City University of New York (CUNY) CUNY Academic Works
All Dissertations, Theses, and Capstone Projects Dissertations, Theses, and Capstone Projects
9-2017
Trypanosome Lytic Factor Mediated Immunity Against Leishmania sp.
Jyoti Pant The Graduate Center, City University of New York
How does access to this work benefit ou?y Let us know!
More information about this work at: https://academicworks.cuny.edu/gc_etds/2435 Discover additional works at: https://academicworks.cuny.edu
This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Title
Trypanosome Lytic Factor (TLF) Mediated Immunity Against Leishmania sp.
By Jyoti Pant
A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy, The City University of New York
2017
Copyright page
Copyright © 2017
JYOTI PANT
All Rights Reserved
ii Approval page
Trypanosome Lytic Factor (TLF) Mediated Immunity Against Leishmania sp.
By Jyoti Pant
This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the dissertation requirement for the degree of Doctor of Philosophy.
Date Dr. Jayne Raper
Chair of Examining Committee
Date Laurel A. Eckhardt
Executive Officer
Supervisory Committee:
Date Dr. Michael Steiper
Date Dr. Weigang Qiu
Date Dr. Nina Papvasiliou
Date Dr. Rachael Zufferey
THE CITY UNIVERSITY OF NEW YORK
iii ABSTRACT
Trypanosome Lytic Factor (TLF) is an innate immunity complex that was originally discovered to protect against African Trypanosomes. The major components of TLF are
Apolipoprotein A1 (APOA1), Apolipoprotein L1 (APOL1) and HPR (Haptoglobin Related
Protein), where APOL1 is necessary and sufficient for trypanolysis. Recently we have shown that TLF ameliorates infections by cutaneous Leishmania species. Here we investigated the effect of different primate and human TLF against different Leishmania sp. Our result shows that TLF kills metacyclic promastigotes of cutaneous Leishmania sp. within immune cells such as neutrophils and macrophages by two different mechanism.
Using transiently transfected and germline transgenic mice, we show that baboon as well as human TLF is effective at protecting against cutaneous Leishmania sp. that depends on TLF as well as infectivity dose. We found neutrophils are important for this TLF mediated immunity where TLF activity initiates in acidic phagosome of neutrophils leading to lysis of the metacyclics when they are released in the extracellular milieu. We also investigated the effect of TLF against parasite in macrophages. Using our in vitro assay that ostensibly mimics macrophage phagosome and parasitophorous vacuole, we show that TLF mediated lysis of metacyclics also occur when there is gradual acidification in maturing phagosome.
However, proliferating parasites such as metacyclics of visceral strains and amastigotes of cutaneous strains are resistant to TLF activity. This resistance possibly depends on surface glycoproteins as glycosylation deficient mutants are resistant to TLF.
In conclusion, our results show that TLF is an important immunity complex that synergize with immune cells like neutrophils and macrophages to kill metacyclics of cutaneous
Leishmania sp.
iv Acknowledgement
This dissertation would not have completed without inspiration and support from many people in my life. It is my great pleasure to express my gratitude to all those for being part of this journey.
First of all I would like to thank my advisor Dr. Jayne Raper for accepting me in her lab. Jayne has been a great mentor who constantly encouraged me to ask lots of questions and grow as a scientist. With her patience, support, inspiration, and kindness, Jayne has made it possible for me to finish this journey with fun.
I would like to thank my committee members Dr. Michael Steiper, Dr. Weigang Qiu, Dr. Nina
Papavasiliou and Dr. Rachael Zufferey for their valuable guidance through all these years. I also want to thank you for always keeping your door open for me when I needed guidance, have questions regarding my research, career and professional development. And thank you to Dr. Steiper for reading my grant application, and writing recommendations for various applications.
I would like to thank Dr. David Sacks to allow me in his lab to learn different techniques for my research including helping me troubleshoot some experiments, Dr. Steven Beverely for parasites and valuable suggestion and Dr. Amariliz Rivera for helping me with the gating strategy for my neutrophil experiment. I would also like to thank Dr. Laurel Eckhardt, Dr.
Mande Holford and Dr. Santosh Sapkota for their suggestions and support in fulfilling my future career goals.
I also like to thank my former lab mates Maria and Ronnie for their mentorship, friendship and support in the lab as well as outside. In addition, special thanks to Maria, Mert and Joey for
v helping me with my early Leishmania experiments, Joe for his technical help and witty suggestions. I also want to thank Russell, Charles and all my current and former lab mates for all the good memories and fun time we have had together. I would like to deeply thank Hunter
Bioclub friends who have been an integral part of my PhD life.
I want to express my especial gratitude to the Children’s Learning Center at Hunter College. I cannot explain in words how much of help it was to have Abha in the childcare while I do my research. I would like to thank current and former people in the Biology Department.
Finally, I would like to thank my husband, mom, dad, brother, and in-laws and friends for their love and support.
vi
Table of Contents Title Page i Copyright Page ii Approval Page iii Abstract iv Acknowledgement v List of Figures vii List of Tables ix List of Abbreviations x
INTRODUCTION 1
1. HIGH-DENSITY LIPOPROTEINS 1 A. STRUCTURE AND COMPOSITION 1 B. FUNCTION 2 2. AFRICAN TRYPANOSOMES 4 A. THE DISEASE AND ITS DISTRIBUTION 4 B. PARASITES AND LIFE CYCLE 6 C. PARASITE MORPHOLOGY AND IMMUNE EVASION 7 3. TRYPANOSOME LYTIC FACTOR (TLF) 9 A. TLF IS SPECIALIZED HDL 9 B. SUBCOMPONENTS OF TLF 9 4. LEISHMANIA 19 A. DISEASE AND ITS DISTRIBUTION 19 B. PARASITE AND THE LIFE CYCLE 20 C. CELL ENTRY AND SURVIVAL IN INTRACELLULAR ENVIRONMENT 26 D. IMMUNITY 27
MATERIALS AND METHODS 31
PART I- LEISHMANIA AND THE EVOLUTION OF APOL1 36
RESULTS 36
1. THE SEARCH FOR PRIMATE APOL1 36 A. SEARCH FOR APOL1 IN PRIMATE SAMPLES 38 B. EFFECT OF PRIMATE APOL1 IN NATURAL DERMAL INFECTION 40 C. EFFECT OF HUMAN APOL1 HAPLOTYPES AGAINST LEISHMANIA SP. 44
DISCUSSION 47
PART II- MECHANISM OF TLF MEDIATED KILLING OF LEISHMANIA SP. 49
RESULTS 49
1. TLF KILLS LEISHMANIA SP. WITHIN NEUTROPHILS 50 2. TLF RAPIDLY LYSES METACYCLIC PROMASTIGOTES WHEN RELEASED FROM NEUTROPHILS 56 3. TLF RAPIDLY LYSES METACYCLIC PROMASTIGOTES IN PARASITOPHOROUS VACUOLE 57 3. AMASTIGOTES ARE RESISTANT TO TLF MEDIATED LYSIS 59 4. VISCERAL STRAINS L. INFANTUM AND L. DONOVANI ARE RESISTANT TO TLF ACTIVITY 59 5. HDL BINDS TO METACYCLIC PROMASTIGOTES OF L. INFANTUM 63 6. GLYCOSYLATION DEFICIENT MUTANTS ARE RESISTANT TO TLF ACTIVITY 64
! vi!
DISCUSSION 69
CONCLUSION 72
SUPPLEMENTARY MATERIALS 73
REFERENCES 87
! vii!
List of Figures
Figure 1: HDL classification based on size and density 1
Figure 2: Life Cycle of African Trypanosomes 7
Figure 3: The Haptoglobin Gene Locus 12
Figure 4: APOL1 predicted domains with five common haplotypes 13
Figure5: Alignment of C-terminus of human variants and baboon APOL1 16
Figure 6: Life Cycle of Leishmania sp. 21
Figure 7: Stages of Leishmania sp. In sandflies 22
Figure 8: The Structural representation of L. major proteoglycans 24
Figure 9: Distribution of Leishmania and humanAPOL1 haplotypes 37
Figure 10: Baboon fibroblast and human whole blood does not express APOL1 39
Figure 11: TLF reduces parasite burden in low but not high dose L. major infection in murine ears 41
Figure 12: Baboon TLF ameliorates L. major infection in vivo 43
Figure 13: Human haplotypes G3 and G4 protects against animal infective T. b. brucei 45
Figure 14: Most APOL1 haplotypes ameliorate an intradermal L. major infection in ears 46
Figure 15: Comparision of expression level of G0 and G1 in HGD mice 46
Figure 16: Gating strategy to identify neutrophils in mouse blood and ear 51
Figure 17: HGD mice have neutrophil recruitment in blood 52
Figure 18: Neutrophils and TLF synergize to ameliorate Leishmania infection 55
Figure 19: Metacyclic promastigotes are lysed upon acid priming 58
Figure 20: Amastigotes are resistant to TLF activity 59
Figure 21: Visceral strains are resistant to TLF activity in macrophages 61
Figure 22: L. infantum is resistant to TLF activity in vitro 62
Figure 23: TLF has no effect on L. infantum in vivo 63
Figure 24: HDL binds to metacyclic promastigotes of L. infantum 64
Figure 25: Surface phosphoglycans in L. major metacyclic promastigotes and in mutants 65
Figure 26: Surface mutants are resistant to TLF activity 68
Figure 27: HDL binds to the metacyclics of both WT and mutants 68
! viii!
Figure 28: Proposed Model for TLF mediates Lysis of cutaneous Leishmania metacyclics 70
! ix!
List of Tables
Table 1: APOL1 haplotypes and their distribution 3
! x!
List of Abbreviations
AAT- Animal African Trypanosomiasis LDL: Low-density lipoprotein
ABC: ATP-binding cassette LPG: Lipophospoglycan
Apo: Apolipoprotein MOI: Multiplicity of infection
CE: Cholesteryl ester MPO: Myeloperoxidase
CETP: Cholesteryl ester transfer protein MPO: Myeloperoxidase
CR3: Macrophage receptor 3 NK: Natural killer
DAPI: 4',6-diamidino-2-phenylindole PCR: Polymerase chain reaction
DRC- Democratic Republic of Congo PL: Phospholipids
DMEM: Dulbecco's Modified Eagle Medium PPG: Proteophosphoglycan
ER: Endoplasmic Reticulum PSG- Promastigote Secretory Gel
FACS: Fluorescence-activated cell sorting PV: Parasitophorous vacuole
GPI: Glycophosphatidylinositol ROS: Reactive oxygen species
Hb: Hemoglobin SD: Standard deviation hCAP-18: Human cathelicidin protein SNP: Single-nucleotide polymorphim
HDL: High-density lipoprotein SRA: Serum-resistant associated
HGD- Hydrodynamic Gene Delivery SR-BI: Scavenger receptor class B type I
Hp: Haptoglobin TBS: Tris-buffered saline
Hpr: Haptoglobin-related protein TAG: Triacylglycerides
HAT Human African Trypanosome TLF: Trypanosome lytic factor
HIV: Human immunodeficiency virus TLR: Toll-like receptor
IFN: Interferon VL: Visceral leishmaniasis
Ig: Immunoglobulin VLDL: Very-low-density lipoprotein
IL: Interleukin VSG: Variable surface glycoprotein
LCAT: Lecithin:cholesterol acyltransferase
! xi!
INTRODUCTION
1. High-density lipoproteins
a. Structure and composition
High-density lipoproteins (HDL, the good cholesterol) are small and dense lipoproteins circulating in our blood. HDL is made up of core of lipids that is comprised of triglycerides, cholesterol, cholesteryl ester and an outer phospholipid layer that embeds proteins and microRNAs [1]. The protein components, also called apolipoproteins, make up approximately 50% of the mass of HDL [2-4]. Of more than 80 different apolipoproteins, which govern the heterogeneous nature of HDLs,
Apolipoprotein A-I (apoA-I) is the major protein that forms the structural backbone of the HDL. ApoA-I is secreted from the liver and the intestine and concomitantly lipidated to form HDL particles due to the activity of ATP binding cassette transporter A1 (ABCA1)[5]. Initially upon secretion apoA-I is in a belt like arrangement and starts accepting lipid to form nascent HDL that subsequently becomes discoidal, pre-β HDL. A plasma enzyme called Lecithin:cholesterol acyl transferase (LCAT) then esterifies the cholesterol into cholesteryl ester thereby increasing the lipidation of the HDL to form mature spherical
HDL [6]. Upon transitioning from the nascent to mature form, there may be between 1 and 5 apoA-I molecules per HDL particle, where the alignment of apoA-I ranges from belt like in nascent HDL to trefoil or tetrameric or pentameric in mature spherical HDL [7]. These mature HDLs are named as
HDL3, and HDL2, where HDL2 is the larger HDL than HDL3. Each type of HDL is further divided into subtypes as shown in Figure 1. Therefore, we observe heterogeneity in size, shape, density and charge of circulating HDL based on its lipid to protein ratio and the stage of maturity. This heterogeneity forms the basis of separation and analysis of HDL by various techniques such as ultracentrifugation, gel filtration, sizing, electrophoresis, and nuclear magnetic resonance spectroscopy
[8-10].
! 1!
HDL$Subclasses$
C! A! B! Size! >! >! >! >!
Figure 1: HDL classification based on size and density HDL can be classified based on its shape as A. discoidal or B. spherical. It can also be classified based on its C. size or density in which HDL3c is the smallest and the densest complex while HDL 2b is the largest and the least dense HDL. Source: Annema and Eckhardstein, 2013.
b. Function
I. Reverse Cholesterol transport
One of the important functions of HDL is to transport cholesterol from peripheral cells to the liver or intestine for excretion by a process called reverse cholesterol transport. Cholesterol efflux is the first step in the reverse cholesterol transport. The transport of cholesterol from peripheral cells and macrophages to the acceptor such as apoA-I or HDL occurs by four different pathways:
a) After HDL synthesis and secretion from the liver and intestine, apoA-I accepts the lipids from
cells mediated by the ABCA1 receptor. This process leads to the formation of nascent HDL
that is discoidal in shape [5] Fig 1A.
b) Another important pathway of cholesterol efflux from cells into HDL is by passive diffusion,
which is facilitated by the activity of LCAT, which esterifies the cholesterol and moves it to the
core and thereby prevents the influx of released cholesterol back into the cells [9, 11, 12].
c) Macrophages and some other cells express another receptor called the ATP binding cassette
transporter G1 (ABCG1), which is responsible for the efflux of cholesterol from cells into HDL
[13]. Unlike ABCA1, the ABCG1 mediated efflux cannot lipidate the lipid free apoA-I [14].
! 2!
d) Scavenger receptor class B type I (SR-BI) is another receptor that is ubiquitously distributed in
the cells in our body and is responsible for the bidirectional flux of cholesterol including the
efflux of cholesterol into the mature HDL particles [15].
The effluxed cholesterol that is carried within HDL due to the esterification of cholesterol by the activity of LCAT is then carried to the liver. In the liver, the uptake of cholesterol can occur due to the activity of the SR-BI that selectively uptakes the cholesteryl esters into liver [16]. Alternately, HDL can be taken up into liver cells by holoparticle endocytosis that is mediated by the F(1)-ATPase/P2Y pathway
[17] . Finally, cholesteryl ester transfer can happen from HDL into apolipoprotein B (apo B)- containing lipoproteins due to the activity of Cholesterol Ester Transfer Protein (CETP). These acceptor lipoproteins are then removed from circulation by the activity of LDL receptors on the hepatocytes[18].
The cholesterol is then removed from the liver by excretion into bile as bile acids or as free cholesterol.
II. Anti-oxidation
The anti-oxidative properties of HDL have been attributed to its different components such as apoA-I, paraoxanase-1 (PON-1), phospholipase-A2 and LCAT. Oxidation of plasma low-density lipoprotein
(LDL) is harmful as it produces pro-atherogenic lipoprotein particles that can deposit on endothelial walls. This oxidation of LDL can be overcome by the anti-oxidative property of HDL [8].
III. Anti-inflammatory
Atherosclerosis is the consequence of a pro-inflammatory response that results in the up regulation of adhesive factors in the endothelial lining giving rise to plaque. This process begins from the oxidation of the lipoproteins and other components from the endothelial lining of a developing atherosclerotic plaque. The anti-inflammatory property of HDL aids in moderation of this process under normal conditions, which is perturbed under disease conditions. The HDL anti-oxidative components such as
PON-1 and LCAT are known to reduce the production of pro-inflammatory cytokines such as tumor necrosis factor- alpha, interleukin-1, monocyte chemotaxis protein-1 etc by endothelial cells and smooth muscles [19, 20].
IV. Role of HDL in infections
HDL possibly has an important role in different infections, as many infections are associated with dyslipidemia and the alteration in the size and composition of HDL. For example low plasma HDL-C
! 3!
has been found to be associated with the severity of acute bacterial infections such as septicemia and parasitic infections such as visceral leishmaniasis [21, 22]. Likewise low levels of APOA1, the canonical protein of plasma HDL has been associated with the severity of septicemia [23]. On the contrary, overexpression of APOA1 in septic mice is associated with survival [24]. These observations suggest that HDL has an important role in the protection against these infections.
APOA1 is not the only HDL component associated with protection against different infections. Another
HDL protein, apolipoprotein L1 (APOL1) has also serves as an innate immune component against different infections. Originally discovered due to its protective role against African Trypanosomes [25-
27], APOL1 has been recently been associated with protection against other disease agents such as
Leishmania sp. and Human Immunodeficiency Virus (HIV) [28, 29]. APOL1 is the component of a specialized HDL sub-complex known as Trypanosome Lytic Factor (TLF), named due to its ability to lyse African trypanosomes.
2. African Trypanosomes
a. The disease and its distribution
African trypanosomes are the causative agents of human African trypanosomiasis (HAT) also called
African sleeping sickness in humans. Some parasites in this group also cause animal infections in wild and domestic animals. The disease is called animal African trypanosomiasis (AAT). When the disease affects cattle it is commonly called Nagana. Although the human infection occurrence has dropped significantly over recent years, African trypanosomiasis in cattle presents a huge economic burden in affected regions [30].
The parasites causing African trypanosomiasis in humans and animals belong to order Kinetoplastida, genus Trypanosoma. In general Trypanosoma brucei subspecies are called African Trypanosomes.
These parasites can be further subdivided into three morphologically similar sub-species; T. b. brucei,
T. b. rhodeseinse and T. b. gambiense. T. b. brucei causes trypanosomiasis in animals while T. b. rhodesiense and T. b. gambiense are human infective forms [31]. The disease is usually transmitted to the vertebrate host after a bite by infected tsetse fly. Therefore, the disease occurrence is goverened by the existence of the tsetse in the region. In addition to the vector transmission, it is rarely transmitted trans-placentally from mother to child or due to sexual contact, when blood is exchanged.
! 4!
As reported by WHO the disease is also mechanically transmitted by blood sucking tabanids and has thus spread out of Africa.
According to “The Cattle Site” animals in 37 African countries are affected by Nagana that covers 10 million square kilometers [32]. The disease is characterized by acute onset of disease within 24 days of infection that leads to fever, edema, anemia, loss of appetite and oftentimes causes abortion in animals. Eventually the animals become emaciated and show digestive and neurological dysfunction leading to death in chronic disease. Some acute disease may also lead to early death of the animals
[32]. Therefore, it is a huge economical burden in the affected areas as infected animals are wasted and hence are not suitable for meat or milk. In addition, the disease also affects the fertility of the animals making it a devastating livestock disease.
The Human African Trypanosomiasis (HAT) is commonly distributed in sub-saharan Africa. It is caused by T. b. rhodesiense in Southern and Eastern Africa and by T. b. gambiense in central and
West Africa. Uganda is the only country in Africa that has both forms [33]. The disease caused by T. b. rhodesiense is also called Eastern sleeping sickness and represents 3% of the total HAT reported.
Most of these cases are from Malawi, Tanzania, Uganda, and Zambia. Apart from humans T. b. rhodesiense also infects wild and domestic animals, which serve as the reservoir for the transmission of the disease. In humans, the disease by T. b. rhodesiense is usually characterized by acute onset.
The first sign of disease is observed few weeks to months after the first infection. Eventually the patient develops neurological symptoms when the parasite reaches the brain crossing the blood-brain barrier. In this stage, the sleep pattern of the patient is disrupted, hence the name “The sleeping sickness”. If untreated death occurs within months [31].
Another parasite causing sleeping sickness in humans is T. b. gambiense, which causes approximately 97% of the total HAT reported [31]. There are two group of these parasites named
Group I and Group II T. b. gambiense. One of the major differences between the two is their virulence.
The Group I Gambiense are the most prevalent type and are invariably resistant to human serum
(TLF) while the Group II Gambiense loose their serum resistance property upon continuous passage in mice and can regain resistance upon passage in human sera (TLF). The disease caused by T. b. gambiense is mostly prevalent in Angola, Democratic Republic of Congo (DRC), South Sudan, Central
! 5!
African Republic and Uganda [34]. Approximately 90% of the cases of HAT due to T. b. gambiense are from DRC [34]. Because of the distribution of the disease in Central and West Africa, it is often called the West African sleeping sickness [35]. The disease is chronic characterized by slow progression. Initial infection may be characterized by mild symptoms such as headaches, fever, joint and muscle pains, and swollen lymph nodes. At this stage, the parasitemia in patient blood is typically low making it complicated to diagnose the disease. After 1-2 years of initial infection or 3 years in some case, the patients develop neurological symptoms characterized by personality changes, confusions, and sleep dysregulation. Because of its chronic onset, the disease is often diagnosed in the late stage leading to high mortality and morbidity. For the same reason, humans account for major carriers of the parasites and hence the disease is anthroponotic. Although few domestic and wild animals can get infected with T. b. gambiense [31, 34], its epidemiological role is not extensively studied yet.
b. Parasites and Life cycle
Trypanosomes are unicellular, flagellated, extracellular parasites that are transmitted to humans and animals by a vector called Tsetse fly (Fig 2). However, other forms of transmission such as mother to fetus or mechanical transmission by blood sucking insects, sexual transmission and needle inoculation may transmit the disease in rare cases [30].
After the bite, the parasite makes its way from subcutaneous tissue into blood and lymph. This stage is easier to manage and is characterized by symptoms such as headache, fever, joint pains and itching.
The first stage is followed by a neurological stage where the parasite crosses the blood-brain barrier and infects central nervous system. In this stage, the patient presents neurological symptoms and changes in behavior, confusion, sensory disturbances, poor coordination and disturbances of sleep cycle, which gives its name sleeping sickness. It is difficult to treat patients when they have progressed to the neurological stage. Drugs such as Melarsoprol, Eflornithine, and Nifurtimox manage this stage. These drugs are toxic and difficult to administer which complicates the treatment of the disease at this stage [30]. Therefore, it is important to study the basic biology of the parasite and its interaction with its hosts to develop better treatment in future.
! 6!
Figure 2: Life Cycle of African Trypanosomes The parasites are injected into the host during its blood meal. Once in the blood the parasites transform into trypomastigote stage in the bloodstream. These trypomastigotes multiply and invade different places. The trypomastigote in the blood are then taken up by another tsetse during its blood meal and transform into procyclic trypomastigote in tsetse fly midgut which undergo transformation to form epimastigotes in the salivary gland and the cycle continue when this fly bites a healthy host during its blood meal. [35] Source: CDC.gov.
c. Parasite morphology and immune evasion
Members of T. brucei are unicellular parasites with a single flagellum that originates from its flagellar pocket and runs along the length of parasite to protrude out from the cell body. This flagellar pocket is marked by an invagination and is devoid of the microtubule scaffold that is present throughout the cell body of the parasite. Therefore, this flagellar pocket is the place for the entry and exit of nutrients and other transfered materials [36]. At the base of this flagellar pocket is a structure known as basal body, which has the kinetoplast in its proximity. The parasites also contain a single nucleus, mitochondrion, golgi and lysosome. These core structures are supported by the microtubule skeleton, which is
! 7!
covered with 15nm thick surface coat proteins called Variant Surface Glycoproteins (VSGs) [37]. VSG comprises 95% of the surface proteins of trypanosomes [38]. They are glycosylphospoinositol (GPI) anchored proteins and are expressed from genes called Variant Surface Glycoprotein (VSG), which are located at the telomeric regions of the parasites’ chromosomes. A host immune system can effectively recognize and clear these VSG on the extracellular trypanosomes. However, the presence of many VSG genes, which switch continuously leading to antigenic variation, provide an advantage to the parasites to survive in the host by evading the host immune system. This antigenic variation in trypanosomes is more complex than a single changed coat due to the switching of the VSG repertoire.
According to the recent study by Mugnier et al, at any point of time during infection, there are several
(as many as hundred) different VSGs expressed by individual parasites in a population along with recombinant VSGs called mosaics formed due to complex gene conversion events [39]. Thus the parasites have ability to form large repertoire of VSGs. The VSG coat is highly immunogenic. As a result they evoke strong antibody response that then destroy the parasites due to complement deposition or phagocytosis. Some parasites are able to change their coat to new VSG and evade immune detection. These parasites with new coat then grow in the blood until it is destroyed by the antibody response when another with a different coat come and this process continues. Thus parasites easily disguise themselves from recognition and destruction by host antibody mediated immunity. Since adaptive immunity is not sufficient to fight these parasites, hosts such as humans and higher primates have evolved to develop an innate immunity factor to fight trypanosomes. It is called
Trypanosome Lytic Factor (TLF) due to its ability to lyse trypanosomes. Due to the presence of TLF, human serum is cytotoxic to animal infective T. b. brucei. Human infective forms such as T. b. rhodesiense and T. b. gambiense are however, resistant to the cytoxic effect of human sera, as they have evolved to evade the TLF mediated lysis [40].
The resistance in T. b. rhodesiense is due to the expression of a VSG family protein called Serum
Resistance Associated Factor (SRA) [41]. This GPI anchored protein localizes intracellularly in the parasite endocytic vesicles, lysosome, and flagellar pocket [42, 43]. Using His-tagged SRA and alexa- labelled APOL1, Vanhamme et al, showed colocalization of the two proteins in the endocytic compartments and lysosomes [27]. In separate study using surface plasmon resonance and the C-
! 8!
terminal domain of the APOL1 protein, Thomson and Genovese et al, have shown that the interaction between the two proteins is pH dependent with maximum affinity at pH 4.5 [44]. However, labeled
TLF1 is not found in the lysosomes of parasites expressing SRA in the absence of lysosomal protease inhibitors like FM464 [42, 45]. These data suggest that SRA interacts with C-terminus of APOL1 in the acidic endosome/lysosome leading to the proteolysis of the APOL1/TLF complex within the lysosome thereby inhibiting its trypanolytic activity.
TLF resistivity in Group I T. b. gambiense is due to a mutation in the receptor TbHpHbR that is required for the uptake of the parasites [46]. Because of the mutation in the receptor there is reduced uptake of TLF in these parasites. In addition, these parasites also express a truncated VSG called
TgsGP. TgsGP has been proposed to stiffen the parasite membrane and contribute to resistance the to TLF [47, 48].
3. Trypanosome Lytic Factor (TLF)
a. TLF is specialized HDL
For many years, humans’ and some primates’ sera were known to have a toxic effect against animal infective trypanosomes. Rifkin for the first time showed that high density lipoprotein is the actual lytic factor of these animal infective trypanosomes [49]. Due to its activity against the African trypanosomes this high-density lipoprotein got its name Trypanosome Lytic Factor (TLF). TLF are specialized HDL that can be subdivided into two sub-fractions namely TLF1 and TLF2. TLF1 does not fall into the classical HDL nomenclature, because it is large and dense [50] with approximately 60% protein and 40% lipid. TLF1 is approximately 500kDa in size and is made up of APOA1, the canonical
HDL structural protein along with two unique proteins Apolipoprotein L1 (APOL1) and Haptoglobin related protein (HPR) [51-53]. TLF2 on the other hand is a lipid poor pre-beta complex that is 1000 kDa in size. The major components of TLF2 are APOA1, APOL1, HPR and IgM [53, 54].
b. Subcomponents of TLF
I. Haptoglobin Related Protein (HPR)
The unique components that give lytic property to the TLF complex are APOL1 and HPR [26, 27, 30,
54-57]. Of these components, HPR named due to its similarity to haptoglobin (HP), has 91% sequence homology to the HP [55, 58]. HP and HPR are expressed from the haptoglobin gene cluster. This
! 9!
gene cluster arose due to the result of gene triplication of HP locus followed by deletion of one copy after the split of Old World Monkeys (OWM) and New World Monkeys (NWM) (Fig 3) [59].
HPR is a 45kDa protein with a signal peptide that is retained in the mature secreted protein, which makes HPR unusual among secreted proteins. Currently there are two other proteins known to retain their signal peptide in the mature secreted proteins namely: paraoxanase-1 (PON1) and apolipoprotein M (apoM). Interestingly, all three proteins HPR, PON1, and APOM are components of
HDL complexes [60, 61]. The retained signal peptide is essential for the proteins to associate with the
HDL complex [60-62]. Although lipid alone is sufficient for HPR to associate with Large Unilamellar
Vesicles (LUV), Harrington et al., have shown that presence of APOL1 enhances the binding of HPR to the LUV [62]. Hence, APOL1 may enhance the association of HPR to TLF or membranes when it is secreted from cells. Lipidated HPR has been shown to have higher affinity for its co-factor hemoglobin as compared to HPR alone [62]. Therefore the property of HPR is affected by other components of
TLF. Despite the high degree of structural similarity with HP and its ability to bind to hemoglobin, HPR has some structural differences with HP including the retention of signal peptide in HPR, which is removed in HP. Like HP, HPR is expressed as a nascent peptide that is eventually cleaved into two fragments to form alpha and beta subunits. A disulfide bridge holds the alpha and beta subunits together. Two alpha-subunits then interact with each other to form a tetramer made of two alpha and two beta subunits. Thus the structural organization of HP and HPR at the molecular level are very similar. However, the alpha-chain of haptoglobin has a cysteine residue at position 33 that is absent in
HPR. The extra cysteine residue gives an additional disulfide bridge between two alpha subunits and hence more stability in HP, which is absent in HPR [63]. The most striking difference in sequence is however in the beta subunit. Four amino acids in HPR at valine 259, glutamate 261, lysine 262 and threonine 264, makes it unrecognized by CD163, the human haptoglobin-heamoglobin receptor found on macrophages and monocytes. This makes HPR functionally different from HP because the high affinity binding of haptoglobin bound hemoglobin to CD163 is responsible for the receptor mediated clearing of HP-HB complexes by macrophages and monocytes during hemolysis [63]. For the same reason, the concentration of HPR in serum is not affected by conditions like sickle cell anemia or intravascular hemolysis.
! 10!
Despite these differences, the structural similarity between HPR and HP is exploited by our immune system to combat against extracellular parasites African trypanosomes. African trypanosomes are heme auxotrophs and have a receptor called Trypanosoma brucei haptoglobin-hemoglobin receptor
(TbHpHbR) to scavenge haptoglobin bound hemoglobin that serves as a source of heme for the parasites [64]. Knocking out this receptor in parasites makes trypanosomes less sensitive to lysis by
TLF containing serum implying that the receptor helps in uptake of TLF [64, 65]. The disadvantage of structural similarity between HPR and HP comes from the fact that plasma haptoglobin when bound to heamoglobin can competitively inhibit the binding of HPR-HB to the trypanosome receptor and hence inhibit TLF activity [66]. This inhibition is however, specific to TLF1. In contrast to TLF1, presence of or variation in haptoglobin levels does not affect TLF2 activity [67]. In serum the level of HPR is 0.03-
0.04 mg/ml, which is 10 fold lower than that of HP (0.27-1.39 mg/ml) [68]. Therefore, TLF1 is always inhibited in normal human serum and only active upon extensive hemolysis when all the HP-HB complexes are completely cleared. Thus, TLF2 is considered more relevant than TLF1 to protect humans against African trypanosomiasis in normal physiological levels of HP.
! 11!
Figure 3: The Haptoglobin Gene locus The haptoglobin gene locus underwent triplication after split of the OWM and NWM to form the hp, hpr and hpp. Therefore, in primates there are haptoglobin, haptoglobin related protein and haptoglobin primate protein gene locus. In human the triplication event was followed by a deletion event that lead to the deletion of hpp and therefore humans have hp and hpr gene in the cluster. Source: Nielson and Moestrup, 2009 (Review)[59]
! 12!
II. Apolipoprotein L1 (APOL1)
Apolipoprotein L1 is a 42 kDa pore forming protein. It is an important component of TLF complex, which is necessary and sufficient for trypanolysis [26, 27]. The protein structure has not been resolved due to the fact that the protein is not crystallized. There are different structures predicted for the human APOL1 protein. The predicted structure is shown in figure 4.
Signal!peptide! N!terminus! Transmembrane!domain!
Figure 4: APOL1 predicted domains with five common haplotypes. APOL1 is a secreted protein that has 27 aa long signal peptide. It has a predicted N-terminal domain, three transmembrane domains and a C-terminal coiled coil domain. The backbone shown above represents the most common haplotype, G0, present in 80% of the population. African haplotypes are G1 (p.S342G and p.I384M), G2 (p.delN388/Y389) and G3 (pK255R). G4 (p.I228M, K255R) is the neanderthal APOL1 retained in 22% modern Europeans, 20% Asians and 11% South Americans.
The mature protein is 398 amino acids long and contains a 27 amino acid long signal peptide [50].
Due to the presence of the signal peptide, APOL1 is secreted and hence can be assembled in HDL particles. Due to weak homology of the APOL1 protein to bacterial colicins, the N-terminal 60-235 amino acids were believed to be essential for pore formation by APOL1 based on its ability to kill bacteria in vitro. It was therefore hypothesized that C-terminus of the protein was dispensable for the lytic activity of the protein [27, 69]. However, later studies have established that C-terminus of the protein is essential for the trypanolytic activity of APOL1 [26, 69].
APOL1 is predicted to have a putative BH3 motif [70, 71], which is not essential for trypanolysis or pore formation by APOL1. This was shown by mutating the core BH3 motif amino acids in the protein to alanine, the APOL1 was still toxic when expressed in Xenopus Oocytes as well as trypanolytic to trypanosomes in vivo in transient transgenic mice expressing the mutant APOL1 [72]. In addition to this Bcl2 domain, there are three predicted transmembrane domains, which are required for the membrane association and function of APOL1 at acidic pH. These domains have to be functionally
! 13!
characterized. Finally, the C-terminal domain of APOL1 has been shown to bind to the serum resistance associated (SRA) protein of human infective T. b. rhodesiense at low pH and hence is also called the SRA interacting domain. [44, 69]. The difference in APOL1 sequences of OWMs including baboons to that of humans at the C-terminus makes them lytic to T. b. rhodesiense suggesting that this domain is important for the neutralization of APOL1 by SRA. Moreover, deletion of the C-terminus of APOL1 leads to loss in its ability to form pores in bilayers and lyse African trypanosomes [26].
Therefore, this domain is essential for APOL1 mediated pore formation and lysis.
• APOL1 lyses cells by forming a pH dependent cation selective pore
Trypanosomes are auxotrophs of heme. To access heme, trypanosomes have a haptoglobin haemoglobin (HPHBR) receptor, thus TLF can piggyback on this receptor by HPRHB dependent receptor mediated uptake via the TbHPHBR. In addition, TLF can be endocytosed by yet unknown scavenger receptor and also by pinocytosis [73]. Once in an acidic endocytic compartment, APOL1 will lyse the parasites due to pore formation, followed by colloidal osmosis. The acidic pH is essential for this APOL1 mediated lysis, which can be blocked by neutralizing the acidic endosomes with weak bases such as ammonium chloride (NH4Cl) and chloroquine [74]. Osmotic agents such as sucrose can also inhibit the cellular swelling and lysis, suggesting that influx of water leads to the lysis of the parasites [25]. Finally substitution of Na+ ions (the most abundant ion in extracellular fluid) with large cations such as tetramethylammonium+ or Choline + or chloride with anions such as gluconate delays the lysis by APOL1 suggesting that the formation of ionic pores are in the plasma membrane of the parasites [25, 56]. The delay due to the replacement of sodium by larger cations happens if the substitution is done at the time of incubation with TLF. After 60 minutes, the replacement of sodium does not prevent the lysis, because the cations have already equilibrated across the plasma membrane. At this time (i.e. 60 minutes post incubation with TLF), lysis can be delayed by substituting chloride with large anions [25]. These observations suggest that TLF forms pore that initially allows the selective influx of sodium, which changes the membrane potential by reducing the negative charge inside the cell. Chloride channels then open and flux of chloride increases the negative membrane potential. However, the increase in ions inside the cell drives water through aquaporins that leads to
! 14!
the swollen morphology and lysis. Infact, TLF was shown to form cation selective pores at pH 5.5 in the lipid bilayer extracted from the parasites [25].
TLF mediated lysis can be observed by incubating the parasite with recombinant APOL1 alone.
However, the kinetics of lysis by APOL1 is much slower than that by TLF [25, 27, 56]. It could be due to the fact that APOL1 has to rely on pinocytosis- mediated uptake as compared to the receptor mediated endocytosis of TLF [73]. The APOL1 mediated pore formation is observed in lipid bilayers as well where the protein associates with membranes in acidic pH (5.3) as observed by a small increase in membrane conductance when APOL1 is added to the cis/extracellular/luminal side at pH 5.3
(trans/cytoplasmic side at pH 7.2) [75]. A small increase in conductance also implies that ions can slowly leak through due to the association of APOL1 with the membrane. However, upon increasing the pH of the cis/extracellular/luminal side to 7.4 the conductance drastically increases, indicative of a pH gated channel. These observations can be explained in the context of trypanosome killing as follows: APOL1 associates with endosomal membrane at acidic pH, the membrane containing the pore recycles to the plasma membrane and opens the cation selective pore at neutral pH this leads to cytoplasmic swelling and lysis due to osmotic imbalance [75].
• APOL1 gene is under positive selection
Apolipoprotein L1 is a protein component of the TLF complex that is expressed from the APOL1 gene, which is part of the APOL gene family. The APOL gene family consists of two clusters APOL1-APOL4 and APOL5-APOL6. Of the two clusters, cluster 1-4 is of interest to us, which arose due to gene duplication in primates before separation of Old World Monkeys (OWM) from the New World Monkeys
(NWM) [71]. The APOL3 in the cluster is predicted to be the ancestor gene based on its occurrence and evolution in primate lineage [76]. Although the product of gene duplication, the APOL1-4 have evolved rapidly to genes with their own identity. Infact, this gene cluster has been shown to be under positive selection, and the genes in the cluster are highly polymorphic in their sequences within the primate lineage [71].
Within the APOL1 gene alone, we see a high degree of sequence variability, pseudogenization and deletion events among different primates suggesting that APOL1 is under positive selection. For example, when we compare the APOL1 sequence among different primates, human and gorilla
! 15!
APOL1 sequences are similar to each other but different to the APOL1 sequences of OWMs such as baboons and Sooty Mangabeys [44, 55, 71]. This difference in APOL1 sequences in primate lineages is reflected in their ability to lyse multiple parasite strains.
Human and Gorilla APOL1/TLF can lyse animal infective species of Trypanosoma brucei subspecies while OWMs’ APOL1/TLF lyse wider range of African Trypanosomes (both human and animal infective forms) [55, 77-79]. The difference in the APOL1 sequence of OWMs including baboons to that of humans at the C-terminus is remarkable. Baboon APOL1, which gives 100% resistance against T. b. rhodesiense, has four unique lysine residues at its C-terminus (Fig 5) that makes it possible to evade binding to the SRA of the parasites. Using chimeric APOL1 (human and baboon), our lab has previously shown that two out of four lysines at position 387 and 388 on the C-terminal domain of baboon APOL1 are essential to confer resistance against T. b. rhodesiense [80].
387 388
Figure 5: Alignment of C-terminus of human variants and baboon APOL1. The four unique lysine residues in baboon aligned to the lysine caused by an indel in G2 is in red. Base pair substitution in G1 is highlighted in yellow.
The APOL1 gene is absent in chimpanzees and bonobos, the closest relatives of humans; and pseudogenized in macaques, closest relatives of baboons [71, 81]. Therefore, sera from these primates are not trypanolytic. Thus the presence of APOL1 is necessary for trypanolytic activity and hence innate immunity against African trypanosomes. It is possible that African trypanosomes were/are the selective pressure leading to the evolution of APOL1 in primates. One exception to this rule is Gibbons, which are predicted to have full open reading frame of APOL1 (XM_003264694.2) implying that there is a possibility of expression of APOL1 in gibbons. There is no evidence of the expression of APOL1 gene in Gibbons. In addition in vitro studies have shown Gibbons’ sera to be non-trypanolytic. Although various factors including improper handling of sera could lead to loss in
! 16!
trypanolytic activity, geographical occurrence of Gibbons in regions of Asia support the fact that
Gibbon sera are non-trypanolytic. We do not know the selective pressure for the evolution of APOL1 in
Gibbons, primates that are geographically distributed in Indonesia and nearby regions of Asia. A parasite to blame is T. evansi, which evolved from T. brucei and infects domestic and wild animals in regions Gibbons are prevalent. The specific date of the evolution of T. evansi from T. brucei and its spread into these regions however, has not been resolved yet. [82]
Selective evolution of APOL1 is observed within species as well. Population based genotyping studies have identified as many as 16 different haplotypes of human APOL1 existing within human populations [44, 83]. This result is supported by the result from a large-scale exome sequencing
(~60,000 individuals) performed by broad institute that has been deposited in the ExAC database.
According to this database, human APOL1 has 450 Single Nucleotide Polymorphism (SNP) variants and 46 Copy Number Variants (CNVs). Interestingly, the ratio of observed to expected variants for both synonymous and non-synonymous SNPs is greater than 1 indicating that APOL1 is rapidly evolving in human populations [35]. More recently, genome wide association studies, long range haplotype test, and genomic differential testing found three APOL1 haplotypes namely: G1, G2, and
G3 are positively selected in different parts of Africa [44, 83-85]. These haplotypes are defined as- G1- two point mutations at rs73885319 (S342G) and rs60910145 (I384M), G2- inframe deletion at rs71785313 (delN388/Y389) and G3- rs136175 (p.M228I) and rs136176 (p.K255R) (Fig 4 and Table
1). Of the three, G1 and G2 have been shown to protect against Human African Trypanosomiasis
(HAT) due to T. b. rhodesiense at the expense of a higher risk of chronic kidney diseases [44, 84, 85].
Due to its six base pair (two amino acids) deletion, the C-terminus of G2 aligns with the lysine at 387 to that of OWMs’ APOL1 (Fig 5). Due to this change in alignment, the C- terminus of G2 does not bind to SRA of T. b. rhodesiense as shown by surface plasmon resonance (SPR). The C- terminus lysines of G1 on the other hand do not align with OWM lysines and was found to bind to SRA with an affinity only slightly less than G0 in SPR binding experiments using the APOL1 C-terminus as bait [44]. The mechanism of killing of T. b. rhodesiense by G1 is not known yet. Unlike the immunity due to human
TLF against animal infective forms that completely kills the parasites, the immunity due to human haplotypes G1 and G2 does not completely protect against T. b. rhodesiense infecton in Tg-mice.
! 17!
Instead, these haplotypes were found to increase the survival rate of the mice, G2 being better than
G1. Therefore, these haplotypes may be selected due to African trypanosomiasis in Africa where the disease has been endemic for past 3 million years [86]. However, G1 is highly selected (70% prevalence) in West Africa and coexists with the G2 (3% prevalence) suggesting that they may have been selected against two different pathogens. Haplotype G3 exists with very low frequencies in
African populations and is positively selected in one Cameroonian population in West Africa indicating that G3 is a newly evolved haplotype [14]. This haplotype is not associated with the risk of kidney disease and matches with the Neanderthal APOL1, which is positively selected in the modern
European population and is named G4 (Fig 4 and Table 1). Haplotype G4 represents 22% of the modern European population suggesting that Europeans acquired it from ancient human Neanderthals during interbreeding and that it must have been retained due to some selective advantage. Despite the fact that it is not the most common haplotype, G4 is reference gene for APOL1 (hg19). This haplotype matches the African haplotype G3 in all but two SNPs, one of which is a synonymous mutation [44] suggesting that G3 may have evolved from G4 due to interbreeding. We do not know the pressure driving the selection of G3 in Africa and G4 out of Africa. Given that APOL1 is an innate immunity gene, selection of APOL1 in distinct human populations may be driven by pathogens other than African Trypanosomes.
! 18!
4. Leishmania
a. Disease and its distribution
Leishmania are intracellular kinetoplastid parasites that cause a range of diseases collectively called leishmaniasis. There are 21 different species of Leishmania that cause human diseases ranging from mild cutaneous lesions at the site of infection called cutaneous leishmaniasis: moderate, disseminating mucocutaneous leishmaniasis to severe often life threatening visceral leishmaniasis.
I. Cutaneous Leishmaniasis
L. tropica, L. major, L. aethiopica, and rarely L. infantum and L donovani in the Old World cause cutaneous leishmaniasis. In the New World, the disease is caused by parasites belonging to the L. mexicana complex such as L. mexicana, and L. amazonensis. This is the most common form of leishmaniasis that is characterized by a mild self-healing lesion at the site of infection. The lesion usually starts as a bump that eventually opens to form ulcer. The ulcers are usually subject to secondary infections by bacteria. The skin ulcers often are covers with scabs. The lesion is most usually in the exposed part of the body such as face, neck, arms, and legs. The lesion therefore causes disfigurement in facial areas, which makes it undesirable as it may contribute to mental worries.
Moreover, the disease is characterized by presence of more than one lesion often ranging to as many as 200 that leads to serious disability [87, 88]. According to CDC, there are approximately 0.7 million to
1.2 million cases of cutaneous leishmaniasis worldwide [87]. The majority of these cases are from
Afghanistan, Algeria, Brazil, Colombia, the Islamic Republic of Iran, Pakistan, Peru, Saudi Arabia and the Syrian Arab Republic. Some parts of South-East Asia have cutaneous leishmaniasis that cluster with visceral leishmaniasis and is believed to be of anthroponotic origin. In recent years, the disease outbreak has usually occurred in war conflict regions that have a dense population for example refugee camps [88].
II. Muco-cutaneous leishmaniasis
Mucocutaneous leishmaniasis is caused by Viannia subgenus (especially L. [V.] braziliensis but also
L. [V.] panamensis and sometimes L. [V.] guyanensis); it also can be caused by L. (Leishmania) amazonensis. The disease is the disseminating form of cutaneous leishmaniasis that spreads from the skin to nasal and mucosal membranes [87]. The disease is common in the Americas due to
! 19!
metastasis of the cutaneous lesions that were not treated or were suboptimally treated. The disease manifestation often happens years or sometimes even a decade after the initial infection. Untreated cases can progress and even destroy the entire naso-pharyngeal membrane.
III. Visceral leishmaniasis
Visceral leishmaniasis is caused by L. donovani in South-East Asia and parts of Africa. In some
European countries and the Americas it is cause by member of L. chagasi complex mostly L. infantum. As the name indicates visceral leishmania spreads from the site of infection to viscera and affects internal organs of the reticulo-endothelial system particularly liver, spleen and bone marrow and is usually fatal if left untreated. The disease onset can be acute or chronic depending on the immunocompetency of the infected person. The common symptoms of the disease are fever, weight- loss, lymphadenopathy, liver and spleen enlargement. Occurrence of the disease in HIV patients as a co-infection presents a big problem. Currently the majority of the cases are reported from Brazil,
Ethiopia, Sudan, South Sudan, and Somalia. South Asian countries like Nepal, India, and Bangladesh where the disease was highly prevalent are poised to declare the eradication of disease by 2020 [87,
88]. Approximately 0.2 million to 0.4 million new cases of visceral leishmaniasis are reported with
20,000-40,000 deaths every year.
b. Parasite and the Life cycle
Leishmania sp. completes their lifecycle in sand-fly (vectors) and mammalian hosts like humans and dogs who also serve as the reservoir of the disease (Fig 6). Based on the animal or human reservoirs as the source of disease, the disease can be zoonotic or anthroponotic.
! 20!
Figure 6: Life Cycle of Leishmania sp. Humans and other vertebrate hosts are infected A. when an infected sandfly injects metacyclic promastigotes of the parasite intradermally during a blood meal. B. Neutrophils are then recruited at the site of infection and are the dominant cells that phagocytose the metacyclic promastigotes on the first day of infection. C. Eventually the parasites enter macrophages where they reside in the acidic parasitophorous vacuole and transition into round non-flagellated forms, the amastigotes. D, E. These amastigotes are the dividing forms that divide and proliferate to manifest different disease symptoms in the host. F. Sandflies then take these parasites from the skin of an infected individual G., which transform into promastigotes in sandfly midgut. Source: Adopted from www.niaid.nih.gov [89]
The parasites exist in different forms in the sandfly and vertebrate hosts that are described below:
I. Sandfly
Phleotomine sandflies of genus Plebotomous in Old World and Lutzomyia in New World spread leishmaniasis in humans and other vertebrate hosts [90]. Previous experiments have demonstrated species specificity between the sandfly and the Leishmania species [91, 92]. Although, there are differences, the major steps of metamorphosis of the parasites from the amastigotes to metacyclics after a blood meal in the sandfly follows same general scheme (Fig 7).
! 21!
Figure 7: Stages of Leishmania sp. in sandflies Sandflies take amastigotes from an infected vertebrate host during a blood meal into the abdominal midgut where the parasites transform into flagellated procyclics within 18-24 hrs. In 3-4 days the procyclics change to long slender Nectomonads. The nectomonads migrate to thoracic midgut and further transform to metacyclics and haptomonads. Finally the parasites migrate to foregut and are injected as non-dividing metacyclics into the vertebrate host during a blood meal to establish a new infection. Source: Sacks D., 2001. [93]
The amastigotes ingested after blood meal lodge into the alimentary canal of the sandfly where they transform into flagellated procyclic forms in 18-24 hours. The parasites have to overcome different barriers like the chitin containing peritrophic matrix, hydrolytic enzymes and other innate immunity factors in sandfly gut [94]. Overcoming all these barriers, the parasites multiply and transform into nectomonads. The promastigotes at this stage attach to the midgut epithelium for their survival. Any promastigotes that fail to attach to the midgut epithelium are defecated by the sandflies. Therefore, this attachment is an essential step for the parasite development and propagation. One of the mechanisms by which the promastigotes attach themselves to the sandfly midgut is via the surface glycoprotein lipophosphoglycan (LPG) in the restrictive strains of the sandfly. It is the most abundant surface glycoprotein on the surface of the promastigotes that is made up of four domains: (a) a phosphatidyl inositol lipid anchor, (b) a phosphosaccharide core, (c) a repeating phosphoglycan region
! 22!
(PG repeat), and (d) a small oligosaccharide cap (Fig 8). Of these four domains, the repeating phosphorylated saccharide region and the oligosaccharide cap are variable while the other two domains are fairly conserved throughout the species. The repeating phosphorylated saccharide has
(6Galβ1,4-Manα1-PO4) core with the sugar branches and varies with the species and developmental stages (Fig 8). This variation in the glycan core or the cap structure has been shown to be the factor governing the species-specific attachment of Leishmania sp. to sandflies [95]. However, overexpression of the LPG binding receptor is not sufficient to enhance the establishment of infection by the parasites suggesting the existence of an unknown factor for the survival of parasites in their selective vectors [96]. In permissive strains eg. L. longipalpalis and P. arabicus, the attachment of promastigotes to the midgut is LPG independent. In these strains, vector glycans along with LPG2 dependent molecules have been implicated in the binding of the parasites to the vector midgut [97,
98].
! 23!
B
L. donovani procyclic
L. infantum procyclic
L. major procyclic
L. major metacyclic
Figure 8: A. The structural representation of L. major proteoglycans- LPG, PPG and GIPLs. The PGs are made up of a phosphatidyl inositol lipid anchor, a phosphosaccharide (glycan) core, a repeating phosphoglycan region (PG repeat), and (d) a small oligosaccharide cap. (Source: Adopted from [99]). B. LPGs of different Leishmania sp. (Source : Adopted from [100, 101])
Eventually, the parasites transform into the thin slendar, highly motile, terminally differentiated forms called metacyclics. Metacyclics are 5-8 microm in size, the non-dividing infective stage that are injected by blood feeding female sandlflies into the vertebrate host during a blood meal.
II. Vertebrate host:
Parasites are transmitted to the vertebrate host during a bloodmeal by an infected sandfly where the fly regurgitates the metacyclics into dermis accompanied by egestion of promastigote secretory gel
(PSG) and salivary fluid [102, 103]. The PSG and sandfly saliva helps in establishment of the infection
! 24!
and exacerbate disease when injected along with parasites in needle inoculation in rodents [102-104].
Mouse experiments revealed that sandflies inject L. major in the range of 10-105, though the range is segregated in two different clusters; a low dose with a median of ~40 parasites and a high dose with a median of ~8000. Clearly the progression of disease was different with different infection dosage. The high dose infection (5000 parasites) progresses rapidly with large lesion as compared to the low dose infection (100) [105].
In vertebrate hosts, the Leishmania live as intracellular parasites in the cells of reticuloendothelial system. This process begins with the recruitment of neutrophils at the site of the infection following the sandfly bite. The recruitment of neutrophils has been observed within the first hour of infection and peaks at 12 hours post infection. Therefore, in the first several hours of infection, metacyclics are predominantly observed in the neutrophils [106-108]. These observations have been made in rodent models of infection, which are also used to assess the function of neutrophils in human leishmaniasis.
In mice, depletion of neutrophils (first 24-48 hours post infection) leads to a decrease in parasite burden. This observation forms the basis of the hypothesis that neutrophils are a safe harbor for
Leishmania [107-109]. The parasites in the neutrophils have been shown to be alive [106] and approximately 30% of the parasites were found to be released from infected neutrophils isolated from mice within 4-5 hours in vitro [107]. Therefore, it is possible that neutrophils release live parasites after phagocytosis, which may then be taken up (phagocytosed) by bystander immune cells such as macrophages and dendritic cells. Experiments performed by injecting infected neutrophils into mice suggest that the freed parasites are mostly taken up by macrophages and neutrophils. However, dendritic cells showed markers for neutrophils as well as fluorescent parasites suggesting that dendritic cells phagocytize apoptotic neutrophils as well as live parasites [107]. By 48 hours of infection, most of the parasites are observed in inflammatory monocytes and by day 4 of infection, there are very few neutrophils at the site of infection [94, 108]. By day 9 parasites are predominantly in macrophages following an ear infection [108]. In macrophages, Leishmania live as intracellular non- flagellated amastigotes.
Amastigotes are oval, 2-5um in size, non-flagellated forms that reside in the acidic parasitophorous vacuoles (PV) of macrophages. Depending on the species of Leishmania, the PV may be small and
! 25!
tight carrying single amastigotes eg. L. major and L. donovani or large and communal carrying multiple parasites in one PV eg. L. mexicana and L. amazonensis. These forms divide by binary fission within the PV of the macrophages leading to the death of host cells harboring the parasites. The parasites are then released to infect new immune cells and thus proliferate in our body locally or viscerally depending on the species [110]. In this form they can manifest the disease symptoms in the infected hosts.
c. Cell entry and survival in intracellular environment
Leishmania encounters a barrage of host antimicrobial responses that they have to evade to establish a successful infection. These survival strategies range from being unrecognized by the host immune system to manipulating host cellular machinery for their survival and proliferation. Even before they reside in the cell they have to overcome complement mediated lysis, which they do by the activity of
Leishmania surface protein GP63. It converts the active component of complement C3b into C3bi and thus evades the complement-mediated lysis by the Membrane Attack Complex (MAC). This process also facilitates the phagocytosis of the parasites by complement receptor 3 (CR3) mediated entry [111,
112]. In addition, GP63 has been shown to inhibit the activity of natural killer (NK) cells by suppressing the proliferation and secretion of effector cytokines like IFN- γ. Recombinant biotinylated GP63 was found to interact with the NK cells to induce the same phenotype inferring that GP63 interacts with NK cells to inhibit its proliferation and cytolysis [113].
Eventually immune cells like neutrophils and macrophages phagocytose the parasites. LPG the major surface glycoprotein plays an important role in the process of disease establishment by Leishmania.
For example, LPG has been found to protect the parasites from killing by the neutrophils extracellular traps (NETs) [114].
The phagocytosis and the host pathogen interaction that follows have been more extensively studied in macrophages than any other immune cells. The phagocytosis process initiates with the recognition of parasites and attachment, which occurs by using a range of macrophage receptors as CR3, mannose receptors, fibronectin receptors and Fcγ receptors [115]. Following this initial recognition by host cells, metacyclics are internalized into cells. The internalization of parasite can also occur by lipid raft mediated uptake that utilizes caveolae or cytoskeleton mediated uptake that utilizes actin [116].
! 26!
Once phagocytosed, metacyclics evade the phagosomal lysis by delaying the maturation of the parasitophorous vacuole. The surface glycoprotein LPG has been shown to inhibit the interaction of the parasite containing phagosome with late endosomes and lysososmes thereby delaying the biogenesis of the acidic PV [117]. This inhibition of PV biogenesis is related to parasite survival, as it has been associated with the reduction in the production of Reactive oxygen species (ROS) by macrophages [117].
The metacyclics eventually transform into the non-flagellated amastigotes within macrophage, which is triggered by the decrease in pH and increase in temperature. These forms are highly adapted to survive in acidic PV and differ from metacyclics in several features. The surface glycoproteins such as
LPG, PPG and GP63 are highly downregulated in the amastigotes. These parasites have reduced glucose and amino acid uptake and metabolism and increased beta-oxidation of fatty acids for the survival in nutrient deficient PV. In this form the optimal metabolic environment for the parasite is at pH
4.0-5.5 [118]. Thus amastigotes are well suited for the growth in acidic PV.
d. Immunity
Multiple host, environmental and parasite factors govern the immune response to Leishmania sp. in vertebrate hosts. As an intracellular pathogen residing in cells of the reticuloendothelial system, immunity against Leishmania is remarkably complicated. From the studies done so far, immunity against both cutaneous and visceral strains of the parasite are driven primarily by cellular immunity. In humans, this immune response varies from strong T cell responses and delayed type hypersensitivity as observed in tuberculosis, to the absence of such a response. In other instances, there appears to be exaggerated immune responses giving rise to chronic progressive mucocutaneous leishmaniasis.
The immune response in leishmaniasis can be divided into innate and adaptive immunity.
I. Innate Immunity
Once in the body of its vertebrate host, Leishmania sp. encounters variety of innate immunity factors.
Neutrophils are the first cell to be recruited at infection site and hence to phagocytize parasite.[106].
Neutrophils can kill pathogens by phagocytosis, formation of extracellular traps, or by killing by activated neutrophils. Human and mouse experiments have demonstrated the existence of live
Leishmania in the neutrophils of parasites [119, 120]. In fact, based on results from depletion studies
! 27!
in rodents, neutrophils are considered safe harbor for Leishmania where they reside and hide until they are ready to invade macrophages [108, 109]. In these depletion studies performed by using anti-
Ly6G antibodies RB6C-8C5 and 1A8, the depleted mice are prone to T-cell activation indicated by increase in IFN-Υ and Leishmania specific ovalbumin [107]. Therefore, it is hypothesized that parasites hide in neutrophils and make silent entry into other cells to establish the infection. The role of
NETs in leishmaniasis is unclear because of different results with different species. The NETs have been shown to kill promastigotes of L. amazonensis [121]. Some other studies have shown promastigotes of L. donovani and L. mexicana are resistant [119, 122].
Based on rodent experiments, apoptotic neutrophils with parasites are then taken up by dendritic cells.
The dendritic cells in the presence of neutrophils are less prone to activation as seen by lower expression of MHC class II, CD86 and CD40 which are markers of dendritic cell activation [107].
Evidence suggest that a large number of parasites are also released alive into the extracellular milieu which are then taken up by immune cells like monocytes and macrophages [107, 108]. In macrophages, the parasites can grow silently. Alternatively, the macrophages can get activated mediated by IFNγ to induce Th1 response or by IL-4 to induce Th2 response thereby destroying the parasite [123]. The interferon gamma (IFNγ) plays an important role in the control of Leishmania in the macrophages by inducing the production of NO (nitric oxide), iNOS (inducible nitric oxide synthase) and ROS (Reactive Oxygen species) leading to the respiratory burst and the death of parasites [124].
Natural Killer (NK) cells are immune cells that play an important role in the innate as well as adaptive immunity against Leishmania sp. The role of NK cells and their ability to produce cytokines such as
IFNγ and tumor necrosis factor- alpha (TNF α), which are known to drive TH1 response associated with protection against leishmaniasis has been well studied [124]. In addition to cytokines, the activated NK cells also release cytotoxic granules such as perforin, granzymes and antimicrobial granulolysin. Recently, these cytolytic components have been shown to be antimicrobial against intracellular parasites such as Leishmania, Trypanosoma cruzi and Toxoplasma gondii [125].
II. Adaptive immunity
Dendritic cells are one of the important cells that produce different cytokines and polarize T cells into
TH1, TH2, TH17 or TReg phenotype, which determines the pathogenesis of leishmaniasis. Based on
! 28!
early experiments done using susceptible BALB/c and resistant C57BL/6 mice, IFNγ and interleukin
IL-12 driven TH1 immunity was associated with protection while IL-4 driven TH2 with exacerbation of leishmaniasis [124]. In human cutaneous infections, disease progression is associated with decreased level of IL-10 receptor suggesting that IL-10 plays an important role in the immunity against leishmaniasis [126]. IL-10 is an autocrine inhibitor of IFNγ production and is therefore associated with parasite persistence in organs like spleen in visceral leishmaniasis [127]. In addition, other factors such as prostaglandin E2 and TGFβ have been shown to have a role in immunity against leishmaniasis.
III. TLF mediated immunity in leishmaniasis
TLF is an innate immunity factor against leishmaniasis. Our lab has shown that TLF ameliorates cutaneous infection by intracellular Leishmania sp. in macrophages and in mice [28, 128]. This TLF mediated immunity is due to the ability of TLF to damage the infective metacyclics. The dividing amastigotes are resistant to TLF activity. Therefore, TLF activity against Leishmania is limited to the initial infective stage of the parasites. This may explain the persistence of some parasites even in the presence of TLF in both mice and macrophage infections. Thus TLF is an innate immunity factor that acts early in the Leishmania infection before the metacyclics transition into amastigotes. Although we have seen decrease in parasite burden in mice expressing TLF, we do not know the role of neutrophils in this transgenic murine model. We will revisit this model because recently neutrophils have been shown to be the first cells recruited to the site of the infection that uptake the metacylics.
With respect to the role of macrophages, the parasites were found to co-localise with labeled TLF in the acidic PV. Therefore, it was hypothesized that TLF kills metacylics in the acidic PV [28, 128]. We do not know the mechanism for the uptake of TLF into macrophages. However, macrophages have scavenger receptors for uptake of HDL, which may be responsible for endocytic uptake of TLF., The receptor for HPHB, CD163 is not involved in TLF uptake in macrophages, because HPRHB is not recognized by the receptor. Nonetheless HPR is required for the amelioration of leishmaniasis in addition to APOL1, although HPR alone has no effect. Moreover, haptoglobin inhibits the toxic effect of TLF against Leishmania sp, but does not appear to compete for uptake into macrophages. We do not know the role of HPR or the precise mechanism of activity of TLF against Leishmania. In vitro co-
! 29!
incubation of purified TLF1 with purified metacyclic parasites shows swollen parasites from two cutaneous strains of Leishmania with a marked decrease in infectivity after 24 hours in acidic media suggesting that TLF may act by pore formation and eventual parasite lysis in Leishmania sp. as well
[28, 128]. This provides evidence for the slow lysis of parasites within intracellular phagosome at slightly acidic pH. In the case of African Trypanosomes, TLF can rapidly lyse the parasites within hour of co-incubation [53]. We do not know if there is a rapid lysis of Leishmania sp. by TLF similar to that observed in African Trypanosomes.
TLF mediated protection has been observed for cutaneous strains such as L. major and L. amazonensis that cause self-healing cutaneous lesions [28]. Given that TLF reduces the parasite burden, we infer that human TLF naturally acts as a restriction factor for cutaneous leishmaniasis. This restriction of Leishmania is limited by the transformation of the parasites to resistant amastigotes, which are the proliferative forms that lead to disease manifestation. It is undetermined whether TLF provides any protective effect against visceral strains such as L. infantum and L. donovani, which have worse disease outcome than cutaneous leishmaniasis [28].
In this study, we further examined TLF mediated protection against Leishmania sp. First we tried to look at the effect of primate and different human haplotypes of APOL1 that make TLF to understand if there is a role of Leishmania in the evolution of APOL1 gene. Next we studied the effect of TLF on the parasites with respect to its activity in innate immune cells such as neutrophils and the possible mechanism of activity of TLF against the parasites. We also investigated the effect of TLF on visceral strains.
! 30!
MATERIALS AND METHODS
Synthesis of plasmids with APOL1 haplotypes
Plasmid DNA with APOL1 haplotypes was synthesized by Quick-change site directed mutagenesis- using primers with the mutation and PfuUltra HF DNA polymerase (Agilent Genomics) following the manufacturer’s protocol. The PCR cycle was 950C- 30 s, (950C-30s, 550C-1min, 680C-1min/kb plasmid) x18 cycles. The original template DNA was digested using DpnI enzyme for an hour and the mutant plasmid was transformed into DH5α cells.
Search for primate APOL1
Blood- We obtained fresh human blood that was immediately stored in PAXgene Blood RNA Tube
(PreAnalytix). The blood samples were then used for RNA isolation using High Pure RNA Isolation kit
(Roche).
Fibroblast and B cells- Fibroblast and B cells were obtained from Corriell Cell Repository. RNA was obtained using High Pure RNA Isolation Kit. cDNA was synthesized using an RT PCR Kit (Promega).
Primers
Primers used for the amplification of APOL1 genomic locus and cDNA are: Human- HuAfwd
(GAACCTGGGATGGAGTTGGG), HuArev (GATGTGGCCCCTGTAAGCTT)
Baboon- DBabFEx4 (AGTGGTGGCTACTGCTGAAC), DBabREx5 (CTCGGTTGGAAAGGGAGCTT),
BabEx5F (GCAGCAAAACCATCCAGGTG)
Gibbon- GibL1Ex5Fw (CCGGTGTTATCTCTGACATCCT), GibL1Ex5Rev
(ATGATCTCAAGGGGTGTGGC)
Orangutan- OREX4F (GCCGTCACTCCTAAGGCATC), OREX5R (GGATTGGCTGTGGCTCATCT),
OrEx5F (GCACGATAAAGGACAGCAGC)
Trypanosome Infection
Mice were transfected with 25ug of plasmid DNA with APOL1 haplotypes by Hydrodynamic Gene
Delivery (HGD) as previously described [26, 80]. Gene expression, which results in circulating protein was tested 2 days post HGD by western blot using rabbit anti-APOL1 polyclonal IgG (1:10,000;
Protein Tech) and anti-rabbit TrueBlot-HRP (1:5,000; Rockland). Mice were infected with 5000 mouse
! 31!
passaged T. b. brucei 427 or T. b. brucei 427- SRA intraperitoneally on Day 2 post HGD. The infected mice were monitored for parasitemia and euthanized when the parasitemia reached 1 x 109/ml..
Parasites and media
L. major strain Friedlin V1 (MHOM/JL/80/Friedlin) L. amazonensis (IFLA/BR/67/PH8) or L. infantum
(MHOM/ES/92/LLM-320) or L. donovani (LD1S) promastigotes were grown in medium M199 (Gibco)
[129]. When the parasites are grown to stationary phase (day XX), the infective-stage metacyclic promastigotes were isolated by density gradient centrifugation on a Ficoll (Sigma) [130].
Tissue and blood preparation
Mice infected with L. major were euthanized 15 days-post infection and ears were removed and placed in 70% ethanol for 5 minutes. Using tweezers, dorsal and ventral sheets of the ears were separated and digested in 160ug/ml using Liberase TL (Sigma-Aldrich) in DMEM (Cellgro) at 37oC for
90 minutes. After 90 minutes, ears were homogenized and processed for determining the parasite load or for staining and phenotypic analysis of cells described in later section.
For the analysis of cell population from blood, 40ul of blood was collected from the tail vein and processed for staining and cell analysis by FACS.
Parasite load determination
For parasite load by qPCR, ears were harvested, dissolved in trizol (ZYMO Research) and DNA was isolated using Qiagen DNeasy Blood and Tissue kit following manufacturer protocol.. Parasite DNA was quantified using previously described primers that amplify the kDNA: forward - 5’-
CCTATTTTACACCAACCCCCAGT-3’ [JW11]; reverse - 5’-GGGTAGGGGCGTTCTGCGAAA-3’
[JW12] [131]. The housekeeping gene used was mouse-specific beta catenin amplified using previously described primers: b-cat-F–CTTGGCTGAACCATCAC; b-cat-R-
GGTCCTCATCGTTTAGCA [132]. PCR was performed using the ViiA™ 7 Real-Time PCR System in a 20ul reaction mix with 10ul SYBR Green master mix (Applied Biosystems), 1umol each of the forward and reverse primers and 10ng of the template. The PCR was run for 40 cycles at 950C for 10 sec, 600C for 15 sec and 720C for 30 sec.
! 32!
Purification of human and bovine HDL
The HDL from normal human serum was purified by density gradient centrifugation as described elsewhere [55]. The serum density was adjusted to 1.25 g/ml using potassium bromide (KBr) and centrifuged at 49,000 rpm (NVTi 65; Beckman) for 16 hours at 10°C. The top lipoprotein fraction was collected followed by density adjustment to 1.3 g/ml with KBr. Then 4 ml of the adjusted lipoprotein was layered under 8 ml of 0.9% NaCl and centrifuged at 49,000 rpm for 4 hours at 10°C (NVTi 65 rotor; Beckman). The HDL was then harvested and dialyzed in Tris-buffered saline (TBS; 50 mM Tris-
HCl, 150 mM NaCl (pH 7.5) at 4°C and concentrated by ultrafiltration (XM300 filter membrane;
Amicon). The concentrated HDL was purified by size fractionation using superpose 6 (GE Healthcare)
Fast Protein Liquid chromatography and the fractions that showed 50% or higher trypanolysis were collected and concentrated [55].
For the bovine HDL separation, following first float after density gradient centrifugation; HDL was purified by size fractionation on a Superose 6 column (GE Healthcare) equilibrated with TBS. Only the fractions containing APOA1 were then pooled and concentrated.
Macrophage preparation
Bone marrow-derived macrophages were prepared from femurs of BALB/c mice (Taconic) as described previously [133]. Bone marrow progenitor stem cells were cultured in conditioned medium
0 supplemented with L-Cell supernatant 30% (v/v) at 37 C (5% CO2, 95% air humidity). Adherent macrophages were harvested and replated into 8-well Lab-Tek II (Nalge Nunc International,
Naperville, IL) at 50,000 macrophages per well. The cells were then allowed to adhere to the slides by
0 incubating at 37 C (5% CO2, 95% air humidity) for 24 hours in medium without L-Cell supernatant.
Macrophage infection
The infective metacyclic promastigotes of L. major, L amazonensis, L. donovani or L. infantum were opsonized by 30 minutes incubation in DMEM medium containing 4% A/J mouse (Jackson
Laboratories) serum, which has a defect in C5 of the complement cascade. The parasites are thus coated in C3b but are not killed by the membrane attack complex. The C3b is recognized by CR1 receptors on the macrophage, which facilitates phagocytosis. The multiplicity of infection (MOI) was 3 or 2 parasites per macrophage performed in DMEM (Cellgro) medium for 2 hours at 33°C (L. major
! 33!
0 and L. amazonensis) and 37 C (L. infantum and L. donovani) (5% CO2, 95% air humidity) in the presence of human HDL, bovine HDL or no HDL. The parasites that were not phagocytosed were washed off and the cultures were incubated for different time periods in respective media (HDL or no
HDL). Intracellular parasites were assessed after staining with DAPI (3 µmol/L) and visualizing under fluorescence microscopy.
Leishmania acid lysis and acid priming in vitro
For acidic lysis to mimick the endosome pH to lysosome pH change in macrophages, parasites were incubated in slightly acidic pH (5.6) in presence of human HDL (1 Lytic Unit) or bovine HDL (equivalent protein concentration) for an hour followed by further acidification to pH 4.5 by adding succinate buffer at pH 3.8. Live parasites were counted using a hemocytometer using 400X magnification and phase- contrast.
For acid priming to mimick the intial acidic endosome encountered in neutrophils followed by parasite release into the neutral extracellular space, L. amazonensis or L. infantum were acidified to pH 5.6
0 0 using succinate buffer (pH 3.8) and incubated at 33 C or 37 C (5% CO2, 95% air humidity) for 1 hour in the presence of human or bovine HDL (1.5mg/ml). After 1-hour incubation in acidic pH (5.6), the media was neutralized to pH 7 using HEPES buffer (pH 8) and incubated for 2 more hours. Parasites were then washed to remove the HDL and buffer, opsonized in DMEM medium containing 4% A/J mouse serum and allowed to infect macrophages for two hours?. Parasites incubated in neutral medium with human or bovine HDL for 3 hours were used as control.
Transfection and Leishmania infection of mice
Transient transgenic mice were created by injecting plasmid DNA (APOL1:HPR) by hydrodynamic gene delivery as described previously [26, 80, 134]. One day post-HGD, plasma was collected by tail bleeding to analyze the expression level of both genes by western blot using a rabbit polyclonal anti-
APOLI antibody (ProteinTech 16139-1-AP - 1:10,000) or a rabbit polyclonal anti-HP antibody (Sigma
H8636 - 1:10,000) as the primary antibody and TrueBlot anti-rabbit secondary antibody (Rockland
Antibodies 18-8816-33 - 1:5000). On the same day mice were infected with 10,000 Ficoll (Sigma) purified metacyclic promatigotes in 10ul of DMEM intradermally in the ear, using 3/10cc insulin syringe
U-100 29G1/2”.
! 34!
HDL labeling and binding to parasites
Human HDL was labeled with DyLightTM 488 NHS ester (ThermoFisher) according to the manufacturer’s instructions. Ficoll purified metacyclic promastigotes of L. major, mutants lpg5A-/lpg5B or add-backs lpg5A-/lpg5B-/ +LPG5A+LPG5B, L. amazonensis or axenic amastigotes were incubated
(1 x 106/ml) with 10 µg/ml Alexa Fluor-488 labeled HDL in DMEM, 1% BSA for 30 minutes on ice.
Cells were washed twice in DMEM with 1% BSA before being analyzed by flow cytometry. Cells not treated with labeled HDL were used as the controls. Flow cytometry was performed with a Becton
Dickinson FACS Calibur system to measure the fluorescence intensity.
! 35!
PART I- LEISHMANIA AND THE EVOLUTION OF APOL1
RESULTS
1. The search for primate APOL1
Previously we have shown that human TLF with most common haplotype of APOL1 (G0) ameliorates infection by cutaneous Leishmania sp. Based on the long haplotype analysis, done in the samples of
Thousand-genome database phase I, this haplotype is present in 80% of the population sampled [44]
Table 1. Different population based studies have discovered APOL1 haplotypes that are present in people of African descent three of which are positively selected in specific populations in Africa. They are named G1, G2 and G3, where G1 and G3 are selected in West Africa while G2 is distributed throughout Africa (Fig 9, Table 1) [44, 84]. The haplotype G1 and G2 have mutations in their C- terminal domain, the domain that binds to parasite resistance factor SRA. In fact, these haplotypes can kill the human infective T. b. rhodesiense in vitro and in mice. Considering their distribution and the ability to kill African Trypanosomes, it is possible that these haplotypes are selected due to pressure from African trypanosomes. One haplotype, G4, was found to be present only in population outside of Africa (Fig 9, Table 1). This haplotype matches the SNP of ancient humans Neanderthals and Denisovans in all but two (non coding) SNPs in a region of 8 KB [44] suggesting that modern humans got this haplotypes from ancient humans due to interbreeding and kept it due to some selective advantage in populations outside of Africa. Given that there is no African trypanosome pressure in these populations for past 3 million years, African trypanosomes cannot be the selection pressure for G4. Therefore, we hypothesize that another pathogen has driven selection of G4 in out of
Africa population including ancient Neanderthals and Denisovans. The distribution of Leishmania sp. overlaps with the distribution G4 (Fig 9) G4 as well as of primates such as gibbons and orangutans
(Fig 9). Here we wanted to test the effect of primate and human APOL1 on Leishmania sp. using unbiased approach to understand if APOL1 and Leishmania sp. is under molecular arms race.
! 36!
Figure 9: Distribution of Leishmania and human APOL1 haplotypes Leishmania sp. are worldwide in distribution. . G1, G2 and G3 are African haplotypes selected in different parts of Africa while G4 originated out of Africa possibly in Europe and is still prevalent in 22% Europeans and 20% Asians. Adopted from Thomson et al 2014 [44] and WHO Leishmania map.
Table 1: APOL1 haplotypes and their distribution (Analyzed from Thousand genome database)
Haplotypes with variant sites Frequency of occurrence
Amino acid position Total African Non- Freq % of Total African %
% of total
Name 96 150 176 228 255 337 342 384 387 G0 G K N I K D S I NNY 67.2 7.52 59.68 G1 G E N I K D G M NNY 4.9 4.8 0.1 G K N I K D G M NNY 0.05 0.05 0 G2 G E N I K D S I N— 2.01 1.91 0.1 G K N I K D S I N— 0.05 0.05 0 G3 G E N M R D S I NNY <0.05 <0.05 0 G4 G E N M R D S I NNY 15.8 0.77 15.03
It is very difficult to obtain sufficient non-human primate blood for TLF isolation, as most great apes and old world monkeys are protected species. Therefore, to test the effect of different non-human primate APOL1, we tried to obtain APOL1 cDNA from primate samples such as blood and fibroblasts and B-cells. The aim of doing so was to clone the cDNA into plasmid, which can then be expressed in mice to test their effect on Leishmania in vivo in our transient transgenic mouse model.
! 37!
a. Search for APOL1 in primate samples
Originally when discovered, APOL1 was found to be expressed in tissues such as liver, lung, pancreas, prostrate, brain, kidney, and some intestinal tissues[135]. With the advancement in technology, it was reported to be expressed in more cells and tissues indicating it’s ubiquitous expression based on microarray and RNA seq analysis [136]. Therefore, first we tested for the expression of the genes in primates that we knew had circulating TLF (APOL1 and HPR) in their blood. We screened human blood cells and baboon fibroblasts, representative of the cells that we could obtain from non-human primate repositories.
! 38!
Exon4 Exon5 A!
Baboon! Liver! fibroblast!
Human! B! Whole!blood!
C!
Orangutan!
B!cells!
D! Gibbon! Fibroblast!
Figure 10: Baboon fibroblast and human whole blood does not express APOL1 A. Baboon APOL1 gene was amplified from genomic DNA of the samples as indicated using primers that amplifies a segment of exon 5 (longest exon). Amplification of baboon cDNA was done using the primers (exon4-exon5) flanking the intron. B. Human APOL1 was amplified from genomic DNA, cDNA, and no RT control using primer (exon 5). C. Orangutan genomic DNA and c-DNA from B cells were amplified using different primers as indicated. D. Genomic DNA amplification from Gibbon fibroblast sample.
! 39!
To test the expression of APOL1 in baboon fibroblast, we obtained genomic DNA as well as cDNA from the fibroblast cells. Liver that has been previously shown to express APOL1 was used as positive control. We found that genomic DNA is present in baboon fibroblast as seen by the PCR amplified band of expected size. However, cDNA prepared from fibroblast cells did not have APOL1 band of the expected size (Fig 10 A) despite the fact that liver had the band of right size. This suggests that baboon fibroblast does not express APOL1. Based on this data, we conclude that fibroblast do not express APOL1.
We also tested human whole blood for the expression of APOL1. We used genomic DNA extracted from blood or cDNA synthesized from mRNA using primer pairs HuAfwd (exon4), HuArev (exon5) flanking intron. We obtained expected band in our genomic DNA prepared from human whole blood
(Fig 10 B). However, we did not observe APOL1 band in our cDNA suggesting that whole blood cells do not express APOL1. We did not observe expression of APOL1 in any of these cells tested, although presence of the gene within genomic DNA was confirmed.
We also tested the presence of gene in orangutan B cells and gibbon fibroblast. Despite the presence of APOL1 gene in genomic DNA, We did not detect the expression of APOL1 in orangutan B cells. We do not know if orangutans express APOL1. There is a non-sense mutation at C862T in orangutan that leasds to early termination of APOL1 during translation. Therefore, it is possible that orangutan does not express the APOL1 gene. However, it is also possible that the gene is not expressed in B cells.
Based on the result from baboon sample, fibroblast does not express APOL1. Therefore, we did not look for the expression of APOL1 in gibbon fibroblast cDNA. Based on these results we conclude that whole blood and fibroblast does not express APOL1. It is possible that B cells do not express APOL1 as well. More experiments needs to be done to rule this out.
b. Effect of Primate APOL1 in natural dermal infection
Recently, our lab identified, sequenced and cloned baboon APOL1 cDNA from a liver sample, after necropsy. Although we could not obtain the APOL1 cDNA of other non-human primates, we have human APOL1 sequences (in silico) representative of hominoids and baboon APOL1 sequences
(cloned from liver cDNA) representative of OWMs. Therefore, we tested the effect of human and baboon TLF against L. major.
! 40!
I. Human TLF (G0) protects against L. major in natural dermal infection
Previously, human APOL1 (G0) was shown to ameliorate infection by L. major in a subcutaneous footpad infection infected with 1x106 or 5X105 metacyclic promastigotes [28]. However, in the natural sandfly bite, fewer parasites are injected intradermally in the skin [137, 138]. Therefore, we tested the effect of TLF on L. major in an intradermal ear infection murine model at two different doses: 104 and
106 metacyclic promastigotes per ear. We observed reduced parasite burden in the TLF expressing mice as compared to control mice in low parasite dose (104) but not in high parasite dose (106) (Fig
11). Sandflies inject 10-105 Leishmania intradermally into the skin; therefore we conclude that TLF ameliorates infection only when infected at low doses. We further extrapolate this result in human infections where higher number of parasites inoculum is possibly required for lesion formation.
A. Low Dose (104 per ear) B. High Dose (106 per ear)
1×106 1×109 TLF TLF Control ns 8 1×105 ** 1×10 Control
7 1×104 1×10 Leishmania per ear Leishmania per ear 1×106 1×103 TLF TLF Control Control Figure 11: TLF reduces parasite burden in low but not high dose L. major infection in murine ears Mice were transfected with plasmids containing APOL1 (G0) and HPR by hydrodynamic gene delivery (HGD). Expression of genes was confirmed by immunoblotting the mouse serum for proteins of interest using rabbit polyclonal anti-APOL1 antibody (Protein-tech) or rabbit polyclonal anti-Hp antibody (Sigma) (data not shown). Transfected mice expressing TLF with APOL1 G0 haplotype were infected in the ear with 104 or 106 ficol-purified metacyclics. Ears were harvested 15 days post infection and parasite burden was determined by limiting dilution assay. The data represents Mean ± SD of one typical experiment. Low dose infection has been repeated twice and the high dose infection was performed once. **p<0.001, ns-non significant, compared to saline (HGD) group, Student’s t test. n = 4 for each group (High dose control 3) in both experiments.
! 41!
II. Baboon TLF protects against cutaneous L. major.
Human APOL1 ameliorates infection by cutaneous strains L. major and L. amazonensis in the macrophage and in murine models of infection. Therefore, we hypothesize that APOL1 from non- human primates would also protect against cutaneous Leishmaniasis. To test our hypothesis, we first did macrophage infection with L. major in the presence of human/baboon HDL (TLF) and bovine
HDL/no HDL (control). We found fewer parasites in macrophages in 24 hours when incubated with human or baboon HDL as compared to the control groups (Fig 12) suggesting that baboon TLF kills L. major within macrophages. To confirm this in vitro result, we infected our C57Bl/6 germline transgenic mice-expressing baboon APOL1 or the germline transgenic mice transfected with baboon HPR (by
HGD) with L. major. Wild-type C57B6 mice were used as negative control. Likewise mice transfected with human APOL1: HPR dual plasmid that were previously shown to protect against L. major infection were used as positive control. As expected, the mice expressing baboon TLF i.e. both APOL1 and
HPR had significantly reduced parasite burden as compared to control mice suggesting that baboon
TLF ameliorates infection by cutaneous L. major. Mice expressing baboon APOL1 alone had no reduction in parasite burden at the site of infection indicating that APOL1 alone is not sufficient to protect against L. major infection (Fig 12). Although we do not know the reason for this, we have observed significantly smaller footpad lesion in mice expressing human APOL1 and HPR as compared to the control mice or the mice expressing either APOL1 or HPR alone. In addition, we have observed that haptoglobin inhibits TLF mediated killing of parasites in macrophages. Therefore, we conclude that HPR has vital role in TLF mediated protection against Leishmania sp. Likely by enhancing the uptake of TLF into infected macrophages.
! 42!
A. Macrophage infection
30 Human HDL
Baboon HDL 20 Bovine HDL No HDL
10 ** **
0
Parasites per 100 Macropghages
2 hours 24 hours
B. In vivo mice infection
1×106 ** ns **
1×105
1×104 Parasites per ear
1×103
Saline control
Baboon APOL1+HPRBaboon APOL1Human only APOL1+HPR
Figure 12: Baboon TLF ameliorates L. major infection in vivo Ficoll purified metacyclic promastigotes were used to infect A. 50,000 BMDM (MOI 3:1) in the presence of human, bovine or baboon HDL for 2 hrs. The macrophages were then incubated for 24 hours in the presence of the respective HDLs after washing away the non-infecting parasites. Parasites inside macrophages were counted after staining with DAPI under fluorescent microscope. The data represents Mean ± SD of one typical experiment repeated twice **p<0.001, ns-non significant, compared to saline (HGD) group, ANOVA test. B. Mice were infected with 10,000 parasites as indicated. The number of parasites per ear was estimated by real time PCR on day 15-post infection. The data represents Mean ± SD of one typical experiment repeated twice. **p<0.001 compared to saline (HGD) group, Mann-Whitney U test, Bonferroni Correction. n= Baboon APOL1+HPR (8), Baboon APOL1 (4), Human APOL1+HPR (7), and Saline (8).
! 43!
c. Effect of human APOL1 Haplotypes against Leishmania sp.
Human APOL1 is highly polymorphic with more than 16 haplotypes existing in different populations.
Some of these haplotypes show geographic specificity and marks of positive selection (Table 1). The out of Africa haplotype G4 overlaps with the distribution of Leishmania sp. (Fig 9 and Table 1) in the modern world. Here we tested the effect of five common haplotypes and named G0-G4 and tested the effect of these haplotypes against L. major to test if there is a molecular arms race between APOL1 and Leishmania sp.
III. Haplotypes G3 and G4 are lytic only to animal infective African Trypanosomes
Previously, we have shown that African haplotypes G1 and G2 were effective at protecting against both animal infective T. b. brucei and human infective T. b. rhodesiense in our mouse model [44].
Here we characterized the effect of G3 and G4 against animal and human infective African
Trypanosomes. Plasmid DNA with genes G3 and G4 were synthesized by Quick-change site directed mutagenesis of the plasmid carrying APOL1 G0 haplotypes. Next we tested the lytic ability of the newly synthesized proteins against animal infective T. b. brucei and human infective T. b. rhodesiense.
To test the effect of G3 and G4, we challenged the transfected mice expressing APOL1 haplotypes with T. b. brucei or human infective T. b. rhodesiense. We found both G3 and G4 like G0 protect against animal infective T. b. brucei (Fig 13). As expected, G3 and G4 that have mutations upstream of the SRA binding domain do not protect against T. b. rhodesiense (Fig 13).
! 44!
A. T. b. brucei B. T. b. rhodesienseSRA repeat 12/5/14 ALL GROUPS 100 G0 ns 100 saline G2 ** G0 *** G3 ns G3 *** G4 ns G4 ** 50 50 Percent survival Percent survival
0 0 5 10 15 20 25 0 0 5 10 15 20 Days Days
Figure 13: Human haplotypes G3 and G4 protects against animal infective T. b. brucei Mice were transfected with plasmid DNA containing different haplotypes by HGD. Two days after HGD when the protein expression is at peak, 5000 A. T. b. brucei were injected into n= Saline (6), G0 (7), G3 (4), and G4 (6) mice. The infection progression was observed by checking parasitemia in the mice which were euthanized at 109 parasites/ml. The data represents survival curve of one typical experiment that has been repeated twice. ***p<0.0001 and **p<0.001 compared to saline (HGD) group, Log-rank Test. B. T. b. rhodesiense were injected into n= 5 mice per group. Mice were then observed for parasitemia and euthanized at 109 parasites/ml. The data represents survival curve of one typical experiment that has been repeated twice. **p<0.001 and ns- non-significant compared to saline (HGD) group, Log-rank Test
IV. Effect of human APOL1 haplotypes on L. major infection
Next we tested the effect of TLF containing these major APOL1 haplotypes against L. major in HGD mice infected with ficoll purified metacyclics intradermally in their ears. Saline HGD mice were used as controls. Parasites were counted by harvesting ears 15 days post infection. Ears were then digested and parasites were counted by limiting dilution assay as described elsewhere [139, 140]. We found that mice expressing TLF with APOL1 haplotypes G0, G2, G3 and G4 had fewer parasites as compared to saline mice. The reduction in the parasite number is significant for all of these haplotypes when analyzed by Mann Whitney U test with out the correction for standard error due to multiple pairwise tests. However, upon applying the bonferroni correction, only G3 and G4 had significant reduction in parasite burden. Haplotype G1 had similar number of Leishmania as the saline mice. We do not know the reason for lack of efficacy of G1 in killing the Leishmania parasites. However, four other haplotypes were protective against infection by L. major (Fig 14). Haplotype G1 is lytic to human infective T. b. rhodesiense and is toxic to mammalian cells when expressed from the cells. It has been shown to be associated with chronic kidney diseases in humans [84]. Given its toxicity to other cells, it
! 45!
was surprising that G1 was not lytic to L. major in our HGD mice. Therefore, we looked at the expression of APOL1 in mice expressing G0 or G1 at different times to see if there is difference in expression of the gene due to the toxicity of G1 to the cells that have been transfected with the G1 plasmid. Infact, we observed difference in protein level in G1 compared to G0 mice (Fig 15).
ns 1000 Saline ns ns G0 100 ** ** G1 G2
10 G3 G4
Leishmania per ear 1
G0 G1 G2 G3 G4 Saline
Figure 14: Most APOL1 haplotypes ameliorate an intradermal L. major infection in the ear Mice were transfected with plasmids containing APOL1 haplotypes and HPR by hydrodynamic gene delivery (HGD). Expression of genes was confirmed by immunoblotting the mouse serum for proteins of interest using rabbit polyclonal anti-APOL1 antibody (Protein-tech) or rabbit polyclonal anti-Hp antibody (Sigma). Transfected mice expressing TLF with different APOL1 haplotypes were infected in the ear with 104 ficol-purified metacyclics. Ears were harvested 15 days post infection and parasite burden was determined by limiting dilution assay. The data represents Mean ± SD of one typical experiment that has been repeated twice. **p<0.001 compared to saline group, Mann-Whitney U test with Bonferroni correction. n= Saline (4), G0 p= 0.028 (4), G1 (6), G2 (6), G3 (4), and G4 p= 0.010 (6).
Figure 15: Comparision of expression level of G0 and G1 in HGD mice Blood was collected from mice tail by tail bleeding on different days. The serum was separated using heparinized serum separator. The serum was serially diluted starting at 1:40 dilution and detected by western blot, using anti-APOL1 antibody (Protein-tech).
! 46!
DISCUSSION
Our results show that APOL1 is not expressed in blood cells, B cells and fibroblasts (Fig 10). This is in agreement with the data from Serial Analysis of Gene Expression (SAGE) and the original paper that reported the expression of APOL1 in only some specific cells and tissues [135, 136]. Our results thus dispute the results of mRNA expression of APOL1 in these tissues as reported based on microarray and RNA Seq [136]. Our original aim was to use the cell lines to evaluate the expression of APOL1 in various non-human primates, however because the cell lines from primates that we know have circulating APOL1 within their blood are negative for APOL1 expression this approach was stopped.
We continued our analyses with baboon APOL1 and human variants of APOL1.
Previously we have looked at the effect of TLF against L. major in subcutaneous infection [28], because this is the common method used in the field of Leishmania research. Like in subcutaneous infection, TLF ameliorates infection by L. major in a more natural intradermal infection (as delivered by a sandfly) in a dose dependent manner (Fig 11). We observed an effect of TLF on low but not high parasite dose. This could be possible due to limited availability of TLF to kill intracellular Leishmania as TLF acts against the parasites in dose dependent manner [28]. In fact, the difference in fate of infection due to difference in cellular infiltration and cytokine production in low vs high dose has been previously described [105, 141]. The interplay between parasite dose, TLF and other immune components however, is yet to be investigated.
Our results show that baboon TLF, like human TLF ameliorates infection due to L. major (Fig 12). This was anticipated as baboon TLF has been found to be lytic to wider range African Trypanosomes indicating its broad-spectrum activity [44, 73, 80]. Baboon APOL1 alone did not reduce parasites number comparable to APOL1 and HPR together in mice suggesting an important role of HPR in this
TLF mediated protection against Leishmania sp. This is in agreement with previous data, where
APOA1, HPR and APOL1 needed to be expressed in mice to get maximum protection against African
Trypanosomes [80]. This result suggests that the assembly of the whole TLF particle is necessary for the activity of TLF against Leishmania. Similar results were observed for human TLF as well where mice expressing both HPR and APOL1 had smaller Leishmania lesions as compared to the groups expressing either protein [28]. We do not know the function of HPR with relation to Leishmania
! 47!
infection. The fact that haptoglobin can inhibit the effect of TLF in macrophage [28] implies that it may play role in receptor mediated uptake of TLF in immune cells such as macrophages.
Our result shows that primate and human TLF are effective at reducing L. major in mice. Based on this result we extrapolate that TLF is an innate immune factor against the parasite. However, humans get infected with Leishmania even though we have TLF in our blood. Similarly in our mice experiment, we have observed that the parasites persist in TLF mice although there is some reduction in parasite burden. This suggests that parasites although are killed by TLF, are successful at evading the host immune system to establish the infection. We have observed that parasite infectivity dose can govern the disease outcome (Fig 11). Therefore, it is possible that high dose inoculation of parasite in humans lead to successful establishment of infection as compared to the low dose inoculation. Alternatively, the inoculum dose of parasite may govern the disease pathogenicity and the timing of lesion development.
Finally, we found that most of the human APOL1 haplotypes were effective at ameliorating infection by
L. major. We found that G1, which kills human infective African Trypanosomes, did not reduce the parasite burden in L. major infection in mice (Fig 14). This result is surprising given that G1 kills broader range of African Trypanosomes and has higher toxicity to mammalian cells [84]. However, we have observed approximately two fold decrease in expression of G1 as compared to G0 in the HGD mice which may be due to toxicity of G1 to the cells expressing it (Fig 15). We know the effect of TLF is dependent on its dose [28]. Hence, the lack of effect of G1 against L. major may be due to the lower level of proteins in the HGD mice. Based on the haplotype results, we cannot conclude if G4 was selected against Leishmania sp.
! 48!
PART II- MECHANISM OF TLF MEDIATED KILLING OF LEISHMANIA SP.
RESULTS
Previously we have shown that TLF ameliorates infection in macrophages. Microscopic examination using Alexa labeled TLF show that TLF and Leishmania colocalize in the parasitophorous vacuole of macrophages. Co-incubation of parasites with TLF shows reduced infectivity of parasites in acidic pH
(5.3) but not at neutral pH (7.4) confirming that this TLF mediated lysis occurs within phagosome where TLF encounters the parasite at acidic pH (the parasitophorous vacuole) [28]. However, we do not know the activity of TLF against parasites in neutrophils the first cells to phagocytose the metacyclic promastigotes in the body after a sandfly bite [106]. Considering that metacyclic promastigotes of Leishmania sp. are phagocytosed into neutrophil phagosomes, we hypothesize that
TLFs lyse parasites in neutrophil phagosomes. However, mouse experiments using a neutrophil depletion strategy have shown that depletion of neutrophils in mice leads to a reduction in parasite burden at the site of infection [106, 108, 109]. Moreover, in vitro infection of murine neutrophils shows evidence of lodging of parasites into phagosomes of lysosomal and endoplasmic reticular (ER) origin.
The parasites in phagosomes with ER markers evade neutrophil mediated lysis [120]. Hence, it is assumed that these compartments are not acidic, which forms the basis of the argument for neutrophils being a safe harbor for the parasites.
The effect of TLF is limited by the conversion of parasites to amastigotes because amastigotes of L. amazonensis are resistant to TLF activity. We do not know the reason for this resistance of amastigotes to TLF activity. We know that amastigotes are TLF resistant and are able to divide and proliferate in this stage. It is likely that the difference in TLF activity against Leishmania life cycle stages is accountable for the difference in disease outcome. As such proliferating amastigote forms of
L. infantum and L. donovani may be resistant to TLF. Although effect of neither TLF nor APOL1 has been tested, previous data suggests that APOL1 may protect against more virulent form of leishmaniasis by L. donovani and L. infantum. For example, linkage analysis has shown D22S280 at chromosome locus 22q12.3 is responsible for susceptibility to visceral leishmaniasis by L. donovani
[142]. This locus is very close to the APOL1 gene locus. Likewise, increased HDL level confers
! 49!
resistance to infection by L. infantum in humans [22]. Hence it is possible that like L. major, TLF kills the metacyclic promastigotes of visceral Leishmania strains.
Here we attempted to answer some of these unanswered questions by testing the effect of neutrophil depletion on TLF activity and investigating possible mechanism of TLF activity against the parasites.
We also tested the effect of TLF against the more virulent L. infantum.
1. TLF kills Leishmania sp. within neutrophils
To test the effect of neutrophils on TLF activity, we adopted a neutrophil depletion strategy using the depleting antibody 1A8 in our transient TLF transgenic mice (transfected by HGD). First we checked the effect of HGD on blood neutrophils. We collected blood from our HGD or control mouse (no HGD) and stained the cells with anti-CD11b, anti-Ly6C and anti-Gr-1 (Ly6G) (1A8). Gating strategy for cells is shown in figure 16. We found that our HDG mice had a higher frequency of neutrophils in blood as compared to our control mice (Fig 17).
! 50!
A. Dot plot murine blood and ear
! Ly6GLy6C ! (1A8) ! Ly6G ! Ly6GLy6C
Figure 16: Gating strategy to identify neutrophils in mouse blood and ear A. Murine blood (50ul) was collected by tail bleeding, B. Murine ears were collected 12 hours after injection of (1x106 metacyclic promastigotes) and processed as described in methods. The blood/ear cells were stained with anti-mouse CD11b PE, anti-mouse GR-1 (antiLy6G) FITC, and anti Ly6-C APC and measured by Flow cytometry in BD FACSCalibur™. Total cells were then sorted for CD11b+ cells. CD11b+ lineage cells were then divided into sub-populations. Neutrophils are identified as the CD11b+Ly6G+Ly6C+ subpopulation (when depletion was performed with 1A8 antibody) otherwise CD11b+Ly6G+ (1A8) subpopulation.
! 51!
Figure 17: HGD mice have high neutrophil recruitment in blood Mouse blood was collected from the tail vein two hours post HGD. Neutrophil frequency in mouse blood was measured by staining with fluorescent antibodies followed by flow cytometry as described above in Fig. 14 Frequency of neutrophils (CD11b+Ly6G+(Ab1A8)Ly6C+) increases due to A. HGD as compared to B. No HGD mouse control. n= 1 mice per group.
Next, we looked at the effect of neutrophils in TLF mediated immunity against Leishmania sp. We depleted neutrophils in mice by intraperitoneal injection of 1mg anti-mouse Ly6-G 1A8 antibody 6 hours post HGD (24 hours before infection). Isotype IgG antibody was injected as control. Since we used 1A8 antibody for depleting the neutrophils, we used a different antibody RB6-8C5 (Ly6-G Ly6-C) for identifying the neutrophil population (Fig 16). This is done to make sure the depletion we observed is not due to masking by the 1A8 antibody. At 1mg antibody concentration of 1A8, although neutrophil depletion in blood is not complete (Fig. 18 A and C), we got good reduction in the number of neutrophils in ear (site of infection) (Fig. 18 B). Incomplete neutrophil depletion may be due to the increased neutrophil frequency in our HGD mice. In addition, 1A8 antibody is not very efficient at depleting neutrophil especially in blood [108]. Despite these limitations, 1A8 is the most specific antibody available for the depletion of neutrophils at the moment [108, 143]. We used saline HGD mice injected with 1A8 or IgG isotype as controls. Neutrophil depletion at the time of ear infection was approximately 60% in blood (Fig. 18A). Twelve hours post infection (36 hours post initiation of neutrophil depletion) the neutrophil depletion was still 70% in the ear (Fig. 18B). As expected, there was a reduction in parasite burden (ear) in the saline HGD neutrophil depleted group when compared to the IgG isotype control (Fig. 18D). We see a reduced parasite burden in TLF expressing mice in the
! 52!
presence of neutrophils suggesting that TLF act against L. major. However, the parasite burden increases when neutrophil is depleted from TLF expressing mice (Fig 18D). The number of parasites in our neutrophil depleted TLF mice was comparable to that of the neutrophil depleted saline mice suggesting that the increase in parasite number is not merely due to the effect of antibody. However, increase in the number of parasites in the neutrophil depleted TLF mice and the equivalent number in the neutrophil depleted saline mice suggests that some parasites evade TLF lysis as well as complement-mediated lysis in these mice and successfully establish infection. Since Leishmania are intracellular parasites, the most likely explanation for this result is that these parasites possibly infect some other cells in the absence of neutrophils. Previous results done in neutrophil depleted mice using 1A8 antibody suggest that most of the parasites do not infect other immune cells such as Ly6Chi monocytes, Ly6C low macrophages and dendritic cells in the absence of neutrophils [108]. Therefore, there may be other immune cells that are phagocytizing the parasites in the absence of neutrophils where they are not affected by TLF. We know TLF activity against Leishmania is dependent on the concentration of TLF [28, 128]. The abundance of TLF is approximately 10 times lower in interstitial tissue fluids as compared to plasma level[144]. Therefore, it is likely that L. major is taken up by tissue resident immune cells upon depletion of neutrophils by 1A8 antibody. This would explain the survival of the parasites in our TLF expressing mice in the absence of neutrophils. Nevertheless, our result shows that TLF kills L. major in immune cells such as neutrophils. Thus TLF and neutrophils synergize to ameliorate infection by cutaneous L. major.
! 53!
A. Neutrophil depletion in blood
Isotype 1A8 isotype…CD11b+ 1A8…CD11b+
104 104 11.6 64.2 5.82 22.3
103 103 ! 2 2 1 10 10 S Gr FL1-H: NS FITC FL1-H: NS FITC
101 101
19.8 4.34 52.4 19.4 100 100 100 101 102 103 104 100 101 102 103 104 FL4-H: NS APC FL4-H: NS APC
Ly6SC!
B. Neutrophil depletion in ear (site of infection) Isotype 1A8 isotype left…CD11b+ 1A8 Left…CD11b+ 4 10 104 0.98 63.8 1.18 17.1
3 10 103
! 1
S 2 10 102
Gr FL1-H: NS FITC
FL1-H: NS FITC 1 10 101
0 22.5 12.8 44 37.7 10 100 0 1 2 3 4 10 10 10 10 10 100 101 102 103 104 FL4-H: NS APC FL4-H: NS APC
LyS6C!
C. Neutrophil frequency D. Parasite burden in ear (Day 15)
80 106 ns *
60 105
40 ** 104 20 Parasites per ear
Neutrophil frequency 103 0
IgG 1A8 TLF/1A8 Saline/1A8 TLF/Isotype Saline / Isotype
! 54!
! ! ! Figure 18: Neutrophils and TLF synergize to ameliorate Neutrophils were depleted in mice using 1mg anti-mouse Ly6-G 1A8 antibody or an isotype control 6 hours post-HGD. Neutrophil counts were assayed 24 hours post-depletion by collecting blood from the tail, staining for indicated surface markers and, analyzing by flow cytometry. Representative dot plots and gating strategy for A. blood from mice injected with 1A8 or isotype antibody at the time of infection (+/-30 min) B. ears from mice injected with 1A8 or isotype antibody 12 hours post-infection with L. major. C. The bar graph depicts total number of neutrophils (CD11b+Ly6G+Ly6C+) in blood after FACS in neutrophil depleted 1A8 antibody (grey bar) or isotype antibody controls (black bar) at the time of infection. ,**p< 0.001 student t test. D. Number of parasites quantified by real time PCR in mouse ears harvested 15 days post-infection. The data represents Mean ± standard deviation (SD) of one typical experiment that has been repeated twice. ns= non-significant and *p<0.05 Mann- Whitney U test. n = 4 in each group.
! 55!
2. TLF rapidly lyses metacyclic promastigotes when released from neutrophils
Based on the results from macrophage and in vitro experiments [28], we hypothesize that the synergism between TLF and neutrophils happens in the neutrophil phagosome where TLF has the potential to directly interact with the parasites. Previously, we have shown that a 24-hour incubation of
TLF with parasites in acidic media (pH 5.3) reduces the infectivity of the treated parasites for macrophages. The survivor parasites will transform into amastigotes and begin to divide by 72 hours.
In contrast to macrophages, which live for 6-16 days neutrophils are short-lived cells that live for 5-90 hours and do not support the growth of amastigotes [145]; furthermore infected neutrophils isolated from murine ears were found to release approximately 30% of the metacyclic promastigotes within 4-5 hours [107]. Therefore, we hypothesized that there is an alternate pathway for the rapid killing of
Leishmania in neutrophils.
The fate of the metacyclic promastigotes invading neutrophils with respect to pH is to go from neutral pH (extracellular milieu) to slightly acidic pH in the phagosome to neutral pH in the extracellular pH
(upon being released from the neutrophils). We mimicked this in in vitro where we co-incubated parasites with human HDL (which has TLF) or bovine HDL (negative control) in acidic media pH 5.6 to mimic the phagosome for an hour followed by neutralization (to pH7 to mimic extracellular milieu). The one-hour incubation in acidic media theoretically allows APOL1 to become membrane associated. We have observed that it takes approximately an hour for APOL1 to become membrane associated in a bilayer experiment using physiological salt concentrations. Also longer incubations in acidic media cause the parasite to begin a differentiation program into amastigotes. Parasites co-incubated with human HDL (TLF) or bovine HDL (no TLF) in neutral media for 3 hours were used as our control.
Survivor parasites were evaluated after removing extracellular HDL (3 washes in PBS) by allowing them to infect 50,000 macrophages assuming that only live parasites are capable of infecting macrophages. Therefore, lower infection rates would be indicative of a diminished number of healthy parasites due to TLF-mediated damage during the acid primed assay (pH 5.6 followed by pH 7). We observe a significant reduction in the number of parasites per 100 macrophages in acid primed L. amazonensis co-incubated with Human HDL (TLF) but not with bovine HDL (no TLF) (Fig 19A). These data suggest that TLF induces damage in metacyclic promastigotes of Leishmania sp. that initiates in
! 56!
the acidic phagosome. This damage is Human HDL specific, as we do not see such decrease in parasite infectivity in the presence of bovine HDL. However, macrophage infection assay did not address if the reduced infectivity is due to direct interaction of TLF with parasite leading to lysis as in the case of African Trypanosomes. Another caveat of the assay was long incubation in neutral pH (2 hours neutralization plus an hour infection =3 hours). Therefore, the infectivity reflected the death of parasites in 4 hours. We were interested to test how early can we observe this TLF mediated damage to test if parasite would be damaged when released from neutrophils in an hour. To test if TLF directly lyse the parasites, and to determine the earliest time this lysis can happen, we counted the intact parasites using hemocytometer an hour after neutralization (Fig 19 B). As expected, we observed reduction in parasite number in presence of human HDL (TLF) but not bovine HDL in the acid primed condition but not in acidic media only (pH5.6) or neutral media only (pH7.4). This difference in parasite count is not statistically significant. However, we see a significant reduction in the parasite infectivity when acid primed in the presence of human HDL (TLF) as compared to the bovine HDL control (Fig
19 A & B). It could be due to the fact that longer incubation is necessary after priming in acid to get a significant difference in parasite number. Alternatively, it could be that some of the parasites are damaged but yet not lysed, which may decrease the number of parasites in macrophages due to decreased phagocytosis or survival of the damaged Leishmania in the macrophages. Based on these observations, we extrapolate that TLF rapidly lyses metacyclic promastigotes of L. amazonensis upon being released from neutrophil phagosome due to acid priming. Hence we conclude that neutrophils are essential for TLF mediated protection of Leishmania.
3. TLF rapidly lyses metacyclic promastigotes in parasitophorous vacuole
The fate of parasites in macrophages is different than in neutrophils as metacyclic promastigotes in the macrophage phagosome ultimately transform to amastigotes in the acidic parasitophorous vacuole during phagosomal maturation. Although we do not know the pH of phagosome harboring metacyclic promastigotes, the pH of macrophage parasitophorous vacuole harboring L. amazonensis amastigotes can be as low as 4.8 [146]. To study if TLF mediated rapid killing happens in the parasitophorous vacuole, we mimicked the parasites natural fate during the maturation of the parasitophorous vacuole by vATPase delivered by endosomes, which pumps H+ into the vacuole. We
! 57!
subjected the metacyclic promastigotes to gradual acidification in the presence of human HDL. Human
HDL or bovine HDL was added to parasites in neutral media (mimicking the extracellular environment) followed by acidification to an initial phagosomal pH 5.6 [147]. Parasites were incubated for 1 hour at pH 5.6 to allow the insertion of APOL1 into the parasite membrane followed by a second acidification to mimic parasitophorous vacuolar maturation (pH4.5) [146]. To assess the number of parasites alive, we could not perform a macrophage infection assay, because the macrophages did not survive the acidic pH incubation and if we neutralized the media prior to infecting the macrophages we would perform an acid prime experiment as above. Therefore, we used the microscopic count as the measure to assess the number of intact parasites after 1-hour incubation at pH 4.5 (Fig 19 B). We observed complete lysis of parasites after an hour of incubation at pH 4.5 in the presence of lytic human HDL (TLF), which is not observed in neutral pH or pH 5.6 incubation with Human or bovine
HDL (Fig 19 A & B). This result implies that TLF lyse the parasites in acidic parasitophorous vacuole due to gradual decrease in pH during phagosomal maturation.
A. Macrophage Infection B. Percent lysis in 2 hours ** 100 Human HDL ns Human HDL 80 Bovine HDL 150 ** Bovine HDL 60 100 ns ns
% lysis 40
50 20
0 0 N N A AP AA AN Parasites per 100 Macrophages Figure 19: Metacyclic promastigotes are lysed upon acid priming Ficoll purified metacyclic promastigotes of L. amazonensis were treated with human or bovine HDL and incubated at different conditions, A. N- pH 7.4 for 3 hrs, AP- 1h at pH 5.6 an 2 hrs at pH 7. Parasites were washed and opsonized to infect 50,000 BMDM for 1 h. Parasites per macrophages counted by DAPI staining under fluorescent microscope. B. N-pH 7 for 2 hrs, A- pH 5.6 for 2 hrs, AA- pH 5.6 1 hr and 4.5 1 hr, AP- pH 5.6 1 hr followed by pH 7 1 hr. Parasites were microscopically counted using hemocytometer. The data represents Mean ± standard deviation (SD) of one typical experiment that has been repeated three times. **p<0.001, ns- not significant, ANOVA.
! 58!
3. Amastigotes are resistant to TLF mediated lysis
Previously, we have shown that TLF does not reduce the infectivity of amastigote forms of the cutaneous strain L. amazonensis when incubated in acidic media (pH5.3) for 24 hours implying that amastigotes are resistant to slow lysis by TLF. Here we tested if amastigotes are resistant to rapid lysis by TLF. To test this, we incubated axenic amastigotes of L. amazonensis with human or bovine
HDL at pH 5.6 for an hour (to mimick the phagosome) followed by neutralization (acid primed) or further acidification to pH 4.5 (gradual acidification, to mimick maturation to the phagolysosome). We did not observe any difference in parasite count/ lysis in the presence of human or bovine HDL in both acid priming and gradual acidification conditions confirming that amastigotes are resistant to TLF activity (Fig 20).
Number of intact parasites
100 Human HDL
80 Bovine HDL
60
% lysis 40 ns ns ns ns 20
0 N A AA AN
Figure 20: Amastigotes are resistant to TLF activity Ficoll purified metacyclic promastigotes of L. amazonensis were treated with human or bovine HDL and incubated at different conditions as indicated. Parasites were microscopically counted using hemocytometer. Legends N-pH 7 for 2 hrs, A- pH 5.6 for 2 hrs, AA- pH 5.6 1 hr and 4.5 1 hr, AP- pH 5.6 1 hr followed by pH 7 1 hr. Parasites were microscopically counted using hemocytometer. The data represents Mean ± standard deviation (SD) of one typical experiment that has been repeated two times. ns- not significant, as compared to bovine HDL treatment under same conditions. ANOVA.
4. Visceral strains L. infantum and L. donovani are resistant to TLF activity
Our result shows that the non-dividing metacyclic promastigotes of two cutaneous strains of
Leishmania, L. major and L. amazonensis are lysed by TLF. In contrast, the dividing amastigotes that establish disease are resistant to TLF activity. Therefore, we looked at the effect of TLF against the more virulent strains of Leishmania that can proliferate in the body beyond the site of infection to understand if susceptibility of parasites to TLF plays a role in the outcome of infection. Our hypothesis
! 59!
was that more virulent strains like L. infantum and L. donovani are TLF resistant and hence can proliferate beyond the site of infection. To test effect of TLF on parasites in vitro, we infected primary bone marrow derived mouse macrophages with ficoll purified infective metacyclic promastigotes (MOI
3:1) of the respective parasites in the presence of human HDL (TLF), bovine HDL (no TLF) or no HDL
(control). Parasites were counted using a fluorescent microscope after staining the slides with fluorescent nuclear stain. We did not see a significant difference in the number of parasites per 100 macrophages counted when incubated with human HDL, bovine HDL or no HDL controls at different time points suggesting that visceral strains of Leishmania are resistant to TLF activity (Fig 21 A). The decrease in parasite burden observed at 48 hrs in L. infantum in bovine HDL (Fig 21 A) is not due to
TLF, as bovine HDL does not have TLF.
In the L. donovani macrophage assay we observed a constant decrease in parasites numbers in macrophages over time (Fig 21 B). Given that L. donovani is very virulent parasite, we suspected the death of macrophages due to parasite growth that may lead to fewer parasites being counted. To test if there is macrophage death due to parasites, we performed Lactate Dehydrogenase (LDH) assay.
Lactate Dehydrogenase is a cytosolic enzyme present in macrophages but not parasites. Therefore, if there is cellular damage or death, this enzyme will be released on to the media. We tested the release of LDH in macrophages infected by both L. infantum and L. donovani. We observed a significantly higher LDH titer in L. donovani as compared to L. infantum within 24 hours (Fig 21 C). Thus we found that L. donovani has a complex tropism in which it successfully kills the host cells to possibly infect new one. This phenomenon possibly allows for the pathogen to successfully proliferate to visceral organs like spleen and liver to cause visceral leishmaniasis. We speculated that this might complicate and make it to discern the role of TLF in parasite proliferation in L. donovani. Therefore, we decided to first understand the effect of TLF in L. infantum and use that knowledge to later revisit L. donovani.
! 60!
A. L. infantum macrophage assay B. L. donovani macrophage assay Human HDL Human HDL 150 Bovine HDL 150 Bovine HDL No HDL No HDL
100 100
50 50
0 0 Parasites per 100 Macropghages 100 per Parasites Parasites per 100 Macropghages 100 per Parasites
2 hours 2 hours 24 hours 48 hours 24 hours 48 hours C. Lactate Dehydrogenase Assay
150 Human HDL *** Bovine HDL 100 No HDL *
50 % cytotoxicity
0
! DonovaniInfantum DonovaniInfantum DonovaniInfantum ! Figure 21: Visceral strains are resistant to TLF activity in macrophages Ficoll purified metacyclic promastigotes of A. L. infantum and B. L. donovani,were opsonized and used to infect 50,000 macrophages MOI (3:1) in the presence of human, bovine or no HDL. After 2 hrs infections, the unphagocytosed parasites were washed off and the infected macrophages incubated the in respective media with or without HDL for 24 or 48 hours changing media every 24 hours. C. The media of each experimental condition were collected at 24 hrs and the concentration of LDH was estimated. The data represents Mean ± standard deviation (SD) of one typical experiment that has been repeated three times, twice for LDH. *p<0.005, ***p<0.0001, ANOVA.
To understand if this TLF mediated resistance is due to the ability of parasite to evade lysis by TLF, we performed the acid priming and gradual acidification experiments using L. infantum. The ficoll- purified metacyclic promastigotes parasites were treated with human or bovine HDL in acidic media
(pH 5.6) for one hour. The parasites were either neutralized (pH 7.4) or further acidified (pH 4.5) and incubated for 1 more hour. Parasites incubated in neutral media (pH7.4) for 2 hrs were used as a control. We did not see a significant difference in the number of parasites between lytic human HDL treatments when compared to bovine HDL treatment (Fig. 22).
! 61!
L. infantum in vitro assay
100 Human HDL 80 Bovine HDL
60
40
20 ns ns ns ns
0 N A AA AN
Figure 22: L. infantum is resistant to TLF activity in vitro Ficoll purified metacyclic promastigotes of L. infantum were incubated with human HDL (TLF) or bovine HDL as indicated. Parasites were microscopically counted using hemocytometer. The data represents Mean ± standard deviation (SD) of one typical experiment that has been repeated twice. ns-non significant, ANOVA.
To determine the relevance of our macrophage infection and in vitro result, we tested the effect of TLF on the visceral strain L. infantum in vivo in our transiently transgenic mice created by HGD injection of plasmid DNA encoding the APOL1 and HPR genes. One day after HGD, when the gene expression peaks, they were infected intradermally in the ear with 106 ficoll purified L. infantum metacyclics.
Disease burden was assessed by quantifying the number of parasites in the liver harvested 15 days post infection using qPCR as described elsewhere [132]. We saw no difference in the parasite burden in TLF or control mouse livers corroborating our in vitro result that L. infantum is resistant to TLF activity (Fig. 23).
! 62!
L. infantum in vivo ns 5000
4000
3000
2000
parasites/ g liver 1000
0
TLF Saline
Figure 23: TLF has no effect on L. infantum in vivo Mice were transfected with plasmid DNA containing APOL1 and HPR by HGD. A day post HGD, mice were infected with 106 metacyclic promastigotes per ear. Liver samples were harvested from mice 15 days post infection. The data represents Mean ± standard deviation (SD) of one typical experiment repeated twice. ns-non significant, compared to saline (HGD) group, ANOVA test. n = saline (2), TLF (4)
5. HDL binds to metacyclic promastigotes of L. infantum
Previously we have found that HDL binds to the TLF susceptible metacyclic promastigotes but not to resistant amastigotes of cutaneous Leishmania [128]. Like the amastigotes of cutaneous Leishmania
(Fig 20), we have found metacyclic promastigotes of visceral L. infantum to be resistant to TLF activity
(Fig. 21, 22 & 23). Therefore, we tested the binding of HDL to the metacyclic promastigotes of visceral
L. infantum. We incubated Alexa-488 labeled lytic HDL with the parasites and the fluorescent intensity of the parasites was measured to test if the HDL bound to the parasite. We used metacyclic promastigotes of L. major, to which HDL binds [128], as positive control. Metacyclic promastigotes of
L. infantum or L. major not treated with labeled HDL were used as background fluorescence controls.
We observed an increase in fluorescent intensity in the parasites co-incubated with labeled HDL as compared to the background control in both L. infantum and L. major (Fig. 24) suggesting that HDL binds to the metacyclics of these parasites. The fluorescence intensity of HDL coated L. major was however brighter as compared to that of L. infantum.
! 63!
HDL binding experiment
100
80
60
% of Max 40
20
0 100 101 102 103 104 FL1-H: FL1-Height Figure 24: HDL binds to metacyclic promastigote of L. infantum Metacyclic promastigotes of L. infantum (red) or L. major (blue) were incubated with alexa-488 labelled lytic HDL for 30 minutes on ice. L. infantum (black) or L. major (green) not treated with labeled HDL were used as background control. Free labeled HDL that did not bind to parasites were washed and the fluorescence was determined by flow cytometry using BD FACSCalliburTM.
The difference in fluorescence intensity between L. major and L. infantum metacylic promastigote may be due to the differences in the surface phosphoglycan structures between the two parasites, as the binding was conducted at 4oC.
6. Glycosylation deficient mutants are resistant to TLF activity
In our in vitro assays we have observed that TLF lysed parasites just by changing the pH of the media
(i.e. ostensibly mimicking the pH of parasites extracellular environment) coupled with the FACS data suggests that TLF binds and lyses the parasites without being endocytosed by the parasite. In addition, amastigotes of L. major and metacyclic promastigotes of L. infantum are resistant to TLF activity. One of the differences in the surface composition between TLF susceptible L. major metacyclics to TLF resistant L. infantum metacyclics or L. major amastigotes is the surface glycoproteins (Fig 25). The surface glycoproteins such as LPG and PPG are down regulated in all amastigotes when compared to metacyclics. Likewise, the surface glycoproteins of L. infantum are different to the surface glycoproteins of L. major metacyclics due to differences in glycosylation and
- the length of (6Galβ1,4-Manα1-PO4) core (Fig 25). Previously, we have tested effect of TLF on lpg1 mutants that lacks the LPG core galactofuranosyl transferase LPG1 and are specifically deficient in
! 64!
LPG synthesis (See Fig. 8 The structural representation of L. major proteoglycans-LPG, PPG and
GIPLs)[148]. We did not observe any difference in TLF activity against these mutants [149].
B
L. donovani procyclic
L. infantum procyclic
L. major procyclic
L. major metacyclic
Figure 25: Surface phosphoglycans in L. major metacyclic promastigotes and in mutants. A. The surface of lpg1- lakcs the surface PG, LPG (black box) that is other wise present in the WT metacyclics. The lpg5A-/lpg5B- lacks the golgi glycosylation enzymes LPG5A and LPG5B and therefore can not synthesize the PG repeats in the LPG and PPG (red box). Therefore, these strains have defective LPG and PPG. B. LPGs of different Leishmania sp. are different.
! 65!
Next we tested the effect of TLF on lpg5A- /lpg5B-. These mutants are deficient in two genes lpg5A and lpg5B and therefore cannot uptake UDP-Gal into the Golgi. These mutants are defective in the synthesis of proteoglycans such as LPG and PPG [99]. We found the lpg5A- /lpg5B- mutants were resistant to TLF activity in vitro, in macrophage infections and in vivo in mice (Fig. 26 A, C & D).
To confirm that deleting lpg5A and lpg5B genes results in TLF resistance, we performed macrophage infections, in vitro TLF killing assays, and in vivo ear infections with complemented lines lpg5A-/ lpg5B-
/+LPG5A+LPG5B [99]. Like the mutants lpg5A-/ lpg5B-, the complemented parasites were also resistant to TLF activity in macrophage infections or in vitro lysis assays as seen by an equal number of parasites in the presence of human or bovine HDL. (Fig. 26 B). This result was supported by an in vivo infection assay, where equal numbers of parasites were observed at the site of infection (ear) in both TLF expressing mice and the controls (Fig 26 D). We do not understand the reason for the resistance of lpg5A-/ lpg5B- /+LPG5A+LPG5B to the TLF activity despite gaining the glycosylation genes at this time. We evaluated the efficiency of the complementation. Western blot analysis of the surface glycoproteins revealed lower expression of surface glycoprotein (LPG) in the complimented parasite cell line when compared to the wild type metacyclics of L. major [149].
We also tested for the binding ability of the HDL to mutant surface. Our result shows that HDL binds to the metacyclics of WT as well as mutants WT L. major (Fig 27) suggesting that binding alone cannot determine the effect of TLF to the parasites (Fig 26 E).
! 66!
A. In vitro TLF killing assay (L. major)
- - - - lpg5A /lpg5Blpg5-/- lpg5A /lpg5B /+LPG5A+LPG5Blpg5+/-
100 100 Human HDL Human HDL 80 Bovine HDL 80 Bovine HDL
60 ns ns ns 60 ns ns
% lysis 40 ns % lysis 40 ns ns 20 20
0 0 N A N A AA AN AA AN B. L. major (WT) macrophage C. lpg5A-/lpg5B- macrophage ns 50 Human HDL ns 40 80 Bovine HDL 50 Human HDL 30 *** 40 Bovine HDL 60 ns 20 30 10 40 ns 20
parasites/100 macropahges 0 20 10 Parasites/100 Macrophages 0 parasites/100 macropahges 0 lpg5A-/lpg5B- lpg5A-/lpg5B-/ +LPG5A+LPG5B
Human HDL Bovine HDL lpg5A-/lpg5B- lpg5A-/lpg5B-/ D. In vivo +LPG5A+LPG5B
challenge E. Expression of LPG in WT and add backs
ns 300 Saline ns TLF 200
100 parasites per ear
0 -
- /lpg5B - /lpg5B/
lpg5A lpg5A +LPG5A+LPG5B
! 67!
Figure 26: Surface mutants are resistant to TLF activity A. Ficoll purified metacyclics of lpg5A-/lpg5B- or lpg5A-/lpg5B/+LPG5A+LPG5B were coincubated with lytic human HDL (TLF) or bovine HDL. N- Neutral for 2 hrs., A- 5.6 for 2 hrs., AA- 5.6 for 1 hr. followed by 4.5 for 1 hr., AP- 5.6 for 1 hour followed by 7.4 for 1 hr. Parasite numbers were determined by counting intact parasites under microscope using hemocytometer. The data represents Mean ± SD of duplicate cultures of one typical experiment that has been repeated twice, ns- non-significant compared to bovine HDL, ANOVA test. B. & C. Ficoll purified metacyclics of L. major (WT) or lpg5A- /lpg5B or lpg5A-/lpg5B/+LPG5A+LPG5B were used to infect macrophages in the presence of human HDL or bovine HDL. Parasites were counted in macrophages at 24 hours post infection. The data *** p<0.0001, and ns- non significant, compared to bovine HDL, ANOVA test. D. Mice transfected with plasmid DNA with APOLI:HPR plasmid or Saline (control) were infected with lpg5A-/lpg5B- & lpg5A- /lpg5B/+LPG5A+LPG5B in ear and parasite load were quantified by real time PCR 15 days post infection. The data represents Mean ± SD of one typical experiment repeated twice, ns- non-significant compared to control group, t-test. n = lpg5A-/lpg5B- : Saline (8), TLF (8); lpg5A- /lpg5B/+LPG5A+LPG5B : Saline (6), TLF (8). E. Whole cell extracts of 2.5x105 metacyclic proamstigotes of wild type L. major or lpg5A-/lpg5B-/ +LPG5A+LPG5B were prepared using lysis buffer. The extract was then serially diluted to compare the expression of LPG proteins, which was probed using anti-phosphoglycan antibody WIC 79.3 [150].
HDL binding assay
lpg5A-/lpg5B-/ A. L. major (WT) B. lpg5A-/lpg5B- C. +LPG5A+LPG5B
Figure 27: HDL binds to the metacyclics of both WT and mutants Labelled HDL was incubated with ficoll purified metacyclic of L. major (WT and lpg5A-/lpg5B-, lpg5A- /lpg5B-/ +LPG5A+LPG5B). Fluorescence intensity was measured after washes using flow cytometer. Parasites not treated with labeled HDL (red) were used as background control. HDL bound parasites are blue.
! 68!
DISCUSSION
Previously we have shown that TLF ameliorates the infection of cutaneous strains of Leishmania in macrophages and in mice [28]. Here we found that neutrophils act synergistically with TLF in reducing the parasite burden by L. major in mice (Fig 18). Given that TLF is an innate immunity factor that requires acidic pH for membrane association, we hypothesize that TLF associates with parasite membrane in the slightly acidic phagosome within the neutrophil; the TLF will eventually lyse metacyclic promastigotes due to change in pH when they are released into extracellular milieu or due to maturation of the phagosome to a fully acidified parasitophorus vacuole. In support of this hypothesis our in vitro results show that once TLF and the parasite come in contact with each other in an acidic media, the infectivity of the metacyclic parasites decreases upon neutralizing the parasite extracellular environment (Fig 19). Our result disputes the hypothesis “neutrophils are safe harbor for
Leishmania sp.”, which is proposed based on depletion experiments in murine model. Although murines are useful model animals to study many biological phenomena, they are evolutionarily different than humans. Infact, previous studies have found some difference in behavior between mouse and human neutrophils. For example, murine neutrophil phagosomes with Leishmania are positive for ER markers suggesting that the phagosomes are of ER origin or they somehow interacts with ER after infection [120]. This phenomenon is not observed in human neutrophils infected with
Leishmania sp. [151] Therefore, it is important to study the synergism between neutrophils and TLF using human neutrophils.
Likewise, TLF rapidly lyses metacyclics when the parasites are co-incubated with TLF in slightly acidic media (pH 5.6) for 1 hour followed by further acidification (Fig 19). There is no detectable damage to metacyclic parasites co-incubated with bovine HDL under the same conditions. The co-incubation of the metacyclic parasites with lytic HDL (TLF) in neutral pH conditions also shows no detectable damage. These data taken together suggest that TLF requires an acidic pH for anti-metacyclic parasite activity. Furthermore, once associated with parasites in the acidic environment, TLF can damage parasites whether they go to the parasitophorous vacuole or egress from cells (Fig 28). The effect of TLF was complete lysis upon gradual acidification to pH 4.5 (parasitophorous vacuole).
However, in macrophages or in mouse infections, we see some parasites always persisting
! 69!
suggesting that not all parasites are exposed to low pH, or they occupy a phagosome devoid of TLF, or they have a mechanism to resist TLF. Previous studies have suggested that the LPG of metacyclic promastigotes of Leishmania sp. inhibits the fusion of lysosomes to phagosomes containing parasites thereby delaying the formation of PV and acidification [116, 117, 119]. This inhibition of phagosomal acidification may be the parasites’ way of evading TLF activity because TLF resistant amastigotes reside in acidic PV [118].
Figure 28: Proposed Model for TLF mediated lysis of cutaneous Leishmania metacyclics Metacyclic promastigotes are phagocytosed by phagocytic cells such as neutrophils and macrophages. In the phagosomes, the TLF/APOL1 becomes integrated into parasites surface membrane. Upon change of pH due to release of parasites from neutrophils or due to maturation of phagosomes to an acidic pahgolysosome, the parasites are lysed.
Like amastigotes of L. amazonensis, metacyclics of visceral L. infantum and L. donovani are resistant to TLF activity (Fig. 19). Although both of the strains were resistant to TLF, we discovered that L. donovani infection would kill the host cells within 24 hours as measured by the release of Lactate dehydrogenase, a cytosolic enzyme of the infected macrophages (Fig. 21 C). The resistance to TLF by L. infantum does not require manipulation of the host environment by the parasites. We show that metacyclic promastigotes of L. infantum are resistant to lysis even when the parasites are incubated with TLF and subjected to acid priming or increasing acidification (Fig 22) suggesting that the visceral parasites are inherently resistant to TLF lysis. We observed similar resistance to TLF for the
! 70!
amastigotes of L. amazonensis (Fig. 20). Under these conditions, lytic human HDL lyses the metacyclics of L. amazonensis suggesting that metacylic promastigotes of cutaneous strains are susceptible while amastigotes are resistant to TLF activity. This suggests that transformation to the dividing amastiogte stage limits the TLF activity against cutaneous strains such as L. major and L. amazonensis. This demonstrates the importance of TLF as an innate immunity factor in Leishmania infection.
Finally, we have found that parasites deficient in golgi glycosylation enzymes that can not form phosphoglycan structure such as LPG and PPG were resistant to TLF activity (Fig. 26). We found lpg5A- /lpg5B- to be TLF resistant. This TLF resistance however, could not be restored in the complemented line lpg5A-/ lpg5B- /+LPG5A+LPG5B. We do not understand the reason for this discrepancy. It is possible that the glycosylation pattern of proteins govern the TLF susceptibility that is not restored completely in the add-back. In fact, we have found lower expression of LPG in the lpg5A-/ lpg5B- /+LPG5A+LPG5B as compared to the WT L. major (Fig 26 E), which could account for the resistance of the parasites to TLF activity.
! 71!
CONCLUSION
Our results confirm that TLF is an important innate immunity factor in Leishmania infection that can govern the fate of infection. Our result shows that TLF has evolved as a host immune factor to kill parasite in intracellular environment. At the same time, the parasites have evolved to overcome the
TLF activity and hence can eventually survive, divide and proliferate to cause disease pathogenesis.
Therefore, there appears to be a molecular arms race between the host immunity factor TLF where the factor attempts to kill Leishmania sp. in immune cells such as macrophages and neutrophils. On the other hand the parasite evades this TLF mediated lysis by transforming into amastigotes with different surface structures, which are then resistant to TLF.
! 72!
SUPPLEMENTARY MATERIALS
Infantum in vivo
Plate Well Sample Detector Ct Ct Mean Ct SD Comments
Name
Plate1 A1 liver10^5 minicircleDNA 24.668 24.706 0.053
Plate1 A2 liver10^5 minicircleDNA 24.743 24.706 0.053
Plate1 A3 liver10^5 beta-cat 35.849 36.147 0.422
Plate1 A4 liver10^5 beta-cat 36.446 36.147 0.422
Plate1 B1 liver10^4 minicircleDNA 24.557 24.468 0.125 STD Curve
Plate1 B2 liver10^4 minicircleDNA 24.380 24.468 0.125
Plate1 B3 liver10^4 beta-cat 34.077 35.089 1.431
Plate1 B4 liver10^4 beta-cat 36.101 35.089 1.431
Plate1 C1 liver10^3 minicircleDNA 27.049 27.027 0.031
Plate1 C2 liver10^3 minicircleDNA 27.005 27.027 0.031
Plate1 C3 liver10^3 beta-cat 35.253 35.126 0.179
Plate1 C4 liver10^3 beta-cat 34.999 35.126 0.179
Plate1 D1 liver10^2 minicircleDNA 30.771 30.761 0.014
Plate1 D2 liver10^2 minicircleDNA 30.751 30.761 0.014
Plate1 D3 liver10^2 beta-cat 34.591 34.559 0.045
Plate1 D4 liver10^2 beta-cat 34.528 34.559 0.045
Plate1 E1 liver10^1 minicircleDNA 33.353 33.453 0.141
Plate1 E2 liver10^1 minicircleDNA 33.553 33.453 0.141
Plate1 E3 liver10^1 beta-cat 34.621 34.988 0.519
Plate1 E4 liver10^1 beta-cat 35.356 34.988 0.519
Plate1 A5 Saline 0 minicircleDNA 34.477 34.398 0.111 whole-30mg
Plate1 A6 Saline 0 minicircleDNA 34.320 34.398 0.111 liver
Plate1 A7 Saline 0 beta-cat 35.690 35.421 0.380 suspended
! 73!
Plate1 A8 Saline 0 beta-cat 35.152 35.421 0.380 in 2ml trizol.
Plate1 B5 Saline 1 minicircleDNA 35.047 35.047 0.844 50ul of the
Plate1 B6 Saline 1 minicircleDNA 35.047 35.047 0.844 homogenate
Plate1 B7 Saline 1 beta-cat 36.345 36.345 0.791 was used to
Plate1 B8 Saline 1 beta-cat 36.345 36.345 0.791 obtain DNA.
Plate1 C5 TLF 0 minicircleDNA 34.007 33.634 0.527 10ng of the
Plate1 C6 TLF 0 minicircleDNA 33.262 33.634 0.527 DNA was
Plate1 C7 TLF 0 beta-cat 34.880 34.810 0.099 used as
Plate1 C8 TLF 0 beta-cat 34.740 34.810 0.099 template
Plate1 D5 TLF 1 minicircleDNA 32.249 31.978 0.383
Plate1 D6 TLF 1 minicircleDNA 31.707 31.978 0.383
Plate1 D7 TLF 1 beta-cat 34.609 34.869 0.367
Plate1 D8 TLF 1 beta-cat 35.128 34.869 0.367
Plate1 E5 TLF 2 minicircleDNA 33.793 34.393 0.849
Plate1 E6 TLF 2 minicircleDNA 34.994 34.393 0.849
Plate1 E7 TLF 2 beta-cat 35.238 37.196 2.770
Plate1 E8 TLF 2 beta-cat 39.155 37.196 2.770
Plate1 F5 TLF 3 minicircleDNA 34.032 34.261 0.324
Plate1 F6 TLF 3 minicircleDNA 34.490 34.261 0.324
Plate1 F7 TLF 3 beta-cat Undeter 38.800
mined
Plate1 F8 TLF 3 beta-cat 38.800 38.800
Plate 2 A1 liver10^5 minicircleDNA 24.615 24.699 0.119 Std Curve
Plate 2 A2 liver10^5 minicircleDNA 24.783 24.699 0.119
Plate 2 A3 liver10^5 beta-cat 36.304 36.802 0.703
Plate 2 A4 liver10^5 beta-cat 37.299 36.802 0.703
! 74!
Plate 2 B1 liver10^4 minicircleDNA 24.967 24.820 0.207
Plate 2 B2 liver10^4 minicircleDNA 24.674 24.820 0.207
Plate 2 B3 liver10^4 beta-cat 34.097 34.276 0.253
Plate 2 B4 liver10^4 beta-cat 34.455 34.276 0.253
Plate 2 C1 liver10^3 minicircleDNA 27.168 27.191 0.032
Plate 2 C2 liver10^3 minicircleDNA 27.214 27.191 0.032
Plate 2 C3 liver10^3 beta-cat 33.590 33.973 0.541
Plate 2 C4 liver10^3 beta-cat 34.355 33.973 0.541
Plate 2 D1 liver10^2 minicircleDNA 31.482 31.247 0.332
Plate 2 D2 liver10^2 minicircleDNA 31.012 31.247 0.332
Plate 2 D3 liver10^2 beta-cat 34.215 34.011 0.288
Plate 2 D4 liver10^2 beta-cat 33.807 34.011 0.288
Plate 2 E1 liver10^1 minicircleDNA 34.688 34.368 0.454
Plate 2 E2 liver10^1 minicircleDNA 34.047 34.368 0.454
Plate 2 E3 liver10^1 beta-cat 33.400 34.202 1.134
Plate 2 E4 liver10^1 beta-cat 35.004 34.202 1.134
Plate 2 A5 Saline 0 minicircleDNA 34.016 33.994 0.031 Remaining
Plate 2 A6 Saline 0 minicircleDNA 33.972 33.994 0.031 30 mg was
Plate 2 A7 Saline 0 beta-cat 34.645 34.472 0.245 suspended
Plate 2 A8 Saline 0 beta-cat 34.298 34.472 0.245 in 1ml trizol
Plate 2 B5 Saline 1 minicircleDNA 31.433 31.331 0.144 and 200ul of
Plate 2 B6 Saline 1 minicircleDNA 31.229 31.331 0.144 that was
Plate 2 B7 Saline 1 beta-cat 34.518 34.450 0.097 used for
Plate 2 B8 Saline 1 beta-cat 34.381 34.450 0.097 DNA
Plate 2 C5 Saline 2 minicircleDNA 34.582 34.896 0.444 preparation.
Plate 2 C6 Saline 2 minicircleDNA 35.210 34.896 0.444 10ug of DNA was Plate 2 C7 Saline 2 beta-cat 35.923 35.366 0.788
! 75!
loaded
Plate 2 C8 Saline 2 beta-cat 34.809 35.366 0.788
Plate 2 D5 TLF0 minicircleDNA 34.142 34.652 0.721
Plate 2 D6 TLF0 minicircleDNA 35.163 34.652 0.721
Plate 2 D7 TLF0 beta-cat 35.409 35.902 0.698
Plate 2 D8 TLF0 beta-cat 36.396 35.902 0.698
Plate 2 E5 TLF1 minicircleDNA 33.981 34.075 0.133
Plate 2 E6 TLF1 minicircleDNA 34.168 34.075 0.133
Plate 2 E7 TLF1 beta-cat 33.395 33.076 0.450
Plate 2 E8 TLF1 beta-cat 32.758 33.076 0.450
Plate 2 F5 TLF2 minicircleDNA 34.284 34.193 0.129
Plate 2 F6 TLF2 minicircleDNA 34.102 34.193 0.129
Plate 2 F7 TLF2 beta-cat 33.417 33.559 0.201
Plate 2 F8 TLF2 beta-cat 33.701 33.559 0.201
Plate 2 G5 TLF3 minicircleDNA 32.515 33.121 0.857
Plate 2 G6 TLF3 minicircleDNA 33.727 33.121 0.857
Plate 2 G7 TLF3 beta-cat 34.302 34.920 0.874
Plate 2 G8 TLF3 beta-cat 35.538 34.920 0.874
Neutrophil
depletion
Plate1 A1 EAR10^5 minicircleDNA 22.330 0.162
Plate1 A2 EAR10^5 minicircleDNA 22.558 0.162
Plate1 A3 EAR10^5 beta-cat 29.323 0.089
Plate1 A4 EAR10^5 beta-cat 29.449 0.089
Plate1 B1 EAR10^4 minicircleDNA 24.623 0.311 STD Curve
Plate1 B2 EAR10^4 minicircleDNA 24.184 0.311
! 76!
Plate1 B3 EAR10^4 beta-cat 28.795 0.020
Plate1 B4 EAR10^4 beta-cat 28.823 0.020
Plate1 C1 EAR10^3 minicircleDNA 28.043 0.037
Plate1 C2 EAR10^3 minicircleDNA 27.990 0.037
Plate1 C3 EAR10^3 beta-cat 28.784 0.102
Plate1 C4 EAR10^3 beta-cat 28.928 0.102
Plate1 D1 EAR10^2 minicircleDNA 31.881 0.113
Plate1 D2 EAR10^2 minicircleDNA 31.721 0.113
Plate1 D3 EAR10^2 beta-cat 29.662 0.101
Plate1 D4 EAR10^2 beta-cat 29.519 0.101
Plate1 E1 EAR10^1 minicircleDNA 34.609 0.752
Plate1 E2 EAR10^1 minicircleDNA 33.546 0.752
Plate1 E3 EAR10^1 beta-cat 29.748 0.388
Plate1 E4 EAR10^1 beta-cat 30.296 0.388
Plate1 F1 EAR ONLY minicircleDNA 35.119 0.388
Plate1 F2 EAR ONLY minicircleDNA 34.571 0.388
Plate1 F3 EAR ONLY beta-cat 28.938 0.161
Plate1 F4 EAR ONLY beta-cat 29.166 0.161
Plate2 F1 Saline/Isot minicircleDNA 33.215 33.042 0.245
ype
Plate2 F2 Saline/Isot minicircleDNA 32.869 33.042 0.245
ype
Plate2 F3 Saline/Isot beta-cat 38.753 38.753
ype
Plate2 F4 Saline/Isot beta-cat Undeter 38.753
ype mined
! 77!
Plate2 F5 Saline/Isot minicircleDNA 31.998 32.113 0.164 Ear
ype resuspende
Plate2 F6 Saline/Isot minicircleDNA 32.229 32.113 0.164 d in 1 ml
ype trizol. 200ul
Plate2 F7 Saline/Isot beta-cat Undeter 38.272 used to
ype mined obtain DNA.
Plate2 F8 Saline/Isot beta-cat 38.272 38.272 10ng per
ype sample
Plate2 G1 Saline/Isot minicircleDNA 31.685 31.611 0.104 ussed as
ype template
Plate2 G2 Saline/Isot minicircleDNA 31.538 31.611 0.104
ype
Plate2 G3 Saline/Isot beta-cat 37.049 37.539 0.692
ype
Plate2 G4 Saline/Isot beta-cat 38.028 37.539 0.692
ype
Plate2 G5 Saline/Isot minicircleDNA 31.713 31.805 0.130
ype
Plate2 G6 Saline/Isot minicircleDNA 31.898 31.805 0.130
ype
Plate2 G7 Saline/Isot beta-cat Undeter 38.718
ype mined
Plate2 G8 Saline/Isot beta-cat 38.718 38.718
ype
Plate2 A1 TLF/Isotyp minicircleDNA 32.993 33.268 0.389
e
Plate2 A2 TLF/Isotyp minicircleDNA 33.543 33.268 0.389
! 78!
e
Plate2 A3 TLF/Isotyp beta-cat 37.353 37.883 0.750
e
Plate2 A4 TLF/Isotyp beta-cat 38.414 37.883 0.750
e
Plate2 A5 TLF/Isotyp minicircleDNA 35.312 35.498 0.263
e
Plate2 A6 TLF/Isotyp minicircleDNA 35.684 35.498 0.263
e
Plate2 A7 TLF/Isotyp beta-cat 36.463 36.463
e
Plate2 A8 TLF/Isotyp beta-cat Undeter 36.463
e mined
Plate2 B1 TLF/Isotyp minicircleDNA 32.426 32.406 0.027
e
Plate2 B2 TLF/Isotyp minicircleDNA 32.387 32.406 0.027
e
Plate2 B3 TLF/Isotyp beta-cat 33.236 33.325 0.126
e
Plate2 B4 TLF/Isotyp beta-cat 33.414 33.325 0.126
e
Plate2 B5 TLF/Isotyp minicircleDNA 34.166 33.965 0.283
e
Plate2 B6 TLF/Isotyp minicircleDNA 33.765 33.965 0.283
e
Plate2 B7 TLF/Isotyp beta-cat 36.896 36.781 0.162
e
! 79!
Plate2 B8 TLF/Isotyp beta-cat 36.667 36.781 0.162
e
Plate2 C1 TLF/1A8 minicircleDNA 32.103 31.944 0.225
Plate2 C2 TLF/1A8 minicircleDNA 31.785 31.944 0.225
Plate2 C3 TLF/1A8 beta-cat 39.228 38.464 1.080
Plate2 C4 TLF/1A8 beta-cat 37.700 38.464 1.080
Plate2 C5 TLF/1A8 minicircleDNA 33.140 33.348 0.295
Plate2 C6 TLF/1A8 minicircleDNA 33.557 33.348 0.295
Plate2 C7 TLF/1A8 beta-cat 39.228 38.464 1.080
Plate2 C8 TLF/1A8 beta-cat 37.700 38.464 1.080
Plate2 H1 TLF/1A8 minicircleDNA 32.726 32.742 0.023
Plate2 H2 TLF/1A8 minicircleDNA 32.758 32.742 0.023
Plate2 H3 TLF/1A8 beta-cat Undeter 38.401
mined
Plate2 H4 TLF/1A8 beta-cat 38.401 38.401
Plate2 H5 TLF/1A8 minicircleDNA 33.100 32.793 0.435
Plate2 H6 TLF/1A8 minicircleDNA 32.486 32.793 0.435
Plate2 H7 TLF/1A8 beta-cat 39.216 38.458 1.072
Plate2 H8 TLF/1A8 beta-cat 37.700 38.458 1.072
Plate2 E1 Saline/1A8 minicircleDNA 32.532 32.617 0.121
Plate2 E2 Saline/1A8 minicircleDNA 32.703 32.617 0.121
Plate2 E3 Saline/1A8 beta-cat 37.181 37.750 0.804
Plate2 E4 Saline/1A8 beta-cat 38.318 37.750 0.804
Plate2 E5 Saline/1A8 minicircleDNA 33.699 34.127 0.606
Plate2 E6 Saline/1A8 minicircleDNA 34.556 34.127 0.606
Plate2 E7 Saline/1A8 beta-cat 37.750 37.750
Plate2 E8 Saline/1A8 beta-cat Undeter 37.750
! 80!
mined
Plate2 D1 Saline/1A8 minicircleDNA 29.810 29.958 0.210
Plate2 D2 Saline/1A8 minicircleDNA 30.106 29.958 0.210
Plate2 D3 Saline/1A8 beta-cat 33.781 34.514 1.037
Plate2 D4 Saline/1A8 beta-cat 35.248 34.514 1.037
Plate2 D5 Saline/1A8 minicircleDNA 34.892 34.702 0.268
Plate2 D6 Saline/1A8 minicircleDNA 34.513 34.702 0.268
Plate2 D7 Saline/1A8 beta-cat Undeter 39.864
mined
Plate2 D8 Saline/1A8 beta-cat 39.864 39.864
LPG5 experiment
A1 EAR10^6 minicircleDNA 22.109 22.148 0.056
A2 EAR10^6 minicircleDNA 22.188 22.148 0.056
A3 EAR10^6 beta-cat 30.049 30.094 0.064
A4 EAR10^6 beta-cat 30.139 30.094 0.064
B1 EAR10^5 minicircleDNA 25.318 25.295 0.033
B2 EAR10^5 minicircleDNA 25.272 25.295 0.033
B3 EAR10^5 beta-cat 31.331 31.217 0.161 STD curve,
B4 EAR10^5 beta-cat 31.103 31.217 0.161 the
C1 EAR10^4 minicircleDNA 29.166 29.380 0.302 ear+10e3
C2 EAR10^4 minicircleDNA 29.593 29.380 0.302 was omitted
C3 EAR10^4 beta-cat 31.787 31.953 0.235 from the
C4 EAR10^4 beta-cat 32.120 31.953 0.235 analysis
D1 EAR10^3 minicircleDNA 29.315 29.324 0.013
D2 EAR10^3 minicircleDNA 29.333 29.324 0.013
! 81!
D3 EAR10^3 beta-cat 31.915 31.633 0.398
D4 EAR10^3 beta-cat 31.351 31.633 0.398
E1 EAR10^2 minicircleDNA 30.403 30.540 0.195
E2 EAR10^2 minicircleDNA 30.678 30.540 0.195
E3 EAR10^2 beta-cat 31.995 32.062 0.095
E4 EAR10^2 beta-cat 32.129 32.062 0.095 lpg5A-/lpg5b-
Plate1 A9 TLF1 minicircleDNA 30.886 30.909 0.032
Plate1 A10 TLF1 minicircleDNA 30.931 30.909 0.032
Plate1 A11 TLF1 beta-cat 34.655 35.056 0.567
Plate1 A12 TLF1 beta-cat 35.456 35.056 0.567
Plate1 B9 TLF2 minicircleDNA 30.550 30.615 0.092
Plate1 B10 TLF2 minicircleDNA 30.680 30.615 0.092
Plate1 B11 TLF2 beta-cat 33.782 33.808 0.036
Plate1 B12 TLF2 beta-cat 33.834 33.808 0.036
Plate1 C9 TLF3 minicircleDNA 30.095 29.979 0.165
Plate1 C10 TLF3 minicircleDNA 29.862 29.979 0.165
Plate1 C11 TLF3 beta-cat 35.196 35.194 0.004
Plate1 C12 TLF3 beta-cat 35.191 35.194 0.004
Plate1 D9 TLF4 minicircleDNA 30.528 30.591 0.089
Plate1 D10 TLF4 minicircleDNA 30.654 30.591 0.089
Plate1 D11 TLF4 beta-cat 35.533 35.335 0.281
Plate1 D12 TLF4 beta-cat 35.136 35.335 0.281
Plate1 E9 TLF5 minicircleDNA 31.251 31.074 0.250
Plate1 E10 TLF5 minicircleDNA 30.897 31.074 0.250
Plate1 E11 TLF5 beta-cat 35.258 35.325 0.095
Plate1 E12 TLF5 beta-cat 35.392 35.325 0.095
! 82!
Plate1 F9 TLF6 minicircleDNA 30.828 30.879 0.073
Plate1 F10 TLF6 minicircleDNA 30.930 30.879 0.073
Plate1 F11 TLF6 beta-cat 31.800 32.240 0.622
Plate1 F12 TLF6 beta-cat 32.679 32.240 0.622
Plate1 G5 TLF7 minicircleDNA 32.092 31.954 0.195
Plate1 G6 TLF7 minicircleDNA 31.817 31.954 0.195
Plate1 G7 TLF7 beta-cat 33.473 33.879 0.574
Plate1 G8 TLF7 beta-cat 34.285 33.879 0.574
Plate1 H5 TLF8 minicircleDNA 32.114 31.969 0.205
Plate1 H6 TLF8 minicircleDNA 31.825 31.969 0.205
Plate1 H7 TLF8 beta-cat 33.088 33.435 0.490
Plate1 H8 TLF8 beta-cat 33.781 33.435 0.490
Plate2 C5 Saline1 minicircleDNA 31.597 31.465 0.187
Plate2 C6 Saline1 minicircleDNA 31.333 31.465 0.187
Plate2 C7 Saline1 beta-cat 33.874 34.142 0.380
Plate2 C8 Saline1 beta-cat 34.411 34.142 0.380
Plate2 D5 Saline 2 minicircleDNA 30.751 30.909 0.223
Plate2 D6 Saline 2 minicircleDNA 31.066 30.909 0.223
Plate2 D7 Saline 2 beta-cat 32.472 32.432 0.057
Plate2 D8 Saline 2 beta-cat 32.392 32.432 0.057
Plate2 E5 Saline 3 minicircleDNA 31.992 32.197 0.290
Plate2 E6 Saline 3 minicircleDNA 32.403 32.197 0.290
Plate2 E7 Saline 3 beta-cat 34.915 35.642 1.027
Plate2 E8 Saline 3 beta-cat 36.368 35.642 1.027
Plate2 F5 Saline 4 minicircleDNA 31.745 31.627 0.167
Plate2 F6 Saline 4 minicircleDNA 31.508 31.627 0.167
Plate2 F7 Saline 4 beta-cat 32.808 32.976 0.237
! 83!
Plate2 F8 Saline 4 beta-cat 33.144 32.976 0.237
Plate2 G5 Saline5 minicircleDNA 31.093 31.204 0.157
Plate2 G6 Saline5 minicircleDNA 31.315 31.204 0.157
Plate2 G7 Saline5 beta-cat 33.371 34.099 1.029
Plate2 G8 Saline5 beta-cat 34.827 34.099 1.029
Plate2 H5 Saline 6 minicircleDNA 30.400 30.404 0.005
Plate2 H6 Saline 6 minicircleDNA 30.407 30.404 0.005
Plate2 H7 Saline 6 beta-cat 31.949 32.098 0.212
Plate2 H8 Saline 6 beta-cat 32.248 32.098 0.212
lpg5-A-/lpg5B-
/+LPG5A+LPG5B
Plate 1 A5 TLF1 minicircleDNA 31.687 31.701 0.019
Plate 1 A6 TLF1 minicircleDNA 31.715 31.701 0.019
Plate 1 A7 TLF1 beta-cat 34.300 34.031 0.380
Plate 1 A8 TLF1 beta-cat 33.762 34.031 0.380
Plate 1 B5 TLF2 minicircleDNA 30.775 30.807 0.046
Plate 1 B6 TLF2 minicircleDNA 30.840 30.807 0.046
Plate 1 B7 TLF2 beta-cat 31.488 31.810 0.455
Plate 1 B8 TLF2 beta-cat 32.132 31.810 0.455
Plate 1 C5 TLF3 minicircleDNA 31.150 31.183 0.046
Plate 1 C6 TLF3 minicircleDNA 31.215 31.183 0.046
Plate 1 C7 TLF3 beta-cat 33.257 33.286 0.041
Plate 1 C8 TLF3 beta-cat 33.315 33.286 0.041
Plate 1 D5 TLF4 minicircleDNA 30.915 30.956 0.057
Plate 1 D6 TLF4 minicircleDNA 30.996 30.956 0.057
Plate 1 D7 TLF4 beta-cat 32.217 31.966 0.354
! 84!
Plate 1 D8 TLF4 beta-cat 31.716 31.966 0.354
Plate 1 E5 TLF5 minicircleDNA 30.939 31.127 0.267
Plate 1 E6 TLF5 minicircleDNA 31.316 31.127 0.267
Plate 1 E7 TLF5 beta-cat 33.343 33.314 0.041
Plate 1 E8 TLF5 beta-cat 33.286 33.314 0.041
Plate 1 F5 TLF6 minicircleDNA 32.151 32.059 0.130
Plate 1 F6 TLF6 minicircleDNA 31.967 32.059 0.130
Plate 1 F7 TLF6 beta-cat 34.870 34.821 0.069
Plate 1 F8 TLF6 beta-cat 34.772 34.821 0.069
Plate 1 G5 TLF7 minicircleDNA 32.092 31.954 0.195
Plate 1 G6 TLF7 minicircleDNA 31.817 31.954 0.195
Plate 1 G7 TLF7 beta-cat 33.473 33.879 0.574
Plate 1 G8 TLF7 beta-cat 34.285 33.879 0.574
Plate 1 H5 TLF8 minicircleDNA 32.114 31.969 0.205
Plate 1 H6 TLF8 minicircleDNA 31.825 31.969 0.205
Plate 1 H7 TLF8 beta-cat 33.088 33.435 0.490
Plate 1 H8 TLF8 beta-cat 33.781 33.435 0.490
Plate 2 C9 Saline1 minicircleDNA 31.688 32.135 0.632
Plate 2 C10 Saline1 minicircleDNA 32.582 32.135 0.632
Plate 2 C11 Saline1 beta-cat 34.300 33.736 0.798
Plate 2 C12 Saline1 beta-cat 33.172 33.736 0.798
Plate 2 D9 Saline 2 minicircleDNA 31.407 31.521 0.161
Plate 2 D10 Saline 2 minicircleDNA 31.635 31.521 0.161
Plate 2 D11 Saline 2 beta-cat 31.157 31.407 0.354
Plate 2 D12 Saline 2 beta-cat 31.658 31.407 0.354
Plate 2 E9 Saline3 minicircleDNA 31.816 32.050 0.331
Plate 2 E10 Saline3 minicircleDNA 32.283 32.050 0.331
! 85!
Plate 2 E11 Saline3 beta-cat 32.319 32.682 0.513
Plate 2 E12 Saline3 beta-cat 33.045 32.682 0.513
Plate 2 F9 Saline4 minicircleDNA 31.773 31.678 0.134
Plate 2 F10 Saline4 minicircleDNA 31.584 31.678 0.134
Plate 2 F11 Saline4 beta-cat 32.248 32.093 0.219
Plate 2 F12 Saline4 beta-cat 31.938 32.093 0.219
Plate 2 G9 Saline5 minicircleDNA 32.588 32.421 0.236
Plate 2 G10 Saline5 minicircleDNA 32.254 32.421 0.236
Plate 2 G11 Saline5 beta-cat 32.554 32.281 0.386
Plate 2 G12 Saline5 beta-cat 32.008 32.281 0.386
Plate 2 H9 Saline6 minicircleDNA 32.748 32.549 0.282
Plate 2 H10 Saline6 minicircleDNA 32.349 32.549 0.282
Plate 2 H11 Saline6 beta-cat 34.317 34.817 0.708
Plate 2 H12 Saline6 beta-cat 35.318 34.817 0.708
Plate 2 A5 Saline7 minicircleDNA 27.372 27.357 0.021
Plate 2 A6 Saline7 minicircleDNA 27.343 27.357 0.021
Plate 2 A7 Saline7 beta-cat 33.231 33.821 0.835
Plate 2 A8 Saline7 beta-cat 34.412 33.821 0.835
Plate 2 B5 Saline 8 minicircleDNA 26.598 26.617 0.026
Plate 2 B6 Saline 8 minicircleDNA 26.636 26.617 0.026
Plate 2 B7 Saline 8 beta-cat 33.172 33.265 0.132
Plate 2 B8 Saline 8 beta-cat 33.359 33.265 0.132
! 86!
REFERENCES
1. Esau, C., et al., miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab, 2006. 3(2): p. 87-98. 2. Gordon, S.M., et al., High density lipoprotein: it's not just about lipid transport anymore. Trends Endocrinol Metab, 2011. 22(1): p. 9-15. 3. Kaji, H., High-density lipoproteins and the immune system. J Lipids, 2013. 2013: p. 684903. 4. Lund-Katz, S. and M.C. Phillips, High density lipoprotein structure-function and role in reverse cholesterol transport. Subcell Biochem, 2010. 51: p. 183-227. 5. Wang, N., et al., Specific binding of ApoA-I, enhanced cholesterol efflux, and altered plasma membrane morphology in cells expressing ABC1. J Biol Chem, 2000. 275(42): p. 33053-8. 6. Chajek, T. and F. C.J., Isolation and characterization of a human serum cholesteryl ester transfer protein. Proc. Natl. Acad. Sci. , 1978. 75(7): p. 3445-3449. 7. Raper, J., V. Nussenzweig, and S. Tomlinson, The Main Lytic Factor of Trypanosoma brucei brucei in Normal Human Serum Is Not High Density Lipoprotein. J Exp Med, 1996. 183: p. 1023-1029. 8. Annema, W. and A. von Eckardstein, High-Density Lipoproteins. Circulation Journal, 2013. 77(10): p. 2432-2448. 9. Segrest, J.P., M.C. Cheung, and M.K. Jones, Volumetric determination of apolipoprotein stoichiometry of circulating HDL subspecies. J Lipid Res, 2013. 54(10): p. 2733-44. 10. Huang, R., et al., Apolipoprotein A-I structural organization in high-density lipoproteins isolated from human plasma. Nat Struct Mol Biol, 2011. 18(4): p. 416-22. 11. Johnson, W.J., et al., The Bidirectional Flux of Cholesterol between Cells and Lipoproteins. The Journal of Biological Chemistry, 1986. 261(May 5): p. 5766-5776. 12. Czarnecka, H. and S. Yokoyama, Regulation of Cellular Cholesterol Efflux by Lecithin:Cholesterol Acyltransferase Reaction through Nonspecific Lipid Exchange. The Journal of Biological Chemistry, 1996. 271(4): p. 2023-2028. 13. Wang, N., et al., ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci U S A, 2004. 101(26): p. 9774-9. 14. Vaughan, A.M. and J.F. Oram, ABCG1 redistributes cell cholesterol to domains removable by high density lipoprotein but not by lipid-depleted apolipoproteins. J Biol Chem, 2005. 280(34): p. 30150-7. 15. Ji, Y., et al., Scavenger Receptor BI Promotes High Density Lipoprotein-mediated Cellular Cholesterol Efflux. The Journal of Biological Chemistry, 1997. 272(34): p. 20982-20985. 16. Ueda, Y., et al., Lower Plasma Levels and Accelerated Clearance of High Density Lipoprotein (HDL) and Non-HDL Cholesterol in Scavenger Receptor B Type I Transgenic Mice. The Journal of Biological Chemistry, 1999. 274(11): p. 7165-7171. 17. Fabre, A.C., et al., Cell surface adenylate kinase activity regulates the F(1)-ATPase/P2Y (13)- mediated HDL endocytosis pathway on human hepatocytes. Cell Mol Life Sci, 2006. 63(23): p. 2829-37. 18. Rader, D.J., Regulation of reverse cholesterol transport and clinical implications. The American Journal of Cardiology, 2003. 92(4): p. 42-49. 19. Cockerill, G.W., et al., High-density lipoproteins inhibit cytokine-induced expression of endothelial cell adhesion molecules. Artherioscler Thromb Vasc Biol, 1995. 15: p. 1987-1994. 20. Kovanen, P.T. and Pentikainen, Circulating lipoproteins as proinflammatory and anti- inflammatory particles in atherogenesis. Current Opinion in Lipidology, 2003. 2003: p. 411- 419. 21. Chien, J., et al., Low serum level of high-density lipoprotein cholesterol is a poor prognostic factor for severe sepsis Crit Care Med, 2005. 33(8): p. 1688-93 . 22. Carvalho, M.D., et al., Lipoprotein lipase and PPAR alpha gene polymorphisms, increased very-low-density lipoprotein levels, and decreased high-density lipoprotein levels as risk
! 87!
markers for the development of visceral leishmaniasis by Leishmania infantum. Mediators Inflamm, 2014. 2014: p. 230129. 23. Guo, L., et al., High density lipoprotein protects against polymicrobe-induced sepsis in mice. J Biol Chem, 2013. 288(25): p. 17947-53. 24. Lee, R.P., et al., High-Density lipoprotein prevents organ damage in endotoxemia. Res Nurs Health, 2007. 30(3): p. 250-60. 25. Molina-Portela Mdel, P., et al., Trypanosome lytic factor, a subclass of high-density lipoprotein, forms cation-selective pores in membranes. Mol Biochem Parasitol, 2005. 144(2): p. 218-26. 26. Molina-Portela, M.P., M. Samanovic, and J. Raper, Distinct roles of apolipoprotein components within the trypanosome lytic factor complex revealed in a novel transgenic mouse model. J exp Med, 2008. 205(8): p. 1721-8. 27. Vanhamme, L., et al., Apoliporpottein L-1 is the trpanosome lytic facotr of human serum. Nature, 2003. 422: p. 83-87. 28. Samanovic, M., et al., Trypanosome lytic factor, an antimicrobial high-density lipoprotein, ameliorates Leishmania infection. PLoS Pathog, 2009. 5(1): p. e1000276. 29. Taylor, H.E., A.K. Khatua, and W. Popik, The innate immune factor apolipoprotein L1 restricts HIV-1 infection. J Virol, 2014. 88(1): p. 592-603. 30. Tomlinson, S., et al., Haptoglobin-related protein and apolipoprotein AI are components of the two trypanolytic factors in human serum. Molecular and Biochemical Parasitology, 1997. 86(1): p. 117-120. 31. http://www.who.int/mediacentre/factsheets/fs259/en/. 32. http://www.thecattlesite.com/diseaseinfo/249/trypanosomosis-sleeping-disease-nagana/, cited on 02/26/17. 33. Berrang-Ford, L., C. Wamboga, and A.S. Kakembo, Trypanososma brucei rhodesiense sleeping sickness, Uganda. Emerg Infect Dis, 2012. 18(10): p. 1686-7. 34. Franco, J.R., et al., Epidemiology of human African trypanosomiasis. Clin Epidemiol, 2014. 6: p. 257-75. 35. https://www.cdc.gov/parasites/sleepingsickness/biology.html. Jan 7 2017. 36. Engstler, M., et al., Kinetics of endocytosis and recycling of the GPI-anchored variant surface glycoprotein in Trypanosoma brucei. J Cell Sci, 2004. 117(Pt 7): p. 1105-15. 37. GA, C., Identification, purification and propertiesof clone-specific glycoprotein antigens constituting the surface coat of Trypanoosma brucei. Parasitology, 1975. 71(3): p. 393-417. 38. Grunfelder, C.G., et al., Accumulation of a GPI-Anchored Protein at the Cell Surface Requires Sorting at Multiple Intracellular Levels. Traffic, 2002. 3(8): p. 547-559. 39. Mugnier, M.R., G.A. Cross, and F.N. Papavasiliou, The in vivo dynamics of antigenic variation in Trypanosoma brucei. Science, 2015. 347(6229): p. 1470-3. 40. Rifkin, M.R., et al., Human serum-sensitive Trypanosoma brucei rhodesiense: a comparison with serologically identical human serum-resistant clones. Mol Biochem Parasitol, 1994. 66(2): p. 211-20. 41. Xong, H.V., et al., A VSG Expression Site-Associated Gene Confers Resistance to Human Serum in Trypanosoma rhodesiense. Cell 1998. 95: p. 839-846. 42. Stephens, N.A. and S.L. Hajduk, Endosomal localization of the serum resistance-associated protein in African trypanosomes confers human infectivity. Eukaryot Cell, 2011. 10(8): p. 1023- 33. 43. Bart, J.M., et al., Localization of serum resistance-associated protein in Trypanosoma brucei rhodesiense and transgenic Trypanosoma brucei brucei. Cell Microbiol, 2015. 17(10): p. 1523- 35. 44. Thomson, R., et al., Evolution of the primate trypanolytic factor APOL1. Proc Natl Acad Sci U S A, 2014. 111(20): p. E2130-9. 45. Oli, M.W., et al., Serum resistance-associated protein blocks lysosomal targeting of trypanosome lytic factor in Trypanosoma brucei. Eukaryot Cell, 2006. 5(1): p. 132-9. 46. Kieft, R., et al., Mechanism of Trypanosoma brucei gambiense (group 1) resistance to human trypanosome lytic factor. PNAS, 2010. 107: p. 16137-16141. 47. Capewell, P., et al., The TgsGP Gene Is Essential for Resistance to Human Serum in Trypanosoma brucei gambiense. PLOS Pathogens, 2013. 9(10): p. e1003686.
! 88!
48. Uzureau, P., et al., Mechanism of Trypanosoma brucei gambiense resistance to human serum. Nature, 2013. 501(7467): p. 430-4. 49. Rifkin, M.R., Identification of the trypanocidal factor in normal human serum: high density lipoprotein. Proc Natl Acad Sci U S A, 1978. 72: p. 3450-54. 50. Duchateau, P.N., et al., Apolipoprotein L, a New Human High Density Lipoprotein Apolipoprotein Expressed by the Pancreas. J Biol Chem, 1997. 272: p. 25576-25582. 51. Smith, A.B., J.D. Esko, and S.L. Hajduk, Killing of trypnosomes by the human haptoglobin- related protein. Science, 1995. 268(5208): p. 284-286. 52. Vanhamme, L., et al., Apolipoprotein L-I is the trypanosome lytic factor of human serum. Nature, 2003. 422(6927): p. 83-87. 53. Raper, J., et al., Characterization of a novel Trypanosome Lytic Factor from Human Serum. Infection and Immunity, 1999. 67(4): p. 1910-1916. 54. Raper, J., V. Nussenzweig, and S. Tomlinson, The main Lytic Facotr in Normal Human Serum is not High Density Lipoprotein. The Journal of Experimental Medicine, 1996. 183(3): p. 1023. 55. Lugli, E.B., et al., Characterization of primate trypanosome lytic factors. Mol Biochem Parasitol, 2004. 138(1): p. 9-20. 56. Pérez-Morga, D., et al., Apolipoprotein L-I Promotes Trypanosome Lysis by Forming Pores in Lysosomal Membranes. Science, 2005. 309(5733): p. 469-472. 57. Raper, J., et al., Trypanosome lytic factors: novel mediators of human innate immunity. Current Opinion in Microbiology, 2001. 4(4): p. 402-408. 58. Hajduk, S.L., et al., Lysis of Trypanosoma brucei by a Toxic Subspecies of Human High Density Lipoprotein. The Journal of Biological Chemistry, 1989. 264: p. 5210-5217. 59. Nielsen, M.J. and S.K. Moestrup, Receptor targeting of hemoglobin mediated by the haptoglobins: roles beyond heme scavenging. Blood, 2009. 114(4): p. 764-71. 60. Axler, O., J. Ahnstrom, and B. Dahlback, Apolipoprotein M associates to lipoproteins through its retained signal peptide. FEBS Lett, 2008. 582(5): p. 826-8. 61. Sorenson, R.C., et al., Human Serum Paraoxonase/Arylesterase's Retained Hydrophobic N- Terminal Leader Sequence Associates With HDLs by Binding Phospholipids. Arteroscler Thromb Vasc Biol, 1999. 19: p. 2214-2225. 62. Harrington, J.M., et al., A retained secretory signal peptide mediates high density lipoprotein (HDL) assembly and function of haptoglobin-related protein. J Biol Chem, 2014. 289(36): p. 24811-20. 63. Nielsen, M.J., et al., A unique loop extension in the serine protease domain of haptoglobin is essential for CD163 recognition of the haptoglobin-hemoglobin complex. J Biol Chem, 2007. 282(2): p. 1072-9. 64. Vanhollebeke, B., et al., A Haptoglobin- Hemoglobin Receptor Conveys Innate Immunity to Trypanosoma brucei in Humans. Science, 2008. 320: p. 677-681. 65. Vanhollebeke, B., et al., Distinct roles of haptoglobin-related protein and apolipoprotein L-I in trypanolysis by human serum. Proc Natl Acad Sci U S A, 2007. 104(10): p. 4118-23. 66. Smith, A.B. and S.L. Hajduk, Indentification of haptoglobin as a natural inhibitor of trypanocidal activity in human serum. Proc Natl Acad Sci U S A, 1995. 92: p. 10262-10266. 67. Raper, J., V. Nussenzweig, and S. Tomlinson, Lack of correlation between haptoglobin concentration and trypanolytic activity of normal human serum. Molecular and Biochemical Parasitology, 1996. 76: p. 337-338. 68. Muranjan, M., V. Nussenzweig, and S. Tomlinson, Characterization of the Human Serum Trypanosome Toxin, Haptoglobin related Protein. The Journal of Biological Chemistry, 1998. 273: p. 3884-3887. 69. Lecordier, L., et al., C-Terminal Mutants of Apolipoprotein L-I Efficiently Kill Both Trypanosoma brucei brucei and Trypanosoma brucei rhodesiense. PLOS Pathogens, 2009. 5(12): p. e1000685. 70. Liu, Z., et al., Apolipoprotein l6, a novel proapoptotic Bcl-2 homology 3-only protein, induces mitochondria-mediated apoptosis in cancer cells. Mol Cancer Res, 2005. 3(1): p. 21-31. 71. Smith, E.E. and H.S. Malik, The apolipoprotein L family of programmed cell death and immunity genes rapidly evolved in primates at discrete sites of host-pathogen interactions. Genome Res, 2009. 19(5): p. 850-8.
! 89!
72. Heneghan, J.F., et al., BH3 domain-independent apolipoprotein L1 toxicity rescued by BCL2 prosurvival proteins. Am J Physiol Cell Physiol, 2015. 309(5): p. C332-47. 73. Thomson, R., M. Samanovic, and J. Raper, Activity of trypanosome lytic factor: a novel component of innate immunity. Future Microbiol, 2009. 4(7): p. 789-96. 74. Hager, K.M., et al., Endocytosis of a cytotoxic human high density lipoprotein results in disruption of acidic intracellular vesicles and subsequent killing of African trypanosomes. J Cell Biol, 1994. 126(1): p. 155-67. 75. Thomson, R. and A. Finkelstein, Human trypanolytic factor APOL1 forms pH-gated cation- selective channels in planar lipid bilayers: Relevance to trypanosome lysis. Proceedings of the National Academy of Sciences of the United States of America, 2015. 112(9): p. 2894-2899. 76. Monajemi, H., et al., The apolipoprotein L gene cluster has emerged recently in evolution and is expressed in human vascular tissue. Genomics, 2002. 79(4): p. 539-46. 77. Kageruka, P., et al., Infectivity of Trypanosoma (Trypanozoon) brucei gambiense for baboons (Papio hamadryas, Papio papio). Ann Soc Belg Med Trop, 1991. 71(1): p. 39-46. 78. Peolvoorde, P., et al., Distribution of apolipoprotein L-I and trypanosome lytic activity among primate sera. Mol Biochem Parasitol, 2004. 134: p. 155-157. 79. Seed, J.R., J.B. Sechleski, and M.R. Loomis, A survey for a trypanocidal factor in primate sera. J Protozool, 1990. 37: p. 393-400. 80. Thomson, R., et al., Hydrodynamic gene delivery of baboon trypanosome lytic factor eliminates both animal and human-infective African trypanosomes. Proc Natl Acad Sci U S A, 2009. 106(46): p. 19509-14. 81. Prufer, K., et al., The bonobo genome compared with the chimpanzee and human genomes. Nature, 2012. 486(7404): p. 527-531. 82. Desquesnes, M., et al., Trypanosoma evansi and surra: a review and perspectives on origin, history, distribution, taxonomy, morphology, hosts, and pathogenic effects. Biomed Res Int, 2013. 2013: p. 194176. 83. Ko, W.Y., et al., Identifying Darwinian selection acting on different human APOL1 variants among diverse African populations. Am J Hum Genet, 2013. 93(1): p. 54-66. 84. Genovese, G., et al., Association of trypanolytic ApoL1 variants with kidney disease in African Americans. Science, 2010. 329(5993): p. 841-5. 85. Tzur, S., et al., Missense mutations in the APOL1 gene are highly associated with end stage kidney disease risk previously attributed to the MYH9 gene. Hum Genet, 2010. 128(3): p. 345- 50. 86. http://www.who.int/trypanosomiasis_african/country/history/en/index1.html. 87. https://www.cdc.gov/parasites/leishmaniasis/epi.html. 88. http://www.who.int/leishmaniasis/burden/en/. 89. http://www.niaid.nih.gov. 90. Maroli, M., et al., Phlebotomine sandflies and the spreading of leishmaniases and other diseases of public health concern. Med Vet Entomol, 2013. 27(2): p. 123-47. 91. Kamhawi, S., et al., The vectorial competence of Phlebotomus sergenti is specific for Leishmania tropica and is controlled by species-specific, lipophosphoglycan-mediated midgut attachment. Parasitology, 2000. 121(1): p. 25-33. 92. Killick-Kendrick, R., M. Killick-Kendrick, and Y. Tang, Anthroponotic cutaneous leishmaniasis in Kabul, Afganistan: The high suscptibility of Phlebotomus sergenti to Leishmania tropica. Trans R Soc Trop Med Hyg, 1995. 89: p. 477. 93. Sacks, D., Leishmania-sand fly interactions controlling species-specific vector competence. Cellular Microbiology, 2001. 3(4): p. 189-196. 94. Sacks, D., P. Lawyer, and S. Kamhawi, The biology of Leishmania – sand fly interactions. In: Myler PJ, Fasel N, editors. Leishmania - After the Genome. Norwish, UK: Caister Academic Press, 2008(205–238). 95. Pimenta, P.F., et al., Stage-specific adhesion of Leishmania promastigotes to the sandfly midgut. Science, 1992. 256(5065): p. 1812-5. 96. Dobson, D.E., et al., Leishmania major Survival in Selective Phlebotomus papatasi Sand Fly Vector Requires a Specific SCG-Encoded Lipophosphoglycan Galactosylation Pattern. PLOS Pathogens, 2010. 6(11): p. e1001185.
! 90!
97. Svárovská, A., et al., Leishmania major Glycosylation Mutants Require Phosphoglycans (lpg2−) but Not Lipophosphoglycan (lpg1−) for Survival in Permissive Sand Fly Vectors. PLOS Neglected Tropical Diseases, 2010. 4(1): p. e580. 98. Secundino, N., et al., Proteophosphoglycan confers resistance of Leishmania major to midgut digestive enzymes induced by blood feeding in vector sand flies. Cellular microbiology, 2010. 12(7): p. 906-918. 99. Capul, A.A., et al., Comparisons of mutants lacking the Golgi UDP-galactose or GDP- mannose transporters establish that phosphoglycans are important for promastigote but not amastigote virulence in Leishmania major. Infect Immun, 2007. 75(9): p. 4629-37. 100. Soares, R.P.P., et al., Leishmania chagasi: lipophosphoglycan characterization and binding to the midgut og the sandfly vector Lutzomyia longipalpalis. Mol Biochem Parasitol, 2002. 121: p. 213-224. 101. http://dna.kdna.ucla.edu/parasite_course-old/leish_files/subchapters/surface.htm. 102. Titus, R.G. and J.M. Ribeiro, Salivary gland lysates from the sand fly Lutzomyia longipalpis enhance Leishmania infectivity. Science, 1988. 239(4845): p. 1306. 103. Rogers, M.E., et al., Transmission of cutaneous leishmaniasis by sand flies is enhanced by regurgitation of fPPG. Nature, 2004. 430(6998): p. 463-467. 104. Kamhawi, S., The biological and immunomodulatory properties of sand fly saliva and its role in the establishment of Leishmania infections. Microbes and Infection, 2000. 2(14): p. 1765- 1773. 105. Kimblin, N., et al., Quantification of the infectious dose of Leishmania major transmitted to the skin by single sand flies. Proceedings of the National Academy of Sciences, 2008. 105(29): p. 10125-10130. 106. Peters, N.C., et al., In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science, 2008. 321(5891): p. 970-4. 107. Ribeiro-Gomes, F.L., et al., Efficient capture of infected neutrophils by dendritic cells in the skin inhibits the early anti-leishmania response. PLoS Pathog, 2012. 8(2): p. e1002536. 108. Ribeiro-Gomes, F.L., et al., Site-dependent recruitment of inflammatory cells determines the effective dose of Leishmania major. Infect Immun, 2014. 82(7): p. 2713-27. 109. Sousa, L.M., et al., Neutrophils have a protective role during early stages of Leishmania amazonensis infection in BALB/c mice. Parasite Immunol, 2014. 36(1): p. 13-31. 110. Real, F., et al., Cell-to-cell transfer of Leishmania amazonensis amastigotes is mediated by immunomodulatory LAMP-rich parasitophorous extrusions. Cellular Microbiology, 2014. 16(10): p. 1549-1564. 111. Joshi, P.B., et al., Targeted gene deletion in Leishmania major identifies leishmanolysin (GP63) as a virulence factor. Molecular and Biochemical Parasitology, 2002. 120(1): p. 33-40. 112. Brittingham, A., et al., Role of the Leishmania surface protease gp63 in complement fixation, cell adhesion, and resistance to complement-mediated lysis. The Journal of Immunology, 1995. 155(6): p. 3102-3111. 113. Lieke, T., et al., Leishmania surface protein gp63 binds directly to human natural killer cells and inhibits proliferation. Clinical and Experimental Immunology, 2008. 153(2): p. 221-230. 114. Gabriel, C., et al., Leishmania donovani Promastigotes Evade the Antimicrobial Activity of Neutrophil Extracellular Traps. The Journal of Immunology, 2010. 185(7): p. 4319- 4327. 115. Ueno, N. and M.E. Wilson, Receptor-mediated phagocytosis of Leishmania: implications for intracellular survival. Trends in Parasitology, 2012. 28(8): p. 335-344. 116. Podinovskaia, M. and A. Descoteaux, Leishmania and the macrophage: a multifaceted interaction. Future Microbiology, 2015. 10: p. 111-129. 117. Moradin, N. and A. Descoteaux, Leishmania promastigotes: building a safe niche within macrophages. Frontiers in Cellular and Infection Microbiology, 2012. 2: p. 121. 118. Mukkada, A.J., et al., Enhanced metabolism of Leishmania donovani amastigotes at acid pH: an adaptation for intracellular growth. Science, 1985. 229(4718): p. 1099-101. 119. Gabriel, C., et al., Leishmania donovani Promastigotes Evade the Antimicrobial Activity of Neutrophil Extracellular Traps. The Journal of Immunology, 2010. 185(7): p. 4319-4327.
! 91!
120. Gueirard, P., et al., Trafficking of Leishmania donovani promastigotes in non-lytic compartments in neutrophils enables the subsequent transfer of parasites to macrophages. Cell Microbiol, 2008. 10(1): p. 100-11. 121. Guimaraes-Costa, A.B., et al., Leishmania amazonensis promastigotes induce and are killed by neutrophil extracellular traps. Proc Natl Acad Sci U S A, 2009. 106(16): p. 6748-53. 122. Hurrell, B.P., et al., Rapid Sequestration of Leishmania mexicana by Neutrophils Contributes to the Development of Chronic Lesion. PLOS Pathogens, 2015. 11(5): p. e1004929. 123. Liu, D. and J.E. Uzonna, The early interaction of Leishmania with macrophages and dendritic cells and its influence on the host immune response. Frontiers in Cellular and Infection Microbiology, 2012. 2: p. 83. 124. Scott, P. and F.O. Novais, Cutaneous leishmaniasis: immune responses in protection. Nature Reviews, 2016. 16: p. 581-592. 125. Dotiwala, F., et al., Killer lymphocytes use granulysin, perforin and granzymes to kill intracellular parasites. Nat Med, 2016. 22(2): p. 210-6. 126. Faria, D.R., et al., Decreased in situ expression of interleukin-10 receptor is correlated with the exacerbated inflammatory and cytotoxic responses observed in mucosal leishmaniasis. Infect Immun, 2005. 73(12): p. 7853-9. 127. Gautam, S., et al., IL-10 Neutralization Promotes Parasite Clearance in Splenic Aspirate Cells From Patients With Visceral Leishmaniasis. The Journal of Infectious Diseases, 2011. 204(7): p. 1134-1137. 128. Samanovic, M., Trypanosome Lytic Factor, as a component of innate immunity. Thesis, 2009. 129. Kapler, G.M., C.M. Coburn, and S.M. Beverley, Stable Transfection of the Human Parasite Leishmania major Delineates a 30-Kilobase Region Sufficient for Extrachromosomal Replication and Expression. Molecular and Cellular Biology, 1990. 10(3): p. 1084-1094. 130. Spath, G.F. and S.M. Beverley, A lipophosphoglycan-independent method for isolation of infective Leishmania metacyclic promastigotes by density gradient centrifugation. Exp Parasitol, 2001. 99(2): p. 97-103. 131. Nicholas, L., et al., Leishmania major Reaches Distant Cutaneous Sites Where It Persists Transiently while Persisting Durably in the Primary Dermal Site and Its Draining Lymph Node: a Study with Laboratory Mice. Infect Immun, 2000. 68(12): p. p. 6561– 6566. 132. Prina, E., et al., Leishmania DNA is rapidly degraded following parasite death: an analysis by microscopy and real-time PCR. Microbes Infect, 2007. 9(11): p. 1307-15. 133. Marim, F.M., et al., A method for generation of bone marrow-derived macrophages from cryopreserved mouse bone marrow cells. PLoS One, 2010. 5(12): p. e15263. 134. Kovacsics, D. and R. J, Transient Expression of Proteins by Hydrodynamic Gene Delivery in Mice. . J. Vis. Exp., 2014. 87(e51481): p. doi:10.3791/51481. 135. Duchateau, P.N., et al., Apolipoprotein L gene family: tissue expression, splicing, promoter regions; discovery of a new gene. J Lipid Res, 2001. 42: p. 620-630. 136. http://www.genecards.org/cgi-bin/carddisp.pl?gene=APOL1, cited on 03/15/2017. 137. Belkaid, Y., et al., A natural model of Leishmania major infection reveals a prolonged "Silent" phase pf parasite amplification in the skin before the onset of Lesion Formation and Immunity. The Journal of Immunology, 2000. 165: p. 969-977. 138. Kimblin, N., et al., Quantification of the infectious dose of Leishmania major transmitted to the skin by single sand flies. Proc Natl Acad Sci U S A, 2008. 105(29): p. 10125-30. 139. Sacks, D.L. and P.C. Melby, Animal models for the analysis of immune responses to leishmaniasis. Curr Protoc Immunol, 2001. Chapter 19: p. Unit 19 2. 140. Titus, R.G., et al., A limiting dilution assay for quantifying Leishmania major in tissues of infected mice. Parasite Immunology, 1985. 7(5): p. 545-555. 141. Cortes, D.F., et al., Low and high-dose intradermal infection with Leishmania major and Leishmania amazonensis in C57BL/6 mice. Mem Inst Oswaldo Cruz, 2010. 105: p. 736-745. 142. Bucheton, B., et al., A major susceptibility locus on chromosome 22q12 plays a critical role in the control of kala-azar. Am J Hum Genet, 2003. 73(5): p. 1052-60. 143. Daley, J.M., et al., Use of Ly6G-specific monoclonal antibody to deplete neutrophils in mice. J Leukoc Biol, 2008. 83(1): p. 64-70.
! 92!
144. Roheim, P.S., L. Dory, and C.H. Sloop, Interstitial fluid lipoproteins. J Lipid Res, 1987. 28(3): p. 225-37. 145. Athens, J.W., et al., Leukokinetic studies. IV. The total blood, circulating and marginal granulocyte pools and the granulocyte turnover rate in normal subjects. J Clin Invest, 1961. 40(6): p. 989-995. 146. Antoine, J.C., et al., Parasitophorous Vacuoles of Leishmania amazonensis- Infected Macrophages Maintain an Acidic pH Infect Immun, 1990. 58(3): p. 779-787. 147. Spath, G.F., et al., A novel role for Stat1 in phagosome acidification and natural host resistance to intracellular infection by Leishmania major. PLoS Pathog, 2009. 5(4): p. e1000381. 148. Spath, G.F., et al., Lipophosphoglycan is a virulence factor distinct from related glycoconjugates in the protozoan parasite Leishmania major. Proc Natl Acad Sci U S A, 2000. 97(16): p. 9258-63. 149. Pant , J., et al., Trypanosome Lytic Factor protects aganinst cutaneous, but not visceral leishmaniasis in a neutrophil dependent manner. Unpublished. 150. Späth, G.F., et al., Lipophosphoglycan is a virulence factor distinct from related glycoconjugates in the protozoan parasite Leishmania major. Proceedings of the National Academy of Sciences, 2000. 97(16): p. 9258-9263. 151. Mollinedo, F., et al., Selective fusion of azurophilic granules with Leishmania-containing phagosomes in human neutrophils. J Biol Chem, 2010. 285(45): p. 34528-36.
! 93!
! 94!