Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2017

1 Support Information for Tetrabromobisphenol A (TBBPA) Exhibits

2 Specific Antimicrobial Activity against Gram-positive Bacteria without

3 Detectable Resistance

4 Fang Jia#, Chang Wangb#, Huimin Wangb#, Guangliang Liub, Bolei Chenc, Ligang Hud, Guibin

5 Jiangd, Maoyong Songd, Yong Lianga,b,e*

6 aSchool of Medicine, Jianghan University, Wuhan 430056, P. R. China

7 bInstitute of Environment and Health, Jianghan University, Wuhan 430056, P. R. China

8 cInstitute for Interdisciplinary Research, Jianghan University, Wuhan 430056, P. R. China

9 dState Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-

10 Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, Beijing 100085, P. R.

11 China.

12 eKey Laboratory of Optoelectronic Chemical Materials and Devices (Jianghan University),

13 Ministry of Education, Wuhan 430056, P. R. China.

14 # Equal contribution. 15 16 17 *Corresponding author: 18 Yong Liang 19 Institute of Environment and Health 20 Jianghan University 21 Wuhan 430056, P. R. China 22 Tel: +86 27 84238886 23 E-mail: [email protected] 24 25 26 27 28 29 30 31 32 33 34 Methods:

35 Materials: Bacterial strains used in this study are listed in Table 1. The strains were obtained from

36 State Key Laboratory of Agricultural Microbiology, Huazhong Agriculture University and the

37 State Key Laboratory of Crop Biology, Shandong Agricultural University. The strains were

38 cultured under normal conditions described previously[1]. The chemicals used in this study are as

39 follows: TBBPA, 2,2-bis-(4-hydroxyphenyl) propane (BPA) and triclosan were obtained from

40 Alfa Aesar Company; 2,2-bis-(3,5-dichloro-4-hydroxyphenyl)propane (TCBPA) from Tokyo

41 Chemical Industry; 2,2',6,6'-tetrabromobisphenol A diallyl ether (TBBPADE) and 4,4'-

42 isopropylidenebis [2-(2,6-dibromophenoxy) ethanol] (TBBPABE) from Sigma-Aldrich; 2,2-bis-

43 (3,5-dibromo-4-hydroxyphenyl)sulfone (TBBPS) from Beijing Apis Biotechnology; Stock

44 solutions of 10 mg/ml of these chemicals were prepared in dimethyl sulfoxide (DMSO). The

45 antibiotics used in this paper are ampicillin and tetracycline that were purchased from

46 Biosharp Company.

47 Susceptibility test. The minimum inhibitory concentrations (MICs) were determined with the

48 broth microdilution method according to Clinical and Laboratory Standards Institute guidelines.

49 The organisms in the exponential growth phase were diluted to a final inoculum of 1×105 to 5×

50 105 CFU/ml. The MIC was defined as the lowest concentration of a compound that completely

51 inhibited bacterial growth[2]. Compounds were taken from a stock solution of 20 mg/ml in 100%

52 dimethyl sulfoxide (DMSO).

53 Preparation of bacterial samples for SEM and TEM. When the OD600 of the culture of B.

54 subtilis reached approximately 0.6-0.8, TBBPA was added to a final concentration of 1×MIC to

55 the case, or equal amount of DMSO was added to the control. One hour later the cultures were

56 centrifuged and prepared for scanning electron microscopy (SEM) and transmission electron 57 microscopy (TEM). SEM and TEM was performed following the method described by Wang et

58 al[1] and Zhu et al [3] , respectively.

59 Microarray and data analysis. When the OD600 of B. subtilis culture reached approximately 0.6-

60 0.8, the cultures were challenged with 16 μg/ml of TBBPA or equal amount of DMSO (control).

61 The cells were harvested 1 hour later and cell pellets were directly snap-frozen in dry ice. We then

62 submitted the samples to KangChen Biotech (Shanghai, China) for an mRNA microarray assay.

63 Sample processing including labelling, hybridization, scanning, and normalization，and data

64 analysis was performed by KangChen Biotech (Supplementary file 2).

65 RNA isolation and reverse transcription. B. subtilis cells were grown till the OD600 reached

66 approximately 0.6-0.8. Each compound (TBBPA, TCBPA, BPA, TBBPADE, TBBPABE and

67 TBBPS) at different concentrations or DMSO (control) were added respectively. The cells were

68 harvested 1 hour later and the RNA was isolated according to the Bacterial RNA Kit (Omega Bio-

69 tek) then was reverse transcribed with M-MLV reverse transcriptase (High Capacity cDNA

70 Reverse Transcription kit; Promega, UK Ltd.)

71 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR). The reaction was

72 performed on cDNA generated from RNA samples (each experiment was performed at least three

73 times). Three genes of dlt operon identified by microarray analysis as up-regulated by TBBPA,

74 dltA was chosen to be tested by qRT-PCR with rpsJ gene as the internal control. The used primers

75 were listed in Table S1. qRT-PCR was run using the SYBR Green Realtime PCR Master Mix

76 (TOYOBO CO., LTD.) according to the manufacturer’s procedure. The amplification reaction

77 was carried out using the following program: 95°C for 10 min, 55 cycles of (95°C for 30 s, 57°C

78 for 30 s), and 72°C for 30 s. Expression of the dlt and autolysin genes was calculated as fold 79 changes using the following formula: fold change = 2－ΔΔCt

[4] 80 －ΔΔCt= (Ctgene x － CtrpsJ)condition I－(Ctgene x －CtrpsJ)condition II ( ).

81 Background information on cell wall synthesis and degradation in Gram-positive bacteria.

82 A significant difference between Gram-positive and Gram-negative bacteria is the presence of

83 teichoic acids (TAs) specifically in Gram-positive bacteria cell wall. The TAs are closely related

84 to the synthesis and degradation of cell wall, which is regulated by the dlt operon and autolysins.

85 The dlt operon is responsible for adding positively charged D-alanine via esterification to teichoic

86 acids (TAs), as DltA ligates D-alanines in the cytoplasm of the cell and the ligated form is then

87 transported by the carrier protein DltC[5]. The TAs, including wall teichoic acid (WTA) and

88 lipoteichoic acid (LTA), are a major structural component specifically present in the gram-positive

89 cell wall. WTA is covalently linked to the peptidoglycan, while LTA is amphiphilic with its

90 glycolipid being anchored in the membrane and its poly-glycerophosphate (Gro-P) chain

91 extending into the wall. Together with peptidoglycan, WTA and LTA construct the network or

92 matrix that provides functions relating to the elasticity, porosity, tensile strength, and electrostatic

93 steering of the cell wall envelope[6]. Protonated D-alanyl ester residues, one of the principal

94 substituents of TAs in many low-G+C gram-positive bacteria, are covalently linked to these

95 chains and provide counter ions for determining the net negative charge of the TA. The bacterial

96 cell wall is a dynamic structure that undergoes coordinated synthesis and degradation during cell

97 growth and division. The degradative phase, referred to as “autolysis”, is mediated by autolysins

98 [7]. Negatively charged D-alanyl-TAs provide binding sites for cationic autolysins by electrostatic

99 interaction, therefore, D-alanyl-TAs play an important role in modulating the activities of

100 autolysins by means of changing the amount of binding sites[8]. 101 Table S1. Oligonucleotide primers used for qRT-PCR analysis.

Primer targeta Sequence(5' to 3')b

dltA F GGGACTTTACATTGCGTGAC R CACAAAGGAAGGTGTTGATG rpsJ F CGGTTACGAAGCAATCCAG R ATACGCATCCATTTCCACT yocH F AAATAAGAACCCGAACGCGA R GCCCCAATTAGAAGCATCAC cwlO F CAATCTGAGGTTGCTTCCCA R TCGCACGAGAGATAAAGTCA

102 aBased on the annotation of B. subtilis 168 genome. 103 dltA: D-alanine--poly(phosphoribitol) ligase subunit 1 rpsJ: 30S ribosomal protein S10 104 yocH: cell wall-binding protein cwlO: peptidoglycan D,L-endopeptidase 105 bForward (F) and reverse (R) primers. 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146

147 Figure. S1. Effects of TBBPA on yocH and cwlO mRNA. Bs168 was grown to an OD600 of 0.6- 148 0.8 and incubated for 90 min with the addition of different concentrations of TBBPA. Mean 149 values from three different experiments are shown. The error bars indicate ±standard deviations. 150 The results shown are representative of experiments performed at least three times. 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 Figure. S2: The schematic diagram of the proposed processes involved in cell wall damage caused 194 by TBBPA. ATO:Alditol; LTA:lipid teichoic acid; WTA: wall teichoic acid 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 References 223 [1] C. Wang, L. Wang, Y. Wang, Y. Liang, J. Zhang, Environmental Earth Sciences 2012, 1-7. 224 [2] T. M. Menzel, M. Tischer, P. Francois, J. Nickel, J. Schrenzel, H. Bruhn, A. Albrecht, L. Lehmann, U. 225 Holzgrabe, K. Ohlsen, Antimicrob Agents Chemother 2011, 55, 311-320. 226 [3] Y. Zhu, F. Ji, H. Shang, Q. Zhu, P. Wang, C. Xu, Y. Deng, D. Peng, L. Ruan, M. Sun, PloS one 2011, 6, 227 e27164. 228 [4] T. Wecke, B. Veith, A. Ehrenreich, T. Mascher, Journal of bacteriology 2006, 188, 7500-7511. 229 [5] N. T. Reichmann, C. P. Cassona, A. Grundling, Microbiology 2013, 159, 1868-1877. 230 [6] H. Yonus, P. Neumann, S. Zimmermann, J. J. May, M. A. Marahiel, M. T. Stubbs, J. Bio. Chem 2008, 283, 231 32484-32491. 232 [7] S. P. Falk, J. W. Noah, B. Weisblum, Antimicrob. Agents. Chemother 2010, 54, 3723-3729. 233 [8] a) F. C. Neuhaus, J. Baddiley, Microb. Mol. Bio. Rev 2003, 67, 686-723; b) A. Steen, E. Palumbo, M. 234 Deghorain, P. S. Cocconcelli, J. Delcour, O. P. Kuipers, J. Kok, G. Buist, P. Hols, J. Bacteriol 2005, 187, 114-124; 235 c) J. Wecke, M. Perego, W. Fischer, Microb. Drug. Resist 1996, 2, 123-129

236

237

238