Sequences Analysis of ITS Region and 18S Rdna of Ulva

Total Page:16

File Type:pdf, Size:1020Kb

Load more

International Scholarly Research Network ISRN Botany Volume 2012, Article ID 468193, 9 pages doi:10.5402/2012/468193 Research Article Sequences Analysis of ITS Region and 18S rDNA of Ulva Zijie Lin, Zhongheng Lin, Huihui Li, and Songdong Shen College of Life Sciences, Soochow University, Suzhou 215123, China Correspondence should be addressed to Songdong Shen, [email protected] Received 23 February 2011; Accepted 7 April 2011 Academic Editors: J. Elster and H. Sanderson Copyright © 2012 Zijie Lin et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ulva, as the main genera involved in green tides in the Yellow Sea, has attracted serious concern in China. Especially, Ulva prolifera is one of the causative species of the occurring. This paper focused on the complete sequences analyses of ITS, 18S, and the combined data to determine phylogenetic relationships among taxa currently attributed to Ulva, Monostroma, and some other green algal. The samples are all concluded in the area of Yellow Sea, China. The results showed the content of G+C in 18S was approximately concentrated upon 49% in average of 19 subjects while the ITS region content of base G and C is obviously higher than A and T. Comparing the ITS and 18S rDNA sequences obtained in this paper to other species retrieved from GenBank, the genetic distance and the ratio of sequence divergence reflect that U. pertusa and U. prolifera had closer genetic relationship with an 18S rDNA, which had genetic distance of 0.007 while ITS had further genetic distance. According to further comparison, Ulva prolifera has closest genetic distance with Chloropelta caespitosa (0.057) and Ulva californica (0.057), which is a reverification coincided Chloropelta, Enteromorpha,andUlva are not distinct genera. 1. Introduction morphology [11]. In addition, 23 species of Enteromorpha have been recorded in China [12–16]. Most of them are Green tide is an ecological phenomenon that occurs globally marine species, which are widespread along the coast of in which fixed growth alga break away from the shallow China. beaches of calm bays, resulting in accumulation of extensive Due to the divergence of Enteromorpha or Ulva, the Ulva biomass of free-floating green alga [1, 2]. Eutrophication sp. is named according to Tan et al. [20]andHaydenetal. is the main reason for green tide [3, 4]. The main species [21] in this study. Ulva sp. has wide acclimatization and can involved in green tides are Ulva sp. and Enteromorpha sp. grow well in a broad range of temperatures and salinities, Large scale green tides have occurred continuously four times but the morphological characteristics are changing easily in in the Yellow Sea, from 2007 to 2010 in China, [5, 6], which response to the environment [16]. Various morphological had serious influences on the local environment and the life changes in the intraspecies and less differences that are diffi- of coastal residents. As well known, these green tides consist cult to identify, even among interspecies. Therefore, making of Enteromorpha sp. [7, 8]; however, their sources are still an identification of Ulva sp. by using classical taxonomic subject to debate. It has been suggested that the southern methods is very difficult [22, 23]. Molecular biology and coast of the Yellow Sea is the ultimate source; accordingly, cross-hybridization methods [24, 25] have been introduced this region has become the focus of many investigations into this field to clarify the species. By this method, some into the subject [9]. Ulva sp. has been considered the reportshavesuggestedthatgreentidesareformedby main causative species of green tides, which have bloomed an Ulva linza-procera-prolifera (LPP) complex instead of continuously in recent years in the central and southern individual species [5, 26]. Analyses of nuclear ribosomal Yellow Sea in China. Enteromorpha [10]belongstoUlvaceae, internal transcribed spacer DNA (ITS nrDNA; 29 ingroup Ulvales, Chlorophyceae, Chlorophyta. More than 100 species taxa including the type species of Ulva and Enteromorpha), of this organism have been recorded worldwide; however, the chloroplast-encoded rbcL gene (for a subset of taxa), only about 30 species can be recognized based on their and a combined dataset were carried out. Combined with 2 ISRN Botany Table 1: Primers used for PCR amplification and sequencing. Gene Region and direction Primer name Sequence (5-3) 5 end (F) F TCT TTG AAA CCG TAT CGT GA ITS region 3 end (R) R GCT TAT TGA TAT GCT TAA GTT CAG CGG GT 18S rRNA 5 end (F) NS11 GTAGTCATATGCTTGTCTC ∼1150 (R) NS41 CTT CCG TCA ATT CCT TTA AG ∼1150 (F) NS51 AAC TTA AAG GAA TTG ACG GAA G 3 end (R) NS81 TCC GCA GGT TCA CCT ACG GA 5 end (F) CRN52 TGG TTG ATC CTG CCA GTA G ∼1137 (R) 11372 GTG CCC TTC CGT CAA T ∼337 (F) AB13 GGAGGATTAGGGTCCGATTCC ∼1131 (R) TW43 CTTCCGTCAATTCCTTTAAG ∼1056 (F) MonS GCGGGTGTTTGTTTGA ∼1328 (R) MonA CTATTTAGCAGGCTGAGGT 1 From White et al. [17], 2 from Booton et al. [18],3 from Van Oppen [19]. earlier molecular and culture data, these data provide strong hours at 25◦C in swing bed and then were filtered and col- evidence that Ulva, Enteromorpha,andChloropelta are not lected. Total genomic DNA was extracted by CTAB method, distinct evolutionary entities and should not be recognized which was modified according to the samples. In brief, each as separate genera [21]. Partial sequences of the genes coding sample was suspended with DNA extraction solution (3% for rbcL and the 18S rRNA were used to determine the CTAB, 0.1 mol L−1 Tris-HCl, pH 8.0, 0.01 mol L−1 EDTA, phylogenetic position of the order Prasiolales among other 1.4 mol L−1 NaCl, 0.5% β-mercaptoethanol, 1% PVP) and members of the Chlorophyta. Sequence divergence values digested with protease-K with a final concentration of within the Prasiolales for the rbcL gene (0–6.1%) and the 300 μgmL−1. The mixture was incubated at 55◦C for half an 18S rRNA gene (0.4–3.8%) are both low compared to values hour with shaking every ten minutes, and then it was cooled among the other green algal sequences. Parsimony and down to room temperature. One-third volume of 5 M KAc distance analyses of the two subject genes sequences indicate was mixed with the solution before extracting the protein that the Prasiolales is a well-delineated order of green algae with phenol : trichloromethane : isoamyl-alcohol (25 : 24 : 1 containing both Prasiola and Rosenvingiella [27]. v/v/v). The extract was precipitated by isopropyl-alcohol ◦ In this study, complete sequences of ITS and 18S are at −20 C for two hours. The solution was centrifuged used to analyze the phylogenetic relationship among three and then the sediment was collected and cleaned with common species (Ulva prolifera, Ulva pertusa,andMonos- 70% ethyl alcohol. Finally, the sediments were dissolved − − troma grevillei) in the Yellow Sea, China and some other in TE buffer (10 mmol L 1 Tris-HCl, pH 8.0, 1 mmol L 1 green algal around the world. Especially, Ulva prolifera is the EDTA) and could be used as template for the following PCR main causative species of green tides in China. Assessing the amplification. phylogenetic position of Ulva contributes to the investigation of the process of phylogenetic. 2.3. PCR Amplification and Purification. The primers F&R were designed according to ITS region sequence and MonS 2. Material and Methods & MonA were designed according to 18S rDNA sequence retrieved from software Primer 5.0. And the primers were 2.1. Plant Material. Ulva prolifera were collected from synthesized by Shanghai Sangon Biological Engineering Lianyungang coast of Jiangsu Province. And Monostroma Technology and Service Co., Ltd. (Table 1). grevillei and Ulva lactuca were collected from Qingdao coast The reactions for PCR amplification were performed of Shandong Province. Thallus were cleaned up, dried, and with a final volume of 50 μL, containing 27.5 μL ddH2O, stored at −20◦C for further analysis. The samples were 10 μL5×ExTaq Buffer (Mg2+), 6 μL dNTPMix (2.5 mM), reanimated several hours to unfold entirely and then soaked 5 μL of the DNA template, 2 μL of each PCR primer in 0.7% KI solution for ten minutes, followed by scouring (50 pmol μL−1), and 0.5 μL ExTaq DNA polymerase −1 with ddH2O. (5 U μL ). The amplification of ITS region was performed with an ◦ ◦ 2.2. DNA Extraction. The cleaned-up samples were stored initial denaturation at 94 C for 5 min, 35 cycles at 94 Cfor ◦ ◦ at −70◦C overnight and then were triturated thoroughly 1 min, 45 Cfor2min,and65 C for 3 min. And the products ◦ with a chilled mortar and pestle. They were transferred into of amplification were preserved in 4 C. microcentrifuge tubes, which 2% sea snail enzyme with 2 M The amplification of 18S rDNA was performed with an glucose was added into. The samples were digested for three initial denaturation at 95◦C for 2 min, 35 cycles at 95◦C ISRN Botany 3 Table 2: List of species used in this study and GenBank accession the program MEGA 3.1 with Kimura’s two-parameter numbers for ITS and 18S. model [29] to calculate the base composition, Kimura two- 18S rRNA accession parameter distance and the ratio of sequence divergence. For Taxon ITS accession number number phylogenetic analysis, we used MEGA3.1 (neighbor-joining method) to study the relationship of different species to Ulva lactuca AY422499 AF499666 construct the phylogenetic tree, and detect the degree of Klebsormidium EU434019 M95613 bootstrap confidence from 1000 replicates.
Recommended publications
  • Exhaustive Reanalysis of Barcode Sequences from Public

    Exhaustive Reanalysis of Barcode Sequences from Public

    Exhaustive reanalysis of barcode sequences from public repositories highlights ongoing misidentifications and impacts taxa diversity and distribution: a case study of the Sea Lettuce. Antoine Fort1, Marcus McHale1, Kevin Cascella2, Philippe Potin2, Marie-Mathilde Perrineau3, Philip Kerrison3, Elisabete da Costa4, Ricardo Calado4, Maria Domingues5, Isabel Costa Azevedo6, Isabel Sousa-Pinto6, Claire Gachon3, Adrie van der Werf7, Willem de Visser7, Johanna Beniers7, Henrice Jansen7, Michael Guiry1, and Ronan Sulpice1 1NUI Galway 2Station Biologique de Roscoff 3Scottish Association for Marine Science 4University of Aveiro 5Universidade de Aveiro 6University of Porto Interdisciplinary Centre of Marine and Environmental Research 7Wageningen University & Research November 24, 2020 Abstract Sea Lettuce (Ulva spp.; Ulvophyceae, Ulvales, Ulvaceae) is an important ecological and economical entity, with a worldwide distribution and is a well-known source of near-shore blooms blighting many coastlines. Species of Ulva are frequently misiden- tified in public repositories, including herbaria and gene banks, making species identification based on traditional barcoding hazardous. We investigated the species distribution of 295 individual distromatic foliose strains from the North East Atlantic by traditional barcoding or next generation sequencing. We found seven distinct species, and compared our results with all worldwide Ulva spp sequences present in the NCBI database for the three barcodes rbcL, tuf A and the ITS1. Our results demonstrate a large degree of species misidentification in the NCBI database. We estimate that 21% of the entries pertaining to foliose species are misannotated. In the extreme case of U. lactuca, 65% of the entries are erroneously labelled specimens of another Ulva species, typically U. fenestrata. In addition, 30% of U.
  • Differentiation Between Some Ulva Spp. by Morphological, Genetic and Biochemical Analyses

    Differentiation Between Some Ulva Spp. by Morphological, Genetic and Biochemical Analyses

    Филогенетика Вавиловский журнал генетики и селекции. 2017;21(3):360­367 ОРИГИНАЛЬНОЕ ИССЛЕДОВАНИЕ / ORIGINAL ARTICLE DOI 10.18699/VJ17.253 Differentiation between some Ulva spp. by morphological, genetic and biochemical analyses M.M. Ismail1 , S.E. Mohamed2 1 Marine Environmental Division, National Institute of Oceanography and Fisheries, Alexandria, Egypt 2 Department of Molecular Biology, Genetic Engineering and Biotechnology Research Institute, Sadat City University, Sadat City, Egypt Ulva is most common green seaweed in Egypt coast, it used as a Различия между некоторыми source of food, feed, medicines and fertilizers in all the world. This study is the first time to investigate the morphological, genetic видами рода Ulva, выявленные and biochemical variation within four Ulva species collected путем морфологического, from Eastern Harbor, Alexandria. The morphology description of генетического и биохимического thallus showed highly variations according to species, but there is not enough data to make differentiation between species in the анализа same genus since it is impacted with environmental factors and development stage of seaweeds. Genetic variations between the М.М. Исмаил1 , С.Э. Мохамед2 tested Ulva spp. were analyzed using random amplified polymor­ phic DNA (RAPD) analyses which shows that it would be possible 1 Отдел исследований морской среды Национального института to establish a unique fingerprint for individual seaweeds based on океанографии и рыболовства, Александрия, Египет 2 Отдел молекулярной биологии Исследовательского института the combined results generated from a small collection of prim­ генной инженерии и биотехнологий, Садатский университет, ers. The dendrogram showed that the most closely species are Садат, Египет U. lactuca and U. compressa, while, U. fasciata was far from both U.
  • Using a Macroalgal Functional Form Approach to Assess the Level of Disturbance of Seagrass Meadows in Bahía of Nuevitas, Cuba (2000-2002)

    Using a Macroalgal Functional Form Approach to Assess the Level of Disturbance of Seagrass Meadows in Bahía of Nuevitas, Cuba (2000-2002)

    American Journal of Plant Sciences, 2019, 10, 2020-2033 https://www.scirp.org/journal/ajps ISSN Online: 2158-2750 ISSN Print: 2158-2742 Using a Macroalgal Functional Form Approach to Assess the Level of Disturbance of Seagrass Meadows in Bahía of Nuevitas, Cuba (2000-2002) Rubén Cabrera1*, Jhoana Díaz-Larrea2, Schery Umanzor3, Laura Georgina Núñez García2 1Gabinete de Arqueologia,́ Oficina del Historiador de la Ciudad, Habana Vieja, Cuba 2Departamento de Hidrobiología, Universidad Autónoma Metropolitana-Iztapalapa, Mexico City, Mexico 3Department of Ecology & Evolutionary Biology, University of Connecticut, Stamford, CT, USA How to cite this paper: Cabrera, R., Abstract Díaz-Larrea, J., Umanzor, S. and García, L.G.N. (2019) Using a Macroalgal Func- A study on the spatial and seasonal variations of the associate macroalgae and tional Form Approach to Assess the Level epiphytes of Thalassia testudinum was carried out in Bahía de Nuevitas. Six- of Disturbance of Seagrass Meadows in ty-two species were identified: 3 Cyanophyta, 25 Chlorophyta, 8 Phaeophy- Bahía of Nuevitas, Cuba (2000-2002). American Journal of Plant Sciences, 10, ceae, 23 Rhodophyta and 3 Magnoliophyta, with two new records for Cuba 2020-2033. and 43 for the area. The differences in the specific composition of the ma- https://doi.org/10.4236/ajps.2019.1011142 croalgae communities are determined by a space component related to the Received: October 10, 2019 type of affectation in each area. The morpho-functional groups of macroalgae Accepted: November 18, 2019 in the station with more nutrient influence were mainly foliaceous and fila- Published: November 21, 2019 mentous. In the stations far from the city, the predominant morpho-types were the leathery and articulate calcareous indicators of lower nitrification Copyright © 2019 by author(s) and Scientific Research Publishing Inc.
  • Successions of Phytobenthos Species in a Mediterranean Transitional Water System: the Importance of Long Term Observations

    Successions of Phytobenthos Species in a Mediterranean Transitional Water System: the Importance of Long Term Observations

    A peer-reviewed open-access journal Nature ConservationSuccessions 34: 217–246 of phytobenthos (2019) species in a Mediterranean transitional water system... 217 doi: 10.3897/natureconservation.34.30055 RESEARCH ARTICLE http://natureconservation.pensoft.net Launched to accelerate biodiversity conservation Successions of phytobenthos species in a Mediterranean transitional water system: the importance of long term observations Antonella Petrocelli1, Ester Cecere1, Fernando Rubino1 1 Water Research Institute (IRSA) – CNR, via Roma 3, 74123 Taranto, Italy Corresponding author: Antonella Petrocelli ([email protected]) Academic editor: A. Lugliè | Received 25 September 2018 | Accepted 28 February 2019 | Published 3 May 2019 http://zoobank.org/5D4206FB-8C06-49C8-9549-F08497EAA296 Citation: Petrocelli A, Cecere E, Rubino F (2019) Successions of phytobenthos species in a Mediterranean transitional water system: the importance of long term observations. In: Mazzocchi MG, Capotondi L, Freppaz M, Lugliè A, Campanaro A (Eds) Italian Long-Term Ecological Research for understanding ecosystem diversity and functioning. Case studies from aquatic, terrestrial and transitional domains. Nature Conservation 34: 217–246. https://doi.org/10.3897/ natureconservation.34.30055 Abstract The availability of quantitative long term datasets on the phytobenthic assemblages of the Mar Piccolo of Taranto (southern Italy, Mediterranean Sea), a lagoon like semi-enclosed coastal basin included in the Italian LTER network, enabled careful analysis of changes occurring in the structure of the community over about thirty years. The total number of taxa differed over the years. Thirteen non-indigenous species in total were found, their number varied over the years, reaching its highest value in 2017. The dominant taxa differed over the years.
  • Download This Article in PDF Format

    Download This Article in PDF Format

    E3S Web of Conferences 233, 02037 (2021) https://doi.org/10.1051/e3sconf/202123302037 IAECST 2020 Comparing Complete Mitochondrion Genome of Bloom-forming Macroalgae from the Southern Yellow Sea, China Jing Xia1, Peimin He1, Jinlin Liu1,*, Wei Liu1, Yichao Tong1, Yuqing Sun1, Shuang Zhao1, Lihua Xia2, Yutao Qin2, Haofei Zhang2, and Jianheng Zhang1,* 1College of Marine Ecology and Environment, Shanghai Ocean University, Shanghai, China, 201306 2East China Sea Environmental Monitoring Center, State Oceanic Administration, Shanghai, China, 201206 Abstract. The green tide in the Southern Yellow Sea which has been erupting continuously for 14 years. Dominant species of the free-floating Ulva in the early stage of macroalgae bloom were Ulva compressa, Ulva flexuosa, Ulva prolifera, and Ulva linza along the coast of Jiangsu Province. In the present study, we carried out comparative studies on complete mitochondrion genomes of four kinds of bloom-forming green algae, and provided standard morphological characteristic pictures of these Ulva species. The maximum likelihood phylogenetic analysis showed that U. linza is the closest sister species of U. prolifera. This study will be helpful in studying the genetic diversity and identification of Ulva species. 1 Introduction gradually [19]. Thus, it was meaningful to carry out comparative studies on organelle genomes of these Green tides, which occur widely in many coastal areas, bloom-forming green algae. are caused primarily by flotation, accumulation, and excessive proliferation of green macroalgae, especially the members of the genus Ulva [1-3]. China has the high 2 The specimen and data preparation frequency outbreak of the green tide [4-10]. Especially, In our previous studies, mitochondrion genome of U.
  • Lateral Gene Transfer of Anion-Conducting Channelrhodopsins Between Green Algae and Giant Viruses

    Lateral Gene Transfer of Anion-Conducting Channelrhodopsins Between Green Algae and Giant Viruses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.15.042127; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 5 Lateral gene transfer of anion-conducting channelrhodopsins between green algae and giant viruses Andrey Rozenberg 1,5, Johannes Oppermann 2,5, Jonas Wietek 2,3, Rodrigo Gaston Fernandez Lahore 2, Ruth-Anne Sandaa 4, Gunnar Bratbak 4, Peter Hegemann 2,6, and Oded 10 Béjà 1,6 1Faculty of Biology, Technion - Israel Institute of Technology, Haifa 32000, Israel. 2Institute for Biology, Experimental Biophysics, Humboldt-Universität zu Berlin, Invalidenstraße 42, Berlin 10115, Germany. 3Present address: Department of Neurobiology, Weizmann 15 Institute of Science, Rehovot 7610001, Israel. 4Department of Biological Sciences, University of Bergen, N-5020 Bergen, Norway. 5These authors contributed equally: Andrey Rozenberg, Johannes Oppermann. 6These authors jointly supervised this work: Peter Hegemann, Oded Béjà. e-mail: [email protected] ; [email protected] 20 ABSTRACT Channelrhodopsins (ChRs) are algal light-gated ion channels widely used as optogenetic tools for manipulating neuronal activity 1,2. Four ChR families are currently known. Green algal 3–5 and cryptophyte 6 cation-conducting ChRs (CCRs), cryptophyte anion-conducting ChRs (ACRs) 7, and the MerMAID ChRs 8. Here we 25 report the discovery of a new family of phylogenetically distinct ChRs encoded by marine giant viruses and acquired from their unicellular green algal prasinophyte hosts.
  • Metagenomic and Proteomic Analyses of a Mangrove Microbial

    Metagenomic and Proteomic Analyses of a Mangrove Microbial

    J. Microbiol. Biotechnol. (2016), 26(12), 2127–2137 http://dx.doi.org/10.4014/jmb.1607.07025 Research Article Review jmb Metagenomic and Proteomic Analyses of a Mangrove Microbial Community Following Green Macroalgae Enteromorpha prolifera Degradation S Yijing Wu1, Chao Zhao1,2*, Zheng Xiao1, Hetong Lin1, Lingwei Ruan3, and Bin Liu1,4 1College of Food Science, Fujian Agriculture and Forestry University, Fuzhou 350002, P.R. China 2Department of Chemistry, University of California, Davis, CA 95616, USA 3Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration, Xiamen 361005, P.R. China 4National Engineering Research Center of Juncao, Fuzhou 350002, P.R. China Received: July 11, 2016 Revised: August 7, 2016 A mangrove microbial community was analyzed at the gene and protein levels using Accepted: August 10, 2016 metagenomic and proteomic methods with the green macroalgae Enteromorpha prolifera as the substrate. Total DNA was sequenced on the Illumina HiSeq 2000 PE-100 platform. Two- dimensional gel electrophoresis in combination with liquid chromatography tandem mass First published online spectrometry was used for proteomic analysis. The metagenomic data revealed that the orders August 24, 2016 Pseudomonadales, Rhizobiales, and Sphingomonadales were the most prevalent in the *Corresponding author mangrove microbial community. By monitoring changes at the functional level, proteomic Phone: +86-591-83530197; analyses detected ATP synthase and transporter proteins, which were expressed mainly by Fax: +86-591-83530197; members of the phyla Proteobacteria and Bacteroidetes. Members of the phylum E-mail: [email protected] Proteobacteria expressed a high number of sugar transporters and demonstrated specialized and efficient digestion of various glycans.
  • SPECIAL PUBLICATION 6 the Effects of Marine Debris Caused by the Great Japan Tsunami of 2011

    SPECIAL PUBLICATION 6 the Effects of Marine Debris Caused by the Great Japan Tsunami of 2011

    PICES SPECIAL PUBLICATION 6 The Effects of Marine Debris Caused by the Great Japan Tsunami of 2011 Editors: Cathryn Clarke Murray, Thomas W. Therriault, Hideaki Maki, and Nancy Wallace Authors: Stephen Ambagis, Rebecca Barnard, Alexander Bychkov, Deborah A. Carlton, James T. Carlton, Miguel Castrence, Andrew Chang, John W. Chapman, Anne Chung, Kristine Davidson, Ruth DiMaria, Jonathan B. Geller, Reva Gillman, Jan Hafner, Gayle I. Hansen, Takeaki Hanyuda, Stacey Havard, Hirofumi Hinata, Vanessa Hodes, Atsuhiko Isobe, Shin’ichiro Kako, Masafumi Kamachi, Tomoya Kataoka, Hisatsugu Kato, Hiroshi Kawai, Erica Keppel, Kristen Larson, Lauran Liggan, Sandra Lindstrom, Sherry Lippiatt, Katrina Lohan, Amy MacFadyen, Hideaki Maki, Michelle Marraffini, Nikolai Maximenko, Megan I. McCuller, Amber Meadows, Jessica A. Miller, Kirsten Moy, Cathryn Clarke Murray, Brian Neilson, Jocelyn C. Nelson, Katherine Newcomer, Michio Otani, Gregory M. Ruiz, Danielle Scriven, Brian P. Steves, Thomas W. Therriault, Brianna Tracy, Nancy C. Treneman, Nancy Wallace, and Taichi Yonezawa. Technical Editor: Rosalie Rutka Please cite this publication as: The views expressed in this volume are those of the participating scientists. Contributions were edited for Clarke Murray, C., Therriault, T.W., Maki, H., and Wallace, N. brevity, relevance, language, and style and any errors that [Eds.] 2019. The Effects of Marine Debris Caused by the were introduced were done so inadvertently. Great Japan Tsunami of 2011, PICES Special Publication 6, 278 pp. Published by: Project Designer: North Pacific Marine Science Organization (PICES) Lori Waters, Waters Biomedical Communications c/o Institute of Ocean Sciences Victoria, BC, Canada P.O. Box 6000, Sidney, BC, Canada V8L 4B2 Feedback: www.pices.int Comments on this volume are welcome and can be sent This publication is based on a report submitted to the via email to: [email protected] Ministry of the Environment, Government of Japan, in June 2017.
  • Print This Article

    Print This Article

    Mediterranean Marine Science Vol. 15, 2014 Seaweeds of the Greek coasts. II. Ulvophyceae TSIAMIS K. Hellenic Centre for Marine Research PANAYOTIDIS P. Hellenic Centre for Marine Research ECONOMOU-AMILLI A. Faculty of Biology, Department of Ecology and Taxonomy, Athens University KATSAROS C. of Biology, Department of Botany, Athens University https://doi.org/10.12681/mms.574 Copyright © 2014 To cite this article: TSIAMIS, K., PANAYOTIDIS, P., ECONOMOU-AMILLI, A., & KATSAROS, C. (2014). Seaweeds of the Greek coasts. II. Ulvophyceae. Mediterranean Marine Science, 15(2), 449-461. doi:https://doi.org/10.12681/mms.574 http://epublishing.ekt.gr | e-Publisher: EKT | Downloaded at 25/09/2021 06:44:40 | Review Article Mediterranean Marine Science Indexed in WoS (Web of Science, ISI Thomson) and SCOPUS The journal is available on line at http://www.medit-mar-sc.net Doi: http://dx.doi.org/ 10.12681/mms.574 Seaweeds of the Greek coasts. II. Ulvophyceae K. TSIAMIS1, P. PANAYOTIDIS1, A. ECONOMOU-AMILLI2 and C. KATSAROS3 1 Hellenic Centre for Marine Research (HCMR), Institute of Oceanography, Anavyssos 19013, Attica, Greece 2 Faculty of Biology, Department of Ecology and Taxonomy, Athens University, Panepistimiopolis 15784, Athens, Greece 3 Faculty of Biology, Department of Botany, Athens University, Panepistimiopolis 15784, Athens, Greece Corresponding author: [email protected] Handling Editor: Sotiris Orfanidis Received: 5 August 2013 ; Accepted: 5 February 2014; Published on line: 14 March 2014 Abstract An updated checklist of the green seaweeds (Ulvophyceae) of the Greek coasts is provided, based on both literature records and new collections. The total number of species and infraspecific taxa currently accepted is 96.
  • Seaweeds of California Green Algae

    Seaweeds of California Green Algae

    PDF version Remove references Seaweeds of California (draft: Sun Nov 24 15:32:39 2019) This page provides current names for California seaweed species, including those whose names have changed since the publication of Marine Algae of California (Abbott & Hollenberg 1976). Both former names (1976) and current names are provided. This list is organized by group (green, brown, red algae); within each group are genera and species in alphabetical order. California seaweeds discovered or described since 1976 are indicated by an asterisk. This is a draft of an on-going project. If you have questions or comments, please contact Kathy Ann Miller, University Herbarium, University of California at Berkeley. [email protected] Green Algae Blidingia minima (Nägeli ex Kützing) Kylin Blidingia minima var. vexata (Setchell & N.L. Gardner) J.N. Norris Former name: Blidingia minima var. subsalsa (Kjellman) R.F. Scagel Current name: Blidingia subsalsa (Kjellman) R.F. Scagel et al. Kornmann, P. & Sahling, P.H. 1978. Die Blidingia-Arten von Helgoland (Ulvales, Chlorophyta). Helgoländer Wissenschaftliche Meeresuntersuchungen 31: 391-413. Scagel, R.F., Gabrielson, P.W., Garbary, D.J., Golden, L., Hawkes, M.W., Lindstrom, S.C., Oliveira, J.C. & Widdowson, T.B. 1989. A synopsis of the benthic marine algae of British Columbia, southeast Alaska, Washington and Oregon. Phycological Contributions, University of British Columbia 3: vi + 532. Bolbocoleon piliferum Pringsheim Bryopsis corticulans Setchell Bryopsis hypnoides Lamouroux Former name: Bryopsis pennatula J. Agardh Current name: Bryopsis pennata var. minor J. Agardh Silva, P.C., Basson, P.W. & Moe, R.L. 1996. Catalogue of the benthic marine algae of the Indian Ocean.
  • Ulva L. (Ulvales, Chlorophyta) from Manawatāwhi/ Three Kings Islands, New Zealand: Ulva Piritoka Ngāti Kuri, Heesch & W.A.Nelson, Sp

    Ulva L. (Ulvales, Chlorophyta) from Manawatāwhi/ Three Kings Islands, New Zealand: Ulva Piritoka Ngāti Kuri, Heesch & W.A.Nelson, Sp

    cryptogamie Algologie 2021 ● 42 ● 9 DIRECTEUR DE LA PUBLICATION / PUBLICATION DIRECTOR : Bruno DAVID Président du Muséum national d’Histoire naturelle RÉDACTRICE EN CHEF / EDITOR-IN-CHIEF : Line LE GALL Muséum national d’Histoire naturelle ASSISTANTE DE RÉDACTION / ASSISTANT EDITOR : Marianne SALAÜN ([email protected]) MISE EN PAGE / PAGE LAYOUT : Marianne SALAÜN RÉDACTEURS ASSOCIÉS / ASSOCIATE EDITORS Ecoevolutionary dynamics of algae in a changing world Stacy KRUEGER-HADFIELD Department of Biology, University of Alabama, 1300 University Blvd, Birmingham, AL 35294 (United States) Jana KULICHOVA Department of Botany, Charles University, Prague (Czech Republic) Cecilia TOTTI Dipartimento di Scienze della Vita e dell’Ambiente, Università Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona (Italy) Phylogenetic systematics, species delimitation & genetics of speciation Sylvain FAUGERON UMI3614 Evolutionary Biology and Ecology of Algae, Departamento de Ecología, Facultad de Ciencias Biologicas, Pontificia Universidad Catolica de Chile, Av. Bernardo O’Higgins 340, Santiago (Chile) Marie-Laure GUILLEMIN Instituto de Ciencias Ambientales y Evolutivas, Universidad Austral de Chile, Valdivia (Chile) Diana SARNO Department of Integrative Marine Ecology, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli (Italy) Comparative evolutionary genomics of algae Nicolas BLOUIN Department of Molecular Biology, University of Wyoming, Dept. 3944, 1000 E University Ave, Laramie, WY 82071 (United States) Heroen VERBRUGGEN School of BioSciences,
  • Species Determination of Ulvoid Algae Through Genotyping; What Are the Environmental Implications? Kora S

    Species Determination of Ulvoid Algae Through Genotyping; What Are the Environmental Implications? Kora S

    Seattle aP cific nivU ersity Digital Commons @ SPU Honors Projects University Scholars Spring June 7th, 2019 Species determination of ulvoid algae through genotyping; what are the environmental implications? Kora S. Krumm Seattle Pacific nU iversity Follow this and additional works at: https://digitalcommons.spu.edu/honorsprojects Part of the Environmental Health and Protection Commons, Environmental Monitoring Commons, Natural Resources and Conservation Commons, and the Oceanography Commons Recommended Citation Krumm, Kora S., "Species determination of ulvoid algae through genotyping; what are the environmental implications?" (2019). Honors Projects. 95. https://digitalcommons.spu.edu/honorsprojects/95 This Honors Project is brought to you for free and open access by the University Scholars at Digital Commons @ SPU. It has been accepted for inclusion in Honors Projects by an authorized administrator of Digital Commons @ SPU. SPECIES DETERMINATION OF ULVOID ALGAE THROUGH GENOTYPING: WHAT ARE THE ENVIRONMENTAL IMPLICATIONS? by KORA S KRUMM FACULTY ADVISOR, TIMOTHY A NELSON SECOND READER, ERIC S LONG A project submitted in partial fulfillment of the requirements of the University Scholars Honors Program Seattle Pacific University 2019 Approved _________________________________ Date ________________________________________ ABSTRACT Ulva is a genus of marine green algae native to many of the world’s coastlines and is especially difficult to identify via traditional methods such as dichotomous keying. This project aims to streamline taxonomic classification of Ulva species through DNA sequence analysis. Local samples of Ulva were obtained from Puget Sound, Seattle, WA, and two target genes (rbcL and its1) were amplified via PCR and sequenced for comparative analysis between samples. Ulvoids have a detrimental impact on marine ecosystems in the Pacific Northwest due to their role in eutrophication-caused algal blooms, and reliable identification can help inform conservation efforts to mitigate these effects.