Neuroprotective Effect of Kinase Inhibition in Ischemic Factor Modeling in Vitro

International Journal of Molecular Sciences

Article Neuroprotective Effect of Kinase Inhibition in Ischemic Factor Modeling In Vitro

Elena V. Mitroshina 1,*, Maria M. Loginova 1, Maria O. Savyuk 1, Mikhail I. Krivonosov 2 , Tatiana A. Mishchenko 1, Viktor S. Tarabykin 1,3, Mikhail V. Ivanchenko 2 and Maria V. Vedunova 1,*

1 Institute of Biology and Biomedicine, Lobachevsky State University of Nizhni Novgorod, 23 Prospekt Gagarina, 603950 Nizhny Novgorod, Russia; [email protected] (M.M.L.); [email protected] (M.O.S.); [email protected] (T.A.M.); [email protected] (V.S.T.) 2 Institute of Information, Technology, Mathematics and Mechanics, Lobachevsky State University of Nizhni Novgorod, 23 Prospekt Gagarina, 603950 Nizhny Novgorod, Russia; [email protected] (M.I.K.); [email protected] (M.V.I.) 3 Institute of Cell Biology and Neurobiology, Charité—Universitätsmedizin Berlin, Charitéplatz 1, 10117 Berlin, Germany * Correspondence: [email protected] (E.V.M.); [email protected] (M.V.V.); Tel.: +7-950-604-5137 (E.V.M.); +7-915-937-55-55 (M.V.V.)

Abstract: The contribution of many neuronal kinases to the adaptation of nerve cells to ischemic damage and their effect on functional neural network activity has not yet been studied. The aim of this work is to study the role of the four kinases belonging to different metabolic cascades (SRC, Ikkb, eEF2K, and FLT4) in the adaptive potential of the neuron-glial network for modeling the key factors of ischemic damage. We carried out a comprehensive study on the effects of kinases blockade on the viability and network functional calcium activity of nerve cells under ischemic factor modeling in vitro. Ischemic factor modelling was performed on day 14 of culturing primary hippocampal cells obtained from mouse embryos (E18). The most signiﬁcant neuroprotective effect Citation: Mitroshina, E.V.; Loginova, was shown in the blockade of FLT4 kinase in the simulation of hypoxia. The studies performed M.M.; Savyuk, M.O.; Krivonosov, revealed the role of FLT4 in the development of functional dysfunction in cerebrovascular accidents M.I.; Mishchenko, T.A.; Tarabykin, and created new opportunities for the study of this enzyme and its blockers in the formation of new V.S.; Ivanchenko, M.V.; Vedunova, M.V. Neuroprotective Effect of Kinase therapeutic strategies. Inhibition in Ischemic Factor Modeling In Vitro. Int. J. Mol. Sci. Keywords: protein kinase inhibitors; primary hippocampal cultures; functional neural network 2021, 22, 1885. https://doi.org/ activity; neuroprotection; ischemia; hypoxia 10.3390/ijms22041885

Academic Editor: Ana Martínez Received: 11 January 2021 1. Introduction Accepted: 10 February 2021 Ischemic stroke is one of the most common diseases in the world, characterized by high Published: 14 February 2021 disability and death rates of patients and is especially signiﬁcant in terms of life expectancy. In the coming decades, an increase in the average age of the population and additional risk Publisher’s Note: MDPI stays neu- factors such as hypertension, being overweight, and a sedentary lifestyle will contribute tral with regard to jurisdictional claims to the increase of the prevalence of pathologies related to the acute impairment of blood in published maps and institutional afﬁliations. supply to the brain. Ischemic damage triggers signaling pathways that lead to nerve cell death and destruction of the brain tissue. Oxygen and energy starvation activate pathogenetic reactions in various types of cells of the central nervous system (CNS), including neurons, astrocytes, Copyright: © 2021 by the authors. Li- microglia, and vascular endothelial cells. The most important of these reactions include censee MDPI, Basel, Switzerland. This excitotoxicity, mediated by the excessive release of excitatory neurotransmitters [1], as article is an open access article distributed well as dysfunction of mitochondria and oxidative stress [2]. These processes lead to under the terms and conditions of the disturbances in the functional and metabolic activity of nerve cells. They ultimately trigger Creative Commons Attribution (CC BY) necrotic and apoptotic processes, which are associated with the loss of structural and license (https://creativecommons.org/ functional elements of the neural network [3–5]. In addition, an important component licenses/by/4.0/).

Int. J. Mol. Sci. 2021, 22, 1885. https://doi.org/10.3390/ijms22041885 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 1885 2 of 18

of the pathophysiology of ischemic stroke is inflammation mediated by astrocytes and microglia [6–9]. Various kinases are components of almost all these molecular cascades; they can be considered potential molecular targets for the development of neuroprotection methods in ischemic stroke. For example, the neuroprotective role of phosphatidylinositol-3-kinase (PI3K)/Akt cascade has been widely studied [10–12]. PI3Ks are a family of proteins involved in intracellular signal transduction and the regulation of cell survival [13]. Previous investigations showed PI3K/Akt pathway plays a critical role to regulate cell activities, inflammatory response and apoptosis in cerebral ischemia. Akt, a serine protein kinase, triggers phosphorylation of several enzymes (e.g., glycogen synthase kinase 3 beta (GSK3β), thereby regulating a series of cellular functions [14,15]. However, the contribution of many neuronal kinases to the adaptation of nerve cells to ischemic damage and their effect on functional neural network activity has not yet been studied. In our recent study [16], we performed screening of the effect of selective and nonse- lective blockers on more than 50 kinases with a previously undescribed neuroprotective effect on neuronal viability when modeling one of the factors of ischemic damage (glucose deprivation). Particular attention is paid to enzymes with neuroprotective effects that were not previously described as neuroprotectors or those kinases whose functions are not directly related to the function of cells of the nervous system. We identified several groups of kinases and characterized the most physiologically significant of them based on the effect they have. It was shown that inhibition of the eEF2K, SRC, and IKKb (IKK2) kinases maintain cell viability in primary neuronal cultures during in vitro glucose deprivation. In the present study, these kinases were selected to assess their effect on the neural network activity of brain cells in ischemic injury. Unlike other tissues and organs, brain functionality depends not on individual cells, but rather on their functional ensembles, which make up neuron-glial networks. Neural networks are considered as the minimum functional unit that ensures the implementation of higher cognitive functions, including memory, consciousness, emotional reactions, and the ability to respond to environmental changes. To understand the pathogenesis and to develop methods of therapy for diseases of the central nervous system, it is essential to study the functional network activity of nerve cells. The functional network activity is spontaneous spatiotemporal patterns of bioelectric signaling between nerve cells in neuronal assemblies. These rhythmic modulations in neuronal activity have been linked to various important brain functions, including attention, sensory or computational processing, decision-making and consciousness [17]. Calcium ions play a crucial role in signaling between nerve cells and the regulation of synaptic activity, and their imaging gives a means to estimate the functional state of neuronal networks with cellular resolution. The recently developed algorithm for analyzing calcium imaging data employs correlation analysis to reconstruct and follow the dynamical architecture of neuron-glial networks [18,19]. It provides with a powerful tool to characterize the collective and coordinated activity of these networks on the functional level and infer its response to model conditions, and evaluate the effect of damaging and protective factors. The goal of this work is to study the role of the four kinases belonging to different metabolic cascades in the adaptive potential of the neuron-glial network in modeling the key factors of ischemic damage.

2. Results The functions of the studied kinases in the nervous system are so far almost undescribed. However, in our recent work, it was shown that their blockade has a positive effect on the viability of nerve cells in a deﬁciency of energy substrates, which indicates the important role of the selected kinases in the regulation of adaptation of nerve cells to stress-factors [16]. We carried out a study of the level of expression of the selected kinases by nerve cells of different parts of the brain under physiological conditions and during the modeling of damaging ischemic factors. Expression of all studied enzymes in the nervous Int. J. Mol. Sci. 2021, 22, 1885 3 of 18

Int. J. Mol. Sci. 2021, 22, 1885 3 of 18

Int. J. Mol. Sci. 2021, 22, 1885 3 of 18 the modeling of damaging ischemic factors. Expression of all studied enzymes in the nervous tissue was demonstrated. No significant differences were found in the mRNA level of the modeling of damaging ischemic factors. Expression of all studied enzymes in the nerv- the corresponding kinases in primary hippocampal and cortical cultures (Figure 1). Next, ous tissue was demonstrated. No significant differences were found in the mRNA level of tissuewe evaluated was demonstrated. the influence No of signiﬁcant ischemic factors differences on the were expression found in of the kinases mRNA in levelthese of areas the the corresponding kinases in primary hippocampal and cortical cultures (Figure 1). Next, correspondingof the brain (Figure kinases 2). in primary hippocampal and cortical cultures (Figure1). Next, we we evaluated the influence of ischemic factors on the expression of kinases in these areas evaluated the inﬂuence of ischemic factors on the expression of kinases in these areas of of the brain (Figure 2). the brain (Figure2).

Figure 1. Features of kinase gene expression in primary cortical and hippocampal cultures. Data Figureare normalized 1. Features to ofthe kinase reference gene gene expression (Oaz1). in primary cortical and hippocampal cultures. Data are Figure 1. Features of kinase gene expression in primary cortical and hippocampal cultures. Data normalizedare normalized to the to reference the reference gene gene (Oaz1). (Oaz1).

Figure 2. Features of kinase gene expression on day 7 of the post-hypoxic period. Data are normalized Figure 2. Features of kinase gene expression on day 7 of the post-hypoxic period. Data are normal- toized the to intact the intact cultures cultures (Control). (Control). * p < 0.05,* p < **0.05,p < ** 0.01, p < 0.01, **** p ****< 0.001, p < 0.001, the Mann-Whitney the Mann-Whitney U test. U test. Figure 2. Features of kinase gene expression on day 7 of the post-hypoxic period. Data are normalized Weto the have intact shown cultures that (Control). the effect *of p < ischemic 0.05, ** p factors< 0.01, **** on cellsp < 0.001, of the the cerebral Mann-Whitney cortex does U test. not signiﬁcantly affect the level of mRNA expression of the studied kinases. When modeling hypoxia, the expression of the considered kinases did not change; when modeling glucose

Int. J. Mol. Sci. 2021, 22, 1885 4 of 18

deprivation (GD), an increase in the expression of SRC kinase mRNA by 1.44 ± 0.36 times was noted. It is interesting to note that the level of expression of all studied kinases in hippocampal cell cultures significantly changed when both ischemic factors were simulated (Figure2). It was demonstrated that the expression of mRNA of kinases SRC and eEF2K increased significantly in the postischemic period (SRC when modeling GD by 2.74 ± 1.04 times, when modeling hypoxia by 2.06 ± 0.61; eEF2K by 1.68 ± 0.33 and 1.55 ± 0.3 times, respectively). The expression of IKKb kinase, on the contrary, decreased under the influence of both ischemic factors (with glucose deprivation by 13 ± 6.5%, with hypoxia by 9.4 ± 4.5%). Glucose deprivation did not affect the expression of FLT4 by hippocampal cells; hypoxia caused a significant decrease in the expression of this kinase by more than two times. Thus, for further research, we chose hippocampal cell cultures as an object since they demonstrated a strong response to ischemic exposure by the kinome. We evaluated the neuroprotective effect of the blockade of the studied kinases in the modeling of glucose deprivation and acute normobaric hypoxia in vitro in primary hippocampal cultures. It is important to note that, under normal conditions, the blockade of the selected kinases did not affect the viability of nerve cells, except for the blockade of the FLT4 kinase. The use of the inhibitor SAR-131675 under normal conditions led to a decrease in the viability of nerve cells (Table1).

Table 1. Cell viability of primary hippocampal cultures on day 7 post-hypoxia or post-GD modeling with kinase blockers application.

Normal Condition Number of Viable GD Number of Viable Hypoxia Number of Viable Group Cells, % Cells, % Cells, % Sham 96.05 ± 2.29 Ischemic factor 78.79 ± 1.92 * 75.77 ± 2.17 * SRC 92.61 ± 0.69 88.33 ± 1.21 *,# 81.64 ± 2.32 *,# Ikkb 89.4 ± 1.49 90.32 ± 1.2 *,# 94.83 ± 1.39 # eEF2K 92.53 ± 1.12 89.705 ± 1.76 *,# 81.12 ± 1.86 *,# FLT4 82.29 ± 1.9 * 76.98 ± 1.98 * 82.75 ± 1.61 *,# *—versus “Sham”, #—versus “Hypoxia” or “Glucose deprivation”, p < 0.05, two-way ANOVA and Tukey post hoc test.

Modeling of both damaging factors led to a strong decrease in viability on the 7th day after exposure compared to the “Intact” group (Table1). To verify the cellular content, primary hippocampal cultures were subjected to immunocytochemical staining. We have shown that neurons and astrocytes are present in primary cultures of the hippocampus in the 1:2 ratio (Figure3A). Hypoxia leads to predominant neuronal death; the ratio of cell types changes and is 1:3.6 (Figure3B). Fragmentation of neuronal processes should also be noted, which indicates the destruction of connections between cells and the loss of synapses. Glucose deprivation has a less pronounced effect on the morphology of cell cultures. Inhibitors of SRC, Ikkb, and eEF2K kinases significantly increased the resistance of cells to the action of both key ischemic factors (Table1). ACHP, an Ikkb kinase inhibitor, demonstrated the most significant neuroprotective effect. The blockade of FLT4 kinase with the SAR-131675 inhibitor had a neuroprotective effect only in the simulation of hypoxia. We assessed the effect of blockade of the studied kinases on the calcium activity of primary hippocampal cultures under physiological conditions. It is important to note that, although the blockade of Ikkb and eEF2K kinases did not affect the viability of nerve cells, it modulated their calcium activity. The eEF2K blockade led to significant inhibition of calcium activity and a decrease in the number of cells in which calcium events were recorded from by 3.8 times (Table2). Int. J. Mol. Sci. 2021, 22, 1885 5 of 18 Int. J. Mol. Sci. 2021, 22, 1885 5 of 18

FigureFigure 3.3. Morphology of of primary primary hippocampal hippocampal cultures cultures on on day day 21 21 of of cultivation cultivation in invitro. vitro Green,. Green, stainedstained byby a a marker marker of of neuronal neuronal protein protein (MAP2); (MAP2); red, red, marker marker of of cytoskeleton cytoskeleton protein protein of differentiatedof differenti- astrocytesated astrocytes (GFAP). (GFAP). (A) Sham. (A) Sham. (B) Hypoxia. (B) Hypoxia. (C) Glucose (C) Glucose deprivation. deprivation. (D) Hypoxia (D) Hypoxia + FLT4 + blocker. FLT4 (E) Glucoseblocker. deprivation(E) Glucose +deprivation FLT4 blocker. + FLT4 Scale blocker. bars: 50 Scaleµm. bars: 50 µm.

Inhibitors of SRC, Ikkb, and eEF2K kinases significantly increased the resistance of Tablecells to 2. Mainthe action parameters of both of key calcium ischemic activity factors of primary (Table hippocampal 1). ACHP, an cultures Ikkb togetherkinase inhibitor, with the blockadedemonstrated of intracellular the most kinases. significant neuroprotective effect. The blockade of FLT4 kinase with the SAR-131675 inhibitor had a neuroprotective effect only in the simulation of hy- Group Active Cells, % 1 Frequency, osc/min Duration, s poxia. WeSham assessed the effect 61.13of blockade± 4.21 of the studied 1.43 ± kinases0.27 on the calcium 11.79 ± activity0.88 of ± ± ± primary hippocampalSRC cultures 69.34 under9.46 physiological 1.11 conditions.0.13 It is important 12.41 to 0.3note that, Ikkb 65.95 ± 3.524 1.54 ± 0.42 7.75 ± 0.88 * althougheEF2K the blockade of Ikkb 15.96 and± 2.09eEF2K * kinases did 0.54 not± 0.12 affect * the viability 12.88 of± nerve0.67 cells, it modulatedFLT4 their calcium 57.06 activity.± 28.07 The eEF2K blockade 2.13 ± 0.53 led to significant 7.002 ±inhibition1.05 * of 1calciumActive cells, activity %—the and cell number a decrease with at in least the one number recorded of oscillation cells in divided which by calcium the total cellevents number; were * versus rec- “Sham”,orded pfrom< 0.05, by two-way 3.8 times ANOVA (Table and 2). Tukey post hoc test.

Int. J. Mol. Sci. 2021, 22, 1885 6 of 18

Table 2. Main parameters of calcium activity of primary hippocampal cultures together with the blockade of intracellular kinases.

Group Active Cells, % 1 Frequency, osc/min Duration, s Sham 61.13 ± 4.21 1.43 ± 0.27 11.79 ± 0.88 SRC 69.34 ± 9.46 1.11 ± 0.13 12.41 ± 0.3 Ikkb 65.95 ± 3.524 1.54 ± 0.42 7.75 ± 0.88 * eEF2K 15.96 ± 2.09 * 0.54 ± 0.12 * 12.88 ± 0.67 Int. J. Mol. Sci. 2021, 22, 1885 FLT4 57.06 ± 28.07 2.13 ± 0.53 7.002 ± 1.05 * 6 of 18 1 Active cells, %—the cell number with at least one recorded oscillation divided by the total cell number; * versus “Sham”, p < 0.05, two-way ANOVA and Tukey post hoc test.

TheThe inhibition inhibition of Ikkb of Ikkb and and FLT4 FLT4 kinases kinases led to led a decrease to a decrease in the in duration the duration of calcium of cal- oscillations.cium oscillations. The SRC The kinase SRC was kinase of particular was of particular interest because interest its because blockade its blockade did not signif- did not icantlysigniﬁcantly affect the affect main the characteristics main characteristics of calcium of activity calcium under activity normal under conditions. normal conditions. Repre- sentativeRepresentative examples examples of recordings of recordings of calcium of calcium activity activity together together with kinase with kinase blockade blockade are shownare shown in Figure in Figure 4. 4.

FigureFigure 4. Characteristic 4. Characteristic examples examples of th ofe dynamics the dynamics of Oregon of Oregon Green Green calcium calcium sensor sensor fluorescence ﬂuorescence in primaryin primary monoastrocytic monoastrocytic cultures cultures in vitro.in vitro(A,B.() Sham,A,B) Sham, (C,D) (eEF2k,C,D) eEF2k, (E,F) Ikkb, (E,F) ( Ikkb,G,H) (FLT4,G,H) FLT4,(I,J) (I,J) SRCSRC kinase. kinase.

Next, we examined the calcium activity of primary hippocampal cultures when simulating ischemic factors together with the inhibition of kinases. It has been shown that both glucose deprivation and hypoxia led to inhibition of calcium activity. Hypoxia has a stronger negative impact on nerve cells. The number of cells with the recorded calcium events decreased by 23% when modeling GD, and by 42% when modeling hypoxia (Table3). Furthermore, in the post-hypoxic period, there was a decrease in the incidence of calcium events. Int. J. Mol. Sci. 2021, 22, 1885 7 of 18

Table 3. The main parameters of the calcium activity of primary hippocampal cultures under the inﬂuence of ischemic factors together with the blockade of intracellular kinases.

Group Active Cells, % 1 Frequency, osc/min Duration, s Sham 61.13 ± 4.21 1.43 ± 0.27 11.79 ± 0.88 GD control 47.17 ± 7.05 * 1.04 ± 0.25 11.77 ± 0.67 Hypoxia control 35.91 ± 1.05 * 0.48 ± 0.12 * 11.95 ± 0.36 GD + SRC 51.97 ± 5.79 1.03 ± 0.41 11.44 ± 0.705 Hypoxia + SRC 35.87 ± 5.67 * 1.03 ± 0.41 11.35 ± 0.07 # GD + Ikkb 21.54 ± 4.58 *,# 0.62 ± 0.11 *,# 15.93 ± 1.69 *,# Hypoxia + Ikkb 38.69 ± 6.58 * 1.17 ± 0.21 @ 11.08 ± 1.03 GD + eEF2K 18.41 ± 2.55 *,# 0.81 ± 0.13 * 17.67 ± 2.68 *,# Hypoxia + eEF2K 10.67 ± 2.05 *,@ 1.15 ± 0.29 @ 9.38 ± 0.62 @ GD + FLT4 (VEGFR3) 67.74 ± 9.33 # 0.58 ± 0.08 *,# 8.94 ± 0.79 *,# Hypoxia + FLT4 63.58 ± 5.15 @ 0.87 ± 0.11 @ 11.66 ± 1.83 (VEGFR3) 1 Active cells, %—the cell number with at least one recorded oscillation divided by the total cell number; * versus “Sham”, p < 0.05; # versus “Control GD”, p < 0.05; @ versus “Control Hypoxia”, p < 0.05, two-way ANOVA and Tukey post hoc test.

The blockade of eEF2K kinase aggravated the negative effect of damaging factors on calcium dynamics in cells of primary hippocampal cultures. The number of active cells in the “GD + eEF2K” and “Hypoxia + eEF2K groups was significantly lower than in the “GD” and “Hypoxia”. The blockade of Ikkb kinase led to the aggravation of the disorders caused by glucose deprivation and had no effect on hypoxic damage. The effects of SRC and FLT4 kinase blockers are of the greatest interest. With the blockade of SRC kinase, the number of cells exhibiting calcium activity in the presence of energy substrates deficiency did not differ from the intact group, however, under hypoxia, no protective effect was revealed for this parameter. The use of the SAR-131675 blocker, which inhibits the FLT4 kinase, maintained the number of cells in which calcium events were recorded under the influence of both hypoxia and glucose deprivation. However, in the “GD + FLT4” group, a decrease in the frequency and duration of calcium oscillations was noted. The number of active elements is fundamental for maintaining the functional activity of the neuron-glial network. Therefore, the effect of the FLT blocker can be considered protective. We have studied the effect of FLT4 kinase blockade in modeling stress factors on primary hippocampal cultures’ cellular composition. The results are presented in Figure3D,E. It can be noted that the blockade of FLT4 kinase contributes to the preservation of the morphology of neuronal processes and the maintenance of neuronal viability. This effect is expressed in the simulation of glucose deprivation and, to a lesser extent, in hypoxia simulation. The key aspect in the characterization of the dynamic interactions of neuron-glial networks in our study is the neural network parameters of calcium activity, which characterize the degree of connectivity of network elements after exposure to ischemic factors (Figure5). Application of previously developed algorithms for network analysis of imaging data [19] makes it possible to comprehensively characterize the features of network activity reorganization under damaging influences. Int.Int. J. Mol. J. Mol. Sci. Sci.2021 2021, 22,, 22 1885, 1885 8 of8 18of 18

Figure 5. Correlation dependence between spontaneous Ca2+ oscillations and cell distance (red dots—pairs of neighboring Figure 5. Correlation dependence between spontaneous Ca2+ oscillations and cell distance (red dots—pairs of neighboring cells,cells, blue blue dots—pairs dots—pairs of distantof distant cells): cells): (A )(A Intact;) Intact; (B )(B glucose) glucose deprivation, deprivation, (C )(C hypoxia;) hypoxia; representative representative correlation correlation network network graphsgraphs with with a threshold a threshold of >0.3.of > 0.3. (D )(D Intact;) Intact; (E) ( glucoseE) glucose deprivation; deprivation; (F) ( hypoxia.F) hypoxia.

FigureFigure5 analyzed 5 analyzed the the correlation correlation between between the th levele level of correlationof correlation of calciumof calcium activity activity andand the the distance distance between between pairs pairs of of cells cells in in culture. culture. AdjacentAdjacent pairspairs of cells, the somas of ofwhich which are are in in direct direct contact contact with with each each other, other, are are shown shown as red as reddots; dots; distant distant cells cellsare shown are shown as blue. Under normal conditions, both adjacent and distant cells have a high as blue. Under normal conditions, both adjacent and distant cells have a high level of cor- level of correlation; the signal correlation value is 0.50 [0.33–0.68] (Figure5A). Thus, in relation; the signal correlation value is 0.50 [0.33–0.68] (Figure 5A). Thus, in the primary the primary hippocampal cultures under physiological conditions, a developed dynamic hippocampal cultures under physiological conditions, a developed dynamic neuron-glial neuron-glial network is formed, which is characterized by correlated calcium dynamics. network is formed, which is characterized by correlated calcium dynamics. The visualiza- The visualization of connections between functional elements of the network is shown tion of connections between functional elements of the network is shown in Figure 5D. in Figure5D. The impact of ischemic factors leads to a significant decrease in the connectivity of The impact of ischemic factors leads to a significant decrease in the connectivity of neural-glial networks and loss of functional connections (Figure 5B,C,E,F). The number of neural-glial networks and loss of functional connections (Figure5B,C,E,F). The number of significant correlations decreases in both adjacent and distant pairs of cells (Figure 5B,C). significant correlations decreases in both adjacent and distant pairs of cells (Figure5B,C). For this parameter, the negative effect of oxygen deprivation on the connectivity of neural For this parameter, the negative effect of oxygen deprivation on the connectivity of neural networksnetworks is is stronger stronger compared compared to to thethe energyenergy substrates deficiency. deficiency. The The correlation correlation of of cal- calciumcium dynamics dynamics was was 0.29 0.29 [0.16; [0.16; 0.62] 0.62] in in the the “GD” “GD” group group and and 0.22 0.22 [0.14; [0.14; 0.45] 0.45] in the in the“Hy- “Hypoxia”poxia” group. group. It It demonstrates demonstrates a a decrease inin thethe connectivityconnectivity of of the the neural-glial neural-glial network network andand a lossa loss of of functional functional connections connections betweenbetween nervenerve cells. The The number number of of functionally functionally sig- significantnificant cell cell connections connections in in the the “Sham” “Sham” group group was was 391.67 391.67 [107.18; [107.18; 574.29], 574.29], “GD” “GD” 38.26 38.26 [1.66; [1.66;207.43], 207.43], “Hypoxia” “Hypoxia” 147.47 147.47 [3.91; [3.91; 329.22] 329.22] (Figure (Figure 5C 5andC and Figure Figure 7C). 7C). WhenWhen modeling modeling glucose glucose deprivation deprivation of the of studied the studied kinases, kinases, only the only blockade the blockade of FLT4 of makesFLT4 it makes possible it possible to partially to partially maintain maintain the degree the ofdegree correlation of correlation of the calcium of the calcium activity activ- of cells.ity of The cells. level The of correlationlevel of correlation of all cells of doesall cell nots does differ not from differ the from indices the of indices the intact of the group intact andgroup is 0.56 and [0.46; is 0.56 0.61] [0.46; (Figure 0.61]6 ).(Figure The level 6). The of activitylevel of correlationactivity correlation between between pairs of bothpairs of distantboth anddistant adjacent and adjacent cells in othercells experimentalin other experi groupsmental does groups not differdoes not from differ the parameters from the pa- oframeters the “GD” of group the “GD” and is group significantly and is significantly lower than in lower the “Sham” than in group. the “Sham” Evaluation group. of Evalua- other parameterstion of other of neural–glialparameters of network neural–glial connectivity network confirmed connectivi thety confirmed neuroprotective the neuroprotec- effect of SAR-131675,tive effect of a blockerSAR-131675, of FLT4 a blocker kinase. of Its FLT4 use inkinase. modeling Its use glucose in modeling deprivation glucose makes depriva- it possibletion makes to maintain it possible the numberto maintain of functionally the number significant of functionally connections significant between connections cells, the be- ratetween of propagation cells, the rate of the of calciumpropagation signal, of and the the calcium degree signal, of correlation and the betweendegree of the correlation activity ofbetween adjacent the cells activity at the levelof adjacent of intact cells cultures at the (Figurelevel of7 ).intact cultures (Figure 7).

Int.Int.Int. J. J. J.Mol. Mol.Mol. Sci. Sci.Sci. 2021 20212021, 22,, 2222, 1885,, 18851885 99 of9 ofof 18 1818

Figure 6. Correlation dependence between spontaneous Ca2+ oscillations and cell distance (red FigureFigure 6. 6. Correlation Correlation dependence dependence between between spontaneous spontaneous Ca Ca2+ 2+oscillations oscillations and and ce cell lldistance distance (red (red dots—pairs of neighboring cells, blue dots—pairs of distant cells): (A) Sham; (B) glucose deprivation, dots—pairsdots—pairs of of neighboring neighboring cells, cells, blue blue dots—pairs dots—pairs of of distant distant cells): cells): (A (A) Sham;) Sham; (B ()B glucose) glucose depriva- depriva- tion,(tion,C) GD(C (C) +GD) GD SRC, + +SRC, SRC, (D) ( GDD (D) GD +) GD Ikkb, + +Ikkb, Ikkb, (E) GD(E ()E GD) + GD eEF2K, + +eEF2K, eEF2K, (F) GD(F ()F GD) + GD FLT4. + +FLT4. FLT4.

FigureFigureFigure 7. 7.7. Neuron-glial Neuron-glialNeuron-glial network networknetwork activity activityactivity reorganization reorganizationreorganization in inin primary primaryprimary hippocampal hippocampalhippocampal cultures. cultures. cultures. ( (A A(A)) ) Mean MeancorrelationMean correlation correlation level level of level adjacent of of adjacent adjacent cells; cells; ( Bcells;) the (B ()B rate the) the ofrate rate signal of of signal signal delay delay betweendelay between between cells; cells; (cells;C) average (C (C) average) average number of number of functional connections per cell; (D) the percentage of correlated connections from the functionalnumber of connections functional connections per cell; (D) per the percentagecell; (D) the of percentage correlated of connections correlated from connections the total from number the of total number of possible connections. * versus “Intact”, # versus “GD”, p < 0.05, the Mann-Whitney possibletotal number connections. of possible * versus connections. “Intact”, * #versus versus “Intact”, “GD”, p #< versus 0.05, the “GD”, Mann-Whitney p < 0.05, the test.Mann-Whitney test.test.

Int. J. Mol. Sci. 2021, Int.22, 1885J. Mol. Sci. 2021, 22, 1885 10 of 18 10 of 18

Under the influenceUnder of hypoxia,the influence the destructionof hypoxia, ofthe network destruct interactionsion of network is expressed interactions is expressed more significantlymore in terms significantly of the correlation in terms of of the the correlation activity of of functional the activity network of functional elements. network elements. The most significantThe neuroprotectivemost significant effectneuroprotective was shown effect in the was blockade shown of in FLT4 the blockade kinase in of the FLT4 kinase in the simulation of hypoxia.simulation The degreeof hypoxia. of correlation The degr betweenee of correlation adjacent between pairs of adjacent cells and pairs all cells of cells and all cells in the culture, thein ratethe culture, of calcium the signal rate of propagation, calcium signal and pr theopagation, proportion and of the functionally proportion of functionally significant connectionssignificant from connections their maximum from their possible maximum number possible in the “Hypoxianumber in + the FLT4” “Hypoxia + FLT4” group did not differgroup from did the not parameters differ from ofthe intact parameters cultures of (Figures intact cultures8 and9 )(Figures. 8 and 9).

Figure 8. CorrelationFigure 8. Correlation dependence dependence between betweenspontaneous spontaneous Ca2+ oscillations Ca2+ oscillations and cell distance and cell distance(red dots—pairs (red dots— of neighboring cells, bluepairs dots—pairs of neighboring of distant cells, cells): blue (A)dots—pairs Sham, (B) hypoxia, of distant (C) cells): hypoxia (A) + Sham, SRC, ( (DB)) hypoxia hypoxia, + (Ikkb,C) hypoxia (E) hypoxia + + eEF2K, (F) hypoxiaSRC, + FLT4. (D) hypoxia + Ikkb, (E) hypoxia + eEF2K, (F) hypoxia + FLT4.

Int.Int. J. J. Mol. Mol. Sci. Sci. 20212021,, 2222,, 1885 1885 1111 of of 18 18

Figure 9. Neuron-glialNeuron-glial network network activity activity reorganization reorganization in in primary primary hippocampal hippocampal cultures. cultures. (A) ( AMean) Mean correlation correlation level level of adjacentof adjacent cells; cells; (B) (theB) therate rate of signal of signal delay delay between between cells; cells; (C) average (C) average number number of function of functionalal connections connections per cell; per ( cell;D) per- (D) centagepercentage of correlated of correlated connections connections from from thethe total total number number of possible of possible connections. connections. * versus * versus “Intact”, “Intact”, # versus # versus “Hypoxia”, “Hypoxia”, p < 0.05, Mann-Whitney test. p < 0.05, Mann-Whitney test.

UnderUnder hypoxic exposure,exposure, partialpartial preservation preservation of of the the network network characteristics characteristics of calcium of cal- ciumactivity activity was observed was observed in the in “Hypoxia the “Hypoxia + Ikkb” + group.Ikkb” group. The level The of level correlation of correlation of calcium of calciumsignals wassignals 0.33 was [0.14; 0.33 0.47], [0.14; which 0.47], iswhich signiﬁcantly is significantly higher higher than in than the “Hypoxia”in the “Hypoxia” group group(0.22 [0.14; (0.22 0.45]).[0.14; 0.45]). However, However, it should it should be noted be noted that thethat correlation the correlation of activity of activity between be- tweenadjacent adjacent cells was cells signiﬁcantly was significantly lower thanlower in than the intact in the group intact and group did and not differdid not from differ the from“Hypoxia” the “Hypoxia” group (Intact, group 0.65 (Intact, [0.40; 0.65 0.83]; [0.40; Hypoxia, 0.83]; Hypoxia, 0.45 [0.18; 0.45 0.63]; [0 Hypoxia.18; 0.63];+ Hypoxia Ikkb, 0.37 + Ikkb,[0.21; 0.37 0.51]). [0.21; Moreover, 0.51]). Moreover, the percentage the percentage of correlated of correlated connections connections from the total from number the total of numberpossible of connections possible connections did not differ did from not differ the indices from the of theindices intact of group the intact (Figure group9D). (Figure 9D). 3. Discussion 3. DiscussionOur work was focused on identifying new targets for correcting the consequences of the impairmentOur work was of cerebral focused circulation.on identifying To thisnew end, targets we focusedfor correcting on studying the consequences the molecular of theand impairment cellular mechanisms of cerebral of circulation. action of kinome To this representatives end, we focused with on previouslystudying the undescribed molecular andneuroprotective cellular mechanisms functions. of action When of modeling kinome representatives individual ischemic with previously factors, the undescribed blockade of neuroprotectiveall the kinases consideredfunctions. When in the modeling work preserves individual the viabilityischemic of factors, nerve the cells blockade effectively. of allHowever, the kinases in some considered cases, the in functional the work activity preserves of neuron-glial the viability networks of nerve is cells not maintained,effectively. However,for example, in some in the cases, blockade the functional of eEF2K kinase.activity Itof isneuron-glial the preservation networks of a is functionally not maintained,complete for interaction example, in between the blockade the components of eEF2K ofkinase. neuron-glial It is the networks preservation that isof thea function- basis for allyeffective complete neuroprotection interaction andbetween is necessary the componen to maintaints of the neuron-glial cognitive and networks amnestic that functions is the basisof the for brain. effective To assess neuroprotection the neuroprotective and is nece effectssary of to blockade maintain of the various cognitive molecular and amnestic targets, functionsit is not enough of the brain. to assess To theassess survival the neuropro of nervetective cells. effect A key of aspect blockade for understanding of various molec- the state of neuron-glial networks is the assessment of functional network activity. Calcium

Int. J. Mol. Sci. 2021, 22, 1885 12 of 18

imaging is one of the relevant methods for recording the spatiotemporal patterns of neural network activity. Traditional electrophysiological methods make it possible to record either the activity of single neurons (patch-clamp) or small neuronal ensembles (multielectrode arrays), the individual cellular elements of which can be included in various functional networks. Their total activity does not allow making unambiguous conclusions about the functional network architecture. Visualization of calcium dynamics in the cytoplasm of nerve cells is an extremely informative approach for assessing neural network metabolic activity since it allows visualizing the architecture and mapping the activity of neural networks with cellular resolution since changes in the content of cytoplasmic transient-free calcium [Ca2+] are directly related to synaptic activity [20]. Among the kinase blockers studied, the most promising molecular targets for the development of methods for correcting and maintaining functional neural network activity are ACHP, which inhibits Ikkb kinases, and SAR-131675, which inhibits FLT4 kinase. On the other hand, the very fact of maintaining viability, without maintaining activity, could in the short term be considered as a favorable factor that allows cells to be preserved for possible stimulation of functional regeneration. The choice of kinases as potential targets for the activation of nerve cells’ adaptive resources was determined by the results of screening of the effect of selective and nonselec- tive blockers of more than 50 kinases, the effect of which on the viability of nerve cells in the modeling of ischemic factors in vitro has not been previously studied [16]. The four kinases, the blockade of which had the strongest neuroprotective effect, were studied in detail in this work. The studied kinases belong to various metabolic pathways. The IκB kinase enzyme complex is part of the upstreaming NF-κB signal transduction. The effects of the activation of this nuclear transcription factor are multidirectional, which may be associated with the neuroprotective effect of Ikkb kinase blockade [21]. Our data demonstrate the neuroprotective effect of IkkB blockade—which is stronger than the hypoxia—and are consistent with the few available works indicating the potential neuroprotective properties of IKKb in cerebral ischemia. For example, the antioxidant pathway IKK/NF-κB/SOD2 is important for the protection of nerve cells during the development of excitotoxicity [22]. Experiments on mice with IKK2 deletion in astrocytes have shown that such animals are more resistant to nitrosative stress and demonstrate a decrease in the level of neuronal apoptosis when simulating Parkinson’s disease. This effect is assumed to be associated with inhibition of the astrocytic expression of inflammatory genes [23]. The SRC kinase was of great interest for us. We have shown that its inhibition makes it possible to maintain the viability of cells in primary cultures of the hippocampus when modeling the key factors of ischemia, significantly higher than it was in the control group. Kinases of the SRK family of nonreceptor kinases are involved in the regulation of many normal and pathological processes in the nervous system, including cell survival and proliferation, and angiogenesis. Although studies of the effect of SRC kinase on the resistance of the brain to ischemia have not been carried out, some works have shown the neuroprotective effect of inhibition of c-SRC kinase under the neurotoxic effects of kainic acid and oxidative stress [24]. The neuroprotective effect of blockade of SRC kinase may be explained by its ability to enhance the activity of NMDA receptors [25] which, under conditions of ischemic factors, can lead to the development of excitotoxicity. There is evidence that the use of inhibitors specific for Src effectively reduced hydrogen-peroxide- induced apoptosis of cells during oxidative stress [26]. Since oxidative stress develops during hypoxic damage, this may also be one of the mechanisms of the neuroprotective effect of SRC kinase blockade shown by us. However, our data indicate that, despite the effective maintenance of the viability of nerve cells, neural network activity is not preserved during the blockade of this kinase. Of particular interest are the data according to which the correlation characteristics of neural network activity are disturbed during glucose deprivation (despite the preservation of calcium events). Thus, nerve cells cease to interact with each other effectively. Int. J. Mol. Sci. 2021, 22, 1885 13 of 18

The data on the role of FLT4 kinase in ischemic injury are of the greatest interest. There is little information available about its functions in the nervous system. FLT4 kinase (VEGFR3, vascular endothelial growth factor receptor 3) acts as a cell surface receptor for VEGFC and VEGFD (vascular endothelial growth factor) and promotes proliferation, survival, and migration of endothelial cells and regulates angiogenesis. Signaling with activated FLT4 results in enhanced production of VEGFC and to a lesser extent VEGFA, thereby creating a positive feedback loop that amplifies FLT4 signaling. It mediates the activation of the MAPK1/ERK2, MAPK3/ERK1 signaling pathway, the MAPK8 and JUN signaling pathway, and the AKT1 signaling pathway, which are involved in maintaining cell viability. It is known that VEGF has neurotrophic and neuroprotective activity in both the peripheral and central nervous systems, exerting a direct effect on neurons, Schwann cells, astrocytes, neural stem cells, and microglia. The involvement of FLT4 in the cascades initiating the maintenance of cell survival, neurogenesis, and angiogenesis, suggests that modulating the activity of VEGF receptors can be effective in the therapy of several neurodegenerative diseases and ischemic stroke. However, there are, so far, few data on this in the scientific literature. When simulating focal ischemia in rats, it was shown that blockade of FLT4 (VEGFR3) reduces activation of the lymphatic endothelium, reduces the level of activation of proinflammatory macrophages, and reduces the volume of cerebral infarction [27]. It has also been demonstrated that VEGFC and VEGFR-3 are involved in the neuroprotective effects of preconditioning in the mouse hippocampus. FLT4 blockade can likely reduce the level of inflammation and reactivity of glial cells, since VEGFR-3 could be involved in the development of the inflammatory response of astrocytes in ischemic strokes [28,29]. At present, there is no doubt that astrocytes play an important role in modulating synaptic plasticity and neural network interactions [30], therefore, preventing the transition of astrocytes into the reactive state can positively affect neural network activity. An indirect confirmation of this may be the fact that there is evidence of increased expression of vascular endothelial growth factor and its receptors during neurodegenerative changes in Alzheimer’s disease. At the same time, a higher expression of VEGFB, FLT4, FLT1, and PGF in the prefrontal cortex was related to the stronger cognitive impairments in patients indicating impaired neural network function [31]. Our model made it possible to assess the neuroprotective effect of FLT4 blockade using the SAR-131675 inhibitor when modeling isolated ischemic factors. A significant result is the preservation of correlation characteristics and functional network architecture when using this blocker together with modeling ischemic injury. We were the first to describe the effect of FLT4 blockade on the functional calcium activity of nerve cells. Preservation of a functionally complete dynamic interaction between the components of neuron-glial networks allows us to consider FLT4 as a promising target for the development of methods of protection against cerebral ischemia and is of interest for future research. The studies performed revealed the role of FLT4 in the development of functional dysfunction in cerebrovascular accidents and exposed new opportunities for the study of this enzyme and its blockers in the formation of new therapeutic strategies.

4. Materials and Methods 4.1. Ethics Statement All experimental procedures were approved by the Bioethics Committee of Lobachevsky University and carried out in accordance with Act 708n (23 082010) of the Russian Federa- tion National Ministry of Public Health, which states the rules of laboratory practice for the care and use of laboratory animals, and Council Directive 2010/63 EU of the European Parliament (22 September 2010) on the protection of animals used for scientiﬁc purposes. Pregnant C57BL/6 mice (day of gestation 18) were killed by cervical vertebra dislocation.

4.2. Isolation of Murine Primary Cortical and Hippocampal Cultures Neuronal cells were obtained from mice embryos and cultured on coverslips (18 × 18 mm) pretreated with polyethyleneimine solution (1 mg/mL) (Merck KGaA, Darmstadt, Ger- Int. J. Mol. Sci. 2021, 22, 1885 14 of 18

many) according to the previously developed protocol described in [14]. Isolation of embry- onic cortex or hippocampi was performed in Ca2+- and Mg2+-free phosphate-buffered saline (PBS) with subsequent enzymatic digestion with 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA, Thermo Fisher, Waltham, MA, USA) for 20 min. After centrifugation (800 rpm for 3 min), the pellet of dissociated cells was seeded on coverslips at an approximate initial density of 7000–9000 cells/mm2. The primary neuronal cultures were grown in neurobasal medium (Thermo Fisher, Waltham, MA, USA), supplemented with 2% B27 (Thermo Fisher, Waltham, MA, USA), 0.5 mM L-glutamine (Invitrogen, 25030-024), and 0.4% fetal bovine ◦ serum (FBS; PanEco, Moscow, Russia) under constant conditions of 35.5 C, 5% CO2, and a humidiﬁed atmosphere in a Binder C150 incubator (BINDER GmbH, Tuttlingen, Germany). A half-replenishment of the medium was performed once every three days [21].

4.3. Immunocytochemical Analysis To verify the cellular content, primary hippocampal cultures were subjected to immunocytochemical staining on day 21 of culture development in vitro (DIV). The cultures were fixed with 4% paraformaldehyde for 15 min at room temperature, followed by incubation with a solution of 0.2% Triton X-100/PBS for effective cell permeabilization. For immunofluorescence reactions, the cultures were then incubated for 2 h in the presence of a polyclonal mouse anti-GFAP (glial fibrillary acidic protein, a marker of differentiated astrocytes) primary antibody (Sigma-Aldrich G3893, Merck KGaA, Darmstadt, Germany, 1:500 dilution) and polyclonal rabbit anti MAP2 (a marker of differentiated neurons) primary antibody (Abcam 32454, Cambridge, UK, 1:500 dilution). Next, the cultures were subjected to a 45-min incubation in the following secondary antibody mixture: goat anti- mouse Alexa 647 (Thermo Fisher Scientific, A21236, Waltham, MA, USA, 1:800 dilution) and chicken anti-Rabbit Alexa Fluor 488 (Thermo Fisher Scientific, A21441, Waltham, MA, USA, 1:800 dilution). The stained material was observed using a Zeiss LSM 800 fluorescence confocal microscope (Carl Zeiss, Oberkochen, Germany).

4.4. Glucose Deprivation Modeling of glucose deprivation in vitro was performed on the 14th day of cultivation (DIV) of primary cultures by replacing the normal culture medium with a medium that did not contain glucose, lactate, and pyruvate (PanEco, Moscow, Russia) for one hour, followed by a reverse replacement of the medium with a standard one.

4.5. Acute Normobaric Hypoxia Model Acute normobaric hypoxia was modeled on day 14 of culture development in vitro (DIV) by replacing the normoxic culture medium with a medium containing low oxygen for 10 min. The oxygen was displaced from the medium in a sealed chamber with an inert gas (argon). The oxygen concentration in the culture medium was decreased from 3.26 mL/L to 0.37 mL/L [21]. After 10 min of incubation, the hypoxic medium was replaced by a complete culture medium.

4.6. Real-Time PCR Total RNA was extracted from primary dissociated neuronal cultures of the mouse cerebral cortex and hippocampus using the ExtractRNA reagent (Evrogen, Moscow, Russia); reverse transcription was performed using the MMLV RT kit and the random primer mixture (Evrogen, Moscow, Russia). RT-qPCR reactions were performed using the qPCRmix- HS SYBG Green kit (Evrogen, Moscow, Russia) using an Applied Biosystems 7500 RT-PCR ampliﬁer. The reaction was set up in four repetitions using the following cycle protocol: 50 ◦C for two minutes, 95 ◦C for 10 min, followed by 40 cycles at 95 ◦C for 15 s and 62 ◦C for one minute, then 95 ◦C for 15 s, 60 ◦C for one minute, and 95 ◦C for 30 s. The primers used are shown in Table1. The sequence of the cycles for the various samples is shown in Table4. Int. J. Mol. Sci. 2021, 22, 1885 15 of 19

Int. J. Mol. Sci. 2021, 22, 1885 15 of 19

mixture (Evrogen, Moscow, Russia). RT-qPCR reactions were performed using the mixtureqPCRmix (Evrogen,-HS SYBG Moscow,Green kit Russia).(Evrogen, RT Moscow,-qPCR reactionsRussia) u sing were an performed Applied Biosystems using the qPCRmix7500mixture RT -PCR (Evrogen,-HS SYBGamplifier. Moscow,Green The kit reaction Russia).(Evrogen, was RT Moscow, -setqPCR up in reactionsRussia) four repetitions u sing were an performed Appliedusing the Biosystems usingfollowing the 7500cycleqPCRmix RTprotocol:-PCR-HS amplifier.SYBG 50 °C Greenfor twoThe kit minutes,reaction (Evrogen, was95 °CMoscow, set for up 10 in minRussia) four, followed repetitions using byan 40Appliedusing cycles the atBiosystems following 95 °C for cycle157500 s and RTprotocol:- 62PCR °C amplifier. for50 °Cone for minute, twoThe minutes,reaction then 95 was95 °C °C forset for 15up 10 s ,in min60 four °C, followed for repetitions one minute, by 40 using cycles and the 95at following 95°C °Cfor for 30 15scycle. The s and protocol: primers 62 °C usedfor50 °Cone are for minute, shown two minutes, thenin Table 95 95°C 1. °C Thefor for 15 sequence 10 s, 60min °C, followed offor the one cycles minute, by 40for cycles theand various 95 at °C95 °Cfor sam- for30 sples15. The s andis primersshown 62 °C in usedfor Table one are 4.minute, shown inthen Table 95 °C 1. Thefor 15 sequence s, 60 °C of for the one cycles minute, for theand various 95 °C for sam- 30 pless. The is primersshown in used Table are 4. shown in Table 1. The sequence of the cycles for the various sam- Int. J. Mol. Sci. 2021, 22, 1885 15 of 18 Tableples 4. The is shownprimer sequencesin Table 4. used for RT-qPCR target the following genes. Table 4. The primer sequences used for RT-qPCR target the following genes. Gene Forward Primer Reverse Primer Table 4. The primer sequences used for RT-qPCR target the following genes. GeneIkkb 5′-AACCAGAATCCAGGAAGACACGForward Primer -3′ 5′-TCGTTTGTCTTGCTGTCTGAGATGReverse Primer -3′ Table 4. The primer sequences used for RT-qPCR target the following genes. GeneIkkbFlt4 5′5′--AACCAGAATCCAGGAAGACACGAACAACACGGGCAGCTACCACTForward Primer --3′3′ 5′--TCGTTTGTCTTGCTGTCTGAGATGCAGGAGCGTGTCAGGTTTGTTGAReverse Primer -3′ ScrIkkbFlt4 (SRC)Gene 5′--5′AACCAGAATCCAGGAAGACACGAACAACACGGGCAGCTACCACT-AGGCTTCAACTCCTCGGACA Forward Primer-3′- -3′3′ 5′5′--TTCTTGAAGGACAGGTCAGTCTCTCAGGAGCGTGTCAGGTTTGTTGATCGTTTGTCTTGCTGTCTGAGATG Reverse Primer ---3′3′ EafScr (eEF2K)Flt4 (SRC)Ikkb 5′-5′AACAACACGGGCAGCTACCACT5′--AGGCTTCAACTCCTCGGACATCGAGGACATCGCCACAGA 50-AACCAGAATCCAGGAAGACACG-3--3′3′ - 3′ 0 5′5′-5′5-TTCTTGAAGGACAGGTCAGTCTCTCAGGAGCGTGTCAGGTTTGTTGA0--TCGTTTGTCTTGCTGTCTGAGATG-3GTTTCTTCGTCCTGAAGCACTC-03′--3′ 3′ EafScr Oaz1(eEF2K) (SRC)Flt4 5′5′-5′AAGGACAGTTTTGCAGCTCTCC--AGGCTTCAACTCCTCGGACATCGAGGACATCGCCACAGA 50-AACAACACGGGCAGCTACCACT-3--3′3′- 3′ 0 5′-5′5TTCTTGAAGGACAGGTCAGTCTCT5′0--CAGGAGCGTGTCAGGTTTGTTGA-3GTTTCTTCGTCCTGAAGCACTC-TCTGTCCTCACGGTTCTTGGG-3′-03′ - 3′ 0 0 0 0 EafOaz1 Scr(eEF2K) (SRC) 5′-5′AAGGACAGTTTTGCAGCTCTCC-TCGAGGACATCGCCACAGA 5 -AGGCTTCAACTCCTCGGACA-3-3′- 3′ 55′5′-TTCTTGAAGGACAGGTCAGTCTCT-3--GTTTCTTCGTCCTGAAGCACTCTCTGTCCTCACGGTTCTTGGG-3′-3′ 0 0 0 0 EafOaz1 (eEF2K) 5′-AAGGACAGTTTTGCAGCTCTCC 5 -TCGAGGACATCGCCACAGA-3Data processing was carried-3′ out using 5′5 the--GTTTCTTCGTCCTGAAGCACTC-3TCTGTCCTCACGGTTCTTGGG ΔΔC method and a control sample,-3′ in Oaz1 50-AAGGACAGTTTTGCAGCTCTCC-30 50-TCTGTCCTCACGGTTCTTGGG-30 whichData the level processing of the target was carried gene was out taken using as the a unit. ΔΔC The method Oaz1 gene and awas control used as sample, a house- in whichkeepingData the gene level processing to of normalize the target was carriedthe gene findings. was out taken using as the a unit. ΔΔC The method Oaz1 gene and was a control used as sample, a house- in keepingwhichData processingthe gene level to of normalize was the carriedtarget the gene out findings. usingwas taken the ∆∆ asC a methodunit. The and Oaz1 a control gene was sample, used in as which a house- the4.7. levelkeeping Pharmacological of the gene target to normalize gene Treatment was the taken findings. as a unit. The Oaz1 gene was used as a housekeeping gene4.7. to Pharmacological normalizeApplication the of ﬁndings. Treatmentkinase inhibitors was carried out on the 14th day of cultivation, 20 min before4.7. Pharmacological the modeling Treatment of the ischemia factor, and immediately during the modeling at a 4.7. PharmacologicalApplication Treatment of kinase inhibitors was carried out on the 14th day of cultivation, 20 min beforeconcentrationApplication the modeling of 1of μM. kinase of Thethe inhibitors chemicalischemia was structurefactor, carried and of out immediatelythe on inhibitors the 14th during dayis shown of cultivation,the inm Tableodeling 205. minatThe a Application of kinase inhibitors was carried out on the 14th day of cultivation, 20 min concentrationkinasebefore inhibitorsthe modeling of 1used μM. of were Thethe kindlychemicalischemia provided structurefactor, theand of Drug immediatelythe inhibitorsDiscovery during is Group, shown the Ontario in m Tableodeling Institute 5. Theat a before the modeling of the ischemia factor, and immediately during the modeling at a kinaseforconcentration Cancer inhibitors Research, of used1 μM. Toronto were The kindlychemical, ON, providedCanada structure. the of Drug the inhibitorsDiscovery isGroup, shown Ontario in Table Institute 5. The concentration of 1 µM. The chemical structure of the inhibitors is shown in Table5. The forkinase Cancer inhibitors Research, used Toronto were kindly, ON, providedCanada. the Drug Discovery Group, Ontario Institute kinase inhibitors used were kindly provided the Drug Discovery Group, Ontario Institute Tablefor Cancer 5. The Research, chemical structure Toronto of, ON, the kinase Canada inhibitors. . for CancerTable 5. Research,The chemical Toronto, structure ON, of Canada.the kinase inhibitors. Group Kinase Blockers Structural Formula Table 5. The chemical structure of the kinase inhibitors. Table 5. The chemicalGroupIntact structure of theKinase kinase inhibitors. Blockers- Structural Formula GroupIntact Kinase Blockers- Structural Formula Group Kinase Blockers Structural Formula Intact - Intact - Ikkb ACHP Ikkb ACHP IkkbIkkb ACHP ACHP C21H24N4O2

C21H24N4O2 CC2121H2424N44O2 eEF2K Compound 34 eEF2KeEF2K Compound Compound 34 34 eEF2K Compound 34

C19H21N3O2S C H N O S C1919H21N3O2S C19H21N3O2S

Int. J. Mol. Sci. 2021, 22, 1885 SRCSRC Compound Compound 4 4 16 of 19 SRC Compound 4 SRC Compound 4 C H ClN C3232H23ClN88

C32H23ClN8 FLT4FLT4 (VEGFR3) (VEGFR3) SAR SAR-131675-131675 C32H23ClN8

C H N O C1818H2222N4O4

4.8.4.8. Cell Cell Viability Viability Assay Assay TheThe viability viability of primary of primary hippocampal hippocampal cultures cultures was was expressed expressed as a as ratio a ratio of the of the number number of nucleiof nuclei of dead of dead cells stained cells stained with propidium with propidium iodide (Merckiodide (KGaA,Merck Darmstadt, KGaA, Darmstadt, Germany) Ger- to themany) total to number the total of number cells stained of cells with stained bis-benzimide with bis-benzimide (Merck KGaA, (Merck Darmstadt, KGaA, Darmstadt, Ger- many).Germ Propidiumany). Propidium iodideand iodide bis-benzimide and bis-benzimide at concentrations at concentrations of 5 µg/mL of and 5 μg/mL 1 µg/mL, and 1 respectively,μg/mL, respectively, were added were to the added culture to 30the min culture before 30 registration.min before registration. The stained The cultures stained cultures were observed using a ZEISS Observer A1 inverted fluorescence microscope (Carl Zeiss, Oberkochen, Germany) with a 20×/0.2 objective.

4.9. Calcium Imaging To characterize the dynamics of calcium homeostasis in the hippocampal cells, functional calcium imaging was performed with a fluorescent calcium-sensitive dye Oregon Green 488 BAPTA-1 AM (OGB-1) (Invitrogen, O-6807, USA) on an LSM 510 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany) with a W Plan-Apochromat 20 ×/1.0 objective. The calcium sensor, 0.4 μM OGB-1 (Thermo Fisher Scientific, Waltham, MA USA), was dissolved in DMSO (Merck KGaA, Darmstadt, Germany) with 4% pluronic F-127 (Thermo Fisher Scientific, Waltham, MA USA), added to the examined cultures and incubated for 30 min in a CO2-incubator. The OGB1 fluorescence excitation wavelength was set at 488 nm with an argon laser, and the emission was recorded using a 500–530 nm filter. To evaluate the dynamics of changes in the intracellular calcium concentration, a time-series of confocal images was recorded. The registration rate used was two frames per second. The spontaneous calcium activity of primary hippocampal cultures was recorded on day 7 post-ischemic damage. The following main parameters were analyzed: duration of calcium events (time period from the beginning to the end of an oscillation, s), frequency of calcium oscillations (average number of oscillations per min), and percentage of active cells (the cells number with at least one recorded oscillation divided by the total cell number, %) [18,21].

Int. J. Mol. Sci. 2021, 22, 1885 16 of 18

were observed using a ZEISS Observer A1 inverted ﬂuorescence microscope (Carl Zeiss, Oberkochen, Germany) with a 20×/0.2 objective.

4.9. Calcium Imaging To characterize the dynamics of calcium homeostasis in the hippocampal cells, functional calcium imaging was performed with a fluorescent calcium-sensitive dye Oregon Green 488 BAPTA-1 AM (OGB-1) (Invitrogen, O-6807, Carlsbad, CA, USA) on an LSM 510 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany) with a W Plan-Apochromat 20 ×/1.0 objective. The calcium sensor, 0.4 µM OGB-1 (Thermo Fisher Scientific, Waltham, MA, USA), was dissolved in DMSO (Merck KGaA, Darmstadt, Ger- many) with 4% pluronic F-127 (Thermo Fisher Scientific, Waltham, MA, USA), added to the examined cultures and incubated for 30 min in a CO2-incubator. The OGB1 fluorescence excitation wavelength was set at 488 nm with an argon laser, and the emission was recorded using a 500–530 nm filter. To evaluate the dynamics of changes in the intracellular calcium concentration, a time-series of confocal images was recorded. The registration rate used was two frames per second. The spontaneous calcium activity of primary hippocampal cultures was recorded on day 7 post-ischemic damage. The following main parameters were analyzed: duration of calcium events (time period from the beginning to the end of an oscillation, s), frequency of calcium oscillations (average number of oscillations per min), and percentage of active cells (the cells number with at least one recorded oscillation divided by the total cell number, %) [18,21].

4.10. Calcium Network Activity Analysis Calcium network analysis was performed using a previously developed algorithm [19]. The approach to the reconstruction of the network consisted of two steps: computation of pairwise correlations of the preprocessed fluctuations in the intracellular calcium level of individual cells (network nodes) and applying a threshold cutoff for the correlation level ρ > 0.3 to determine the significant network connections. The threshold correlation level corresponds to the upper bound of the correlation of a primary monoastrocyte culture in the absence of neurons. Exceeding the threshold of the correlation in calcium activity above 0.3 indicates significant network activity of neurons. In the paper by [19], several measures were proposed to estimate network activity: the average level of correlation between adjacent cells, the average number of functional connections per cell, the percentage of correlated connections, and the average propagation speed of delays. The average level of correlation between adjacent cells shows how the strength of physical connections required for network communication. An average number of functional connections per cell describes the average number of cells whose calcium activity significantly correlates with the individual cell in the network. The percentage of correlated connections from the total number of possible connections quantifies the used resource of significant correlations in the network. A 0% value means the complete absence of significant correlative interactions. A 100% value characterizes the maximally possible level of significant correlations in the network. An increase in the last two parameters considered above indicates the presence of a long-term significantly correlated response of the cell network, whereas their low levels characterize its absence [18,19]. The propagation speed of calcium waves in the cell culture is associated with spatiotemporal delays. To estimate propagation speed, the average propagation speed of delays was introduced based on two parameters: the distance between corresponding somas and cross-correlation time delay between fluctuations in the calcium level of cell pairs. The average ratio of these quantities shows how far the wave peaks travel per unit of time.

4.11. Statistical Analysis Quantitative results are presented as a mean ± standard mean error (SEM) for normal distributions, or as a median value and second and third interquartile range. To compare Int. J. Mol. Sci. 2021, 22, 1885 17 of 18

the two unrelated groups, the Mann-Whitney U test and ANOVA was used. The Tukey post hoc test was used as a post hoc test following ANOVA. At least three independent biological replicates were used for all experiments. The difference between the groups was considered signiﬁcant if the p-value was less than 0.05.

5. Conclusions The studies performed revealed the role of FLT4 in the development of functional dysfunction in cerebrovascular accidents and exposed new opportunities for the study of this enzyme and its blockers in the formation of new therapeutic strategies.

Author Contributions: Conceptualization, M.V.V., E.V.M. and V.S.T.; data curation, M.V.I.; formal analysis, M.I.K. and M.O.S.; investigation, E.V.M., M.M.L., and T.A.M.; supervision, M.V.V.; visualization, M.I.K. and M.O.S.; writing—original draft, E.V.M., M.V.I., and M.V.V. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by grant from the Russian Science Foundation (RSF), project no. 18-75-10071. This research was carried out using The Core Facilities «Molecular Biology and Neurophysiology». Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Bioethics Committee of Lobachevsky University (protocol 42 dated 15 October 2020). Informed Consent Statement: Not applicable. Data Availability Statement: The data used to support the findings of this study are available from the corresponding author upon request. Acknowledgments: The authors thank the Drug Discovery Group, Ontario Institute for Cancer Research, Toronto, ON, Canada and, personally, Rima Al-Awar for kindly providing the kinase inhibitors. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Choi, D.W. Excitotoxicity: Still Hammering the Ischemic Brain in 2020. Front. Neurosci. 2020, 14, 579953. [CrossRef] 2. MacDougall, G.; Anderton, R.S.; Mastaglia, F.L.; Knuckey, N.W.; Meloni, B.P. Mitochondria and Neuroprotection in Stroke: Cationic Arginine-Rich Peptides (CARPs) as a Novel Class of Mitochondria-Targeted Neuroprotective Therapeutics. Neurobiol. Dis. 2019, 121, 17–33. [CrossRef] 3. Radak, D.; Katsiki, N.; Resanovic, I.; Jovanovic, A.; Sudar-Milovanovic, E.; Zafirovic, S.; Mousad, S.A.; Isenovic, E.R. Apoptosis and Acute Brain Ischemia in Ischemic Stroke. CVP 2017, 15, 115–122. [CrossRef][PubMed] 4. Small, J.E.; Butler, P.M.; Zabar, Y.; Barash, J.A. Complete, Bilateral Hippocampal Ischemia: A Case Series. Neurocase 2016, 22, 411–415. [CrossRef] 5. Lanzino, G.; Burrows, A.M.; Tymianski, M. Advances in Stroke. Stroke 2013, 44, 316–317. [CrossRef] 6. Li, Z.; Song, Y.; He, T.; Wen, R.; Li, Y.; Chen, T.; Huang, S.; Wang, Y.; Tang, Y.; Shen, F.; et al. M2 Microglial Small Extracellular Vesicles Reduce Glial Scar Formation via the MiR-124/STAT3 Pathway after Ischemic Stroke in Mice. Theranostics 2021, 11, 1232–1248. [CrossRef][PubMed] 7. Murata, Y.; Sugimoto, K.; Yang, C.; Harada, K.; Gono, R.; Harada, T.; Miyashita, Y.; Higashisaka, K.; Katada, R.; Tanaka, J.; et al. Activated Microglia-Derived Macrophage-like Cells Exacerbate Brain Edema after Ischemic Stroke Correlate with Astrocytic Expression of Aquaporin-4 and Interleukin-1 Alpha Release. Neurochem. Int. 2020, 140, 104848. [CrossRef][PubMed] 8. Wang, X.; Xuan, W.; Zhu, Z.-Y.; Li, Y.; Zhu, H.; Zhu, L.; Fu, D.-Y.; Yang, L.-Q.; Li, P.-Y.; Yu, W.-F. The Evolving Role of Neuro-Immune Interaction in Brain Repair after Cerebral Ischemic Stroke. CNS Neurosci. Ther. 2018, 24, 1100–1114. [CrossRef] 9. Zarruk, J.G.; Greenhalgh, A.D.; David, S. Microglia and Macrophages Differ in Their Inflammatory Profile after Permanent Brain Ischemia. Exp. Neurol. 2018, 301, 120–132. [CrossRef] 10. Dolgacheva, L.P.; Berezhnov, A.V.; Fedotova, E.I.; Zinchenko, V.P.; Abramov, A.Y. Role of DJ-1 in the Mechanism of Pathogenesis of Parkinson’s Disease. J. Bioenerg. Biomembr. 2019, 51, 175–188. [CrossRef][PubMed] 11. Jin, B.; Kim, H.; Choi, J.-I.; Bae, H.-B.; Jeong, S. Avenanthramide C Prevents Neuronal Apoptosis via PI3K/Akt/GSK3β Signaling Pathway Following Middle Cerebral Artery Occlusion. Brain Sci. 2020, 10, 878. [CrossRef][PubMed] 12. Zhang, J.; Ding, C.; Zhang, S.; Xu, Y. Neuroprotective Effects of Astaxanthin against Oxygen and Glucose Deprivation Damage via the PI3K/Akt/GSK3β/Nrf2 Signalling Pathway in Vitro. J. Cell. Mol. Med. 2020, 24, 8977–8985. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 1885 18 of 18

13. Sánchez-Alegría, K.; Flores-León, M.; Avila-Muñoz, E.; Rodríguez-Corona, N.; Arias, C. PI3K Signaling in Neurons: A Central Node for the Control of Multiple Functions. Int. J. Mol. Sci. 2018, 19, 3725. [CrossRef][PubMed] 14. Li, L.; McBride, D.W.; Doycheva, D.; Dixon, B.J.; Krafft, P.R.; Zhang, J.H.; Tang, J. G-CSF Attenuates Neuroinflammation and Stabilizes the Blood–Brain Barrier via the PI3K/Akt/GSK-3β Signaling Pathway Following Neonatal Hypoxia-Ischemia in Rats. Exp. Neurol. 2015, 272, 135–144. [CrossRef] 15. Turovsky, E.A.; Turovskaya, M.V.; Gaidin, S.G.; Zinchenko, V.P. Cytokine IL-10, Activators of PI3-Kinase, Agonists of α-2 Adrenoreceptor and Antioxidants Prevent Ischemia-Induced Cell Death in Rat Hippocampal Cultures. Arch. Biochem. Biophys. 2017, 615, 35–43. [CrossRef] 16. Mitroshina, E.V.; Mishchenko, T.A.; Loginova, M.M.; Tarabykin, V.S.; Vedunova, M.V. Identification of Kinome Representatives with Neuroprotective Activity. Neurochem. J. 2020, 14, 394–407. [CrossRef] 17. Yuste, R. From the Neuron Doctrine to Neural Networks. Nat. Rev. Neurosci. 2015, 16, 487–497. [CrossRef] 18. Savyuk, M.; Krivonosov, M.; Mishchenko, T.; Gazaryan, I.; Ivanchenko, M.; Khristichenko, A.; Poloznikov, A.; Hushpulian, D.; Nikulin, S.; Tonevitsky, E.; et al. Neuroprotective Effect of HIF Prolyl Hydroxylase Inhibition in an In Vitro Hypoxia Model. Antioxidants 2020, 9, 662. [CrossRef] 19. Mitroshina, E.V.; Krivonosov, M.I.; Burmistrov, D.E.; Savyuk, M.O.; Mishchenko, T.A.; Ivanchenko, M.V.; Vedunova, M.V. Signatures of the Consolidated Response of Astrocytes to Ischemic Factors In Vitro. Int. J. Mol. Sci. 2020, 21, 7952. [CrossRef] 20. Carrillo-Reid, L.; Yang, W.; Kang Miller, J.; Peterka, D.S.; Yuste, R. Imaging and Optically Manipulating Neuronal Ensembles. Annu. Rev. Biophys. 2017, 46, 271–293. [CrossRef] 21. Vedunova, M.V.; Mishchenko, T.A.; Mitroshina, E.V.; Mukhina, I.V. TrkB-Mediated Neuroprotective and Antihypoxic Properties of Brain-Derived Neurotrophic Factor. Oxidative Med. Cell. Longev. 2015, 2015, 1–9. [CrossRef] 22. Pose-Utrilla, J.; García-Guerra, L.; Del Puerto, A.; Martín, A.; Jurado-Arjona, J.; De León-Reyes, N.S.; Gamir-Morralla, A.; Sebastián-Serrano, Á.; García-Gallo, M.; Kremer, L.; et al. Excitotoxic Inactivation of Constitutive Oxidative Stress Detoxification Pathway in Neurons Can Be Rescued by PKD1. Nat. Commun. 2017, 8, 2275. [CrossRef][PubMed] 23. Kirkley, K.S.; Popichak, K.A.; Hammond, S.L.; Davies, C.; Hunt, L.; Tjalkens, R.B. Genetic Suppression of IKK2/NF-KB in Astrocytes Inhibits Neuroinflammation and Reduces Neuronal Loss in the MPTP-Probenecid Model of Parkinson’s Disease. Neurobiol. Dis. 2019, 127, 193–209. [CrossRef] 24. Gangoso, E.; Talaverón, R.; Jaraíz-Rodríguez, M.; Domínguez-Prieto, M.; Ezan, P.; Koulakoff, A.; Medina, J.M.; Giaume, C.; Tabernero, A. A C-Src Inhibitor Peptide Based on Connexin43 Exerts Neuroprotective Effects through the Inhibition of Glial Hemichannel Activity. Front. Mol. Neurosci. 2017, 10.[CrossRef][PubMed] 25. Dantsuji, M.; Nakamura, S.; Nakayama, K.; Mochizuki, A.; Park, S.K.; Bae, Y.C.; Ozeki, M.; Inoue, T. 5-HT 2A Receptor Activation Enhances NMDA Receptor-mediated Glutamate Responses through Src Kinase in the Dendrites of Rat Jaw-closing Motoneurons. J. Physiol. 2019, 597, 2565–2589. [CrossRef] 26. Qi, S.; Feng, Z.; Li, Q.; Qi, Z.; Zhang, Y. Inhibition of ROS-Mediated Activation Src-MAPK/AKT Signaling by Orientin Alleviates H2O2-Induced Apoptosis in PC12 Cells. Drug Des. Dev. Ther. 2018, 12, 3973–3984. [CrossRef] 27. Esposito, E.; Ahn, B.J.; Shi, J.; Nakamura, Y.; Park, J.H.; Mandeville, E.T.; Yu, Z.; Chan, S.J.; Desai, R.; Hayakawa, A.; et al. Brain-to-Cervical Lymph Node Signaling after Stroke. Nat. Commun. 2019, 10.[CrossRef][PubMed] 28. Shin, Y.-J.; Choi, J.-S.; Choi, J.-Y.; Hou, Y.; Cha, J.-H.; Chun, M.-H.; Lee, M.-Y. Induction of Vascular Endothelial Growth Factor Receptor-3 MRNA in Glial Cells Following Focal Cerebral Ischemia in Rats. J. Neuroimmunol. 2010, 229, 81–90. [CrossRef] 29. Shin, Y.-J.; Park, J.-M.; Cho, J.M.; Cha, J.-H.; Kim, S.Y.; Lee, M.-Y. Induction of Vascular Endothelial Growth Factor Receptor-3 Expression in Perivascular Cells of the Ischemic Core Following Focal Cerebral Ischemia in Rats. Acta Histochem. 2013, 115, 170–177. [CrossRef] 30. Verkhratsky, A.; Nedergaard, M. Physiology of Astroglia. Physiol. Rev. 2018, 98, 239–389. [CrossRef][PubMed] 31. Mahoney, E.R.; Dumitrescu, L.; Moore, A.M.; Cambronero, F.E.; De Jager, P.L.; Koran, M.E.I.; Petyuk, V.A.; Robinson, R.A.S.; Goyal, S.; Schneider, J.A.; et al. Brain Expression of the Vascular Endothelial Growth Factor Gene Family in Cognitive Aging and Alzheimer’s Disease. Mol. Psychiatry 2019.[CrossRef][PubMed]