DOCSLIB.ORG

Medium Reiteration Frequency Repetitive Sequences in the Human Genome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Medium Reiteration Frequency Repetitive Sequences in the Human Genome k.-_:) 1991 Oxford University Press Nucleic Acids Research, Vol. 19, No. 17 4731-4738 Medium reiteration frequency repetitive sequences in the human genome David J.Kaplan, Jerzy Jurka1, Joseph F.Solus and Craig H.Duncan* Center for Molecular Biology, Wayne State University, Detroit, Ml and 'Linus Pauling Institute of Science and Medicine, 440 Page Mill Road, Palo Alto, CA 94306, USA Received April 24, 1991; Revised and Accepted August 7, 1991 EMBL accession nos X59017-X59026 (incl.) ABSTRACT Fourteen novel medium reiteration frequency (MER) Isolation of novel MER families from sequence libraries families were found, in the human genome, by using The Alu fragment library. Human genomic DNA (250 isg) was two different methods. Repetition frequencies per digested to completion with the restriction enzyme AluI. The haploid human genome were estimated for each of resulting fragments were fractionated on a 6% polyacrylamide these families as well as for six previously described gel and fragments in the 500-1000 bp region were isolated. MER DNA families. By these measurements, the 50 ng of this size fractionated DNA was ligated to 500 ng of families were found to contain variable numbers of SnaI cleaved Ml3mpl9 RF DNA (5). The vector was elements, ranging from 200 to 10,000 copies per phosphatased before use. The ligated DNA was mixed with haploid human genome. competent JM 109 bacteria (Stratagene Inc.) and 20,000 resulting transformants were plated at a density of 1,650 plaques per 10 cm INTRODUCTION petri dish. Duplicate filter replicates were prepared and were incubated separately with either of two radioactive oligonucleotide The human genome, like those of other higher eukaryotes, probes. One of these oligonucleotides was the 25 mer, GTGG- contains a substantial amount of interspersed repetitive DNA CTCA[C/T][A/G]CCTGTAATCCCAGCA. This sequence is sequence. Besides the three largest families, the Alu family, the from the 5' consensus sequence for Alu repeats (bases # 12-36 Ll family, and the THE repeats, there are a number of minor from Fig. 1, ref 6). The other oligonucleotide was the 33 mer families, referred to as medium reiteration frequency repeats GG[C/T]TGCAGTGAGC[C/T] [A/G][T/A]GAT[C/T][A/G] (MER). [C/T][A/G]CCA[C/T]TGCACT. This sequence was from the Medium frequency repetitive sequences were first observed 3' region of the Alu family consensus sequence (bases # as sequences which were present in naturally occurring SV40 218-250 from Fig. 1, ref 6). Phage which hybridized to both variants (1,2). With the recent surge of structural information probes were replated at lower density and subjected to a repeat about the human genome, more examples of MER families have screening with the same probes. Single stranded template DNA been uncovered. Two quite different approaches have proven was extracted from 131 phage isolates in 2 ml cultures. useful for identifying MER families. One method was a systematic computer analysis of the entire human DNA sequence The PCR library. One zg of genomic human placental DNA was database to detect repetitive elements which do not belong to mixed with 20 Atg each of two oligonucleotides. One known families (3). The second method was a sequence library oligonucleotide was the 31 mer GGGTCGACAGTGAGCCG- construction technique which selected regions of human DNA AGATCGCGCCACTG, where the underlined region is an lying between closely spaced Alu repeats (4). In this report, we outward facing primer at the 3' boundary of the Alu family use both approaches to discover fourteen novel MER families. consensus sequence (bases 224-246 from Fig. 1, ref 6). The We also provide measurements ofthe repetition frequency ofeach second oligonucleotide was the 28 mer GGGGATCCTGGGA- family. There are certainly more families which have yet escaped TTACAGGCGTGAGCC, where the underlined region is an detection. outward facing primer at the 5' boundary of the Alu family consensus sequence (bases 33-14 from Fig. 1, ref 6). The reaction mixture was adjusted to a volume of 2001d, containing EXPERIMENTAL METHODS each dNTP at a final concentration of 300AtM, polymerase Homology searches by computer assisted analysis of the reaction buffer, and 40 units of Thermus aquaticus DNA human DNA database polymerase (Amersham). The polymerase chain reaction (7) was The GenBank DNA sequence database (Release 65) was subjected performed for 25 cycles of 940 for 3 minutes, followed by 500 to a rapid search using the DASHER2 program as previously for 5 minutes, followed by 720 for 5 minutes. The reaction was described (3). then extracted twice with an equal volume of phenol, once with * To whom correspondence should be addressed at: Room 4118, MCHT, 2727 2nd Avenue, Detroit, MI 48201, USA 4732 Nucleic Acids Research, Vol. 19, No. 17 an equal volume of CHCl3, and ethanol precipitated. The DNA formula, 1( # of positive plaques binding probe) x (2.5 x 106)1 was then dissolved in 50 ,ul of restriction enzyme buffer, followed 1(total # of plaques on the filter) x 151. In this formula the by the addition of 25 units of Sall and 50 units of BamH 1. After 2.5 x 106 represents the size of the human genome in kb, while a 4 hour incubation at 370, the reaction mixture was heated at 15 is the average size (in kb) of the human DNA inserted in the 650 for 5 minutes and DNA fragments were purified by two bacteriophage. As reflected by the numbers in Table I, this cycles of preparative electrophoresis on a 7% polyacrylamide formula gives a statistical estimate, which may be in error by gel. DNA fragments in the 300-1000 bp region were isolated. as much as 50%. 40 ng of this size fractionated DNA was ligated to 100 ng of BamHl, Sall cleaved M13mpl9 RF DNA (from which the 12 bp Sall-BamHl insert had been removed by S-300 gel filtration RESULTS [Pharmacia]). The ligated DNA was mixed with competent JM109 bacteria (Stratagene Inc.) and 2000 resulting transformants Sequence Analysis of novel MER families were plated at a density of 150 plaques per 10 cm petri dish on A total of 562 M13 templates were subjected to sequence analysis. NZY plates containing f-galactosidase indicator dye. Duplicate 131 of these templates came from the Alu fragment library and filter replicates were prepared and were incubated separately with 431 of the templates came from the PCR library. In both cases, either of two radioactive probes. One probe was a double stranded the selection procedures were designed to identify DNA 69 bp sequence taken from the internal region of an Alu repeat sequences 200-700 bp in length which are flanked by Alu (CACTTTGGGAGGCCAAGGCAGGTGGATCACCTCAA- repeats. GTCAGGAGTTCAAGGCCAGCCTGACCAACATGGA). The The Alu fragment method was based on the fact that the bulk second probe was a 5 kb fragment containing an L1 sequence of Alu family elements in the human genome contain a conserved from the region 5' to the human -y-gamma globin gene (8). 431 site for the restriction enzyme AluI (16). When human genomic phage plaques were selected by the criteria of not reacting with DNA was cleaved with this enzyme a subset of the resulting the dye indicator and not hybridizing to either of the radioactive fragments possessed the 3' portion of an Alu family repeat at probes. Single stranded template DNA was extracted from small one end, the 5' portion of an Alu family repeat at the other end, scale (3 ml) cultures of these phage. with an internal region of non-Alu family DNA in between. The AluI restriction fragments were cloned and the subset of DNA DNA, sequencing, amplification, hybridization, and sequence fragments described above was identified by the use of two analysis oligonucleotide hybridization probes. One was specific for the The single stranded templates were sequenced by the dideoxy 5' end of an Alu family repeat, and the other was specific for termination method (8) as modified (9) using T7 DNA the 3' end of an Alu family repeat. Polymerase (10). 400-600 bp of sequence information was The PCR method used two oligonucleotide primers which faced obtained from each template. Oligonucleotides were synthesized outward from the 5' and 3' regions of a consensus Alu family by Research Genetics Inc (Huntsville AL) and labeled with repeat sequence. When these primers were incubated with human polynucleotide kinase and 32p labeled 'y-ATP. Double stranded genomic DNA under PCR conditions, the regions between Alu DNA was labeled by the random primer method (11). repeats were selectively amplified. These amplified fragments Hybridizations were performed at 600 in 6 x SSC, 20 mM were then cloned. NaPO4, 10% dextran sulfate, 4xDenhart's solution, 0.1% Both these methods suffered limitations which precluded the SDS, and 100 pjg/ml denatured salmon sperm DNA for 16 hrs. isolation of certain sequences or included undesired sequences Washing was done twice for 5 minutes in 2 x SSC, 0.2% SDS at room temperature, followed by two washes for 15 minutes in 0.2 xSSC, 0.1% SDS at 450. Autoradiography was 6 hrs to Table I. MER sequences. overnight with an intensifying screen at -70°. MER probes were # in Repetition # in Alu n Hyb to Hyb to constructed by synthesizing oligonucleotide primers suitable for MER# Source Genkank Frequency frag lib PCR lib rod DNA bov DA I DASHER2; ref 3 4 4000-8000 - + Polymerase Chain Reaction amplification (7) of the M 13 sequence 2 DASHER2; ref 3 4 1500-3000 2 + 3 DASHER2: ref 3 nd - nd nd templates. The PCR products were then subcloned in Bluescript 4 DASHER2: ref 3 3 1000-2000 5 DASHER2; ref 3 2 1000-2000 1 - + vectors (Stratagene Inc.).
Load more

Recommended publications
  • Identification of the Promoter and a Transcriptional Enhancer of The
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 11356-11360, December 1993 Developmental Biology Identification of the promoter and a transcriptional enhancer of the gene encoding L-CAM, a calcium-dependent cell adhesion molecule (gene expression/regulatory sequences/morphogenesis/cadherins) BARBARA C. SORKIN, FREDERICK S. JONES, BRUCE A. CUNNINGHAM, AND GERALD M. EDELMAN The Department of Neurobiology, The Scripps Research Institute, 10666 North Torrey Pines Road, La Jolla, CA 92037 Contributed by Gerald M. Edelman, August 20, 1993 ABSTRACT L-CAM is a calcium-dependent cell adhesion expressed in the dermis, but rather in the adjacent epidermis molecule that is expressed in a characteristic place-dependent (6). pattern during development. Previous studies of ectopic ex- L-CAM mediates calcium-dependent cell-cell adhesion (7) pression of the chicken L-CAM gene under the control of via a homophilic mechanism; i.e., L-CAM on one cell binds heterologous promoters in transgenic mice suggested that directly to L-CAM on apposing cells (8). In all tissues where cis-acting sequences controlling the spatiotemporal expression the molecule is expressed, L-CAM is detected as a trans- patterns ofL-CAM were present within the gene itself. We have membrane protein of 124 kDa (7). Mammalian proteins now examined the L-CAM gene for sequences that control its uvomorulin (9), E-cadherin (10), cell-CAM 120/80 (11), and expression and have found an enhancer within the second Arcl (12) are similar to L-CAM in their biochemical and intron of the gene. A 2.5-kb Kpn I-EcoRI fragment from the functional properties and tissue distributions.
    [Show full text]
  • Super Short Operations on Both Gene Order and Intergenic Sizes Andre R
    Oliveira et al. Algorithms Mol Biol (2019) 14:21 https://doi.org/10.1186/s13015-019-0156-5 Algorithms for Molecular Biology RESEARCH Open Access Super short operations on both gene order and intergenic sizes Andre R. Oliveira1* , Géraldine Jean2 , Guillaume Fertin2 , Ulisses Dias3 and Zanoni Dias1 Abstract Background: The evolutionary distance between two genomes can be estimated by computing a minimum length sequence of operations, called genome rearrangements, that transform one genome into another. Usually, a genome is modeled as an ordered sequence of genes, and most of the studies in the genome rearrangement literature consist in shaping biological scenarios into mathematical models. For instance, allowing diferent genome rearrangements operations at the same time, adding constraints to these rearrangements (e.g., each rearrangement can afect at most a given number of genes), considering that a rearrangement implies a cost depending on its length rather than a unit cost, etc. Most of the works, however, have overlooked some important features inside genomes, such as the pres- ence of sequences of nucleotides between genes, called intergenic regions. Results and conclusions: In this work, we investigate the problem of computing the distance between two genomes, taking into account both gene order and intergenic sizes. The genome rearrangement operations we consider here are constrained types of reversals and transpositions, called super short reversals (SSRs) and super short transpositions (SSTs), which afect up to two (consecutive) genes. We denote by super short operations (SSOs) any SSR or SST. We show 3-approximation algorithms when the orientation of the genes is not considered when we allow SSRs, SSTs, or SSOs, and 5-approximation algorithms when considering the orientation for either SSRs or SSOs.
    [Show full text]
  • Genome-Wide Analysis of the Intergenic Regions in Arabidopsis Thaliana Suggests the Existence of Bidirectional Promoters and Genetic Insulators Xiaohan Yang, Cara M
    Current Topics in Plant Biology Vol. 12, 2011 Genome-wide analysis of the intergenic regions in Arabidopsis thaliana suggests the existence of bidirectional promoters and genetic insulators Xiaohan Yang, Cara M. Winter, Xiuying Xia, and Susheng Gan* Department of Horticulture, Cornell University, 134A Plant Science, Ithaca, New York 14853-5904, USA ABSTRACT Our analysis suggests that specific intergenic The short regions flanked by divergent genes regions contain potential bidirectional promoters or genetic insulators, offering guidance for future provide a good opportunity for exploring experimental efforts to isolate those regulatory mechanisms of transcriptional regulation because of the confined nature of the upstream regulatory elements. elements of both genes. We performed a genome- wide analysis of coexpression levels of divergent KEYWORDS: Arabidopsis, bidirectional promoter, gene regulation, genetic insulator, intergenic gene pairs in Arabidopsis thaliana, along with convergent and parallel gene pairs as controls for region, rice comparison, and found that for adjacent genes INTRODUCTION ≤0.4 kb apart, there was a significantly higher portion of gene pairs showing coexpression The availability of complete genome sequence in divergent configuration than in parallel and gene annotation information and increasingly or convergent configuration. We divided the robust expression data sets for some model higher different expression patterns in adjacent divergent eukaryotes has made it possible to perform large- Arabidopsis gene pairs
    [Show full text]
  • A Model-Based Approach for Identifying Functional Intergenic Transcribed Regions and Noncoding Rnas John P
    A Model-Based Approach for Identifying Functional Intergenic Transcribed Regions and Noncoding RNAs John P. Lloyd,†,1 Zing Tsung-Yeh Tsai,2 Rosalie P. Sowers,3 Nicholas L. Panchy,‡,4 and Shin-Han Shiu*,1,4,5 1Department of Plant Biology, Michigan State University, East Lansing, MI 2Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI 3Department of Biochemistry and Molecular Biology, Pennsylvania State University, University Park, PA 4Genetics Program, Michigan State University, East Lansing, MI 5Ecology, Evolutionary Biology, and Behavior Program, Michigan State University, East Lansing, MI †Present address: Departments of Human Genetics and Internal Medicine, University of Michigan, Ann Arbor, MI ‡National Institute for Mathematical and Biological Synthesis, University of Tennessee, Knoxville, TN *Corresponding author: E-mail: [email protected]. Associate editor: Jun Gojobori Abstract With advances in transcript profiling, the presence of transcriptional activities in intergenic regions has been well established. However, whether intergenic expression reflects transcriptional noise or activity of novel genes remains unclear. We identified intergenic transcribed regions (ITRs) in 15 diverse flowering plant species and found that the amount of intergenic expression correlates with genome size, a pattern that could be expected if intergenic expression is largely nonfunctional. To further assess the functionality of ITRs, we first built machine learning models using Arabidopsis thaliana as a model that accurately distinguish functional sequences (benchmark protein-coding and RNA genes) and likely nonfunctional ones (pseudogenes and unexpressed intergenic regions) by integrating 93 biochemical, evolutionary, and sequence-structure features. Next, by applying the models genome-wide, we found that 4,427 ITRs (38%) and 796 annotated ncRNAs (44%) had features significantly similar to benchmark protein-coding or RNA genes and thus were likely parts of functional genes.
    [Show full text]
  • Number of Patterns Over-Represented in Three Genomes
    Digging Deep for Ancient Relics: A Survey of Protein Motifs in the Intergenic Sequences of Four Eukaryotic Genomes Running title: Survey of Protein Pseudomotifs in Intergenic Region ZhaoLei Zhang, Paul Harrison and Mark Gerstein*, † Department of Molecular Biophysics and Biochemistry and †Department of Computer Science, Yale University, 266 Whitney Avenue, New Haven, CT 06520-8114 *Corresponding author Tel: (203) 432 6105 Fax: (360) 838 7861 Email: [email protected] 1 Summary We have examined conserved protein motifs in the non-coding, intergenic regions ("pseudomotif patterns") and surveyed their occurrence in the fly, worm, yeast and human genomes (chromosomes 21 and 22 only). To identify these patterns, we masked out annotated genes, pseudogenes and repeat regions from the raw genomic sequence and then compared the remaining sequence, in six-frame translation, against 1319 patterns from the PROSITE database. For each pseudomotif pattern, the absolute number of occurrences is not very informative unless compared against a statistical expectation; consequently, we calculated the expected occurrence of each pattern using a Poisson model and verified this with simulations. Using a p-value cut-off of 0.01, we found 67 pseudomotif patterns over-represented in fly intergenic regions, 34 in worm, 21 in human and 6 in yeast. These include the Zinc finger, leucine zipper, nucleotide-binding motif and EGF domain. Many of the over-represented patterns were common to two or more organisms, but there were a few that were unique to specific ones. Furthermore, we found more over-represented patterns in the fly than in the worm, although fly has fewer pseudogenes.
    [Show full text]
  • Transcriptional Regulation of Pena Β-Lactamase in Acquired
    www.nature.com/scientificreports OPEN Transcriptional and post- transcriptional regulation of PenA β-lactamase in acquired Received: 10 April 2018 Accepted: 1 July 2018 Burkholderia pseudomallei β-lactam Published: xx xx xxxx resistance Sunisa Chirakul1, Michael H. Norris2, Sirawit Pagdepanichkit1,3, Nawarat Somprasong1, Linnell B. Randall1,6, James F. Shirley1, Bradley R. Borlee4, Olga Lomovskaya5, Apichai Tuanyok 2 & Herbert P. Schweizer1 Therapy of Burkholderia pseudomallei acute infections is largely limited to a few β-lactam antibiotics such as ceftazidime or meropenem. Although relatively rare, resistance emergence during therapy leads to treatment failures with high mortality rates. In the absence of acquired external resistance determinants in B. pseudomallei emergence of β-lactam resistance is invariably caused by mutational modifcation of genomically encoded factors. These include the deletion of the ceftazidime target penicillin-binding protein 3 or amino acid changes in the Class A PenA β-lactamase that expand its substrate spectrum, as well as penA gene duplication and amplifcation or its overexpression via transcriptional up-regulation. Evidence is presented that penA is co-transcribed with the upstream nlpD1 gene, that the transcriptional terminator for nlpD1 serves as a penA attenuator and that generation of a new promoter immediately upstream of the terminator/attenuator by a conserved G to A transition leads to anti-termination and thus constitutive PenA expression and extended β-lactam resistance. Further evidence obtained with the extensively β-lactam resistant clinical isolate Bp1651 shows that in addition to PenA overexpression and structural mutations other adaptive mechanisms contribute to intrinsic and acquired B. pseudomallei β-lactam resistance. Burkholderia pseudomallei is an opportunistic pathogen prevalent in tropical and sub-tropical regions around the world where it causes melioidosis, a multifacteted disease syndrome1,2.
    [Show full text]
  • Deconvoluting the Most Clinically Relevant Region of the Human Genome
    Deconvoluting the Most Clinically Relevant Region of the Human Genome Dimitri Monos Ph.D. Immunogenetics Laboratory The Children’s Hospital of Philadelphia Department of Pathology and Lab Medicine Perelman School of Medicine, University of Pennsylvania ARUP LABORATORIES, Pathology Grand Rounds, September 20, 2018 GWAS Interpretation ‐ Tag SNPs are Markers of LD blocks *Concept of LD is population specific http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0046295 Published Genome‐Wide Associations through 12/2012 Published GWA at p≤5X10‐8 for 17 trait categories NHGRI GWA Catalog www.genome.gov/GWAStudies www.ebi.ac.uk/fgpt/gwas/ A SNP may appear twice if it has been associated with more than one disease Clark et al. The Dichotomy Between Disease Phenotype Databases and the Implications for Understanding Complex Diseases Involving the Major Histocompatibility Complex. Intern. J. of Immunogenetics 42:413‐ 422, 2015 Genome‐wide Density of SNPs Associated with Diseases Density of diseases associated with specific SNPs in MHC region (20Kbp bins) Data from NGHRI‐EBI GWAS Catalog • The MHC (chr6:29‐33Mb = 4Mb) includes ~260 genes, about half of which are involved in the immune response • 884 unique loci associated with 479 unique traits/diseases; 112 unique disease phenotypes • The MHC is recognized as the most important region of the human genome in relation to disease susceptibility specified positions Disease counts associated with SNPs at Position on chromosome; HLA gene locations indicated Approaches 1. Sequencing characterization of the MHC: Complete and accurate sequencing of the 4Mb of heterozygote samples using long sequencing reads (3‐10kb) and de novo (not reference‐based) assembly.
    [Show full text]
  • 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008
    MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 6.047/6.878 Computational Biology September 29, 2008 Lecture 8: Computational Gene Prediction and GHMMs Lecturer: James E. Galagan 1 Overview of gene prediction One of the fundamental problems in computational biology identification of genes in very long genome sequences. As we know DNA is a sequence of nucleotide molecules, or bases, which encode instructions for generation of proteins. However, not all of these bases correspond directly to amino acids. Even within a gene, a relatively small percentage of the nucleotides might actually be translated into an amino acid chain. For example, Eukaryotic genomes contain introns, or long segments of non-coding nu­ cleotides within a gene; the introns are discarded during processing into mature RNA leaving only the exons linked together to contribute to protein manufacturing. Also, both Prokaryotic and Eukaryotic genomes contain substantial intergenic regions, and there are many other types of segments such as introns, start and stop codons, etc. which do not code for proteins directly, but are crucial to the protein synthesis in other ways. The contiguous subsequence of bases that is finally parsed out of DNA during processing into RNA is called the coding sequence, and is comprised of the exons with all introns removed. This sequence is then deterministically translated into amino acids. Our task in gene prediction (or genome annotation) is: Given a DNA sequence (X) with zero or more genes and some “evidence” associated with the given DNA sequence, determine a labeling (Y ) that assigns to each base a label according to the functionality of that part of the gene.
    [Show full text]
  • Comparative Genome Sequence Analyses of Geographic Samples of Aspergillus Fumigatus—Relevance for Amphotericin B Resistance
    microorganisms Article Comparative Genome Sequence Analyses of Geographic Samples of Aspergillus fumigatus—Relevance for Amphotericin B Resistance Yuying Fan y, Yue Wang y and Jianping Xu * Department of Biology, McMaster University, Hamilton, ON L8S 4K1, Canada; [email protected] (Y.F.); [email protected] (Y.W.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 29 September 2020; Accepted: 27 October 2020; Published: 28 October 2020 Abstract: Amphotericin B (AMB) is a major fungicidal polyene agent that has a broad spectrum of action against invasive fungal infections. AMB is typically used as the last-line drug against serious and life-threatening infections when other drugs have failed to eliminate the fungal pathogens. Recently, AMB resistance in Aspergillus fumigatus has become more evident. For example, a high rate of AMB resistance (96%) was noted in the A. fumigatus population in Hamilton, Ontario, Canada. AMB-resistant strains have also been found in other countries. However, the mechanism of AMB resistance remains largely unknown. Here, we investigated the potential genes and mutations associated with AMB resistance using whole-genome sequences and examined AMB resistance distribution among genetic populations. A total of 196 whole-genome sequences representing strains from 11 countries were examined. Analyses of single nucleotide polymorphisms (SNPs) at the whole-genome level revealed that these strains belonged to three divergent genetic clusters, with the majority (90%) of AMB resistant strains located in one of the three clusters, Cluster 2. Our analyses identified over 60 SNPs significantly associated with AMB resistance. Together, these SNPs represent promising candidates from which to investigate the putative molecular mechanisms of AMB resistance and for their potential use in developing rapid diagnostic markers for clinical screening of AMB resistance in A.
    [Show full text]
  • Intronic Cnvs Cause Gene Expression Variation in Human Populations
    RESEARCH ARTICLE Intronic CNVs and gene expression variation in human populations 1 2 1,3☯ 4☯ Maria RigauID , David JuanID , Alfonso Valencia *, Daniel RicoID * 1 Barcelona Supercomputing Center (BSC), Barcelona, Spain, 2 Institut de Biologia Evolutiva, Consejo Superior de Investigaciones CientõÂficas±Universitat Pompeu Fabra, Parc de Recerca Biomèdica de Barcelona, Barcelona, Spain, 3 Institucio Catalana de Recerca i Estudis AvancËats (ICREA), Barcelona, Spain, 4 Institute of Cellular Medicine, Newcastle University, Newcastle upon Tyne, United Kingdom ☯ These authors contributed equally to this work. * [email protected] (AV); [email protected] (DR) a1111111111 a1111111111 a1111111111 a1111111111 Abstract a1111111111 Introns can be extraordinarily large and they account for the majority of the DNA sequence in human genes. However, little is known about their population patterns of structural varia- tion and their functional implication. By combining the most extensive maps of CNVs in human populations, we have found that intronic losses are the most frequent copy number OPEN ACCESS variants (CNVs) in protein-coding genes in human, with 12,986 intronic deletions, affecting Citation: Rigau M, Juan D, Valencia A, Rico D 4,147 genes (including 1,154 essential genes and 1,638 disease-related genes). This intro- (2019) Intronic CNVs and gene expression nic length variation results in dozens of genes showing extreme population variability in size, variation in human populations. PLoS Genet 15(1): with 40 genes with 10 or more different sizes and up to 150 allelic sizes. Intronic losses are e1007902. https://doi.org/10.1371/journal. pgen.1007902 frequent in evolutionarily ancient genes that are highly conserved at the protein sequence level.
    [Show full text]
  • Integration of Multiple Repeats of Geminiviral DNA Into
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 759-764, January 1996 Plant Biology Integration of multiple repeats of geminiviral DNA into the nuclear genome of tobacco during evolution (plant DNA viruses/replication origin/ALI gene/illegitimate recombination/horizontal transmission) EDUARDO R. BEJARANO*, ALAA KHASHOGGI, MICHAEL WITrY, AND CONRAD LICHTENSTEINt Department of Biochemistry, Imperial College of Science, Technology and Medicine, Exhibition Road, London SW7 2AZ, United Kingdom Communicated by Mary-Dell Chilton, Ciba-Geigy Corporation, Research Triangle Park, NC, October 13, 1995 (received for review December 1, 1994) ABSTRACT Integration of viral DNA into the host nu- original publication of methods are as described by Sambrook clear genome, although not unusual in bacterial and animal et al. (5). systems, has surprisingly not been reported for plants. We Southern Blot Analysis ofTobacco DNA. Tobacco DNA was have discovered geminivirus-related DNA (GRD) sequences, prepared essentially according to Dellaporta et al. (6). To- in the form of distinct sets of multiple direct repeats com- bacco DNA was digested with a variety of restriction endo- prising three related repeat classes, situated in a unique locus nucleases and 10 ,ug was fractionated through a 0.8% agarose in the Nicotiana tabacum (tobacco) nuclear genome. The gel in Tris/borate/EDTA buffer, transferred to Hybond N organization of these sequences is similar or identical in eight nylon membranes (Amersham), and hybridized with 32p_ different tobacco cultivars we have examined. DNA sequence radiolabeled probes in Church buffer (5) overnight at 65°C. analysis reveals that each repeat has sequences most resem- The final two washes of the membranes were in 0.2x standard bling those of the New World geminiviral DNA replication saline citrate (SSC) at 60°C and labeled bands were visualized origin plus the adjacent ALI gene, encoding the viral repli- by autoradiography.
    [Show full text]
  • Transcription-Mediated Gene Fusion in the Human Genome
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Transcription-mediated gene fusion in the human genome Pinchas Akiva,1,2,3 Amir Toporik,1,3 Sarit Edelheit,1 Yifat Peretz,1 Alex Diber,1 Ronen Shemesh,1 Amit Novik,1 and Rotem Sorek1,4,5 1Compugen Ltd., Tel Aviv 69512, Israel; 2Faculty of Life Sciences, Bar Ilan University, Ramat Gan 52900, Israel Transcription of a gene usually ends at a regulated termination point, preventing the RNA-polymerase from reading through the next gene. However, sporadic reports suggest that chimeric transcripts, formed by transcription of two consecutive genes into one RNA, can occur in human. The splicing and translation of such RNAs can lead to a new, fused protein, having domains from both original proteins. Here, we systematically identified over 200 cases of intergenic splicing in the human genome (involving 421 genes), and experimentally demonstrated that at least half of these fusions exist in human tissues. We showed that unique splicing patterns dominate the functional and regulatory nature of the resulting transcripts, and found intergenic distance bias in fused compared with nonfused genes. We demonstrate that the hundreds of fused genes we identified are only a subset of the actual number of fused genes in human. We describe a novel evolutionary mechanism where transcription-induced chimerism followed by retroposi- tion results in a new, active fused gene. Finally, we provide evidence that transcription-induced chimerism can be a mechanism contributing to the evolution of protein complexes. [Supplemental material is available online at www.genome.org.] Eukaryotic genes are generally well defined on the genome.
    [Show full text]