Gene Molecular Characterization and Expression Analysis of Heat Shock

Gene 627 (2017) 15–25

Contents lists available at ScienceDirect

Gene

journal homepage: www.elsevier.com/locate/gene

Research paper Molecular characterization and expression analysis of heat shock protein 70 MARK and 90 from Hermetia illucens reared in a food waste bioconversion pilot plant

⁎ Alessia Giannettoa, , Sabrina Olivaa, Lorenzo Mazzaa, Giovanni Mondellob, Domenico Savastanoc, Angela Mauceria, Salvatore Fasuloa a Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, Viale F. Stagno d'Alcontres n. 31, 98166 Messina, Italy b Department of Economics, University of Messina, Piazza Pugliatti n. 1, 98122 Messina, Italy c Biosistemi Srls, SS 111 n. 68, 89013 Gioia Tauro, Italy

ARTICLE INFO ABSTRACT

Keywords: Two full-length cDNAs of heat shock protein (HSP) genes (Hihsp70 and Hihsp90) were cloned from the black Black soldier fly soldier fly (BSF) Hermetia illucens larvae reared in a food waste bioconversion pilot plant. The Hihsp70 and Gene expression Hihsp90 transcripts were 2243 and 2507 bp long, contained 1923 and 2166 bp open reading frames encoding HSP70 proteins of 640 and 721 amino acids with a molecular mass of 69.8 and 83 kDa, respectively. Comparative HSP90 analysis of protein sequences revealed the presence of the conserved HSP motifs in both proteins, showing high Phylogenetic analysis homology to their counterparts in other insect species from six different orders. Hihsp70 and Hihsp90 transcriptional expression profiles during two key developmental stages in the bioconversion process were evaluated by quantitative real time PCR showing that both genes were modulated during larval development. HiHsp70 mRNA expression levels during the II instar larvae was higher in respect to the V instar larvae. A similar difference in mRNA expression levels, but in a less extent, was found for the Hihsp90. Moreover, a diverse transcript level between the two genes at the V larval stage was observed where Hihsp90 was up-regulated compared to Hihsp70. These results suggested the involvement of Hsp70 and Hsp90 in H. illucens development and provide further evidences on the ecological and evolutionary importance of HSPs in the insect developmental processes together with valuable information on molecular features of adaptability to peculiar rearing conditions during food waste bioconversion.

1. Introduction cracks and crevices near larval habitat, and die within hours (Tomberlin et al., 2002a). Lifespan of H. illucens is sensitively influenced by several The black soldier fly (BSF), Hermetia illucens (Linneus 1758), is a physical parameters – i.e. temperature, relative humidity, lighting- and Diptera fly of the Stratiomyidae family, is native from the warm tem- rearing conditions – i.e. density, diet- (Oliveira et al., 2015; Tomberlin perate zone of America and it is now widespread in warmer regions et al., 2002b; Tomberlin et al., 2009). BSF larvae develop in decom- worldwide. Adults do not feed, except to take water, surviving on the posing organic matter such as fruit and vegetable waste, as well as large fat body stored during larval development (Diclaro and Kaufman, human and animal manure (Diener et al., 2009). Although the devel- 2009), therefore is not a potential carrier of diseases. Males aggregate at opmental timing strongly depends on the farming conditions, larvae lekking sites where they encounter flying females and within two days require approximately 14 days developing into prepupae going through of mating depending on the environmental conditions (Zhang et al., six instars corresponding to six molts. Before pupation, the sixth instar 2010), females lay a number of eggs ranged from 236 and 1088 (Diener larvae disperse from the feeding site to find a dry site for pupation et al., 2009; Diclaro and Kaufman, 2009; Samayoa et al., 2016) into dry (Tomberlin et al., 2009), the exoskeleton darkens and a pupa develops

Abbreviations: HSP, heat shock protein; HSP70, heat shock protein 70; HSP90, heat shock protein 90; BSF, black soldier fly; LCA, Life Cycle Assessment; RACE, rapid amplification of cDNA ends; UTR, untranslated region; ORF, open reading frame; NCBI, National Center for Biotechnology Information; qPCR, quantitative real time PCR; 18s, 18s ribosomal RNA; 16s, 16s ribosomal RNA; ef1-a, elongation factor; aa, amino acids; SE, standard error; ME, minimum evolution; ML, maximum likelihood; BLAST, Basic Local Alignment Search Tool; cDNA, complementary DNA ⁎ Corresponding author. E-mail address: [email protected] (A. Giannetto). http://dx.doi.org/10.1016/j.gene.2017.06.006 Received 21 February 2017; Received in revised form 29 May 2017; Accepted 5 June 2017 Available online 06 June 2017 0378-1119/ © 2017 Elsevier B.V. All rights reserved. A. Giannetto et al. Gene 627 (2017) 15–25 within two weeks. Developmental stage of the BSF larvae is sig- features among organism; the gene lacks introns, the highly conserved nificantly related to the head capsule width and body weight. Larval aminoterminal region corresponds to an ATP binding domain while the instars can be distinguished by the naked eye based on the larval size carboxy terminal domain corresponds to the substrate binding domain. but it is hard and inaccurate to distinguish 1st and 2nd instar based on As an important member of the HSP protein family, the HSP90 protein the larval size because they are very similar; on the contrary, the head consists of four structural domains: a highly conserved N-terminal do- capsule width can be divided into six significantly different sizes that main of ~25 kDa, a “charged linker” region, that connects the N-ter- could be useful for better verify the six instars in the BSF larvae (Kim minus with the middle domain, a middle domain of ~40 kDa and a C- et al., 2010). terminal domain of ~12 kDa. The MEEVD motif at the C-terminal end In modern times, insects are emerging as promising solution for feed was considered functional and characteristic of cytosolic HSP90 (Chen and food and recent literature reports on the nutritive composition of et al., 2006). insects and their potentiality of utilisation as a source of protein both The molecular characterization of cDNAs encoding HSP70 and for human consumption and animal feeding (Bukkens, 1997; Rumpold HSP90 have been described in almost all living organisms including and Schluter, 2013; van Huis, 2013) or as a source of lipids for biodiesel insects belonging to different orders, as well as their expression pattern production (Manzano-Agugliaro et al., 2012; Yang and Liu, 2014; in response to environmental stressors, such as physical stimuli, toxic Zheng et al., 2012); moreover, studies on the environmental con- and carcinogenic compounds, pesticides, heavy metals, and infection sequences associated with their mass-rearing are just in infancy (Chen et al., 2014; Colinet and Hoffmann, 2010; Mahmood et al., 2014; (Oonincx and de Boer, 2012; Salomone et al., 2017; van Zanten et al., Morales et al., 2011; Parsell and Lindquist, 1993; Xu et al., 2011). 2015). In particular, Hermetia illucens represents a potential valuable In insect hsps genes are induced and modulated in response to en- solution in the context of food waste valorisation as mass-reared insects vironmental factors including abiotic (elevated temperature, ultraviolet can be used as a protein source for the livestock sector or as a fat-rich radiations, drought and dehydration, metal, nutrient, hypoxia) and resource for other purposes, such as the production of biodiesel. biotic (parasites and pathogens) stresses (Zhao and Jones, 2012). More In our previous paper (Salomone et al., 2017) we measured the 42% recent evidences suggest the involvement of HSPs during embryogen- of protein and 35% of crude fat (% on dry matter) in H. illucens pre- esis and morphogenesis of several insects species. It has been demon- pupae reared on food waste in a pilot plant located in Southern Italy strated that hsps genes expression is closely regulated during larval (Biosistemi srls) able to convert to 30 tonnes/day of food waste pro- stage development in Tribolium castaneum (Mahroof et al., 2005), Spo- ducing 930 Kg/day of dried larvae and 9990 Kg/day of larvae manure. doptera exigua (Jiang et al., 2012), in two species of Chironomus Dried larvae resulted in a high value feed source rich in protein and fat, (Karouna-Renier et al., 2003), Spodoptera litura (Gu et al., 2012), Dro- experiencing high values of C16 and C18 fatty acid with the greatest sophila melanogaster (Craig et al., 1983; Michaud et al., 1997), Plutella potential for biodiesel production due to their high calorific value and xylostella (Sonoda et al., 2006) and other insects (Rybczynski and good potential viscosity. Moreover, chemical characterization of com- Gilbert, 2000; Zhao and Jones, 2012) where the hsps developmental post derived from food waste bioconversion process showed a good modulation is important for survival and adaptation to their environ- potential for this material to be used as a fertilizer being equivalent to a ments (Garbuz et al., 2008). commercial one in quality. Noteworthy, Life Cycle Assessment (LCA) Although the functions of insects HSPs related to their chaperone study on the bioconversion process by H. illucens in the “Biosistemi” activity in response to different environmental stressful conditions has pilot plant aimed to perform a balanced environmental evaluation widely been investigated, the information about their role during de- connected to the nutrient, protein and lipid contents of insect-based velopment and cellular differentiation remains unclear and need further products, showed a significant benefit of insect production mainly investigation. connected to Land Use (Salomone et al., 2017). The hsp genes have been cloned and sequenced from several insect The process of bioconversion by H. illucens is a very attractive op- species representing different insect orders. However, to date there is tion, considering that it represents a potential valuable solution to the no published information about the heat shock proteins gene sequences food waste management problem on the one hand and the rising of and their expression from H. illucens. global demand for feed on the other hand. For all these reasons, a more As hsps developmental modulation is important for survival and detailed studies on H. illucens biology and gene expression during larval adaptation to living environments, the aim of this study was to char- development is needful to better understand molecular and physiolo- acterize, for the first time, the complete hsp70 and hsp90 cDNA se- gical mechanisms that underlie larval development of such an im- quences (denoted as Hihsp70 and Hihsp90, respectively) of Hermetia il- portant insect whose products represent a very attractive potential for lucens and investigate their transcriptional response during two key quantity, quality and price. To the best of our knowledge, no data on larval developmental stages in the food waste bioconversion process. heat shock proteins (HSPs) sequences and gene expression during larval development are available. 2. Material and methods HSPs are evolutionarily conserved proteins in all living organisms that play important roles in the environmental adaptation. They exert a 2.1. H. illucens rearing and sample collection protective effect against a variety of stressful stimuli and are major determinants in the acquisition of thermo tolerance and stress re- The black soldier fly larvae were maintained and reared at sistance (Fasulo et al., 2010; Feder and Hofmann, 1999). In addition to 30 ± 1 °C and 60 ± 1% humidity on organic matter for 38 days in a their chaperone function during de novo synthesis of polypeptides or pilot plant for food waste bioconversion (Biosistemi srls) as extensively under stress conditions, HSPs are also involved in diverse specific cel- described by Salomone et al. (2017). Briefly, 4 days post hatching lular processes, including protein metabolism and homeostasis, signal larvae were fed with food waste coming from nine different munici- transduction, DNA replication, immune defense reactions, metabolic palities (organic fraction from urban waste collection and waste from detoxi(fication Pockley, 2003; Richter et al., 2010; Zhao and Jones, food chains). In order to allow the balanced composition of the sub- 2012). strate, organic waste entering in the plant was selected upstream, ra- HSPs are divided in five major subfamilies on the basis of their tionally alternating the FW sources. The average composition of the molecular weight, amino acid sequence homologies and functions: substrate was: 65% vegetal; 5% meat/fish; 25% bread/pasta/rice; 5% HSP100, HSP90, HSP70, HSP60 and the small HSP family (Joly et al., other. After the milling phase, the substrate was treated to let the excess 2010). water (50–55%) pour out, as detailed reported in Salomone et al. Among all HSPs, HSP70 and HSP90 are the most conserved and (2017). extensively studied proteins. The hsp70 genes share several common Fifteen larvae were randomly sampled at each investigated

16 A. Giannetto et al. Gene 627 (2017) 15–25

Table 1 Table 2 Primer sequences used in Hihsps transcript cloning. HSP70 gene family proteins used for the phylogenetic analysis of HiHSP70 deduced amino acid sequences with homologues from other species of insects deposited in the Gene Method Oligo name Primer sequence (5′ → 3′) NCBI database.

Hsp70 PCR hsp70_f TGAAGGARACSGCDGARGC Species Number of GenBank number Identity to H. hsp70_r WVTCCTTBGCYGABACATTS amino acid illucens (%) RACE sp1_r GCCAAGCAAGTTGTTGTCCT sp2_r GTTCGCTTGGCTCGTTCAG Anatolica polita borealis 653 ABQ39970.1 85 sp3_r GCTGCGAGTCGTTGAAGTAG Antheraea pernyi 634 ADI50267.1 81 sp5_f TTTGAGGGAGAACGAGCGAT Bactrocera minax 636 AIA62361.1 83 Hsp90 PCR hsp90_f TCTAYTCNKCBTACTTGRTCGC Bombyx mori 676 NP_001037396.1 83 hsp90_r TTGGTTACKGAVACVAGKGA Delia antiqua 643 AAY28732.1 81 RACE sp1_r ATGAGGTCCTGGCAGTTGTC Drosophila melanogaster 642 NP_731651.1 82 sp2_r CAGATGGGCTTGGTTTTGTTC Helicoverpa armigera 634 ADP37711.1 82 sp3_r GGTAGCGAATGAACTGCGAG Leptinotarsa 648 AHA36968.1 76 sp5_f TTGAGAGGTTGGCTGAAGACA decemlineata Liriomyza huidobrensis 642 AAW32098.2 83 Liriomyza sativae 638 AAW32099.2 83 developmental larval stage (II and V instars larvae) evaluated according Lucilia cuprina 636 AEF38376.1 82 Lygus hesperus 643 AFX84560.1 80 to parameters suggested by Kim et al. (2010). Triplicates were per- Macrocentrus cingulum 641 ACD84944.1 78 formed at each sampling point. Samples were collected, measured in Mamestra brassicae 638 BAF03555.1 82 total body weight and length, head capsule width and snap-frozen in Nilaparvata lugens 631 AFJ20626.1 81 liquid nitrogen prior to RNA extraction from whole H. illucens larvae. Omphisa fuscidentalis 638 ABP93405.1 80 The larval head capsule width was evaluated using a stereo microscope Oxya chinensis 640 AFN08643.1 77 Oxycera pardalina 639 ADJ96610.1 85 (SZ-ST, Olympus). Paratlanticus ussuriensis 669 AEP68850.1 81 Plutella xylostella 632 ADK39311.1 79 2.2. RNA extraction, reverse transcription and hsps transcripts isolation Quadrastichus 644 AFC76151.1 78 erythrinae Spodoptera exigua 667 ACQ78180.1 85 Total RNA was extracted from whole bodies using Qiazol Reagent Spodoptera litura 643 ADV03160.1 83 (Qiagen) following the manufacturer's instructions and the con- Stratiomys singularior 638 ACB59073.1 85 taminating genomic DNA was eliminated by using RNase-free DNase Tenebrio molitor 644 AFE88579.1 82 (Qiagen) following the protocol of the manufacturer. RNA quantity, purity and integrity were verified by both electrophoresis on 1.0% control PCR reactions. agarose gel and the UV absorbance ratio at 260 nm and 280 nm The products of 3′ and 5′ RACE were visualized on 1% agarose gel, (Nanodrop 2000, Thermo Scientific). cDNA was synthesized from 1 μg purified, cloned and sequenced in both directions as described above. of total RNA by QuantiTect reverse transcription kit (Qiagen) according to the manufacturer's protocol. Degenerate primers (Table 1) were designed on the conserved re- 2.4. Sequence and phylogenetic analysis gions of hsp70 and hsp90 genes isolated from other insect. The obtained PCR products were cloned and sequenced as described by Lazado et al. The obtained cDNA sequences and deduced amino acid sequences of (2014). HSPs were analyzed using the BLAST algorithm (http://www.ncbi.nlm. nih.gov/blast) and the Expert Protein Analysis System (http://www. 2.3. Cloning of the full-length cDNA of hsp70 and hsp90 by RACE expasy.org/). The functional protein domains were revealed comparing HiHSP70 and HiHSP90 protein sequences against the Conserved The full-length cDNA sequence of hsp70 and hsp90 genes were Domain Database (http://ncbi.nlm.nih.gov/cdd/). identified by employing the 5′/3′ RACE kit 2nd Generation (Roche), as In addition, the molecular masses and theoretical isoelectric points described by Giannetto et al. (2015).1μg of total RNA was extracted were predicted using the Compute pI/Mw tool (http://www.expasy. from whole H. illucens larvae and used to synthesize cDNA. PCR am- org/tools/pi_tool.html). plifications were performed with gene-specific primers designed against The ClustalW multiple alignment program was used to create the the obtained sequences (Table 1). multiple sequence alignment of HSP70 (Table 2) and HSP90 (Table 3) For determination of the 5′ end sequence of cDNAs, template cDNA amino acid sequences of H. illucens with those of other insects. was synthesized using specific (sp1) oligonucleotide primers (Table 1); The resulting multiple sequence alignments were used for minimum this synthesis was followed by purification using the High Pure PCR evolution (ME) phylogenetic analysis with MEGA5 software using a Product Purification Kit (Roche) and by subsequent dA-tailing of the mixed model of amino acid substitution and 1000 bootstrap replicates cDNA with dATP and the terminal transferase supplied in the RACE kit. (Tamura et al., 2011). Moreover maximum likelihood (ML) phyloge- The tailed cDNA was amplified using the oligo(dT)-anchor primer and a netic analysis (PhyML3.0, www.atgc-montpellier.fr/phyml) was also gene-specific (sp2) primer (Table 1); this was followed by further am- performed as described by Giannetto et al. (2013) using the LG sub- γ plification of the first-round PCR products with the anchor primer and a stitution model with 4 substitution rate categories and an estimated gene-specific (sp3) primer (Table 1), according to the manufacturer's shape parameter. Phylogenetic trees were represented using FigTree 1.4 fi instructions. software (http://tree.bio.ed.ac.uk/software/ gtree/). For the 3′ RACE, 1 μg of total RNA was reverse transcribed and the Protein sequences were further analyzed using the PRALINE align- first-strand cDNA directly amplified using specific sp5 forward primers. ment tool (Simossis and Heringa, 2005) to compare HiHSPs proteins PCR reactions for both 5′ and 3′ end amplifications were performed in a with the relative counterparts from Diptera. final volume of 50 μl using the Expand High Fidelity PCR System (Roche) as follow: initial denaturation at 94 °C for 2 min, 30 cycles of 2.5. Quantitative real time PCR 94 °C for 15 s, 60 °C for 30 s, 72 °C for 2 min, and a final elongation of 72 °C for 7 min. The expected specific single bands of 293 bp and Quantification of hsps gene expression in whole BSF larvae was 1026 bp (for 5′ RACE and 3′ RACE, respectively) were obtained from performed by real time PCR using the Rotor-Gene Q 2plex Hrm

17 A. Giannetto et al. Gene 627 (2017) 15–25

Table 3 3. Results HSP90 gene family proteins used for the phylogenetic analysis of HiHSP90 deduced amino acid sequences with homologues from other species of insects deposited in the 3.1. H. illucens larvae measurements NCBI database.

Species Number of GenBank number Identity to H. BSF larvae total body weight and length and head capsule width amino acid illucens (%) were measured during the investigated larval stages. Individual exuviae of BSF larvae were examined and used for the recognition of the II and Apis mellifera 724 NP_001153536 80 Apolygus lucorum 722 AGM20719.1 81 V larval instars as suggested by Kim et al. (2010). In our experimental Bactrocera dorsalis 715 AEJ88466.1 84 conditions larvae measured 91 mg weight, 4 mm length and 0.7 mm Camponotus floridanus 722 EFN72016.1 80 head capsule width after 4 days of rearing (II larval instar) and 220 mg Chilo suppressalis 717 BAE44307.1 82 weight, 14 mm length and 2 mm head capsule width after 13 days of Delia antiqua 717 CAI64494.1 84 rearing (V larval instar). Drosophila melanogaster 717 NP_523899.1 85 Gryllus firmus 723 ADK64952.1 82 Harpegnathos saltator 723 EFN88374.1 80 3.2. Cloning and sequence analysis of the hsps genes from H. illucens Helicoverpa armigera 717 ADM26743.1 81 Leptinotarsa 719 AHB18587.1 83 decemlineata The full-length cDNAs of Hihsp70 and Hihsp90 were successfully Liriomyza huidobrensis 714 AAW49252.2 85 obtained by the RACE method and the sequences were submitted to Liriomyza sativae 714 AAW49253.2 86 NCBI database (GenBank accession numbers: KY457331 and Locusta migratoria 718 AAS45246.2 80 Lygus hesperus 722 AFX84559.1 81 KY457332, respectively). Mamestra brassicae 717 BAF03554.1 82 The complete sequence of the Hihsp70 cDNA was 2243 bp, con- Omphisa fuscidentalis 716 ABP93404.1 82 taining a 5′ untranslated region (UTR) of 227 bp, a 3′ UTR of 93 bp and Ostrinia furnacalis 716 ADM26737.1 82 the open reading frame (ORF) encoded a polypeptide of 640 amino Oxya chinensis 724 AFN08644.1 79 acids (Fig. 1) with a calculated molecular mass of 69.8 kDa and the Oxycera pardalina 724 AER28023.1 90 Paratlanticus ussuriensis 727 AFP54306.1 81 predicted isoelectric point was 5.25. Propylea japonica 716 AHW57925.1 81 The obtained full-length Hihsp90 sequence was 2507 bp, containing Quadrastichus 721 AFC76152.1 78 a5′ untranslated region (UTR) of 216 bp, a 3′ UTR of 125 bp and the erythrinae open reading frame (ORF) encoded a polypeptide of 721 amino acids Spodoptera litura 717 ADK55516.1 82 Stratiomys singularior 719 AER28025.1 92 (Fig. 2). The calculated molecular mass of HiHSP90 was 83 kDa and the Tenebrio molitor 721 AFN02497.1 82 predicted isoelectric point was 5.04. thermocycler (Qiagen) with SYBR Green chemistry (Qiagen) and pri- 3.3. Multiple sequence alignment and phylogenetic analysis mers listed in Table 4. qPCR primers were designed using the Beacon Designer TM online tool (http://www.premierbiosoft.com/qOligo/ Blast and ClustalW analyses indicated that the deduced amino acid fi Oligo.jsp?PID=1) for the target and reference genes analyzed. sequences of HiHSP70 and HiHSP90 shared a signi cant identity with In each reaction, twenty-fold diluted cDNA samples were run in other HSPs from insects deposited at NCBI database. Similarity para- duplicate together with no template and minus reverse transcriptase meters showed E value 0.0, query cover 100% with a total score in the – – controls. The PCR efficiency was determined as detailed by Fernandes 1107 1199 range (HSP70) and 1213 1305 range (HSP90) among the fi et al. (2006). The 18s (18s ribosomal RNA), 16s (16s ribosomal RNA) and rst 20 sequences retrieved from the blast search. elongation factor(ef1-a) were used as reference genes and the normal- The deduced amino acid sequence of HiHSP70 presented a high ization factor from the two most stable genes (calculated by geNorm degree of similarity with other insects, sharing 85% identity with software, http://medgen.ugent.be/~jvdesomp/genorm/), 16s and ef1- Oxycera pardalina (ADJ96610.1) and Stratiomys singularior (ACB59073. fl a, was used in order to correct the raw target gene data as described by 1) soldier ies from Stratiomyidae family (Table 2). Giannetto et al. (2014). Single-peak melting curves were used to eval- Multiple sequence alignment of HSP70 proteins revealed a high uate the specificity of the reaction. degree of conservation, particularly in the N-terminal and in the middle The one-way analysis of variance (ANOVA) and the Tukey's post hoc regions. Alignment of proteins from insects revealed that HiHSP70s test were used to test for statistically significant differences in the re- have three highly conserved signatures of the HSP70 gene family, in- lative mRNA quantities among larval stages. Statistical analyses were cluding IDLGTTYS, IFDLGGGTFDVS(I/L)LT and (I/V)V(M/L) – – – performed using SPSS v14.0 software (SPSS Inc., USA) and the level of VGGSTRIPKVQ at amino acid positions 6 13, 194 208 and 332 345, significance was set at p < 0.05. respectively. A putative ATP/GTP binding site motif AEAYLG(T/K)T is located at position 128–135. Furthermore, HiHSP70 has an EEVD motif at its C terminus. Comparison of HiHSP70 protein sequences with homologues from Diptera revealed typical amino acid substitutions in the characteristic signatures (Fig. S1). Conserved domain search showed that HiHSP70 is characterized by the NBD_Sugar-Kinase_HSP70_Actin Superfamily domain at the amino

Table 4 List of primers used in quantitative real time PCR and qPCR eﬃciencies (E%).

Primer Forward (5′ → 3′) Reverse (5′ → 3′) Size (bp) E (%)

qHihsp70 ATTTGAGGGAGAACGAGCGA CCTTTGCCGAGACATTGAGA 149 99.7 qHihsp90 GTTCTACGACCAGTTCAGCAAG TCGTTCAAGGAGCAGTATTCG 129 99.6 qHief1-a TATGGTTGTCGTCTTCGCC GGATGGTTGAGCACGATGA 225 99.2 qHi16S AGCCTGCCCACTGATTGTTT CGTTCAGCCATTCATACAAGC 102 99.5 qHi18S GGAAGCGTATTATCGGTGGAGT CAATGCCCCCAACTGCTTCTA 264 99.6

18 A. Giannetto et al. Gene 627 (2017) 15–25

Fig. 1. Nucleotide and deduced amino acid sequences of H. illucens Hihsp70 cDNA. The conserved regions representing signature amino acid sequences of the HSP70 family are in bold and blue. The star represents the stop codon. The characteristic HSP cytoplasmic carboxyl terminal region (EEVD) and the conserved tetrapeptide repeat (GGMP) are boxed. The characteristic HSPA1-2_6-8-like_NBD domain is underlined. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) acid residues 3–379 (Fig. 1). Moreover, all 27 residues composing the five highly conserved signature sequences specific of the HSP90 family nucleotide binding site, all 18 residues composing the BAG/HSP70 in- in eukaryotes: NKEIFLRELISN(S/A)SDALDKIR, LGTIA(K/R)SGT, teraction site and all 24 residues composing the NEF/HSP70 interaction IGQFGVGFYS(A/C)(Y/F)LVAD, IKLYVRRVFI and (D/G)VVD(Y/S)EDL site on conserved domain HSPA1-2_6-8-like_NBD, have been mapped to (S/P)LN(L/I)S(L/R)E at the amino acid positions 31–51, 98–106, the HSP70 protein sequence from H. illucens. 122–137, 348–357 and 374–388, respectively. Moreover, at the C-ter- Results from blast search showed that the deduced amino acid se- minus, the motif MEEVD is the terminal amino acid sequence. HiHSP90 quence of HiHSP90 shared a significant identity of 92% to Stratiomys protein sequences were compared with homologues from Diptera singularior (AER28025.1) and 90% to Oxycera pardalina (AER28023.1) showing characteristic amino acid substitutions in the conserved motifs (Table 3). of HSP90 family (Fig. S2). Multiple sequence alignment of HiHSP90 with known members of Conserved domain search showed that HiHSP90 is characterized by the HSP90 family from insects showed that HiHSP90 is characterized by two domains, the HSP90 Superfamily domain at amino acid residues

19 A. Giannetto et al. Gene 627 (2017) 15–25

Fig. 2. Nucleotide and deduced amino acid sequences of H. illucens Hihsp90 cDNA. The conserved regions representing signature amino acid sequences of the HSP90 family are in bold and blue. The star represents the codon stop. The characteristic HSP cytoplasmic carboxyl terminal region (MEEVD) is boxed. The HATPase_C and HSP90 superfamily domains are underlined and dotted underlined, respectively. (For interpretation of the references to colour in this ﬁgure legend, the reader is referred to the web version of this article.)

187–710, and the Histidine kinase-like ATPase_c Superfamily been found in the HiHSP90 amino acid sequence. (HATPase_c) domain at amino acid residues 31–182 (Fig. 2). Moreover, To explore the evolutionary relationship of the HSPs proteins, a in the HATPase_c domain all residues that compose the ATP binding site phylogenetic analysis of each family was performed comparing the full- (17 aa), the Mg2+ binding site (1 aa) and the G-X-G motif (4 aa) have length amino acid sequences from H. illucens cloned in this study with

20 A. Giannetto et al. Gene 627 (2017) 15–25

Fig. 3. Phylogenetic analysis of HSP70 protein sequences from six orders of insect. Numbers at the nodes indicate posterior probability values obtained from ME analysis (in black) and approximate likelihood-ratio values obtained from ML analysis (in blue). Only values higher than 50 and 0.5 are showed for ME and ML analyses, respectively. Accession number of sequences is indicated in Table 2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) their counterparts in other insect species from Coleoptera, Diptera, 3.4. Hihsp70 and Hihsp90 gene expression profile at different Hemiptera, Hymenoptera, Lepidoptera and Orthoptera orders. developmental stages Names and accession numbers of the protein sequences used to evaluate the homology relationships are given in Table 2 (HSP70) and The relative mRNA expression levels of Hihsp70 and Hihsp90 during Table 3 (HSP90). the II and V larval stages were quantified by real time quantitative PCR. Both ME and ML phylogenetic analyses of HSPs proteins showed Both genes were differently expressed depending on the larvae devel- comparable tree topology characterized by six different branches, opment (Fig. 5). Hihsp70 was 3 times over-expressed during the II instar which contained the insects belonging to the same order. larvae in respect to the V instar larvae (p < 0.05). A similar difference The phylogenetic tree of HSP70 proteins revealed that the twenty- in mRNA expression levels, but in a less extent, was found for the six amino acid sequences employed for the analysis were clearly di- Hihsp90 where the gene was expressed 1.5 times less in the V instar vided in different clades and HiHSP70 clustered with proteins from compared to the II instar (p < 0.05). Moreover, a diverse transcript Diptera (Fig. 3). Moreover HSP70 proteins from Diptera were more level between the two genes at the V larval stage was observed where closely related to Hemiptera and Orthoptera respect to the other orders. Hihsp90 was 2.3 times up-regulated compared to Hihsp70 (p < 0.01). Twenty-seven full length HSP90 amino acid sequences were used for On the contrary, no significant difference between Hihsp70 and Hihsp90 phylogenetic analysis and tree construction. H. illucens HSP90 protein gene expression in the II instar larvae was detected. clustered with the appropriate HSP90 homologues from Diptera (Fig. 4). Sequences from Lepidoptera were also more closely related to each other than to any other insect order. 4. Discussion

Living organisms, including insects, have the ability to adapt to

21 A. Giannetto et al. Gene 627 (2017) 15–25

Fig. 4. Phylogenetic analysis of HSP90 protein sequences from six orders of insect. Numbers at the nodes indicate posterior probability values obtained from ME analysis and approximate likelihood-ratio values obtained from ML analysis. Only values higher than 50 and 0.5 are showed for ME and ML analyses, respectively. Accession number of sequences is indicated in Table 3. different environments using physiological and molecular mechanisms The coding sequence of the H. illucens hsp70 and hsp90 and the re- to cope with a range of environmental stimuli. lative deduced proteins conserved the typical motifs that have been Heat shock proteins are among the most ancient and highly con- previously described (Sonoda et al., 2006). At the amino acid level they served proteins in all living organisms. Homologues of HSPs have been shared a high level of identity with the homologous proteins of Stra- identified in every species and their role in fundamental cellular pro- tiomys singularior and Oxycera pardalina soldier flies from Stratiomyidae cesses has widely been documented (Pearl and Prodromou, 2006). Hsps family. genes encode a family of proteins involved in the adaptation to en- The members of the HSP70 family are found to be present in the vironmental changes and early studies documented their induction in cytoplasm, mitochondria, endoplasmic reticulum, and chloroplast de- response to various stresses. pending on the sequences specific to each cellular organelle; in parti- In our study, two full length Hihsp70 and Hihsp90 cDNAs were cular, the cytoplasmic HSP70 has the specific motif EEVD. The COOH- identified and cloned by an RT-PCR and RACE strategy from Hermetia terminal amino acid sequence Glu-Glu-Val-Asp (EEVD), which is con- illucens reared in a pilot plant for food waste bioconversion and their served in nearly all eukaryotic cytosolic HSP70s, was identified at the expression patterns during different developmental stages was eval- C-termini of both HiHSP70 (forego by isoleucine amino acid) and uated by real time quantitative PCR. HiHSP90 (forego by methionine amino acid). This terminal region is The attempt to amplify hsp70 and hsp90 cDNA by using degenerate essential for the association of HSP70 with co-factors that modulate the primers designed from conserved regions found in other insects species chaperone activity (Karouna-Renier et al., 2003). was successful, suggesting that H. illucens hsp70 and hsp90 genes are The three highly conserved signatures of the HSP70 gene family highly conserved with those of previously described insects. found in HiHSP70 have been identified in most members of the HSP70

22 A. Giannetto et al. Gene 627 (2017) 15–25

Fig. 5. Hihsp70 and hihsp90 relative gene expression during II and V larval stages. Data are presented as mean ± SE (n = 6). Different upper case and lower case letters refer to significant differences between larval stages in gene expression of hsp70 and hsp90, respectively. Star represents significant difference (p < 0.05) between hsp70 and hsp90 gene expression in the V larval stage.

family of proteins. Moreover, the ATP-GTP binding site motif probably related to maintain normal metabolism during the period (AEAYLGKT) located at position 128–135 in the N-terminal region of H. when the larvae are actively feeding and growing (Rinehart et al., illucens sequence was detected; this signal, was characterized by an 2006). The involvement of hsp70 and hsp90 in developmental processes abundance of the basic amino acids lysine and arginine, that are need has been reported in earlier studies mainly limited to model insects, for the selective translocation of HSP70 into the nucleus (Karouna- such as D. melanogaster where the expression levels of hsps change Renier et al., 2003). Among the conserved domains identified in during development (Craig et al., 1983). Consistently with our results, HiHSP70 amino acid sequence, the ATPase domain was the most con- more recently, it has been found that the expression of hsp90, hsp60 and served. Interestingly, the conserved tetrapeptide repeat (GGMP) that small hsps occurred throughout the developmental cycle of Liriomyza mediates the association of HSP70 with HSP90 into a multichaperone sativae, with expression levels varying significantly among different complex previously found in other species (Morales et al., 2011; Rhee developmental stages (Huang et al., 2009). Results reported in this et al., 2009; Wang et al., 2015) was identified. study showing the decrease in both hsps expression levels in the V instar As found in HSP90s from other species, HiHSP90 contains an N- larvae stage could be imputable to the change of feeding habit of domain possessing a deep ATP binding pocket, a middle domain with a Hermetia illucens that, at this age, stop feeding before pupation altering major site for client protein interaction forming a catalytic site that its metabolisms; consequently, it may be inferred that the modulation of interacts with ATP bound in the N-domain and a C-domain that plays an Hihsp70 and Hihsp90 expression during different developmental stages essential role in HSP90 dimerization (Pearl and Prodromou, 2006). The can be also related to change in metabolic rates as recently reviewed by linker region between the N and middle domains consist of highly Storey and Storey (2011). charged amino acids, but it is not essential for HSP90 function. Phylogenetic analysis of HiHSP70 and HiHSP90 proteins and their corresponding homologues from seven major insect taxa revealed a 5. Conclusions high degree of conservation. Although HSP family genes have been characterized from animals Our data showed that HSP70 and HSP90 proteins from Hermetia belonging to different orders, the role of heat shock proteins in devel- illucens share characteristic signature sequences with their counterparts opment is far less understood and little is known about the specific from insects belonging to different orders confirming that HSPs are functions of hsps genes in insect development processes. evolutionary conserved and ancient proteins. Besides, the molecular Specifically, they play vital roles in cell differentiation, cell cycle characterization of both the full-length cDNAs gives further insights regulation and embryonic development (de Andrade et al., 2009; into the elucidation of the Whole-genome shotgun contigs (wgs) Mahroof et al., 2005; Tachibana et al., 2005; Zhang and Denlinger, available from the NCBI database. Moreover, the expression of Hihsp70 2010). It has been reported that transcripts of hsps are involved in ga- and Hihsp90 genes, herein cloned and characterized, is modulated metogenesis and embryonic development in Drosophila (Joanisse et al., during two key larval stages in the food waste bioconversion process 1998), and in insect diapause (Flannagan et al., 1998; Rinehart et al., suggesting their involvement in H. illucens development. Taken together 2007; Rinehart et al., 2000; Yocum et al., 1998; Zhang and Denlinger, these results provide further evidences on the ecological and evolu- 2010). tionary importance of HSPs in the insect developmental processes The results presented here for Hihsp transcripts from Hermetia illu- (Feder and Hofmann, 1999; Gross et al., 2009; Huang et al., 2009; Karl cens clearly demonstrate that Hihsp70 and Hihsp90 expression is et al., 2009). modulated during the investigated developmental stages. Particularly, Nevertheless, this report gives important functional information on Hihsp70 showed a significantly over expression during the II instar gene expression in BSF, a promising insect species that represents a new larvae in respect to the V instar larvae and a similar trend of expression low-impact environmental strategy for food waste valorisation and a was found for the Hihsp90. Moreover, a diverse expression pattern be- very attractive resource for insect-based products that can be im- tween the two genes at the V larval stage was observed where Hihsp90 plemented on an industrial scale in the next future. was up-regulated compared to Hihsp70. These results suggest the in- Supplementary data to this article can be found online at http://dx. volvement of both genes in metabolic processes that control larval de- doi.org/10.1016/j.gene.2017.06.006. velopment in BSF highlighting that hsps genes have different functions

23 A. Giannetto et al. Gene 627 (2017) 15–25

Funding 2014. Daily rhythmicity of clock gene transcripts in Atlantic cod fast skeletal muscle. PLoS One 9, e99172. Mahmood, K., Jadoon, S., Mahmood, Q., Irshad, M., Hussain, J., 2014. Synergistic effects This research did not receive any specific grant from funding of toxic elements on heat shock proteins. Biomed. Res. Int. http://dx.doi.org/10. agencies in the public, commercial, or not-for-profit sectors. 1155/2014/564136. Mahroof, R., Yan Zhu, K., Neven, L., Subramanyam, B., Bai, J., 2005. Expression patterns of three heat shock protein 70 genes among developmental stages of the red flour References beetle, Tribolium castaneum (Coleoptera: Tenebrionidae). Comp. Biochem. Physiol. A 141, 247–256. Manzano-Agugliaro, F., Sanchez-Muros, M.J., Barroso, F.G., Martinez-Sanchez, A., Rojo, de Andrade, A., Siviero, F., Rezende-Teixeira, P., Santelli, R.V., Machado-Santelli, G.M., S., Perez-Banon, C., 2012. Insects for biodiesel production. Renew. Sust. Energ. Rev. 2009. Molecular characterization of a putative heat shock protein cognate gene in 16, 3744–3753. Rhynchosciara americana. Chromosom. Res. 17, 935–945. Michaud, S., Marin, R., Tanguay, R.M., 1997. Regulation of heat shock gene induction Bukkens, S.G.F., 1997. The nutritional value of edible insects. Ecol. Food Nutr. 36, and expression during Drosophila development. Cell. Mol. Life Sci. 53, 104–113. 287–319. Morales, M., Planelló, R., Martínez-Paz, P., Herrero, O., Cortés, E., Martínez-Guitarte, J.L., Chen, B., Zhong, D., Monteiro, A., 2006. Comparative genomics and evolution of the Morcillo, G., 2011. Characterization of Hsp70 gene in Chironomus riparius: expression HSP90 family of genes across all kingdoms of organisms. BMC Genomics 7, 156. in response to endocrine disrupting pollutants as a marker of ecotoxicological stress. Chen, H., Xu, X.L., Li, Y.P., Wu, J.X., 2014. Characterization of heat shock protein 90, 70 Comp. Biochem. Physiol. C 153, 150–158. and their transcriptional expression patterns on high temperature in adult of Oliveira, F., Doelle, K., List, R., O'Reilly, J.R., 2015. Assessment of Diptera: Stratiomyidae, Grapholita molesta (Busck). Insect Sci. 21, 439–448. genus Hermetia illucens (L., 1758) using electron microscopy. J. Entomol. Zool. Stud. Colinet, H., Hoffmann, A., 2010. Gene and protein expression of Drosophila Starvin during 3, 147–152. cold stress and recovery from chill coma. Insect Biochem. Mol. Biol. 40, 425–428. Oonincx, D.G., de Boer, I.J., 2012. Environmental impact of the production of mealworms Craig, E.A., Ingolia, T.D., Manseau, L.J., 1983. Expression of Drosophila heat-shock cog- as a protein source for humans - a life cycle assessment. PLoS One 7, e51145. nate genes during heat shock and development. Dev. Biol. 99, 418–426. Parsell, D.A., Lindquist, S., 1993. The function of heat-shock proteins in stress tolerance: Diclaro II, J.W., Kaufman, P.E., 2009. Black soldier fly Hermetia illucens Linnaeus (Insecta: degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27, 437–496. Diptera: Stratiomyidae). In: EENY 461. Entomology and Nematology Department, Pearl, L.H., Prodromou, C., 2006. Structure and mechanism of the Hsp90 molecular Florida Cooperative Extension Service, Institute of Food and Agricoltural Sciences, chaperone machinery. Annu. Rev. Biochem. 75, 271–294. University of Florida. Pockley, A.G., 2003. Heat shock proteins as regulators of the immune response. Lancet Diener, S., Zurbrugg, C., Tockner, K., 2009. Conversion of organic material by black 362, 469–476. soldier fly larvae: establishing optimal feeding rates. Waste Manag. Res. 27, 603–610. Rhee, J.S., Raisuddin, S., Lee, K.W., Seo, J.S., Ki, J.S., Kim, I.C., 2009. Heat shock protein Fasulo, S., Mauceri, A., Maisano, M., Giannetto, A., Parrino, V., Gennuso, F., D'Agata, A., (Hsp) gene responses of the intertidal copepod Tigriopus japonicus to environmental 2010. Immunohistochemical and molecular biomarkers in Coris julis exposed to en- toxicants. Comp. Biochem. Physiol. C 149, 104–112. vironmental contaminants. Ecotoxicol. Environ. Saf. 73, 873–882. Richter, K., Haslbeck, M., Buchner, J., 2010. The heat shock response: life on the verge of Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the death. Mol. Cell 40, 253–266. stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, Rinehart, J.P., Yocum, G.D., Denlinger, D.L., 2000. Developmental upregulation of in- 243–282. ducible hsp70 transcripts, but not the cognate form, during pupal diapause in the Fernandes, J.M.O., MacKenzie, M.G., Wright, P.A., Steele, S.L., Suzuki, Y., Kinghorn, J.R., flesh fly, Sarcophaga crassipalpis. Insect Biochem. Mol. Biol. 30, 515–521. Johnston, I.A., 2006. Myogenin in model pufferfish species: comparative genomic Rinehart, J.P., Hayward, S.A., Elnitsky, M.A., Sandro, L.H., Lee, R.E., Denlinger, D.L., analysis and thermal plasticity of expression during early development. Comp. 2006. Continuous up-regulation of heat shock proteins in larvae, but not adults, of a Biochem. Physiol. D 1, 35–45. polar insect. Proc. Natl. Acad. Sci. U. S. A. 103, 14223–14227. Flannagan, R.D., Tammariello, S.P., Joplin, K.H., Cikra-Ireland, R.A., Yocum, G.D., Rinehart, J.P., Li, A., Yocum, G.D., Robich, R.M., Hayward, S.A., Denlinger, D.L., 2007. Denlinger, D.L., 1998. Diapause-specific gene expression in pupae of the flesh fly Up-regulation of heat shock proteins is essential for cold survival during insect dia- Sarcophaga crassipalpis. Proc. Natl. Acad. Sci. U. S. A. 95, 5616–5620. pause. Proc. Natl. Acad. Sci. U. S. A. 104, 11130–11137. Garbuz, D.G., Zatsepina, O.G., Przhiboro, A.A., Yushenova, I., Guzhova, I.V., Evgen'ev, Rumpold, B.A., Schluter, O.K., 2013. Nutritional composition and safety aspects of edible M.B., 2008. Larvae of related Diptera species from thermally contrasting habitats insects. Mol. Nutr. Food Res. 57, 802–823. exhibit continuous up-regulation of heat shock proteins and high thermotolerance. Rybczynski, R., Gilbert, L.I., 2000. cDNA cloning and expression of a hormone-regulated Mol. Ecol. 17, 4763–4777. heat shock protein (hsc 70) from the prothoracic gland of Manduca sexta. Insect Giannetto, A., Nagasawa, K., Fasulo, S., Fernandes, J.M.O., 2013. Influence of photo- Biochem. Mol. Biol. 30, 579–589. period on expression of DNA (cytosine-5) methyltransferases in Atlantic cod. Gene Salomone, R., Saija, G., Mondello, G., Giannetto, A., Fasulo, S., Savastano, D., 2017. 519, 222–230. Environmental impact of food waste bioconversion by insects: application of life Giannetto, A., Fernandes, J.M.O., Nagasawa, K., Mauceri, A., Maisano, M., De Domenico, cycle assessment to process using Hermetia illucens. J. Clean. Prod. 140, 890–905. E., Cappello, T., Oliva, S., Fasulo, S., 2014. Influence of continuous light treatment on Samayoa, A.C., Chen, W.T., Hwang, S.Y., 2016. Survival and development of Hermetia expression of stress biomarkers in Atlantic cod. Dev. Comp. Immunol. 44, 30–40. illucens (Diptera: Stratiomyidae): a biodegradation agent of organic waste. J. Econ. Giannetto, A., Maisano, M., Cappello, T., Oliva, S., Parrino, V., Natalotto, A., De Marco, Entomol. 109, 2580–2585. G., Barberi, C., Romeo, O., Mauceri, A., Fasulo, S., 2015. Hypoxia-inducible factor Simossis, V.A., Heringa, J., 2005. PRALINE: a multiple sequence alignment toolbox that alpha and Hif-prolyl hydroxylase characterization and gene expression in short-time integrates homology-extended and secondary structure information. Nucleic Acids air-exposed Mytilus galloprovincialis. Mar. Biotechnol. 17, 768–781. Res. 33, W289–W294. Gross, T.L., Myles, K.M., Adelman, Z.N., 2009. Identification and characterization of heat Sonoda, S., Ashfaq, M., Tsumuki, H., 2006. Cloning and nucleonde sequencing of three shock 70 genes in Aedes aegypti (Diptera: Culicidae). J. Med. Entomol. 46, 496–504. heat shock protein genes (hsp90, hsc70, and hsp19.5) from the diamondback moth, Gu, J., Huang, L.X., Shen, Y., Huang, L.H., Feng, Q.L., 2012. Hsp70 and small Hsps are the Plutella xylostella (L.) and their expression in relation to developmental stage and major heat shock protein members involved in midgut metamorphosis in the common temperature. Arch. Insect Biochem. Physiol. 62, 80–90. cutworm, Spodoptera litura. Insect Mol. Biol. 21, 535–543. Storey, K.B., Storey, J.M., 2011. Heat shock proteins and hypometabolism: adaptive Huang, L.H., Wang, C.Z., Kang, L., 2009. Cloning and expression of five heat shock strategy for proteome preservation. Res. Rep. Biol. 2, 57–68. protein genes in relation to cold hardening and development in the leafminer, Tachibana, S., Numata, H., Goto, S.G., 2005. Gene expression of heat-shock proteins Liriomyza sativa. J. Insect Physiol. 55, 279–285. (Hsp23, Hsp70 and Hsp90) during and after larval diapause in the blow fly Lucilia van Huis, A., 2013. Potential of insects as food and feed in assuring food security. Annu. sericata. J. Insect Physiol. 51, 641–647. Rev. Entomol. 58, 563–583. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Jiang, X.F., Zhai, H.F., Wang, L., Luo, L.Z., Sappington, T.W., Zhang, L., 2012. Cloning of molecular evolutionary genetics analysis using maximum likelihood, evolutionary the heat shock protein 90 and 70 genes from the beet armyworm, Spodoptera exigua, distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. and expression characteristics in relation to thermal stress and development. Cell Tomberlin, J.K., Sheppard, D.C., Joyce, J.A., 2002a. Susceptibility of black soldier fly Stress Chaperones 17, 67–80. (Diptera: Stratiomyidae) larvae and adults to four insecticides. J. Econ. Entomol. 95, Joanisse, D.R., Inaguma, Y., Tanguay, R.M., 1998. Cloning and developmental expression 598–602. of a nuclear ubiquitin-conjugating enzyme (DmUbc9) that interacts with small heat Tomberlin, J.K., Sheppard, C., Joyce, J.A., 2002b. Selected life-history traits of black shock proteins in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 244, soldier flies (Diptera: Stratiomyidae) reared on three artificial diets. Ann. Entomol. 102–109. Soc. Am. 95, 379–386. Joly, A.L., Wettstein, G., Mignot, G., Ghiringhelli, F., Garrido, C., 2010. Dual role of heat Tomberlin, J.K., Adler, P.H., Myers, H.M., 2009. Development of the black soldier fly shock proteins as regulators of apoptosis and innate immunity. J. Innate Immun. 2, (Diptera: Stratiomyidae) in relation to temperature. Environ. Entomol. 38, 930–934. 238–247. Wang, L., Yang, S., Zhao, K., Han, L., 2015. Expression profiles of the heat shock protein Karl, I., Sorensen, J.G., Loeschcke, V., Fischer, K., 2009. HSP70 expression in the Copper 70 gene in response to heat stress in Agrotis c-nigrum (Lepidoptera: Noctuidae). J. butterfly Lycaena tityrus across altitudes and temperatures. J. Evol. Biol. 22, 172–178. Insect Sci. http://dx.doi.org/10.1093/jisesa/ieu169. Karouna-Renier, N.K., Yang, W.J., Rao, K.R., 2003. Cloning and characterization of a Xu, Q., Zou, Q., Zheng, H., Zhang, F., Tang, B., Wang, S., 2011. Three heat shock proteins 70 kDa heat shock cognate gene (HSC70) from two species of Chironomus. Insect Mol. from Spodoptera exigua: gene cloning, characterization and comparative stress re- Biol. 12, 19–26. sponse during heat and cold shocks. Comp. Biochem. Physiol. B 159, 92–102. Kim, W., Bae, S., Park, H., Park, K., Lee, S., Choi, Y., Han, S., Koh, Y., 2010. The larval age Yang, S., Liu, Z.D., 2014. Pilot-scale biodegradation of swine manure via Chrysomya and mouth morphology of the black soldier fly, Hermetia illucens (Diptera: megacephala (Fabricius) for biodiesel production. Appl. Energy 113, 385–391. Stratiomyidae). Int. J. Indust. Entomol. 21, 185–187. Yocum, G.D., Joplin, K.H., Denlinger, D.L., 1998. Upregulation of a 23 kDa small heat Lazado, C., Kumaratunga, H., Nagasawa, K., Babiak, I., Giannetto, A., Fernandes, J.M.O.,

24 A. Giannetto et al. Gene 627 (2017) 15–25

shock protein transcript during pupal diapause in the flesh fly, Sarcophaga crassi- Zhang, J., Huang, L., He, J., Tomberlin, J.K., Li, J., Lei, C., Sun, M., Liu, Z., Yu, Z., 2010. palpis. Insect Biochem. Mol. Biol. 28, 677–682. An artificial light source influences mating and oviposition of black soldier flies, van Zanten, H.H.E., Mollenhorst, H., Oonincx, D.G.A.B., Bikker, P., Meerburg, B.G., de Hermetia illucens. J. Insect Sci. http://dx.doi.org/10.1673/031.010.20201. Boer, I.J.M., 2015. From environmental nuisance to environmental opportunity: Zhao, L., Jones, W.A., 2012. Expression of heat shock protein genes in insect stress re- housefly larvae convert waste to livestock feed. J. Clean. Prod. 102, 362–369. sponses. Invertebr. Surviv. J. 9, 93–101. Zhang, Q., Denlinger, D.L., 2010. Molecular characterization of heat shock protein 90, 70 Zheng, L., Li, Q., Zhang, J., Yu, Z., 2012. Double the biodiesel yield: rearing black soldier and 70 cognate cDNAs and their expression patterns during thermal stress and pupal fly larvae, Hermetia illucens, on solid residual fraction of restaurant waste after grease diapause in the corn earworm. J. Insect Physiol. 56, 138–150. extraction for biodiesel production. Renew. Energy 41, 75–79.