University of Florida Thesis Or Dissertation Formatting

YOU CANNOT HIDE YOUR LICHENIZE: INFIDELITY IN THE LEPTOGIUM CYANESCENS SPECIES COMPLEX AND ITS ASSOCIATED NOSTOC

BARRY SAUL KAMINSKY

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2016

To everyone who has helped me along this journey

ACKNOWLEDGMENTS

Many people have helped me throughout my time as a graduate student. First and foremost, I thank Stuart McDaniel, my advisor, for his tireless enthusiasm and guidance. I also thank the members of the McDaniel lab, especially labmates Sarah

Carey and Leslie Kollar. I also thank Adam Payton and Emily Woodruff for all of their patience and advice.

Jared Miller helped with the fieldwork. Jacob Landis helped with the ancestral state reconstructions. My collaborators, Roger Rosentreter and Rick and Jean Seavey made helpful suggestions to refine ideas.

I also thank the members of my committee, Matthew Smith, and Pamela Soltis for providing lab resources and suggestions throughout the thesis process. Their support greatly shaped how I approached science and research. Lastly I thank my family for their support throughout my entire time in graduate school.

Permits were issued by the Florida Department of Environmental Protection

(permit # 11051410), Everglades National Park (permit # EVER-00378), and Ordway-

Swisher Biological Station (permit # OSR-14-10). Funding for the research was supported by the Thad Owens Memorial Fund (Ordway-Swisher Biological Station), and the Michael May Interdisciplinary Fund (University of Florida Biology Department).

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 7

LIST OF FIGURES ...... 8

LIST OF ABBREVIATIONS ...... 9

ABSTRACT ...... 11

CHAPTER

1 INTRODUCTION ...... 13

2 SYMBIONT SHARING IN THE LEPTOGIUM CYANESCENS COMPLEX IN FLORIDA ...... 15

Methods ...... 17 Collection Localities and Sampling ...... 17 DNA Extraction and Sequencing ...... 19 Tests for Sexual Reproduction ...... 20 Phylogenetic Analyses ...... 20 Tests for Symbiont Switching ...... 22 Results ...... 22 Mycobiont Phylogenetic Analyses ...... 23 Recombination ...... 24 Nostoc Phylogeny of Florida Specimens ...... 24 Symbiont Switching between Florida Populations ...... 24 Mycobiont Switching of Photobiont on a Global Scale ...... 25 Discussion ...... 26 High Specificity in Leptogium sp. A ...... 26 Mycobiont Specificity amongst Leptogium sp. C and Leptogium sp. D ...... 27 Coevolution ...... 28

3 TAXONOMIC REVISION OF THE LEPTOGIUM CYANESCENS SPECIES COMPLEX IN FLORIDA ...... 41

Methods ...... 44 Collection Methods ...... 44 Phylogenetic Work ...... 44 Morphological Work ...... 45 Results ...... 46 Phylogenetic Analyses ...... 46 Morphology ...... 47

Discussion ...... 47 Molecular Evidence for Cryptic Fungal Diversity ...... 47 Morphological Investigations and Their Impact on Taxonomy ...... 48 Taxonomic Diversity ...... 50 The Putative Species ...... 50 Leptogium cf. arsenei ...... 50 Description ...... 50 Ecology and distribution ...... 51 Differentiation ...... 51 Nomenclatural investigations ...... 51 Leptogium austroamericanum ...... 52 Description ...... 52 Ecology and distribution ...... 53 Differentiation ...... 53 Nomenclatural investigation ...... 53 Leptogium cyanescens ...... 54 Description ...... 54 Ecology and distribution ...... 54 Key characteristics ...... 54 Nomenclature investigation ...... 55 Leptogium cf. denticulatum ...... 55 Description ...... 55 Ecology and distribution ...... 55 Differentiation ...... 55 Nomenclatural investigations ...... 56

APPENDIX: GENBANK RECORDS FOR NOSTOC PHYLOGENY ...... 63

LIST OF REFERENCES ...... 66

BIOGRAPHICAL SKETCH ...... 71

LIST OF TABLES

Table page

2-1 Names of localities, GPS and vegetation community of the eight localities included in analyses ...... 30

2-2 Primers utilized for PCR amplification of mycobiont and photobiont markers. .... 31

2-3 List of all Sanger sequences utilized in analyses...... 32

2-4 Tests for recombination and location of breakpoints in the four mycobiont clades using the Four Gamete Test and Single Breakpoint analyses ...... 35

3-1 List of GenBank records included in the fungal gene MCM7 phylogeny ...... 57

A-1 GenBank rbcLX sequences of the cyanobacterial photobiont of free-living and lichenized Nostoc ...... 63

LIST OF FIGURES

Figure page

2-1 Phylogeny of the individual mycobiont genes ...... 36

2-2 Phylogenetic tree for the concatenated fungal gene dataset ...... 37

2-3 Frequency of the 4 mycobiont clades by locality ...... 38

2-4 A concatenated phylogeny of the Nostoc associated with the Leptogium cyanescens species complex in Florida ...... 39

2-5 A phylogeny of the coding region rbcLX ...... 40

3-1 Assessment of the placement of the Florida fungal clades using a phylogenetic tree of the fungal gene MCM7 and records from the Collemataceae ...... 59

3-2 Assessment of the laminal isidia between the four fungal clades ...... 60

3-3 Assessment of the marginal isidia between the four fungal clades...... 61

3-4 Assessment of the marginal isidia between the four fungal clades...... 62

LIST OF ABBREVIATIONS

ºC Degrees Celsius

AMOVA Analysis of molecular variance

ARSP Alafia River State Park

BRSP Blackwater River State Park

BSSP Big Shoals State Park

C. Collema cf. See also, resembles cm Centimeter

DJSP Dagny Johnson State Park

DNA Deoxyribonucleic acid

ENP Everglades National Park et al. Et alia

FAK Fakahatchee Strand State Preserve

FGSP Fred Gannon Rocky Bayou State Park

FL Florida

FLAS Florida Museum of Natural History

FWSP Falling Water State Park

GARD Genetic algorithm for recombination detection ha Hectare

HHSP Highlands Hammock State Park kg Kilogram

L. Leptogium

MCM7 Deoxyribonucleic acid replication licensing factor mg Milligram

min Minute mm Millimeter

MLG Multi locus genotype

MRSP Myakka River State Park

NATL Natural Area Teaching Laboratory nifV1 Nitrogen fixation gene V

ORD Ordway-Swisher Biological Station rbcLX Rubisco chaperonin gene X and subunit L

RPB1 DNA directed ribonucleic acid polymerase II subunit, largest subunit

RPB2 DNA directed ribonucleic acid polymerase II subunit, second largest subunit rpoc2 Ribonucleic acid polymerase beta chain

RUBISCO Ribulose-1,5-bisphosphate carboxylase/oxygenase

SBP Single breakpoint sec Second sp. Specie

TSP Torreya State Park yr Year

µL Microliter

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

YOU CANNOT HIDE YOUR LICHENIZE: INFIDELITY IN THE LEPTOGIUM CYANESCENS SPECIES COMPLEX AND ITS ASSOCIATED NOSTOC

Barry Saul Kaminsky

May 2016

Chair: Stuart McDaniel Major: Botany

Many unrelated organisms form intimate symbiotic relations. Lichens consist of a fungus (mycobiont) and photosynthesizing partner (photobiont). There have been few regional assessments of both mycobiont and photobiont assemblages in one lichen that utilize multiple mycobiont and photobiont genes. I utilized the common lichen Leptogium cyanescens sensu lato to assess specificity, which is the phylogenetic range of one symbiont that the other symbiont can form a symbiosis with. To test mycobiont and photobiont associations across regional localities, I sequenced three fungal genes and three photobiont genes, cyanobacteria in the genus Nostoc. Within the Leptogium cyanescens species complex there were four mycobiont clades. Three of the mycobiont clades, L. austroamericanum, L. cyanescens and L. denticulatum associated with multiple clades of Nostoc (low photobiont specificity). An AMOVA partitioned by mycobiont species versus locality showed that, amongst these three species, the population structure of the photobiont is best explained by collection site rather than host species. The fourth mycobiont Leptogium cf. arsenei associated with only one clade of photobionts (high specificity), which is uncommon amongst all lichens. There was evidence of recombination within both L. cyanescens and L. denticulatum which

showed that fungal spores are produced and may provide an opportunity for the mycobiont to form a lichen with a different Nostoc genotype. I compared morphological characteristics of the four fungal clades including dominate isidia shape and thallus texture. The same morphological character was found in multiple fungal clades suggesting that a character by itself may be insufficient for species identifications.

CHAPTER 1 INTRODUCTION

Lichens are often referred to as a model organism for symbiosis. A lichen is a symbiotic, coevolved organism between a fungus (mycobiont) and a photosynthesizing partner (photobiont). The “organism” is formed when the cells of the mycobiont and photobiont intermesh, and it resembles neither the mycobiont nor the free-living photobiont (Friedl & Büdel, 2010). The mechanisms that trigger the formation of a lichen are unknown (Friedl & Büdel, 2010). Due to their symbiotic complexity, lichens provide an interesting system to address questions pertaining to the formation and maintenance of symbioses.

In this thesis, I examine the maintenance of the fungal and cyanobacterial symbiosis in the Leptogium cyanescens species complex in Florida. These lichens are the most common nitrogen-fixing lichens in Florida and the southeastern United States

(Brodo et al., 2001). I examine how the genetic diversity of the mycobiont and associated Nostoc photobionts differ by locality throughout Florida. By using genetic diversity and population differentiation I can examine whether different mycobiont clades share photobionts or not. I also examine whether a photobiont from my Florida collections associates with mycobionts outside of Florida to assess the extent of symbiont sharing.

Lichens are classified as fungi because the mycobiont exhibits more diagnostic characteristics than the photobiont does. These characteristics include mycobiont sexual reproductive structures and visible traits that are composed primarily of mycobiont tissues. In Chapter 2, I report evidence for four fungal species within the in L. cyanescens species complex, based on DNA sequence data. In Chapter 3, I present a

taxonomic prospectus based on these molecular data and a comprehensive morphological analysis. These data provide a foundation for further investigations of speciation and species delineation and of the role of these overlooked organisms in driving ecological processes in humid forests in Florida.

CHAPTER 2 SYMBIONT SHARING IN THE LEPTOGIUM CYANESCENS COMPLEX IN FLORIDA

Intimate symbiotic interactions between unrelated species are common in most of Earth’s ecosystems. Yet, symbiosis presents a paradox: how can natural selection favor an allele in one organism that appears to benefit another organism? Some species associate with a narrow phylogenetic range of a symbiont which high specificity.

High specificity can occur in some cases when a symbiont is co-dispersed with their host and therefore limits the opportunity for either partner to evolve independently.

However, low specificity is prevalent in many other types of organisms, including corals

(Baker, 2003), orchid/mycorrhizae (Porras-Alfaro & Bayman, 2007), ant/bacterial associations (Mikheyev et al., 2007), and legumes/nodulating bacteria (Bala & Giller,

2001). A critical gap in our knowledge of the evolution of symbiosis concerns how a symbiont evaluates their symbionts in a marketplace of possible partners.

Lichens are a symbiotic relationship between a fungal partner (mycobiont, typically a member of Ascomycota or more rarely of Basidiomycota) and a photosynthetic partner (photobiont, either a green alga or cyanobacterium) (Friedl &

Büdel, 2010). Mycobiont species with low photobiont specificity may associate with multiple groups of photobionts. In fact, some lichens consist of multiple photobionts (for example, the lichen may contain a green alga and a cyanobacterium) (Friedl & Büdel,

2010). Low photobiont specificity is common in mycobionts (Piercey-Normore &

Depriest, 2001; Yahr et al., 2006; Otalora et al., 2010; Dal Grande et al., 2014), but high specificity has been documented in some mycobiont genera (Otalora et al., 2010;

O’Brien et al., 2013; Leavitt et al., 2015). Similarly, a photobiont group may associate

with multiple mycobiont clades (Wirtz et al., 2003; Yahr et al., 2004), or may only associate with a single mycobiont clade (Otalora et al., 2010; Leavitt et al., 2015).

Many lichens produce sexual and asexual reproductive structures which may influence patterns of specificity. I hypothesize that sexually reproducing lichens will more frequently exhibit low specificity than asexual mycobiont species. This is because mycobiont sexual spores lack a photobiont, meaning that the germinating mycobiont mycelium must find a photobiont in order to form a lichen thallus. Sexually reproducing lichens may associate with a wider pool of photobionts and may have the capacity to associate with one of multiple genotypes that are present in a locality. In contrast, in asexual structures called isidia, the mycobiont and the photobiont are co-dispersed suggesting that species that produce asexual propagules should associate with fewer genotypes of the respective symbiont. Nevertheless, evidence shows that a primarily asexually reproducing mycobiont in a lichen can associate with multiple lineages of photobiont (Otalora et al., 2010; Leavitt et al., 2015). There is sparse data comparing mycobiont recombination rates to the molecular data of their respective photobiont.

To examine the geographic scale of symbiont flexibility, I studied the genealogical variation among mycobionts and photobionts (Nostoc spp.) in the

Leptogium cyanescens species complex in several populations along a latitudinal gradient on the Florida peninsula. Leptogium cyanescens sensu lato is the most widespread nitrogen-fixing lichen in Florida (Moore, 1968). The Leptogium cyanescens species complex primarily utilizes asexual reproductive structures (isidia) and the sexual reproductive structures, (apothecia) are uncommon in most populations. In spite of this,

Otalora et al., (2010) reported that Leptogium cyanescens (3 samples) and the related

L. austroamericanum (2 samples) had low photobiont specificity in a worldwide sample.

However, specificity patterns at the regional level were not investigated and the lichens were identified morphologically so no genetic data was used to show mycobiont diversity nor the phylogenetic relationships between mycobionts. Similarly, the relationships between specific Nostoc genotypes and associated mycobiont species are poorly characterized at a regional biogeographic scale, especially in subtropical ecosystems. In this study I utilize the Leptogium cyanescens species complex as a test case to address the following questions:

1) Does a mycobiont clade associate with one or multiple clades of photobiont? A mycobiont that associates with multiple photobionts has a low specificity and could suggest that the mycobiont/photobiont association may be locally adapted.

2) Is there evidence for sexual reproduction in the mycobiont? If sexual reproduction is occurring, then in order to form a lichen the fungal spores need to associate with a photobiont. Mycobiont spores are an opportunity to associate with a new photobiont genotype.

3) Does a photobiont genotype associate with one or multiple clades of mycobiont across the world? Does the Florida photobionts collected in this study in the same or different lineage. This assessment can be used to examine coevolution at regional and global scales.

Methods

Collection Localities and Sampling

I collected at ten sites in Florida (Table 2-1). The ten sites included two from the

Florida Panhandle and eight from the Florida Peninsula. I chose these sites to sample the L. cyanescens species complex at different latitudes in a representative set of

habitats. The dominant habitat type at eight localities was deciduous hardwood forests.

The vegetation at Everglades National Park (ENP) was a Buttonwood (Conocarpus sp.) forest, and Fred Gannon Rocky Bayou State Park (FGSP) was an old growth sand pine scrub forest. From observation, stand age and hydrological regimes (ranging from no seasonal flooding to seasonally flooded forests) were different between sites to capture the spectrum of habitats. Specimens were collected under the Florida Department of

Environmental Protection permit # 11051410, Everglades National Park permit EVER-

00378, and Ordway-Swisher Biological Station permit OSR-14-10.

I collected 20 “L. cyanescens” samples per locality. One individual thallus was collected per tree, and samples were collected 30 meters apart in a linear transect in an effort to minimize sampling identical genotypes. All of the samples had a smoothe thallus when viewed with a 10x hand lens. A smoothe thallus differentiates L. cyanescens from all other isidiate Leptogium from Florida. In two populations (Alafia

River SP and Highlands Hammock SP), L. cyanescens was locally rare, and I collected haphazardly where this lichen could be found. Morphology from each specimen was examined with a dissecting microscope to differentiate L. cyanescens from the morphologically similar L. austroamericanum. Leptogium cyanescens can be clearly differentiated by the absence of minute wrinkles whereas L. austroamericanum has at least some minute wrinkles (Brodo et al., 2001). In addition, I selected samples to gather data from a wide range of morphological features including: the shape of isidia

(cylindrical or flattened), placement of asexual reproductive structures (isidia) (whether the isidia were present throughout the entire thallus, on margin, or), thallus size, and presence/absence of sexual reproductive structures (apothecia).

DNA Extraction and Sequencing

I chose ten samples for DNA extractions from each population. No other lichens were present in the sample and bryophytes were removed. I extracted DNA from 1.5 mg of a clean outer lobe tip of each lichen using a PowerSoil DNA isolation kit from MO BIO

Laboratories Incorporated. The one modification to the procedure was that I ground the specimens using steel ball bearings, then poured the PowerBead tube content into the vial with the ground specimen.

From each sample I amplified three mycobiont nuclear genes and three photobiont, cyanobacterial, genes. The mycobiont genes were MCM7 (minichromosome maintenance complex component) (Schmitt et al., 2009), RPB1 (RNA polymerase II large subunit) and RPB2 (DNA-directed RNA polymerase II core subunit) primers (this study) (Table 2-2). The cyanobacterial genes were nifV1 (nitrogen fixation gene V) and rpoc2 (RNA polymerase beta chain) (O’Brien et al., 2013) and rbcLX (RUBISCO large chain gene) and the adjacent intergenic spacer (Rudi et al., 1998; O’Brien et al., 2013).

Polymerase chain reaction was conducted in 16 µL volumes using GoTaq MasterMix

(Promega Co., Fitchburg, WI). The cycling conditions for RPB1 were: 94°C for 2 min, then 35 cycles of 94°C for 45 sec, 61°C for 1 min, 68°C for 2:30 min and terminating with a 68°C for 5 min. The cycling conditions for RPB2 were: 94°C for 2 min, then 35 cycles of 94°C for 30 sec, 50°C for 1 min, 72°C for 1:30 min and terminating with a 72°C for 10 min.

The University of Florida Interdisciplinary Center for Biotechnology Research core facility performed the sequencing. Most genes were sequenced in only one direction. I cleaned the sequences in Sequencher v4.10 (Gene Codes, Ann Arbor, MI) and checked all polymorphisms by examining the chromatograms. Sequences were

aligned using MUSCLE (Edgar, 2004), in Geneious v8.1 (http://www.geneious.com), then manually adjusted. Select specimens were deposited in the Florida Museum of

Natural History (FLAS).

Tests for Sexual Reproduction

Sexual reproduction can cause different genomic regions to show different genealogical patterns, which can be detected using tests for recombination. Therefore, I tested for recombination within and among mycobiont loci, using three different tests. A concatenated dataset (MCM7, RPB1, and RPB2) was used for analyses. I ran two tests for recombination and one to pinpoint where a breakpoint occurs. I ran the Four Gamete

Test (Hudson & Kaplan, 1985) in DnaSP v5.10 (Librado & Rozas, 2009). The test looks for two sites that have single nucleotide polymorphisms. If four genotypes at those two positions are found then that suggests that recombination occurred somewhere between those two sites. The other program was Single Breakpoint (SBP) (Kosakovsky

Pond et al., 2006) and was run on the online HyPhy package on the Datamonkey server

(Kosakovsky Pond & Frost, 2005). Single breakpoint (SBP) is a qualitative tree-based approach that looks for topological discordance. When SBP detected recombination,

Genetic Algorithm Recombination Detection (GARD) was used to figure out the specific position of the breakpoint (Kosakovsky Pond et al., 2006). The analyses were run using the HKY85 model, a general discrete model, and 4 rate classes. Support for recombination was considered high if both SBP and the Four Gamete Test supported a breakpoint in the concatenated sequence.

Phylogenetic Analyses

The first phylogenetic test was to assess the number of clades or groups of both the mycobionts and the photobionts. If the number of mycobiont clades is the same as

photobiont clades, then this would suggest the mycobionts have high specificity. If the number of mycobiont and photobiont clades is unequal then this would be evidence of host switching. I built phylogenetic trees for each of the three mycobiont genes separately to determine how many mycobiont clades were present. I used a maximum likelihood approach in RAxML v8.2 (Stamatakis, 2014) and the GTRGAMMA model to build each tree. Each tree was run for 1000 bootstraps. The outgroup in each tree was

Collema furfuraceum (GenBank records: JX992982, GQ259048, KJ766931,

GQ396261). Support for concordance was considered high if the bootstrap value was

>70%. Each mycobiont gene tree had four clades and each specimen was in the same mycobiont clade across all three trees. However the clades were not concordant. Two trees had the same topology, while the third had a different topology that was not supported. The sequences were concatenated into a multilocus genotype (MLG) for each specimen. A phylogenetic tree was built based on the concatenated MLG’s using

GTRGAMMA and C. furfuraceum as the outgroup.

I also built trees for each of the three cyanobacterial genes using GTRGAMMA in

RAxML to assess how many groups of photobionts were present. I used Anabeana records from GenBank as the outgroup for each gene (X99902, M60831, CP003659).

Each gene tree was run for 1000 bootstraps. The same specimens grouped together among all three trees and the topology was no supported disconcordance. The sequences were concatenated, and a concatenated tree was reconstructed using

RAxML and the GTRGAMMA model of nucleotide substitution for 1000 bootstraps.

Lastly, to examine if the photobiont that is symbiotic with L. cyanescens species complex in Florida also associates with other mycobionts throughout the world, I built a

phylogeny using the coding region rbcLX of all lichenized Nostoc available in GenBank.

I mined GenBank using a script on http://dx.doi.org/10.6084/m9.figshare.841758

(O’Brien, 2013), which contains a current list of symbiotic and closely related cyanobacteria records (Appendix A-1). I included additional Florida rbcLX for individuals not used in previous analyses (included in Appendix A-1). I aligned the sequences using

MAFFT (Katoh, 2013) and Geneious to find the proper reading frame. The tree was generated using GTRGAMMA in RAxML for 1000 bootstraps. A total of 643 specimens were used initially. The tree that is presented contains records of the Nostoc that associates with Leptogium and closely related mycobionts in the Collemataceae. To better visualize the phylogenetic tree, a majority rule analysis with a cutoff bootstrap of

70 (Aberer et al., 2010). All analyses were conducted on the University of Florida

HiperGator 2.0.

Tests for Symbiont Switching

I also examined genetic differentiation of the photobiont to determine whether the genetic diversity was better explained by partitioning by mycobiont clade or by population. If host associations are partitioned by mycobiont clade, that would suggest coevolution. However, if the population is more important that would suggest that there is a local pool of photobiont for each mycobiont or that the pool could interact with multiple hosts at that collection site. I generated these values using AMOVA (Excoffier et al., 1992) in Arlequin v3.5 (Excoffier et al., 2005).

Results

A total of 420 sequences were generated using Sanger sequencing (Table 2-3).

Eighty samples were from MCM7, 68 from RPB1, 66 from RPB2, 77 from nifV1, 57 from rbcLX and 72 from rpoc2. The concatenated sequence length of the Nostoc genes was

1126 bases. There were 240 substitutions, 164 transitions and 73 transversions. There were on average 46 polymorphisms and π was 57. For the mycobiont there were 1327 sites amongst three loci. There were 309 polymorphic sites, 244 transitions and 96 transversions. There were on average 67 segregating sites, and π was 126.

Mycobiont Phylogenetic Analyses

For the individual mycobiont gene trees, four clades were recovered and the same individuals always were in the same clade (Figure 2-1). Taxonomy will be treated in Chapter 3, however the four clades morphologically resemble the following taxa: L. arsenei, L. austroamericanum, L. cyanescens, and L. denticulatum. For this thesis, I will call the taxa Leptogium sp. A, B, C and D. The topology of the mycobiont clades were not congruent. In all three mycobiont genes one clade, Leptogium sp. A was sister to the other three taxa. In two of the gene trees, Leptogium sp. C was sister to Leptogium sp. D however in one tree Leptogium sp. C was sister to Leptogium sp. B. However the node with the discordant topology was not supported, the bootstrap was <70.The bootstrap support was >70 for all other clade branches.

In the concatenated dataset four mycobiont clades were present (Figure 2-2).

Leptogium sp. A was sister to the other three taxa. Leptogium sp. C and Leptogium sp.

D were sister taxa. The bootstrap for each clade was >90%. Leptogium sp. B was sister to Leptogium sp. C and D. The topology is the same as the genes MCM7 and RPB2.

The four mycobiont clades were widespread in Florida (Figure 2-3). Leptogium sp. D was collected in 8 localities while Leptogium sp. C was collected in 4 localities.

Leptogium sp. D was more common in southern Florida, while Leptogium sp. C was only found in northern Florida, north of Gainesville. Leptogium sp. B was found in four sites in northern Florida. Leptogium sp. A was collected in six localities (ARSP, ENP,

FAK, FGSP, HHSP, ORD). All four species co-occur at two sites (FGSP, HHSP). With further collection Leptogium sp. A, Leptogium sp. B and Leptogium sp. D may be sympatric in Florida while Leptogium sp. C is restricted to northern Florida.

Recombination

Recombination was detected in Leptogium sp. C, Leptogium sp. D and

Leptogium sp. B, but not Leptogium sp. A (Table 2-4). In the Four Gamete Test, there were two recombination events in Leptogium sp. B, four in Leptogium sp. C and one in

Leptogium sp. D (Table 2-4). Recombination was detected using SBP in the Leptogium sp. C and D.

Nostoc Phylogeny of Florida Specimens

The phylogenetic trees for nifV1, rbcLX and rpoc2 were concordant. There were two photobiont clades (Figure 2-4). Clade 1 associated with only one mycobiont clade,

Leptogium sp. A. Clade 2 was a large polytomy that contained the cyanobionts of

Leptogium sp. C, Leptogium sp. D, and Leptogium sp. B. Within the polytomy, there were seven groups of genotypes but their relationships to one another could not be resolved. Each of the three mycobiont clades associated with two groups of genotypes with no overlap. Four of the Nostoc groups only associated with one mycobiont clade.

Symbiont Switching between Florida Populations

To determine whether the photobiont populations were structured more by mycobiont clade or by mycobiont population, I removed Leptogium sp. A from the analysis because it was genetically different from the other three taxa. Its inclusion would have made it difficult to test for more subtle associations amongst the other three taxa. The AMOVA value when partitioned by locality was 0.3 (0.28-0.33) and the

AMOVA by mycobiont clade was 0.13 (0.11-0.17). This suggests that among the three

mycobiont clades, availability of a photobiont genotype in a collection site is a better indicator than mycobiont clade.

To assess how widely distributed a mycobiont/photobiont genotype combination was, I manually searched for the same mycobiont, photobiont or mycobiont/photobiont

MLG between habitats. The same photobiont MLG of Leptogium sp. A was found in three localities (ENP, FAK, FGSP). The same photobiont MLG for Leptogium sp. B

(ARSP and HHSP) was found in two collection sites, and for Leptogium sp. D also two localities (FAK, ORD mesic). The same MLG mycobiont genotype in Leptogium sp. A was found in two locations (ENP and FAK); in Leptogium sp. C one MLG mycobiont genotype was found in two locations (FAK and ENP), and another MLG mycobiont genotype occurred in three locations (ENP, FGSP, TSP). The same MLG mycobiont/photobiont MLG was found in two localities in Leptogium sp. A (ENP, FAK).

Mycobiont Switching of Photobiont on a Global Scale

The general topology of the global phylogeny based on rbcLX was similar to

Otalora et al., (2010) (Figure 2-5). Leptogium sp. A was in Clade 1, and Leptogium sp.

D and Leptogium sp. C were in clade 2. Only one chromatogram of a Nostoc rbcLX from a L. austroamericanum host showed clean sequences and it was identical to the rbcLX from a Florida L. cyanescens specimen. The phylogenetic analysis suggests limited sharing on a global scale. One group of photobiont which associates with L. cyanescens was monophyletic while the other group shares a genotype with a L. gelatinosum specimen from Spain and L. cyanescens from North Carolina. No other

Florida mycobiont is currently known to share a rbcLX genotype elsewhere in the world.

The Nostoc photobiont from Leptogium cf. arsenei is sister to a Nostoc photobiont from L. cyanescens from Spain. Leptogium sp. D associated with two groups

of Nostoc. However, rbcLX sequences were only obtained from half of the specimens.

One group of L. denticulatum was monophyletic, and the sister of L. “denticulatum” is L. austroamericanum from Argentina. The sister clades to the photobiont in L. cyanescens from Florida are L. austroamericanum from Colombia and L. furfuraceum (photobiont from multiple continents).

Discussion

High Specificity in Leptogium sp. A

The Leptogium sp. A mycobiont clade had higher specificity than the other three

Leptogium clades and only associated with one clade of photobionts throughout Florida.

Based on the phylogenetic markers used here, there was low phylogenetic diversity and there was no evidence for recombination within the Leptogium sp. A mycobiont clade. In the photobiont MLG for Leptogium sp. A (11 individuals), 1 SNP was found in only one individual from HHSP, suggesting that there was low diversity among the Nostoc photobionts. This high specificity and lack of genetic diversity suggest that the mycobiont and photobiont may be strongly co-dispersed in asexual propagules (isidia) or that they have some strong association that precludes association with a different symbiotic partner. The Nostoc that associates with this mycobiont clade was unique in the phylogeny and was not found in any other places yet. It appears that this mycobiont clade and its Nostoc group have high specificity.

A study of the Nostoc associations of Collemataceae by Otalora et al., (2010) found that 5 of 24 mycobionts (Collema flaccidum, Leptogium furfuraceum, L. magnussonii, L. saturninum and Scytinium lichenoides) were highly specific to only one clade of photobiont based on a total of five to seven collections; three of the mycobiont clades were collected in non-contiguous European nations and the other two contained

specimens from non-contiguous European nations and North American collections

(Otalora et al., 2010). I collected 14 samples in my regional assessment. One future direction is to expand the range of sampling of the Leptogium sp. A clade.

I observed that Leptogium sp. A primarily produces isidia and apothecia are rarely, which is similar to the above lichens. The five high-specificity mycobionts reported by Otalora et al., were widespread, yet grow in areas with high humidity and old growth forests (2010). High specificity has been observed in many lichen genera in the Lobariaceae, which like Collemataceae is in the order Peltigerales, and have a narrow ecological niche (Dal Grande et al., 2014). Leptogium sp. A may not be a habitat specialist. I found Leptogium sp. A in hardwood bottomland forests, buttonwood forests, and temperate hardwood forests suggesting it is a generalist.

Mycobiont Specificity amongst Leptogium sp. C and Leptogium sp. D

Multiple pieces of evidence suggest that Leptogium sp. B, Leptogium sp. C and

Leptogium sp. D are distinct mycobiont species that are biologically separated units.

Despite morphological similarities (Chapter 3) and co-occurring in many of the same sites and habitats, the phylogenetic results indicate that they are phylogenetically separated and likely not capable of mating with one another.

These three cryptic taxa have a low specificity at a regional level. Each mycobiont clade associates with multiple lineages of Nostoc photobionts. Leptogium sp.

C associates with multiple Nostoc clades that do not appear to be closely related based on the wider phylogeny (Figure 2-5). Most mycobionts exhibit this same pattern of low specificity on a larger geographic range but high specificity for locally available photobionts (Rikkinen, 2013).

The findings suggest that there is local adaptation or limited dispersal of either the photobiont, or the mycobiont, or both symbionts. An individual Leptogium + Nostoc

MLG occurred only rarely in more than one locality. The dominate mycobiont and photobiont combination may not be the same across a wide geographic region however the relationship may be widespread but locally rare. There was an instance of photobiont being the same across large distances in Leptogium sp. B (HHSP and

ARSP) and Leptogium sp. D (FAK and ENP). It may be that one or both symbionts have locally adapted to locality-level habitat variables, although further tests are needed to address this. The presence of sexual reproduction in the mycobiont provides the opportunity to switch partners, and potentially to adapt to local environmental differences. Dictyochloropsis reticulata, the photobiont that associates with Lobaria, has slightly different genetic structure between forest types (Nadyeina et al., 2014). Another explanation for genetic differences between populations, is that the isidia may have limited dispersal (Walser, 2004).

Coevolution

There is conflicting evidence of coevolution between mycobionts and photobionts in the L. cyanescens species complex depending on the scale and data that are studied. When the Florida data are examined alone, they suggest there may be coevolution deeper within the tree at the node between Leptogium sp. A and the other three taxa. However, when additional samples are included on a global scale, the phylogenetic placement of Nostoc that associates with L. cyanescens, appears in multiple subclades, which suggests that a Nostoc genotype can associate with multiple mycobionts, including mycobionts in different genera In addition, Nostoc of L. Leptogium

sp. D, and Leptogium sp. B were found in different subclades and associated with more distantly related mycobiont clades of taxa from around the world.

There were no instances in which the four mycobiont clades shared the exact photobiont MLG in Florida, which suggests that switching may not be occurring or is at very low frequencies within a region. Sampling in many additional localities may provide a better idea of the number of instances of switching. Future studies of additional isidiate and apotheciate lichens should be sampled to assess if there is a core group of isidiate lichens sharing photobionts with mycobionts that only produce sexually.

To summarize, three of the four mycobiont clades had a high photobiont specificity within a locality, but lower specificity across all collection sites. There was evidence of sexual reproduction, which suggests that the mycobiont can switch photobiont. Globally there is evidence for sharing of cyanobacterial photobionts between different mycobiont species. This evidence suggests that there is local adaptation that the mycobiont or photobiont is changing its respective symbiont between localities

Table 2-1. Names of localities, GPS and vegetation community of the eight localities included in analyses. Locality Location (GPS) Tree community Alafia River State Park 27.763, -82.140 Hardwood bottomwood forest Everglades National Park 25.178, -80.899 Buttonwood forest in a salty marsh Fakahatchee Strand State Preserve 26.004, -81.399 Temperate hardwood forest Fred Gannon Rocky Bayou State Park 30.499, -86.426 Pine scrub habitat Highlands Hammock State Park 27.467, -81.542 Xeric and mesic temperate hardwood forest Ordway-Swisher Biol. Station- 29.700, -81.963 Temperate hardwood forest Ordway-Swisher Biol. Station 29.686, -82.0218 Mesic Quercus dominated hardwood forest Torreya State Park 30.530, -84.947 Quercus dominated hardwood forest

Table 2-2. Primers utilized for PCR amplification of mycobiont and photobiont markers. Locus Direction Primer sequence (5' to 3') Reference MCM7 forward ACI MGI GTI TCV GAY GTH AAR CC Schmitt et al., 2009 MCM7 reverse GAY TTD GCI ACI CCI GGR TCW CCC AT Schmitt et al., 2009 nifV1 forward GTCTCTGGTATCCAMATYGC O'Brien et al., 2013 nifV1 reverse GCGCACTGCATCTAAAACAG O'Brien et al., 2013 rbcLX forward GAGTTTGARGCAATGGATACC O'Brien et al., 2013 rbcLX reverse GGGGCAGGTAAGAAAGGGTTTCGTA Rudi et al., 1998 RPB1 forward GAA GTT GCT GGA GAT GGT CTG This study RPB1 reverse TAA GTT AAG TCG TCT TCA CCG CG This study RPB2 forward ATGCTYTTCAACAAGCTDACCAGG This study RPB2 reverse GTGTGGCCGTTGTACATYACCTC This study RPB2 reverse CCTWCCCAGACGCCRTTCAC This study rpoc2 forward GCBATTCAGGAAGCACTAGC O'Brien et al., 2013 rpoc2 reverse CCTTGAGGATCTGCCATC O'Brien et al., 2013

Table 2-3. List of all Sanger sequences utilized in analyses. Collection number MCM7 RPB1 RPB2 nifV1 rbcLX rpoc2 ARSP 43 + - - - - - ARSP 44 + + - + + + ARSP 45 - - - +* - +* ARSP 47 + + + + - + ARSP 49 + + + + - + ARSP 50 + + + + - + ARSP 54 + + + +* - +* ARSP 55 + - - - + - ARSP 57 + + - +* - +* ARSP 58 + - + - - - BRSP 112 + + + +* + +* DJSP 213 + - + - + - ENP 1 + + + + + + ENP 2 + + + +* + + ENP 4 + + + + + + ENP 6 - + + + + + ENP 8 + + + + + + ENP 10 + + + +* + + ENP 11 + + + + + + ENP 16 +* - + + + + ENP 20 + + + + + + ENP 22 + + + - + + FAK 185 + + + +* - + FAK 188 + + + +* - + FAK 189 + + + +* - + FAK 192 + - + + + + FAK 194 + + + +* - + FAK 196 + + + + + + FAK 198 + + + + + + FAK 201 + - - - - - FAK 203 + + + +* - + FAK 205 + + +* + + + FGSP 132 +* + +* + - + FGSP 133 + + - + + + FGSP 134 + + - + - + FGSP 135 + + + + + - FGSP 140 + + + + + - FGSP 141 + + + + + - FGSP 146 + + + + + - FGSP 147 + + + + + +* FGSP 153 +* + +* + - +

Table 2-3. Continued Collection number MCM7 RPB1 RPB2 nifV1 rbcLX rpoc2 FWSP 114 - - - + + +* FWSP 115 - +* + + + +* HHSP 20 + + + + - + HHSP 21 + - - - - - HHSP 23 + - + - - - HHSP 24 + + + + - + HHSP 25 + + + + - + HHSP 27 + + + + - + HHSP 31 + + + +* + +* HHSP 32 + + + + - - HHSP 33 + - + - - - HHSP 38 + - - + + + HHSP 39 - + - +* + + MRSP 206 + - - - + - NATL Leau - + - - - - NATL 211 + + + - + - ORD 157 + + + + + + ORD 159 + + + + + + ORD 162 + + + + + + ORD 165 + + + + + + ORD 169 + + + + + + ORD 171 + + + + + + ORD 174 + + + + + + ORD 176 +* + - + + + ORD 177 + - - + + + ORD 22 + + + +* - + ORD 23 + + + + + + ORD 24 + + + +* + +* ORD 25 + + + +* + + ORD 26 + + + +* + + ORD 27 + + + +* + +* ORD 28 + + + +* + +* ORD 29 + + + +* + + ORD 30 + + + +* + + ORD 31 + + + +* + + ORD 208 + - - - + - ORD 217 + - - - - - TSP 117 + - - + + +* TSP 119 + - - + - +* TSP 121 - + + + + +* TSP 122 + - - + - +

Table 2-3. Continued Collection number MCM7 RPB1 RPB2 nifV1 rbcLX rpoc2 TSP 123 - + + +* + + TSP 124 + + + + - + TSP 125 + + + + - + TSP 126 + + + + + + TSP 127 + + - +* - - TSP 128 +* + +* + - + + denotes specimens that were successfully amplified; - denotes specimens that data was not successfully amplified. Specimens with a * were sequenced in both directions.

Table 2-4. Tests for recombination and location of breakpoints in the four mycobiont clades using the Four Gamete Test and Single Breakpoint analyses. Four Gamete Test SBP GARD Recombination Recombination Bases for Mycobiont clade events detected Bases for Breakpoint(S) detected Breakpoint(s) Leptogium sp. A 0 none No none Leptogium sp. B 2 447, 483; 483, 660 No none Leptogium sp. C 4 228, 372; 372, 434; 450, 827; 827, 1179 Yes 513 Leptogium sp. D 1 432, 1151 Yes 558 SBP is Single Break Point; GARD is Genetic Algorithm for Recombination Detection.

A B

Figure 2-1. Phylogeny of the individual mycobiont genes. A) MCM7, B) RPB1, C) RPB2. The topology for MCM7 and RPB2 are identical. In RPB1 Leptogium sp. B is sister to Leptogium sp. C, while in MCM7 and RPB2 Leptogium sp. C is sister to Leptogium sp. D.

Figure 2-2. Phylogenetic tree for the concatenated fungal gene dataset.

Figure 2-3. Frequency of the 4 mycobiont clades by locality. Only the eight main localities are included. Two localities were made in the Ordway-Swisher Biological Station (ORD Suggs and ORD mesic) and the same frequency of each mycobiont clade was present in both sites. The four mycobiont clades were found in multiple localities and were widespread. Leptogium sp. C was not present in southern Florida populations.

Figure 2-4. A concatenated phylogeny of the Nostoc associated with the Leptogium cyanescens species complex in Florida. All sequences of three cyanobacterial genes, nifV1, rbcLX, and rpoc2 were included in this phylogeny. Each Nostoc isolate is shown with a colored circle depicting the identity of its mycobiont. Three of the mycobiont clades associate with multiple groups of Nostoc whereas the L. cf. arsenei mycobiont associates with only one Nostoc group.

Figure 2-5. A phylogeny of the coding region rbcLX that includes all Florida specimens and select records of free-living and lichenized Nostoc from GenBank. There were three clades, and the Florida Nostoc was widespread amongst all three clades. This suggests that coevolution is not occurring at a global scale.

CHAPTER 3 TAXONOMIC REVISION OF THE LEPTOGIUM CYANESCENS SPECIES COMPLEX IN FLORIDA

Molecular sequence data can guide observations of morphology in determining species delimitation in fungi. Lichens are a symbiosis between a fungus (referred to as a mycobiont) and a photosynthesizing partner (photobiont). Species delineation in lichens has often been difficult. Sequence data have shown that there are instances where mycobiont species, that have no obvious differences in morphological characteristics, are in fact multiple species (Molina et al., 2011; Leavitt et al., 2013).

Other lichenized species possess such great morphological variation that they appear to be multiple species but are actually one species (Lendemer & Ruiz, 2015). Conversely, there are also many examples where a fungal species with a wide range of traits may in fact be multiple species, each with a narrower range of morphological traits (Magain &

Serusiaux, 2015).

The Collemataceae are a family of lichenized fungi that molecular evidence has been utilized to examine character evolution at the level of genus. Recent study of molecular and morphological characteristics suggests that there are approximately 10 genera delineated by the presence or absence and type of an outer cortex in combination with additional morphological traits and substrate data (Otalora et al.,

2014). These results were largely confirmed by Miadlikowska et al., (2014). Taxonomic work in Collemataceae is ongoing. Recently, the genus Epiphloea was moved from

Heppiaceae and synonymized with Leptogium based on the presence of a

Lecanoralean ascus type and tube-like amyloid structures (Schultz et al., 2015).

Previous work has focused primarily on revising at the level of genera and investigation into species complexes is necessary. One widespread species complex in

the Collemataceae that is in need of molecular and morphological work is the

Leptogium cyanescens complex. This genus is a very common nitrogen-fixer in epiphytic communities in the southeast United States. Leptogium cyanescens fixes up to 0.22-1.23 kg nitrogen ha-1 yr-1 per inch in the Piedmont region of North Carolina

(Becker et al., 1977). Many species of Leptogium are old growth indicators and are negatively impacted by human impacts such as climate change and air pollutants

(Brodo et al., 2001)

The Leptogium cyanescens species complex consists of three morphotypes: L. austroamericanum, L. cyanescens and L. denticulatum. Leptogium cyanescens and

Leptogium austroamericanum are currently circumscribed as cosmopolitan species, found on every continent except Antarctica and are the most common nitrogen-lichens in the southeast United States (Brodo et al., 2001). Leptogium denticulatum was considered widespread but was recently was split into 5 species based on only morphological data from only a portion of its range although no molecular evidence was presented to confirm the morphological data (Kitaura et al., 2015).

Based on morphological examinations, the three fungal species have a large overlap of morphological characters, however there are two main characteristics used to differentiate the three taxa. Asexual reproductive structures such as isidia are used to tell apart L. denticulatum from L. austroamericanum and L. cyanescens. The latter two have similar asexual reproductive structures (isidia) ranging from cylindrical to flattened to fan-shaped, yet are predominately cylindrical or flattened. Occasional fan-shaped isidia may be present on a thallus (the vegetative body), but the majority of the isidia on a thallus are cylindrical. Leptogium denticulatum only has fan-shaped isidia (denticules).

The presence of only denticules is used as a diagnostic characteristic to delineate species (Kitaura et al., 2015). However from observation, many characteristics related to isidia such as shapes of isidia, isidia type, and the placement of the isidia, whether it is marginal or laminal or both are variable within a species (Jørgensen & Nash, 2004).

To differentiate between L. cyanescens and L. austroamericanum, the presence or absence of wrinkles on the upper thallus is utilized. Leptogium austroamericanum has minute wrinkles on the thallus while L. cyanescens has an entirely smooth thallus

(Brodo et al., 2001; Jørgensen & Nash, 2004). Thallus thickness is also different. The thallus thickness of L. austroamericanum is 100-300 µm while L. cyanescens is 35-110

µm (Jørgensen & Nash, 2004).

Three to four genes from two specimens of L. cyanescens (from Spain and North

Carolina) and L. austroamericanum (from Florida) were amplified and each species formed a separate clade (Otalora et al., 2013). In the same study L. cyanescens and L. denticulatum (two specimens from Argentina) were two separate clades, suggesting that the two are different species. These examinations suggest that that wrinkles and predominate isidia shape may be useful for species delineation, however there has been no regional study where all three members of L. cyanescens species complex have been collected and examined using molecular techniques.

While investigating fungal/Nostoc associations within L. cyanescens in Florida, we applied molecular techniques to identify multiple phylogenetic lineages within the L. cyanescens species complex (See Chapter 2). In this study we investigate the taxonomic and phylogenetic placement of these phylogenetic lineages and determine

whether there are morphological characters shared among species within lichen clades.

We provide a preliminary revision to the isidiate Collemataceae in Florida.

Methods

Collection Methods

I collected samples of the L. cyanescens species complex from eight locations at different latitudes throughout Florida (detailed in Chapter 2). Six localities were deciduous hardwood forests, one was a Conocarpus forest, and the other was a sand pine scrub. Ten samples were collected per locality. Samples were brought back to the lab and examined under a dissecting microscope. DNA was extracted using the procedure detailed above (Chapter 2). Samples were chosen non-randomly to better capture differences in morphology, and emphasis was placed on sampling L. cyanescens and L. denticulatum. Select specimens were deposited in the Florida

Museum of Natural History (FLAS).

Phylogenetic Work

First I looked for taxonomic concordance between MCM7, RPB1, and RPB2 by building gene trees for each. I used a maximum likelihood approach in RAxML v8.2

(Stamatakis, 2014) and a GTRGAMMA model to build the trees. Each gene tree was run for 1000 bootstraps. To test the placement of the specimens within the

Collemataceae, I built a phylogenetic tree using select MCM7 records in the

Collemataceae from GenBank (Table 3-1). I used MCM7 because it was a gene that has been widely sequenced in the Collemataceae. Pannaria rubiginosa and

Staurolemma omphalarioides were selected as outgroups following Otalora et al.,

(2013), Otalora et al., (2014), and Schultz et al., (2015).

Morphological Work

I conducted a blind assessment of morphological characters based on 96 specimens of the L. cyanescens species complex. For each trait, all 96 samples were examined and placed into preliminary groupings to better understand the range of traits.

Afterwards, each specimen in each group was examined to assess each trait separately. The characters I examined are:

1. Dominant asexual structure on margin: 0 = Denticulate, 1 = Lobulate, 2 = Isidiate

2. Dominant asexual structure on lamina: 0 = Denticulate, 1 = Lobulate, 2 = Isidiate

3. Dominant texture of the upper cortex of the lichen thallus (40x magnification): 0 =

Smooth 1 = Wrinkled, 2 = Canaliculate

Dominant asexual structure and texture of the upper surface was defined as greater than 75% cover of the given trait. I defined denticules as a type of isidia that appears fan-shaped, with a base that is less than half as wide as the widest part of the structure. Denticules are also referred to as phyllidia (Kitaura et al., 2015). Lobules are flattened cylindrical structures that are not constricted at the base. Flattened isidia were treated as lobules. Isidia were defined as cylindrical, and taller than wider structures.

Wrinkled was defined as having sharp ridges, while canaliculate is when the lobe has raised portions that are not sharply ridged or wrinkled and are usually only visible under a minimum of 10x magnification. Canaliculate may often be referred to as “wavy” in the literature; however, “wavy” is a general term that could also apply to a lobe that is not entirely in plane.

I mapped out these traits using a maximum likelihood approach in Mesquite v3.04 using the ancestral state analysis to assess if a specific trait was found in one or multiple clades (Maddison & Maddison, 2015). A trait was considered highly informative

if it was restricted to only one clade, and marginally informative if it was found in two or more clades.

Results

Phylogenetic Analyses

The phylogenetic tree with MCM7 records from Florida and GenBank suggests that there are 4 fungal clades (Figure 3-1). All four clades are located within a large group of specimens in Leptogium. However based on one marker, species currently classified as Leptogium were polyphyletic with Collema. In addition, Scytinium and

Lathagrium were polyphyletic. Two fungal clades, L. cyanescens and L. denticulatum, are located within L. cyanescens (in a broad sense). A specimen of L. cyanescens from

North Carolina was located within the Florida L. cyanescens clade. Leptogium denticulatum records were genetically distinct in comparison to L. denticulatum records from Argentina. One clade was L. austroamericanum, and contained the GenBank record of L. austroamericanum from Florida. The last clade is on a separate branch and is distantly related to L. cyanescens and L. austroamericanum. This species is referred to as L. cf. arsenei and is a species new to Florida. The four fungal clades are largely sympatric throughout Florida. One exception is that L. cyanescens is not found in southern Florida while its sister clade L. denticulatum is widespread throughout Florida.

In each individual gene tree for MCM7, RPB1, and RPB2, four clades were recovered. The same individuals were in the same clade in all three gene trees. The topologies were not concordant. In all three genes four clades L. cf arsenei was sister to the other three clades. In MCM7, and RPB2 L. denticulatum is sister to L. cyanescens, while in RPB1 L. austroamericanum and L. cyanescens were sister (figures in Chapter

2). However for RPB1 there was no support for branch for L. austroamericanum and L. cyanescens (bootstrap <70).

Morphology

For the character analysis, because there were large polytomies within all of the fungal clades, one individual representing each combination of unique trait sets in each fungal clade was used for character state reconstruction. There were morphological differences among the four fungal clades (Figures 3-2, 3-3, 3-4). Leptogium cf. arsenei was the only clade that had a predominantly canaliculate thallus, in all but one individual. Leptogium austroamericanum had minute wrinkles in all but 2 specimens, though the wrinkles were often only visible at magnification of at least 20x. The isidia of

L. austroamericanum were predominantly cylindrically isidiate, and rarely globose. The thallus of L. cyanescens and L. denticulatum was predominantly smooth. Leptogium denticulatum contained over 75% phyllidia on both the margin and lamina, in all but 2 individuals, which were isidiate. Of the 24 L. cyanescens individuals sampled, 23 were predominantly lobulate or isidiate, and one was phyllidiate.

Discussion

Molecular Evidence for Cryptic Fungal Diversity

The molecular results suggest that at least 2 cryptic species are present in the L. cyanescens complex in Florida. The species appear to all be located with Leptogium; however, inclusion of additional genes to MCM7 may address the boundaries of

Collema and Leptogium. A sample of the specimens was examined for a cortex, a one- cell-thick layer of cells on the upper and lower boundaries of the thallus. A cortex was present in each fungal clade.

Cryptic species have been documented in species complexes of lichens including Letharia, Pseudocyphellaria and Rhizoplaca (Leavitt et al., 2011; Leavitt et al.,

2014; Moncada et al., 2014). Two of the ten localities contained all four fungal clades, but with further collection all four fungal clades may co-occur in additional localities.

Sympatry of cryptic species has been observed in other lichen species complexes, including Rhizoplaca melanophthalma (Leavitt et al., 2011).

The one exception to sympatry is that Leptogium cyanescens may not be present in southern Florida. Further sampling is needed to determine if L. cyanescens is found in southern Florida or not. Moore (1968) noted that some lichen species were found only north or south of Tampa and Melbourne (approximately 28° latitude). It may be that biotic or abiotic variables associated with latitude may limit the dispersal of Leptogium cyanescens into southern Florida. This seems plausible as there is evidence that the biogeography of other fungi is affected by abiotic variables associated with latitude in this region. For example, the ascomycete Neurospora crassa contained two populations: one in Louisiana and one in southern Florida, Haiti and Mexico (Caribbean

Basin). The two populations differed by distinctive alleles in both cold tolerance and circadian cycle genes (Ellison et al., 2011), suggesting that abiotic factors can influence speciation. It is also possible that Leptogium denticulatum may be widespread but locally uncommon in northern Florida because there are only small and sparse areas of suitable habitat in northern Florida that possess currently unknown abiotic variables necessary for its survival.

Morphological Investigations and Their Impact on Taxonomy

The findings of the morphological analyses suggest that isidia shape, and thallus texture are highly variable within a species. A single character may not be sufficient to

delineate between two species. Individual traits do not accurately delineate species

100% of the time. The type of isidia, specifically denticules and cylindrical isidia, may be an unreliable characteristic for species delineation unless used in conjunction with other characteristics. Two individuals of L. denticulatum were densely isidiate, with approximately 15% phyllidia. Phylogeography may be useful but only in part of the fungus range. Leptogium cyanescens and L. denticulatum may be reproductively isolated but recently diverged. This may result in an incomplete sorting of morphological traits (Taylor et al., 2000). I recommend assessing additional characteristics that may be more stable such as the shape of the hyphae or thallus thickness.

The presence of wrinkles may be variable in L. cf. arsenei. Wrinkles may occasionally cover over 75% of the surface area of L. cf. arsenei thallus. I undersampled wrinkled thalli, because it is a characteristic for L. austroamericanum and

I was focusing on collecting L. cyanescens. Further sampling is needed to assess morphological similarity between L. cf. arsenei and L. austroamericanum. Lobe size or thallus color may be informative characteristics. In L. austroamericanum, wrinkles may sometimes be a difficult characteristic to assess. Wrinkles may be present at 10x, but sometimes wrinkles may only appear minute at 20x or 40x. A more accurate description is the thallus is “never really smooth” (Jørgensen & Nash, 2004). Leptogium cyanescens has been described as smooth. However, there appear to be patches of wrinkles (under 5% of surface area) in L. cyanescens and on L. cf. arsenei. The wrinkles are never on lobe tips and usually on the base of an upturned lobe.

A single morphological trait though may be useful to narrow to a smaller number of possible species. For example, if a thallus is predominately wrinkled it is either L. cf.

arsenei or L. austroamericanum, the other taxa could be removed. However to determine between L. cf. arsenei and L. austroamericanum multiple characteristics should be utilized in a species identification key. Isidia shape may not be informative to eliminate taxonomic choices in a dichotomous key.

Taxonomic Diversity

Leptogium cf. arsenei is a large conspicuous lichen that appears to be undercollected in Florida and possibly other southeastern states. In this regard, the lichen is similar to the recently reported Parmotrema internexum in the Atlantic Coastal

Plains (Lendemer, 2015), which has been widely collected but misidentified. Recent and intensive collection efforts in southern Florida have yielded many new records of crustose lichens in Florida (Lucking et al., 2011; Seavey & Seavey, 2012; Seavey &

Seavey, 2014; Sanders & Lucking, 2015). These taxonomic studies suggest that additional collection of lichenized fungi is needed to establish a baseline of biological diversity in this region.

The Putative Species

Leptogium cf. arsenei

Description

(14 specimens studied) Thallus is foliose, lobes are 2-5 cm wide. Marginal asexual/vegetative structures: isidia are globose to cylindrical. Laminal asexual/reproductive structures: Initially appearing globose, then cylindrical, rarely branched. Isidia are usually cylindrical, rarely slightly flattened. Top of isidia occasionally concave. Thallus color: Brownish gray to gray. Upper thallus texture is rarely smooth only in outer lobes, older parts of thallus are predominantly canaliculate, occasionally wrinkled, wrinkles associated with upturned lobes. Lower cortex color:

same color as upper cortex. Lower cortex texture is occasionally smooth, usually strongly wrinkled longitudinally. Pycnidia not seen.

Ecology and distribution

Leptogium cf. arsenei is a species new to Florida, yet appears widespread. Leptogium cf. arsenei was very common in the two southernmost localities (Everglades National

Park and Fakahatchee Strand State Preserve). It was uncommon in more northern localities. However, further collection may yield more records in northern Florida. It may be more common along the coastline in northern Florida due to temperature moderation and consistently higher humidity from the ocean.

Differentiation

The species could be superficially confused with either L. cyanescens, L. austroamericanum or a Collema species. The canaliculate margins most closely resemble those of L. austroamericanum, and occasionally the thallus of L. cf. arsenei is wrinkled. The lobes of L. cf. arsenei may be larger (2-5 cm) compared to L. austroamericanum, and this would be a trait to gather additional data on in the future.

Leptogium cf. arsenei most closely resembles a Collema species due to the globose isidia; however, Collema lacks a eucortex (a one cell thick layer for a cortex).

Nomenclatural investigations

To investigate if this was an overlooked North American taxon outside of Florida, I used the North American Lichen Checklist and investigated possible species that have similar morphology. Nomenclature outside of North America was not investigated. The morphology most closely resembles L. arsenei, which is only known from the Sonoran

Desert. One morphological difference is that L. arsenei from the Sonoran Desert has isidia that are initially granular, while the Florida collections are initially globose. The

Consortium of North American Lichen Herbaria (CNALH) lists one record of L. aff arsenei (determined Marcus Kitaura) from the Everglades National Park. Sierk (1964), who last revised Leptogium in North America and described L. arsenei, did not report L. arsenei from Florida based on herbaria material. There are three explanations. The first is that Sierk primarily reviewed specimens north of Orlando where L. cf. arsenei may be rare. The other possibility is that specimens of L. cf. arsenei were filed under taxa that were not investigated by Sierk, including Collema flaccidum, C. subflaccidum and L. pseudofurfuraceum (http://lichenportal.org/portal/) (Consortium of North American

Lichen Herbaria, 2016). Two specimens of Collema flaccidum located from Florida

(herbarium FLAS) were reviewed. The morphology of one specimen corresponded with

L. cf arsenei and one with L. cyanescens. Lastly, Sierk may also have left L. cf. arsenei as L. austroamericanum specimens with wrinkles.

Leptogium austroamericanum

Description

(21 of specimens studied) Thallus is foliose, lobes are 2-5 mm wide. Marginal asexual/vegetative structures: Isidia are globose to cylindrical, occasionally flattened.

Laminal asexual/reproductive structures: Initially appearing globose, then cylindrical, occasionally phyllidiate. Isidia rarely branched. Top of isidia rarely concave. Thallus color: Gray to brownish gray. Upper thallus texture is rarely smooth only in outer lobes, older parts of thallus are always wrinkled (visible at 10X, but occasionally only minute wrinkles present at 20x), never canaliculate. Lower cortex color: gray to brownish gray, same color as upper cortex. Lower cortex texture is occasionally smooth, usually wrinkled. Pycnidia not seen.

Ecology and distribution

Leptogium austroamericanum is widespread in Florida. It is found in xeric to hydric hardwood forests. The range of this species in North America is the Sonoran Desert and east of the Mississippi River in the southern United States (Brodo et al., 2001).

Differentiation

Leptogium austroamericanum most closely resembles L. austroamericanum; however,

L. austroamericanum has wrinkles and a thicker thallus. Leptogium cf. arsenei may infrequently be predominantly wrinkled, but may have larger lobes. The pattern of wrinkles may be different, pending further investigation. Leptogium austroamericanum has long wrinkles that look like large continuous line and are parallel to each other, while L. cf. arsenei has shorter wrinkles that are parallel or perpendicular to each other.

Nomenclatural investigation

There were 2 clades within L. austroamericanum. One clade consisted of samples from

Alafia River State Park (Tampa, FL) and Torreya State Park (Tallahassee, FL), and the other included samples from Alafia River State Park and Highlands Hammock State

Park (in central Florida). No morphological differences were seen between the two clades. Further molecular and morphological study is needed to assess the monophyly of this species. The type specimen of L. austroamericanum is from Brazil and samples should be sequenced from the region of the holotype. Further work is necessary to assess phenotypic plasticity of L. austroamericanum. In this study, emphasis was placed on collecting L. austroamericanum that resembled L. cyanescens in lobe shape and also minute wrinkles. The emphasis of future collecting should be placed on collecting L. austroamericanum more widely throughout the state because it was undersampled. Torreya State Park 207 was a specimen that was minutely wrinkled and

lacked isidia. The current accepted name of this specimen is L. azureum. Alafia River

State Park 44 was atypical in that its lobe margins seemed thicker, and the lobes had indentations in them. Dagny Johnson State Park 214 was from the Florida Keys, and had very deep wrinkles.

Leptogium cyanescens

Description

(24 of specimens studied) Thallus is foliose, lobes are 2-5 mm wide. Marginal asexual/vegetative structures: rarely appearing globose, but only when very immature.

Isidia are cylindrical, occasionally branched. Lobules present. Laminal asexual/reproductive structures: Initially appearing minutely globose, isidia cylindrical, occasionally branched. Isidia are usually cylindrical, to slightly flattened. Top of isidia occasionally concave. Thallus color: gray. Upper thallus texture is smooth only in outer lobes, older parts of thallus are predominantly smooth, occasionally slightly canaliculated or wrinkled, only when a lobe is upturned. Lower cortex color: same as upper cortex. Lower cortex texture is usually smooth, usually strongly wrinkled longitudinally. Pycnidia not seen.

Ecology and distribution

The species is currently known from the Florida Peninsula, north of Orlando, and the

Florida Panhandle. It is found in xeric to hydric hardwood forests, and other hydric habitats. The species is currently described as widespread in North America.

Key characteristics

Leptogium cyanescens does not have wrinkles on the upper cortex and has a slightly thinner thallus than L. austroamericanum. Leptogium cyanescens resembles L. denticulatum but the latter is predominately phyllidiate.

Nomenclature investigation

The type specimen of L. cyanescens is from Switzerland (Jørgensen, 1983), and the species name is widely applied across many continents. Further morphological work and reassessment of type specimens from similar tropical species are needed to evaluate this species complex. Until the type locality has been sampled, this taxon should be left as L. cyanescens. A specimen from North Carolina (JX993010) is in the same clade.

Leptogium cf. denticulatum

Description

(20 of specimens studied) Thallus is foliose, lobes are 2-5 cm wide. Marginal asexual/vegetative structures: Usually phyllidiate, rarely isidiate. Laminal asexual/reproductive structures: Initially appearing isidiate or lobulate. Phyllidia are predominant structure. Thallus color: gray to brownish gray. Upper thallus texture: smooth, occasionally wrinkled or canaliculate associated with upturned lobes. Lower cortex color: same as upper cortex. Lower cortex texture: occasionally smooth. Pycnidia not seen.

Ecology and distribution

This species is widespread in Florida. It may be more common south of Orlando, but found in lower frequency in northern Florida. The species may be common along the coastlines in northern Florida.

Differentiation

This species resembles L. cyanescens but differs in that it contains denticules, as opposed to isidia. Leptogium denticulatum is similar to L. austroamericanum but the former rarely has wrinkles and never on the lobe apex.

Nomenclatural investigations

Leptogium denticulatum applies to European taxa (Kitaura et al., 2015). The L. denticulatum group was split into 5 species based only on morphological characteristics such as the presence of asexual propagules on the ampithecium and the type of columnar hyphae. Material from Florida was not examined in the study. A search on the

CNALH suggests that a denticulate Leptogium is found in the eastern United States from Georgia and Florida and west along the Gulf Coast States to eastern Texas (Brodo et al., 2001). There may be a separate population of a denticulate Leptogium that is found primarily in the Sonoran Desert south into Mexico. The Sonoran Desert taxon was renamed L. joergensenii (Kitaura et al., 2015). Florida material is left as L. denticulatum pending further examination.

Table 3-1. List of GenBank records included in the fungal gene MCM7 phylogeny. Genus Species GenBank Accession Collema auriforme JX992973 Collema bachmanianum JX992974 Collema callopismum JX992975 Collema crispum JX992977 Collema crispum JX992978 Collema cristatum JX992979 Collema fragrans JX992981 Collema fragrans JX992980 Collema furfuraceum JX992982 Collema fuscovirens JX992983 Collema italicum JX992984 Collema italicum JX992985 Collema leptaleum JX992986 Collema leptaleum JX992987 Collema multipunctatum JX992988 Collema nigrescens JX992989 Collema occultatum JX992990 Collema occultatum JX992991 Collema parvum JX992992 Collema polycarpon JX992993 Collema polycarpon JX992994 Collema rugosum JX992995 Collema tenax JX992999 Collema tenax JX992998 Collema undulatum JX993000 Leptogium austroamericanum JX993001 Leptogium azureum JX993002 Leptogium biatorinum JX993003 Leptogium biloculare JX993004 Leptogium brebissonii JX993005 Leptogium brebissonii JX993006 Leptogium britannicum JX993037 Leptogium corticola JX993008 Leptogium crispatellum JX993009 Leptogium cyanescens JX993010 Leptogium dactylinum JX993011 Leptogium denticulatum JX993012 Leptogium denticulatum JX993013 Leptogium diffractum JX993014 Leptogium diffractum JX993015 Leptogium digitatum JX993016

Table 3-1. Continued Genus Species GenBank Accession Leptogium furfuraceum JX993017 Leptogium hibernicum JX993020 Leptogium isidiosellum JX993018 Leptogium juressianum JX993019 Leptogium laceroides JX993039 Leptogium lichenoides JX993021 Leptogium magnussonii JX993022 Leptogium malmei JX993023 Leptogium marginellum JX993024 Leptogium palmatum JX993025 Leptogium palmatum JX993026 Leptogium papillosum JX993027 Leptogium phyllocarpum JX993028 Leptogium phyllocarpum JX993029 Leptogium plicatile JX993030 Leptogium pseudofurfuraceum JX993031 Leptogium pulvinatum JX993032 Leptogium resupinans JX993033 Leptogium reticulatum JX993038 Leptogium saturninum JX993034 Leptogium saturninum JX993035 Leptogium schraderi JX993036 Leptogium sessile JX993007 Leptogium turgidum JX993040 Leptogium velutinum JX993041 Pannaria rubiginosa JX993042 Staurolemma omphalarioides JX993043

Figure 3-1. Assessment of the placement of the Florida fungal clades using a phylogenetic tree of the fungal gene MCM7 and GenBank records from the Collemataceae, a family of lichenized fungi which contains Leptogium.

Figure 3-2. Assessment of the laminal isidia between the four fungal clades.

Figure 3-3. Assessment of the marginal isidia between the four fungal clades.

Figure 3-4. Assessment of the marginal isidia between the four fungal clades.

APPENDIX GENBANK RECORDS FOR NOSTOC PHYLOGENY

Table A-1. GenBank rbcLX sequences of the cyanobacterial photobiont of free-living and lichenized Nostoc. Genus Species GenBank Accession Collema auriforme EU877461 Collema auriforme EU877462 Collema crispum DQ185273 Collema crispum EU877460 Collema flaccidum DQ266040 Collema flaccidum EU877465 Collema flaccidum EU877466 Collema flaccidum GQ184606 Collema fragile EU877467 Collema fragile EU877468 Collema furfuraceum EU877469 Collema furfuraceum EU877470 Collema furfuraceum EU877471 Collema furfuraceum EU877472 Collema nigrescens EU877473 Collema nigrescens EU877474 Collema nigrescens EU877475 Collema polycarpon EU877476 Collema polycarpon EU877477 Collema subnigrescens EU877478 Collema subnigrescens EU877479 Collema subnigrescens EU877480 Collema tenax EU877481 Collema tenax EU877482 Collema tenax EU877483 Fischerella muscicola DQ185299 Fuscopannaria leucophaea DQ266033 Leptogium austroamericanum EU877484 Leptogium austroamericanum EU877485 Leptogium azureum EU877486 Leptogium azureum EU877487 Leptogium azureum EU877488 Leptogium azureum TSP_207 Leptogium brebissonii EU877489 Leptogium brebissonii EU877490 Leptogium cf. arsenei DJSP 213 Leptogium cf. arsenei MRSP 206

Table A-1. Continued Genus Species GenBank Accession Leptogium corniculatum EU877491 Leptogium corniculatum EU877492 Leptogium corticola EU877493 Leptogium corticola EU877494 Leptogium cyanescens BRSP 112 Leptogium cyanescens BSSP 60 Leptogium cyanescens EU877495 Leptogium cyanescens EU877496 Leptogium cyanescens EU877497 Leptogium cyanescens FWSP 114 Leptogium cyanescens FWSP 115 Leptogium floridanum HHSP 212 Leptogium furfuraceum EU877498 Leptogium furfuraceum EU877499 Leptogium furfuraceum EU877500 Leptogium furfuraceum EU877501 Leptogium furfuraceum EU877502 Leptogium furfuraceum EU877503 Leptogium furfuraceum EU877504 Leptogium gelatinosum DQ185289 Leptogium gelatinosum EU877505 Leptogium gelatinosum EU877506 Leptogium isidiosellum NATL 211 Leptogium lichenoides EU877507 Leptogium lichenoides EU877508 Leptogium lichenoides EU877509 Leptogium lichenoides EU877510 Leptogium lichenoides EU877511 Leptogium lichenoides GQ184605 Leptogium magnussonii EU877512 Leptogium magnussonii EU877513 Leptogium magnussonii EU877514 Leptogium magnussonii EU877515 Leptogium magnussonii EU877516 Leptogium magnussonii EU877517 Leptogium pseudofurfuraceum EU877518 Leptogium pseudofurfuraceum EU877519 Leptogium pseudofurfuraceum EU877520 Leptogium pseudofurfuraceum EU877521 Leptogium pseudofurfuraceum EU877522 Leptogium pulvinatum EU877523

Table A-1. Continued Genus Species GenBank Accession Leptogium pulvinatum EU877524 Leptogium saturninum DQ266037 Leptogium saturninum DQ266038 Leptogium saturninum EU877525 Leptogium saturninum EU877526 Leptogium saturninum EU877527 Leptogium saturninum EU877528 Leptogium scharderii EU877529 Leptogium scharderii EU877530 Mollenhauer sp. DQ185264 Nostoc edaphicum AJ632065 Nostoc ellipsosporum AJ632066 Nostoc flagelliforme Z94893 Nostoc muscorum DQ185313 Nostoc calcicola AJ632063 Nostoc calcicola AJ632064 Nostoc commune DQ185280 Nostoc commune Z94892 Nostoc punctiforme DQ185314 Nostoc punctiforme DQ185315 Nostoc punctiforme DQ185316 Nostoc punctiforme DQ185317 Nostoc sp. DQ185309 Nostoc sp. DQ185310 Nostoc sp. DQ185311 Nostoc sp. DQ185312 Nostoc sp. EU672828 Nostoc sp. EU672829 Nostoc sp. EU672830 Nostoc sp. HQ335213 Nostoc sp. HQ335214 Nostoc sp. KM006001 Nostoc sp. KM006002 Nostoc sp. KM006004 Nostoc sp. Z94889 Nostoc sp. Z94890 Nostoc sp. Z94891 Protopannaria pezizoides DQ266032 Stereocaulon exutum DQ266029 Stereocaulon fronduliferum DQ266030 Stereocaulon tomentosum DQ266031

LIST OF REFERENCES

Aberer AJ, Pattengale ND, Stamatakis A. 2010. Parallelized phylogenetic post- analysis on multicore architecture. Journal of Computational Science 1: 107-114.

Altermann S, Leavitt SD, Goward T, Nelsen MP, Lumbsch HT. 2014. How do you solve a problem like Letharia? A new look at cryptic species in lichen-forming fungi using Bayesian clustering and SNPs from multilocus sequence data. Plos ONE 9: e97556.

Baker AC. 2003. Flexibility and specificity in coral-algal symbiosis: diversity, ecology, and biogeography of Symbiodinium. Annual Review of Ecology, Evolution, and Systematics 34: 661-689.

Bala A, Giller KE. 2001. Symbiotic specificity of tropical tree rhizobia for host legumes. New Phytologist 149: 495-507.

Becker V, Reeder J, Stetler R. 1977. Biomass and habitat of nitrogen fixing lichens in an oak forest in the North Carolina Piedmont. The Bryologist 80: 93-99.

Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. New Haven, CT: Yale University Press.

Consortium of North American Lichen Herbaria (CNALH). Result: Collema records in Florida. [WWW document] URL http://lichenportal.org [accessed 20 January 2016].

Dal Grande F, Alors D, Divakar PK, Bálint M, Crespo A, Schmitt I. 2014. Insights into intrathalline genetic diversity of the cosmopolitan lichen symbiotic green alga Trebouxia decolorans Ahmadjian using microsatellite markers. Molecular Phylogenetics and Evolution 72: 54-60.

Delport W, Poon AF, Frost SD, Kosakovsky Pond SL. 2010. Datamonkey 2010: a suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics 26: 2455-2457.

Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792-1797.

Excoffier L, Laval G, Schneider S. 2007. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47-50.

Excoffier L, Smouse PE, Quattro JM. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131: 479-491.

Friedl T, Büdel B. 2010. Photobionts. In Nash, TH, ed. Lichen Biology. New York City, NY: Cambridge University Press, 9-29.

Hudson RR, Kaplan NL. 1985. Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111: 147-164.

Jørgensen PM, Nash TH. 2004. Leptogium. In Nash TH, Ryan BD, Gries C, Bungartz F, eds. Lichen flora of the Greater Sonoran desert region. Tempe, AZ: Arizona State University, 330-350.

Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772-780.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton SC, Markowitz S, Duran C, Thierer T et al. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.

Kitaura MJ, Marcelli MP, da Hora BR, Jungbluth P. 2015. Leptogium denticulatum (Collemataceae, lichenized Ascomycota) and some morphologically related species. The Bryologist 118: 11-21.

Kosakovsky Pond SL, Frost SDW. 2005. Datamonkey: rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 21: 2531–2533.

Kosakovsky Pond SL, Posada D, Gravenor MB, Woelk CH, Frost SD. 2006. Automated phylogenetic detection of recombination using a genetic algorithm. Molecular Biology and Evolution 23: 1891-1901.

Leavitt SD, Fankhauser JD, Leavitt DH, Porter LD, Johnson LA, St. Clair LL. 2011. Complex patterns of speciation in cosmopolitan “rock posy” lichens–Discovering and delimiting cryptic fungal species in the lichen-forming Rhizoplaca melanophthalma species-complex (Lecanoraceae, Ascomycota). Molecular Phylogenetic and Evolution 59: 587-602.

Leavitt SD, Fernández-Mendoza F, Pérez-Ortega S, Sohrabi M, Divakar PK, Vondrák J, Lumbsch HT, St. Clair LL. 2013. Local representation of global diversity in a cosmopolitan lichen‐forming fungal species complex (Rhizoplaca, Ascomycota). Journal of Biogeography 40: 1792-1806.

Leavitt SD, Kraichak E, Nelsen MP, Altermann S, Divakar PK, Alors D, Esslinger TL, Crespo A, Lumbsch HT. 2015. Fungal specificity and selectivity for algae play a major role in determining lichen partnerships across diverse ecogeographic regions in the lichen‐forming family Parmeliaceae (Ascomycota). Molecular Ecology 24: 3779-3797.

Lendemer JC. 2015. Parmotrema internexum (Lecanorales: Parmeliaceae): an overlooked macrolichen in southeastern North America highlights the value of basic biodiversity research. The Bryologist 118: 130-144.

Lendemer JC, Ruiz AM. 2015. Molecular data confirm morphological variability in the widespread foliose lichen Canoparmelia carolinana (Parmeliaceae). Castanea 80: 29-36.

Librado P, Rozas J. 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451-1452.

Lücking R, Seavey F, Common RS, Beeching SQ, Breuss O, Buck WR, Crane L, Hodges M, Hodkinson BP, Lay E et al. 2011. The lichens of Fakahatchee Strand Preserve State Park, Florida: Proceedings from the 18th Tuckerman Workshop. Bulletin of the Florida Museum of Natural History 49: 127-186.

Maddison WP, Maddison DR. 2014. Mesquite: a modular system for evolutionary analysis v.3.04. [WWW document] URL http://mesquiteproject.org [accessed 3 November 2015].

Magain N, Sérusiaux E. 2015. Dismantling the treasured flagship lichen Sticta fuliginosa (Peltigerales) into four species in Western Europe. Mycological Progress 14: 1-33.

Miadlikowska J, Kauff F, Högnabba F, Oliver JC, Molnár K, Fraker E, Gaya E, Hafellner J, Hofstetter V, Gueidan C et al. 2014. A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Molecular Phylogenetics and Evolution 79: 132-168.

Mikheyev A, Mueller UG, Boomsma JJ. 2007. Population genetic signatures of diffuse co‐evolution between leaf‐cutting ants and their cultivar fungi. Molecular Ecology 16: 209-216.

Moncada B, Reidy B, Lücking R. 2014. A phylogenetic revision of Hawaiian Pseudocyphellaria sensu lato (lichenized Ascomycota: Lobariaceae) reveals eight new species and a high degree of inferred endemism. The Bryologist 117: 119-160.

Moore BJ. 1968. The macrolichen flora of Florida. The Bryologist 71: 161-266.

Nadyeina O, Dymytrova L, Lyudmyla N, Naumovych A, Postoyalkin S, Werth S, Cheenacharoen S, Scheidegger C. 2014. Microclimatic differentiation of gene pools in the Lobaria pulmonaria symbiosis in a primeval forest landscape. Molecular Ecology 23: 5164-5178.

O'Brien H. 2013. PhotobiontDiversity.org: a searchable database of photobiont sequences. [WWW document] URL http://www.photobiontdiversity.org [accessed 15 December 2015].

O'Brien HE, Miadlikowska J, Lutzoni F. 2013. Assessing population structure and host specialization in lichenized cyanobacteria. New Phytologist 198: 557-566.

Otálora MAG, Aragón G, Martínez I, Wedin M. 2013. Cardinal characters on a slippery slope– A re-evaluation of phylogeny, character evolution, and evolutionary rates in the jelly lichens (Collemataceae s. str). Molecular Phylogenetics and Evolution 68: 185-198.

Otálora MAG, Jørgensen PM, Wedin M. 2014. A revised generic classification of the jelly lichens, Collemataceae. Fungal Diversity 64: 275-293.

Otálora MAG, Martínez I, O’Brien H, Carmen MM, Aragón G, Lutzoni F. 2010. Multiple origins of high reciprocal symbiotic specificity at an intercontinental spatial scale among gelatinous lichens (Collemataceae, Lecanoromycetes). Molecular Phylogenetics and Evolution 56: 1089-1095.

Piercey-Normore MD, Depriest PT. 2001. Algal switching among lichen symbioses. American Journal of Botany 88: 1490-1498.

Porras-Alfaro A, Bayman P. 2007. Mycorrhizal fungi of Vanilla: diversity, specificity and effects on seed germination and plant growth. Mycologia 99: 510-525.

Rikkinen J. 2013. Molecular studies on cyanobacterial diversity in lichen symbioses. Mycokeys 6: 3-32.

Rudi K, Skulberg OM, Jakobsen KS. 1998. Evolution of cyanobacteria by exchange of genetic material among phyletically related strains. Journal of Bacteriology 180: 3453-3461.

Sanders WB, Lücking R. 2015. Three new species of foliicolous Gomphillaceae (lichen-forming ascomycetes) from southern Florida. The Bryologist 118: 170- 177.

Schmitt I, Crespo A, Divakar PK, Fankhauser JD, Herman-Sackett E, Kalb K, Nelsen MP, Nelson NA, Rivas-Platas E, Shimp AD et al. 2009. New primers for promising single-copy genes in fungal phylogenetics and systematics. Persoonia 23: 35-40.

Schultz M, Wedin M, Henrike D, Prieto M. 2015. Epiphloea belongs to Collemataceae (Lecanoromycetes, lichenized Ascomycota). The Lichenologist 47: 369-378.

Seavey F, Seavey J. 2014. New additions to the lichen genus Enterographa (Roccellaceae) from Everglades National Park including an updated world key. The Lichenologist 46: 83-93.

Seavey F, Seavey J. 2012. Caloplaca lecanorae (Teloschistaceae), a new lichenicolous lichen and several additions to the North American lichenized mycota from Everglades National Park. The Bryologist 115: 322-328.

Sierk HA. 1964. The Genus Leptogium in North America North of Mexico. The Bryologist 67: 245-317.

Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies. Bioinformatics 30: 1312-1313.

Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC. 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21-32.

Walser JC. 2004. Molecular evidence for limited dispersal of vegetative propagules in the epiphytic lichen Lobaria pulmonaria. American Journal of Botany 91: 1273- 1276.

Wirtz N, Lumbsch HT, Green TG, Türk R, Pintado A, Sancho L, Schroeter B. 2003. Lichen fungi have low cyanobiont selectivity in maritime Antarctica. New Phytologist 160: 177-183.

Yahr R, Vilgalys R, DePriest PT. 2004. Strong fungal specificity and selectivity for algal symbionts in Florida scrub Cladonia lichens. Molecular Ecology 13: 3367- 3378.

Yahr R, Vilgalys R, DePriest PT. 2006. Geographic variation in algal partners of Cladonia subtenuis (Cladoniaceae) highlights the dynamic nature of a lichen symbiosis. New Phytologist 171: 847-860.

BIOGRAPHICAL SKETCH

Barry Kaminsky attended Coral Gables Senior High School and graduated in

2005. Then he went to New College of Florida, in Sarasota, FL for undergraduate. While at New College of Florida, Barry took a class on mycology and wrote a senior thesis on lichens of Myakka River State Park, which sparked his passion for fungi. After graduation Barry volunteered for the Army Corp of Engineers Miami Permitting office.

He also spent a summer working as a Student Conservation Association intern in

Juneau, Alaska for the Forest Service. Afterwards Barry worked for the Bureau of Land

Management as a Conservation and Land Management Intern managing the lichen herbarium at Boise State University. This influenced Barry to continue working with small and overlooked organisms as well as education. Barry graduated with a Master of

Science from the University of Florida in 2016 and will continue to work in the University of Florida Plant Pathology Department as a curatorial assistant in the fungal collection.