10 pfu/ml or more after 1, 2,3,4,5,6,7,8,9, 10 US 9,139,620 B2 3 4 or more passages in cells (e.g., MDCK cells) or embryonated another embodiment, provided herein is a method of prevent chick eggs. In certain embodiments, a FmoPV described ing and/treating FmoPV infection in a subject, wherein the herein comprises an attenuating mutation. In one aspect, pro method comprises administering a FmoPV described herein vided herein are methods of using a FmoPV, wherein the or a composition thereof to the subject. In another embodi FmoPV comprises a modified FmoPV gene segment. ment, provided herein is a method for preventing and/or treat In one embodiment, provided herein are methods for ing an FmoPV disease in a subject, wherein the method detecting the presence or expression of FmopV, natural or comprises administering a FmoPV described herein oracom artificial variants, analogs, or derivatives thereof, in a biologi position thereof to the subject. cal material. Such as cells, blood, serum, plasma, saliva, urine, In another embodiment, provided herein are methods for stool, sputum, nasopharyngeal aspirates, and so forth. The 10 eliciting an immune response against an antigen in a Subject, increased or decreased activity or expression of FmoPV in a comprising administering a FmoPV described herein or a sample relative to a control sample can be determined by composition thereof to the subject. In another embodiment, contacting the biological material with an agent which can provided herein are methods for generating or identifying detect directly or indirectly the presence or expression of antibodies that bind to a FmoPV utilizing a FmopV described FmoPV. In a specific embodiment, the detecting agents are 15 herein or a composition thereof. nucleic acid molecules of the present invention. In another aspect, the FmoPV described herein can be used In a specific embodiment, provided herein is a diagnostic to assess the antiviral activity of a compound or understand assay for FmoPV, natural or artificial variants, analogs, or the life cycle of a FmoPV. derivatives thereof. In particular, provided herein is a quanti tative assay for the detection of nucleic acid molecules of 2.1 Terminology FmoPV using reverse transcription and polymerase chain reaction (RT-PCR). Also provided in the present invention are As used herein, the term “variant” refers either to a natu nucleic acid molecules that are suitable for hybridization to rally occurring genetic mutant of the FmoPV or a recombi FmoPV nucleic acids such as, including, but not limited to, nantly prepared variation of the FmoPV, each of which con PCR primers, Reverse Transcriptase primers, probes for 25 tain one or more mutations in its genome compared to the Southern analysis or other nucleic acid hybridization analysis FmoPV having a nucleic acid sequence disclosed in Genbank for the detection of FmoRV nucleic acids. Said FmoRV accession nos. JQ41 1014, JQ41 1015 and JO411016. The nucleic acids consist of or comprise the nucleic acid sequence term “variant may also refer to either a naturally occurring as described infra or a complement, analog, derivative, or variation of a given peptide or a recombinantly prepared fragment thereof, or a portion thereof. 30 variation of a given peptide or protein in which one or more In one aspect, the invention relates to the use of the isolated amino acid residues have been modified by amino acid Sub FmoPV for diagnostic methods. In a specific embodiment, stitution, addition, or deletion. the invention provides a method of detecting mRNA or As used herein, the term “mutant” refers to the presence of genomic RNA of FmoPV of the invention in a biological mutations in the nucleotide sequence of an organism as com material. Such as cells, blood, serum, plasma, saliva, urine, 35 pared to a wild-type organism. stool, sputum, nasopharyngeal aspirates, and so forth. The As used herein, the terms “antibody' and “antibodies' increased or decreased level of mRNA or genomic RNA of refer to monoclonal antibodies, bispecific antibodies, multi FmoPV in a sample relative to a control sample can be deter specificantibodies, human antibodies, humanized antibodies, mined by contacting the biological material with an agent chimeric antibodies, camelised antibodies, single domain which can detect directly or indirectly the mRNA or genomic 40 antibodies, single-chain FVS (ScPV), single chain antibodies, RNA of FmoPV. In a specific embodiment, the detecting Fab fragments, F(ab') fragments, disulfide-linked FVs (sdFV), agents are the nucleic acid molecules of the present invention. and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id The present invention also relates to a method of identify antibodies to antibodies of the invention), and epitope-bind ing a subject infected with FmoPV. natural or artificial vari ing fragments of any of the above. In particular, antibodies ants, analogs, or derivatives thereof. In a specific embodi 45 include immunoglobulin molecules and immunologically ment, the method comprises obtaining total RNA from a active fragments of immunoglobulin molecules, i.e., mol biological sample obtained from the Subject; reverse tran ecules that contain an antigen binding site. Immunoglobulin scribing the total RNA to obtain cDNA; and subjecting the molecules can be of any type (e.g., IgG, IgE, IgM, Ig), IgA cDNA to PCR assay using a set of primers derived from a and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and nucleotide sequence of FmoPV. 50 IgA2), or Subclass. The present invention further relates to a diagnostic kit As used herein, the term “antibody fragment” refers to a comprising primers and a nucleic acid probe for the detection fragment of an antibody that immunospecifically binds to a of mRNA or genomic RNA of FmoPV. In a specific embodi FmoPV or any epitope of the FmoPV. Antibody fragments ment, provided herein is a diagnostic kit comprising nucleic may be generated by any technique known to one of skill in acid molecules which are suitable for use to detect FmoPV, 55 the art. For example, Fab and F(ab') fragments may be pro natural or artificial variants, analogs, or derivatives thereof. In duced by proteolytic cleavage of immunoglobulin molecules, one embodiment, a kit provided herein comprises, in one or using enzymes Such as papain (to produce Fab fragments) or more containers, a nucleic acid sequence described herein. In pepsin (to produce F(ab')2 fragments). F(ab')2 fragments con another embodiment, a kit provided herein, comprises, in one tain the complete light chain, and the variable region, the CH1 or more containers, a FmoPV described herein. 60 region and the hinge region of the heavy chain. Antibody In another aspect, provided herein are substrates (e.g., host fragments can be also produced by recombinant DNA tech cells and eggs) comprising a nucleic acid sequence described nologies. Antibody fragments may be one or more comple herein. mentarity determining regions (CDRs) of antibodies. In one embodiment, provided herein is a method for elic As used herein, the term “an antibody or an antibody frag iting an immune response against FmoPV in a Subject, 65 ment that immunospecifically binds a polypeptide of the wherein the method comprises administering a FmoPV invention” refers to an antibody or a fragment thereof that described herein or a composition thereof to the subject. In immunospecifically binds to the polypeptide encoded by the US 9,139,620 B2 5 6 nucleic acid sequence of the FmopV, or a complement, ana separated from cellular components of the cells from which it log, derivative, or fragment thereof, or a portion thereof, or is isolated or recombinantly produced. Thus, a polypeptide? that immunospecifically binds to the polypeptide of the protein that is substantially free of cellular material includes FmoPV, or a variant, analog, derivative, or fragment thereof, preparations of the polypeptide?protein having less than and does not non-specifically bind to other polypeptides. An about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of antibody or a fragment thereofthat immunospecifically binds contaminating protein. When the polypeptide?protein is to the polypeptide of the invention may cross-react with other recombinantly produced, it is also preferably substantially antigens. Preferably, an antibody or a fragment thereof that free of culture medium, i.e., culture medium represents less immunospecifically binds to a polypeptide of the invention than about 20%, 10%, or 5% of the volume of the protein does not cross-react with other antigens. An antibody or a 10 preparation. When polypeptide?protein is produced by fragment thereof that immunospecifically binds to the chemical synthesis, it is preferably substantially free of polypeptide of the invention, can be identified by, for chemical precursors or other chemicals, i.e., it is separated example, immunoassays or other techniques known to those from chemical precursors or other chemicals which are skilled in the art. involved in the synthesis of the protein. Accordingly, Such As used herein, the term “epitope” refers to a fragment of 15 preparations of the polypeptide?protein have less than about FmoPV peptide, polypeptide or protein having antigenic or 30%. 20%, 10%, 5% (by dry weight) of chemical precursors immunogenic activity in an animal, preferably a mammal, or compounds other than the polypeptide?protein fragment of and most preferably in a feline. An epitope having immuno interest. In a preferred embodiment, the polypeptides/pro genic activity is a fragment of a polypeptide that elicits an teins are isolated or purified. antibody response in an animal. An epitope having antigenic As used herein, the term "isolated virus is one which is activity is a fragment of a polypeptide or protein to which an separated from other organisms which are present in the antibody immunospecifically binds as determined by any natural source of the virus, e.g., biological material Such as method well known in the art, for example, by the immunoas cells, blood, serum, plasma, saliva, urine, stool, sputum, says described herein. Antigenic epitopes need not necessar nasopharyngeal aspirates, and so forth. The isolated virus can ily be immunogenic. 25 be used to infect a subject. As used herein, the term “antigenicity” refers to the ability As used herein, the term “having a biological activity of the of a substance (e.g., foreign objects, microorganisms, drugs, polypeptides of the invention” refers to the characteristics of antigens, proteins, peptides, polypeptides, nucleic acids, the polypeptides or proteins having a common biological DNA, RNA, etc.) to trigger an immune response in a particu activity similar or identical structural domain and/or having lar organism, tissue, and/or cell. Sometimes, the term “anti 30 sufficient amino acid identity to the polypeptide encoded by genic' is synonymous with the term “immunogenic'. the nucleotide sequence of FmoPV or a complement, analog, As used herein, the term “immunogenicity” refers to the derivative, or fragment thereof, or a portion thereof, or the property of a Substance (e.g., foreign objects, microorgan polypeptide having the amino acid sequence of FmoPV, or a isms, drugs, antigens, proteins, peptides, polypeptides, variant, analog, derivative, or fragment thereof. Such com nucleic acids, DNA, RNA, etc.) being able to evoke an 35 mon biological activities of the polypeptides of the invention immune response within an organism. Immunogenicity include antigenicity and immunogenicity. depends partly upon the size of the Substance in question and As used herein, the term “portion' or “fragment” refers to partly upon how unlike the host molecules is the Substance. a fragment of a nucleic acid molecule containing at least Highly conserved proteins tend to have rather low immuno about 25, 30, 35, 40, 45,50, 60, 70, 80,90, 100, 150, 200,250, genicity. 40 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, As used herein, the term “hybridizes under stringent con 900, 950, 1000, 1050, 1100, 1150, 1200, 2,000, 3,000, 4,000, ditions' describes conditions for hybridization and washing 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, under which nucleotide sequences having at least 30%, 35%, 13,000, 14,000, 15,000, 16,000, 17,000 or more contiguous 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, nucleic acids in length of the relevant nucleic acid molecule 90%, or 95% identity to each other typically remain hybrid 45 and having at least one functional feature of the nucleic acid ized to each other. Such hybridization conditions are molecule (or the encoded protein has one functional feature described in, for example but not limited to, Current Protocols of the protein encoded by the nucleic acid molecule); or a in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1- fragment of a protein or a polypeptide containing at least 5, 6.3.6.; Basic Methods in Molecular Biology, Elsevier Science 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, Publishing Co., Inc., N.Y. (1986), pp. 75-78, and 84-87; and 50 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. 340,360,380, 400, 500, 600, 800, 1,000, 2,000, 3,000, 4,000, (1982), pp. 387-389, and are well known to those skilled in 5,000, 6,000, 7,000, 8,000, 9,000, 9,500 or more amino acid the art. A preferred, non-limiting example of stringent hybrid residues in length of the relevant protein or polypeptide and ization conditions is hybridization in 6x sodium chloride/ having at least one functional feature of the protein or sodium citrate (SSC), 0.5% SDS at about 68°C. followed by 55 polypeptide. one or more washes in 2xSSC, 0.5% SDS at room tempera As used herein, the term “analogue' (e.g., proteins, ture. Another preferred, non-limiting example of stringent polypeptides, peptides, and antibodies) refers to an agent that hybridization conditions is hybridization in 6xSSC at about possesses a similar or identical function as a second agent but 45° C. followed by one or more washes in 0.2xSSC, 0.1% does not necessarily comprise a similar or identical amino SDS at about 50° C. to 65° C. 60 acid sequence of the second agent, or possess a similar or An "isolated or “purified peptide or protein is substan identical structure of the second proteinaceous agent. In a tially free of cellular material or other contaminating proteins specific embodiment, antibody analogues immunospecifi from the cell or tissue source from which the protein is cally bind to the same epitope as the original antibodies from derived, or is substantially free of chemical precursors or which the analogues were derived. In an alternative embodi other chemicals when chemically synthesized. The language 65 ment, antibody analogues immunospecifically bind to differ “substantially free of cellular material includes preparations ent epitopes than the original antibodies from which the ana of a polypeptide?protein in which the polypeptide?protein is logues were derived. An agent that has a similar amino acid US 9,139,620 B2 7 8 sequence refers to a second agent that satisfies at least one of Res. 25:3389 3402. Alternatively, PSI BLAST can be used to the following: (a) an agent having an amino acid sequence perform an iterated search which detects distant relationships that is at least 30%, at least 35%, at least 40%, at least 45%, at between molecules (Id.). When utilizing BLAST, Gapped least 50%, at least 55%, at least 60%, at least 65%, at least BLAST, and PSI Blast programs, the default parameters of 70%, at least 75%, at least 80%, at least 85%, at least 90%, at the respective programs (e.g., of XBLAST and NBLAST) least 95% or at least 99% identical to the amino acid sequence can be used (see, e.g., the NCBI website). Another preferred, of a second agent; (b) an agent encoded by a nucleotide nonlimiting example of a mathematical algorithm utilized for sequence that hybridizes under Stringent conditions to a the comparison of sequences is the algorithm of Myers and nucleotide sequence encoding a second agent of at least 5 Miller, 1988, CABIOS 4:11 17. Such an algorithm is incor contiguous amino acid residues, at least 10 contiguous amino 10 porated in the ALIGN program (version 2.0) which is part of acid residues, at least 15 contiguous amino acid residues, at the GCG sequence alignment Software package. When utiliz least 20 contiguous amino acid residues, at least 25 contigu ing the ALIGN program for comparing amino acid ous amino acid residues, at least 40 contiguous amino acid sequences, a PAM120 weight residue table, a gap length residues, at least 50 contiguous amino acid residues, at least penalty of 12, and a gap penalty of 4 can be used. 60 contiguous amino residues, at least 70 contiguous amino 15 The percent identity between two sequences can be deter acid residues, at least 80 contiguous amino acid residues, at mined using techniques similar to those described above, least 90 contiguous amino acid residues, at least 100 contigu with or without allowing gaps. In calculating percent identity, ous amino acid residues, at least 125 contiguous amino acid typically only exact matches are counted. residues, or at least 150 contiguous amino acid residues; and As used herein, the term "derivative” (e.g., proteins, (c) an agent encoded by a nucleotide sequence that is at least polypeptides, peptides, and antibodies) refers to an agent that 30%, at least 35%, at least 40%, at least 45%, at least 50%, at comprises an amino acid sequence which has been altered by least 55%, at least 60%, at least 65%, at least 70%, at least the introduction of amino acid residue substitutions, dele 75%, at least 80%, at least 85%, at least 90%, at least 95% or tions, and/or additions. The term "derivative' as used herein at least 99% identical to the nucleotide sequence encoding a also refers to an agent which has been modified, i.e., by the second agent. An agent with similar structure to a second 25 covalent attachment of any type of molecule to the agent. For agent refers to an agent that has a similar secondary, tertiary example, but not by way of limitation, an antibody may be or, quaternary structure to the second agent. The structure of modified, e.g., by glycosylation, acetylation, pegylation, an agent can be determined by methods known to those phosphorylation, amidation, derivatization by known protect skilled in the art, including but not limited to, peptide ing/blocking groups, proteolytic cleavage, linkage to a cellu sequencing, X ray crystallography, nuclear magnetic reso 30 lar ligand or other protein, etc. A derivative of an agent may be nance, circular dichroism, and crystallographic electron produced by chemical modifications using techniques known microscopy. to those of skill in the art, including, but not limited to specific To determine the percent identity of two amino acid chemical cleavage, acetylation, formylation, metabolic Syn sequences or of two nucleic acid sequences, the sequences are thesis of tunicamycin, etc. Further, a derivative of an agent aligned for optimal comparison purposes (e.g., gaps can be 35 may contain one or more non-classical amino acids. A deriva introduced in the sequence of a first amino acid or nucleic acid tive of an agent possesses a similar oridentical function as the sequence for optimal alignment with a second amino acid or agent from which it was derived. nucleic acid sequence). The amino acid residues or nucle As used herein, the term “about' or “approximately' when otides at corresponding amino acid positions or nucleotide used in conjunction with a number refers to any number positions are then compared. When a position in the first 40 within 1, 5 or 10% of the referenced number. sequence is occupied by the same amino acid residue or As used herein, the term “effective amount in the context nucleotide as the corresponding position in the second of administering a therapy to a subject refers to the amount of sequence, then the molecules are identical at that position. a therapy which has a prophylactic and/or therapeutic The percent identity between the two sequences is a function effect(s). In certain embodiments, in the context of adminis of the number of identical positions shared by the sequences 45 tration of a therapy to a subject, “effective amount” refers to (i.e., '% identity number of identical overlapping positions/ the amount of a therapy which is Sufficient to achieve one, total number of positions x100%). In one embodiment, the two, three, four, or more of the following effects: (i) reduction two sequences are the same length. oramelioration in the severity of FmoPV infection, a FmoPV The determination of percent identity between two disease or symptom associated therewith; (ii) reduction in the sequences can also be accomplished using a mathematical 50 duration of FmoPV infection, a FmoPV disease or symptom algorithm. A preferred, nonlimiting example of a mathemati associated therewith; (iii) prevention of the progression of a cal algorithm utilized for the comparison of two sequences is FmoPV infection, a FmoPV disease or symptom associated the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. therewith; (iv) regression of a FmoPV infection, a FmoPV Sci. U.S.A. 87:2264 2268, modified as in Karlin and Altschul, disease or symptom associated therewith; (V) prevention of 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873 5877. Such an 55 the development or onset of a FmoPV infection, a FmoPV algorithm is incorporated into the NBLAST and XBLAST disease or symptom associated therewith; (vi) prevention of programs of Altschul et al., 1990, J. Mol. Biol. 215:403. the recurrence of a FmoPV infection, a FmoPV disease or BLAST nucleotide searches can be performed with the symptom associated therewith; (vii) reduction or prevention NBLAST nucleotide program parameters set, e.g., for of the spread of a FmoPV from one cell to another cell, one score=100, wordlength=12 to obtain nucleotide sequences 60 tissue to another tissue, or one organ to another organ; (viii) homologous to a nucleic acid molecules of the present inven prevention or reduction of the spread/transmission of a tion. BLAST protein searches can be performed with the FmoPV from one subject to another subject; (ix) reduction in XBLAST program parameters set, e.g., to score 50, organ failure associated with a FmoPV infection or FmoPV wordlength 3 to obtain amino acid sequences homologous to disease: (X) reduction in the hospitalization of a Subject; (xi) a protein molecule of the present invention. To obtain gapped 65 reduction in the hospitalization length; (xii) an increase in the alignments for comparison purposes, Gapped BLAST can be survival of a subject with a FmoPV infection or a disease utilized as described in Altschul et al., 1997, Nucleic Acids associated therewith; (xiii) elimination of a FmoPV infection US 9,139,620 B2 10 or a disease associated therewith; (xiv) inhibition or reduction As used herein, the term “host cell refers to any type of in FmoPV replication; (XV) inhibition or reduction in the cell, e.g., a primary cell or a cell from a cell line. In specific binding or fusion of FmoPV to a host cell(s); (xvi) inhibition embodiments, the term "host cell refers a cell transfected or reduction in the entry of an FmoPV into a host cell(s): with a nucleic acid molecule and the progeny or potential (xvii) inhibition or reduction of the replication of the FmoPV 5 progeny of Such a cell. Progeny of Such a cell may not be genome: (Xviii) inhibition or reduction in the synthesis of identical to the parent cell transfected with the nucleic acid FmoPV proteins; (xix) inhibition or reduction in the assembly molecule due to mutations or environmental influences that of FmoPV particles; (XX) inhibition or reduction in the release may occur in Succeeding generations or integration of the nucleic acid molecule into the host cell genome. of FmoPV particles from a host cell(s); (xxi) reduction in As used herein, the term “incombination' in the context of FmoPV titer; (xxii) reduction in the number of symptoms the administration of a therapy(ies) to a subject, refers to the associated with a FmoPVB infection or a FmoPV disease; use of more than one therapy. The use of the term “in combi (XXiii) enhancement, improvement, Supplementation, nation' does not restrict the order in which therapies are complementation, or augmentation of the prophylactic or administered to a Subject. A first therapy can be administered therapeutic effect(s) of another therapy; (xxiv) prevention of 15 prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, the onset or progression of a secondary infection associated 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, with a FmoPV infection; and/or (XXV) prevention of the onset 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 or diminution of disease severity of occurring secondary to weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly FmoPV infections. Exemplary doses of an effective amount with, or Subsequent to (e.g., 5 minutes, 15 minutes, 30 min are provided herein below. utes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, In certain embodiments, the effective amount of a therapy 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 does not result in complete protection from a FmoPV disease, weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks but results in a lower titer or reduced number of FmoPV after) the administration of a second therapy to a subject. compared to an untreated Subject. In certain embodiments, As used herein, the term “infection” means the invasion by, the effective amount of a therapy results in a 0.5 fold, 1 fold, 25 multiplication and/or presence of a virus in a cellora Subject. 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 25 fold, In one embodiment, an infection is an “active' infection, i.e., 50 fold, 75 fold, 100 fold, 125 fold, 150 fold, 175 fold, 200 one in which the virus is replicating in a cellora Subject. Such fold, 300 fold, 400 fold, 500 fold, 750 fold, or 1,000 fold or an infection is characterized by the spread of the virus to other greater reduction in titer of FmoPV relative to an untreated cells, tissues, and/or organs, from the cells, tissues, and/or subject. In certain embodiments, the effective amount of a 30 organs initially infected by the virus. An infection may also be therapy results in a reduction by 0.5 log, 1 log, 2 logs, 3 logs, a latent infection, i.e., one in which the virus is not replicating. 4 logs, 5, logs, 6, logs, 7 logs, or 10 logs or more in titer of In certain embodiments, an infection refers to the pathologi FmoPV relative to an untreated subject. Benefits of a reduc cal state resulting from the presence of the virus in a cell or a tioninthetiter, number or total burden of FmoPV include, but subject, or by the invasion of a cell or subject by the virus. are not limited to, less severe symptoms of the infection, 35 As used herein, the term “FmoPV disease' and phrases fewer symptoms of the infection, reduction in the length of referring to a disease associated with a FmopV infection refer the disease associated with the infection, and prevention of to the pathological state resulting from the presence of a the onset or diminution of disease severity of infection occur FmoPV in a cell or subject or the invasion of a cell or subject ring secondary to FmoPV infections. by a FmoPV. In specific embodiments, the term refers to a As used herein, the term “fragment in the context of a 40 kidney disease caused by a FmoPV. nucleic acid sequence refers to a nucleotide sequence com As used herein, the term "isolated in the context of nucleic prising at least 2 or at least 3 consecutive nucleotides from a acids refers to a nucleic acid molecule which is separated parent sequence. In a specific embodiment, the term refers to from other nucleic acid molecules which are present in the a nucleotide sequence of 2 to 30, 5 to 30, 10 to 60, 25 to 100, natural source of the nucleic acid molecule. Moreover, an 150 to 300 or more consecutive nucleotides from a parent 45 "isolated nucleic acid molecule, such as a cDNA molecule, sequence. In another embodiment, the term refers to a nucle can be substantially free of other cellular material, or culture otide sequence of at least 5, 10, 15, 20, 25, 30, 35, 40, 45,50, medium when produced by recombinant techniques, or Sub 55,60, 65,70, 75,80, 85,90,95, 100, 110, 125, 150, 175,200, stantially free of chemical precursors or other chemicals 250, 275,300, 325, 350, 375,400, 425, 450 or 475 consecu when chemically synthesized; however, “isolated excludes tive nucleotides of a parent sequence. 50 members of a library of clones such as a cDNA library. In a As used herein, the term “fragment” in the context of an specific embodiment, a nucleic acid described herein is iso amino acid sequence refers to an amino acid sequence com lated. In another specific embodiment, antibodies described prising at least 2 consecutive amino acid residues from a herein are isolated. The language “substantially free of other parent sequence. In a specific embodiment, the term refers to cellular material” includes preparations of a nucleic acid mol an amino acid sequence of 2 to 30, 5 to 30, 10 to 60, 25 to 100, 55 ecule in which the nucleic acid molecule is separated from 150 to 300 or more consecutive amino acid residues from a cellular components of the cells from which it is isolated or parent sequence. In another embodiment, the term refers to an recombinantly produced. Thus, a nucleic acid molecule that amino acid sequence of at least 5, 10, 15, 20, 25, 30, 35, 40, is substantially free of cellular material includes preparations 45, 50,55, 60, 65,70, 75, 80, 85,90, 95, 100, 110, 125, 150, having less than about 30%, 20%, 10%, or 5% (by dry weight) 175, 200, 250,275,300,325, 350,375,400, 425,450 or 475 60 of heterologous nucleic acid molecules or other cellular com consecutive amino acid residues of a parent sequence. ponents. When the nucleic acid molecule is recombinantly As used herein, the term "heterologous' refers to a unit that produced, it is also preferably substantially free of culture is not found naturally be associated with another unit. For medium, i.e., culture medium represents less than about 20%, example, a first nucleotide sequence is said be a heterologous 10%, or 5% of the volume of the nucleic acid molecule to a second nucleotide sequence if the two nucleotide 65 preparation. When the nucleic acid molecule is produced by sequences are not found in nature to be associated with each chemical synthesis, it is preferably substantially free of other. chemical precursors or other chemicals, i.e., it is separated US 9,139,620 B2 11 12 from chemical precursors or other chemicals which are As used herein, the terms “therapies” and “therapy” can involved in the synthesis of the nucleic acid molecule. refer to any protocol(s), method(s), compound(s), composi Accordingly such preparations of the nucleic acid molecule tion(s), formulation(s), and/or agent(s) that can be used in the have less than about 30%, 20%, 10%, 5% (by dry weight) of prevention or treatment of a viral infection or a disease or chemical precursors or compounds other than the nucleic acid 5 symptom associated therewith. In certain embodiments, the molecule of interest. terms “therapies” and “therapy” refer to biological therapy, As used herein, the phrase “multiplicity of infection” or Supportive therapy, and/or other therapies useful in treatment “MOI is the average number of virus per infected cell. The or prevention of a viral infection or a disease or symptom MOI is determined by dividing the number of virus added (ml associated therewith known to one of skill in the art. In some addedxplaque forming units (pfu)) by the number of cells 10 embodiments, the term “therapy refers to an immunogenic added (ml addedxcells/ml). composition (e.g., a FmoPV vaccine). As used herein, the terms “nucleic acid' and “nucleotides’ As used herein, the terms “treat,” “treatment, and “treat refer to deoxyribonucleotides, deoxyribonucleic acids, ribo ing in the context of the administration of a therapy(ies) to a nucleotides, and ribonucleic acids, and polymeric forms subject refer a beneficial or therapeutic effect resulting from thereof, and includes either single- or double-stranded forms. 15 the administration of a therapy or a combination of therapies. In certain embodiments, such terms include known analogues In specific embodiments, such terms refer to one, two, three, of natural nucleotides, for example, peptide nucleic acids four, five or more of the following effects resulting from the (“PNA's), that have similar binding properties as the refer administration of a therapy or a combination of therapies: (i) ence nucleic acid. In some embodiments, such terms refer to reduction or amelioration in the severity of a disease or a deoxyribonucleic acids (e.g., cDNA or DNA). In other symptom associated therewith; (ii) reduction in the duration embodiments, such terms refer to ribonucleic acids (e.g., of a disease or a symptom associated therewith; (iii) preven mRNA or RNA). tion of the progression of a disease or symptom associated As used herein, the terms “prevent,” “preventing and “pre therewith; (iv) regression of a disease or a symptom associ vention' in the context of the administration of a therapy(ies) ated therewith; (v) prevention of the development or onset of to a subject refer to a prophylactic effect that results from the 25 a disease or a symptom associated therewith; (vi) prevention administration of a therapy or a combination of therapies. In of the recurrence of a disease or a symptom associated there a specific embodiment, the terms “prevent,” “preventing and with; (vii) reduction or prevention of the spread of a pathogen “prevention' in the context of the administration of a from one cell to another cell, one tissue to another tissue, or therapy(ies) to a Subject to prevent a disease refer to one or one organ to another organ; (viii) prevention or reduction of more of the following effects resulting from the administra 30 the spread/transmission of a pathogen from one subject to tion of a therapy or a combination of therapies: (i) the inhi another Subject; (ix) reduction in organ failure associated bition or reduction in the development or onset of a disease or with a disease; (x) reduction in the hospitalization of a sub a symptom thereof; (ii) the inhibition or reduction in the ject; (xi) reduction in the hospitalization length; (xii) an recurrence of a disease or a symptom associated therewith: increase in the Survival of a Subject with a disease associated and (iii) the reduction or inhibition in a pathogen infection 35 therewith; (xiii) elimination of a disease; (xiv) inhibition or and/or replication. In other specific embodiment, the terms reduction in pathogen replication; (XV) reduction in pathogen “prevent,” “preventing and “prevention” in the context of the numbers; (XV) the reduction in the number of symptoms asso administration of a therapy(ies) to a Subject to prevent a ciated with a disease; and (Xvi) enhancement, improvement, FmoPV disease refer to one or more of the following effects Supplementation, complementation, or augmentation of the resulting from the administration of a therapy or a combina 40 prophylactic or therapeutic effect(s) of another therapy. tion of therapies: (i) the inhibition or reduction in the devel As used herein, in some embodiments, the term “wild opment or onset of a FmoPV disease or a symptom thereof; type' in the context of a virus refers to the types of viruses that (ii) the inhibition or reduction in the recurrence of a FmoPV are prevalent, circulating and naturally producing typical out disease or a symptom associated therewith; and (iii) the breaks of disease. reduction or inhibition in FmoPV infection and/or replica 45 tion. 4. BRIEF DESCRIPTION OF THE DRAWINGS In another specific embodiment, the terms “prevent”, “pre venting and “prevention' in the context of the administration FIG. 1 shows the genome organization of FmoPV and other of a therapy(ies) to a subject to prevent a FmoPV infection morbilliviruses. The genes are shown as boxes that are drawn refer to one or more of the following effects resulting from the 50 to scale. For the P gene, the first line above the box labeled “P” administration of a therapy or a combination of therapies: (i) with the letter V at the end of the line represents the region of the reduction or inhibition of the spread of FmoPV from one V CDS and the second line with the letter C at the end of the cell to another cell; (ii) the reduction or inhibition of the line represents the CCDS. spread of FmoPV from one organ or tissue to another organ or FIGS. 2-1 to 2-10 indicate the 16050 bp nucleotide tissue; and/or (iii) the reduction or inhibition of the spread of 55 sequence of FmoPV 761U Cats/Hong Kong/2009 (SEQ ID FmoPV from one region of an organ or tissue to another NO: 1). region of the organ or tissue (e.g., the reduction in the spread FIGS. 3-1 to 3-10 indicate the 16050 bp nucleotide of FmoPV from the upper to the lower respiratory tract). sequence of FmoPV 776U Cats/Hong Kong/2009 (SEQ ID As used herein, the terms “subject' and “patient” are used NO: 2). interchangeably to refer to an animal (e.g., cats, dogs, birds, 60 FIGS. 4-1 to 4-10 indicate the 16050 bp nucleotide reptiles, and mammals). In a specific embodiment, a Subject is sequence of FmoPVM252A Cats/Hong Kong/2009 (SEQID a cat. In another embodiment, a Subject is a mammal includ NO:3). ing a non-primate (e.g., a camel, donkey, Zebra, cow, pig, FIG. 5 Multiple alignments of N proteins of FmoPV and horse, goat, sheep, cat, dog, rat, and mouse) and a primate other morbilliviruses (SEQID NOS 9, 7-8 and 21-26, respec (e.g., a monkey, chimpanzee, and a human). In another 65 tively, in order of appearance). The conserved MA(S.T)L embodiment, a Subject is a non-human mammal. In another motif in morbilliviruses and the three conserved motifs in embodiment, a Subject is a human. paramyxoviruses are marked in open boxes with Solid line US 9,139,620 B2 13 14 border and reported consensus sequences (SEQ ID NOS FIGS. 11A-B present representative images of cauxin-im 27-28, respectively, in order of appearance) are indicated munohistochemical stained paraffin-embedded renal sec above the alignment (where X represents any amino acid tions of cats without and with histological evidence of TIN in residue and 0 represents an aromatic amino acid residue). Panels A and B, respectively. Amino acid residue numbers for each protein are shown to the FIGS. 12A-C show double staining of the lymph node of an right of each sequence. Dots indicate identical residues and FmoPV infected stray cat for(A) mouse anti-human myeloid/ dashes indicate gaps. The NES are in open boxes with dotted histocyte antigen and then labeled with Texas-red conjugated line border and the NLS in open box with dashed line border. goat anti-mouse IgG; (B) guinea pig antiserum against the N FIGS. 6A-D indicate four panels. Panel A shows the cyto protein of FmoPV, followed by FITC conjugated rabbit anti pathic effects of FmoPV on CRFK cells. The open squares 10 guinea pig IgG, (C) the merged photo showed that both anti gens co-localized in cytoplasm of the cells. show the formation of giant cells. Panels B and C, show FIG. 13 shows the N protein polypeptide comprising the indirect immunofluorescent antigen detection in uninfected sequence of 776U, M252A, and 761 U. which is used as an and infected CRFK cells using serum from guinea pig immu antigenic peptide. nized with recombinant N protein of FmoPV. showing spe 15 cific apple green cytoplasmic fluorescence in FmoPV 5. DETAILED DESCRIPTION OF THE infected CRFK cells. Panel D is an electron microscopic INVENTION examination of infected CRFK cell culture supernatant show ing enveloped virus with burst envelope and typical “herring 5.1 Nucleic Acids bone' appearance of helical N in paramyxoviruses. FIGS. 7A-F are phylogenetic analyses of the N. P. M. F. A In one aspect, provided herein are nucleic acid sequences and L amino acid sequences of FmoPV. The trees were con comprising or consisting of a wild-type or a modified feline structed by maximum likelihood method with bootstrap val morbilli virus (“FmoPV). Also provided are modified ues calculated from 1000 trees and rooted on midpoint. The FmoPV gene segment (genomic RNA) or the complement scale bars indicate the branch length that corresponds to 0.5 25 thereof (antigenomic RNA). substitutions per site. Three strains from FmoPV were named In one aspect, described herein is the entire nucleotide as 761U, 776U, M252A. Names and accession numbers of sequence of the FmoPV. In certain embodiments, the nucle the other viruses are listed in Table 3. otide sequences are Genbank accession numbers: JO41 1014, FIG. 8 is a phylogenetic analysis of amino acid sequences JQ411015 and JQ411016. The JQ411014 nucleotide of 72-bp fragment of L gene of paramyxoviruses identified 30 sequence is shown in FIG. 2, labeled as FmoPV 761U Cats/ from cats in the present study. The tree was constructed by Hong Kong/2009. The JQ41 1015 nucleotide sequence is neighbor-joining method. The scale bar indicates the branch shown in FIG. 3, labeled as FnoPV 776U Cats/Hong Kong/ length that corresponds to 2 amino acid differences per 2009. The JO411016 nucleotide sequence is shown in FIG.4, sequence. The three strains from stray cats numbered 761 U. labeled as FmoPV M252A Cats/Hong Kong/2009. 776U and M252A with genome sequences determined are 35 In other aspects, described herein are a complement, ana shown in bold. RSV, respiratory syncitial virus (U39661); log, derivative, or fragment thereof, or a portion of the DmoPV. Dolphin morbillivirus (NC 005283); PprPV, Peste FmoPV nucleotide sequence. In certain embodiments, des-petits ruminants virus (NC 006383); MeaPV. Measles described herein are nucleic acid molecules that hybridizes to virus (NC 001498); CdiPV, Canine distemper virus (NC any portion of the genome of the FmoPV, under stringent 001921); MosPV. Mossman virus (NC 005339): NarPV, 40 conditions. In specific embodiment, described herein are Nariva virus (FJ362497); ThkPV3, Tuhoko virus 3 nucleic acid molecules which are Suitable for use as primers (GU128082); ThkPV2, Tuhoko virus 2 (GU128081); ThkPV, consisting of or comprising the nucleic acid sequence of the Tuhoko virus 1 (GU128080); JPV. J-virus (NC 007454): FmoPV. In another embodiment, described herein are nucleic BeiPV. Beilong virus (NC 007803): NipPV. Nipah virus acid molecules that are suitable for use as hybridization (NC 002728); HenPV, Hendra virus (NC 001906); Fd1PV, 45 probes for the detection of FmoPV. The primers and probes Fer-de-lance virus (NC 005084); SenPV. Sendai virus are contained in a kit for the detection of nucleic acid mol (NC 001552); HpiPV-1, Human parainfluenza virus 1 ecules or proteins from wild-type, natural or artificial vari (NC 003461). ants, analogs, or derivatives of FmoPV. FIG. 9 shows a Western blot analysis with stray cat sera Described herein is a natural variant of FmoPV having a against the purified (His)-tagged (“(His)6” disclosed as SEQ 50 sequence that is different from the genomic sequence of Gen ID NO: 10) recombinant FmoPV N protein antigen. Results bank accession numbers: JO411014, JQ41 1015 and of RT-PCR of the corresponding urine samples for FmoPV JQ411016 due to one or more naturally occurred mutations, are also shown. including, but not limited to, point mutations, rearrange FIGS. 10A-F indicate six panels. Panels A and B show ments, insertions, deletions, etc., to the genomic sequence histological section of kidneys stained by H & E from a stray 55 that may or may not result in a phenotypic change. Preferably, cat with FmoPV detected in urine and a normal cat, showing the variants include 1-5, 6-10, 11-10, 20-40, 40-60, 60-100, aggregates of inflammatory cells in the interstitium and renal 100-500, 500-1000, 1000-2000 nucleic acid changes in the tubular degeneration in the infected cat. Panels C and D show genome. In certain embodiments, the mutation of the immunohistochemical staining of kidney sections of a stray genomic sequence of the FmoPV resulted in rearrangements, cat with FmoPV detected in urine using guinea pig serum 60 insertions, and/or deletions relative to the wild-type genomic positive for anti-FmoPV N protein antibody and preimmune sequence of FmoPV. guinea pig serum, showing positive renal tubular cells. Panels In certain embodiments, a nucleic acid sequence described E and F show immunohistochemical staining of lymph node herein is part of or incorporated into a vector. In a specific sections of a stray cat positive for FmoPV using guinea pig embodiment, a nucleic acid sequence described herein is part serum positive for anti-FmoPV N protein antibody and pre 65 of or incorporated into a vector that facilitates the production immune guinea pig serum, showing positive mononuclear of a modified FmoPV gene segment or the complement cells. thereof. In one embodiment, a nucleic acid sequence US 9,139,620 B2 15 16 described herein is part of or incorporated into the pl)Zvector 5.2 Proteins (see, e.g., Quinlivan et al., 2005, J. of Virology 79: 8431-8439 for information relating to the pl)Z vector). In another The open reading frames of FmoPV gene segments can be embodiment, a nucleic acid sequence described herein is part determined using standard molecular biology and Virology of or incorporated into the pHW2000 vector (see, e.g., Hoff techniques. Provided herein are FmoPV polypeptides mann et al., 2000, Proc Natl AcadSci USA. 97(11):6108-13 expressed by the FmoPV nucleic acid molecule comprising for information relating to the pHW2000 vector). In another the FmoPV nucleic acid sequences. In certain embodiments, embodiment, a nucleic acid sequence described herein is part the FmoPV proteins are. In certain embodiments, FmoPV of or incorporated into the pAD3000 vector (see, e.g., Hoff antigens are fragments or full length N. P/V/C(P), P/V/C/(V), mann et al., 2000, Proc Natl AcadSci USA. 97(11):6108-13 10 P/VC(C), M. F., H and L proteins. Also described herein are for information relating to the p AD3000 vector). In another recombinant or chimeric viruses encoded by viral vectors embodiment, a nucleic acid sequence described herein is part derived from the genome of FmoPV or natural variants of or incorporated into the p AD4000 vector (see, e.g., Wang thereof. et al., 2007, J. of Virology 4: 102 for information relating to In another specific embodiment, described herein is a chi the p AD4000 vector). In one embodiment, a nucleic acid 15 meric FmoPV virus which further comprises a heterologous sequence described herein is part of or incorporated into the nucleotide sequence. In certain embodiments, a chimeric vector in Section 6 infra. virus may be encoded by a nucleotide sequence in which Techniques for the production or use of the nucleic acids heterologous nucleotide sequences have been added to the will employ, unless otherwise indicated, routine conventional genome or in which endogenous or native nucleotide techniques of molecular biology and recombinant DNA sequences have been replaced with heterologous nucleotide manipulation and production. Any cloning technique known Sequences. to the skilled artisan can be used to assemble the nucleic acids In certain embodiments, the chimeric viruses are encoded described herein and to mutate nucleotides where necessary. by the vectors which further comprise a heterologous nucle Such techniques are well-known and are available to the otide sequence. In accordance with the present invention a skilled artisan in laboratory manuals such as Sambrook and 25 chimeric virus is encoded by a viral vector that may or may Russell, Molecular Cloning: A Laboratory Manual, 3' edi not include nucleic acids that are non-native to the viral tion, Cold Spring Harbor Laboratory Press, Cold Spring Har genome. In accordance with the invention a chimeric virus is bor, N.Y. (2001). In particular, polymerase chain reaction, encoded by a viral vector to which heterologous nucleotide restriction enzymes, ligase enzyme, mutagenic primers, and sequences have been added, inserted or substituted for native amplification of nucleic acid fragments in vectors can be used 30 or non-native sequences. In accordance with the present to generate the individual elements of the nucleic acids invention, the chimeric virus may be encoded by nucleotide described herein and then to assemble them. sequences derived from different strains or variants of In some embodiments, a nucleic acid sequence described FmoPV. In particular, the chimeric virus is encoded by nucle herein is introduced (e.g., transfected) into a Substrate. Such otide sequences that encode antigenic polypeptides derived as a host cell or an embryonated egg. Thus, in some embodi 35 from different strains or variants of FmoPV. ments, provided herein is a Substrate (e.g., host cells or eggs) Achimeric virus may be of particular use for the generation comprising a nucleic acid sequence described herein. In other of recombinant vaccines protecting against two or more embodiments, a nucleic acid sequence described herein that is viruses (Tao et al., J. Virol. 72:2955-2961: Durbinet al., 2000, part of or incorporated into a vector is introduced (e.g., trans J. Virol. 74:6821-6831; Skiadopoulos et al., 1998, J. Virol. fected) into a substrate, such as a host cellor an embryonated 40 72: 1762-1768: Tenget al., 2000, J. Virol. 74.9317-9321). For egg. Thus, in some embodiments, provided herein is a Sub example, it can be envisaged that a vector expressing one or strate (e.g., host cells or eggs) comprising a nucleic acid more proteins of FmoPV and FmoPV variants, will protect a sequence described herein that is part of or incorporated into Subject vaccinated with Such vector against infections by both a vector. In certain embodiments, provided herein is a cell line the FmoPV and FmoPV variant. Attenuated and replication that is transformed with the vector containing FmoPV nucleic 45 defective viruses may be of use for vaccination purposes with acid sequences. In certain embodiments, provided herein is a live vaccines. transgenic animal containing a vector comprising FmoPV In accordance with the present invention the heterologous nucleic acid sequences. sequence to be incorporated into the viral vectors encoding In certain embodiments, the FmoPV nucleic acid is used in the recombinant or chimeric viruses of the invention include a diagnostic assay for the FmoPV infection. In particular, the 50 sequences obtained or derived from different strains or vari diagnostic assay is a quantitative assay for the detection of the ants of the FmoRV. FmoPV. natural or artificial variants, analogs, or derivatives In certain embodiments, the chimeric or recombinant thereof. In certain embodiments, the quantitative assay is viruses of the invention are encoded by viral vectors derived PCR or RT-PCR. In certain embodiments, the FmoPV nucleic from viral genomes wherein one or more sequences, inter acid is in separate containers in a diagnostic kit. In specific 55 genic regions, termini sequences, or portions or entire ORF embodiments, the nucleic acid that encodes a portion or frag have been substituted with a heterologous or non-native ment of any gene of FmoPV. natural or artificial variants, sequence. In certain embodiments of the invention, the chi analogs, or derivatives thereof, can be used as a target for meric viruses of the invention are encoded by viral vectors diagnostic purpose. In a specific embodiment, the nucleic derived from viral genomes wherein one or more heterolo acid that encodes the L gene of FmoPV is used as target for 60 gous sequences have been inserted or added to the vector. diagnosis. In one specific embodiment, diagnosis is made by Any nucleotide sequence heterologous to FmoPV may be amplifying a 172 bp L gene fragment from a cDNA template included in a modified FmoPV gene segment described using quantitative PCR system. In a specific embodiment, the herein. In certain embodiments, the heterologous nucleotide primers (LPW 124905'-CAGAGACTTAATGAAATT sequence is 8 to 100 nucleotides in length, 15 to 100 nucle TATGG-3'; LPW124915'-CCACCCATCGGGTACTT-3' 65 otides in length, 25 to 100 nucleotides in length, 50 to 200 (SEQID NO: 12)) are used. Sequences of target fragments are nucleotide in length, 50 to 400 nucleotide in length, 200 to shown in FIG. 13. 500 nucleotide in length, or 400 to 600 nucleotides in length, US 9,139,620 B2 17 18 500 to 800 nucleotide in length. In other embodiments, the and bacterial antigens, tumor antigens, allergen antigens, and heterologous nucleotide sequence is 750 to 900 nucleotides in auto antigens involved in autoimmune disorders. In particu length, 800 to 100 nucleotides in length, 850 to 1000 nucle lar, the chimeric virions of the present invention may be otides in length, 900 to 1200 nucleotides in length, 1000 to engineered to create vaccines for the protection of a subject 1200 nucleotides in length, 1000 to 1500 nucleotides or 10 to from infections with the FmoPV, natural or artificial variants, 1500 nucleotides in length. In some embodiments, the heter analogs, or derivatives thereof. ologous nucleotide encodes a peptide or polypeptide that is 5 In another aspect, the mutation of the genomic sequence of to 10 amino acids in length, 10 to 25 amino acids in length, 25 the FmoPV resulted in changes in the FmoPV proteins. In to 50 amino acids in length, 50 to 100 amino acids in length, certain embodiments, the mutation of the genomic sequence 100 to 150 amino acids in length, 150 to 200 amino acids in 10 of the FmoPV resulted in less than 25, 20, 15, 10, 5, 4, 3, or 2 length, 200 to 250 amino acids in length; 250 to 300 amino amino acid substitutions in the FmoPV proteins. acids in length, 300 to 400 amino acids in length, or 500 or Either conservative or non-conservative amino acid Substi more amino acids in length. In some embodiments, the het tutions can be made at one or more amino acid residues. In erologous nucleotide encodes a polypeptide that does not preferred embodiments, the variants have conservative amino exceed 500 amino acids in length. In specific embodiments 15 acid substitutions that are made at one or more predicted the heterologous nucleotide sequence does not contain a stop non-essential amino acid residues (i.e., amino acid residues codon. In certain embodiments, the heterologous nucleotide which are not critical for the expression of the biological sequence is codon-optimized. Techniques for codon optimi activities of the virus, e.g., infectivity, replicability, protein Zation are known in the art and can be applied to codon synthesis ability, assembling ability, and cytotoxic effect). In optimize a heterologous nucleotide sequence. other embodiments, the variants have non-conservative In one embodiment, a heterologous nucleotide sequence amino acid Substitutions that are made at one or more pre encodes an antigen of any infectious pathogen or an antigen dicted non-essential amino acid residues (i.e., amino acid associated with any disease that is capable of eliciting an residues which are not critical for the biological activities of immune response. In a specific embodiment, the antigen is a the virus, e.g., infectivity, replicationability, protein synthesis glycoprotein. In certain embodiments, a heterologous nucle 25 ability, assembling ability, and cytotoxic effect). In other otide sequence encodes a viral antigen. In other embodi embodiments, the amino acid Substitutions are made at essen ments, the viral antigen is an antigen from a virus other than tial amino acid residues (i.e., amino acid residues which are a FnoPV. critical for the biological activities of the virus, e.g., infectiv In specific embodiments, a FmoPV described herein is ity, replicability, protein synthesis ability, assembling ability, attenuated. In a particular embodiment, the FmoPV is attenu 30 and cytotoxic effect). ated Such that the virus remains, at least partially, infectious A “conservative amino acid substitution' is one in which and can replicate in vivo, but only generate low titers resulting the amino acid residue is replaced with an amino acid residue in Subclinical levels of infection that are non-pathogenic. having a side chain with a similar charge. A “non-conserva Such attenuated viruses are especially suited for embodi tive amino acid substitution' is one in which the amino acid ments described herein wherein the virus or an immunogenic 35 residue is replaced with an amino acid residue having a side composition thereof is administered to a Subject to induce an chain with an opposite charge. Families of amino acid resi immune response. dues having side chains with similar charges have been In some embodiments, a FmoPV described herein com defined in the art. Genetically encoded amino acids are can be prises one or more attenuating mutations in a modified divided into four families: (1) acidic aspartate, glutamate; FmoPV gene segment. In some embodiments, a FmoPV 40 (2) basic-lysine, arginine, histidine; (3) nonpolar alanine, described herein comprises one or more attenuating muta Valine, leucine, isoleucine, proline, phenylalanine, methion tions in a complementing FmoPV gene segment. In certain ine, tryptophan; and (4) uncharged polar glycine, aspar embodiments, a FmoPV described herein comprises one or agine, glutamine, cysteine, serine, threonine, tyrosine. In more attenuating mutations in two, three or more comple similar fashion, the amino acid repertoire can be grouped as menting FmoPV gene segments. In some embodiments, a 45 (1) acidic aspartate, glutamate; (2) basic lysine, arginine FmoPV described herein comprises one or more attenuating histidine, (3) aliphatic glycine, alanine, Valine, leucine, iso mutations in a modified FmoPV gene segment and one or leucine, serine, threonine, with serine and threonine option more attenuating mutations in a complementing FmoPV gene ally be grouped separately as aliphatic-hydroxyl; (4) Segment. aromatic phenylalanine, tyrosine, tryptophan; (5) The selection of the viral vector may depend on the species 50 amide-asparagine, glutamine; and (6) sulfur of the subject that is to be treated or protected from a viral containing cysteine and methionine. (See, for example, Bio infection. If the subject is a feline, then an attenuated FmoPV chemistry, 4th ed., Ed. by L. Stryer, WH Freeman and Co.: can be used to provide the antigenic sequences. 1995). In accordance with the present invention, the viral vectors The invention further relates to mutant FmoPV peptides. In can be engineered to provide antigenic sequences which con 55 one embodiment, mutations can be introduced randomly fer protection against infection by the FmoPV, natural or along all or part of the coding sequence of the FmoPV or artificial variants, analogs, or derivatives thereof. The viral variants thereof. Such as by Saturation mutagenesis, and the vectors may be engineered to provide one, two, three or more resultant mutants can be screened for biological activity to antigenic sequences. In accordance with the present invention identify mutants that retain activity. Techniques for mutagen the antigenic sequences may be derived from the same virus, 60 esis known in the art can also be used, including but not from different strains or variants of the same type of virus, or limited to, point-directed mutagenesis, chemical mutagen from different viruses. esis, in vitro site-directed mutagenesis, using, for example, The expression products and/or recombinant or chimeric the QuikChange Site-Directed Mutagenesis Kit (Stratagene), virions obtained in accordance with the invention may advan etc. Non-limiting examples of Such modifications include tageously be utilized in vaccine formulations. The expression 65 Substitutions of amino acids to cysteines toward the formation products and chimeric virions of may be engineered to create of disulfide bonds; substitution of amino acids to tyrosine and vaccines against a broad range of pathogens, including viral Subsequent chemical treatment of the polypeptide toward the US 9,139,620 B2 19 20 formation of dityrosine bonds, as disclosed in detail herein; A549 cells, MDBK cells, etc. Such methods are well-known one or more amino acid Substitutions and/or biological or to those skilled in the art. In a specific embodiment, the chemical modification toward generating a binding pocket for FmoPV described herein may be propagated in cell lines. In a small molecule (substrate or inhibitor), and/or the introduc another embodiment, the FmoPV described herein described tion of side-chain specific tags (e.g., to characterize molecular 5 herein are propagated in chicken cells or embryonated eggs. interactions or to capture protein-protein interaction part Representative chicken cells include, but are not limited to, ners). In a specific embodiment, the biological modification chicken embryo fibroblasts and chicken embryo kidney cells. comprises alkylation, phosphorylation, Sulfation, oxidation For virus isolation, the FmoPV described herein can be or reduction, ADP-ribosylation, hydroxylation, glycosyla removed from cell culture and separated from cellular com tion, glucosylphosphatidylinositol addition, ubiquitination. 10 ponents, typically by well known clarification procedures, In another specific embodiment, the chemical modification e.g., Such as gradient centrifugation and column chromatog comprises altering the charge of the recombinant virus. In yet raphy, and may be further purified as desired using proce another embodiment, a positive or negative charge is chemi dures well known to those skilled in the art, e.g., plaque cally added to an amino acid residue where a charged amino assayS. acid residue is modified to an uncharged residue. 15 5.3 Construction of Recombinant FmoPV 5.5 Compositions & Routes of Administration Techniques known to one skilled in the art may be used to The FmoPV described herein may be incorporated into produce a recombinant FmoPV containing a modified compositions. In a specific embodiment, the compositions are FmoPV gene segment described herein. For example, reverse pharmaceutical compositions, such as immunogenic compo genetics techniques may be used to generate such a FmoPV. sitions (e.g., vaccine formulations). The pharmaceutical com Briefly, reverse genetics techniques generally involve the positions provided herein can be in any form that allows for preparation of synthetic recombinant viral RNAs that contain the composition to be administered to a Subject. In a specific the non-coding regions of the negative-strand, viral RNA 25 embodiment, the pharmaceutical compositions are Suitable which are essential for the recognition by viral polymerases for Veterinary and/or human administration. The composi and for packaging signals necessary to generate a mature tions may be used in methods of preventing and/or treating an virion. The recombinant RNAs are synthesized from a recom FmoPV infection. The compositions may also be used in binant DNA template and reconstituted in vitro with purified methods or preventing and/or treating FmoPV disease. The viral polymerase complex to form recombinant ribonucle 30 composition may be used in methods of eliciting an immune oproteins (RNPs) which can be used to transfect cells. A more response to a particular antigenCS) or in methods of delivering efficient transfection is achieved if the viral polymerase pro a certain protein to a subject. teins are present during transcription of the synthetic RNAs In one embodiment, a pharmaceutical composition com either invitro or in vivo. The synthetic recombinant RNPs can prises a FmoPV in an admixture with a pharmaceutically be rescued into infectious virus particles. 35 acceptable carrier. In some embodiments, a pharmaceutical Alternatively, helper-free plasmid technology may be used composition may comprise one or more other therapies in to produce a recombinant FmoPV containing a modified addition to a FmoPV. In specific embodiments, a FmoPV FmoPV gene segment. Briefly, full length cDNAs of viral described herein that is incorporated into a pharmaceutical segments are amplified using PCR with primers that include composition (e.g., an immunogenic composition Such as a unique restriction sites, which allow the insertion of the PCR 40 vaccine) is a live virus. An immunogenic composition com product into the plasmid vector. The plasmid vector is prising a live FmoPV for administration to a subject may be designed so that an exact negative (VRNA sense) transcript is preferred because multiplication of the virus in the subject expressed. For example, the plasmid vector may be designed may lead to a prolonged stimulus of similar kind and magni to position the PCR product between a truncated human RNA tude to that occurring in natural infections, and therefore, polymerase I promoter and a hepatitis delta virus ribozyme 45 confer Substantial, long lasting immunity. sequence such that an exact negative (VRNA sense) transcript In some embodiments, a FmoPV described herein that is is produced from the polymerase I promoter. Separate plas incorporated into a pharmaceutical composition (e.g., an mid vectors comprising each viral segment as well as expres immunogenic composition Such as a vaccine) is inactivated. sion vectors comprising necessary viral proteins may be Techniques known to one of skill in the art may be used to transfected into cells leading to production of recombinant 50 inactivate FmoPV described herein. viral particles. In another example, plasmid vectors from In specific embodiments, immunogenic compositions which both the viral genomic RNA and mRNA encoding the described herein are monovalent formulations. In other necessary viral proteins are expressed may be used. embodiments, immunogenic compositions described herein are multivalent formulations. 5.4. Propagation of FmoPV 55 As used herein, the term “pharmaceutically acceptable' means approved by a regulatory agency of the Federal or a The FmoPV described herein can be propagated in any state government or listed in the U.S. Pharmacopeia or other substrate that allows the virus to grow to titers that permit the generally recognized pharmacopeiae for use in animals, and uses of the viruses described herein. In one embodiment, the more particularly in humans. The term “carrier refers to a substrate allows the FmoPV described herein to grow to titers 60 diluent, adjuvant, excipient, or vehicle with which the phar comparable to those determined for the corresponding wild maceutical composition is administered. Saline solutions and type viruses. aqueous dextrose and glycerol Solutions can also be The FmoPV described herein may be grown in host cells employed as liquid carriers, particularly for injectable solu (e.g., cat, avian cells, chicken cells, etc.) that are susceptible tions. Suitable excipients include starch, glucose, lactose, to infection by the viruses, embryonated eggs or animals (e.g., 65 Sucrose, gelatin, malt, rice, flour, chalk, silica gel, Sodium birds). Specific examples of host cells include Vero cells, Stearate, glycerol monostearate, talc, Sodium chloride, dried MDCK cells, MBCK cells, COS cells, 293 cells, 293T cells, skim milk, glycerol, propylene, glycol, water, ethanol and the US 9,139,620 B2 21 22 like. Examples of Suitable pharmaceutical carriers are (P<0.0001). See FIG.9 and see Table 6 below. Among tested described in “Remington’s Pharmaceutical Sciences” by E. sera from the 56 cats that were RT-PCR positive for FmoPV. W. Martin. only 5 (8.9%) were positive for IgM against N protein of In certain embodiments, biodegradable polymers, such as FmOPV. ethylene vinyl acetate, polyanhydrides, polyethylene glycol 5 In one embodiment, a sequence for use as an antigenic (PEGylation), polymethyl methacrylate polymers, polylac peptide is the N protein polypeptide comprising the sequence tides, poly(lactide-co-glycolides), polyglycolic acid, col of 776U, M252A, and 761U as shown in FIG. 13. The anti lagen, polyorthoesters, and polylactic acid, may be used as genic polypeptide is used to detect the presence of FmoPV in carriers. Liposomes or micelles can also be used as pharma a sample. ceutically acceptable carriers. These can be prepared accord 10 In FIG.9, a Western blot analysis with stray cat sera against ing to methods known to those skilled in the art, for example, the purified (His)-tagged (“(His)6” disclosed as SEQID NO: as described in U.S. Pat. No. 4,522,811. 10) recombinant FmoPV N protein antigen, prominent In a specific embodiment, pharmaceutical compositions immunoreactive protein bands of about 69 kDa, consistent are formulated to be suitable for the intended route of admin with the expected size of 68.7kDa of the recombinant protein, istration to a subject. For example, the pharmaceutical com 15 were detected in three of the six cat serum samples shown, position may beformulated to be suitable for parenteral, oral, indicating antigen-antibody interactions between the recom intradermal, intranasal, transdermal, pulmonary, colorectal, binant FmoPV N protein and serum antibodies. Results of intraperitoneal, and rectal administration. In a specific RT-PCR of the corresponding urine samples for FmoPV are embodiment, the pharmaceutical composition may beformu also shown. Table 6 shows the FmoPV viral load and antibody lated for intravenous, oral, intraperitoneal, intranasal, level of RT-PCR positive stray cats in this study. intratracheal, Subcutaneous, intramuscular, topical, intrader mal, transdermal or pulmonary administration. TABLE 6 In certain embodiments, the compositions described herein comprise, or are administered in combination with, an adju FoPW vant. The adjuvant for administration in combination with a 25 Cat Date of sample Type of positive Viral load Western composition described herein may be administered before, no. collection sample(s) (copies/ml) blot concomitantly with, or after administration of the composi 543 14 May 2009 Orine 1.4 x 10' -- tion. In specific embodiments, an inactivated virus immuno 545 14 May 2009 Faecal Swab 3.8 x 10 genic composition described herein comprises one or more SS7 12 Jun. 2009 Orine 9.5 x 102 -- adjuvants. In some embodiments, the term “adjuvant” refers 30 572 24 Jun. 2009 Orine 1.2 x 10 -- S87 O2J. 2009 Orine 4.88 ---- to a compound that when administered in conjunction with or 591 O8.J. 2009 Orine 2.7 x 10' ------as part of a composition described herein augments, enhances 592 O8.J. 2009 Orine 3.0 x 10 ------and/or boosts the immune response to a FmoPV virus, but 670 27 Aug. 2009 Orine 2.7 x 10 -- when the compound is administered alone does not generate 680 31 Aug. 2009 Orine 8.8 x 10 ------35 688 03 Sep. 2009 Orine 7.1 x 10 ------an immune response to the virus. In some embodiments, the 725 O3 Nov. 2009 Faecal Swab 2.7 x 10 ---- adjuvant generates an immune response to a FmoPV and does 761 24 Nov. 2009 Orine 5.9 x 10 ------not produce an allergy or other adverse reaction. Adjuvants 773 O1 Dec. 2009 Orine 6.4 x 10' -- can enhance an immune response by several mechanisms 776 O4 Dec. 2009 Orine 2.3 x 10 ------including, e.g., lymphocyte recruitment, stimulation of B 8O2 24 Dec. 2009 Orine 2.76 810 29 Dec. 2009 Orine 1.6 x 10° 40 and/or T cells, and stimulation of macrophages. 818, 12 Jan 2010 Orine 1.06 Specific examples of adjuvants include, but are not limited 835 22 Jan 2010 Orine 2.4 x 10 -- to, aluminum salts (alum) (Such as aluminum hydroxide, 850 29 Jan 2010 Orine 2.1 x 10 ---- 851 29 Jan 2010 Orine 2.6 ---- aluminum phosphate, and aluminum sulfate), 3 De-O-acy Faecal Swab 5.0 x 10? lated monophosphoryl lipid A (MPL) (see GB 2220211) and 858 26 Feb. 2010 Orine 6.9 x 10 -- QS21 (see Kensil et al., in Vaccine Design: The Subunit and 45 898 23 Mar. 2010 Orine 2.4 x 10 -- Adjuvant Approach (eds. Powell & Newman, Plenum Press, 900 23 Mar. 2010 Orine 1.6 x 10' -- 906 23 Mar. 2010 Orine 9.8 x 10 ---- NY, 1995); U.S. Pat. No. 5,057,540). In some embodiments, Faecal Swab 2.0 x 10 the adjuvant is Freund's adjuvant (complete or incomplete). 908 25 Mar. 2010 Orine 8.8 x 102 Other adjuvants are oil in water emulsions (such as squalene 909 25 Mar. 2010 Orine 2.6 x 10 or peanut oil), optionally in combination with immune stimu 50 938 29 Apr. 2010 Orine 2.1 x 102 ---- 962 06 May 2010 Orine 8.0 x 10 ------lants, such as monophosphoryl lipid A (see Stoute et al., N. 968 10 May 2010 Orine 4.7 x 102 ------Engl. J. Med. 336, 86-91 (1997)). Another adjuvant is CpG 970 10 May 2010 Blood 3.1 x 10' ------(Bioworld Today, Nov. 15, 1998). Such adjuvants can be used 979 17 May 2010 Orine 5.3 x 10 ------with or without other specific immunostimulating agents 990 24 May 2010 Orine 1.4 x 10 ---- 55 997 31 May 2010 Orine 5.0 x 10 ---- such as MPL or 3-DMP, QS21, polymeric or monomeric 1012 10 Jun 2010 Orine 9.5 x 10 -- amino acids such as polyglutamic acid or polylysine. 1036 28 Jun 2010 Orine 1.6 x 10 ---- The pharmaceutical compositions described herein can be 1055 O2 Aug. 2010 Orine 1.0 x 10 -- included in a container, pack, or dispenser together with 1057 02 Aug. 2010 Orine 9.7 x 10 ---- instructions for administration. 1078 09 Sep. 2010 Orine 2.0 x 10 -- 1091 24 Sep. 2010 Orine 7.0 x 10 -- In a particular embodiment, the recombinant N proteins of 60 1096 27 Sep. 2010 Orine 2.0 x 10 ------the present invention have antigenicity, making them Suitable 1107 O7 Oct. 2010 Orine 4.6 x 10 ---- for use in immunogenic compositions. The antigenicity of 1148 25 Oct. 2010 Orine 1.4 x 10 ---- 1155 28 Oct. 2010 Orine 3.2 x 10 -- these recombinant N proteins is demonstrated in Example 7. 1189 25 Nov. 2010 Orine 6.9 x 10 -- Among tested sera from the 56 cats that were RT-PCR posi 1226 O6 Jan 2011 Orine 3.7 x 102 ------tive and 401 cats that were RT-PCR negative for FmoPV, 49 65 1297 28 Feb. 2011 Orine 2.7 x 10? -- (76.7%) and 78 (19.4%), respectively, were positive for IgG 1312 O9 Mar. 2011 Orine 3.8 ---- against N protein of FmoPV by Western blot analysis US 9,139,620 B2 24 TABLE 6-continued sequence. In a specific embodiment, a FmoPV described herein or a composition thereof may be administered to a FoPW non-human Subject (e.g., mouse, rabbit, rat, guinea pig, cat, Cat Date of sample Type of positive Viral load Western etc.) to induce an immune response that includes the produc no. collection sample(s) (copies/ml) blot tion of antibodies which may be isolated using techniques known to one of skill in the art (e.g., immunoaffinity chroma 1314 09 Mar. 2011 Urine 1.6 x 10 1325 14 Mar. 2011 Urine 2.3 x 10 ---- tography, centrifugation, precipitation, etc.). 1327 24 Mar. 2011 Urine 3.7 x 10 -- Alternatively, a virus described herein may be used to 1336 31 Mar. 2011 Urine 5.4 x 10 ---- screen for antibodies from antibody libraries. For example, a 1357 28 Apr. 2011 Urine 1.0 x 10? ---- 10 FmoPV may be immobilized to a solid support (e.g., a silica 1359 28 Apr. 2011 Urine 2.0 x 10 -- 1392 30 May 2011 Urine 5.2 x 10 gel, a resin, a derivatized plastic film, a glass bead, cotton, a 1407 13 Jun 2011 Urine 3.5 x 10 ---- plastic bead, a polystyrene bead, an aluminagel, or a polysac 1409 16 Jun 2011 Urine 1.4 x 10 -- charide, a magnetic bead), and Screened for binding to anti bodies. As an alternative, the antibodies may be immobilized Specific apple green finely granular and diffuse cytoplasmic 15 to a solid support and screened for binding to a FmoPV fluorescence was also observed using serum from guinea pig described herein. Any screening assay, Such as a panning immunized with recombinant N protein of FmoPV or corre assay, ELISA, Surface plasmon resonance, or other antibody sponding serum of the infected cat (FIG. 6). screening assay known in the art may be used to Screen for antibodies that bind to a FmoPV. The antibody library 5.6 Immunogenic Compositions Comprising Live screened may be a commercially available antibody library, Viruses an in vitrogenerated library, or a library obtained by identi fying and cloning or isolating antibodies from a subject In one embodiment, provided herein are immunogenic infected with FmoPV. In particular embodiments, the anti compositions (e.g., vaccines) comprising one or more live body library is generated from a survivor of an FmoPV out FmoPV described herein. In some embodiments, the live 25 break. Antibody libraries may be generated in accordance virus is attenuated. In some embodiments, an immunogenic with methods known in the art. In a particular embodiment, composition comprises two, three, four or more live viruses. the antibody library is generated by cloning the antibodies In certain embodiments, provided herein are immunogenic and using them in phage display libraries or a phagemid compositions (e.g., vaccines) comprising about 10 to about display library. 10' fluorescent focus units (FFU) of live attenuated FmoPV 30 Antibodies elicited or identified in accordance with the described herein, about 0.1 to about 0.5 mg monosodium glutamate, about 1.0 to about 5.0 mg hydrolyzed porcine methods described herein may be tested for specificity for gelatin, about 1.0 to about 5.0 mg arginine, about 10 to about FmoPV antigens and the ability to neutralize FmoPV using 15 mg Sucrose, about 1.0 to about 5.0 nag dibasic potassium the biological assays known in the art or described herein. In phosphate, about 0.5 to about 2.0 mg monobasic potassium one embodiment, an antibody identified or isolated from a phosphate, and about 0.001 to about 0.05ug/ml gentamicin 35 non-human animal antibody specifically binds to a FmoPV Sulfate per dose. In some embodiments, the immunogenic antigen. compositions (e.g., vaccines) are packaged as pre-filled Antibodies elicited or identified in accordance with the sprayers containing single 0.2 ml doses. methods described herein may be tested for specificity to, and In a specific embodiment, provided herein are immuno the ability to neutralize, a peptide or polypeptide antigen genic compositions (e.g., vaccines) comprising 10° to 10' 40 encoded by a heterologous nucleotide sequence described FFU of live attenuated FmoPV described herein, 0.188 mg herein using the biological assays known in the art or monosodium glutamate, 2.0 mg hydrolyzed porcine gelatin, described herein. In one embodiment, an antibody identified 2.42 mg arginine, 13.68 mg Sucrose, 2.26 mg dibasic potas or isolated from a non-human animal antibody specifically sium phosphate, 0.96 mg monobasic potassium phosphate, binds to a peptide or polypeptide antigen encoded by a het and <0.015 g/ml gentamicin Sulfate per dose. In some 45 erologous nucleotide sequence described herein. In one embodiments, the immunogenic compositions (e.g., vac embodiment, the neutralizing antibody neutralizes the viral, cines) are packaged as pre-filled sprayers containing single bacterial, fungal or other pathogen, or a tumor that expresses 0.2 ml doses. the peptide or polypeptide antigen encoded by a heterologous In a specific embodiment, the live virus is propagated in nucleotide sequence described herein. embryonated chicken eggs before its use in an immunogenic 50 Antibodies elicited or identified using a FmoPV described composition described herein. In another specific embodi herein include immunoglobulin molecules and immunologi ment, the live virus is not propagated in embryonated chicken cally active portions of immunoglobulin molecules, i.e., mol eggs before its use in an immunogenic composition described ecules that contain an antigen binding site that specifically herein. In another specific embodiment, the live virus is binds to a hemagglutinin polypeptide. The immunoglobulin propagated in mammalian cells before its use in an immuno 55 molecules may be of any type (e.g., IgG, IgE, IgM, Ig), IgA genic composition described herein. and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and An immunogenic composition comprising a live virus for IgA2) or Subclass of immunoglobulin molecule. Antibodies administration to a subject may be preferred because multi include, but are not limited to, monoclonal antibodies, mul plication of the virus in the Subject may lead to a prolonged tispecific antibodies, human antibodies, humanized antibod stimulus of similar kind and magnitude to that occurring in 60 ies, chimericantibodies, single-chain FVS (ScPV), single chain natural infections, and, therefore, confer Substantial, long antibodies, Fab fragments, F(ab') fragments, disulfide-linked lasting immunity. FVS (SdPV), and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies elicited or identified 5.7 Generation of Antibodies using a method described herein), and epitope-binding frag 65 ments of any of the above. The FmopV described herein may be used to elicit anti Antibodies elicited or identified using a FmoPV described bodies against FmoPV or a heterologous nucleotide herein may be used in diagnostic immunoassays, passive US 9,139,620 B2 25 26 immunotherapy, and generation of antiidiotypic antibodies. Subject comprises administering to a Subject in need thereof a The antibodies before being used in passive immunotherapy FmoPV described herein as an inactivated virus vaccine. may be modified, e.g., the antibodies may be chimerized or In another aspect, provided hereinare methods for prevent humanized. See, e.g., U.S. Pat. Nos. 4.444,887 and 4,716. ing and/or treating a FmoPV infection in a Subject utilizing a 111; and International Publication Nos. WO98/46645, WO FmoPV described herein or a pharmaceutical composition 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO thereof. In one embodiment, a method for preventing or treat 96/33735, and WO 91/10741, each of which is incorporated ing a FmoPV infection in a Subject comprises administering herein by reference in its entirety, for reviews on the genera to a subject in need thereof an effective amount of a FmoPV tion of chimeric and humanized antibodies. In addition, the or a composition thereof. In another embodiment, a method ability of the antibodies to neutralize FmoPV and the speci 10 for preventing or treating an FmoPV infection in a subject ficity of the antibodies for FmoPV antigens may be tested comprises administering to a subject in need thereof an effec prior to using the antibodies in passive immunotherapy. Anti tive amount of a FmoPV or a pharmaceutical composition thereof and one or more other therapies. In another embodi bodies against FmoPV antigens are used to detect the pres ment, a method for preventing or treating a FmoPV infection ence of FmoPV in a subject. In specific embodiments, 15 in a subject comprises administering to a Subject in need FmoPV antibodies are used to diagnose FmoPV infections in thereof a FmoPV described herein as a live virus vaccine. In feline. In specific embodiments, FmoPV antibodies are used particular embodiments, the live virus vaccine comprises an to diagnose TIN in feline. attenuated virus. In another embodiment, a method for pre The antibodies elicited or identified using a FmoPV venting or treating a FnoPV infection in a Subject comprises described herein may be incorporated into compositions. In a administering to a subject in need thereofa FmopV described specific embodiment, the compositions are pharmaceutical herein as an inactivated virus vaccine. compositions. In some embodiments, a pharmaceutical com In another aspect, provided hereinare methods for prevent position may comprise one or more other therapies in addi ing and/or treating a FmoPV in a subject utilizing a FmoPV tion to an antibody. The pharmaceutical compositions pro described herein or a pharmaceutical composition thereof. In vided herein can be in any form that allows for the 25 a specific embodiment, a method for preventing or treating a composition to be administered to a Subject. In a specific FmoPV disease in a Subject comprises administering to a embodiment, the pharmaceutical compositions are suitable subject in need thereof an effective amount of a FmoPV or a for veterinary and/or human administration. In another spe pharmaceutical composition thereof. In another embodiment, cific embodiment, the antibody compositions are formulated a method for preventing or treating a FmoPV in a subject for the intended route of administration (e.g., parenteral, 30 comprises administering to a subject in need thereof an effec intranasal, or pulmonary administration). The antibody com tive amount of a FmoPV or a pharmaceutical composition positions may be used in methods of preventing and/or treat thereof and one or more other therapies. In another embodi ing a FmoPV infection. The antibody compositions may also ment, a method for preventing or treating a FmoPV disease in be used in methods or preventing and/or treating FmoPV a subject comprises administering to a subject in need thereof disease. 35 a FmoPV described herein as a live virus vaccine. In particu Antibodies elicited or identified using a FmoPV described lar embodiments, the live virus vaccine comprises an attenu herein may be used to monitor the efficacy of a therapy and/or ated virus. In another embodiment, a method for preventing disease progression. Any immunoassay system known in the or treating a FmoPV disease in a subject comprises adminis art may be used for this purpose including, but not limited to, tering to a subject in need thereof a FmoPV described herein competitive and noncompetitive assay systems using tech 40 as an inactivated virus vaccine. niques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assays), “sandwich’ immunoassays, precip 5.9 Dosage and Frequency of Administration itin reactions, gel diffusion precipitin reactions, immunodif fusion assays, agglutination assays, complement fixation A FmoPV, an antibody or a composition described herein assays, immunoradiometric assays, fluorescent immunoas 45 may be delivered to a subject by a variety of routes. These says, protein A immunoassays and immunoelectrophoresis include, but are not limited to, intranasal, intratracheal, oral, assays, to name but a few. intradermal, intramuscular, topical intraperitoneal, transder mal, intravenous, pulmonary, conjunctival and Subcutaneous 5.8 Prophylactic & Therapeutic Uses routes. In some embodiments, a composition is formulated 50 for topical administration, for example, for application to the In one aspect, provided herein are methods for inducing an skin. In specific embodiments, the composition is formulated immune response in a subject utilizing a FmoPV described for nasal administration, e.g., as part of a nasal spray. In herein or an immunogenic composition thereof. In a specific certain embodiments, a composition is formulated for intra embodiment, a method for inducing an immune response to a muscular administration. In some embodiments, a composi FmoPV in a Subject comprises administering to a subject in 55 tion is formulated for Subcutaneous administration. In spe need thereof an effective amount of a FmoPV or an immuno cific embodiments for live virus vaccines, the vaccine is genic composition thereof. In certain embodiments, the formulated for administration by a route other than injection. FmoPV or immunogenic composition thereof expresses In some embodiments it may be desirable to introduce the FmoPV proteins from two or more types, subtypes or strains pharmaceutical compositions into the lungs by any Suitable of FmoPV, and thus, may be used to induce an immune 60 route. Pulmonary administration can also be employed, e.g., response to two or more types, subtypes or strains of FmoPV. by use of an inhaler or nebulizer, and formulation with an In a specific embodiment, a method for inducing an immune aerosolizing agent for use as a spray. response to a FmoPV in a subject comprises administering to In some embodiments, when a FmoPV or a composition a subject in need thereof a FmoPV described herein as a live thereof is administered to a non-human Subject (e.g., a cat), virus Vaccine. In particular embodiments, the live virus vac 65 the virus or composition is administered orally to the Subject cine comprises an attenuated virus. In another embodiment, a in the subjects food. In other embodiments, when a FmoPV method for inducing an immune response to FmoPV in a or a composition thereof is administered to a Subject (e.g., US 9,139,620 B2 27 28 cat), the virus or composition is administered orally to the be weekly, monthly or yearly. Intervals can also be irregular subject in the subject’s water. In other embodiments, when a as indicated by measuring blood levels of antibody to the FmoPV or a composition thereof is administered to a non FmoPV in the patient. human Subject, the virus or composition is administered by spraying the Subject with the virus or composition. 5 5.10 Screening Assays The amount of a FmoPV, an antibody or composition described herein which will be effective in the treatment In one aspect, a FmoPV described herein may be used to and/or prevention of a FmoPV infection or a FmoPV disease study the life cycle of a FmoPV. For example, a FmoPV will depend on the nature of the disease, and can be deter described herein that expresses a detectable heterologous mined by standard techniques. The precise dose to be 10 sequence (e.g., a detectable Substance such as described employed in the formulation will also depend on the route of above) is introduced into a host cell and the life cycle of the administration, and the seriousness of the infection or disease virus is monitored by the assessing the expression of the caused by it, and should be decided according to the judgment detectable heterologous sequence. A FmoPV described of the practitioner and each subjects circumstances. For herein that expresses a detectable heterologous sequence may example, effective doses may also vary depending upon 15 also be administered to a non-human animal and the infection means of administration, target site, physiological state of the monitored by assessing the expression of the detectable het Subject (including age, body weight, health), whether the erologous sequence. Subject is human oran animal, whether other medications are In another aspect, provided herein are high throughput administered, and whether treatment is prophylactic orthera screening assays for the identification or validation of com peutic. Similarly, the amount of a FmoPV or a composition pounds that modulate the replication of negative-sense, thereofthat will be effective as a delivery vector will vary and single-stranded RNA viruses, in particular FmoPV. In a spe can be determined by Standard techniques. Treatment dos cific embodiment, the high throughput screening assay to ages are optimally titrated to optimize safety and efficacy. identify a compound that modulates the replication of a nega In certain embodiments, an in vitro assay is employed to tive-sense, single-stranded RNA virus (in particular FmoPV) help identify optimal dosage ranges. Effective doses may be 25 comprises: (a) contacting a compound or a member of a extrapolated from dose response curves derived from in vitro library of compounds with a host cell infected with a FmoPV or animal model test systems. described herein that expresses a detectable heterologous Exemplary doses for live FmoPV may vary from 10-100, nucleotide sequence; and (b) measuring the expression or or more, virions per dose. In some embodiments, Suitable activity of a product encoded by the detectable heterologous dosages of a live FmoPV virus are 10, 5x10, 10, 5x10, 30 nucleotide sequence. In another embodiment, the high 10, 5x10, 10,5x10, 10°, 5x10°, 107,5x107, 10, 5x10, throughput screening assay to identify a compound that 1x10, 5x10, 1x10", 5x10, 1x10", 5x10" or 10 pful, modulates the replication of a negative-sense, single-stranded and can be administered to a Subject once, twice, three or RNA virus (in particular FmoPV) comprises: (a) infecting a more times with intervals as often as needed. In another host cell with a FmoPV described herein that expresses a embodiment, a live FmoPV is formulated such that a 0.2-mL 35 detectable heterologous nucleotide sequence in the presence dose contains 10°-107 fluorescent focal units of live of a compound or a member of a library of compounds; and FmoPV. In another embodiment, an inactivated vaccine is (b) measuring the expression or activity a product encoded by formulated Such that it contains about 15 g to about 100 ug, the detectable heterologous nucleotide sequence. In another about 15 Jug to about 75 ug, about 15 g to about 50 ug, or embodiment, the high throughput screening assay to identify about 15ug to about 30 ug of a FmoPV protein. 40 a compound that modulates the replication of a negative In certain embodiments, a FmoPV described herein or a sense, single-stranded RNA virus (in particular FmoPV) composition thereof is administered to a Subject as a single comprises: (a) contacting a host cell with a compound or a dose followed by a second dose 3 to 6 weeks later. In accor member of a library of compounds: (b) infecting the host cell dance with these embodiments, booster inoculations may be with a FmoPV described herein that expresses a detectable administered to the subject at 6 to 12 month intervals follow 45 heterologous nucleotide sequence; and (c) measuring the ing the second inoculation. In certain embodiments, the expression or activity a product encoded by the detectable booster inoculations may utilize a different FmoPV strain or heterologous nucleotide sequence. a composition thereof. In some embodiments, the adminis Any method known to one of skill in the art can be used tration of the same FmoPV strain or a composition thereof measure the expression or activity of a product encoded by may be repeated and the administrations may be separated by 50 the detectable heterologous nucleotide sequence. In one at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, embodiment, the product encoded by the detectable heterolo 45 days, 2 months, 75 days, 3 months, or at least 6 months. gous nucleotide sequence is RNA and a technique known to For passive immunization with an antibody, the dosage one of skill in the art, such as RT-PCR or Northern blot ranges from about 0.0001 to 100 mg/kg, and more usually analysis, is used to measure the expression of the RNA prod 0.01 to 50 mg/kg or 0.1 to 15 mg/kg, of the subject body 55 uct. In another embodiment, the product encoded by the weight. For example, dosages can be 1 mg/kg body weight or detectable heterologous nucleotide sequence is protein and a 10 mg/kg body weight or within the range of 1-10 mg/kg or in technique known to one of skill in the art, such as western blot other words, 70 mg or 700 mg or within the range of 70-700 analysis or an ELISA, is used to measure the expression of the mg, respectively, for a 70kg patient. An exemplary treatment protein product. In another embodiment, the product encoded regime entails administration once per every two weeks or 60 by the detectable heterologous nucleotide sequence is protein once a month or once every 3 to 6 months for a period of one and the activity of the protein is measured using a technique year or over several years, or over several year-intervals. In known to one of skill in the art. some methods, two or more monoclonal antibodies with dif Any screening assay described herein can be performed ferent binding specificities are administered simultaneously, individually, e.g., just with the test compound, or with appro in which case the dosage of each antibody administered falls 65 priate controls. For example, a parallel assay without the test within the ranges indicated. Antibody is usually administered compound, or other parallel assays without other reaction on multiple occasions. Intervals between single dosages can components (e.g., virus) can be performed. In one embodi US 9,139,620 B2 29 30 ment, a parallel screening assay as described above is per pound, an enzymatic Substrate, a radioactive compound or a formed except that a negative control and/or a positive control luminescent compound, or a second antibody which recog are used in place of a test compound. In another embodiment, nizes the first antibody may be conjugated to a detectable to eliminate cytotoxic compounds that appear as false posi Substrate). In specific embodiments, a kit may include a tives, a counter Screen is performed in which uninfected cells s recombinantly produced or chemically synthesized FmopV are transfected with a nucleic acid construct (e.g., a plasmid) antigen. The FmoPV antigen provided in the kit may also be comprising a detectable heterologous nucleotide sequence attached to a solid Support. In a more specific embodiment the detecting means of the above described kit includes a solid and the expression or activity of a product encoded by the support to which a FmoPV antigen is attached. Such a kit may detectable heterologous nucleotide sequence is measured. also include a non-attached reporter-labeled anti-human anti Alternatively, it is possible to compare assay results to a 10 body. In this embodiment, binding of the antibody to the reference, e.g., a reference value, e.g., obtained from the FmoPV antigen can be detected by binding of the said literature, a prior assay, and so forth. Appropriate correlations reporter-labeled antibody. and art known statistical methods can be used to evaluate an Optionally associated with Such a kit can be a notice in the assay result. form prescribed by a governmental agency regulating the In another aspect, the antiviral effect of a compound on 15 manufacture, use or sale of pharmaceuticals or biological FmoPV can be assessed in a non-human animal using a products, which notice reflects approval by the agency of FmoPV described herein. In one embodiment, the antiviral manufacture, use or sale for human administration. effect of a compound on FmoPV can be assessed by a method Example 2 demonstrates a diagnostic test done by RT comprising: (a) administering (for example, parenterally, PCR. Another diagnostic test. demonstrated in Example 3, is Subcutaneously, intranasally, or intraperitoneally) to a non a viral load test using real-time quantitative RT-PCR using the human Subject, concurrently, Subsequently or prior to admin above genomic information obtained from sequencing. istration of a compound, an effective amount of a FmoPV described herein; b) waiting for a time interval following the 5.12 Complete Genome Sequencing and Analysis administration of the FmoPV; and d) detecting the FmoPV in the Subject or in a biological specimen from the Subject. as Three complete genomes of FmoPV, from two urine (761 U. 776U) and one rectal swab (M252A) samples, were amplified and sequenced using RNA extracted directly from 5.11 Kits the specimens as templates with a strategy described in our previous publications (13, 14). Genome analysis was per In one aspect, provided herein is a kit comprising, in one or formed as described in our previous publications (13, 14, 23, more containers, one or more nucleic acid sequences 30 24, 25). Phylogenetic trees were constructed by maximum described herein. In a specific embodiment, a kit comprises, likelihood method using PhyML 3.0 (26). in a container, a FimopV gene segment or a complement The complete genome sequences of three Strains of thereof. In another embodiment, a kit comprises, in one, two FmoPV designated 761U, 776U and M252A were deter or more containers, a nucleic acid sequence encoding a mined. The genome sequence for FmoPV strain 761U was FmoPV gene segments or a complement thereof. The kit may 35 deposited at GenBank and given accession number further comprise one or more of the following: host cells JQ41 1014. The FmoPV 761U nucleotide sequence is shown suitable for rescue of the virus, reagents suitable for trans in FIG. 2. The genome sequence for FmoPV strain 776U was fecting plasmid DNA into a host cell, helper virus, plasmids deposited at GenBank and given accession number encoding one or more types of FmoPV gene segments, one or JQ411015. The FmoPV 776U nucleotide sequence is shown more expression plasmids encoding viral proteins, and/or one 40 in FIG. 3. The genome sequence for FmoPV strain M252A or more primers specific for a FmoPV gene segment or a was deposited at GenBank and given accession number complement thereof, or nucleic acid sequences encoding the JQ411016. The FmoPV M252A nucleotide sequence is SaC. shown in FIG. 4. In another aspect, provided herein is a kit comprising one The genome size of these FmoPV nucleotide sequences are 16050 bases and G+C contents 35.1% to 35.3%, with FmoPV or more containers filled with one or more of the one or more 45 having the largest genome among all morbilliviruses with FmoPV described herein or a composition thereof. In a spe genome sequences available (see FIG. 1). The genome of cific embodiment, provided herein is a pharmaceutical pack FmoPV conforms to the rule of six as in other paramyxovirus or kit comprising, in one or more containers, a composition genomes. It contains a 12-nt complementary 3' leader and 5' comprising one or more FmoPV described herein. In another trailer sequence. The 3' leader sequence is 55 nt. In contrast to aspect, provided herein is a kit comprising, in one or more 50 other morbilliviruses which only have 5' trailer sequences of containers, primers specific for a particular FmoPV gene 40 or 41 nt, the genome of FmoPV has a trailer sequence of Segment. 400 nt, accounting for its bigger genome size. Such long In another aspect, provided herein is a kit comprising one trailer sequences of 400 nt have only been observed in avian or more containers filled with one or more antibodies gener paramyxoviruses 3 (681-707 nt) and 5 (552 nt) and tupaia ated or identified using a FmoPV described herein. In one 55 paramyxovirus (590 nt). embodiment, a kit comprises an antibody described herein, Similar to other morbilliviruses, the genome of FmoPV preferably an isolated antibody, in one or more containers. In contains six genes (3'-N-P/V/C-M-F-H-L-5') (see FIG. 1). a specific embodiment, a kit encompassed herein contains an Pairwise alignment of the predicted gene products among isolated FmoPV antigen that the antibodies encompassed FmoPV and other paramyxoviruses showed the highest herein react with as a control. In a specific, a kit provided 60 amino acid identities with members of the genus Morbillivi herein further comprise a control antibody which does not rus, with the N, P/V/C(P), P/V/C(V), P/V/C(C), M, F, Hand react with a FmoPV antigen that an antibody encompassed L of FmoPV having 54.3-56.8%, 25.6-31.7%, 20.7-25.7%, herein reacts with. In another specific embodiment, a kit 18.3-25.4%, 57.6-60.0%, 35.8-45.1%. 20.4-24.1% and 55.2- provided herein contains a means for detecting the binding of 57.3% amino acid identities to those of other morbilliviruses an antibody to a FmoPV antigen that an antibody encom (see Table 1). The lengths and characteristics of the major passed herein reacts with (e.g., the antibody may be conju structural genes and intergenic regions (IGRs) are Summa gated to a detectable Substrate such as a fluorescent com rized in Table 2. US 9,139,620 B2 31 TABLE 1 Pairwise amino acid identities of predicted gene products of FmoPV compared to other paramyxoviruses Percentage of amino acid sequence identity

N P M Paramyxoviruses 761U 776U M252A 761U 776U M252A 761U 776U M252A Morbillivirus

FoPW 761U - 99.2 96.O - 97.4 89.2 - 98.8 95.8 FmoPV 776U 99.2 - 96.1 97.4 - 88.6 98.8 - 96.4 FoPVM2S2A 96.O 96.1 89.2 88.6 95.8 96.4 CPV 56.8 S6.5 56.2 29.7 29.3 27.5 58.8 S8.5 58.8 DOPV S4S 54.3 SS.O 26.4 25.8 25.6 S9.3 59.6 59.5 MeaPV SS.4 SS.2, 54.6 29.0 28.8 27.8 6O.O 59.7 59.0 PprPV S5.6 SS.8 SS.8 31.6 31.7 31.6 58.2 58.5 58.8 RPV 55.5 55.5 SS. 6 28.4 28.4 26.8 S9.S. 592 58.2 PoPV 56.6 S6.2 56.2 30.6 30.4 28.8 S7.9 57.9 57.6 AVulavirus

AyiPV-6 29.1 29.3 28.1 18.3 17.9 18.6 23:S 23.5 22.9 NdPV 27.1 27.1 28.0 19.8 18.8 18.1 19.S. 20.O 20.9 Henipavirus

HenPV 33.6 33.2 32.8 21.1 222 23.3 43.9 44.2 44.2 NipPV 33.8 334 330 22.4 21.8 22.8 43.1 433 43.4 Respirovirus

BpiPV-3 25.7 25.9 25.4 18.0 18.7 19.2 33.9 336 34.2 SenPV 24.2 25.2 25.0 19.0 18.5 2O.S 34.7 34.7 34.4 Rubulavirus

HpiPV-2 27.5 27.7 27.9 19.4 19.6 16.8 22.8 231 21.8 MnPV 27.6 27.8. 27.7 19.6 19.9 17.2 20.4 20.O 20.7 Unclassified Paramyxovirinae

AsaPV 29.8. 29.8 28.4 16.4 17.2 17.1 34.7 34.7 34.7 TPW 35.7 36.4 36.O 22.7 22.7 23.0 48.0 48.3 48.8 BePV 36.6 36.2 36.3 23S 23.3 23.9 47.4 47.7 48.5 FoPV 28.4 28.4 28.5 19.9 21.1 20.8 34.9 34.5 33.9 PV 34.O 34.O 34.O 23.1 23.3 22.3 47.8 48.1 48.4 MosRV 38.6 38.6 37.6 22.9 22.9 22.0 47.5 48.2 46.9 TupPV 33.4 32.7 32.1 23.2 23.2 23.9 43.9 43.2 42.5 NarPV 37.2 36.9 38.1 22.7 23.8 22.6 S15 S1.5 SO.6 Percentage of amino acid sequence identity

F A. L Paramyxoviruses 761U 776U M252A 761U 776U M252A 761U 776U M252A

Morbillivirus

FoPW 761U - 98.9 96.3 - 99.O 96.3 - 99.4 97.O FmoPV 776U 98.9 - 95.9 99.0 - 95.3 99.4 — 97.3 FoPVM2S2A 96.3 95.9 96.3 95.3 97.0 97.3 CPV 36.0 35.8 36.1 20.4 20.6 20.6 SS.S. SS-4 SS.4 DOPV 43.0 42.2 42.4 24.1 24.1 23.9 S6.4 56.4 S 6.5 MeaPV 44.O 44.O 43.9 20.7 20.9 20.7 S6.O SS-9 S5.8 PprPV 428 428 43.2 21.6 21.8 21.6 57.3 57.3 57.2 RPV 44.6 44.3 45.1 21 21.1 22.4 SS.4 SS3 55.2 PoPV 42.7 42.9 42.9 20.6 20.8. 20.9 SS.4 SS4 SS. 7 AVulavirus

AyiPV-6 26.8. 27.O 26.6 17.7 17.6 17.3 28.5 28.6 29.1 NdPV 25.8 25.8 25.4 17.5 17.2 16.2 27.7 27.5 27.6 Henipavirus

HenPV 32.4 32.6 33.0 17.8 17.8 18.9 43.4 434 43.4 NipPV 33.O 33.2 33.3 18.2 18.2 18.9 44.9 44.8 452 Respirovirus

BpiPV-3 28.S. 28.2 28.5 18.9 18.9 18.2 38.4 38.6 38.9 SenPV 27.1 26.5 26.5 2O.S. 20.3 21.1 39.1 393 39.4 US 9,139,620 B2 33 34 TABLE 1-continued Pairwise amino acid identities of predicted gene products of FmoPV compared to other paramyxoviruses Rubulavirus

25.O 244 2S.O 18.0 18.0 18.3 30.4 30.2 30.2 26.4 26.2 25.7 18.1 17.8 18.7 3O.O 30.1 29.9 Unclassified Paramyxovirinae

30.9 30.6 30.8 20.1 20.1. 19.0 40.O 40.1 40.4 32.7 32.9 33.0 16.1 15.8 16.6 46.4 46.4 46.4 32.9 32.7 32.7 16.1 15.8 15.8 46.3 46.3 46.6 29.0 29.2 29.7 19.9 19.9 19.2 40.O 40.O 39.7 31.8 31.8 32.9 14.8 15.O 14.4 46.9 46.9 47.2 36.3 36.3 35.8 19.0 19.2 19.9 48.6 48.8 48.8 35.0 35.4 3S.O 14.7 14.4 15.6 47.3 47.2 47.1 33.0 32.5 32.6 18.6 184 18.7 47.7 48O 47.9

TABLE 2 Molecular features and predicted gene products of FnoPV and other morbilliviruses mRNA features (nt Deduced protein total hexamer Intergenic Size MW Coding Virus Gene length 5' UTR ORF 3' UTR phase regions (nt) (aa) (kDa) pI frame Leader 55 (TTT N 659 52 S60 47 CTT 519 57.01 5.27 P/V/C(P) 637 63 476 98 CTT 491 53.12 5.20 P/V/C(V) 638 63 831 744 CTT 276 29.97 4.85 P/V/C(C) 637 94 513 1030 CTT 170 1990 9.69 M 378 31 O14 333 CTA 337 38.05 9.29 2191 215 632 344 CTT 543 60.26 8.8O H 934 30 788 116 CTT 595 68.11 6.25 6781 22 6609 150 (CTT) 22O2 252.87 8.32 Trailer 400 FoPW Leader 55 (TTT) 776U N 659 52 S60 47 CTT 519 57.06 5.15 P/V/C(P) 637 63 476 98 CTT 491 S3.19 5.33 P/V/C(V) 638 63 831 744 CTT 276 29.99 4.91 P/V/C(C) 637 94 513 1030 CTT 170 19.87 9.69 M 378 31 O14 333 CTA 337 38.02 9.29 2191 215 632 344 CTT 543 6021 8.79 H 934 30 788 116 CTT 595 68.24 6.03 6781 22 6609 150 (CTT) 22O2 253.01 8.23 Trailer 400 55 (TTT) 659 52 S60 47 CTT 519 57.08 S.34 637 63 476 98 CTT 491 53.41 5.44 638 63 831 744 CTT 276 29.94 S.13 637 94 513 1030 CTT 170 1986 9.69 378 31 O14 333 CTA 337 38.06 9.29 2191 215 632 344 CTT 543 60.19 8.8O H 934 30 788 116 CTT 595 68.18 6.25 6781 22 6609 150 (CTT) 22O2 252.91 8.28 Trailer 400 MeaPV Leader 55 (CTT) N 689 52 578 59 525 S8.02 S.11 P/V/C(P) 655 59 524 72 507 53.90 4.99 P/V/C(V) 656 59 900 697 299 31.85 4.66 P/V/C(C) 655 81 561 1013 186 21.11 10.36 M 466 32 OO8 426 335 37.71 9.07 2373 583 653 137 550 59.53 8.78 H 958 2O 854 84 617 69.17 7.88 6643 22 6552 69 (CTT) 21.83 247.74 8.43 Trailer 40 CPV Leader 55 N 683 52 572 59 523 58.14 5.20 P/V/C(P) 655 59 524 72 507 54.75 S.O3 P/V/C(V) 656 59 900 697 299 33.11 4.66 P/V/C(C) 655 81 525 1049 174 20.26 10.30 M 447 32 OO8 407 335 37.77 8.87 22O6 85 989 132 662 72.95 9.18 H 946 2O 815 111 604 67.99 6.74 US 9,139,620 B2 35 36 TABLE 2-continued Molecular features and predicted gene products of FinOPV and other morbilliviruses mRNA features (nt Deduced protein Total hexamer Intergenic Size MW Coding Virus Gene length 5' UTR ORF 3' UTR phase regions (nt) (aa) (kDa) pI frame 6642 22 6555 65 2 (CAA) 2184 248.19 8.39 3 Trailer 41 DmoPW Leader 55 (CTT) N 683 52 572 59 2 CTT 523 S749 S.14 3 P/V/C(P) 655 59 521 75 2 CTT SO6 SS.26 S.09 1 P/V/C(V) 656 59 912 685 2 CTT 3O3 33.69 4.75 1 P/V/C(C) 655 81 S34 1040 2 CTT 177 20.41 10.19 2 M 453 32 OO8 413 4 CTT 335 37.97 8.97 3 2212 421 659 132 2 CTT SS2 59.87 8.81 3 H 946 2O 815 111 3 CTT 604 68.04 6.18 2 6643 22 6552 69 2 (CAA) 2183 248.07 8.52 3 Trailer 40 PprPV Leader 55 (CTT) N 689 52 578 59 2 CTT 525 57.78 5.21 3 P/V/C(P) 655 59 530 66 2 CTT SO9 S4.79 S.14 1 P/V/C(V) 656 59 897 700 2 CTT 298. 31.34 4.58 1 P/V/C(C) 655 81 S34 1040 2 CTT 177 1993 9.92 2 M 483 32 OO8 443 4 CTT 335 37.95 8.97 3 2411 634 641 136 2 CTT S46 59.12 8.71 3 H 957 2O 830 107 4 CTT 609 68.76 6.64 3 6643 22 6552 69 2 (CTA) 2183 247.27 7.73 3 Trailer 40 RinPW Leader 55 (CTT) N 689 52 578 59 2 CTT S25 S8.04 S.08 3 P/V/C(P) 655 59 524 72 2 CTT SO7 54.36 4.82 1 P/V/C(V) 656 59 900 697 2 CTT 299 32.57 4.56 1 P/V/C(C) 655 81 S34 1040 2 CTT 177 1993 10.29 2 M 460 32 OO8 420 4 CTT 335 37.54 9.15 3 2367 589 641 137 3 CTT S46 58.73 8.43 1 H 958 2O 830 108 3 CGT 609 67.90 6.61 2 6643 22 6552 69 2 (CTT) 2183 248.21 8.48 3 Trailer 40

35 The conserved N-terminal motif MA(T/S)L in morbillivi protein). The sequence TTAG, is conserved as in other ruses was absent in the N protein of FmoPV, which contained paramyxovirus editing sites except for those of rubulavi the sequence MSSL (SEQ ID NO: 13) as a result of A->S ruses. In contrast to other morbilliviruses in which the (G->U at first codon position) substitution at the second sequence is TTAG (SEQ ID NO: 16) (33), the TTAG, amino acid (FIG. 5). Similar to the nuclear localization signal 40 sequence in FmoPV is TTAG (SEQID NO: 14). (NLS) of the N proteins in CdiPV. MeaPV and RinPV but Different from all other known morbilliviruses, the F pro different from the classical NLS sequence (PMID: tein of FmoPV has a single-basic protein cleavage site, 16716375), a leucine/isoleucine-rich motif at amino acid whereas the cleavage sites in other morbilliviruses are multi positions 70-77 is identified in the N protein of FmoPV (see 45 SI FIG. 5). Similar to the nuclear export signal (NES) of the basic (34). Cellular trypsin-like protease cleaves the F protein N proteins in CdiPV and RinPV, a leucine-rich motif atamino into F1 and F2 before cell fusion occurs, which facilitates the acid positions 4-11 is also identified in the N protein of isolation of these viruses in cell lines. Two heptad repeat FmoPV (see FIG. 5). sequences similar to those in F proteins of other paramyxovii As in other morbilliviruses, the P/V/C gene of FmoPV 50 ruses were also identified in the F of FmoPV. The F protein contains two initiation codons, the first one for translation of of FmoPV also contains the 10 Cys residues that are highly P and V and the second for translation of C. Similar to most conserved in other morbilliviruses and 5 potential N-glyco members of Paramyxoviridae, the P/V/C gene of FmoPV contains a UC-rich editing site that allows the addition of Sylation sites, most of which located in the F. peptide. non-templated G residues to mRNA products during P/V/C 55 Phylogenetic trees constructed using the predicted amino gene transcription, resulting in the production of different acid sequences of N. P. M. F. Hand L genes of FmoPV and proteins with a common N-terminal region. In all three strains other members of Paramyxoviridae are shown in FIG. 7. In all of FmoPV, this common N-terminal region consists of 226 six trees, the three viruses were clustered with morbillivi amino acids. ruses, with high bootstrap Supports, forming a distinct Sub To determine the exact location of P gene editing site and 60 the number and frequency of G-residue insertions, a small group (see FIG. 7). The trees were constructed by maximum cDNA fragment including the UC-rich region was amplified, likelihood method with bootstrap values calculated from cloned and sequenced using mRNA extracted from FmoPV 1000 trees and rooted on midpoint. The scale bars in FIG. 7 infected CRFK cells. Among 23 independent clones indicate the branch length that corresponds to 0.5 substitu sequenced, 13 contained the sequence TTAAAAGGGG 65 tions per site. Three strains from FmoPV were named as (without G insertion, encoding P protein) and 10 contained 761U, 776U, M252A. Names and accession numbers of the the sequence TTAAAAGGGGG (one Ginserted, encoding V other viruses in FIG. 7 are listed in Table 3 below. US 9,139,620 B2 37 38 TABLE 3 TABLE 3-continued

Viruses and GenBank accession numbers Viruses and GenBank accession numbers Abbreviation Virus name GenBank accession no. Abbreviation Virus name GenBank accession no. AsaPV Atlantic Salmon paramyxovirus EU156171 AyiPW-S Avian paramyxovirus 5 GU206351 PprPV Peste-des-petits-ruminants virus NC 006383 AyiPV-6 Avian paramyxovirus 6 NC 003043 RPV Rinderpest virus NC OO6396 AyiPV-7 Avian paramyxovirus 7 F231524 SenPV Sendai virus NC OO1552 BePV Beilong virus NC 007803 SpiPV-3 Swine parainfluenza virus 3 EU439429 BpiPV-3 Bovine parainfluenza virus 3 NC 002161 10 ThkPV1 Tuhoko virus 1 GU12808O CPV Canine distemper virus NC OO1921 DOPV Dolphin morbillivirus NC OO5283 ThkPV-2 Tuhoko virus 2 GU128O81 FoPV Fer-de-lance virus NC 005084 ThkPV-3 Tuhoko virus 3 GU128082 GOOPV Goose paramyxovirus SFO2 NC 005036 TPW Taillam virus JN689.227 HenPV Hendra virus NC OO1906 TupPV Tupaia paramyxovirus NC 002199 HpiPV-1 Human parainfluenza virus 1 NC OO3461 15 HpiPV-2 Human parainfluenza virus 2 NC 003443 HpiPV-3 Human parainfluenza virus 3 NC OO1796 HpiPV-4a Human parainfluenza virus 4a BAJ11741 HRSV Human respiratory syncytial NC OO1781 5.13 Detection of FmoRV Infection in Felines virus JPV J-virus NC 007454 MeaPV Measles virus NC OO1498 MosRV Mossman virus NC OO5339 Infection of a feline by FmoPV can be detected in sera by MnPV Mumps virus NC OO2200 the use of immunofluorescent antibodies as demonstrated in NarPV Nariva virus FJ362497 Example 9, or by the detection of neutralizing antibodies as NdPV Newcastle disease virus NC 002617 demonstrated in Example 10. Of the 27 cat sera samples NipPV Nipah virus NC 002728 PoPV Phocine distemper virus P35944, P35939, 25 tested in Example 9, immunofluorescent antibody was BAAO1205, BAAO1206, detected from 7 cats with titer from 1:40 to 1:640. Table 4 CAA12080, CAA70843 below shows the association between TIN and evidence of FmoPV infection. TABLE 4

Association between TIN and evidence of FmoPV infection

Evidence of FmoRV infection Urine Antibody response Sample RT Western IF (IgG) with serum dilution

No. TIN PCR Blot 1:10 1:40 1:160 1:640 1:256O 1:10240

357 ------359 ------363 -- 364 365 -- 366 -- 367 368 391 392 ------393 ------394 395 396 397 ------4O2 -- 403 -- 404 40S 4O6 407 ------4.08 -- 409 ------417 -- -- 418 419 420 US 9,139,620 B2 39 40 The same 27 cat sera samples used in Example 9 were tested species specificity in FmoPV. Although no recombination for the presence of neutralization antibody in Example 10. was identified in the present FmoPV strains (data not shown), Neutralization antibody was detected from 6 cats with titer other viruses from cats, such as feline coronaviruses and from 1:20 to 1:40, shown below in Table 5, of which all are feline papillomavirus, have been shown to be closely related positive for immunofluorescent antibody (Table 4). to or recombine with their canine counterparts in dogs, Sug TABLE 5 Neutralizing antibody detected from cats' sera Sample Neutralizing IF (IgG) with serum dilution

No. 1:10 1:20 1:40 1:80 1:160 1:32O 1:640 1:1280

357 -- -- 359 -- -- 363 364 365 366 367 368 391 392 393 394 395 396 397 4O2 403 404 40S 4O6 407 -- -- 4.08 409 -- -- 417 418 419 420

6. EXAMPLES gesting that feline viruses may have the potential to cross species barrier in animals of similar living habitat (17,35). Described herein is a novel feline paramyxovirus, FmoPV. Some recent studies suggested that feline TIN is mediated from Stray cats in Hong Kong, which represents the first 40 by an autoimmune mechanism because cats vaccinated with documentation of paramyxoviruses found in the domestic cat CRFK cell lysates developed antibodies to both CRFK and (Felis catus). Woo et al. (2012) “Feline morbillivirus, a novel kidney cell lysates (36-38). Half of these cats sensitized to paramyxovirus associated with tubulointerstitial nephritis in CRFK lysates on multiple occasions developed tubulointer domestic cats.” PNAS (in press), which is incorporated herein Stitial nephritis at 2 weeks post-sensitization. Sera from by reference in its entirety. 45 CRFK inoculated cats were confirmed to recognize annexin A molecular epidemiology study was carried out in Stray A2 and alpha-enolase by Western blot. In humans, alpha cats in Hong Kong and on diseased cats from mainland China enolase antibodies are nephritogenic and alpha-enolase and from which the novel feline paramyxovirus, FmoPV, was annexin A2 antibodies have been associated with autoim isolated and characterized as shown in the following 50 mune diseases. It is therefore possible that a feline nephro examples. tropic virus, such as FmoPV, may trigger off a self-sustained To summarize, FmoPV was detected in the urine samples immunopathological process after this acute insult. Notably, of 53 of 457 stray cats and in the rectal Swab and blood some morbilliviruses, such as Peste des Petits Ruminants samples of four and one of these cats, respectively. Western virus, Rinderpest virus and canine distemper virus, have also blot analysis revealed a seroprevalence of 27.8% among 55 been found in kidney and/or urine (39-41). Further studies tested cats for IgG against recombinant N protein and the would delineate if these viruses are also associated with renal presence of antibody is highly associated with the presence of pathologies in these animals. virus. Analysis of the complete genomes of three FmoPV Although domestic cats have been associated with humans strains, described earlier in Section 5.12, showed that they for almost 10,000 years, they usually pose little physical formed a distinct cluster among the morbilliviruses in all six 60 hazards to humans. However, as a result of cat bites or via phylogenetic trees constructed using the N. P. M. F. Hand L other routes, cats can transmit a range of bacteria (e.g. Bar genes (FIG. 7). Immunohistochemistry also showed that, tonella hemselae), protozoa (e.g. Toxoplasma gondii), and similar to other morbilliviruses such as measles virus, uncommonly viruses (e.g. rabies virus), causing diseases in FmoPV infects both mononuclear cells and parenchymal humans. Apart from the present novel paramyxovirus, viruses cells (FIG. 10). The three strains of FmoPV exhibited high 65 of at least 15 families have been found in cats, including the sequence similarity and identical genome organization, Sug recent discovery of the first picornavirus in cats (23). More gesting a single species of FmopV and a high degree of over, the domestic cats have also been shown to be susceptible US 9,139,620 B2 41 42 to infection by highly pathogenic avian influenza viruses CCATCGGGTACTT-3' (SEQID NO: 12)) designed by mul H5N1 and H7N7 and SARS coronavirus, suggesting that they tiple alignments of available L gene sequences of can be susceptible to viruses associated with serious infec morbilliviruses. Reverse transcription, PCR and sequencing tions (42-44). A previous Survey in Hong Kong showed that were performed according to our previous publications (13. one in every eight households was keeping pets with 22.3% 14). keeping cats. The number of locally licensed pet shops selling 6.3 Example 3 cats and dogs in Hong Kong has increased from 77 in 2000 to 155 in 2009. In many households, owners having pets share Real-Time Quantitative RT-PCR their beds with their pets, and the pet owners often kiss or are being licked by their pets. Such behavior may allow signifi 10 Real-time quantitative RT-PCR to detect L gene of FmoPV cant exposure to Zoonotic agents carried by the pet or para was performed on the 56 positive samples using LightCyler sitizing arthropods (45). Continuous Surveillance of viruses FastStart DNA Master SYBR Green I Mix reagent kit in these animals is important to understand their potential for (Roche), with primers LPW12490 and LPW12491. Comple causing emerging infectious diseases in other mammals, mentary DNA (cDNA) was amplified by LightCycler 2.0 including humans. 15 (Roche) with 20-ul reaction mixtures containing FastStart DNA Master SYBR Green I Mix reagent kit (Roche), 2 ul of 6.1 Example 1 cDNA, 4 mmol/L MgCl, and 0.5 mmol/l primers at 95°C. for 10 min, followed by 50 cycles of 95°C. for 10s, 60° C. for Sample Collection 5 s and 72° C. for 8 s. A plasmid containing the target sequence was used for generating the standard curves. The Agriculture Fisheries and Conservation Department RT-PCR for a 155-bp fragment in the L gene of morbillivi (AFCD), Hong Kong provided samples collected from 457 ruses was positive in samples from 56 (12.3%) cats from Stray cats captured from various locations in Hong Kong over Hong Kong, including 53 urine, 4 rectal Swabs and 1 blood a 2-year period (March 2009 to February 2011) as part of a specimens. For the 16 diseased cats from mainland China, 25 one (6.25%) cat was RT-PCR positive in both its oral and Surveillance program. Tracheal and rectal Swabs, urine and rectal swabs. Real-time quantitative RT-PCR showed a blood were collected using procedures described previously median viral load of 3.9x10 (range 0.037 to 1.4x10) copies/ (23). In addition, oral and rectal swabs from 16 diseased cats ml. Sequencing results suggested the presence of a novel from mainland China were also collected. The study was paramyxovirus of the genus Morbilli virus, with <80% nt approved by the Committee on the Use of Live Animals in identities to known paramyxoviruses (FIG. 8). This novel Teaching and Research, The University of Hong Kong. 30 paramyxovirus was named FmoPV. Samples were collected immediately after euthanasia as rou tine policies for disposal of locally captured stray cats. 6.4 Example 4 Necropsies of FmoPV-Infected Stray Cats Analysis of P mRNA Editing 35 To identify possible diseases associated with FmoPV. To examine the number of G insertions at the P mRNA necropsies were performed on two euthanized stray cats posi editing site, mRNA from original specimens was extracted tive for FmoPV by RT-PCR. Tissue samples were collected using the Oligotex mRNA Mini kit (QIAgen). First strand from the lungs; brain; heart; prescaspular, retropharyngeal, cDNA synthesis was performed using SuperScript III kit Submandibular and thoracic lymph nodes; spleen; liver, kid 40 (Invitrogen) with random hexamer primers. Primers (5'- neys; urinary bladder; gall bladder, thymus; salivary gland; TTCATCTCTTAGTTCCCAGGAA-3' (SEQIDNO:17) and 5'-TTTCAGACTCACCCTCGATATCT-3' (SEQ ID NO: eyeball; nasal turbinate; intestine; pancreas; foot pads; tes 18)) were used to amplify a 442-bp product of FmoPV cov ticles or ovary; tonsil and adrenal gland. Half of each tissue ering the putative editing site. PCR, cloning and sequencing sample was fixed in 10% neutral buffered formalin for histo were performed as described in our previous publication (13). logical processing and the other half was Submerged in viral 45 transport medium for RNA extraction and virus isolation. 6.5 Example 5 Since the kidneys of the two stray cats showed histopatho logical features compatible with TIN, the kidneys, urine and Cloning and Purification of (His)-Tagged (“(His)6” plasma were obtained from a total of 27 strayed cats, includ Disclosed as SEQID NO: 10) Recombinant ing the two cats with necropsies performed, and were subject 50 Nucleoprotein (N) from Escherichia coli to RT-PCR, histopathology and antibody detection by west ern blot and immunofluorescence to examine for possible Primers (5'-ACGCGGATCCGATGTCTAGTCTA-3' association between FmoPV infection (RT-PCR and/or anti (SEQID NO: 19) and 5'-CGGAATTCGGTTTTAGAAGGT body positive) and TIN. CAGTA-3' (SEQ ID NO: 20)) were used to amplify the N 55 gene (519 amino acids) of FmoPV strain 761U by RT-PCR. 6.2 Example 2 Cloning, expression and purification of (His)-tagged (“(His) 6” disclosed as SEQID NO: 10) recombinant N protein was RT-PCR of L Gene of Morbilliviruses and DNA performed as described in (1) Lau S K, et al. (2010) Virology Sequencing 404:106-116; (2) Woo PC, et al. (2005) J Virol 79.884-895: 60 and (3) Woo PC, et al. (2004) Lancet 363:841-845. Viral RNA was extracted from tracheal and rectal Swabs, urine and blood using EZ1 Virus Mini Kit (QIAgen) and from 6.6 Example 6 tissue samples using QIAamp Viral RNA Mini Kit (QIAgen). Morbillivirus detection was performed by amplifying a 155 Guinea Pig Sera bp fragment of L gene of morbilliviruses using conserved 65 primers (LPW12490 5'-CAGAGACTTAATGAAATT Guinea pig antiserum against the N protein of FmoPV was TATGG-3 (SEQ ID NO: 11) and LPW 12491 5'-CCAC produced by injecting 100 ug purified N protein of FmoPV. US 9,139,620 B2 43 44 with an equal Volume of complete Freund's adjuvant CO and inspected daily by inverted microscopy for cyto (Sigma), Subcutaneously to three guinea pigs. Incomplete pathic effects (CPE). After two to three weeks of incubation, Freund's adjuvant (Sigma) was used in Subsequent immuni subculturing to fresh cell line was performed even if there Zations. Three inoculations at once every two weeks per were no CPE and culture lysates were collected for RT-PCR guinea pig were administered. Two weeks after the last immu 5 for FmoPV. Immunostaining and electron microscopy were nization, 1 ml of blood was taken via the lateral saphenous performed on samples that were RT-PCR positive for FmoPV. vein of the guinea pigs to obtain the Sera. CRFK and Vero E6 cells that were positive for FmoPV by Such hyperimmune guinea pig antibody can be used for RT-PCR were fixed in chilled acetone at -20° C. for 10 min. diagnostic purposes or as a vaccine in the following ways: The fixed cells were incubated with 1:200 dilution of guinea 1. The recombinant nucleoprotein, N protein, can be used as 10 pig antiserum against the N protein of FmoPV, followed by the target antigen for detecting specific antibody against this 1:50 diluted FITC-rabbit anti-guinea pig IgG (Invitrogen). virus from cats' sera. Cells were then examined under fluorescence microscope. 2. The hyperimmune antibody can be used for immunohis Uninoculated cells were used as negative control. tochemical detection of viral protein in tissues or infected cell At the 8' passage, CRFK cells inoculated with a urine culture to confirm the specific presence of this virus. 15 sample (761U) positive for FmoPV showed CPE at day 14, in 3. The recombinant nucleoprotein can be used as a vaccine to the form of cell rounding, followed by cell detachment from induce antibody production. the monolayer and cell lysis. At the 16" passage, CPE were evident at day 10 with syncytia formation (FIG. 6). RT-PCR 6.7 Example 7 for FmoPV using the culture supernatants and cell lysates showed positive results in CRFK cells inoculated with urine Western Blot Analysis sample 761U and VeroE6 cells inoculated with supernatant of CRFK cells positive for FmoPV. Specific apple green finely Antibodies against the N protein of FmoPV were detected granular and diffuse cytoplasmic fluorescence was also in plasma samples of the 56 cats that were RT-PCR positive observed using serum from guinea pig immunized with and 401 cats that were RT-PCR negative for FmoPV by West 25 recombinant N protein of FmoPV or corresponding serum of ern blot. Western blot analysis was performed as described in the infected cat (FIG. 6). Electron microscopy showed an our previous publications (24, 25, 27), using 1000 ng purified enveloped virus with the typical “herring bone' appearance (His)-tagged (“(His)6” disclosed as SEQID NO: 10) recom of the helical N in paramyxoviruses (FIG. 6). Virions are binant N protein, 1:1000 dilutions of cat plasma samples, highly variable in size, ranging approximately from 130 to 1:4000 dilution of horse radish peroxidase conjugated goat 30 380 nm in diameter. No CPE and no viruses were detected by anti-cat IgG antibody and 1:10000 dilution of goat anti-cat RT-PCR in 3T3, B95 and CEF cells inoculated with the IgM antibody (Bethyl laboratories). samples. Among tested sera from the 56 cats that were RT-PCR positive and 401 cats that were RT-PCR negative for FmoPV. 6.9 Example 9 49 (76.7%) and 78 (19.4%) were positive for IgG against N 35 protein of FmoPV by western blot analysis respectively Immunofluorescence Antibody Test (P<0.0001) (FIG.9, Table 6). Among tested sera from the 56 cats that were RT-PCR positive for FmoPV, only 5 (8.9%) CRFK cells infected with FmoRV were fixed in chilled were positive for IgM against N protein of FmoPV. acetone at -20°C. for 10 min. The fixed cells were incubated Prominent immunoreactive proteinbands of about 69 kDa, 40 with 4-fold dilutions of plasma from 1:10 to 1:10240 from the consistent with the expected size of 68.7kDa of the recom 27 cats with necropsies, followed by 1:20 diluted FITC-goat binant protein, were detected in three of the six cat serum anti-cat IgG (Sigma). Cells were then examined under fluo samples shown in FIG. 9, indicating antigen-antibody inter rescence microscope. Uninfected cells were used as negative actions between the recombinant FmoPV N protein and control. Out of the 27 cats, immunofluorescent antibody was serum antibodies. Results of RT-PCR of the corresponding 45 detected from 7 cats with titer from 1:40 to 1:640 (see Table urine samples for FmoPV are also shown. 4, Supra). 6.8 Example 8 6.10 Example 10

Viral Culture 50 Neutralizing Antibody Detection Viral culture and electron microscopy were performed 100 TCID50 FmoRV were incubated with 2-fold dilutions according to our previous publications (28, 29). Two hundred of plasma from 1:10 to 1:25.60 from the 27 cats with necrop microliters of the three samples used for complete genome sies at 37°C. for 1 h. The mixtures were inoculated to 96-well sequencing were subject to virus culture. After centrifuga 55 plates of confluent CRFK cells. After 1 h of adsorption, the tion, they were diluted five folds with viral transport medium inoculums were removed and the plates were washed once and filtered. 200 ul of the filtrate was inoculated to 200 ul of with phosphate buffered saline and replaced by serum free MEM with polybrene. 400 ul of the mixture was added to MEM supplemented by 0.1 g/ml of L-1-tosylamide-2-phe 24-well tissue culture plates, with CRFK (feline kidney). B95 nylethyl chlormethyl ketone-treated trypsin (Sigma). The (marmoset B-cell), CEF (chicken embryo fibroblast), NIH/ 60 plates were incubated at 37°C. with 5% CO, for 7 days. The 3T3 (mouse embryo fibroblast) or Vero E6 (African green Supernatants were removed and the cell monolayers were monkey kidney) cells, by adsorption inoculation. After 1 h of washed once with phosphate buffered saline and fixed in adsorption, excess inoculum was discarded, the wells were chilled methanol at -20°C. for 10 min. The fixed cells were washed twice with phosphate buffered saline and replaced by incubated with 1:200 dilution of guinea pig antiserum against 1 ml of serum free MEM supplemented by 0.1 ug/ml of 65 the N protein of FmoPV, followed by 1:50 diluted FITC L-1-tosylamide-2-phenylethyl chloromethyl ketone-treated rabbit anti-guinea pig IgG (Invitrogen). Cells were then trypsin (Sigma). Cultures were incubated at 37°C. with 5% examined under fluorescence microscope. Cells infected with US 9,139,620 B2 45 46 neutralized FMoPV showed no fluorescence. FmoRV evidence of FmoPV infection (P<0.05 by Fisher's exact test) infected cells were used as negative control. Out of the 27 (Table 4). These results Support a positive association cats, neutralization antibody was detected from 6 cats with between FmoPV infection (RT-PCR and/or antibody positiv titer from 1:20 to 1:40 (see Table 5, supra), of which all were ity) and TIN in cats. positive for immunofluorescent antibody (see Table 4. Supra). The invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifica 6.11 Example 11 tions of the invention in addition to those described will become apparent to those skilled in the art from the foregoing Histopathological Examination and description and accompanying figures. Such modifications Immunohistochemical Staining of FmoPV N Protein 10 are intended to fall within the scope of the appended claims. in Tissues and Cauxin Protein in Kidneys All references cited herein are incorporated herein by ref To determine if FmoPV is associated with renal patholo erence in their entirety and for all purposes to the same extent gies, such as TIN, histopathology and immunohistochemistry as if each individual publication or patent or patent applica were performed on necropsy kidney tissues of two stray cats 15 tion was specifically and individually indicated to be incor with positive FmoPV RT-PCR in their urine samples as porated by reference in its entirety for all purposes. described below, showing histopathological features compat ible with TIN as well as detection of N protein of FmoPV in REFERENCES CITED IN APPLICATION the renal tubules by immunohistochemistry. Fixed necropsy organs of the two stray cats were embedded 1. Barrett T (1999) Morbillivirus infections, with special in paraffin. Tissue sections of 5 um were stained with hema emphasis on morbilliviruses of carnivores. Vet Microbiol toxylin and eosin (H&E). Histopathological changes were 69:3-13. observed using Nikon 80i microscope and imaging system. 2. Chua KB, et al. (2000) Nipah virus: a recently emergent Expression of FmoPV N protein was examined by immuno deadly paramyxovirus. Science 288: 1432-1435. histochemical staining. Tissue sections were deparaffinized 25 3. Halpin K, Young P L. Field HE, Mackenzie J S (2000) and rehydrated, followed by blocking endogenous peroxidase Isolation of Hendra virus from pteropid bats: a natural with 3% HO for 20 min, and then with 10% normal rabbit reservoir of Hendra virus. J Gen Virol 81:1927-1932. serum/PBS at room temperature for 1 h to minimize non 4. Moreno-Lopez J. Correa-Giron P. Martinez A. Ericsson A specific staining. The sections were incubated at 4°C. over (1986) Characterization of a paramyxovirus isolated from night with 1:250 dilution of guinea pig anti-N protein antise 30 the brain of a piglet in Mexico. Arch Virol 91:221-231. rum, followed by incubation of 30 min at room temperature 5. Osterhaus A D, et al. (1995) Morbillivirus infections of with 1:500 dilution of biotin-conjugated rabbit anti-guinea aquatic mammals: newly identified members of the genus. pig IgG, H & L chain (Abeam) (30). Streptavidin/peroxidase Wet Microbiol 44:219-227. complex reagent (Vector Laboratories) was then added and 6. Philbey A. W. et al. (1998) An apparently new virus (family incubated at room temperature for 30 min. Color develop 35 Paramyxoviridae) infectious for pigs, humans, and fruit ment was performed using 3,3'-diaminobenzidine and images bats. Emerg Infect Dis 4(2):269-271. captured with Nikon 80i imaging system and Spot-advance 7. Tidona CA, Kurz H W. Gelderblom HR, Darai G (1999) computer Software. Double staining of lymph node was per Isolation and molecular characterization of a novel cyto formed using mouse anti-human myeloid/histocyte antigen pathogenic paramyxovirus from tree shrews. Virology 258: antiserum MAC387 (DakoCyomation) and labeled with 40 425-434. Texas-red conjugated goat anti-mouse IgG (Jackson Immu 8. Stone B, et al. (2011) Fatal cetacean morbillivirus infection noResearch) (31). Cauxin protein expression was detected in an Australian offshore bottlenose dolphin (Tursiops according to a published protocol (32). truncatus). Aust Wet J 89:452-457. Histological examination of various organs of two stray 9.Young PL, et al. (1996) Serologic evidence for the presence cats with FmoPV detected in urine revealed interstitial 45 in Pteropus bats of a paramyxovirus related to equine mor inflammatory infiltrate and renal tubular degeneration or billivirus. Emerg Infect Dis 2:239-240. necrosis in their kidneys (FIG.10). In addition, there was also 10. Lau S K, et al. (2005) Human parainfluenza virus 4 marked decrease in cauxin expression in the degenerated outbreak and the role of diagnostic tests. J Clin Microbiol tubular epithelial cells, compatible with tubulointerstitial 43:4515-4521. nephritis in cats with histological evidence of TIN (FIG. 50 11. Lau S K, et al. (2009) Clinical and molecular epidemiol 11A), compared to cats without histological evidence of TIN ogy of human parainfluenza virus 4 infections in hong where cauxin-positive proximal straight renal tubules were long: Subtype 4B as common as Subtype 4A. J. Clin Micro observed between the inner cortex and outer medulla (FIG. bio 47: 1549-1552. 11B). Immunohistochemical staining of their organs using 12. Virtue E R, Marsh GA, Wang L. F (2009) Paramyxovii guinea pig serum positive for anti-FmoPVN protein antibody 55 ruses infecting humans: the old, the new and the unknown. revealed positive renal tubular cells in kidney sections and Future Microbiol 4:537-554 positive mononuclear cells in lymph node sections (FIG.10). 13. Lau S K, et al. (2010) Identification and complete genome Using mouse anti-human myeloid/histocyte antigen antise analysis of three novel paramyxoviruses, Tuhoko virus 1, 2 rum MAC387, the targets of FmoPV in lymph node sections and 3, in fruit bats from China. Virology 404: 106-116. were shown to be macrophages (FIG. 12). 60 14. Woo PC, et al. (2011) Complete genome sequence of a novel paramyxovirus, Taillam virus, discovered in Sikkim 6.12 Example 12 rats. J Virol 85:13473-13474. 15. Bart M. Guscetti F. Zurbriggen A. Pospischil A, Schiller I Case Control Study (2000) Feline infectious pneumonia: a short literature 65 review and a retrospective immunohistological study on Among 27 stray cats, TIN was observed in 7 of 12 cats with the involvement of Chlamydia spp. and distemper virus. evidence of FmoPV infection, but only in 2 of 15 cats without eff 159:220-230. US 9,139,620 B2 47 48 16. Chatziandreou N, et al. (2004) Relationships and host 32. Miyazaki. M. et al. (2007) Tubulointerstitial nephritis range of human, canine, simian and porcine isolates of causes decreased renal expression and urinary excretion of simian virus 5 (parainfluenza virus 5). J Gen Virol 85:3007 cauxin, a major urinary protein of the domestic cat. Res Vet 3O16. Sci 82:76-79. 33. Chard L. S. Bailey DS, Dash P. Banyard A C, Barrett T 17. Herrewegh AA, Smeenk I, Horzinek MC, Rottier P.J. de 5 (2008) Full genome sequences of two virulent strains of Groot R J (1998) Feline coronavirus type II strains peste-des-petits ruminants virus, the Cote d'Ivoire 1989 79-1683 and 79-1146 originate from a double recombina and Nigeria 1976 strains. Virus Res 136:192-197. tion between feline coronavirus type I and canine coro 34. Visser I K, et al. (1993) Fusion protein gene nucleotide navirus. J Virol 72:4508-4514. sequence similarities, shared antigenic sites and phyloge 18. Siegl G. et al. (1985) Characteristics and taxonomy of 10 netic analysis Suggest that phocid distemper virus type 2 Parvoviridae. Intervirology 23:61-73. and canine distemper virus belong to the same virus entity. 19. Truyen U (2006) Evolution of canine parvovirus—a need J Gen Virol. 74: 1989-1994. for new vaccines? Wet Microbiol 1 17:9-13. 35. Terai M., Burk R D (2002) Felis domesticus papillomavi rus, isolated from a skin lesion, is related to canine oral 20. King A M Q, Adams M.J. Carsten E. B. Lefkowitz EJ 15 papillomavirus and contains a 1.3 kb non-coding region (2012) Virus Taxonomy. Ninth report of the International between the E2 and L2 open reading frames. J Gen Virol Committee on Taxonomy of Viruses (Elsevier, San Diego) 83:23O3-2307. pp 111-122. 36. Whittemore J C, Hawley J. R. Jensen WA, Lappin MR 21. King A M Q, Adams M.J. Carsten E. B. Lefkowitz EJ (2010) Antibodies against Crandell Rees feline kidney (2012) Virus Taxonomy. Ninth report of the International (CRFK) cell line antigens, alpha-enolase, and annexin A2 Committee on Taxonomy of Viruses (Elsevier, San Diego) in vaccinated and CRFK hyperinoculated cats. J. Vet Intern pp. 235-248. Med 24:306-313. 22. Knipe D M. et al. (2007) Fields Virology (Lippincott 37. Lappin MR, et al. (2005) Investigation of the induction of Williams and Wilkins, Philadelphia), pp 1551-1586. antibodies against Crandell-Rees feline kidney cell lysates 25 and feline renal cell lysates after parenteral administration 23. Lau S K, et al. (2011) Identification of a novel feline of vaccines against feline viral rhinotracheitis, calicivirus, picornavirus from the domestic cat. J Virol (In press). and panleukopenia in cats. Am J Wet Res 66:506-511. 24. Lau S K, et al. (2005) Severe acute respiratory syndrome 38. Lappin MR. Basaraba RJ, Jensen WA (2006) Interstitial coronavirus-like virus in Chinese horseshoe bats. Proc nephritis in cats inoculated with Crandell Rees feline kid Natl AcadSci USA 102: 14040-14045. ney cell lysates.J Feline Med Surg 8(5):353–356. 25. Woo PC, et al. (2005) Characterization and complete 30 39. Kul O, Kabakci N, Atmaca HT, Ozkul A (2007) Natural genome sequence of a novel coronavirus, coronavirus peste des petits ruminants virus infection: novel pathologic HKU1, from patients with pneumonia. J Virol 79:884-895. findings resembling other morbillivirus infections. Vet 26. Guindon S, et al. (2010) New algorithms and methods to Pathol 44:479-486. estimate maximum-likelihood phylogenies: assessing the 40. Liess B, Plowright W (1964) Studies on the Pathogenesis performance of PhyML 3.0. Syst Biol 59:307-321. 35 of Rinderpest in Experimental Cattle. I. Correlation of 27. Woo PC, et al. (2004) Relative rates of non-pneumonic Clinical Signs, Viraemia and Virus Excretion by Various SARS coronavirus infection and SARS coronavirus pneu Routes. J Hyg (Lond) 62:81-100. monia. Lancet 363:841-845. 41. Saito T B, et al. (2006) Detection of canine distemper 28. Li IW, et al. (2009) Differential susceptibility of different virus by reverse transcriptase-polymerase chain reaction in cell lines to swine-origin influenza A H1N1, seasonal 40 the urine of dogs with clinical signs of distemperencepha human influenza A H1N1, and avian influenza A H5N1 litis. Res Vet Sci 8.0:116-119. viruses. J Clin Virol 46:325-330. 42. Marschall J. Hartmann K (2008) Avian influenza A H5N1 29. Peiris JS, et al. (2003) Clinical progression and viral load infections in cats.J Feline Med Surg 10:359-365. in a community outbreak of coronavirus-associated SARS 43. Martina BE, et al. (2003) Virology: SARS virus infection pneumonia: a prospective study. Lancet 361:1767-1772. 45 of cats and ferrets. Nature 425:915. 30. Chan K H, et al. (2010) Wild type and mutant 2009 44. van Riel D. Rimmelzwaan G. F. van Amerongen G. Oster pandemic influenza A (H1N1) viruses cause more severe haus AD, Kuiken T (2010) Highly pathogenic avian influ disease and higher mortality in pregnant BALB/c mice. enza virus H7N7 isolated from a fatal human case causes PLoS One 5:e 13757. respiratory disease in cats but does not spread systemically. 31. Susta L., Torres-Velez. F. Zhang J. Brown C (2009) An in 50 An I Pathol 177:2185-2190. situ hybridization and immunohistochemical study of 45. Chomel B B, Sun B (2011) Zoonoses in the bedroom. cytauxZoonosis in domestic cats. Vet Pathol 46: 1197–1204. Emerg Infect Dis 17:167-172.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 28

<21 Os SEQ ID NO 1 &211s LENGTH: 16 O5 O &212s. TYPE: DNA <213> ORGANISM: Feline morbillivirus

<4 OOs SEQUENCE: 1

accagacaaa gatgtttgttg acct attcta acgacaagac tatt attaaa tatttaggaa 60

US 9,139,620 B2 51 52 - Continued

Cacaggaggg aaattagcct cacctgggat ggagactaca ttatt.cgaga ggagtggtgc 252O aaccc.catct gtacac cc at atact caa.cc tdcaag.cgac ttcaatgtag gtgcaa.gcaa. 2580 tgtc. catcaa cctgcc ctaa atgtgaataa taattgcaat gatgg taggg taa.ca.gc.gc.c 264 O taact cacat aaagatat cq agggtgagtic tdaaatat ct attcaagata tatataactt 27 OO gatt cittgga tittaaggatg attacaggaa attatcaaac aaattagata togg tatt aga 276 O gatgaaacaa gacattgaca atctaaaaaa gaatagtgct aaagtgcaat toggctictatic 282O aact attgag giga catctat coagtgttat gattgc.catc cct ggttcag g tattgattic 288O

Cacaggggat gaggaaaagg at Cagataaa ttctgactta aaaccactgc tagga aggga 294 O t cattgtaga gcattt coag aagttaccaa toctictagat gag tott cac tagccaattic 3 OOO tccaacaaaa catgttgcca agg taaacaa aaactgcact citt cagaaga t caacaagaa 3 O 6 O cgaalacat cit gcaatcaaat ttgttcc tag tdacagt cat gcaag cacat caaccat cag 312 O atcaattatc aggtoatcta atctogatca ggatttgaaa acaaaattgc ticaca attct 318O atcc.ca.gatt agaggggcag acaat attag agaattictat gaaaaggitta tatattaat 324 O aaagaataag aattaaat at tacaaatcta catt cattat aggttgtaat tdt cittcaat 33 OO aagatttggit cagttt cata tatatggitta ttgatttgttgataattataa aaaact tagg 3360 agctaaaggit tacticagt ca tatacagoat gactgagata ttcaacctitg atgagagctic 342O atgg to agtic aaagggatac tagat cogitt aac acctgat accitat cct g atggit cqact 3480 agtgcctaaa gttcgagitta t catc.cggg totaggagat cqcaagagtggggggtatat 354 O gtacct actt Ctt catggtg tcatagaaga tagtgagact ataattagcc caaaggaag 36OO agcatttggit gcatt CCC at taggagtggg toaatcaact gaaaacccgg alagacittgtt 366 O taaggaaata ttaact ct ca acatcgtgac togtagg act gctggattta atgagaaatt 372 O ggitt tatt at aataccacac citctacattt actgaccc.cc toggaaaaaag togttggcata 378 O tggaggcatt tittaatgcta at caggtotg cagtgataca agttc catac caataga cat 384 O tccacaaaaa tittaggc.cag tatatttgac tdttacaaaa ttatctgatg atggct atta 3900 t cagat coca aagatgattic aagatttcaa atcgtcaaat tctgttgcat t caa.catcct 396 O tgtgcatctg. t caatgggca taaatttact tdaccaatcc aaggaccct a gattaagaaa 4 O2O tgctgcagaa actgtgatca catttatgat t catattgga aactittaaac gigaagagtaa 4 O8O taagtc.ttac to acctgaat attgcaagag gaaaataatg aggctgggitt taatatt ct c 414 O attaggtgca attggtggca Caagcttgca tattagatgt acagg talaga tigagcaaacg 42OO actacaggct tatttaggat tcaaaaggac tittatgttac cctittgatgt atgttaatga 426 O agggctgaac aagaccCtgt ggagalagtga atgcagaata gagaaggttcaag cagt ctt 432O acagc.catca gtc.ccgaatgaatttaagat atatgatgat gtt attattgataataccala 438 O tggit ct ctitc aagattaaat agactataac aataataaac agctact aaa tag tatt atg 4 44 O tatttalagtg tacactgata attgc gaata aaatacacca gattaataac agtatagagt 4500 taagat citaa ttgatatgtg ggttgg tact catcattta ttagctic tac tdattatcta 456 O tat cittgaat caccaaatgt aagagcatca acagg taata agttittggat togctagattg 462O acacttaatt ct cagaacta gaatacccag attgttcaaac ctata acctt gttagattica 468O ttaaagttag attcttgtaa togttgat caa titat cactitg agcaattata aaaaactaag 474. O gacctaatgt aataggaacc caaacticcat coagtgagct ctaaatcgcc atgcttgaat 48OO US 9,139,620 B2 53 54 - Continued attaattitat c tagggcc td totaacticag aacaaagat.c acaac tagag totaaaggag 486 O tggg to aagt ctdaacaatt atcaa.gagcc gagattcaaa actgatt cot cottaaactic 492 O agaaccctaa caatatat catcc acticaac at catgaaca gaattaaggit tatgataatt 498O agttctitt at tattat caga tattacgatt gcacaaatag gttgggataa tittgactitcg 5040 attggagitta taagtact aa goaatacgac tataaaataa citact ctdaa cactgaccag 51OO ttaatggitta taaagatggit toctaatata t catcaatca ttaattgcac taaact cqaa 516 O ttaacaaaat atagagagtt agt ct caggg at cattagac caataaatga gtc attagaa 522 O ttaatgaatt catacattaa catgaga.gca ggttcagaga gatttatagg ggctgtaata 528 O gctggtgtag cct taggagt ggcaactgca gcacaaataa Cat Cagggat tcc.ctacat 534 O aattcaatta tdaacaaaaa acaaatacaa gaattgagga aggct cittag tactaccaac 54 OO aaagcaattig atgaaataag gattgcaggt gaaagaa.cat taatagcaat it calaggtgta 546 O caggattata ttaataatat aattatcc ct atgcaggaca aactic caatg tdatattitta 552O t cat cacaac tittctgttgc titt acticaga tattatacaa atatactaac agitttittggg 558 O c caagtatac giggat.cct at tact agtaca attt cagtac aag cact cag toaa.gcatt c 564 O aatggtaatc tt Caggcatt gcttgatgga citggggtata ctgggagaga Cttacgtgat st OO cittctagaga gtaaatctat cactggc.cag ataatt catg cagatatgac tdatttgttc 576. O cittgttittga gaataaatta t cct tccata actgagatgc agggagtaac aatatatggg 582O citcaattcaa ttacatatica tattgggcct gaagagtggit ataccattat gcc tigattitt 588 O attgctgttc agggittttitt aat at Ctaat tttgatgaga gaaagttgttc agtalactaala 594 O t caagtatat tdtgccaa.ca aaattcaatt tacccaatgt caacagagat gcaaagatgt 6 OOO attalagggcg agataagatt Ctgtc.calaga t ccaaggcaa ttgggacatt agittaatcgg 6 O6 O tittatattga ccaaaggtaa tittaatggct aattgtt tag ggattatatg cagatgttat 612 O actt caggac aagttataac acaag accca agtaaattga ttacgataat atcgcaa.gag 618O gagtgcaagg aagttggtgt tatgg tatt Cdt attatgg taggacctag aaaattacca 624 O gatattacct ttaatgctag gttggaaatt ggtgtaccaa tat cattgag caaattggat 63 OO gtcggg actg atttagcg at togctt cagct aaacttaata attctaaggc attgttagag 636 O caat cagata agattittaga ttcaatgtct aaattggatt citatgaattic aagaataata 642O ggattaatct tag caattat gataatctitt ataat catta t tact attat citggat cata 648 O tataaaaaat gtaggaataa agataataaa titcagtactt caattgaacc gct ctacata 654 O cc.ccct tctt ataact cacc ticata.gtgtg gttaagticta tittgagcact gaccatatga 66OO tccactgtaa taagtic caat gaaagtatica attaataata ttgg tagtgc aatgagtatt 666 O gattgtataa tatact cott taalactagat agtgataaag ggittatagat gattt cagtt 672 O attittaatat aat catatat tdattittatt atc.ttacatg act attatgt aattgaatta 678 O. tgttgtcatca attaatagct taataatat c gtttaatgta cittatattga tiggatagatg 6840 tgttatattg taatcaagga tittag tattt agaaaaggaa agagtttaat ttgttgttaa 69 OO ttagittattg td tatt caat tagaaaaaac ttaggaatcc atgttaataa aaatttatta 696 O t catggagtic caacaatatt aag tattaca aagattic tag ccgg tactitt ggtaaaatat 7 O2O tagatgaaca caaaacaatt aatagt caat tdtacagttt gagtat caag gtaattacca 708 O ttattgct at tattgtaagc ctdattgcaa caataataac tattatcaat gcc act agtg 714. O ggagaactac cctaaatagt aatacagaca tact acticag ccaacgagat gagatt cata f2OO US 9,139,620 B2 55 56 - Continued a catccaaga aatgat attt gatcg tattt atcctittgat aaatgctatgagtacagagc 726 O tagg acttica tatt cotacct tattggatgaact tactaa agcgattgac cagaaaatta 732O aaataatgcatcct cotgtg gacactgtga cittctgacct taattggtgc atcaaac ccc 7380 ctaatggaat tat catagac ccaaaaagtt attgtgagag tatggaattig totaaaactt 744. O atgaactgtt acttgaccag titagatgtct caagaaagaa at cact tatt ataaatagaa 75OO agaatat caa ccagtgccaa ttagttgata attcaaagat catttittgct actgtcaa.ca 756 O tacaatctac accogaggttt ttaaactittg gtcacacggit cagcaat caa cqtataacat 762O ttggtcaagg alacatatagt agtactitatgttatalactat ccaagaagat ggagtaactg 768 O atgttcaata t cagtgttt gagat.cggat at atttctga t cagtttggit g tatt cocct 774. O CCttaatagt atcgagagtg ttgc.cgatac gitatgctatt aggaatggala t c ctgtacct 78OO tgacaagtga tag act aggc ggg tatttitt tatgtatgaa tacactgaca cqatctatat 786 O atgattatgt tag cataagg gatttgaaat cactittatat aacaatc cct cattatggta 7920 aagttaatta tact tactitt aattittggta agat caggag cccacatgag attgataaaa 798 O tittggittaac atctgataga gqccaaatta t citctggitta ttittgcagoa tttgttacca 804 O ttacaatt cq gaactataat aattatcc ct acaaatgctt aaataac cca tdttittgaca 81OO actctgagaa ttactgtaga ggatggtata aaaacataac aggaactgat gatgttc.cga 816 O tatt agcata cittattggitt gaaatgtatg atgaggaggg acctittaatt acacttgttgg 822 O caataccacci ttacaattat acagotc.cat ct cataattic tictitt actat gatgacaaaa 828O ttaataaatt aataatgact a catctoaca taggittatat tcaaatcaac gaggtgcatg 834 O aggtaattgttggcgata at ttgaaggcta t cotcittaaa cagattgtct gatgaac atc 84 OO Ctalacctgac to Ctgtaga ct caat Cagg gtattaagga gcaat acaa.g. tctgacggaa 846 O caataattitc aaattctgca cittattgata tacaagaacg aatgtacatt acagttaaag 852O ctatt coacc agcagg taac tataactitta cagttgagtt gcattctaga t caaacacat 858 O cctatotatic gttaccaaaa cagtttaatg ctaagtatga caaattacat cittgagtgct 864 O ttagctggga caaatcCtgg toggtgtgctic tataccc.ca gttitt catta agttggaatg 87OO aatc.cc tittctgttgatact gcc attitt ca atttaataag citgitaaatga acacatcaat 876O citat agttga tagttgttcaa aac attagct aatttgggitt taagaaatag gaaaatgaaa 882O ttaccalatat ctaattagat g tatgttcaa got aaattac aaaaaactta ggagt cagag 888 O actitcgttgc aatggagcag toagact acc aagat attct at acccggaa gtacat citta 894 O acagtic citat agtaattitcc aaattagtag g tattittaga atacgcc caa attgct cata 9 OOO atcaacaatt atcagaccgt acaattatca agaat attca atttagatta aggaacggat 906 O ttaatagttcaaggg tacag gtact at cag c tatgggtga aattatcaac aaaattagaa 912 O ataaatat co taattattta cacatacctt accctgaatg caaccaaaaa citattitcgaa 918O tagtag atco agaactaa.ca totaaaattag aatct cittct aaacaaaggit gacacactgt 924 O atct caagat t catcagat at cataaaat gttittgatag attgaaaatgaaaatgaata 93 OO taaagaatga t cittcttaat gacaatagt caattgattct agatct tcct ttaattatca 936 O aaggat.ctica gtggttctitc cct tttitt at tctggitttitc tat caaaact gaalactagaa 942O gctg tatt cq ccaaaatcaa aag acticgtg ttagat caca at atcggcct cactitat cag 948O agactaagag aattacattg gttgttacat citgatctgat tacaatattt gat catatta 954 O US 9,139,620 B2 57 58 - Continued ataaatgitat attittatctg acttittgaga tigctgttaat g tattgcgat gtgatagaag 96.OO gtcggittaat gactgaaa.ca gctatgagct tactgtcg gtttaccaat ctattgc.cala 966 O gagtgcaata tatgtgggat ttact agatg gaatgtttga aagtttaggc aat caattat 972 O attcagtt at tdcatt atta gag cct ctitt citcttgctta tittgcaattgatagatgcag 978 O. atccacagat t cqgggaaca ttcttgcatc actgcttitt.c cqagittagaa gaaattatat 984 O ttgacaaaac cccttittgat cottttgttgt atgaaaattit aattaatggg cittgattaca 9900 tittatttgac aggtgatatt catctaactg cagaagttitt ttctttittitt agaagttittg 996 O gtcatccttt tttagaggca caaaatgctg ctaataatgt aaggaagitat atgaataagc OO2O ctaagg taat at catat cag actittaatgc aagga catgc gattittittgc gg tattataa OO8O taaatggatt tagaga.ccgc cacgggggaa catggcct Co ttggagitta C caaatcatg O14 O

Catctgctgt aattagaaat gcc cagtt at Ctggaga agg gttaa Catct gaacaatgtg O2OO citcaac actg gagatc ctitt tdtggattta gatttaaatgttt tatgcca ttgagtic tag O26 O at agtgacct tacaatgtac Cittagagaca aggcgctgtc. acctgtcaga aatgagtggg O32O attcagttta togctaaggag tatttaaggt ataatcc agg attacccaca agttccagaa O38O gattgg taaa totatt citta gaagatgata agtttgaccc atatgaaatg at catgitacg O44 O tgataaatgg tdattactta agaga caaag agtttaacct tt catacagc cittaaagaga OSOO aagaaattaa agagg taggit cattgtttg ctaaaatgac ctataagatgagggcttgtc. O560 aagtaatagc tigaaaacctg attgccaatig gag tagggala gtttittcaaa gataatggaa O62O tggcaaaaga tigalacatalaa ttalactalaga Citta Cacaa attagcCatt to aggtgtac O68O ctaaagataa ttctaaactt tatttagatgaatgttggga gcaagtaatt cqacaatgtt Of 4 O Caagtag tac acagataagg galacagacta taatticaca atcaaatagg galaattgaat O8OO caaagt ctitc tagggcacgt Cittaataata gagat at Ctt aaagggcaag agagatt.cga O 860 acaaacaagt aaagtatic ct tcaaacaccg agtattatga gacitat cagt agttt cataa O92O c tactgacct taaaaagtat tdt cittaact gg.cgatatga atcaagtagt atgtttgcag O98O agagacittaa tdaaattitat gigact gcc tig gatttitt coa gtggctt cac aagattittgg O4 O agaaatctgt totatacgtt agtgatccat c tagt ccacc tdactittgat caa.catgtcg 1OO atatagaatc agt cccaaat gaccatat ct titat Caagta CCC gatgggit ggaatagagg 16 O ggttctgtca aaaattatgg accattagta caatticcgtt cot at attta gcagottttg 22 O atacaggggit tagaat ct cat cattggttcaaggcgataa C caggcaatt gcagtalacca 28O aaagagttcc gtcatc.ttgg agttacticaa agaaaaagga agaat caact aaaataacaa 34 O cacaat attt tottaattta agacaacgct tacacgatat agg to atgaa ttgaaagcaa. 4 OO atgagact at tatat cotct catttctttgtttactictaa agg tattitat tatgatggaa 460 tact tct citc ccaggc actt aaaagtattg caagatgtgt cittittggtct gaaacgattg 52O ttgatgagac tagg to agct tcagtaata tat ctacgac act cqcaaag gcaattgaaa 58 O ggggittatga taaatttgtg gcgtacgcta t caat attta taaaacaata catcaggtgt 64 O tgattgcatt gtc.ctttacg attaatcc tactatogacacic agacattaca gaacctittct 7 OO acaagagttt agatct actt aagaatctag ttctgatt.cc togcac catta gggggcatga 760 actatatgaa catgagcagg ttatttgtta ggaatatagg agat.cccatt actgctt cat 82O ttgctgat at aaa.gc.gcatg attgaatgtgggttgttagg atgtag tatt Ctgtcacaaa 88O taatgtacca aaaatgtggit to citccaaat acttagactg. g.gctagtgat cottatt caa 94 O US 9,139,620 B2 59 60 - Continued taaacct tcc titatagocaa agtatgacca aggttittaaa aaatgtaacg gcaagatatg 2 OOO tact tatgca tagt cc caac cctatgctica aagatttgtt ccatgaaaag tot caggaag 2O6 O aagatgaaat cottgctgag tittctgttag accoacactt aataatc cct agagcagolac 212 O acgagattitt atcaaattica gtaac aggtg ctagagaatc tatagcaggt atgcttgaca 218O Ctacta aggg tttaatc.cgit gctag tatgt Caagaggtgg gttgacctica t cacttgttt 224 O taaaattatc aacatatgat taccalacagt ttagaacatgtc.ttgaatgg ctittatgctic 23 OO c tactacggg aattgctgta agcgttgatt cittgctctgt attcttagct aagac catcc 2360 ggaagagaat gtgggttcac ctaactaaag gaagggagat titatgggitta gaagtacctg 242 O acattttgga atgitatgcaa aacaat atta ttgttgatca cqaagattgt tact catgta 248O ttcaaggat.c aagatatt at acatggtttt ttgtacct tc aaattgtcaa citcgatcaaa 254 O taaataagtic aacaaattct citcc.gagtac cittatgttgg atcaacaact gaagaaagga 26 OO gtgatatgaa gttgtcat at gtgaggtoac Ctagt cq9cc acttaaagca gcagttctgaa 266 O ttgcagcagt atatacatgg gct tatggtg atgataattt gtcttgg cat gaagcttggit 272 O atttagcaag gacitagagca aat attactt ttgacgaact caaattaata acaccitatag 2780 ctacatctac aaatttagca catagattga gagatagaag cacticaagtt aaatatt cag 284 O gaacttctitt agtaagagtg gcacgctata caacaat atc taatgataat atgtcgttca 29 OO ttattaataa caaaaaagtic gatactaatt ttgtc.tacca gcaaggaatgttattaggitt 296 O tgagtatatt agaatatata titcagatact gtacaagtac toggacagtica aac actgtaa 3O2O ttcact taca tdcagatgtt aattgttgta tag tacagat gactgat cag ccttatacac 3O8O caagcttaac aaaaaagcta cct gat atta gg.cccattaa taataaact g atatatgat c 314 O cggctic citat aatcgatacc gatgcagota ggctatatto ccaaaaatac ctdt cacatt 32OO taatagattt CCCaagttgg tdaact actic agcttalacac agtgttggcg aaagtggtgg 326 O cggitat coat tdtagaatta attacaaaag c tagtaaaga ccatctoraat gagataatag 332O cagttgttgg tdatgatgat at caatagct ttattacaga atttic tactt gttgatccac 3380 gtctgtttac actatattta ggc caataca cat cattaca atgggcatat gaagt cc att 344 O at Catagacic agtgggtaaa taccagatgg ctgaagttgtt gcataatttg Ctgtcaagag 3500 c tagtagagg tatatt cago at attgacca atgcc tittag ccaccc.caga gtctacaaaa 3560 gattctggga gtgtggittta ttggagccta titt atgggcc ctatatagga agt caaaatc 362O tacataatgc aatgattgat tatatictata atgcatacat tact tatttg gatgct tatt 3 680 tatctgat ca agtagatgat actgat atta taatatgtga aacagaggag acatgtttgg 37.4 O cgaatcgaat tdacaattat caaag cagac acttagctgt gcttatagat citg tattgttg 38OO attic cactag atgtcc caat ataaaagggg cagatacaat tatgagaaac toaattctta 386 O gatctitt cat tdataatgag aggagaacaa atccact cqg tttgacatgg aaccttgacc 392 O cgttact.cgt gigatcatttit agctgttcta ttacgitat cit gaggagaggit attattaaac 398 O agatgaggitt aagatttgat C caagtgt at C9ttggaact atctaggatg attaa.gc.ctg 404 O atgcggittta t caagcacct aaaattic.cgt citt catgggc ticittatagat atcaa.ccctg 41OO aagtaaatga cct taatgta atttittggag agctgaatag caaatggaaa gacattccta 416 O ttggacagat taggatacag aattatgaaa tacatgcata taggaggat.c ggagittaatt 422 O caactgcatgttataaagct citagagct at tdtctgttct aaatcggittt atgtctaatc 428O US 9,139,620 B2 61 62 - Continued catcaggtgc attgtttitta ggtgaaggag caggat caat gctggtcaca taccgtgctt 434 O ttgtcc catt taagacaatt tattataata gtgg tatttic agttcaaaat gttcagggcc 44 OO agagagaatt gag totatat c catctgaag tecact agt tacaacaaa aatcgcttgg 4 460 ctaatgaccc caatat caaa gttcttgttca atggtaalacc agagt citacg tdggttggaa 452O a catcgactg ttittgctitat attcttagcc acattgagac citcaa.gctitg acattgatac 458 O at agtgat at tagtc.ca.gc tita agcaaga Caagaataa aattcttgag gagctgtgcc 464 O acattctgtc. aatggcactic attittgggga aaatcggat.c titt attagtt gtcaagttat 47 OO taccaagggit cqgtgact at acg tatt cat tittgcaggta togcatcggaa ttctatoaac 476 O aaagcct c ct tdttttacct aggtttagta acatgtcatc atctgaggitt tactatatag 482O ggattic acct caatacaaat cqattgattg atcctgatag aatag tacaa tacatagitta 488 O gaaatttaca accaacticca gttacatttt tdtcc tatat ttittgaaact aagtatagaa 494. O ataatatggit tacaaattat gigactgtgct tdt cagacgg acacaaaagt gattacctgt 5 OOO catcaattac aaaaatagag aacgttcttctgt catgtgg gttagaattgaatgg accta 5060 agattataca gcaattatca gga catgact atgctaatgg ggagact agt ctagaat Caa 512 O gtataatgat attagttaga gaatat citta atgcaactat acaaggc.cgg gaaac attag 518O gcttgtttitc acct taccca gtc.ttacatg agagt cagtt aagagaaatt aataagtgta 524 O ttgcattgaa atatgttgta tat citact ct tittattoaag citctacatta t c tagtaaac 53 OO aaataatgag taatcttaga aagggaat at tdatgitatga tittgagagat gaatttittca 536 O tat Caagatt gttcagcaa at tacaagaaaa aggtgatgtc. acaagaagtic alaalactacct 542O ggat ctittaa tottgatact c coacacgaa aag cattata taagttagta ggittatt cat 548 O taataattaa totatgtatga tigatagagta tdattatcca totttaaaag agtaagataa 554. O tat cagatgt atgata acca attaagtatt acttittgaat togaaaggttg ct caattaca 5 6.OO cgcttttitta gtaatcgggt ttittatt coa attagggcaa ttagaaaaaa cittcaacggit 566. O tagt cdagcc cqaatt catt coatataagt tatatttata atc.ttggata agactitttgt 572 O ttagaattat aacagtaata ctaattitatgaatggaagac aattgatatic tagtgtgaat 578 O. tittatgttta totgtc.ttaa accittatact cactataatt gttctittatt tdagaattta 584 O attataggtg tittatgtgtt atgtgatggg aac catcagt gctgacatta ttaataacca 59 OO tagg tattgt atgggatagt gtttatttac taccalatgta caatctorata tdtcggaccc 596 O citcaiac ct co toctitatagt tdagttittct ggaaaaacac aaaagatgat cittgagtaat 6O20 tgitacggacc tatagottt c tttgtctggit 6 OSO

<210s, SEQ ID NO 2 &211s LENGTH: 16 OsO &212s. TYPE: DNA <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 2 accagacaaa gatgtctgtg acct attcta acgacaagat tattact aaa tatttaggaa 6 O taacgatt CC attagtgagg taggaggag gaat Caggta t t c cacaatig tictagt ctat 12 O tgaggt cact tctgcattt aagagacata gggagcaa.cc alacagcaccg. t caggttcag 18O gtgg tacaat taaaggattgaaaaatacaa ttattgttcc ggttcCaggg gatacagtaa 24 O ttact acaag gtctaatttgttatttagat tagtttatat aataggcaat coggatacac 3OO ctittaa.gcac ct coacggga gcaataatat cattgttgac cct atttgtc. gaatcto cag 360

US 9,139,620 B2 65 66 - Continued gatt cittgga tittaaggatg attacaggaa attatcaaac aaattagata togg tatt aga 276 O gatgaaacaa gacattgaca at cittaaaaa gaatagtgct aaagtgcaat tagctictatic 282O aact attgag giga catctat coagtgttat gattgctato cct ggttcag g tattgattic 288O Cacaggggat gaggaaaagg accagataaa ttctgactta aaaccactgc tagga aggga 294 O t cattgtaga gcattt coag aagttaccaa toctictagat gag tott cac tagccaattic 3 OOO tccaacaaaa catgttgcca agg taaacaa gaactgcact citt cagaaga t caacaagaa 3 O 6 O cgaalacat cit gcaatcaaat ttgttcc tag tdacagt cat gcaag cacat caaccat cag 312 O gtcaattatc agg to atcta atctogatca ggatttgaaa acaaaattgc ticacaattitt 318O atcc cagata agaggtgtag acaat attag agaattictat gaaaaggitta tdatattaat 324 O aaagaataag aattaaat at tacaaatcta catgcattat aggttgtaat tdt cittcaat 33 OO aagatttggit cagttt cata tatatggitta ttgatttgttgataattataa aaaact tagg 3360 agctaaagat tacticagt ca tatacagoat gactgagata ttcaacctitg atgagagctic 342O atggtcagtic aaagggacac tagat cogct aac acctgat accitat cct g atggit cact 3480 agtgcctaaa gttcgagitta t catc.cggg totaggagat cqcaagagtggggggtatat 354 O gtat ct actt Ctt catggtg tcatagaaga tagtgagact ataattagt c caaaggaag 36OO agcatttggit gcatt CCC at taggagtggg toaatcaact gaaaacccgg alagacittgtt 366 O taaggaaata ttaact ct ca acatcgtgac togtagg act gctggattta atgagaaatt 372 O ggitt tatt at aataccacac citctacattt actgaccc.cc toggaagaaag togttggcata 378 O tggaggcatt tttaatgcta at Caggtctg. Cagtgataca agttcCatac CaatagaCat 384 O tccacaaaaa tittaggc.cag tatatttgac tdttacaaaa ttatctgatg atggct atta 3900 t cagat coca aagatgattic aagatttcaa atcgtcaaat tctgttgcat ttaa.catcct 396 O tgtgcatctg. t caatgggca caaatttact tdaccaatcc aaggaccct a gattaagaag 4 O2O tgctgcagaa actgtgatca catttatgat t catattgga aactittaaac gigaagagtaa 4 O8O taagtc.ttac to acctgaat attgcaagag gaaaataatg aggcttggitt taatatt ct c 414 O attaggtgca attggtggca Caagcttgca tattagatgt acagg talaga tigagcaaacg 42OO actacaggct tatttgggat tcaaaaggac tittatgttac cctittgatgt atgttaatga 426 O agggctgaac aagaccCtgt ggagaaatga atgcagaata gagaaggttcaag cagt cct 432O acagc.catca gtc.ccgaatgagtttaagat atatgatgat gtt attattgataataccala 438 O tggit ct ctitc aagattaaat agactataac aataataaac cqccaccaaa togg taccatg 4 44 O tatt caagtg tacactgaca attgc gaata aaatatacca gattaacaac agtatagagt 4500 taagat citaa ttgatatgtg ggttgg tact catcattta ttagctic tac tdattatcta 456 O tatic ctaaat caccaaatat aagagcatca acagg taata agtttgggat togctagatta 462O at acttaatt ct cagaacta gaatacacag attgttcaaac ctataatctt gttagattica 468O ttaaagttag attcttgtaa togttgat caa titat cact cq agcaattata aaaaactaag 474. O gacctaatgt aataggagcc caaattic cat coagtgagct ttaaatcgcc atgcttaaac 48OO attaatttgt ccagggccta t ctaacticag aacaaagat.c acaac tagag totgaaggag 486 O tgggittaagt ctdaataatt attaa.gagitt gagatttaaa actgatt cot tottaaattit 492 O agaattittaa taatatat catcc attcaat at catgaaca ggattaaggit tataataatt 498O agttctitt at tactat caga tattacgatt gcacaaatag gttgggataa tittgactitcg 5040 attggagitta taagtact aa goaatacgac tataaaataa citact ctdaa cactgaccag 51OO US 9,139,620 B2 67 68 - Continued ttaatggitta taaagatggit toctaatata t catcaatca ttaattgcac taaact cqaa 516 O ttaacaaaat acagagagtt agt ct caggg at cattagac caataaatga gtc attagaa 522 O ttaatgaatt catacattaa catgaga.gca ggttcagaga gatt Catagg ggctgtaata 528 O gctggtgtag cct taggagt ggcaactgca gcacaaataa Cat Cagggat tcc.ctacat 534 O aattcaatta tdaacaaaaa acagatacaa gaattgagga aggct cittag tact actaac 54 OO aaagcaattig atgaaataag gattgcaggt gaaagaa.cat taatagcaat it calaggtgta 546 O caggattata ttaataatat aattatcc ct atgcaggaca aactic caatg tdatattitta 552O t cat cacaac tittctgttgc titt acticaga tattatacaa atatattaac agitttittggg 558 O c caagtatac giggat.cct at tact agtaca gttt cagtac agg cact cag toaa.gcatt c 564 O aatggtaatc tt Caggcatt gcttgatgga ttgggatata ctgggaaaga Cttacgtgat st OO cittctagaga gtaaatctat cactggc.cag ataatt catg cagatatgac tdatttgttc 576. O cittgttctga gaataaatta t ccttctata actgagatgc agggagtaac aatatatggg 582O citcaattcaa ttacatatica tattgggcct gaagagtggit ataccattat gcc tigattitt 588 O attgctgttc agggittttitt aatat ctaat tittgatgaga gaaagtgttcaataactaaa 594 O t caagtatat tdtgccaa.ca aaattcaatt tacccaatgt caacagagat gcaaagatgt 6 OOO attalagggcg aaataagatt Ctgtc.calaga t ccaaggcaa ttgggacatt agt caatcgg 6 O6 O tittatattga ccaaaggtaa tittgatggct aattgtt tag ggattatatg cagatgttat 612 O actt caggcc aagttataac acaag accct agtaaattga t cacgataat atcgcaa.gag 618O gagtgcaagg aagttggtgt tatggitatic ct attatgg taggacctag aaaattacca 624 O gatattacct ttaacgctag gttggaaatt ggtgtaccga tat cattaag caaattagat 63 OO gtcggg actg atttagcg at togctt cagct aaacttaata attctaaggc attgttagag 636 O caat cagata agattittgga ttcaatgtct aaattggatt citatgaactic aagaataata 642O gggittaatct tag caattat gataatctitt ataat catta t tact attat citggat catg 648 O tataagaaat gtaagaataa agataataaa titcagtactt caattgaacc gct ctacata 654 O cc.ccct tctt ataact cacc ticata.gtgtg gttaaatcta tittgagtact gactatatga 66OO tccactgtaa taagtic caat gaaagtatica attaataata ttgg tagtgc aataagtatt 666 O gattgtataa tatact cott taalactagat agtgataaag ggittatagat gattt cagtic 672 O actittaatat aat catatat tdgttittatt atc.ttgcata act attatgt aattgaatta 678 O. tgitat catca attaatagct taataatatgttittaatata cittatattga tagataaatg 6840 tgtt at attg taatcaagga gttgg tattt agaagaggaia agagittaaat ttgttgttaa 69 OO ttagittattg td tatt caat tagaaaaaac ttaggaatcc atgttaatag aaatttatta 696 O t catggagtic caacaatatt aagtactaca aagattic tag ccgg tactitt ggtaaaatat 7 O2O tagatgaaca caaaacaatt aatagt caat tatacagttt gagtat caag gtaattacca 708 O ttattgct at tattgtaagc ctdattgcaa caataataac tattatcaat gcc act agtg 714. O ggagaactac cctaaatagt aatacagaca tact acticag ccaacgagat gagatt cata f2OO a catccaaga aatgat attt gatcg tattt atcctittgat aaatgctatgagtacagagc 726 O tagg acttica tatt cotacct tattggatgaact tactaa agcgattgac cagaaaatta 732O aaataatgcatcct cotgtg gacactgtga cittctgacct taattggtgc atcaaac ccc 7380 ctaatggaat tat catagac ccaaaaagtt attgtgagag tatggaattig totaaaactt 744. O US 9,139,620 B2 69 70 - Continued atgaattgtt acttgaccag titagatgtct caagaaagaa at cact tatt ataaatagaa 75OO agaat attaa ccaatgccaa ttagttgata attcaaagat catttittgcc actgtcaa.ca 756 O tacaatctac accogaggttt ttaaactittg gtcacacggit cagcaat caa cqtataacat 762O ttggtcaagg alacatatagt agtactitatgttatalactat ccaagaagat ggagtaactg 768 O atgttcaata t cagtgttt gagat.cggat at atttgttga t cagtttggit g tatt cocct 774. O ccittaatagt atcgagagtg ttgcc.gatac goatgctatt agaaatggaa toctd tacct 78OO tgacaagtga tag act aggc ggg tatttitt tatgtatgaa tacactgaca cqatctatat 786 O acgattatgt tag cataagg gatttgaaat cactittatat aacaatc cct cattatggta 7920 aagttaatta tact tactitt aattittggta agat caggag cccacatgag attgataaaa 798 O tittggittaac atctgataga gqccaaatta t citctggitta ttittgcagoa tttgttacca 804 O ttacaatt cq gaactataat aattatcc ct acaaatgctt aaataac cca tdttittgaca 81OO actctgagaa ttactgtaga ggatggtata aaaacataac aggaactgat gatgttc.cga 816 O tattagcata cittattggitt gaaatgitatg atgaagaggg acctittaatt acacttgtgg 822 O caataccacci ttacaattat acagotc.cat ct cataattic tictitt actat gatgacaaag 828O ttaataaatt aataatgact a catctoaca taggittatat tcaaatcaat gaggtgcatg 834 O aggtaattgttggcgata at ttgaaggcta t cotcittaaa cagattatct gatgaac atc 84 OO Ctalacctgac to Ctgtaga ct caat Cagg gtattaagga gcaat acaa.g. tctgacggaa 846 O caataattitc aaattctgta cittattgata tacaagaacg aatgtacatt acagttaaag 852O ctatt.ccacc agcaggtaac tataactitta cagttgagtt gcattctaga t caaacacat 858O cittatgtatic gttgccaaga cagtttaatg ctaagtatga caaattacat cittgagtgct 864 O ttagctggga caaatcCtgg toggtgtgctic tatacctica gttitt catta agttggaatg 87OO aatc.cc tittctgttgatact gcc attitt ca atttaataag ctgtcaatga acacatcaat 876O citat agttga tagttgttcaa aac attagcc aatttgggitt aaagaaatag gaaaatgaaa 882O titat caatat ctaattagat g tatgttcaa got aaattac aaaaaactta ggagt cagag 888 O attt cqttgc aatggagcag toagact acc aagat attct at acccggaa gtacat citta 894 O acagtic citat agtaattitcc aaattagtag g tattittaga atatgcc caa attggtcata 9 OOO atcaacaatt atcagaccgt acaattatca agaat attca atttagatta aggaacggat 906 O ttaatagttcaaggg tacag gtact atcaa citatgggtga aattatcaac aaaattagaa 912 O ataaatat co taattattta cacatacctt accctgaatg caaccaaaaa citattitcgaa 918O tagtag atco agaactaa.ca totaaaattag aatct cittct aaacaaaggit gacacactgt 924 O atct caagat t catcagat at cataaagt gttittgatag attgaaaatgaaaatgaaca 93 OO taaagaatga t cittct caat gacaatagt caattgattct agatct tcct ttaattatca 936 O aaggat.ctica gtggttctitc cct tttitt at tittggitttitc tat caaaact gaalactagaa 942O gctg tatt cq ccaaaatcaa aag acticgtg ttagat caca at atcggcct cactitat cag 948O agactaagag aattacattg gttgttacat citgatctgat tacaatattt gat catatta 954 O ataaatgitat attittatttg acttittgaga tigctgttaat g tattgcgat gtgatagaag 96.OO gtcggittaat gactgaaa.ca gctatgagct tactgtcg gtttaccaat ctattgc.cala 966 O gagtgcaata tatgtgggat ttact agatg gaatgtttga aagtttaggc aat caattat 972 O attcagtt at tdcatt atta gag cct ctitt citcttgctta tittgcaattgatagatgcag 978 O. atccacagat t cqgggaaca ttcctgcatc actgcttitt.c cqagittagaa gaaattatat 984 O US 9,139,620 B2 71 72 - Continued ttgacaaaac cccttittgat cottt cqtat atgaaaattit aattaatgga cittgattaca 9900 tittatttgac agatgatatt catctaactg cagaagttitt ttctttittitt agaagttittg 996 O gtcatccttt tttagaagica caaaatgctg ccaataatgt aaggaagitat atgaataaac OO2O ctaagg taat ct catat cag actittaatgc aagga catgc gattittittgc gg tattataa OO8O taaatggatt tagagat.cgc cacgggggaa catggcct Co ttagagitta C caaatcatg O14 O

Catctgctgt aattagaaat gcc cagtt at Ctggaga agg gttaa Catct gaacaatgtg O2OO citcaac actg gagatcct to tdtggattta gatttaaatgttt tatgcca ttgagtic tag O26 O acagtgacct tacaatgtac Cittagagaca aggcgittatc acctgtcaga aatgagtggg O32O attcagttta togctaaggag tatttaagat ataatcc agg attacccaca agttccagaa O38O gattgg taaa totatt citta gaagatgata agtttgatcc atatgaaatg at catgitacg O44 O tgataaatgg tdattactta agaga caaag agtttaacct tt catacagc cittaaagaga OSOO aagaaattaa agagg taggit cattgttcg ctaaaatgac ctataaaatgagggcttgtc. O560 aagtaatagc tigaaaacctg attgccaatig gag tagggala gtttittcaaa gataatggaa O62O tggcaaaaga tigaacataaa ttalactaaaa cqttacacaa attagccatt to aggtgtac O68O ctaaagataa ttct caactt tatttagatgaatgttggga gcaagtaatt cqacaatgtt Of 4 O

Caagtag tac acagataagg galacaggcta taatticaca atcaaatagg galaattgaat O8OO caaagt ctitc tagggcacgt Cittaataata gagat at Ctt aaagggcaag agagatt.cga O 860 acaaacaaat aaagtatic ct tcaaacaccg agtattatga gacitat cagt agttt cataa O92O c tactgacct taaaaagtat tdt cittaact gg.cgatatga atcaagtagt g tatttgcag O98O agagacittaa tagattt at ggactgcctggatttitt coa gtggctt cac aagattittgg O4 O agaaatctgt totatacgtt agtgatcc at atagt ccacc tdactittgat caa.cat atcg 1OO atatagaatc agt cccaaac gaccatat ct titat Caagta CCC gatgggit ggaatagagg 16 O ggttctgtca aaaattatgg accattagta caatticcgtt cot at attta gcagottttg 22 O atacaggggit tagaat ct cat cattagttcaaggcgataa C caggcaatt gcagtgacca 28O aaagagttcc gtcatc.ttgg agittatt caa agaaaaagga agaat caact aaaataacaa 34 O cacagtattt tottaattta agacaacgct tacacga cat agg to atgaa ttgaaagcaa. 4 OO atgagact at tatat cotct catttctttgtttactictaa agg tattitat tatgatggaa 460 tact tct citc ccaggc actt aaaagtattg caagatgtgt cittctggtct gaaacgattg 52O ttgatgagac tagg to agct tcagtaiaca tat ctacgac act cqcaaag gcaattgaaa 58 O ggggittatga taaatttgtg gcgtacgcta t caat attta taaaacaata catcaggtgt 64 O tgattgcatt gtc.ctttacg attaatcc tactatogacacic agacat caca gaacctittct 7 OO acaagagttt agatct actt aagaatctag toctdatticc togcac catta gggggcatga 760 actatatgaa catgagcagg ttatttgtta ggaatatagg agat.cccatt actgctt cat 82O ttgctgat at aaa.gc.gcatg attgaatgtgggttgttagg atgtag tatt Ctgtcacaaa 88O taatgtacca aaaatgtggit to citctaaat acttagactg. g.gctagtgat cottatt caa 94 O taaacct tcc titatagocaa agtatgacca aggttittaaa aaatgtaacg gcaagatatg 2 OOO tact tatgca tagt cc caac cctatgctica aagatttgtt ccatgaaaag tot caggaag 2O6 O aagatgaaat cottgctgag tittctgttag accoacactt aataatc cct agagcagolac 212 O acgaaattitt atcaaattica gtaac aggtg ctagagaatc tatagcaggt atgcttgaca 218O US 9,139,620 B2 73 74 - Continued

Ctacta aggg tttaatc.cgit gctag tatgt Caagaggtgg gttgacctica t cacttgttt 224 O taaaattatc aacatatgat taccalacagt ttagaacatgtc.ttgaatgg ctittatgctic 23 OO c tactacggg aattgctgta agcgttgatt cittgctctgt attcttagct aagac catcc 2360 ggaagagaat gtgggttcac ctaactaaag gaagggagat titatgggitta gaagtacctg 242 O acattttgga atgitatgcaa aacaat atta ttgttgatca cqaagattgt tact catgta 248O ttcaaggat.c aagatatt at acatggtttt ttgtacct tc aaattgtcaa citcgatcaaa 254 O taaataagtic aacaaattct citcc.gagtac cittatgttgg atcaacaact gaagaaagga 26 OO gtgatatgaa gttgtcat at gta aggtoac Ctagt cq9cc acttaaagca gcagttagga 266 O ttgcagcagt atatacatgg gct tatggtg atgataattt gtcttgg cat gaagcttggit 272 O atttagcaag gacitagagca aat attactt ttgacgaact caaattaata acaccitatag 2780 ctacatctac aaacttagca catagattga gqqatagaag cacticaagtt aaatatt cag 284 O gaacttctitt agtaagagtg gcacgctata caacaat atc taatgataat atgtcgttca 29 OO ttattaataa caagaaagtic gatactaatt ttgtc.tacca gcaaggaatgttattaggitt 296 O tgagtatatt ggaatacata titcagatact gtacaagtac toggacagtica aac actgtaa 3O2O ttcact taca tdcagatgtt aattgttgta tag tacagat gactgat cag ccttatacac 3O8O caagtttaac aaaaaagcta cct gat atta agcc cattaa taataaact g atatatgat c 314 O cggctic citat aatcgatact gatgcagota ggctatatto ccaaaagtac ctdt cacatt 32OO taatagattt cocaagttgg toaac tactic agcttaacac agtattgg.cg aaagtag togg 326 O Cggit at Ct at titggaatta attacaaaag Cagtaaaga CCatctgaat gagataatag 332O cagttgttgg tdatgatgat at caatagct ttattacaga atttic tactt gttgatccac 3380 gtctgtttac actatattta ggc caataca cat cattaca atgggcatat gaagt cc att 344 O at Catagacic agtgggtaaa taccagatgg ctgaagttgtt gcataatttg Ctgtcaagag 3500 c tagtagagg tatatt cagt at attgacca atgcc tittag ccaccc.caga gtctacaaaa 3560 gattctggga gtgtggittta ttggagccta titt atgggcc ctatatagga agt caaaatc 362O tacataatgc aatgattgat tatatictata atgcatacat tact tatttg gatgct tatt 3 680 tatctgat ca agtagatgat actgat atta taatatgtga aacagaggag acatgtttgg 37.4 O cgaatcgaat tdacaattat caaag cagac acttagctgt gcttatagat citg tattgttg 38OO attic cactag atgtcc caat ataaaagggg cagatacaat tatgagaaat t caattctta 386 O gatctitt cat tdataatgag aggagaacaa atccacttgg tttgacatgg aaccttgacc 392 O cgitt acttgt gigatcactitt agctgttcta ttacgitat cit gaggagaggit attattaaac 398 O agatgaggitt aagatttgat C caagtgitat cqctggaact atctaggatg attaa acctg 404 O atgcggittta t caagcacct aaaattic.cgt citt catgggc ticittatagat atcaa.ccctg 41OO aagtaaatga cct taatgta atttittggag agctgaatag caagtggaala gat at CCCta 416 O ttggacagat tagaatacag aattatgaaa tacatgcata taggaggatt ggagittaatt 422 O caactgcctg ttataaagct citagagct at tatctgttct aaatcggittt atgcc taatc 428O catcaggtgc attgtttitta ggtgaaggag caggat caat gctggtcaca taccgtgctt 434 O ttgtcc catt taagacaatt tattacaata gtgg tatttic agttcaaaat gttcagggcc 44 OO agagagaatt gag totatat c catctgaag tecact agt tacaacaaa aatcgcttgg 4 460

Ctaatgaccc taatat caaa gtc.ttgttca atggtaa.gcc agagt ctacg tdggttggaa 452O a catcgactg ttittgctitat attcttagcc acattgagac citcaa.gctitg acattgatac 458 O US 9,139,620 B2 75 76 - Continued at agtgat at tagtc.ca.gc tita agcaaga Caagaataa aattcttgag gagctgtgcc 464 O acattctgtc. aatggcactic attittgggga aaatcggat.c titt attagtt gttaagttat 47 OO taccaagggit cqgtgact at acg tatt cat tittgcaggta togcatcggaa ttctatoaac 476 O aaagcct c ct tdttttacct aggtttagta acatgtcatc atctgaggitt tactatatag 482O gaattic acct caatacaaat cqattgattg atcctgatag aatag tacaa tacataatta 488 O gaaatttaca accaacticca gttacatttt tdtcc tatat ttittgaaact aagtatagga 494. O ataatatggit tacaaattat gigactgtgct tdt cagacgg acacaaaagt gattacctgt 5 OOO catcaattac aaaaatagag aatgttct co tdt catgtgg gttagaattgaatgg accta 5060 agattataca gcaattatca gga catgact atgctaatgg ggagact agt ctagaat Caa 512 O gtataatgat attagttagg gaatat citta atgcaactat acagggc.cgg gaaac attag 518O gcttgtttitc acct taccca gtc.ttacatg agagt cagtt aagagagatt aataagtgta 524 O ttgcattgaa atatgttgta tat citact ct tittattoaaa citctacatta t c tagtaaac 53 OO aaataatgag taatct caga aagggaat at tdatgitatga tittgagagat gaatttittca 536 O tat caagatt gtcagcaa at tacaagaaaa aggtgatgtc. acaggaagtic alagacitacct 542O ggat ctittaa tattgatact c coacacgaa aag cattata taagttagta ggittatt cat 548 O taataattaa totatgtatga tigatagagtg tdattatcca tottt tagag agtaagataa 554. O tat cagatgt atgata acca attaagtatt gcttittgaat togaaaggttg ct caattaca 5 6.OO cgctitctitta gtaatcgggt ttittatt coa attaaggcaa ttagaaaaaa cittcaac agt 566. O tagt cdagcc cqaatt catt toatataagt tatatttata atc.ttggata agactitttgt 572 O ttagaattat aacagtaata ctaattitatgaatggaagac aattgatatic tagtgtgaat 578 O. tt catgctta totgtc.ctta accittatact cacgatcatt attctittatt tdagaattta 584 O attataggtg tittatgtgtt atgtgatggg aac catcaat gctgacatta ttaataacca 59 OO tagg tattgt atgagataat gtttatttac taccalatgta caatctorata tdtcggaccc 596 O citta acct co toctitatagt tdagttittct ggaaaaacac aaaagatgat cittgagtaat 6O20 tgitacggacc tatagottt c tttgtctggit 6 OSO

<210s, SEQ ID NO 3 &211s LENGTH: 16 OsO &212s. TYPE: DNA <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 3 accagacaaa gatgtctgtg acct attcta acgacaagac tatt attaaa tatttaggaa 6 O taacgatt CC attagtgggg taggggaag gaat Caggta titccagaatgtcgagtictac 12 O tgaagt cact togcc.gcattt aaaagacata gaga.gcaa.cc aactacaccg. tcaggttcag 18O gtgg tacaat taaaggattgaaaaacacaa ttattgttcc agtaccaggg gatacagtaa 24 O ttaccacgag gtctaatttgttatttagat tagtttatat aataggcaat coagatacgc 3OO ctictaa.gcac ct coacggga gcaataatat cattattgac cct attcgt.c gaatc.cccag 360 gtcaattaat tcaaagaatt gcc.gatgacc ctdatgcagt ttittaaatta gtagagg to a 42O titcc tdaagc tiggtaatcct ggaga attga cittittgcatc. tcgagggatt aatttagata 48O agcaa.gc.cca acaatactitt aaactggctg agagaaatga t caggggitat tatgttagct 54 O taggatttga gaaccolacca aacgatgatg atata acatc tagt cct gag at atttaatt 6OO US 9,139,620 B2 77 78 - Continued at attittggc atctgtactt gcgcaagttt ggatt cittct ggcaaaagct gtgactgctic 660 cggatacagc tigctgaagct gaaaaccgta gatggattaa attgatgcaa Caacgt.cggg 72 O tggatggtga attalagattg agtaaaggat ggctagattt ggtgagaaat aaaattgcgt. 78O cagatattac aataagacga tittatggtgg cattagt cct toga catcaaa cqttct c ctd 84 O ggacaagacic Cagaatagct gaaatgattt gtgat attga taattatatt gtagaggcag 9 OO ggcttgcaag titt cittgtta act attaa at ttggcataga gacacgittat ccago attgg 96.O cattgcatga gttct ctoga gaattagcta ctattgaggg act tatgaaa ttgtaccaat O2O citatgggaga aatggcacca tatatggtaa ttctggaaaa ttcaattcaa accaggttta O8O gtgc.cgggtc. ttatcc tittg ctatggagtt atgcc atggg C9ttggtgtg gagcttgaaa 14 O gatcgatggg togg acttaat tttac tagga gottctittga ccctacgitac titcagacittg 2OO gtcaagagat ggtgagaaga t ctitcaggga tiggittaatag titcatttgcg cgaga acttg 26 O ggct atctga acatgagaca Caacttgtca gccaaattgt taatt.cggga ggtgaatctg 32O ggatacctaa atttgatgga titcagagcaa atccaacaac ctittctagga accaaagata 38O at attaatga taalaggtgag gat cagt caa gttcagtatic agggittacct ggtcc attat 44 O taccCagt cq tacct aact catcCaggtg att catatgg agcagatgat ggtgtgaaaa SOO atgtcagtaa taaattgagt gaaggaataa gtc.ca.gatca tatgtgtct agctctgc.ca 560 tggaagaatt gaggaggitta gttgagticta cca acagaat tacaccalaa aag.ccggaag 62O citcc aggtgt caccaac cat tataatgaca ccgaccttitt aagataatat gagtatat ct 68O tatttgat cat catacaatt caaattaaga aaaacttagg acct caaggt t cacaactgt 74 O tggcacatca citgagatata gttcaattctt tacccaccac atgtc.ct ct c accagattica 8OO acaagttcaaa catggcct cq aatctttaca agagatcaaa aacaa.ccctic cqtct tccaa 86 O agatgtcgat Cttgcc aggg agatttacga atc cattaga caaac aggala Catct tcagt 92 O gcaaggagga gcc attgcgg gagataat at tacgt caggg ggtaacaatic act caatgca 98 O tagccaagga ccaagttct c ctatttcaag tdttaacaag aatat cqaag gatctactgg 2O4. O attic gatcat t caggact at gggatt Caga gggta acctic ticatgttat tcaaag.cga 21OO tgatgatgaa alaccattatt cagagattaa tigc.cggtct ccc.gctatcg aaggattgga 216 O tgaacaggat actgagaact caatt attaa acaac Cagga aat cagtgta Ctgagggagt 222 O gtctaagact aattcaccitt citagt ccc.ca ggaaactaca citatctgttgggggat.ctaa 228O tatacctggg acaggaatat caacctgtgc ct ctittggat ataactgtaa atgaacttga 234 O ggatgcaact ataagaalaca gcgacaat at gaagggaaac togccaattic caaattact 24 OO tgttaa.gc.cg ccacct aggg caagat Caag cattgat cat agcaatc.cat taalaaggggc 246 O Cacaggaggg aaattagt ct cacctgggat ggagactaca ttatt.cgaga agagtggtgc 252O aacccitat ct gtacac cc at c tact caa.cc tdcaag.cgac ttcaatgitaa atgtaagcaa. 2580 tgtc. catcaa cctgc.cccaa gtgtgaataa tatt acaga gacagtgagg taa.ca.gtgct 264 O taacttacat aaagatattg aggataagtic tdaaatat ct atacaggata tatataactt 27 OO gatt cittgga tittaaggatg attataggaa attattaaac aaattagata togg tatt aga 276 O gatgaaacaa gacattgaca atctaaaaaa gagtagtgct alaggtacaat tattgtc. 282O aact attgaa gogacat citat c tagtgttat gattgc.catc cct ggttcag g tattgattic 288O

Cactggggaa gagaaaaagg at Cagatgaa ttctgactta aaaccatt at tagggaggga 294 O t cattgtaga gcattt coag aagttactaa toctictagat gag togttac tdgccaattic 3 OOO US 9,139,620 B2 79 80 - Continued tccaacaaaa catgttgcca aaatagacaa gaattgcact citt cagaaaa toaacaagaa 3 O 6 O tgaaac at cit gcaatcaagt ttgttcc.caa tdatagt cat gcaag cacat cqaccatcaa 312 O atcaattatc aggtoatcta atctogatca ggatttgaag acaaaattgc ticaca attct 318O atcc caaatt agagggacag agaatgttaa agaattittat gagaagg to a tigatattgat 324 O aaagaataag alactaaatat caccaatcta catgcactat gagttgtaat tdt citt cagt 33 OO agaatttagt tdatttaata catactgttgttgatttgta ataattataa aaaact tagg 3360 agctaaaggc tacticagt ca tatacaa.cat gactgagata t t cactic titg atgagagctic 342O atgg to aatc aaaggaacac ttgat cogct aac acctgat atctatoctd atgggagact 3480 cgtgcc caaa gttcgggitta t catc.cggg cct aggagat cqcaagagtgggggatatat 354 O gtat ct actt Ctc catggtg tcatagaaga Cagcgagaac atgattagt c caaaggggag 36OO agcatttggg gcatt CCC at taggagtggg toaatcaact gaaaacc cag aagatttgtt 366 O taaggaaata ttaact ct ca at atcgtgac togtagaact gctggattta atgagaagtt 372 O agitt tatt at aataccacac ctata cattt act gaccc.cc toggaaaaagg togttggcata 378 O tggaag catc tittaatgcta at caggtotg cagtgataca agctictatac caatagatat 384 O tccacaaaag tittagacctd tatatttgac tdttacaaaa ttatctgatg atggct atta 3900 t cagatacca aagatgattic aagatttcaa atcgtcaaat tctgttgcat t caa.catcct 396 O tgtgcatcta t caatgggta caaatttact tdaccaatcc aaagact ct c gattaagaaa 4 O2O tgctggggaa actgtgatta cattt atgat t catattggg aacttcaaac ggalagagtaa 4 O8O taaatctitat t cagoggaat actgcaagag gaaaataatg aggcttggitt tdatatt ct c 414 O attaggtgca attggtggca Caagcttaca tattagatgc acagg talaga tigagcaaacg 42OO actacaggcc tacttaggat tcaaaaggac tittatgttac cct citgatgt atgtaaatga 426 O agggctaaat aaalacactgt ggagaaatga atgtagaata gagaaggttcaag cagt ctt 432O acagc.catct gttccaaatgaatttaaggt atatgatgat gtc attattg acaataccala 438 O tggit ct ctitc aagattaaat aggttataac cqtaacaaac agctaataaa togg tatt atg 4 44 O tatttalagtg tacactgata attgttgaata aaatacattg ggittaataac gigtatagagt 4500 taaaatctaa ttgatatgtg ggittaatgct taaac actta ttagctictat tdattatcta 456 O tat cittgagt tat ctaatat cagagtatica acatgtaatc agtttaaact tdttggatta 462O acgttcaatt attata acca gaatacacaa attgttaaac ttata attct gttagattica 468O ttcaagttga act tatgtag ggittalaccaa titat catt.cg agcaattata aaaaactaag 474. O gatctaatgt agtaggaacc taalacticcat coagtgagct caaaatcacc acact caaat 48OO atcaatttgt c tagggcc td totaacticaa aacaaagctic at aaccagga t ccagacgag 486 O tgggittaaat citgaataact attaggaatt gagattittaa attgattctic ticitta actict 492 O aaagttittag taatatagca totaatticago accatgaaca gaattaaagt tataataatt 498O agttctttgt tattat caga tattacgatt gcacaaatag gctgggataa tittaactitcg 5040 attggggitta taagtact aa goagtacaac tataaaataa citactictaaa tactaat cag 51OO ttgatggitta taaagatggit toccaatata t cqtcaatca ttaattgcac taaacttgaa 516 O ttgataaaat atagagagtt agt ct caggg at cattagac caataaatga gtc attagaa 522 O ttaatgaact catacattaa tatgagagta ggttcagaga gatttatagg ggctgtaata 528 O gctggagtag cattaggagt ggcaactgca gcacaaataa Cat Cagggat tcc.ctacat 534 O US 9,139,620 B2 81 82 - Continued aattcaatta tdaacaaaaa acagatacaa gagttgagga aggct cittag tactaccaac 54 OO aaagcaattig atgaaataag gattgcaggt gaacgaacat taatggcagt acaaggtgta 546 O caggattata t caataatat aattgtcc ct atgcaggaca aactic caatg tdatattitta 552O t cat cacago tttctgttgc attact caga tattatacaa atatattaac agt ctittgga 558 O c caagtatac gagatccitat cactagoacg attitcgg tac aag cact tag toaa.gcatt c 564 O aatggtaatc tt Cagg cact acttgacgga citaggatata ctgggagaga Cttacatgac st OO cittctagaga gtaaatctat cactggtcag ataatt catg cagatatgac tdatttgttc 576. O cittgttctga gaattaatta ccct tccata actgagatgc agggagtaac aatatatgaa 582O ctgaattcaa ttacatatica tattgggcct gaagagtggit atact attat gcc tigattitt 588 O atagotgttc agggittttitt aatat ctaat tittgatgaaa gaaagtgttcaataactaaa 594 O tcqagtgtaa tatgccaa.ca aaattcaatt taccc.gatgt cagcagagat gcaaagatgt 6 OOO attalagggcg aaataagatt Ctgtc.calaga tictaaggcaa ttgggacgtt agittaatcgg 6 O6 O tt catattga ccaaaggtaa tittaatggct aattgtctgg gaattatatg cagatgttat 612 O acct caggcc aagttataac acagg acccc agtaagttaa ttacaataat at cacaagag 618O gagtgcaaag aagttcggtgt tatggitatic ct attatgg taggacctag aaaattacca 624 O gatattacct ttaatgctag gttagaaatt ggtgtaccga tat cattaag caaattagat 63 OO gtcggaaatg atttagcaat togctt cagct aagcttaata atticcaaagc attgttagag 636 O caat cagata agattctggg ttctatot ct aagttggatt citattaattic aagaattata 642O ggattaatct tag caatcat gataatctitt ataattattgttaccattat ctggat cata 6480 tataaaaatt gtagaaataa agatactaaa titcagtactt caattgaacc gct ctacata 654 O cc.ccct tctt ataact cacc ticata.gtgtg gtcaagticta tittgagtact gaccatatga 66OO tttact.gitaa taagtic cagt gigaagitatica attgacaata citgg tagtat aatgaatatt 666 O gaatatataa tatact ct ct taaattggat agtgataaag agittatagat gattgcaatc 672 O attittaatat aattatatat tdatttgatt acctggtata attct tatgc aattgaatta 678 O. tgttgtcatca attaatagct taatagdact gttittataca cittatgttga tagatagatg 6840 tgtt at attg taatcaagga tittagtat ct agaagaggaia agagttcaat tdgttgttaa 69 OO ttggittattg td tatt caat tagaaaaaac ttaggaatcc atgttaataa aaact catta 696 O t catggagtic caataatgtt aaat attaca aggattictaa ccgatactitt ggtaaaatat 7 O2O tagatgaaca caaaacaatt aatagt caat tdtacagctt aag tattaaa gtaattacca 708 O ttattgc.cat aattgtaagc ctaattgcaa caataatgac tatt attaat gccacaagtg 714. O ggaggactgc cct aaa.cagt aatacagaca tactgct tag C caaagagat gagatt Cata f2OO atat coaaga aatgat attt gatcg tattt atcctittgat aaatgctatgagtacagagt 726 O tagg acttica tatt cotacct tattggatgaact tactaa agcgattgac caaaagatta 732O aaataatgaa tocc cc tatt gacactgtga cqtctgatct taattggtgc atcaaac ccc 7380

Ctaacggaat tattatagac ccgaagggitt attgtgagag tatggaattg tccaaaactt 744. O ataaattact acttgaccaa ttagatgtct taagaaagaa at cact catt ataaatagaa 75OO agaat attaa ccagtgtcaa ttagttgatg attcaaagat catttittgct actgtcaa.ca 756 O tacaatctac accogaggttt ttgaattittg gtcacacagt cagcaat caa cqtataacat 762O ttggtcaagg alacatatagt agtactitatgttatalactat ccaagaagat gggataactg 768 O atgttcaata t cagtttitt gaaatcgggt at atctotga t cagtttggit gttitt cocct 774. O US 9,139,620 B2 83 84 - Continued ccittaatagt atccagagtg ttgcctatac goatgctatt aggaatggaa toctd tacct 78OO tgacaagtga Cagact aggt ggg tatttct ttgt atgaa tacactgaca Catctatat 786 O atgattatgt tag cataagg gatttgaaat cattatatat aac actic cct cattatggta 7920 aggittaatta tact tactitt gattittggta agat cagaag cccacatgaa atagataaaa 798 O tittggittaac atctgagagg ggccalaatta tittctggitta ttittgcagoa tttgttacca 804 O ttacaatt cq gaattataat aattatcc ct acaaatgttt aaataatcca togctittgaca 81OO actctgagaa ttactgtaga gggtggtata aaaacataac agg tactgac gatgttc.cga 816 O tattagcata cct attagtt gaaatgitatg atgaagaagg acctittaatt acacttgtag 822 O caatcc.cgcc ttacaattat acagotc.cat ct cataattic tictitt actat gatgataaaa 828O t caataaatt gataatgact a catctoaca taggit catat t caagttaat gaggtgcatg 834 O aggtgattgttggcgata at ttaaaggcta t cotcctaaa cagattatct gatgaac atc 84 OO

Ctaatcttac to Ctgtaga ct caat Cagg gcattaagga gcagtacagg totgacggaa 846 O caataattitc aaattctgca cittattgata tacaagaacg gatgtatatt acaattaaag 852O ctgttccacc agtggg taac tataactitta cagttgaatt gcattctaga t caaacacat 858 O cittatc tatt gttaccaaaa cagtttaatg ctaaatacga caaattacat cittgagtgct 864 O ttagctggga caaatcttgg toggtgcgc.ct tatacctica gttitt catta agttggaatg 87OO aatc.cc tittctgttgatact gct atttitta atttaataag ttgtaaatga atatgtcaac 876O tgatagttga tagttgttcaa alacat cagct aattgagatt aaagaaataa aaaaatgaaa 882O titat caagat ttgact agat gtatacticaa got aaattac aaaaaactta ggagt cagag 888 O actitcgttgc aatggagcag toagact acc aagat attct at atcct gag gtacat citta 894 O acagtic citat agtaatct ct aaattagtag g tattittaga atatgcc.cga attgct caca 9 OOO atcaacaact atcagaccat acaattatca agaat attca atttagatta agaaatggct 906 O ttaatagt cc aaggatacag acact atcaa citatgggtga aat catcaac aaaattaaaa 912 O gcaaac accc caattattta cacatacctt accc.cgaatg taaccaaaag ctattitcgaa 918O tagtag atco agaactgaca totaaaattgg aatct cittct gaacaaaggit gatacactgt 924 O atct caaaat t cqgtcagat at cataaaat gctittgatag attgaaaatg aagatgaaca 93 OO taaggaatga t cittcttaat gacaatagt caattaattct ggat.ct tcct ttaattctica 936 O aaggat.ctica gtggttctitc cc.gtttitt at tittggitttitc gattaaaact gagacitagaa 942O gctgitatic cq acaaaatcaa aaa.gct cqtg ttagat caca at atcggcct cactitat cag 948O agactaagag aattacattg gttgttacat citgat citaat tacgatattt gat catatta 954 O ataaatgitat attittatctg acttittgaga tigttgttaat g tattgcgat gtggtagaag 96.OO gtagattaat gactgaaaca gctatgagct toggattgtcg atttatcaat citattgccaa 966 O gagtgcaata tatgtgggat ttgctagatg gaatgtttga aagtttaggit aat caattat 972 O attcagtt at tdcattgtta gag cct ctitt citcttgctta tittgcaatta atagatgcag 978 O. atccacagat t cqgggaaca ttcttgcatc actgtttitt.c agagittagaa gaaattatat 984 O ttgacaagtic ticcittittgat cottttgttgt atgaaaattit aattaatgga citagattata 9900 tittatttgac agatgatatt catctaactg cagaagttitt ttctttittitt aggagctittg 996 O gtcatccttt tttagaagica caaaatgctg ctaataatgt gaggaagitat atgaataagc 10 O2O ctaaagtgat ct cataccag actictaatgc aagga catgc gattittctgt gigt attataa 1008 O

US 9,139,620 B2 87 88 - Continued ttcaaggat.c aaaatatt at acatggtttt ttgtacct tc aaattgtcaa citcgatcaga 254 O taaataagtic aacaaattct citcc.gagtac cittatgttgg atcaacaact gaagaaagga 26 OO gtgatatgaa gttgtcat at gtgaggtoac Caagtag acc acttaaagca gcagt cc.gaa 266 O ttgcagcagt atatacatgg gct tatggtg atgatgattt atcCtgg cat gaggcttggit 272 O atttggcaag gacitagggca aat attacat ttgatgaact caaattaata acaccitatag 2780 ctacatctac taatttggca cataggttga gagatagaag tact caagtt aaatatt cag 284 O ggactitcc tt agtaagagtg gcacgctata caacaat atc taatgataac atgtcgttca 29 OO ctattaacaa caggaaagtic gatactaatt ttgtc.tacca gcaagggatgttattaggct 296 O tgagtatact cqaatacata titcagatact gtacaagtac toggacaatca aac actgtaa 3O2O ttcact taca tdcagatgtt aattgttgta tag tacagat gactgat cag ccttatacgc 3O8O caagcttaac taagaa.gcta cct gatatica aaccoat caa taataaattig atatatgat c 314 O cggctic citat aattgatact gatgcagota ggttg tatto tcaaaaatat citgtcacatc 32OO taatagattt to caagttgg toaac tactic agcttaacac agtgttggca aaagtgg tag 326 O cagtat citat agtagaattig at cacaaaag cdagtaaaga ccatctoraat gagataatag 332O cggttgttgg tdatgatgat at caatagct ttattacaga atttic tactt gttgatccac 3380 gtttgtttac act at actta ggc caataca tdt citttaca atgggcatat gaaatccatt 344 O at Catagacic agtgggcaag taccagatgg ccgaagtatt acataatttg Ctgtcaagag 3500 c tagtagagg catatttago at attgacca atgcc tittag ccatcc.ccgg gtctataaaa 3560 gattctggga atgtggittta ttggagccta titt atgggcc titatatagga agt caaaatc 362O tacatagtgc agtgattgat tatatictata atgcatat cit tact tatttg gatgct tatt 3 680 tatctgat ca agtagatgat actgat atta taatctgtga aacagaggag acatgtttag 37.4 O caaatagaat tdacaattac caaagtagac acctagotgt act catagac ttgtactg.cg 38OO attic cactag atgccc caat ataaaagggit cagatacaat tatgagaaat t caatcc tta 386 O gatcct tcat tdataatgag aggaaaacaa acc cact cqg tttgacatgg aatcttgat c 392 O catt acttgt gigatcactitt agctgttcta ttacatat cit aaggagaggit attattaaac 398 O agatgagatt aagatttgac ccaag.cgitat citcttgaatt atctagaatg attaalacctg 404 O atgtgattta t caagcacct aaagttcc.gt cct catgggc ticittatagat atcaa.ccctg 41OO aagtaaatga cct taataca atttittggag agcttaatag caagtggaaa gacatcc cta 416 O taggacaaat cagaatccaa aattatgaaa tacatgcata taggaggatt ggagittaatt 422 O caactgcatgttataaggct ttagagct at tatctgttct aaatcggttc atgtcta acc 428O catcaggtgc attgtttitta ggtgaagggg Caggat.cgat gctggtcaca tat cqtgcct 434 O ttatt coatt caagacaatt tattataata gtgg tatttic agttcaaaat gttcagggit c 44 OO agagagaatt aagtictat at C catctgaag tecact agt tataacaaa aatcgcttgg 4 460 ctaatgaccc taatat caaa gttcttgttta atggtaagcc agagt ctaca tdggttggaa 452O at attgactg ttittgctitat attcttagcc at attgagac ttcaa.gctitg acattgatac 458 O at agtgat at tagtc.ca.gc titgagcaaga caaagaataa aattcttgag gagctgtgcc 464 O at attctgtc. aatggcactic attittgggaa agat.cggat.c titt attagtt gttaagttgc 47 OO taccaagggit cagtgattat acg tatt cat tittgcaaata togcatcagag ttctatoaac 476 O aaaactittct togttctgcct agatttagta acatgtcatc atctgaggitt tact acatag 482O US 9,139,620 B2 89 90 - Continued gaattic acct taatacaaat cgattgattg accctgatag aatagtacaa tacataatta 488 O gaaatttaca acct actic Ca gttacattitt tat CCtaCat ttittgaaact aagtatcgaa 494. O ataatatggit tacaaattat ggactatgct tgtcagacgg acacaaaagt gattacttgt 5 OOO

Catcaattac aaaaatagag agtgttctitc tgt catgtgg gttagaattgaacggacct a 5060 agattataca gcaattatca gga catgact atgc.cagtgg agagact agt ctggaat cala 512 O gtataatgat attagttaga gaatat citta atgcaactat acaaggc.cgg gaaac attag 518O gcttgtttitc acct taccc.g gtcct tcatg agagt cagtt aagagaaatc aataagtgta 524 O ttgt attgaa gtatattgta tat ctdct ct tittattoaaa. ctic tacatta t c tagtaaac 53 OO aaataatgag taatcttaga aaaggaat at tgatgitatga tittgagagat gagtttitt.ca 536 O tat caagatt gtcagdalaat tacaagaaaa aagtaatgtc acaggaagtt aagacitacct 542O ggatatttaa tattgatact ccgacacgaa aggcgittata taagttagta ggittact cat 548 O taataattaa. t cacatatga aggttgggca tggittattoa ttttittaagg agtaagataa 554. O gacttgat at atgata actg attaalacatt accitctgaat tgaaggattg ct caattaca 5 6.OO tggtttittga gtaattgaga titt tattic ca. attagtacaa ttagaaaaaa cittcaac agt 566. O tgattgagcc ttaatt tact c catactago tatatttata agctcggata aaactittggit 572 O ttgaaattat aac agt cata CCaatctato aaggaalacac aattgatgtc. tag tatgaag 578 O. ttcatattta tatgtttitta at Cttatacc CactCtaatt agttcc tatt taagaattaa 584 O attatagatg tta acatgtt atataatggg aac Catcaat gctgctattgttggtaacta 59 OO taggcattgt attagataat gtt tatttct tagaaatgtg caatctgata catcggaccc 596 O cticago: ct co cc cittatagt tgcgtgattt gaaaaaacac aaaaaataat catgaatggg 6O20 tgitacgtacc tatagotttc tttgtctggit 6 OSO

<210s, SEQ ID NO 4 &211s LENGTH: 172 212. TYPE : DNA <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 4 agagacittaa tagattt at ggactgcctggatttitt coa gtggctt cac aagattittgg 6 O agaaatctgt totatacgtt agtgatcc at atagt ccacc tdactittgat caa.cat atcg 12 O atatagaatc agt cccaaac gaccatat ct titat caagta ccc.gatgggt gig 172

<210s, SEQ ID NO 5 &211s LENGTH: 172 212. TYPE : DNA <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 5 agagacittaa tdaaattitat ggattgcc tig gottttitt ca gtggctt cac aaaat attgg 6 O agaaatctgt tittatacgtt agcigatc.cgt. c tagt ccacc tdattittgat cqacatat cq 12 O atatagaatc agttc.cgaat gaccatat ct ttattaagta ccc.gatgggt gig 172

<210s, SEQ ID NO 6 &211s LENGTH: 172 212. TYPE : DNA <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 6 agagacittaa tdaaattitat gigact gcc tig gatttitt coa gtggctt cac aagattittgg 6 O US 9,139,620 B2 91 - Continued agaaatctgt totatacgtt agtgatccat c tagt ccacc tdactittgat caa.catgtcg 12 O atatagaatc agt cccaaat gaccatat ct titat caagta ccc.gatgggt gig 172

<210s, SEQ ID NO 7 &211s LENGTH: 519 212. TYPE: PRT <213> ORGANISM: Feline morbillivirus

<4 OO > SEQUENCE: 7 Met Ser Ser Lieu. Lieu. Arg Ser Lieu Ala Ala Phe Lys Arg His Arg Glu 1. 5 1O 15 Gln Pro Thr Ala Pro Ser Gly Ser Gly Gly. Thir Ile Lys Gly Lieu Lys 2O 25 3O Asn Thr Ile Ile Val Pro Val Pro Gly Asp Thr Val Ile Thr Thr Arg 35 4 O 45 Ser Asn Lieu. Lieu. Phe Arg Lieu Val Tyr Ile Ile Gly ASn Pro Asp Thr SO 55 6 O Pro Leu Ser Thr Ser Thr Gly Ala Ile Ile Ser Lieu Lleu. Thir Lieu Phe 65 70 7s 8O Val Glu Ser Pro Gly Glin Lieu. Ile Glin Arg Ile Ala Asp Asp Pro Asp 85 90 95 Ala Val Phe Llys Lieu Val Glu Val Ile Pro Glu Ala Gly Asn Pro Gly 1OO 105 11 O Glu Lieu. Thir Phe Ala Ser Arg Gly Ile Asn Lieu. Asp Llys Glin Ala Glin 115 12 O 125 Glin Tyr Phe Llys Lieu Ala Glu Lys Asn Asp Glin Gly Tyr Tyr Val Ser 13 O 135 14 O Lieu. Gly Phe Glu Asn Pro Pro Asn Asp Asp Asp Ile Thir Ser Ser Pro 145 150 155 160 Glu Ile Phe Asn Tyr Ile Lieu Ala Ser Val Lieu Ala Glin Val Trp Ile 1.65 17O 17s Lieu. Lieu Ala Lys Ala Val Thr Ala Pro Asp Thr Ala Ala Glu Ala Glu 18O 185 19 O Asn Arg Arg Trp Ile Llys Lieu Met Glin Glin Arg Arg Val Asp Gly Glu 195 2OO 2O5 Lieu. Arg Lieu. Ser Lys Gly Trp Lieu. Asp Lieu Val Arg Asn Lys Ile Ala 21 O 215 22O Ser Asp Ile Thir Ile Arg Arg Phe Met Val Ala Lieu Val Lieu. Asp Ile 225 23 O 235 24 O Lys Arg Ser Pro Gly Thr Arg Pro Arg Ile Ala Glu Met Ile Cys Asp 245 250 255 Ile Asp Asn Tyr Ile Val Glu Ala Gly Lieu Ala Ser Phe Lieu. Lieu. Thr 26 O 265 27 O Ile Llys Phe Gly Ile Glu Thir Arg Tyr Pro Ala Lieu Ala Lieu. His Glu 27s 28O 285

Phe Ser Gly Glu Lieu Ala Thr Ile Glu Gly Lieu Met Lys Lieu. Tyr Glin 29 O 295 3 OO

Ser Met Gly Glu Met Ala Pro Tyr Met Val Ile Lieu. Glu Asn Ser Ile 3. OS 310 315 32O

Gln Thr Arg Phe Ser Ala Gly Ser Tyr Pro Leu Lleu Trp Ser Tyr Ala 3.25 330 335

Met Gly Val Gly Val Glu Lieu. Glu Arg Ser Met Gly Gly Lieu. Asn. Phe 34 O 345 35. O US 9,139,620 B2 93 - Continued Thr Arg Ser Phe Phe Asp Pro Thr Tyr Phe Arg Lieu. Gly Glin Glu Met 355 360 365 Val Arg Arg Ser Ser Gly Met Val Asn. Ser Ser Phe Ala Arg Glu Lieu 37 O 375 38O Gly Leu Ser Glu. His Glu Thr Gln Leu Val Ser Glin Ile Val Asin Ser 385 390 395 4 OO Gly Gly Glu Ser Gly Ile Pro Llys Phe Asp Gly Phe Arg Ala Asn Pro 4 OS 41O 415 Thir Thr Phe Lieu. Gly. Thir Lys Asp Asn. Ile Asp Asp Arg Gly Glu Asp 42O 425 43 O Gln Ser Asn Ser Ile Ser Gly Lieu Pro Gly Pro Leu Lleu Pro Ser Arg 435 44 O 445 Asp Lieu. Asp Lieu. Ser Gly Asp Ser Tyr Gly Ile Asn. Ser Gly Val Lys 450 45.5 460 Asn Val Ser Asp Llys Lieu. Asn. Glu Gly Val Gly Pro Asp His Asp Wall 465 470 47s 48O Ser Ser Ser Ala Met Glu Glu Lieu. Arg Arg Lieu Val Glu Ser Thr Asn 485 490 495 Arg Ile Asp Thr Lys Gln Pro Glu Ala Ser Gly Val Thr Asn His Tyr SOO 505 51O Asn Asp Thir Asp Lieu Lleu Lys 515

<210s, SEQ ID NO 8 &211s LENGTH: 519 212. TYPE PRT <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 8 Met Ser Ser Lieu Lleu Lys Ser Lieu Ala Ala Phe Lys Arg His Arg Glu 1. 5 1O 15 Gln Pro Thir Thr Pro Ser Gly Ser Gly Gly. Thir Ile Lys Gly Lieu Lys 2O 25 3O Asn Thr Ile Ile Val Pro Val Pro Gly Asp Thr Val Ile Thr Thr Arg 35 4 O 45 Ser Asn Lieu. Lieu. Phe Arg Lieu Val Tyr Ile Ile Gly ASn Pro Asp Thr SO 55 6 O Pro Leu Ser Thr Ser Thr Gly Ala Ile Ile Ser Lieu Lleu. Thir Lieu Phe 65 70 7s 8O Val Glu Ser Pro Gly Glin Lieu. Ile Glin Arg Ile Ala Asp Asp Pro Asp 85 90 95 Ala Val Phe Llys Lieu Val Glu Val Ile Pro Glu Ala Gly Asn Pro Gly 1OO 105 11 O Glu Lieu. Thir Phe Ala Ser Arg Gly Ile Asn Lieu. Asp Llys Glin Ala Glin 115 12 O 125 Glin Tyr Phe Llys Lieu Ala Glu Arg Asn Asp Glin Gly Tyr Tyr Val Ser 13 O 135 14 O

Lieu. Gly Phe Glu Asn Pro Pro Asn Asp Asp Asp Ile Thir Ser Ser Pro 145 150 155 160

Glu Ile Phe Asn Tyr Ile Lieu Ala Ser Val Lieu Ala Glin Val Trp Ile 1.65 17O 17s

Lieu. Lieu Ala Lys Ala Val Thr Ala Pro Asp Thr Ala Ala Glu Ala Glu 18O 185 19 O

Asn Arg Arg Trp Ile Llys Lieu Met Glin Glin Arg Arg Val Asp Gly Glu 195 2OO 2O5 US 9,139,620 B2 95 - Continued

Lieu. Arg Lieu. Ser Lys Gly Trp Lieu. Asp Lieu Val Arg Asn Lys Ile Ala 21 O 215 22O Ser Asp Ile Thir Ile Arg Arg Phe Met Val Ala Lieu Val Lieu. Asp Ile 225 23 O 235 24 O Lys Arg Ser Pro Gly Thr Arg Pro Arg Ile Ala Glu Met Ile Cys Asp 245 250 255 Ile Asp Asn Tyr Ile Val Glu Ala Gly Lieu Ala Ser Phe Lieu. Lieu. Thr 26 O 265 27 O Ile Llys Phe Gly Ile Glu Thir Arg Tyr Pro Ala Lieu Ala Lieu. His Glu 27s 28O 285 Phe Ser Gly Glu Lieu Ala Thr Ile Glu Gly Lieu Met Lys Lieu. Tyr Glin 29 O 295 3 OO Ser Met Gly Glu Met Ala Pro Tyr Met Val Ile Lieu. Glu Asn Ser Ile 3. OS 310 315 32O Gln Thr Arg Phe Ser Ala Gly Ser Tyr Pro Leu Lleu Trp Ser Tyr Ala 3.25 330 335 Met Gly Val Gly Val Glu Lieu. Glu Arg Ser Met Gly Gly Lieu. Asn. Phe 34 O 345 35. O Thr Arg Ser Phe Phe Asp Pro Thr Tyr Phe Arg Lieu. Gly Glin Glu Met 355 360 365 Val Arg Arg Ser Ser Gly Met Val Asn. Ser Ser Phe Ala Arg Glu Lieu 37 O 375 38O Gly Leu Ser Glu. His Glu Thr Gln Leu Val Ser Glin Ile Val Asin Ser 385 390 395 4 OO Gly Gly Glu Ser Gly Ile Pro Llys Phe Asp Gly Phe Arg Ala Asn Pro 4 OS 41O 415 Thir Thr Phe Lieu. Gly. Thir Lys Asp Asn. Ile Asn Asp Llys Gly Glu Asp 42O 425 43 O Gln Ser Ser Ser Val Ser Gly Lieu Pro Gly Pro Leu Lleu Pro Ser Arg 435 44 O 445 Asp Lieu. Thir His Pro Gly Asp Ser Tyr Gly Ala Asp Asp Gly Val Lys 450 45.5 460 Asn Val Ser Asn Llys Lieu. Ser Glu Gly Ile Ser Pro Asp His Asp Wall 465 470 47s 48O Ser Ser Ser Ala Met Glu Glu Lieu. Arg Arg Lieu Val Glu Ser Thr Asn 485 490 495 Arg Ile Asp Thr Lys Llys Pro Glu Ala Pro Gly Val Thr Asn His Tyr SOO 505 51O Asn Asp Thir Asp Lieu. Lieu. Arg 515

<210s, SEQ ID NO 9 &211s LENGTH: 519 212. TYPE: PRT <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 9 Met Ser Ser Lieu. Lieu. Arg Ser Lieu Ala Ala Phe Lys Arg His Arg Glu 1. 5 1O 15

Glin Pro Thir Ala Pro Ser Gly Ser Gly Gly Ala Ile Lys Gly Lieu Lys 2O 25 3O

Asn Thr Ile Ile Val Pro Val Pro Gly Asp Thr Val Ile Thr Thr Arg 35 4 O 45

Ser Asn Lieu. Lieu. Phe Arg Lieu Val Tyr Ile Ile Gly ASn Pro Asp Thr US 9,139,620 B2 97 98 - Continued

SO 55 6 O

Pro Luell Ser Thir Ser Thir Gly Ala Ile Ile Ser Lell Lell Thir Luell Phe 65 70

Wall Glu Ser Pro Gly Glin Lell Ile Glin Arg Ile Ala Asp Asp Pro Asp 85 90 95

Ala Wall Phe Lys Lell Wall Glu Wall Ile Pro Glu Ala Gly Asn Pro Gly 105 11 O

Glu Luell Thir Phe Ala Ser Arg Gly Ile Asn Luell Asp Lys Glin Ala Glin 115 12 O 125

Glin Tyr Phe Lell Ala Glu Asn Asp Glin Gly Tyr Wall Ser 13 O 135 14 O

Lell Gly Phe Glu Asn Pro Pro Asn Asp Asp Asp Ile Thir Ser Ser Pro 145 150 155 160

Glu Ile Phe Asn Tyr Ile Lell Ala Ser Wall Luell Ala Glin Wall Trp Ile 1.65 17O 17s

Lell Luell Ala Lys Ala Wall Thir Ala Pro Asp Thir Ala Ala Glu Ala Glu 18O 185 19 O

Asn Arg Arg Trp Ile Lell Met Glin Glin Arg Arg Wall Asp Gly Glu 195

Lell Arg Luell Ser Gly Trp Luell Asp Luell Wall Arg Asn Ile Ala 21 O 215

Ser Asp Ile Thir Ile Arg Arg Phe Met Wall Ala Lell Wall Luell Asp Ile 225 23 O 235 24 O

Arg Ser Pro Gly Thir Arg Pro Arg Ile Ala Glu Met Ile Cys Asp 245 250 255

Ile Asp Asn Tyr Ile Wall Glu Ala Gly Luell Ala Ser Phe Luell Luell Thir 26 O 265 27 O

Ile Phe Gly Ile Glu Thir Arg Pro Ala Lell Ala Luell His Glu 27s 285

Phe Ser Gly Glu Lell Ala Thir Ile Glu Gly Luell Met Luell Tyr Glin 29 O 295 3 OO

Ser Met Gly Glu Met Ala Pro Met Wall Ile Lell Glu Asn Ser Ile 3. OS 310 315

Glin Thir Arg Phe Ser Ala Gly Ser Pro Luell Lell Trp Ser Tyr Ala 3.25 330 335

Met Gly Wall Gly Wall Glu Lell Glu Arg Ser Met Gly Gly Luell Asn Phe 34 O 345 35. O

Thir Arg Ser Phe Phe Asp Pro Thir Phe Arg Lell Gly Glin Glu Met 355 360 365

Wall Arg Arg Ser Ser Gly Met Wall Asn Ser Ser Phe Ala Arg Glu Luell 37 O 375

Gly Luell Ser Asp His Glu Thir Glin Luell Wall Ser Glin Ile Wall Asn Ser 385 390 395 4 OO

Gly Gly Glu Ser Gly Ile Pro Phe Asp Gly Phe Arg Ala Asn Pro 4 OS 415

Thir Thir Phe Luell Gly Thir Asp Asn Ile ASn Asp Arg Gly Glu Asp 425 43 O

Glin Ser Asn Ser Ile Ser Gly Luell Pro Gly Pro Lell Lell Pro Ser Arg 435 44 O 445

Asp Luell Asn Luell Ser Gly Asp Ser Gly Ile Asn Ser Gly Wall 450 45.5 460

Asn Wall Ser Asp Lell Asn Glu Gly Wall Gly Pro Asp His Asp Wall 465 470 47s 48O US 9,139,620 B2 99 100 - Continued

Ser Ser Ser Ala Met Glu Glu Lieu. Arg Arg Lieu Val Glu Ser Thr Asn 485 490 495 Arg Ile Asp Thr Lys Gln Pro Glu Ala Ser Gly Val Thr Asn His Tyr SOO 505 51O Asn Asp Thir Asp Lieu Lleu Lys 515

<210s, SEQ ID NO 10 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 6xHis tag

<4 OOs, SEQUENCE: 10

His His His His His His 1. 5

<210s, SEQ ID NO 11 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 11 cagagacitta atgaaattta tig 23

<210s, SEQ ID NO 12 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 12 ccacccatcg gg tactt 17

<210s, SEQ ID NO 13 &211s LENGTH: 4 212. TYPE: PRT <213> ORGANISM: Feline morbillivirus

<4 OOs, SEQUENCE: 13

Met Ser Ser Lieu. 1.

<210s, SEQ ID NO 14 &211s LENGTH: 10 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 14 ttaaaagggg 10

<210s, SEQ ID NO 15 &211s LENGTH: 11 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 9,139,620 B2 101 102 - Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 15 ttaaaagggg g 11

<210s, SEQ ID NO 16 &211s LENGTH: 10 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 16 ttaaaaaggg 10

<210s, SEQ ID NO 17 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 17 ttcatctott agttcc cagg aa 22

<210s, SEQ ID NO 18 & 211 LENGTH; 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 18 titt cagactic accct cqata t ct 23

<210s, SEQ ID NO 19 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 19 acgcggat.cc gatgtctagt cta 23

<210s, SEQ ID NO 2 O &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 2O cggaatt.cgg ttittagaagg tdagta 26

<210s, SEQ ID NO 21 &211s LENGTH: 523 212. TYPE: PRT <213> ORGANISM: Canine distemper virus US 9,139,620 B2 103 104 - Continued

<4 OOs, SEQUENCE: 21 Met Ala Ser Lieu Lleu Lys Ser Lieu. Thir Lieu. Phe Lys Arg Thr Arg Asp 1. 5 1O 15 Glin Pro Pro Lieu Ala Ser Gly Ser Gly Gly Ala Ile Arg Gly Ile 2O 25 3O His Val Ile Ile Val Lieu. Ile Pro Gly Asp Ser Ser Ile Val Thr Arg 35 4 O 45

Ser Arg Lieu. Lieu. Asp Arg Lieu Val Arg Lieu Val Gly Asp Pro Llys Ile SO 55 6 O

Asn Gly Pro Llys Lieu. Thr Gly Ile Lieu. Ile Ser Ile Lieu. Ser Lieu. Phe 65 70 7s Val Glu Ser Pro Gly Glin Lieu. Ile Glin Arg Ile Ile Asp Asp Pro Asp 85 90 95 Val Ser Ile Llys Lieu Val Glu Val Ile Pro Ser Ile Asn. Ser Ala 1OO 105 11 O Gly Lieu. Thir Phe Ala Ser Arg Gly Ala Ser Lieu. Asp Ser Glu Ala Asp 115 12 O 125

Glu Phe Phe Lys Ile Val Asp Glu Gly Ser Lys Ala Glin Gly Glin Luell 13 O 135 14 O Gly Trp Lieu. Glu Asn Lys Asp Ile Val Asp Ile Glu Val Asp Asn 145 150 155 Glu Glin Phe Asn. Ile Lieu. Lieu Ala Ser Ile Lieu Ala Glin Ile Trp 1.65 17O 17s Lieu. Lieu Ala Lys Ala Val Thr Ala Pro Asp Thr Ala Ala Asp Ser 18O 185 19 O Met Arg Arg Trp Ile Llys Tyr Thr Glin Glin Arg Arg Val Val Gly 195 2OO 2O5 Phe Arg Met Asn Lys Ile Trp Lieu. Asp Ile Val Arg Asn Arg Ile 21 O 215 22O Glu Asp Lieu. Ser Lieu. Arg Arg Phe Met Val Ala Lieu. Ile Lieu. Asp 225 23 O 235 Lys Arg Ser Pro Gly Asn Llys Pro Arg Ile Ala Glu Met Ile Cys Asp 245 250 255

Ile Asp Asn Tyr Ile Val Glu Ala Gly Lieu Ala Ser Phe Ile Lieu. Thir 26 O 265 27 O

Ile Llys Phe Gly Ile Glu Thr Met Tyr Pro Ala Lieu. Gly Lieu. His Glu 27s 28O 285

Phe Ser Gly Glu Lieu. Thir Thr Ile Glu Ser Leu Met Met Leu Tyr Glin 29 O 295 3 OO

Gln Met Gly Glu Thir Ala Pro Tyr Met Val Ile Lieu. Glu Asn Ser Wall 3. OS 310 315

Gln Asn Llys Phe Ser Ala Gly Ser Tyr Pro Leu Lleu Trp Ser Tyr Ala 3.25 330 335

Met Gly Val Gly Val Glu Lieu. Glu Asn. Ser Met Gly Gly Lieu. Asn Phe 34 O 345 35. O

Gly Arg Ser Tyr Phe Asp Pro Ala Tyr Phe Arg Lieu. Gly Glin Glu Met 355 360 365

Val Arg Arg Ser Ala Gly Llys Val Ser Ser Ala Lieu Ala Ala Glu Luell 37 O 375 38O

Gly Ile Thir Lys Glu Glu Ala Glin Lieu Val Ser Glu Ile Ala Ser Lys 385 390 395 4 OO

Thir Thr Glu Asp Arg Thr Ile Arg Ala Thr Gly Pro Lys Glin Ser Glin 4 OS 41O 415