Sequences Analysis of ITS Region and 18S Rdna of Ulva
Total Page：16
File Type：pdf, Size：1020Kb
International Scholarly Research Network ISRN Botany Volume 2012, Article ID 468193, 9 pages doi:10.5402/2012/468193 Research Article Sequences Analysis of ITS Region and 18S rDNA of Ulva Zijie Lin, Zhongheng Lin, Huihui Li, and Songdong Shen College of Life Sciences, Soochow University, Suzhou 215123, China Correspondence should be addressed to Songdong Shen, [email protected] Received 23 February 2011; Accepted 7 April 2011 Academic Editors: J. Elster and H. Sanderson Copyright © 2012 Zijie Lin et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ulva, as the main genera involved in green tides in the Yellow Sea, has attracted serious concern in China. Especially, Ulva prolifera is one of the causative species of the occurring. This paper focused on the complete sequences analyses of ITS, 18S, and the combined data to determine phylogenetic relationships among taxa currently attributed to Ulva, Monostroma, and some other green algal. The samples are all concluded in the area of Yellow Sea, China. The results showed the content of G+C in 18S was approximately concentrated upon 49% in average of 19 subjects while the ITS region content of base G and C is obviously higher than A and T. Comparing the ITS and 18S rDNA sequences obtained in this paper to other species retrieved from GenBank, the genetic distance and the ratio of sequence divergence reflect that U. pertusa and U. prolifera had closer genetic relationship with an 18S rDNA, which had genetic distance of 0.007 while ITS had further genetic distance. According to further comparison, Ulva prolifera has closest genetic distance with Chloropelta caespitosa (0.057) and Ulva californica (0.057), which is a reverification coincided Chloropelta, Enteromorpha,andUlva are not distinct genera. 1. Introduction morphology [11]. In addition, 23 species of Enteromorpha have been recorded in China [12–16]. Most of them are Green tide is an ecological phenomenon that occurs globally marine species, which are widespread along the coast of in which fixed growth alga break away from the shallow China. beaches of calm bays, resulting in accumulation of extensive Due to the divergence of Enteromorpha or Ulva, the Ulva biomass of free-floating green alga [1, 2]. Eutrophication sp. is named according to Tan et al. [20]andHaydenetal. is the main reason for green tide [3, 4]. The main species [21] in this study. Ulva sp. has wide acclimatization and can involved in green tides are Ulva sp. and Enteromorpha sp. grow well in a broad range of temperatures and salinities, Large scale green tides have occurred continuously four times but the morphological characteristics are changing easily in in the Yellow Sea, from 2007 to 2010 in China, [5, 6], which response to the environment [16]. Various morphological had serious influences on the local environment and the life changes in the intraspecies and less differences that are diffi- of coastal residents. As well known, these green tides consist cult to identify, even among interspecies. Therefore, making of Enteromorpha sp. [7, 8]; however, their sources are still an identification of Ulva sp. by using classical taxonomic subject to debate. It has been suggested that the southern methods is very difficult [22, 23]. Molecular biology and coast of the Yellow Sea is the ultimate source; accordingly, cross-hybridization methods [24, 25] have been introduced this region has become the focus of many investigations into this field to clarify the species. By this method, some into the subject [9]. Ulva sp. has been considered the reportshavesuggestedthatgreentidesareformedby main causative species of green tides, which have bloomed an Ulva linza-procera-prolifera (LPP) complex instead of continuously in recent years in the central and southern individual species [5, 26]. Analyses of nuclear ribosomal Yellow Sea in China. Enteromorpha [10]belongstoUlvaceae, internal transcribed spacer DNA (ITS nrDNA; 29 ingroup Ulvales, Chlorophyceae, Chlorophyta. More than 100 species taxa including the type species of Ulva and Enteromorpha), of this organism have been recorded worldwide; however, the chloroplast-encoded rbcL gene (for a subset of taxa), only about 30 species can be recognized based on their and a combined dataset were carried out. Combined with 2 ISRN Botany Table 1: Primers used for PCR amplification and sequencing. Gene Region and direction Primer name Sequence (5-3) 5 end (F) F TCT TTG AAA CCG TAT CGT GA ITS region 3 end (R) R GCT TAT TGA TAT GCT TAA GTT CAG CGG GT 18S rRNA 5 end (F) NS11 GTAGTCATATGCTTGTCTC ∼1150 (R) NS41 CTT CCG TCA ATT CCT TTA AG ∼1150 (F) NS51 AAC TTA AAG GAA TTG ACG GAA G 3 end (R) NS81 TCC GCA GGT TCA CCT ACG GA 5 end (F) CRN52 TGG TTG ATC CTG CCA GTA G ∼1137 (R) 11372 GTG CCC TTC CGT CAA T ∼337 (F) AB13 GGAGGATTAGGGTCCGATTCC ∼1131 (R) TW43 CTTCCGTCAATTCCTTTAAG ∼1056 (F) MonS GCGGGTGTTTGTTTGA ∼1328 (R) MonA CTATTTAGCAGGCTGAGGT 1 From White et al. [17], 2 from Booton et al. [18],3 from Van Oppen [19]. earlier molecular and culture data, these data provide strong hours at 25◦C in swing bed and then were filtered and col- evidence that Ulva, Enteromorpha,andChloropelta are not lected. Total genomic DNA was extracted by CTAB method, distinct evolutionary entities and should not be recognized which was modified according to the samples. In brief, each as separate genera [21]. Partial sequences of the genes coding sample was suspended with DNA extraction solution (3% for rbcL and the 18S rRNA were used to determine the CTAB, 0.1 mol L−1 Tris-HCl, pH 8.0, 0.01 mol L−1 EDTA, phylogenetic position of the order Prasiolales among other 1.4 mol L−1 NaCl, 0.5% β-mercaptoethanol, 1% PVP) and members of the Chlorophyta. Sequence divergence values digested with protease-K with a final concentration of within the Prasiolales for the rbcL gene (0–6.1%) and the 300 μgmL−1. The mixture was incubated at 55◦C for half an 18S rRNA gene (0.4–3.8%) are both low compared to values hour with shaking every ten minutes, and then it was cooled among the other green algal sequences. Parsimony and down to room temperature. One-third volume of 5 M KAc distance analyses of the two subject genes sequences indicate was mixed with the solution before extracting the protein that the Prasiolales is a well-delineated order of green algae with phenol : trichloromethane : isoamyl-alcohol (25 : 24 : 1 containing both Prasiola and Rosenvingiella [27]. v/v/v). The extract was precipitated by isopropyl-alcohol ◦ In this study, complete sequences of ITS and 18S are at −20 C for two hours. The solution was centrifuged used to analyze the phylogenetic relationship among three and then the sediment was collected and cleaned with common species (Ulva prolifera, Ulva pertusa,andMonos- 70% ethyl alcohol. Finally, the sediments were dissolved − − troma grevillei) in the Yellow Sea, China and some other in TE buffer (10 mmol L 1 Tris-HCl, pH 8.0, 1 mmol L 1 green algal around the world. Especially, Ulva prolifera is the EDTA) and could be used as template for the following PCR main causative species of green tides in China. Assessing the amplification. phylogenetic position of Ulva contributes to the investigation of the process of phylogenetic. 2.3. PCR Amplification and Purification. The primers F&R were designed according to ITS region sequence and MonS 2. Material and Methods & MonA were designed according to 18S rDNA sequence retrieved from software Primer 5.0. And the primers were 2.1. Plant Material. Ulva prolifera were collected from synthesized by Shanghai Sangon Biological Engineering Lianyungang coast of Jiangsu Province. And Monostroma Technology and Service Co., Ltd. (Table 1). grevillei and Ulva lactuca were collected from Qingdao coast The reactions for PCR amplification were performed of Shandong Province. Thallus were cleaned up, dried, and with a final volume of 50 μL, containing 27.5 μL ddH2O, stored at −20◦C for further analysis. The samples were 10 μL5×ExTaq Buffer (Mg2+), 6 μL dNTPMix (2.5 mM), reanimated several hours to unfold entirely and then soaked 5 μL of the DNA template, 2 μL of each PCR primer in 0.7% KI solution for ten minutes, followed by scouring (50 pmol μL−1), and 0.5 μL ExTaq DNA polymerase −1 with ddH2O. (5 U μL ). The amplification of ITS region was performed with an ◦ ◦ 2.2. DNA Extraction. The cleaned-up samples were stored initial denaturation at 94 C for 5 min, 35 cycles at 94 Cfor ◦ ◦ at −70◦C overnight and then were triturated thoroughly 1 min, 45 Cfor2min,and65 C for 3 min. And the products ◦ with a chilled mortar and pestle. They were transferred into of amplification were preserved in 4 C. microcentrifuge tubes, which 2% sea snail enzyme with 2 M The amplification of 18S rDNA was performed with an glucose was added into. The samples were digested for three initial denaturation at 95◦C for 2 min, 35 cycles at 95◦C ISRN Botany 3 Table 2: List of species used in this study and GenBank accession the program MEGA 3.1 with Kimura’s two-parameter numbers for ITS and 18S. model [29] to calculate the base composition, Kimura two- 18S rRNA accession parameter distance and the ratio of sequence divergence. For Taxon ITS accession number number phylogenetic analysis, we used MEGA3.1 (neighbor-joining method) to study the relationship of different species to Ulva lactuca AY422499 AF499666 construct the phylogenetic tree, and detect the degree of Klebsormidium EU434019 M95613 bootstrap confidence from 1000 replicates.