1 / 10

Hereditary Breast and Gynecological Cancer Panel Plus

REFERRING HEALTHCARE PROFESSIONAL

NAME HOSPITAL

PATIENT

NAME DOB AGE GENDER ORDER ID 31 Female

PRIMARY SAMPLE TYPE SAMPLE COLLECTION DATE CUSTOMER SAMPLE ID Blood

SUMMARY OF RESULTS

TEST RESULTS

Patient is heterozygous for BRCA2 c.771_775del, p.(Asn257Lysfs*17), which is pathogenic. Patient is heterozygous for ATM c.6908dup, p.(Glu2304Glyfs*69), which is likely pathogenic. Patient is heterozygous for FANCM c.5101C>T, p.(Gln1701*), which is risk factor. Del/Dup (CNV) analysis did not detect any known disease-causing copy number variation or novel or rare deletion/duplication that was considered deleterious.

VARIANT TABLE: GENETIC ALTERATIONS

GENE POS TRANSCRIPT NOMENCLATURE CONSEQUENCE GENOTYPE CLASSIFICATION ATM 11:108196879 NM_000051.3 c.6908dup, p.(Glu2304Glyfs*69) frameshift_variant HET Likely pathogenic

gnomAD AC/AN POLYPHEN SIFT MUTTASTER ID 4/246018 N/A N/A N/A

PHENOTYPE INHERITANCE COMMENT OMIM Ataxia-Telangiectasia, AD,AR - Breast cancer

GENE POS TRANSCRIPT NOMENCLATURE CONSEQUENCE GENOTYPE CLASSIFICATION BRCA2 13:32905140 NM_000059.3 c.771_775del, p.(Asn257Lysfs*17) frameshift_variant HET Pathogenic

ID gnomAD AC/AN POLYPHEN SIFT MUTTASTER rs80359675 2/245582 N/A N/A N/A

PHENOTYPE Breast-ovarian cancer, familial, Fanconi anemia, INHERITANCE COMMENT OMIM Glioma susceptibility, AD,AR - Medulloblastoma, Pancreatic cancer, Wilms tumor

GENE POS TRANSCRIPT NOMENCLATURE CONSEQUENCE GENOTYPE CLASSIFICATION FANCM 14:45658326 NM_020937.2 c.5101C>T, p.(Gln1701*) stop_gained HET Risk factor

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 1 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 2 / 10

ID gnomAD AC/AN POLYPHEN SIFT MUTTASTER rs147021911 370/276976 N/A N/A disease causing

PHENOTYPE INHERITANCE COMMENT OMIM Fanconi anemia AR -

SEQUENCING PERFORMANCE METRICS

PANEL GENES EXONS / REGIONS BASES BASES > 20X MEDIAN PERCENT > COVERAGE 20X Hereditary Breast and Gynecological Cancer 27 575 121253 121170 146 99.93 Panel

TARGET REGION AND GENE LIST

The Blueprint Genetics Hereditary Breast and Gynecological Cancer Panel (version 2, Mar 01, 2018) Plus Analysis includes sequence analysis and copy number variation analysis of the following genes: ATM, BARD1, BLM, BRCA1*, BRCA2, BRIP1, CDH1, CHEK2*, DICER1*, EPCAM, FANCM, MLH1, MRE11A, MSH2, MSH6, NBN, NF1*, PALB2, PMS2*, PTEN*, RAD50, RAD51C, RAD51D#, SMARCA4, STK11, TP53 and XRCC2. The following exons are not included in the panel as they are not covered with sufficient high quality sequence reads: PMS2 (15). This panel targets protein coding exons, exon-intron boundaries (± 20 bps) and selected non-coding, deep intronic variants (listed in Appendix 5). This panel should be used to detect single nucleotide variants and small insertions and deletions (INDELs) up to 220 bps and copy number variations defined as single exon or larger deletions and duplications. This panel should not be used for the detection of repeat expansion disorders or diseases caused by mitochondrial DNA (mtDNA) mutations. The test does not recognize balanced translocations or complex inversions, and it may not detect low-level mosaicism.

*Some, or all, of the gene is duplicated in the genome. Read more: https://blueprintgenetics.com/pseudogene/ #The gene has suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#).

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 2 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 3 / 10

STATEMENT

CLINICAL HISTORY

Patient is a 31-year-old female with breast cancer. Äidin puoleisessa suvussa on syöpää: Äidin äidillä kohtusyöpä 45- vuotiaana ja äidin sisarella todettu rintasyöpä 47-vuotiaana ja myöhemmin munasarjasyöpä. Lisäksi yhdellä maternaalisella serkulla rintasyöpä.

CLINICAL REPORT

Sequence analysis using the Blueprint Genetics (BpG) Hereditary Breast and Gynecological Cancer Panel identified a heterozygous frameshift variant c.771_775del, p.(Asn257Lysfs*17) in BRCA2, a heterozygous frameshift variant c.6908dup, p. (Glu2304Glyfs*69) in ATM, and a heterozygous nonsense variant c.5101C>T, p.(Gln1701*) in FANCM.

BRCA2 c.771_775del, p.(Asn257Lysfs*17) There are two individual heterozygous for BRCA2 c.771_775del, p.(Asn257Lysfs*17) in the Genome Aggregation Database (gnomAD, n>120,000 exomes and >15,000 genomes). Database curators have made every effort to exclude individuals with severe pediatric diseases from this reference population database. The variant generates a frameshift leading to a premature stop codon at position 17 in a new reading frame. It is predicted to cause loss of normal protein function either through protein truncation (274 out of 4419 aa) or nonsense-mediated mRNA decay. The BRCA2 c.771_775del, p.(Asn257Lysfs*17) variant is listed in several public mutation databases (ClinVar Variation ID 9326, HGMD, LOVD, BRCA Exchange). The variant has been reviewed by the ENIGMA expert panel and has been classified as pathogenic. It has been described in the literature in several breast cancer patients and families (PMID: 8589730, 27062684, 19478387, 28724667, 23857704) and is considered as an Icelandic founder mutation (PMID: 19478387). The variant has also been referred as BRCA2 999del5.

BRCA2 (MIM *600185) gene encodes breast cancer type 2 susceptibility protein involved in double-strand break repair and homologous recombination. BRCA2 acts as a tumor suppressor. Germline mutations in BRCA2 cause hereditary breast and ovarian cancer syndrome (HBOC; GeneReviews: NBK1247). HBOC is an autosomal dominant cancer predisposition syndrome caused by germline mutations in BRCA1 or BRCA2. The lifetime risk for breast cancer in individuals with a pathogenic variant in BRCA2 is estimated at 40-70%, and individuals have an increased risk of ovarian, prostate and pancreatic cancer, and melanoma. Male breast cancer is more commonly associated with mutation of BRCA2 than BRCA1. The probability of cancer development in carriers of BRCA2 mutations seems variable, even within families with the same mutation (PMID: 9150153). The BRCA1 and BRCA2 proteins play important role in maintaining genomic stability by promoting efficient and precise repair of double strand breaks (PMID: 16998501). Most pathogenic mutations in BRCA2 are truncating (frameshift, nonsense, splice site altogether >95% of those reported in the ClinVar as pathogenic). The clinical significance of rare missense variants remain often uncertain, especially without family segregation data. Bi-allelic (i.e. homozygous or compound heterozygous) mutations in BRCA2 cause Fanconi anemia (FA) complementation group D1 (MIM #605724). FA is a malformation syndrome with variable phenotypic features, including radial defects and imperforate anus. Specific chromosomal study of the patients show chromosomal breakage induced by diepoxybutane (DEB), and mitomycin C. Some 3% of all FA cases are attributed to pathogenic variants in BRCA2 (PMID: 24259538, GeneReviews NBK1401). For carriers of pathogenic and likely pathogenic BRCA2 variants surveillance should be organized to detect possible cancers at as an early stage as possible and in female carriers, prophylactic surgery (mastectomy and oophorectomy) can be considered. Genetic counseling and family member testing should be organized.

ATM c.6908dup, p.(Glu2304Glyfs*69) There are 4 individuals heterozygous for this variant in the Genome Aggregation Database (gnomAD, n>120,000 exomes and >15,000 genomes). No homozygotes were observed in the dataset. Database curators have made every effort to exclude individuals with severe pediatric diseases from these cohorts. The variant duplicates 1 bp and generates a frameshift leading to a premature stop codon at position 69 in a new reading frame. It is predicted to cause loss of normal protein function either through protein truncation (2372 out of 3056 aa) or nonsense-mediated mRNA decay. This variant (also known as 6903insA in the literature) was first diagnosed in two families associating with ataxia-

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 3 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 4 / 10 telangiectasia (PMID: 11897822, 10980530). Moreover, loss-of-function of ATM is a well-established mechanism leading to ataxia-telangiectasia. Three individuals from these two families were affected with breast cancer at relatively young age (at 50, 51, and 53 years), but the carrier status of this variant in these individuals with breast cancer is uncertain (PMID: 11897822). The variant was also reported in a third family in three sisters, who were diagnosed with breast cancer at ages 40, 47, and 50. One mutation carrier from this large family was unaffected and another individual from the same family with breast cancer was shown not to carry this variant. All these three families came from west of Tampere, Finland (PMID: 11897822). Pylkäs and Tommiska et al. also detected this variant in three individuals from three families with familial breast cancer and in five unselected cases with breast cancer. However, one of the studied families showed incomplete segregation with the disease. All eight 6903insA carriers with breast cancer originated from the Tampere region (PMID: 17166884). In addition, this variant has been reported twice as pathogenic in clinically tested patients, one patient associated with ataxia- telangiectasia and the other patient with hereditary cancer-predisposing syndrome (ClinVar 453647).

ATM gene on chromosome 11q22.3 (MIM *607585) encodes an important cell cycle checkpoint kinase that regulates a wide variety of tumor suppressor proteins (p53, BRCA1, CHEK3, RAD17, RAD9, NBS1). This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. In addition to the canonical transcript (NM_000051.3) consisting 3056 amino acids within 63 exons, it has two other RefSeq transcripts. Biallelic inactivation of the ATM gene causes ataxia-telangiectasia (A-T) (MIM #208900) and heterozygous variants have been associated with an increased risk for breast cancer (PMID: 10677309). Classic ataxia-telangiectasia (A-T) is characterized by progressive cerebellar ataxia beginning between ages one and four years, oculomotor apraxia, choreoathetosis, telangiectasias of the conjunctivae, immunodeficiency, frequent infections, and an increased risk for malignancy, particularly leukemia and lymphoma (GeneReviews NBK26468, PMID 27884168). Staples et al. analyzed immunodeficiency related A-T in 83 patients (64 with complete loss of ATM kinase activity (group A, two null mutations) and 19 patients with residual kinase activity (group B) (PMID 18505428). More than half in group A had undetectable/low IgA levels compared with none in group B; T cell lymphopenia (50% vs 5%) and B cell lymphopenia (64% vs 22%). Epidemiologic studies of A-T families have reported a three-four-fold increase in breast cancer among female relatives presumed to be carriers (PMID: 1961222, 26662178). Similarly, heterozygous truncating ATM mutations were estimated to confer approximately 3-fold increased risk of breast cancer in a large population-based case-control study (PMID: 28779002). Heterozygous ATM germline mutations have also been reported more frequently in patients with other types of cancer (including stomach, bladder, pancreas, lung, and ovarian cancer) compared to control populations. The pLI value of ATM gene in ExAC reference population is 0.00 (minimum 0.00 - maximum 1.00) indicating tolerance to loss- of-function variation and missense variant count is neither significantly lower than expected by gene size (missense constraint -0.70) indicating no specific intolerance for this kind of variation either. One per 145 individuals in gnomAD reference population carries a unique ATM missense variant (not present in anybody else in this cohort) and one per 277 individuals carries a high-quality truncating ATM variant but no homozygous truncations are present. Most of the pathogenic ATM variants are truncating changes but certain missense variants have been shown to confer increased risk of breast cancer (PMID: 19781682). To date, more than 700 distinct variants in ATM have been reported in HGMD.

FANCM c.5101C>T, p.(Gln1701*) There are 368 individuals heterozygous and 1 individual homozygous for this variant in the Genome Aggregation Database (gnomAD, n>120,000 exomes and >15,000 genomes). Database curators have made every effort to exclude individuals with severe pediatric diseases from these cohorts. The variant is enriched in the Finnish population, as 210 heterozygous and 1 homozygous are reported in the gnomAD Finnish cohort (MAF= 0.00822). The FANCM c.5101C>T, p.(Gln1701*) variant has been associated with an increased risk of breast cancer in the Finnish population (PMID: 25288723). Kiiski et al. carried out exome sequencing on germline DNA samples of 24 BRCA1/2-negative patients from 11 breast cancer families. Further genotyping of the damaging variants in 3,166 breast cancer patients, 569 ovarian cancer patients, and 2,090 controls (Helsinki or Tampere regions) showed that FANCM c.5101C>T, p.(Gln1701*) was significantly more frequent among breast cancer patients than among controls [odds ratio (OR) = 1.86, 95% CI = 1.26–2.75; P = 0.0018], with particular enrichment among patients with triple-negative breast cancer (TNBC; OR = 3.56, 95% CI = 1.81–6.98, P = 0.0002). The authors suggested that FANCM c.5101C>T is a moderate-risk allele, which together with other predisposition alleles is explaining the clustering of the disease in the families. Recently, it was shown that the FANCM c.5101C > T was associated with an adverse breast cancer outcome (HR = 1.66, 95% CI 1.09 – 2.52, p = 0.018, N = 3,832 [non‐carriers], N = 101 [mutation carriers]) (PMID: 27542569). The breast cancer specific survival was worse among familial cases (HR = 2.93, 95% CI 1.5–5.76, p = 1.80 × 10−3, N = 981 [non‐carriers], N = 25 [mutation

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 4 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 5 / 10 carriers]). In addition, this variant has been reported in the ClinVar database in clinically tested patients (ClinVar 412519).

The FANCM (MIM *609644) gene encodes Fanconi anemia complementation group M. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. FANCM plays a key role in genome maintenance processes (PMID: 26341555). It supports genome duplication and repair under different circumstances and also functions in the ATR-mediated DNA damage checkpoint. Mutations in FANCM have been associated with Fanconi anemia (MIM #227650, GeneReviews NBK1401) and breast cancer susceptibility (PMID: 26296701, 25288723). However, the role of FANCM in FA is currently controversial. Recently, Catucci et al. and Bogliolo et al. showed that individuals with biallelic FANCM truncating mutations do not develop FA but have an increased risk of cancer and toxicity to chemotherapy (PMID: 28837162, 28837157). HGMD lists currently 17 disease causing variants in FANCM​​​​ mainly associating with breast cancer and FA (January 2019). Loss-of-function variants of FANCM are rather common in control populations. There are >700 individuals heterozygous and 68 homozygous for such a variation in the GnomAD control data set implicating that all of them are not likely to be disease-causing.

Mutation nomenclature is based on GenBank accession NM_000059.3 (BRCA2), NM_000051.3 (ATM), and NM_020937.2 (FANCM) with nucleotide one being the first nucleotide of the translation initiation codon ATG.

CONCLUSION

Considering the current literature and the well-established role of BRCA2 c.771_775del, p.(Asn257Lysfs*17) as a disease- causing variant, we classify it as pathogenic. Genetic counseling and family member testing are recommended. Hereditary breast and ovarian cancer syndrome caused by BRCA2 variants is inherited in an autosomal dominant manner, and thus each child of an affected individual has a 50% chance of inheriting the variant. BpG offers targeted variant testing for the family if requested.

ATM c.6908dup, p.(Glu2304Glyfs*69) is classified as likely pathogenic, considering the current evidence of the variant (established association between the gene and patient’s phenotype, rarity in control populations, and variant type (frameshift)). However, additional information is still needed to confirm the pathogenicity of the variant. Patient is heterozygous for the identified ATM c.6908dup, p.(Glu2304Glyfs*69) variant. Ataxia-telangiectasia caused by ATM variants is inherited in an autosomal recessive manner, thus the identified variant is not sufficient to cause disease without another disease causing variant in the same gene. Heterozygous variants in ATM have been associated with an increased risk for breast cancer.

Considering the current literature of FANCM c.5101C>T, p.(Gln1701*), we classify it as risk factor associated with increased risk of breast cancer. It should be noted, that the variant is enriched in the Finnish population, as 210 heterozygous and 1 homozygous individuals with this variant are reported in the gnomAD Finnish cohort (MAF= 0.00822).

Genetic counseling is recommended.

YHTEENVETO

Luokittelemme BRCA2 c.771_775del, p.(Asn257Lysfs*17) -geenivirheen tautia aiheuttavaksi (pathogenic), koska se on tunnettu ja hyvin kuvattu kirjallisuudessa. Suosittelemme perinnöllisyysneuvontaa ja lähisukulaisten kohdennettua geenitestausta. BRCA2-geenin virheet aiheuttavat vallitsevasti periytyvän taudin. Vallitsevasti periytyvää tautia sairastavan henkilön jokaisella lapsella on 50%:n todennäköisyys periä sairautta aiheuttava geenivirhe vanhemmaltaan. BpG tarjoaa sukulaisten geenitestauspalvelua.

Luokittelemme ATM c.6908dup, p.(Glu2304Glyfs*69) -geenivirheen todennäköisesti tautia aiheuttavaksi (likely pathogenic), koska kyseisen geenin ja taudin välille on osoitettu yhteys, geenivirhe on harvinainen verrokkiaineistoissa ja geenivirhe

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 5 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 6 / 10 muuttaa proteiinin lukukehystä (frameshift). Tarvitaan kuitenkin lisänäyttöä geenivirheen patogeenisyyden varmentamiseksi. Potilaalla on tämä geenivirhe vain toisessa alleelissa (heterotsygootti). ATM-geenin virheet aiheuttavat peittyvästi periytyvän taudin ataksia-teleangiektasian ja siten tämä geenivirhe ei yksinään pysty aiheuttamaan tautia ilman toista tautia aiheuttavaa geenivirhettä samassa geenissä. Heterotsygootit muutokset ATM-geenissä ovat yhteydessä kohonneeseen rintasyöpäriskiin.

Luokittelemme FANCM c.5101C>T, p.(Gln1701*) -geenivirheen riskitekijäksi, jolle on osoitettu yhteys kohonneeseen riskiin sairastua rintasyöpään.

Suosittelemme perinnöllisyysneuvontaa.​​​​​​

STEP DATE

Order date Jan 22, 2019

Sample received Jan 23, 2019

Reported Feb 05, 2019

On Feb 05, 2019 the statement has been prepared by our geneticists and physicians, who have together evaluated the sequencing results:

Anni Niskakoski, Ph.D. Juha Koskenvuo, MD, Ph.D.

Geneticist Lab Director, Chief Medical Officer

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 6 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 7 / 10

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 7 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 8 / 10

APPENDIX 5: SUMMARY OF THE TEST

PLUS ANALYSIS

Laboratory process: Total genomic DNA was extracted from the biological sample using a spin column method. DNA quality and quantity were assessed using electrophoretic methods. After assessment of DNA quality, qualified genomic DNA sample was randomly fragmented using non-contact, isothermal sonochemistry processing and purified with SPRI beads. DNA fragments were then end-repaired and sequencing adapters were ligated to both ends of the resulting fragments. Prepared DNA-Adapter libraries were size-selected with SPRI beads to ensure optimal template size and then amplified by ligation- mediated PCR (LM-PCR). The amplified sequencing library was purified using SPRI beads and a hybridization-capture method was applied for enrichment of whole exome and select non-coding regions (xGen Exome Research Panel with custom- designed capture probes, IDT). The enriched sequencing library was amplified by LM-PCR and purified using SPRI beads. The quality of the completed sequencing library was controlled by ensuring the correct template size and quantity and to eliminate the presence of leftover primer-dimers. Each captured library passing quality control was sequenced using the Illumina sequencing system with paired-end sequencing (150 by 150 bases). Sequencing-derived raw image files were processed using a base-calling software (Illumina) and the sequence data was transformed into FASTQ format. Bioinformatics and quality control: The bioinformatics analysis began with quality control of raw sequence reads. Clean sequence reads of each sample were mapped to the human reference genome (GRCh37/hg19). Burrows-Wheeler Aligner (BWA-MEM) software was used for read alignment. Duplicate read marking, local realignment around indels, base quality score recalibration and variant calling were performed using GATK algorithms (Sentieon). The panel content was sliced from high-quality exome sequencing data acquired as presented above. The sequencing depth and coverage for the tested sample was calculated based on the alignments. The sequencing run included in-process reference sample(s) for quality control, which passed our thresholds for sensitivity and specificity. The patient's sample was subjected to thorough quality control measures as well, after which raw sequence reads were transformed into variants by a proprietary bioinformatics pipeline. Copy number variations (CNVs), defined as single exon or larger deletions or duplications (Del/Dups), were detected from the sequence analysis data using a proprietary bioinformatics pipeline, which processes aligned sequence reads. The difference between observed and expected sequencing depth at the targeted genomic regions was calculated and regions were divided into segments with variable DNA copy number. The expected sequencing depth was obtained by using other samples processed in the same sequence analysis as a guiding reference. The sequence data was adjusted to account for the effects of varying guanine and cytosine content. Interpretation: Our variant classification follows the Blueprint Genetics Variant Classification Schemes modified from the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Likely benign and benign variants were not reported. The pathogenicity potential of the identified variants were assessed by considering the predicted consequence, the biochemical properties of the codon change, the degree of evolutionary conservation as well as the number of reference population databases and mutation databases such as, but not limited, to the 1000 Genomes Project, gnomAD, ClinVar and HGMD. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster were used to assist with variant classification. In addition, the clinical relevance of any identified CNVs was evaluated by reviewing the relevant literature and databases such as 1000 Genomes Project, Database of Genomic Variants, ExAC, DECIPHER. The clinical evaluation team assessed the pathogenicity of the identified variants by evaluating the information in the patient referral, reviewing the relevant literature and manually inspecting the sequencing data if needed. Reporting was carried out using HGNC-approved gene nomenclature and mutation nomenclature following the HGVS guidelines. Confirmation: Pathogenic and likely pathogenic variants that established a molecular diagnosis were confirmed with bi- directional Sanger sequencing unless the following criteria were fulfilled: 1) the variant quality score (QS) was above the internal threshold for a true positive call and 2) visual check-up of the variant at IGV is in-line with the variant call. Reported variants of uncertain significance were confirmed with bi-directional Sanger sequencing only if the QS was below our internally defined score for a true positive call. CNVs (Dels/Dups) were confirmed using a quantitative-PCR assay if they covered less than 10 target exons or were not confirmed at least three times previously at our laboratory. Analytic validation: This laboratory-developed test has been independently validated by Blueprint Genetics. The sensitivity of this panel is expected to be in the same range as the validated whole exome sequencing laboratory assay used to generate the panel data (sensitivity for SNVs 99.65%, indels 1-50 bps 99.07%, one-exon deletion 92.3% and two exons CNV 100%, and specificity >99.9% for most variant types). It does not detect very low level mosaicism as a variant with minor allele fraction of 14.6% can be detected in 90% of the cases. A normal result does not rule out the diagnosis of a genetic

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 8 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 9 / 10 disorder since some DNA abnormalities may be undetectable by the applied technology. Test results should always be interpreted in the context of clinical findings, family history, and other relevant data. Inaccurate, or incomplete information may lead to misinterpretation of the results. Regulation and accreditations: This test has not been cleared or approved by the FDA. This analysis has been performed in a CLIA-certified laboratory (#99D2092375), accredited by the College of American Pathologists (CAP #9257331) and by FINAS Finnish Accreditation Service, (laboratory no. T292), accreditation requirement SFS-EN ISO 15189:2013. All the tests are under the scope of the ISO 15189 accreditation.

NON-CODING VARIANTS COVERED BY THE PANEL:

NM_000051.3(ATM):c.-174A>G NM_000051.3(ATM):c.-31+595G>A NM_000051.3(ATM):c.-30-1G>T NM_000051.3(ATM):c.1236-404C>T NM_000051.3(ATM):c.2639-384A>G NM_000051.3(ATM):c.2839-579_2839-576delAAGT NM_000051.3(ATM):c.3403-12T>A NM_000051.3(ATM):c.3994-159A>G NM_000051.3(ATM):c.5763-1050A>G NM_007294.3(BRCA1):c.*1271T>C NM_007294.3(BRCA1):c.*800T>C NM_007294.3(BRCA1):c.*718A>G NM_007294.3(BRCA1):c.*103_*106delTGTC NM_007294.3(BRCA1):c.*58C>T NM_007294.3(BRCA1):c.5468-40T>A NM_007294.3(BRCA1):c.5407-25T>A NM_007294.3(BRCA1):c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3(BRCA1):c.5194-12G>A NM_007294.3(BRCA1):c.213-11T>G NM_007294.3(BRCA1):c.213-12A>G NM_007294.3(BRCA1):c.213-15A>G NM_007294.3(BRCA1):c.-19-2A>G NM_000059.3(BRCA2):c.-40+1G>A NM_000059.3(BRCA2):c.8954-15T>G NM_000059.3(BRCA2):c.9502-28A>G NM_032043.2(BRIP1):c.1629-498A>T NM_004360.3(CDH1):c.687+92T>A NM_002354.2(EPCAM):c.556-14A>G NM_000249.3(MLH1):c.-42C>T NM_000249.3(MLH1):c.-27C>A NM_000249.3(MLH1):c.117-11T>A NM_000249.3(MLH1):c.454-13A>G NM_000249.3(MLH1):c.589-9_589-6delGTTT NM_000249.3(MLH1):c.885-9_887dupTCCTGACAGTTT NM_000249.3(MLH1):c.1558+13T>A NM_000251.2(MSH2):c.-225G>C NM_000251.2(MSH2):c.-181G>A NM_000251.2(MSH2):c.-78_-77delTG NM_000251.2(MSH2):c.212-478T>G NM_000179.2(MSH6):c.*15A>C NM_001042492.2(NF1):c.-273A>C NM_001042492.2(NF1):c.-272G>A NM_001042492.2(NF1):c.288+2025T>G NM_001042492.2(NF1):c.587-14T>A

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 9 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331 10 / 10

NM_001042492.2(NF1):c.587-12T>A NM_001042492.2(NF1):c.888+651T>A NM_001042492.2(NF1):c.888+744A>G NM_001042492.2(NF1):c.888+789A>G NM_001042492.2(NF1):c.1260+1604A>G NM_001042492.2(NF1):c.1261-19G>A NM_001042492.2(NF1):c.1392+754T>G NM_001042492.2(NF1):c.4110+945A>G NM_001042492.2(NF1):c.4110+1802delA NM_001042492.2(NF1):c.4173+278A>G NM_001042492.2(NF1):c.5269-38A>G NM_001042492.2(NF1):c.5610-456G>T NM_001042492.2(NF1):c.5812+332A>G NM_001042492.2(NF1):c.6428-11T>G NM_001042492.2(NF1):c.6642+18A>G NM_001042492.2(NF1):c.7190-12T>A NM_001042492.2(NF1):c.7971-321C>G NM_001042492.2(NF1):c.7971-17C>G NM_001042492.2(NF1):c.8113+25A>T NM_024675.3(PALB2):c.109-12T>A chr10:g.89622883-89623482 NM_000314.6(PTEN):c.-1239A>G NM_000314.6(PTEN):c.-1178C>T NM_000314.6(PTEN):c.-1171C>T NM_000314.6(PTEN):c.-1111A>G NM_000314.4(PTEN):c.-1001T>C NM_000314.4(PTEN):c.-931G>A NM_000314.4(PTEN):c.-921G>T NM_000314.4(PTEN):c.-896T>C NM_000314.4(PTEN):c.-862G>T NM_000314.4(PTEN):c.-854C>G NM_000314.4(PTEN):c.-765G>A NM_000314.4(PTEN):c.254-21G>C NM_000546.5(TP53):c.-29+1G>T

GLOSSARY OF USED ABBREVIATIONS:

AD = autosomal dominant AR = autosomal recessive CNV = Copy Number Variation e.g. one exon or multiexon deletion or duplication gnomAD = genome Aggregation Database (reference population database; >138,600 individuals) gnomAD AC/AN = allele count/allele number in the genome Aggregation Database (gnomAD) HEM = hemizygous HET = heterozygous HOM = homozygous ID = rsID in dbSNP MutationTaster = in silico prediction tools used to evaluate the significance of identified amino acid changes. Nomenclature = HGVS nomenclature for a variant in the nucleotide and the predicted effect of a variant in the protein level OMIM = Online Mendelian Inheritance in Man® PolyPhen = in silico prediction tool used to evaluate the significance of amino acid changes. POS = genomic position of the variant in the format of chromosome:position SIFT = in silico prediction tool used to evaluate the significance of amino acid changes.

Blueprint Genetics Oy, Haartmaninkatu 8, Biomedicum Helsinki, 00290 Helsinki, Finland 10 / 10 VAT number: FI22307900, CLIA ID Number: 99D2092375, CAP Number: 9257331