BIOREMEDIATION OF DIESEL CONTAMINATED SOIL USING BACTERIAL COCKTAIL AND ORGANIC NUTRIENTS
Ibrahim Osinowo, Olabisi Peter Abioye, Solomon Bankole Oyeleke, Oluwafemi Adebayo Oyewole
Address(es): Dr. Olabisi Peter Abioye, 1Federal University of Technology, School of Life Sciences, Department of Microbiology, Bosso Campus PMB 65, Minna, Nigeria, +2348140031875.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.150-158
ARTICLE INFO ABSTRACT
Received 9. 3. 2018 Bioremediation is a process of contaminant degradation in the environment using microorganisms. Bioremediation of diesel Revised 8. 5. 2020 contaminated soil was studied using bacterial cocktail and organic nutrients from cow dung and poultry droppings at interval of 21 days Accepted 1. 6. 2020 for a total period of 84 days. Two hundred grams (200g) of soil were weighed into clay pots polluted with 10% (w/w) diesel oil and left Published 1. 10. 2020 undisturbed for 48 hours in an open field. After 48 hours, the clay pots were inoculated with bacterial cocktail (two bacteria isolates from diesel contaminated soil), 10% (w/w) of cow dung (CD), 10% (w/w) of poultry droppings (PD) and 5% (w/w) of sodium azide (NaN ). The two bacterial isolates were identified as Micrococcus luteus trpE16 and Bacillus subtilis DNK UT 02 after screening for Regular article 3 hydrocarbon utilization using standard methods. The counts of hydrocarbon utilizing bacteria (THB) in the amended soil ranged from 20.2×107 and 63.5×107 cfu/g while unamended soil had the least count of THB ranging between 8.4×107 and 19.0× 107 cfu/g. Soil bioremediated with bacterial cocktail (BC) + 10% (CD+PD) recorded highest total petroleum hydrocarbon (TPH) degradation of
48.76%, 56.32%, 72.89% and 96.80% at the end of days 21, 42, 63 and 84 respectively while autoclaved soil with 5% NaN3 recorded the least (10.03%, 13.38%, 14.02% and 18.42%) respectively. First order kinetic model showed that soil bioremediated with BC with 10% (CD+PD) recorded highest biodegradation rate constant of 0.2096 day-1 and half-life of 3.31 days. Statistical analysis indicated that the results obtained were significantly (P < 0.05) different during the 84 days of this study. Amendment of diesel contaminated soil with bacterial cocktail and organic wastes caused changes in the soil physiochemical properties and accelerated the rate of biodegradation in the soil. However, poultry droppings and cow dung can serve as a potential and viable biostimulant for enhanced biodegradation of diesel in soil.
Keywords: Bioremediation, Micrococcus luteus, Bacillus subtilis, organic compound
INTRODUCTION polluted site. Bacteria such as Bacillus sp, Micrococcus sp, Pseudomonas sp, Streptomyces sp, Methanobacterium sp, Thiobacillus sp are the most common Over the years, the activities of Oil and Gas industry have turned out to be a microbes used (Castro-Gutiérrez et al., 2012; Okoh, 2013). Biostimulation threat to the environment due to the several occurrences of oil spillage into soil involves the addition of appropriate nutrients such as organic manure, inorganic and water environment. Oil spillage has caused untold hardship on those residing fertilizers (NPK), provision of oxygen to a polluted site to increase microbial in areas where this natural resource is in abundance, as it has deprived them of activities of indigenous microbial flora (Odu et al., 2015). Previous study (Ibiene portable water being that the surface and ground water down the soil layers gets et al., 2011), reported the use of cow dung and poultry droppings for contaminated when the spillage occurs (Olabemiwo et al., 2014). bioremediation of hydrocarbon contaminated soil. However, to the best of my Diesel changes the physico-chemical properties of soil. It increases the level of knowledge on literature search, there is little or no information on the use of toxins such as zinc and iron in the soil and reduces the amount of nutrients bacteria cocktail with cow dung and poultry droppings.Therefore, the aim of this available. There is high accumulation of aluminium and manganese ions which study was to remediate diesel contaminated soil using bacterial cocktail are toxic to plant growth due to the anaerobic condition in the soil, the water (containing Micrococcus luteusand Bacillus subtilis isolated from contaminated logging and acid metabolites created by the diesel fuel. Furthermore, there is soil) and alongside cow dung and poultry droppings. reduction in the amount of oxygen diffused to the root system if the oil is stranded on the plant shoot, thus affecting the soil indirectly (Ebere et al., 2011; MATERIALS AND METHODS Chen et al., 2015). Due to high demand on land and water, it is imperative that the soil and water Collection of samples body affected by the diesel spillage has to be rehabilitated in time for uses. Therefore, natural methods like bush fallowing for soil cannot always be relied Soil sample was collected from 0-10cm depth using soil auger from mechanic on. This has given rise to several techniques of remediation. Among the various workshop beside Bosso primary school Minna and brought to Microbiology techniques that have been utilized in replenishing soil nutrients over the years, Department Federal University of Technology Minna. Diesel was purchased from bioremediation seems to be most thriving (Tariqet al., 2016). Filling Station in Bosso, Minna Niger State. Cow dung and poultry droppings Bioremediation is the process by which pollutants in the environment is were collected from animal farm and poultry farm in Bosso Minna, Niger State. converted into less toxic or non-toxic compounds, using naturally occurring microorganisms or genetically modified microorganisms. It is a natural The isolation of microorganisms degradation process by which microorganisms chemically alter or break down organic molecules into innocuous substances such as carbon dioxide, fatty acids The aerobic heterotrophic bacteria were isolated from soil sample in mechanic and water in order to obtain energy and nutrients (Adaba, 2013). workshop using methods described by (Henrick, 2004) while mineral salt Bioaugmentation and biostimulation are two approaches to bioremediation medium (MSM) in the soil was used to enumerate the hydrocarbon-utilizing geared toward enhancing and speeding up the process. Bioaugmentation involves bacteria (HUB). The mineral salt medium contains 1.8 g K2HPO4, 4.0 g NH4Cl, the addition of external microbial population (endogenous or exogenous) to the 0.2 g MgSO4.7H2O, 1.2 g KH2PO4, 0.01 g FeSO4.7H2O, 0.1 g NaCl, 20 g agar,
150
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
1% diesel (as the only carbon source) in one liter of deionized water. The pH OES and furnace method, respectively. Moisture content was determined using was adjusted to 7.4 with 0.1M NaOH. The oil agar plates were inoculated with the gravimetric method. 0.1mL of serially diluted soil samples (10-3) and were incubated at 30oC for five days and observed. The identities of the isolates were determined by comparing Microbial counts their characteristics with those of known taxa as described in Bergy’s manual of determinative bacteriology. All chemicals (analytical grade) were purchased from Changes in microbial population were determined by inoculating 0.1 mL of Sigma-Aldrich, St Louis, MO, USA. serially diluted soil sample onto nutrient and diesel oil agar for total heterotrophic and hydrocarbon utilizing bacteria counts respectively. The nutrient agar plates Screening of bacterial isolates for biodegradation potential were incubated at 37oC for 24hrs and diesel oil agar plates at 37oC for 5 days. The colonies developed after incubation were counted and expressed as colony Nutrient broth was prepared and 9mL of the broth wasdispensed into test tubes forming units per gram (cfu/g) of soil sample. and autoclaved. The colonies of the pure isolates were inoculated into the test tubes containing the broth and incubated at 37oC for 24 hours. Mineral Salt Total petroleum hydrocarbon determination medium (broth) was prepared by adding 1.2 g KH2PO4, 1.8 g K2HPO4, 4.0 g NH4Cl, 0.2 g MgSO4.7H2O, 0.1 g NaCl and 0.01 g FeSO4.7H2O in one liter of Gravimetric method was used to determine the hydrocarbon content of the soil deionized water. The prepared broth (100 mL) was mixed with 0.1 % of diesel as samples using tuolene cold extraction method described by Adesodun and the only source of carbon and autoclaved. When cooled, 1 mL of the test Mbagwu (2008). This was done by adding 10 g of soil sample into 20mL of organisms in the nutrient broth was transferred into test tubes containing 9 mL of toluene (Analar grade). The mixture was shaken for 30 minutes using an orbital the sterile mixtures (MSM broth and diesell), and were incubated at 37ºC for 5 shaker and the supernatant was measured using spectrophotometer at 420 nm. To days. At the end of incubation, a UV spectrophotometer (model 752 Guang-Zhou determine the total petroleum hydrocarbon in the soil, values were estimated with Co. Ltd, China) was used to determine the optical density at 620 nm wavelength. reference to standard curve obtained from new diesel oil diluted with toluene. The best bacterial isolates were selected for the cocktail used for the The total petroleum hydrocarbon data was fitted to first-order kinetics model of bioremediation process. Yeung et al. (1997) as follows: y = ae-kt. In this equation, y is the residual soil hydrocarbon content (g kg-1), a is the soil initial hydrocarbon content (g kg-1), k is Preparation of inoculums for bioremediation the biodegradation rate constant (day-1), and t is the treatment time. Half- life was calculated as: Half life = 1n (2) / k. The assumption in this model was that the The two bacterial isolates that recorded higher hydrocarbon degradation were rate of hydrocarbons degradation positively correlated with the soil hydrocarbon inoculated into bijou bottles, each containing 5 mL of nutrient broth and were pool size (Yeung et al., 1997). incubated at 37ºC for 24 to 48 hours. The microbial count was carried out by measuring absorbance using a spectrophotometer at an absorbance of 560 nm Gas chromatographic mass- spectrophotometric analysis of diesel extract wavelengths, until a cell concentration of 1.5 × 107 colony forming units (cfu)/mL (McFarland Standard) was achieved. The 5 mL culture was transferred Gas chromatography - Mass spectroscopy analysis of the diesel extracts from the into 1 liter sterile nutrient broth and incubated at 37oC for 24 hours. The bacterial soil samples was analyzed using GC-MS model 7890A with Mass Selective cocktail was prepared by mixing equal volumes (500 mL) of the culture of the Detector model: 5975C (MSD). The diesel oil extraction was carried out by above cell concentration of each isolate. dissolving 5g of the soil samples in 10mL (99.99%) pure dichloromethane in a well corked reagent bottle. This was thoroughly mixed using an ultra sonicator Microcosm set up for a period of five hours. The mixture was allowed to stand for 72 hours and filtered into a beaker; the mixture was rewashed with 20mL dichloromethane for Complete Randomized Block Design (CRBD) was used in this study. Two two more consecutive times. The combined aliquots was evaporated on a steam hundred (200) grams of air-dried soil sieved with 2-mm mesh size was placed in berth to 5mL and filtered through a pipette stocked with glass wool (membrane) clay pots polluted with 10% w/w diesel and left undisturbed for 48 hours. After with packed anhydrous sodium sulfate silica gel to remove the left over moisture 48 hours, treatment one was diesel polluted soil without any amendment with 10 and other impurities. The filtrate was concentrated to 1mL in the vial bottle and mL of cell concentration 1.5 × 107 cfu/mL bacterial cocktail and 10% of each was analyzed on Gas chromatography. organic wastes (cow dung and poultry droppings) serve as control, Treatment two: diesel polluted soil + 10 mL of broth culture of bacterial cocktail, Treatment Statistical analysis of data three: diesel polluted soil + 10mL of broth culture of bacterial cocktail + 10% (w/w) of cow dung, Treatment four: diesel polluted soil + 10mL of broth culture The data generated from this study was subjected to analysis of variance (P≤0.05) of bacterial cocktail + 10% (w/w) of poultry droppings, Treatment five: diesel using SPSS version 20 and the averages were compared by Duncan Multiple polluted soil + 10mL of broth culture of bacterial cocktail + 10% (w/w) of cow Range Tests (DMRT) P≤0.05. The effect of studied factors were considered dung and poultry droppings, Treatment six: diesel polluted soil + 10% (w/w) of significant when P≤0.05. cow dung, Treatment seven: diesel polluted soil + 10% (w/w) of poultry dropping, Treatment eight: autoclaved soil + 10% (w/w) diesel + 5% sodium RESULTS azide (NaN3) (to eliminate all life forms during bioremediation process) and was thoroughly mixed as shown in Table 1. The moisture content was adjusted to Physicochemical properties of soil (unpolluted) and the organic waste 60% water holding capacity and set up under natural environment exposed to sunlight and at room temperature 28ºC ±2. The content of each vessel was mixed The physicochemical properties of soil and organic wastes that were used for twice a week for aeration, and the moisture content was maintained at 60% water bioremediation are presented in Table 2. holding capacity by addition of sterile distilled water. This experiment was set up in duplicate. Table 2 The physicochemical properties of soil and organic wastes
Table 1 Experimental layout for bioremediation Parameter Soil Organic wastes Design Treatment A 200g of Soil + 10% diesel (Control) CD PD B 200g of Soil + 10% diesel oil + 10 mL of BC pH 6.70±0.25 7.10±0.19 7.40±0.25 C 200g of Soil + 10% diesel oil + 10 mL of BC + 10% PD Nitrogen (%) 0.34±0.02 0.74±0.01 3.26±0.25 D 200g of Soil + 10% diesel oil +10 mL of BC + 10% CD Phosphorus (mgkg-1) 23.80±1.52 35.37±2.42 87.58±0.25 E 200g of Soil + 10% diesel oil + 10 mL of BC + 10% (PD+ CD) Organic C (%) 1.30±0.09 2.79±0.20 6.82±0.25 H 200g of Autoclaved soil + 10% diesel oil + 5% NaN3 Moisture (%) 8.20±0.10 36.20±3.15 15.40±0.25 Sand (%) 44.24± 3.67 ______Key BC= bacterial cocktail (two bacterial isolates from diesel contaminated soil); Silt (%) 30.28± 2.29 ______PD= Poultry dropping; CD= Cow dung: NaN3= Sodium azide Clay (%) 25.48±1.09 ______Texture Sandy loam ______Determination of physicochemical properties of soil (unpolluted & polluted) Key: CD = Cow dung, PD = Poultry dropping and organic wastes Nutrients Composition of bioremediated soil Soil pH was determined with pH meter (Model 511) on 1:2.5 (w/v) soil/ distilled water after 30 minutes equilibration. The content of nitrogen in the soil and The pH of the bioremediated soils ranged from 7.1 to 7.8 during the 84 days organic wastes utilized for bioremediation was determined using the Kjeldahl study period. Soil bioremediated with bacterial cocktail (BC) with 10% poultry method, and the contents of phosphorus and carbon were determined using ICP- droppings (PD) + Cow dung (CD) recorded highest pH of 7.8 while autoclaved
151
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
remediated soil with 5% sodium azide (NaN3) recorded the least pH of 7.1 as shown in Fig. 1 4 3,5 Soil + 10% diesel oil (Control) 8 3 Soil + 10% diesel oil Soil + 10% diesel oil + 7,8 (Control) 2,5 BC 2 Soil + 10% diesel oil + 7,6 Soil + 10% diesel oil + BC + 10% PD BC 1,5 7,4 Soil + 10% diesel oil + pH Soil + 10% diesel oil + 1 BC + 10% CD 7,2 (%) content Carbon BC + 10% PD 0,5 Soil + 10% diesel oil + 7 Soil + 10% diesel oil + 0 BC + 10% (PD + CD) BC + 10% CD Autoclaved soil + 10% 6,8 0 21 42 63 84 diesel oil + 5% NaN3 Soil + 10% diesel oil + Time (Days) 6,6 BC + 10% (PD + CD) 0 21 42 63 84 Autoclaved soil + 10% Figure 4 Carbon contents of diesel contaminated soil during bioremediation Time (days) diesel oil + 5% NaN3 Microbial counts
Figure 1 pH values of diesel contaminated soil during bioremediation The counts of total heterotrophic bacteria (THB) in all experimental soil increased with increase in bioremediation time. However, soil bioremediated The minerals (nitrogen, phosphorus, and carbon) content in all experimental soil with bacterial cocktail (BC) + 10% poultry droppings (PD) + cow dung (CD) had decreases with increase in bioremediation time (Fig. 2-4). However, the the highest THB (between 20.2×107 and 63.5×107 cfu/g) while unamended soil autoclaved remediated soil with 5% sodium azide (NaN3) had the highest (control) had the least count of THB (8.4×107 and 19.0× 107 cfu/g) (Fig. 5). nitrogen (3.59±0.21 - 3.42±0.02%) while unamended soil (control) had the least Similarly, soil bioremediated with BC + 10% (PD + CD) had the highest (0.85±0.02%) on day zero (0) whereas soil bioremediated with bacterial cocktail hydrocarbon utilizing bacteria (HUB) ranging between 15.4×106 and 86.4×106 had the least (0.43±0.02%) on the last day (day 84). Also, soil bioremediated 6 cfu/g, while the autoclaved remediated soil with 5% NaN3 had the least (1.00×10 with bacterial cocktail (BC) + 10% Poultry droppings (PD) + Cow dung (CD) cfu/g) as shown in Fig. 6. had the highest phosphorus (39.84±0.67mg/kg) on day zero (0) whereas autoclaved control soil with 5% (NaN3) had the highest phosphorus (24.00±0.26 80 Soil + 10% diesel oil mg/kg) on the last day (day 84) meanwhile unamended soil (control) had the least 70 phosphorus (23.56±0.47-14.62±0.45 mg/kg) content. The highest organic carbon (Control) content was observed in soil bioremediated with BC + 10% PD + CD 60 Soil + 10% diesel oil + (3.61±0.04%) on day zero whereas autoclaved control soil with 5% (NaN3) had cfu/g)107 50 × BC the highest organic carbon (2.07±0.02%) on day 84 meanwhile remediated 40 control soil had the least organic carbon (1.90±0.02-1.03±0.05%). Soil + 10% diesel oil + 30 BC + 10% PD 20 4 10
THB counts ( counts THB Soil + 10% diesel oil + 3,5 Soil + 10% diesel oil 0 BC + 10% CD (Control) 0 21 42 63 84 3 Soil + 10% diesel oil + Soil + 10% diesel oil + Time (Days) BC + 10% (PD + CD) 2,5 BC Figure 5 Total heterotrophic bacteria (THB) count in diesel contaminated soil Soil + 10% diesel oil + during bioremediation 2 BC + 10% PD 100 Soil + 10% diesel oil 1,5 Soil + 10% diesel oil + (Control) BC + 10% CD 80 Nitrogen content (%) content Nitrogen 1 Soil + 10% diesel oil + Soil + 10% diesel oil + BC 60
0,5 BC + 10% (PD + CD) cfu/g)106 Soil + 10% diesel oil + × BC + 10% PD 0 Autoclaved soil + 10% 40 diesel oil + 5% NaN3 Soil + 10% diesel oil + 0 21 42 63 84 BC + 10% CD Time (Days) 20 Soil + 10% diesel oil + BC + 10% (PD + CD) ( counts HUB 0 Figure 2 Nitrogen contents of diesel contaminated soil during bioremediation Autoclaved soil + 10% 0 21 42 63 84 diesel oil + 5% NaN3 Time (Days) 45 Figure 6 Hydrocarbon-utilizing bacterial (HUB) counts in diesel contaminated Soil + 10% diesel oil 40 soil during bioremediation (Control) 35 Soil + 10% diesel oil + Biodegradation of diesel oil 30 BC 25 Soil + 10% diesel oil + The biodegradation rate of diesel during the period of study is presented in Fig 7. BC + 10% PD There was a progressive decline in total petroleum hydrocarbon during the 20 Soil + 10% diesel oil + process of remediation in all the soil bioremediated with the cow dung and 15 BC + 10% CD poultry droppings compared to that of unamended soil and autoclaved remediated soil with 5% NaN3. Soil bioremediated with bacterial cocktail (BC) + 10% Phosphorus (mg/kg) Phosphorus 10 Soil + 10% diesel oil + BC + 10% (PD + CD) Poultry droppings (PD) + Cow dung (CD) had the highest total petroleum 5 hydrocarbon (TPH) degradation of 48.76%, 56.32%, 72.89% and 96.80% at the Autoclaved soil + 10% 0 end of days 21, 42, 63 and 84 respectively while soil remediated with 5% NaN3 0 21 42 63 84 diesel oil + 5% NaN3 had the least TPH degradation of 10.03%, 13.38% 14.02% and 18.42% at the end Time(Days) of days 21, 42, 63 and 84 respectively. Figure 3 Phosphorus contents of diesel contaminated soil during bioremediation
152
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
biodegradation rate of 0.0097day−1 and highest half-life of 71.46 days. However, Soil + 10% diesel oil the biodegradation rate of unamended soil (control) was 0.0916 day−1 and half- (Control) 120 life of 7.57 days. Soil + 10% diesel oil 100 + BC Table 3 Biodegradation rate and half-life of hydrocarbon in diesel contaminated soil 80 Soil + 10% diesel oil Biodegradation Half- life (t ) + BC + 10% PD 1/2 60 Treatment rate constant (k) days Soil + 10% diesel oil day-1 40 + BC + 10% CD Soil + 10% diesel oil (Control) 0.0916 7.57 Soil + 10% diesel oil + BC 0.1732 4.00 20 Soil + 10% diesel oil TPH degradation (%) degradation TPH Soil + 10% diesel oil + BC + 10% 0.1848 3.75 + BC + 10% (PD + PD 0 CD) Soil + 10% diesel oil + BC + 10% 0.1772 3.91 21 42 63 84 Autoclaved soil + 10% diesel oil + 5% CD Time (Days) NaN3 Soil + 10% diesel oil + BC + 10% 0.2096 3.31 (PD + CD) Figure 7 Total petroleum hydrocarbon degradation in diesel contaminated soil Autoclaved soil + 10% diesel oil 0.0097 71.46 during bioremediation + 5% NaN 3 Key: BC = bacterial cocktail (two bacterial isolates from diesel polluted soil),PD Net percentage loss of diesel contaminated soil = Poultry droppings CD = Cow dung
The efficiency of bioremediation was investigated by determining the net % loss Gas chromatography and mass spectroscopy of diesel oil in contaminated soil. Soil remediated with BC + 10% (PD + CD) had the highest net percentage loss of 22.44±0.30%, 24.05±0.49%, 31.83±0.30% and Gas Chromatography and Mass Spectroscopy (GCMS) analysis revealed a total 43.62±0.65% at the end of days 21, 42, 63 and 84 respectively. The least net number of 67 individual hydrocarbons in undegraded diesel oil (Fig. 8) consisting percentage loss of diesel oil of 11.33±0.25%, 14.59±0.20%, 22.70±0.33% and of n-alkane of carbon chain (C - C ), carboxylic acid (C H O - C H O ), 37.46±0.02% was recorded for soil remediated with BC at the end of days 21, 9 31 2 3 23 44 3 naphthalene, akyl group of naphthalene (C H – C H ), aromatic and 42, 63 and 84 (Table 2). 10 8 15 28 polycyclic aromatic compounds at different peak numbers, retention time and
percentage Area or height of abundance using 60 percent match quality NIST Table 2 Net percentage loss of total petroleum hydrocarbon in diesel library (1999) as shown in Table 4. contaminated soil Soil bioremediated with bacterial cocktail (BC) + 10% poultry dropping (PD) and Treatment Time (days) cow dung (CD) had the highest reduction in the hydrocarbon compounds (Fig. 9) 21 42 63 84 in which the odd molecular number of n- alkane (C -C ) except C , carboxylic Soil + 10% 11 31 23 11.33±0.25 14.59±0.20 22.70±0.33 37.46±0.02 acid (C2H3O – C23H44O3), naphthalene, akyl group of naphthalene (C10H8 – diesel oil + BC C15H28), aromatic and polycyclic aromatic compounds had been degraded at the Soil + 10% end of the study period (Table 5). There is also a significant reduction in diesel oil + BC 14.16±0.23 17.66±0.20 23.98±0.25 39.90±0.55 individual hydrocarbons with soil bioremediated with BC + 10% PD (Fig. 10) + 10% PD having degraded a total number of 48 out 67 individual hydrocarbons identified Soil + 10% in undegraded diesel oil. Individual hydrocarbon like decane (C10), undecane diesel oil + BC 12.54±0.22 14.83±0.40 22.89±0.20 39.18±0.25 (C11), dodecane (C12), pentadecane (C15) at different peak numbers 1, 6, 11, 12, + 10% CD respectively (saturated alkane), nonyl vinyl ester (C H O) (carboxylic acid), Soil + 10% 12 22 4,6,8-Trimethylazulene (C13H14) (polycyclic aromatic compound) at peak diesel oil + BC 22.44±0.30 24.05±0.49 31.83±0.30 43.62±0.65 numbers 4,19 and many more compounds had been degraded. However, soil + 10% (PD + bioremediated with BC + 10% CD (Fig. 11) had more higher molecular number CD) of n-alkane (C36-C54), carboxylic acid (C2H3O – C23H44O3), aromatic and Key: BC = bacterial cocktail (two bacterial isolates from diesel polluted soil),PD polycyclic aromatic compounds than soil bioremediated with BC + 10% PD but = Poultry droppings CD = Cow dung degraded all naphthalene and akyl group of naphthalene (C10H8 – C15H28) as shown in Tables 6-7. Biodegradation rate constant and half-life
The biodegradation rate constant (k) and half-life (t1/2) for the different treatments within the 84 days of study is shown in Table 3. Soil remediated with BC + 10% −1 (PD + CD) shows the highest biodegradation rate of 0.2096 day and least half-
life of 3.31 days; while autoclaved soil + 10% diesel oil + 5% NaN3 had the least
Absorbance
Time
Figure 8 Chromatogram charts of undegraded diesel oil used for bioremediation
153
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
Table 4 Individual hydrocarbon identified in undegraded diesel oil S/N PK RT %AREA COMPOUNDS M.F M.Q 1 1 9.741 0.98 Dodecane, 4,6-dimethyl- C12H26 87 2 Hexadecane, 2,6,11,15-tetramethyl- C18H32 93 3 Nonane, 3,7-dimethyl- C13H32 91 4 2 10.062 1.08 Naphthalene, 2-methyl- C10H8 97 5 3 10.165 1.46 Tridecane C14H31 86 6 Undecane C11H24 75 7 Carbonic acid, nonyl vinyl ester CH2CO3 69 8 4 11.126 3.60 Decahydro-1,1,4a,5,6-pentamethyl naphthalene C15H28 91 9 Neopentylidenecyclohexane C11H20 89 10 Bicyclo[3.1.1]heptane, 2,6,6-trimethyl- C7H12 92 11 5 11.246 1.63 Dodecane, 2,6,11-trimethyl- C12H26 90 12 Docosyl pentyl ether C10H20O 87 13 6 11.635 6.50 Tetradecane C14H30 89 14 Decane C10H22 91 15 7 11.910 8.67 Naphthalene, 2,6-dimethyl- C10H8 97 16 8 12.105 0.97 Naphthalene, 2,7-dimethyl- C12H14 89 17 9 12.242 2.94 6-Octen-1-ol, 3,7-dimethyl-, (R)- C10H20O 94 18 2-Octen-1-ol, 3,7-dimethyl- C10H20O 95 19 Citronellol C11H23O 93 20 10 12.362 3.34 Decahydro-1,1,4a,5,6-pentamethylnaphthalene C15H28 87 21 2-Anthracenamine C14H11N 69 22 Benzo[f]quinoline, 3-methyl- C13H9N 84 23 11 12.436 6.46 Dodecane, 2,6,11-trimethyl- C5H11O3 87 24 Carbonic acid, eicosyl vinyl ester C23H44O3 91 25 Undecane C11H24 89 26 12 12.969 6.64 Dodecane C12H26 65 27 Pentadecane C15H32 82 28 Methoxyacetic acid, 2-tridecyl ester C3H6O3 87 29 13 13.260 1.10 Naphthalene, 1,6,7-trimethyl- C10H8 89 30 3-(2-Methyl-propenyl)-1H-indene C17H27 92 31 14 13.335 2.88 Naphthalene, 1,4,6-trimethyl- C13H17 83 32 15 13.564 3.04 Naphthalene, 1,6,7-trimethyl- C13H17 96 33 16 13.598 1.80 Naphthalene, 1,6,7-trimethyl- C13H17 96 34 4,6,8-Trimethylazulene C13H14 89 35 17 13.741 3.13 4,6,8-Trimethylazulene C13H14 89 36 Naphthalene, 2,3,6-trimethyl- C10H8 92 37 18 14.016 1.18 Naphthalene, 2,3,6-trimethyl- C13H17 91 38 4,6,8-Trimethylazulene C13H14 79 39 19 14.216 3.77 Hexadecane C16H34 75 40 20 14.765 2.67 Hentriacontane C31H64 83 41 Methoxyacetic acid, 2-tridecyl ester C3H6O3 67 42 Tetradecane C14H30 83 43 21 15.498 5.48 Dodecane, 2,6,11-trimethyl- C12H26 78 44 Octadecane, 2,6-dimethyl- C21H42 92 45 Pentadecane, 2,6,10,14-tetramethyl C17H34 91 46 22 16.522 2.96 Octadecane C18H38 89 47 23 16.608 1.71 Dodecane, 2,6,10-trimethyl- C10H22 94 48 Hexadecane, 2,6,10,14-tetramethyl- C19H42 69 49 2,6,10-Trimethyltridecane C16H36 87 50 24 17.575 3.17 Nonadecane C19H40 91 51 25 18.576 3.28 Eicosane C20H42 94 52 Octadecane, 2-methyl- C18H38 97 53 26 19.537 3.73 Heneicosane C22H42 89 54 27 20.447 3.28 Docosane C22H46 78 55 28 21.323 3.16 Tricosane C23H48 65 56 Hexacosane C26H54 91 57 29 22.158 2.94 Tetracosane C24H50 87 58 30 22.965 2.10 Pentacosane C25H52 68 59 31 23.743 1.61 Hexadecane, 2,6,10,14-tetramethyl- C26H54 93 60 32 24.493 1.22 Hexadecane, 1-iodo- C29H68 91 61 Heptadecane C17H36 79 62 33 25.219 0.86 Octacosane C28H58 92 63 Hexadecane, 1-iodo- C16H34 97 64 3-Eicosene, (E)- C20H32 85 65 34 25.923 0.66 Hexadecane, 1-iodo- C16H34 91 66 Octadecane, 1-iodo- C18H38 84 67 1-Octadecene C18H3711 67 Key: PK= Peak number, RT= Retention time, M.F=Molecular formula, M.Q=Match Quality
154
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
Absorbance
Time
Figure 9 Chromatogram of diesel contaminated soil remediated with bacterial cocktail + 10% cow dung + poultry dropping after of 84 days
Table 5 Individual hydrocarbon identified in diesel contaminated soil remediated with BC + 10% (PD + CD) after of 84 days S/N PK RT %Area COMPOUNDS M. F M.Q 1 1 6.428 0.03 Decane C10H22 91 2 2 9.724 3.32 Dodecane C12H26 89 3 3 12.505 1.17 Tetradecane C14H30 93 4 4 14.954 1.06 Hexadecane C16H34 85 5 5 17.403 1.35 Octadecane C18H38 69 6 6 19.497 8.62 Eicosane C20H42 92 7 7 21.346 0.39 Docosane C22H44 63 8 8 23.205 0.62 Tetracosane C24H50 87 9 9 24.716 0.33 Hexacosane C26H54 79 10 10 26.329 0.15 Tricosane C23H48 65 Key: BC = bacterial cocktail (two bacterial isolates from diesel polluted soil), CD = Cow dung PD =Poultry dropping PK= Peak number, RT= Retention time, M.F=Molecular formualar, M.Q=Mash Quality
Absorbance
Time
Figure 10 Chromatogram of diesel contaminated soil remediated with bacterial cocktail + 10%poultry dropping after of 84 days
155
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
Absorbance
Time
Figure 11 Chromatogram of diesel contaminated soil remediated with bacterial cocktail + 10% cow dung after of 84 days
Table 6 Individual hydrocarbon identified in diesel contaminated soil remediated with BC + 10% PD after of 84 days SN PK RT %AREA COMPOUNDS M.F MQ 1 1 11.103 4.01 Decahydro-1,1,4a,5,6-pentamethylna phthalene C15H2310H 97 2 2-Pentanone, 4-cyclohexylidene-3,3 -diethyl- C15H24O 95 3 Bicyclo[2.2.1]heptane, 2,2,3-trimethyl-, endo- C7H12 96 4 2 11.870 8.59 Naphthalene, 1,6-dimethyl- C10H22 87 5 3 12.213 3.68 Citronellol C10H22 89 6 6-Octen-1-ol, 3,7-dimethyl- C10H22 91 7 4 12.339 4.29 Decahydro-1,1,4a,5,6-pentamethylna phthalene C10H22 84 8 2(1H)-Naphthalenone, octahydro-4a, 7,7trimethyl C10H22 65 9 5 13.306 2.43 Naphthalene, 1,4,6-trimethyl- C12H12 76 10 6 15.400 4.81 Dodecane, 2-methyl-8-propyl- C12H26 84 11 Methoxyacetic acid, 2-tetradecyl ester C12H22O2 92 12 7 16.562 2.30 2,6,10-Trimethyltridecane C13H28 90 13 8 17.529 4.12 Heptadecane C17H36 88 14 9 18.530 4.17 Eicosane C20H42 75 15 10 19.492 4.26 Heneicosane C21H44 87 16 11 20.401 3.65 Docosane C22H46 93 17 12 22.936 2.11 Pentacosane C25H52 97 18 13 23.715 1.67 Hexadecane, 1-iodo- C16H34 89 19 14 24.464 1.14 Tetracosane C24H50 82 Key: BC = bacterial cocktail (two bacterial isolates from diesel polluted soil), PD =Poultry dropping, PK= Peak number, RT= Retention time, M.F=Molecular formualar, M.Q=Match Quality
Table 7 Individual hydrocarbon identified in diesel contaminated soil remediated with BC + 10% CD after of 84 days S/N PK RT %AREA COMPOUNDS M.F M.Q 1 1 15.338 1.04 1-Heptadecanamine C17H37N 79 2 Carbonic acid, prop-1-en-2-yltridecyl ester CH2CO3 67 3 2 17.432 0.69 1-Octanol, 2-butyl- C8H18O 91 4 Carbonic acid, prop-1-en-2-yltetradecyl ester C19H36O3 89 5 3 18.422 1.32 Sulfurous acid, pentadecyl 2-propy l ester H2SO3 93 6 4 19.360 1.42 Oxalic acid, cyclobutyl pentadecyl ester C21H38O4 69 7 5 20.287 2.42 Docosyl isobutyl ether C16H34O 94 8 6 21.174 2.09 Octatriacontyl pentafluoropropionate C41H75F5O2 87 9 7 23.663 4.65 Tetrapentacontane, 1,54-dibromo- C54H108Br2 83 10 8 26.570 15.78 Triacontane C30H62 91 11 Docosane, 9-octyl- C22H46 87 12 9 27.233 12.63 3-Eicosene, (E)- C20H40 83 13 Heptacosane, 1-chloro- C27H56 69 14 10 27.886 8.20 Tritetracontane C43H88Cl 87 15 Heptacosane, 1-chloro- C12H22 O3 95 16 11 28.515 5.69 Carbonic acid, eicosyl vinyl ester C12H26 91 17 Heptacosane, 1-chloro- C27H56 93 18 12 30.312 1.40 Carbonic acid, eicosyl vinyl ester C12H22O3 89 19 Sulfurous acid, 2-propyl tetradecyl ester C12H26 87 20 13 30.958 0.92 Octadecane C18H38 85 21 14 31.674 0.51 Cyclotrisiloxane, hexamethyl- C36H78O3 93 Key: BC = bacterial cocktail (two bacterial isolates from diesel polluted soil), CD = Cow dung, PK= Peak number, RT= Retention time, M.F=Molecular formular, M.Q=Match Quality
156
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
DISCUSSION Gas chromatography and mass spectrometry (GCMS) are the methods used for identification of compounds in oil compounds. In this study, gas chromatography Species of Micrococcus, Bacillus, Rhodococcus, Staphylococcus, and with mass spectrometer was used to provide insight into the hydrocarbon Pseudomonas have been reported by different authors in hydrocarbon composition of diesel contaminated soil after bioremediation. GCMS degradation (Abioye et al., 2010; Dadrasnia and Agamuthu 2013). Of all the chromatogram show significant hydrocarbon degradation in all sample tested isolates identified, Micrococcus luteus strain trpE16 and Bacillus subtilis strain compared to natural diesel oil and the chromatograms of the bio-remediated soil DNK UT 02 demonstrated higher ability in utilizing hydrocarbon when revealed some peaks. inoculated directly into mineral salt medium (broth) containing diesel oil as the Soil bio-remediated with bacterial cocktail (BC) + 10% poultry dropping (PD) sole source of carbon and energy (results not shown). This may be due to the and cow dung (CD) had the highest reduction in individual hydrocarbons odd ability of these organisms to secrete hydrocarbon degradative enzymes and molecular weight of n- alkane (C11-C31), carboxylic acid (C2H3O – C23H44O3), catabolic genes for hydrocarbon degradation (Abioye et al., 2010; Dadrasnia naphthalene and akyl group of naphthalene (C10H8 – C15H28), aromatic and and Agamuthu 2013; Nwogu, et al., 2015). polycyclic aromatic compounds compared to other bio-remediated soil at the end The pH of the soil indicates that the soil was alkaline in nature. Soil of study period (day 84). This result correlates with total petroleum hydrocarbon bioremediated with bacterial cocktail (BC) with 10% poultry droppings (PD) + (TPH) degraded (96.80%) and kinetic parameter observed in this study and it is Cow dung (CD) recorded highest pH of 7.8 while autoclaved remediated soil similar to Dadrasnia and Agamuthu (2013). This may be due to the ability of with 5% sodium azide (NaN3) recorded least pH of 7.1. This might be a factor the organisms to secrete enzymes (dioxygenase, cytochrome P450) capable of that contributes to the high bacteria counts recorded in this study because bacteria degrading the hydrocarbon compounds and also to the synergistic effect of cow survives and develops within this pH range than any other microorganisms. dung and poultry droppings containing high percentage of nutrient especially Studies have reported that microbial growth in soil is controlled not by the total nitrogen and phosphorus needed for optimum growth and developments (Gorban amount of resource available but by the scarcest resources (limiting factor), et al., 2011; Nilanjana and Preethy, 2011). which are, in this case, Nitrogen (N) and Phosphorus (P) (Akpoveta et al., 2011; Gorban et al., 2011; Abioye et al., 2012). In this study, the soil bioremediated CONCLUSION with bacterial cocktail (BC) + 10% cow dung and poultry droppings (PD + CD) had the second highest nitrogen (2.94±0.19%), highest phosphorus (39.84±0.67 In this study, Hydrocarbon utilizing bacteria isolated from contaminated soil mg/kg) and carbon (3.61±0.04%) content than others in the bio-remediated soil were Micrococcus luteus strain trpE16, Bacillus subtilis strain DNK UT 02, samples. These nutrients (N, P and C) in the appropriate ratio favored the Rhodococcus sp, Staphylococcus sp, and Pseudomonas sp. Micrococcus luteus proliferation of hydrocarbon-utilizing bacteria in the bio-remediated soil which in straintrpE16 and Bacillus subtilis strain DNK UT 02 were used as bacterial turn increase total petroleum hydrocarbon (TPH) degradation. This observation is cocktail as a result of their higher ability to utilize diesel oil as source of carbon in agreement with previous studies that reported enhanced degradation of crude and energy than other organisms that were isolated. Bioremediation of diesel oil using other animal manures such as goat manure (Nwogu, et al., 2015), contaminated soil by bacterial cocktail (BC) and organic wastes (cow dung and poultry manure (Odu et al., 2015). However, the autoclaved control soil with 5% poultry droppings) recorded above 90% of diesel degradation after of 84 days. NaN3 that recorded highest amount nitrogen content (3.59±0.21-3.42±0.02 %) However, soil bioremediated with BC + 10% Poultry droppings (PD) + Cow throughout the study period. The increase in nitrogen content is due to the dung (CD) recorded the highest bacterial counts. addition of NaN3 which is a nitrogenous compound. This neither favored nor stifled the activities of the hydrocarbon-utilizing bacteria (HUB) in the REFERENCES remediated soil. This may be due to the antimicrobial activities of NaN3 which limit the growth and biodegradative activities of HUB in soil (Rahmoun et al., Abioye, O.P., Abdul-Aziz, A., & Agamuthu, P. (2010). Enhanced Biodegradation 2013). of Used Engine oil in soil amended with organic wastes. Water, Air and Soil The HUB counts in all amended bioremediated soils were gave a higher count pollution, 209, 173-179. http://dx.doi.org/10.1007/s11270-009-0189-3 when compared to the control, this result is in agreement with Abioye et al. Abioye, O. P., Agamuthu, P., & AbdulAziz, A. R. (2012). Biodegradation of (2010) who reported the count of ×106 cfu/g for hydrocarbon degraders in used Used Motor Oil in Soil Using Organic Waste Amendments. Biotechnology oil polluted soil. This is found to be higher than those obtained by Nwogu, et al. Research International, 10, 1-8. http://dx.doi.org/10.1155/2012/587041 (2015) who reported a count of ×105 cfu/g for HUB in hydrocarbon contaminated Adaba, C. S. (2013). Effects of particle size distribution on bioremediation of soil; this could be as a result of differences in adaptability and ecological nature crude oil polluted sandy soil. Nigeria Journal of Technology, 32(3), 1-15. of the microorganisms in the experimental soils. Higher bacterial counts recorded Adeleke, I. F., Esther, B. B., & Clement, A. F. (2016). Comparative in amended bioremediated soils might be as a result of high quantities of bioremediation of crude oil contaminated soil samples using activated soil and nitrogen and phosphorus recorded in poultry droppings and cow dung, which are activated cow dung. Sky Journal of Microbiology Research, 4(4), 021-030. essential nutrients needed for bacterial biodegradative activities (Abioye et al., Adesodun, J. K., & Mbagwu, J.S. (2008). Biodegradation of waste lubricating oil 2010; Baruah and Das, 2014; Adeleke et al., 2016). in a tropical alfsoil as mediated by animal droppings. Bioresource Technology, There was a progressive reduction in the total petroleum hydrocarbon during 99(13), 5659-5665. http://dx.doi.org/10.1016/j.biortech.2007.10.031 remediation in all the bioremediated soil with bacterial cocktail (BC), Poultry Akpoveta, O., Egharevba, F., Medjor, O., Osaro K., & Enyemike, E. (2011). droppings (PD) and cow dung (CD) compared to unamended soil (control) and Microbial Degradation and its Kinetics on Crude Oil Polluted Soil. Research autoclaved remediated soil with 5% NaN3. Although microorganisms are present Journal of Chemical Sciences, 11(6), 8-14. in contaminated soil, their numbers might not be sufficient to initiate remediation Baruah, D., & Das, N. J. (2014). Hydrocarbon-degrading bacteria diversity in of contaminated sites (Nwogu et al., 2015). The growth and activities of HUB soils contaminated with diesel oil. Industrial pollution control, 16(3), 308-314. must be stimulated and require essential nutrients like nitrogen, phosphorus, and Chen, M., Xu, P., Zeng, G., Yang, C., Huang, D., & Zhang, J. (2015). carbon as building blocks. This study shows that the rate of biodegradation of Bioremediation of soils contaminated with polycyclic aromatic hydrocarbon, diesel oil in soil bioremediated with BC + 10% (PD + CD) had the highest total petroleum, pesticides, chlorophenols and heavy metals by composting: petroleum hydrocarbon (TPH) degradation of 96.80% at the end of remediation Applications, microbes and future research needs. Biotechnology Advances, (day 84). 33(1), 745-755. This is consistence with kinetic parameters observed in this study (Table 3) Castro-Gutiérrez, V. M., Rodríguez-Rodríguez, C. E., & Vargas-Azofeifa, I. which show that the degradation rates of diesel in soil remediated with BC + 10% (2012). Bioaugmentation for soil bioremediation. International Journal (PD + CD) was higher than other treatments. This may be due to the synergetic Environmental, 21 (6), 345-352. effect of cow dung and poultry droppings resulting in high percentage of nutrient Dadrasnia, A., & Agamuthu, P. (2013). Dynamics of diesel fuel degradation in especially nitrogen and phosphorus which are needed for optimum growth and contaminated soil using organic wastes. International Journal Environmental performances of HUB thus facilitating the synthesis of the necessary enzymes Science Technology, 10, 769-778. http://dx.doi.org/10.1007/s13762-013-0224-1 needed to break down the petroleum hydrocarbon contaminants (Gorban et al., Ebere, J. U., Wokoma, E. C., & Wokocha, C. C. (2011). Enhanced Remediation 2011; Okoh, 2013). However, the rate of hydrocarbon degradation in autoclaved of a Hydrocarbon Polluted Soil. Research Journal of Environmental and Earth remediated soil with 5% NaN3 was lower (18.42%) than even the unamended soil Sciences, 3(2), 70-74. (control) and this may be due to the antimicrobial nature of NaN3 (Rahmoun et Gorban, A.N., Pokidysheva, I., Smirnova, E.V., & Tyukina, T.A. (2011). Law of al., 2013), which limit the biodegradative activities and growth of HUB in soil. the minimum paradoxes,” Bulletin of Mathematical Biology, 73 (9), 2013-2044. Although, there was slow and gradual decrease in the TPH concentration in http://dx.doi.org/10.1007/s11538-010-9597-1 unamended soil compared to the other amended bioremediated soils. This might Henrik, C. (2004). Methods in Practical Laboratory Bacteriology, CRC Press: be attributed to other processes such as volatilization, adsorption, and abiotic London. 201-220. factors (temperature), which have been reported to contribute to decrease in TPH Ibiene, A. A., Orji, F. A., Ezidi, C. O., & Egwobia, C. L. (2011). Bioremediation concentration (Nwogu, et al., 2015). Similarly, the control soil was able to record of Hydrocarbon Contaminated Soil in the Niger Delta using Spent Mushroom higher TPH degradation than the autoclaved soil remediated with 5% NaN3 Compost and other Organic wastes. Nigeria Journal of Agriculture, Food and because autoclaving also could inhibit the growth of the organisms and reduce Environment, 7(3), 1-7. the rate of biodegradation whereas unamended soil (control) contains some level of bacteria which enhance biodegradation of hydrocarbon.
157
J Microbiol Biotech Food Sci / Osinowo et al. 2020 : 10 (2) 150-158
Nilanjana, D., & Preethy, C. (2011). Microbial degradation of petroleum hydrocarbon contaminants: An overview: Biotechnology Research international, 20 (11). 1-13. http://dx.doi.org/10.4061/2011/941810 Nwogu, T. P. Azubuike, C. C., & Ogugbue, C. J. (2015). Enhanced Bioremediation of Soil Artificially Contaminated with Petroleum Hydrocarbons after Amendment with goat manure, International Journal of Biomedical Research, 3(1), 45-51. http://dx.doi.org/10.1155/2015/657349 Odu, C. I., Amadi, E. N., & Okolo, J. C. (2015). Effect of soil treatments containing poultry manure on diese oil degradation in a sandy loam soil. Applied Ecology Environment, 3 (1), 147-159. Olabemiwo, O. M., Adediran, G. O., Adekola, F. A., Adelowo, O. O., & Olajire, A. A. (2014). Biodegradation of hydrocarbon compounds in Agbabu natural bitumen. African Journal of Biotechnology, 13(11), 1257-1264. Okoh, A. I. (2013). Biodegradation of Bonny light crude oil in soil microcosm by some bacterial strains isolated from oil flow stations saver pits in Nigeria. African Journal Biotechnology, 12(5), 104-201. Rahmoun, E. A., Nadjib, M., & Mohammed, A. H. (2013). Antimicrobial Activities of the Henna Extract and Some Synthetic Naphthoquinones Derivatives. American Journal of Medical and Biological Research, 1(1), 16-22. http://dx.doi.org/10.12691/ajmbr-1-1-3 Tariq, M., Hemighaus, K., Hoekman, J., Horn, A., Gibbs, M., Ingham, L., & Jossens, D. (2016). Bioremediation of crude oil- bearing soil: effect of Rhamnolipid addition to soil toxicity and crude oil biodegradation efficiency. International Journal of Environment, 11(2), 1181-1190. Yeung, P.Y., Johnson, R. L., & Xu, J. G. (1997). Biodegradation of petroleum hydrocarbons in soil as affected by heating and forced aeration. Journal of Environmental Quality, 26, 1511-1576. http://dx.doi.org/10.2134/jeq1997.00472425002600060009x.
158
PRODUCTION AND OPTIMIZATION OF CYCLODEXTRIN GLUCANOTRANFERASE FROM BACILLUS SP. SS2
Dhwani Upadhyay1, Divya Shrivastava1 Anita Chauhan2, Niraj Kumar Singh2 and Niha Mohan Kulshreshtha1,3*
Address(es): Dr. Niha Mohan Kulshreshtha, 1School of Life Sciences, Jaipur National University, Jaipur, Rajasthan, India-302025. 2Shri A.N. Patel P.G. Institute, Anand, Gujarat, India-388001. 3Department of Civil Engineering, Malaviya National Institute of Technology, Jaipur, Rajasthan, India-302017.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.159-165
ARTICLE INFO ABSTRACT
Received 11. 4. 2019 An extracellular cyclodextrin glucanotranferase enzyme producing bacterium was isolated from the soil sample collected from Dumas Revised 2. 6. 2020 Beach, Surat, India. The isolate was biochemically, physiologically, and phylogenetically characterized and was identified as a strain of Accepted 2. 6. 2020 Bacillus cereus group. The production of CGTase enzyme was optimized using various starch sources as substrates such as soluble starch, Published 1. 10. 2020 corn starch, potato starch, and rice starch. The enzyme production was found to be maximum when potato starch was added in the medium as substrate. The enzyme activity was measured as 5.132±0.25 U/mL in soluble starch, 8.423±0.33U/mL in corn starch, 14.329 ± 0.14 U/mL in potato starch, and 12.762 ± 0.09 U/mL in rice starch. The optimization of operating parameters such as pH, incubation Regular article temperature, potato starch concentration, incubation time, and agitation speed affecting enzyme production was further carried out using Response Surface Methodology, a combined method of statistical and mathematical approach. Central Composite Design was selected for optimization and the optimum levels of these parameters were identified as 8.8, 38°C, 2.2%, 50 h, and 200 rpm for pH, incubation temperature, potato starch concentration, incubation time, and agitation speed respectively. The final CGTase enzyme activity at the optimum levels of all the factors was measured to be as 38.313 U/mL which was in agreement with the software predicted enzyme activity of 39.901 U/mL and was more than twice the original activity. This study demonstrates the utility of strain SS2 for CGTase production which can be used as an alternative for commercial cyclodextrin production.
Keywords: cyclodextrin glucanotranferase, Optimization, Central Composite Design, Cyclodextrins
INTRODUCTION The production of cyclodextrins using CGTase enzyme results in a mixture of all the three types of cyclodextrins (α, β and γ). The inability of wild type Cyclodextrin glucanotransferase is a versatile enzyme produced by some microorganisms to produce adequate amount of single type of cyclodextrin leads microorganisms that are capable of acting on starch and related carbohydrates. The to increased production cost as a result of requirement of additional purification enzyme catalyzes reactions such as cyclization, hydrolysis, coupling, and step for extraction of the desired type of cyclodextrin from the mixture of all the disproportionation. The cyclization reaction is the most beneficial among all the cyclodextrins. The problem can be partly overcome by use of strains that produce reactions as it produces a non-reducing cyclic molecule known as cyclodextrin cyclodextrins in adequate amount so that the production cycle becomes (CD). Cyclodextrin is an oligosaccharide having glucopyranose units bonded with economically feasible. A large number of genetically engineered CGTase α (1,4) linkage. It possess an external hydrophilic and internal hydrophobic surface overexpressing strains have been developed (Leemhuis et al., 2010) but they suffer conferring it with an ability to encapsulate various guest molecules in its cyclic from an inherent stability issue for long term application (Qi and Zimmermann, cavity (Di Cagno, 2017). Due to its inclusion complex forming capability, 2005). Looking for novel, high CGTase producing strains from unique cyclodextrin is used in multiple industries such as pharmaceutical, cosmetic, environmental niches and optimization of the production medium that may further agriculture, environmental, plastic, chemical, textile, food, medical for diverse increase the efficiency of these strains is a more straightforward and simple purposes (Sharma and Baldi, 2016). There are three types of cyclodextrins based approach. Moreover, the wild type isolates are expected to retain their on the number of glucopyranose units. The cyclodextrins which contain 6 characteristics for many generations. glucopyranose units are known as α cyclodextrins whereas, 7 and 8 glucopyranose In the present study, we have reported the isolation and characterization of a comprising cyclodextrins are called as β and γ cyclodextrins respectively (Jansook CGTase producing strain Bacillus sp. SS2. Both conventional and statistical et al., 2018). The superior intriguing qualities of cyclodextrins are to shelter the methods were used to optimize the production medium. The enzyme activity was guest molecules from biotic and abiotic origins such as heat, light, and microbial estimated using various starches such as soluble starch, corn starch, potato starch, degradation, and the capability to transform their properties such as solubility, and rice starch using the conventional method. Further, various operating stability, chemical reactivity, color and odour (Kfoury et al., 2018). Among the parameters such as pH, incubation temperature, potato starch concentration, three types of cyclodextrins, β-cyclodextrins are routinely utilized for complexing incubation time, and agitation speed were optimized using a combined statistical a variety of guest molecules owing to their high stability and low solubility and and mathematical tool known as response surface methodology. This methodology thus have high commercial value (Upadhyay et al., 2018). The CGTase enzyme bypasses the conventional single factor optimization and allows study of more than is known to be produced mostly by bacterial strains such as Bacillus circulans one factor simultaneously. It also generates contour plots showing interaction (Costa et al., 2015), Microbacterium terrae (Rajput et al., 2016), Bacillus flexus between the factors and fits the experimental data by least squares technique to (Reddy et al., 2017), Bacillus clarkii (Wu et al., 2012) and Amphibacillus sp. calculate the optimal response of the system (Montgomery et al., 2009; Vining (Ibrahim et al., 2012). However, some hyperthermophilic archaea, for instance, and Kowalski 2010). CCD has been used by many researchers to identify optimal Haloferax mediterranei (Bautista et al., 2012), Thermococcus kodakaraensis reaction conditions (de Oliveira et al., 2019; Sreedharan et al., 2019). The current (Rashid et al., 2002), and Pyrococcus furiosus (Lee et al., 2007) are also proficient study was aimed to optimize the CGTase production from a wild type bacterial in secreting the enzyme.
159
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
strain using CCD which may reduce the production cost of cyclodextrins and may starches. The substrate supplemented medium which produced the highest enzyme prove as a viable alternative for commercial CGTase production. activity was considered as the best suitable substrate for CGTase production by MATERIALS AND METHODS SS2. The production medium was further optimized using statistical tools taking various operating parameters. Sample collection and screening of CGTase producing microorganisms Optimization of CGTase production using Response Surface Methodology Soil sample was collected from Dumas beach, Surat, Gujarat, India (21° 4′ 45″ N,72° 42′ 55″ E) in autoclaved glass jar using sterilized gloves and spatula. 0.1 g Response surface methodology was used to optimize various factors that are of soil sample was added to 500 mL of autoclaved Horikoshi-II medium known to affect enzyme production. The optimization of variable factors such as (Horikoshi, 2003) which was supplemented with 10 g soluble starch, 5 g peptone, pH, incubation temperature, incubation time, potato starch concentration, and 5 g yeast extract, 1 g K2HPO4, and 0.2 g MgSO4.7H2O. 10% Na2CO3 was agitation speed was carried out using Central Composite Design of Design-Expert separately added to the medium after autoclaving to adjust the pH at 9. The soil 11.0 software (Trial Version- State Ease, Inc., MN, USA). All the factors were containing medium was incubated at 37°C for 24 h, 120 rpm. Following taken as independent variables to study the variations in response (CGTase enzyme incubation, the sample was diluted appropriately in normal saline and spread onto activity) which may occur due to the interaction effect of operating parameters. the Horikoshi-II agar plates prepared by adding 2% agar to the liquid Horikoshi-II The minimum and maximum values of independent parameters were fixed and medium. All the bacterial colonies were separated and screened for CGTase entered in the CCD tool which generated a total of 50 runs to analyze the response. production according to the method described by Park et al. (1989). The screening According to the design, 50 experiments of different combinations were performed medium was prepared by adding 0.035 mM phenolphthalein dye, 0.030 mM with Horikoshi-II broth. In Horikoshi-II medium, different concentrations of methyl orange dye (filter sterilized with 0.2 micron filter), and 2% agar to the potato starch was added, and the pH of the medium was adjusted according to the sterilized liquid Horikoshi-II medium just before pouring of plates. The plates were described level. The medium was inoculated with 1% of 24 h old bacterial culture punched using cork-borer at the centre to form a well in which 100 µL of cell-free followed by incubation at respective temperatures for a specific time interval at supernatants of isolates grown in liquid Horikoshi II medium were added. The provided agitation speeds. The experiments were conducted in duplicates, and their plates were incubated at for 24 to 48 h at 37°C and regularly inspected for the respective inputs were incorporated in the design for statistical analysis. Further, development of halo zones. The bacterial isolates producing yellowish halo zone to develop the mathematical model and to estimate the response of independent around the wells were considered as CGTase positive, and its culture supernatant variables, following second-order polynomial equation was calculated using an served as crude CGTase enzyme. automated statistical tool of software.
CGTase enzyme activity assay Y= β0 + β1A + β2B + β3C + β4D + β5E + β12AB + β13AC + β14AD + β15AE + β23BC 2 2 2 2 2 + β24BD + β25BE + β34CD + β35CE + β45DE + β11A + β22B + β33C + β44D + β55E CGTase activity was measured by PHP method described by Goel and Nene Where, Y = Response (Predicted), β0 = Interception Coefficient, β1, β2, β3, β4, β5 = (1995). Briefly, 1mL cell-free supernatant of 24 h old bacterial culture grown in Linear Coefficients, β12, β13, β14, β15, β23, β24, β25, β34, β35, β45= Interaction Horikoshi –II medium was added to 1 mL 1% starch solution prepared in 50 mM Coefficient, β11, β22, β33, β44, β55 = Quadratic Coefficient. Tris-HCl buffer solution (pH-7). The tubes containing the enzyme substrate mixture were incubated at 60°C in a water bath for 20 minutes. Later, the The data were further analyzed by ANOVA, and the significant p-values (< 0.05) enzymatic reaction was prohibited by quick cooling of tubes on ice for 10 minutes. were used for surface response analysis. The optimal values of operating The assay reagent of PHP method, i.e. 4 mL of working phenolphthalein was added parameters and their interactions were estimated by three-dimensional response to the tubes. The working phenolphthalein was prepared by adding 4 mL of ethanol surface graphs and 2-dimensional contour graphs. The predicted results generated and 1 mL of 4 mM phenolphthalein to 100 mL 125mM Na2CO3 solution. After the after the design were verified by conducting experiments under optimal conditions. quick mixing of components, the solution was subjected to optical density measurement at 550 nm. A control reaction was prepared by replacing enzyme RESULTS AND DISCUSSION with Tris-HCl buffer (pH-7) 1 Unit of the enzyme is defined as the microgram of product formed in 1 minute from per ml of culture under controlled conditions. In Screening of CGTase producing microorganisms case of the pure enzyme, appropriate dilution was made and the total protein concentration was determined by Bradford’d protein estimation method. The The CGTase producing microorganisms was isolated on Horikoshi-II agar plate experiments were set up in triplicates. supplemented with phenolphthalein and methyl orange dyes. Out of a total of 20 bacterial colonies isolated on the plates, only 1 bacterium (named as SS2) was Identification and characterization of CGTase producing isolate found to be producing CGTase enzyme. As shown in Figure 1 A, the cell-free supernatant of isolate SS2 produced a yellowish halo ring around the well To identify the CGTase producing isolate at primary level, Gram’s staining and suggesting the probable presence of β-CGTase (Vinod and More, 2016). The biochemical assays were performed as described in Bergy’s Manual of reduction of the red color of phenolphthalein may have occurred due to the Determinative Biology. Confirmatory identification was carried out by the formation of cyclodextrin and phenolphthalein complex, resulting in an intensified molecular method of 16S rRNA gene sequencing. The 16S rRNA sequencing was shade of methyl orange. The distilled water was used as negative control for this performed at Yaazh Xenomics, Coimbatore, Tamilnadu, India. Strain SS2 was experiment. The presence of CGTase enzyme was confirmed by identified as Bacillus sp. using the Identify tool of EzBioCloud server (Chun et spectrophotometric CGTase activity assay (PHP assay) which is predominantly al., 2007). The 16S rRNA gene sequences of most closely related, valid strains of sensitive for β-cyclodextrin (Goel and Nene, 1995). The CGTase activity of the Bacillus sp. were downloaded from EzBio cloud server and the phylogenetic crude enzyme (cell-free supernatant) was found to be 3.57 U/mL, similar to the position of SS2 was identified using these sequences in MEGA X software strain Microbacterium terrae KNR 9, having crude CGTase activity of 4.71U (Tamura et al., 2007). Briefly, the FASTA sequences of the closely related (Rajput et al., 2016). Bacillus strains along with one outgroup sp. (Geobacillus stearothermophilus, Accession number- NR 040794.1) were used to create multiple sequence alignment using CLUSTALW program within the MEGA software package. The A B short sequences were manually removed, and alignment was used for phylogenetic tree construction using the neighbor-joining method in the software (Saitou and Nei, 1987). For computation of evolutionary distances, Kimura two parameter method was used (Kimura, 1980). The reliability of the tree was inferred by performing the bootstrap test with 1000 replicates (Felsenstein, 1985). Test Optimization of CGTase production medium for isolate SS2
CGTase production using various starches
Enzyme production was optimized by measuring the enzyme activity using different types of starches - soluble starch, corn starch, potato starch, and rice starch. 1% of each substrate was added to separate flasks containing 100 mL of Figure 1 A. CGTase activity plate showing yellow halo zone around the well Horikoshi-II broth (without dyes) and pH was set to 9 followed by medium loaded with crude enzyme, B. Microscopic image of Gram stained SS2 cells sterilization in autoclave at 15 psi for 20 minutes. 1 mL of 24 h old SS2 bacterial culture was inoculated in all the flasks which were further incubated at 37°C for 24 h at 120 rpm. The enzyme activity assay was performed with the cell-free supernatants collected after centrifugation of all the cultures having various
160
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
Identification and characterization of CGTase producing isolate SS2 Table 2 CGTase activity (U) with various starches The bacterial isolate SS2 formed white colored opaque colonies with irregular Starch Type CGTase Activity (U) shape and rough surface on nutrient agar medium after incubation for 20±2 h at 30̊ Soluble Starch 5.132±0.25 C. The colony diameter was observed to be 4-6 mm. The bacterium was found to Corn Starch 8.423±0.33 be Gram positive, forming dense rods (Figure 1 B). The biochemical Potato Starch 14.329±0.14 characterization was conducted to decipher the metabolic abilities of the bacterium that may confer a selective advantage to the bacterial isolate, apart from CGTase Rice Starch 12.762±0.09 production. This also provided clues for identification of the isolated strain. As mentioned in Table 1, indole and MR tests produced negative results for SS2 while VP, citrate, urease, catalase, and gelatinase tests were found to be positive. The bacterium can ferment simple sugars such as maltose, fructose, sucrose, dextrose, and lactose but is inefficient for xylose and sorbitol fermentation. The results of biochemical tests along with colony characteristics and Gram’s staining were compared with the related species reported in Bergy’s Manual of Systematic Bacteriology Volume 1 and Volume 3 (Krieg and Holt, 1984; Staley et al., 1989) and it was confirmed that the isolate SS2 belonged to the family Bacillaceae and genus Bacillus. It was presumed from the biochemical tests that the strain might belong to one of the following species – Bacillus thuringiensis, Bacillus mycoides, Bacillus cereus, Bacillus anthracis, Bacillus subtilis, or Bacillus licheniformis. The genetic identification of bacterium was validated by the molecular procedure of 16S rRNA gene sequencing followed by BLAST analysis of the consensus sequence. A BLAST analysis of the consensus sequence revealed that isolate SS2 belongs to the Bacillus cereus group and showed the highest similarity with Bacillus cereus strain D18-4 (Accession number MK300054.1). The 16S rRNA gene sequence of isolate SS2 (1225 bp) has been deposited to NCBI-Genbank (Accession number - MK389411). The phylogenetic analysis of isolate SS2 carried out using MEGA X software shows that the strain clustered with the different species of Bacillus genus such as Bacillus cereus, Bacillus luti, Bacillus albus, Bacillus mycoides, and Bacillus tropicus (Figure 2). Genus Bacillus is known for its biotechnological applications such as hydrolytic enzymes as well as value added products (Kumar et al., 2013; Patel et al., 2019; Porwal et al., 2008). CGTase production from Bacillus genus has been reported previously from the species such as Bacillus clausii (Alves-Prado et al., 2008), Bacillus pseudalcaliphilus (Atanasova et al., 2011), Bacillus clarkii (Wu et al., 2012), Bacillus circulans (Costa et al., 2015) etc.
Table 1 Biochemical Tests for CGTase producing isolate SS2 Biochemical Test Experimental Results Indole test Negative Methyl red test Negative VP test Positive Citrate utilization test Positive Urease test Positive Figure 2 Phylogenetic tree of isolate SS2 presenting evolutionary association Gelatinase Positive between isolate SS2 and 30 taxa of Bacillus genus. The bootstrap values are Catalase Positive displayed next to the branch points. The space bar shows the 0.01 substitution per Starch hydrolysis Positive site. Geobacillus stearothermophilus NR_040794.1 was used as outgroup. Maltose fermentation Positive Fructose fermentation Positive Sucrose fermentation Positive Optimization of CGTase production using statistical method (RSM) Dextrose fermentation Positive Lactose fermentation Positive Central composite design of RSM was utilized to optimize the CGTase production Xylose fermentation Negative at various operating parameters. Factors such as pH, incubation temperature (°C), Sorbitol fermentation Negative incubation time (h), potato starch concentration (%), and agitation speed (rpm) were determined as independent operating parameters for this study, and CGTase Optimization of CGTase production from SS2 activity was considered as the response. The different levels of these parameters used for optimization are mentioned in Table 3 and the responses (CGTase Optimization of CGTase using various starches activity) produced after experimenting the combinations of variables, are described in Table 4. The CGTase production was estimated after supplementing the production medium with various starches such as soluble starch, corn starch, potato starch, Table 3 Levels of Independent variables for Central Composite Design and rice starch. The maximum CGTase activity was observed in the medium Independent Variables -1 Level 0 Level +1 Level supplemented with the potato starch (14.329±0.14U). However, rice starch showed pH 6 8 10 the second highest CGTase activity of 12.762±0.09U. The medium containing corn Incubation temperature 25 35 45 starch, and soluble starch showed CGTase activities of 8.423±0.33U and (°C) 5.132±0.25U respectively (Table 2). CGTase enzyme production is induced by the Incubation time (h) 24 48 72 starch and amylopectin is highly preferred by the enzyme for cyclodextrin Potato starch concentration formation (Biwer et al., 2002). Potato starch has clusters of amylopectin which 0.50 1.75 3.0 comprises 5-10 amylopectin chains per cluster (BeMiller and Whistler, 2009). (%) Therefore, it seems that potato starch plays a vital role in CGTase production from Agitation speed (RPM) 100 200 300 strain SS2. In a previous literature of Microbacterium terrae, potato starch has been identified as a potent substrate for CGTase production among corn, sago, and soluble starches (Rajput et al., 2016). However, in another study carried out by Elbaz et al. (2015) it was observed that Bacillus lehensis produces maximum CGTase enzyme when cultured in medium supplemented with rice starch. CGTase production was further optimized using other operating parameters along with the potato starch as the main substrate.
161
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
Table 4 Experimental Central Composite Design having coded values of independent variables along with their respective actual and predicted responses Factor Factor Factor Factor Factor CGTase activity
A B C D E Run pH Temp Incubation time Potato starch conc. Agitation Speed Actual Predicted (h) (%) (rpm) (°C) 1 -1 +1 +1 +1 +1 30.12±0.0832 32.55 2 0 0 0 0 0 39.09±0.0456 38.43 3 0 0 0 0 0 40.21±0.0520 41.44 4 0 0 0 0 -1 38.28±0.0789 36.88 5 0 0 0 0 0 39.01±0.0571 38.50 6 -1 +1 -1 -1 -1 24.32±0.0351 25.01 7 +1 -1 +1 -1 +1 21.41±0.0411 22.69 8 0 0 0 -1 0 36.15±0.0642 35.76 9 0 0 0 +1 0 38.25±0.0587 39.23 10 +1 -1 +1 -1 -1 23.00±0.0935 22.56 11 +1 +1 +1 +1 -1 26.27±0.0847 27.12 12 -1 -1 -1 -1 -1 25.19±0.0863 24.14 13 -1 +1 +1 -1 -1 25.34±0.0572 24.95 14 -1 +1 -1 +1 -1 24.03±0.0637 24.19 15 +1 +1 -1 +1 +1 26.53±0.0825 25.08 16 -1 +1 +1 -1 +1 24.08±0.0790 23.72 17 +1 -1 +1 +1 -1 25.12±0.1312 24.65 18 0 0 +1 0 0 36.43±0.0551 35.01 19 0 0 0 0 0 39.16±0.0645 38.27 20 -1 +1 -1 +1 +1 29.02±0.0873 29.55 21 +1 -1 -1 -1 +1 26.35±0.0468 26.00 22 0 0 0 0 0 40.23±0.0388 39.89 23 +1 -1 -1 -1 -1 27.45±0.0740 26.11 24 0 0 0 0 0 39.36±0.0490 38.15 25 -1 -1 -1 +1 -1 25.48±0.0217 24.23 26 0 0 0 0 0 40.01±0.0513 39.46 27 +1 +1 -1 -1 +1 22.35±0.0683 23.07 28 -1 -1 +1 -1 -1 24.42±0.0879 25.32 29 -1 +1 -1 -1 +1 27.14±0.0320 28.12 30 0 0 -1 0 0 40.12±0.0469 39.88 31 +1 -1 -1 +1 -1 28.50±0.0553 27.78 32 0 0 0 0 0 41.00±0.1231 39.59 33 -1 -1 +1 +1 -1 23.23±0.0434 24.52 34 +1 +1 -1 -1 -1 20.01±0.0659 19.00 35 +1 +1 +1 -1 -1 21.17±0.0347 20.25 36 +1 -1 -1 +1 +1 28.25±0.0897 29.12 37 +1 +1 +1 -1 +1 19.22±0.0923 18.77 38 +1 +1 +1 +1 +1 24.36±0.0230 25.45 39 +1 0 0 0 0 34.43±0.0546 35.12 40 0 +1 0 0 0 38.58±0.0681 39.95 41 -1 +1 +1 +1 -1 28.32±0.1280 27.00 42 +1 -1 +1 +1 +1 27.23±0.0404 26.83 43 0 -1 0 0 0 39.41±0.0361 38.65 44 +1 +1 -1 +1 -1 25.52±0.0343 25.12 45 -1 -1 +1 -1 +1 28.34±0.0715 29.55 46 0 0 0 0 +1 40.11±0.0591 39.43 47 -1 -1 +1 +1 +1 29.02±0.0624 28.52 48 -1 0 0 0 0 36.53±0.0838 38.56 49 -1 -1 -1 -1 +1 30.24±0.0449 28.65 50 -1 -1 -1 +1 +1 31.53±0.0215 28.18
The statistical and mathematical model fitness was assessed using ANOVA test Lack of Fit F-value was not significant which implies that model was of good fit. (Table 5). The inferior probability value (<0.001) and a greater F-value (104.76), The observed adjusted and predicted R2 values were 0.9769 and 0.9540 along with the decent coefficient of determination value (R2-0.9863) represents respectively suggesting sensible agreement between the experimental and that model was highly efficient in predicting response values. As presented in predicted values. The ratio of signal to noise was measured as 32.1999, which Table 5, all the terms of independent parameters (A to E) including linear, denotes that model can potentially circumnavigate the design space. interaction, and square were significant as they possessed the p-values <0.05. The
162
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
Table 5 Analysis of variance (ANOVA) for quadratic model Source Sum of Squares Df Mean Square F-value p-value Model 2254.08 20 112.70 104.76 < 0.0001 significant A-pH 47.06 1 47.06 43.74 < 0.0001 significant B-Temp 21.44 1 21.44 19.93 0.0001 significant C-Incubation time 16.94 1 16.94 15.75 0.0004 significant D- Potato starch concentration 56.94 1 56.94 52.93 < 0.0001 significant E-Agitation 26.47 1 26.47 24.61 < 0.0001 significant AB 10.13 1 10.13 9.41 0.0046 significant AC 4.50 1 4.50 4.18 0.0500 significant AD 10.13 1 10.13 9.41 0.0046 significant AE 32.00 1 32.00 29.75 < 0.0001 significant BC 12.50 1 12.50 11.62 0.0019 significant BD 10.13 1 10.13 9.41 0.0046 significant BE 4.50 1 4.50 4.18 0.0500 significant CD 4.50 1 4.50 4.18 0.0500 significant CE 6.13 1 6.13 5.69 0.0238 significant DE 4.50 1 4.50 4.18 0.0500 significant A² 72.42 1 72.42 67.32 < 0.0001 significant B² 9.03 1 9.03 8.40 0.0071 significant C² 14.38 1 14.38 13.37 0.0010 significant D² 28.78 1 28.78 26.75 < 0.0001 significant E² 4.93 1 4.93 4.58 0.0409 significant Lack of Fit 27.32 22 1.24 2.24 0.1376 Insignificant
Pure Error 3.87 7 0.5536 Cor Total 2285.28 49 P<0.05 is considered significant, R2= 0.9863, Adjusted R2= 0.9769, Predicted R2 = 0.9540.
The interaction study of factors- pH and temperature showed that, at lower pH and adjusting the agitation speed to 200 to 250 rpm could effectively increase the temperature, enzyme activity was restricted which increased linearly and attained CGTase production (Figure 3J). the peak values in the temperature range of 30°C to 35°C and pH range of 7.5 to The statistical model fitted all the selected operating factors to their optimum level 8.5. The enzyme activity decreased at increased temperature and pH (Figure 3A). to provide the highest CGTase activity. The final model represented the optimal The interaction between pH and incubation time interval explained that the values of pH, temperature, incubation time, potato starch concentration, and CGTase production was maximum between 45 to 50 h of inoculation at pH range agitation speed to be as 8.8, 38°C, 50 h, 2.2%, and 200 rpm respectively. To from 7.5 to 8.5. The long term incubation even at lower or higher pH did not validate the method, CGTase production was experimented taking optimum values increase the enzyme activity (Figure 3B). As shown in Figure 3C, the potato starch of the provided factors and the enzyme activity was measured as 38.313U which concentration was a significant factor in the interaction of pH and potato starch was similar to the activity calculated by software (39.901) and it was almost 2 folds concentration. The lower concentration of potato starch prohibited the enzyme higher than the conventional medium supplemented with potato starch. The activity irrespective of pH. The enzyme activity was highest when the substrate variations in pH affected the enzyme production possibly by transporting concentration was taken in the range of 1.5 to 2.5% and the pH range of 7.5 to 8.5. chemicals through cell membrane (Sharma et al., 2017). The isolate SS2 produced In the interaction studies between pH and agitation speed, it was observed that, maximum enzyme at pH 8.8 which means the bacterium is moderately alkaliphilic. when the isolate was cultured at lower pH with high agitation speed, the enzyme At the higher potato starch concentration, enzyme production was not observed as activity was in the increasing mode. However, the maximum level of enzyme potato starch is viscous in nature and its higher concentration might lead to poor activity was obtained when pH was adjusted in the range of 7.5-8.5 with the oxygen uptake that may reduce the enzyme production (BeMiller and Whistler, agitation speed range of 200 to 250 rpm (Figure 3D). Figure 3E, shows that the 2009). The enzyme production might also be repressed at higher substrate incubation time interval is a critical operating parameter. The incubation of culture concentration due to the accumulation of short oligosaccharides and glucose units isolate in the temperature range of 30°C to 35°C for 40 to 45 h provides the degraded from potato starch (Elbaz et al., 2015). The bacterium was able to maximum CGTase activity. The temperature and potato starch concentration produce enzyme in moderate substrate concentration. The operating parameters of interaction disclosed that the CGTase activity was more substrate concentration incubation temperature, incubation time, and agitation speed were identified as dependent. At lower substrate concentration the enzyme activity was minimum growth attendant parameters, it was determined that the isolate produced optimal irrespective of temperature. However, the enzyme activity was maximum in the enzyme activity at the log phase which was characterized with the balanced values substrate concentration range of 1.5 to 2.5% and the temperature range of 30°C to of these factors. The similar optimization report using CCD was studied before in 35°C (Figure 3F). As observed in Figure 3G, the high agitation speed increased the Bacillus G1 where the optimization of various independent factors increased enzyme activity in the temperature range of 30°C to 40°C. The lower and higher CGTase activity till 54.9U/mL (Ibrahim et al., 2005). However, the manual incubation temperature than the provided, couldn’t actively increase the enzyme optimization of multiple factors in Bacillus cereus RJ30 isolated produced activity at lower agitation speed. The interaction between incubation time and maximum CGTase activity of 54U/mL (Jamuna et al., 1993), and in bacterial potato substrate concentration explained that there was minimal enzyme isolate Bacillus sp. TPR71H CGTase activity was measured as 30.34U/mL production at substrate concentration less than 1 irrespective of the incubation time (Ravinder et al., 2014). interval. The increasing substrate concentration increased the CGTase activity The comparative results of CGTase production suggested that the selected factors which reached to the maximum in the time range of 40-50 h and 1.5 to 2.5 % potato profoundly influence the enzyme production and their interactions triggered the starch concentration range (Figure 3H). Figure 3I, shows that the agitation speed enzyme activity to reach the optimal level. The optimization study using the in the range from 200 to 250 rpm increased CGTase activity during the incubation statistical approach of CCD generated encouraging and accurate results to enhance time of 40 to 50 h when other factors were set to their standard levels. The the enzyme production in bacterial isolate SS2. interaction analysis of potato starch concentration and agitation speed revealed that the incorporation of 1.5 to 2.5% potato starch to the culture medium followed by
163
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
Figure 3 Three- dimensional Graphs showing interactions between: (A). pH and temp (B). pH and incubation time (C). pH and potato starch conc. (D). pH and agitation speed (E). Temp and incubation time (F). Temp and potato starch conc. (G). Temp and agitation speed (H). Incubation time and potato starch conc. (I). Incubation time and agitation speed (J). Potato starch conc. and agitation speed
CONCLUSION ribosomal RNA gene sequences. International Journal of Systematic and Evolutionary Microbiology, 57(10), 2259–2261. The isolate SS2 is a potent CGTase producer which can effectively produce an https://doi.org/10.1099/ijs.0.64915-0 enhanced amount of enzyme after optimization of the operating parameters. The Costa, H., Gastón, J. R., Lara, J., Martinez, C. O., Moriwaki, C., Matioli, G., & bacterium can produce the enzyme in a wide thermal and pH range using various Ferrarotti, S. A. (2015). Cyclodextrin glycosyltransferase production by free cells substrates. The main feature of isolate is the production of enzyme in alkaliphilic of Bacillus circulans DF 9R in batch fermentation and by immobilized cells in a conditions which make it suitable for both research and industrial applications. semi-continuous process. Bioprocess and Biosystems Engineering, 38(6), 1055– 1063. https://doi.org/10.1007/s00449-014-1347-6 Acknowledgement: We would like to acknowledge Jaipur National University, De Oliveira, C. C., de Souza, A. K. S., & de Castro, R. J. S. (2019). Bioconversion Jaipur and Shri A.N. Patel P.G. Institute, Anand, Gujarat, India for providing the of Chicken Feather Meal by Aspergillus niger: Simultaneous Enzymes Production infrastructural support for these studies. Using a Cost-Effective Feedstock Under Solid State Fermentation. Indian Journal of Microbiology, 59(2), 209–216. https://doi.org/10.1007/s12088-019-00792-3 REFERENCES Di Cagno, M.P. (2016). The Potential of Cyclodextrins as Novel Active Pharmaceutical Ingredients: A Short Overview. Molecules, 22(1), 1. Alves-Prado, H. F., Carneiro, A. A. J., Pavezzi, F. C., Gomes, E., Boscolo, M., https://doi.org/10.3390/molecules22010001 Franco, C. M. L., & da Silva, R. (2007). Production of Cyclodextrins by CGTase Elbaz, A. F., Sobhi, A., & ElMekawy, A. (2015). Purification and characterization from Bacillus clausii Using Different Starches as Substrates. Applied Biochemistry of cyclodextrin β-glucanotransferase from novel alkalophilic bacilli. Bioprocess and Biotechnology, 146(1-3), 3–13. https://doi.org/10.1007/s12010-007-8093-z and Biosystems Engineering, 38(4), 767–776. https://doi.org/10.1007/s00449-014- Atanasova, N., Kitayska, T., Bojadjieva, I., Yankov, D., & Tonkova, A. (2011). A 1318-y novel cyclodextrin glucanotransferase from alkaliphilic Bacillus pseudalcaliphilus Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the 20RF: Purification and properties. Process Biochemistry, 46(1), 116–122. bootstrap. Evolution, 39(4), 783-791. https://doi.org/10.1111/j.1558- https://doi.org/10.1016/j.procbio.2010.07.027 5646.1985.tb00420.x Bautista, V., Esclapez, J., Pérez-Pomares, F., Martínez-Espinosa, R. M., Camacho, Goel, A. and Nene, S. (1995). A Novel Cyclomaltodextrin glucanotransferase from M., & Bonete, M. J. (2012). Cyclodextrin glycosyltransferase: a key enzyme in the Bacillus firmus that Degrades Raw Starch. Biotechnology Letters, 17(4), 411-416. assimilation of starch by the halophilic archaeon Haloferax mediterranei. https://doi.org/10.1007/BF00130799 Extremophiles, 16(1), 147–159. Horikoshi, K. (2003). Alkaliphiles: Alkaline Enzymes and their Applications. https://doi.org/10.1007/s00792-011-0414-z Encyclopedia of Environmental Microbiology. John Wiley & Sons, Inc., New BeMiller, J. N., & Whistler, R. L. (Eds.). (2009). Starch: chemistry and technology. York. https://doi.org/10.1002/0471263397.env183 Academic Press. https://doi.org/10.1016/S1082-0132(08)X0009-3 Ibrahim, A.S., Al-Salamah, A.A., El-Tayeb, M.A., El-Badawi, Y.B., Antranikian, Biwer, A., Antranikian, G., & Heinzle, E. (2002). Enzymatic production of G. (2012). A novel cyclodextrin glycosyltransferase from Alkaliphilic cyclodextrins. Applied Microbiology and Biotechnology, 59(6), 609–617. Amphibacillus sp. NPST-10: purification and properties. International Journal of https://doi.org/10.1007/s00253-002-1057-x Molecular Sciences, 13, 10505-10522. https://doi.org/10.3390/ijms130810505 Chun, J., Lee, J.-H., Jung, Y., Kim, M., Kim, S., Kim, B. K., & Lim, Y.-W. (2007). Ibrahim, H.M, Yusoff, W.M.W., Hamid, A.A., Illias, R.M., Hassan, O., Omar, O. EzTaxon: a web-based tool for the identification of prokaryotes based on 16S (2005). Optimization of medium for the production of β-cyclodextrin
164
J Microbiol Biotech Food Sci / Upadhyay et al. 2020 : 10 (2) 159-165
glucanotransferase using Central Composite Design (CCD). Process Biochemistry, Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007). MEGAX: Molecular 40, 735-758. https://doi.org/10.1016/j.procbio.2004.01.042 Evolutionary Genetics Analysis (MEGA) software version X. Molecular Biology Jamuna, R., Saswathi, N., Sheela, R., Ramakrishna, S.V. 1993. Synthesis of and Evolution, 24, 1596-1599. https://doi.org/10.1093/molbev/msm092 cyclodextrin glucosyl transferase by Bacillus cereus for the production of Sreedharan, S.M., Singh, S.P. & Singh, R. (2019). Flower Shaped Gold cyclodextrins. Applied Biochemistry and Biotechnology, 43, 163-176. Nanoparticles: Biogenic Synthesis Strategies and Characterization. Indian J https://doi.org/10.1007/BF02916450 Microbiol, 59, 321–327. https://doi.org/10.1007/s12088-019-00804-2 Jansook, P., Ogawa, N., Loftsson, T. (2018). Cyclodextrins: structure, Upadhyay, D., Sharma, S., Shrivastava, D., Kulshreshtha, N.M. (2018). Production physicochemical properties and pharmaceutical applications. International and characterization of of β-cyclodextrin Journal of Pharmaceutics, 535(1-2), 272-284. glucanotransferase from Bacillus sp. ND1. Journal of Basic Microbiology, 59(2), https://doi.org/10.1016/j.ijpharm.2017.11.018 192-205. https://doi.org/10.1002/jobm.201800390 Kfoury, M., Lounès-Hadj, SA., Bourdon, N., Laruelle, F., Fontaine, J., Auezova, Vining, G.G. and Kowalski, S. (2010). Statistical methods for engineers. Cengage L., Greige-Gerges, H., and Fourmentin, S. (2016). Solubility, photostability and Learning. antifungal activity of phenylpropanoids encapsulated in cyclodextrins. Food Vinod, A. S., and More, S. M. (2016). Purification and Characterization of a Novel Chemistry, 196, 518-525. https://doi.org/10.1016/j.foodchem.2015.09.078 CGTase from Alkaliphilic Bacillus flexus Isolated from Lonar lake, India. Kimura, M. A. (1980). A simple method for estimating evolutionary rates of base International Journal of Current Microbiology and Applied Science, 5(7), 164– substitutions through comparative studies of nucleotide 170. https://doi.org/10.20546/ijcmas.2016.507.016 sequences. Journal of Molecular Evolution, 16, 111–20. Wu, D., Chen, S., Wang,N., Chen, J., Wu, J. (2012). Gamma-cyclodextrin https://doi.org/10.1007/BF01731581 production using cyclodextrin glycosyltransferase from Bacillus clarkii 7364. Kreig, R. N., & Holt, G. J. (1984). In Bergey’s Manualof Systematic Bacteriology, Applied Biochemistry and Biotechnology, 167(7), 1954-1962. William and Wilkins Co. https://doi.org/10.1007/s12010-012-9741-5 Kumar, P., Patel, S.K., Lee, J.K. and Kalia, V.C. (2013). Extending the limits of Bacillus for novel biotechnological applications. Biotechnology Advances, 31(8), 1543-1561. https://doi.org/10.1016/j.biotechadv.2013.08.007 Lee, M.H., Yang, S.J., Kim, J.W., Lee, H.S., Kim, J.W., Park, K.H. (2007). Characterization of a thermostable cyclodextrin glucanotransferase from Pyrococcus furiosus DSM3638. Extremophiles, 11, 537-541. https://doi.org/10.1007/s00792-007-0061-6 Leemhuis, H., Kelly, R. M., & Dijkhuizen, L. (2009). Engineering of cyclodextrin glucanotransferases and the impact for biotechnological applications. Applied Microbiology and Biotechnology, 85(4), 823–835. https://doi.org/10.1007/s00253- 009-2221-3 Montgomery, D.C., Runger, G.C. and Hubele, N.F. (2009). Engineering statistics. John Wiley & Sons. Park, C.S., Park, K.H., Kim, S.H. (1989). A rapid screening method for alkaline β- cyclodextrin glucanotransferase using phenolphthalein-methyl orange containing solid medium. Agricultural and Biological Chemistry, 53, 1167–1169. https://doi.org/10.1080/00021369.1989.10869443 Patel, S.K.S., Ray, S., Prakash, J. et al. (2019). Co-digestion of Biowastes to Enhance Biological Hydrogen Process by Defined Mixed Bacterial Cultures. Indian Journal of Microbiology, 59, 154–160. https://doi.org/10.1007/s12088-018-00777-8 Porwal, S., Kumar, T., Lal, S., Rani, A., Kumar, S., Cheema, S., Purohit, H.J., Sharma, R., Patel, S.K.S. and Kalia, V.C. (2008). Hydrogen and polyhydroxybutyrate producing abilities of microbes from diverse habitats by dark fermentative process. Bioresource Technology, 99(13), 5444-5451. https://doi.org/10.1016/j.biortech.2007.11.011 Qi, Q., and Zimmermann, W. (2004). Cyclodextrin glucanotransferase: from gene to applications. Applied Microbiology and Biotechnology, 66(5), 475–485. https://doi.org/10.1007/s00253-004-1781-5 Rajput, K.N., Patel, K.C., Trivedi, U.B. (2016). β-cyclodextrin production by cyclodextrin glucanotransferase from an alkaliphile Microbacterium terrae KNR 9 using different starch substrates. Biotechnology Research International, 7, 1–7. https://doi.org/10.1155/2016/2034359 Rashid, N., Cornista, J., Ezaki, S., Fukui, T., Atomi, H., Imanaka, T. (2002). Characterization of an archaeal cyclodextrin glucanotransferase with a novel C- terminal domain. Journal of Bacteriology, 184, 777-784. http://doi.org/10.1128/JB.184.3.777-784.2002 Ravinder, K., Prabhakar, T., Prashanthkumar K, Venuka N. (2014). Optimization of Process Parameters of Cyclodextrin Glycosyltransferase isolated from Novel Mutated Bacillus Sp. TPR71HNA6 by Taguchi Orthogonal Array Method. Research in Biotechnology, 5(3), 10-20. Reddy, S.V., More, S.S., Annappa, G.S. (2017). Purification and properties of β- cyclomaltodextrin glucanotransferase from Bacillus flexus SV1. Journal of Basic Microbiology, 57, 974–981. https://doi.org/10.1002/jobm.201700270 Saitou, N. and Nei, M. (1987). The neighbour-joining method: a new method for constructing phylogenetic trees. Molecular Biology and Evolution, 4, 406-425. https://doi.org/10.1093/oxfordjournals.molbev.a040454 Sharma, N. and Baldi, A. (2016). Exploring versatile applications of cyclodextrins: an overview. Drug Delivery, 23, 729–47. https://doi.org/10.3109/10717544.2014.938839 Sharma, K. M., Kumar, R., Panwar, S., Kumar, A. (2017). Microbial alkaline proteases: Optimization of production parameters and their properties. Journal of Genetic Engineering and Biotechnology, 15(1), 115–126. https://doi.org/10.1016/j.jgeb.2017.02.001 Staley, J. T. (1989). Bergey's manual of systematic bacteriology. Williams & Wilkins.
165
EVALUATION OF ANTI-CRYPTOCOCCAL ACTIVITY OF BACITRACIN
Neelabh and Karuna Singh*
Address(es): Department of Zoology, MMV, Banaras Hindu University, Varanasi-221005.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.176-181
ARTICLE INFO ABSTRACT
Received 14. 2. 2020 Cryptococcosis is amongst potentially deadly diseases whose impact has aggrandized with the advent of AIDS and antifungal resistance. Antifungals used presently are short of broad spectrum activity and furthermore are involved in several side effects. Henceforth, the Revised 10. 6. 2020 present manuscript focuses on the evaluation of antifungal activity of bacitracin against Cryptococcus neoformans var. grubii, the Accepted 11. 6. 2020 causative agent of the disease. Published 1. 10. 2020 Minimum inhibitory concentration, flow cytometric analysis and confocal microscopy were used to determine the in-vitro fungal susceptibilities. Light microscopy was used to determine the changes in the micromorphology of the fungal organism. Swiss mice were Regular article used for testing the efficacy of bacitracin in-vivo. Bacitracin showed cidal activity against C. n. grubii at 5.5 mg/ml which is on the higher side but on testing under in-vivo conditions it was observed that doses as high as 15 mg/kg bw/day did not show any adverse effect in the body. Better survival rate of the bacitracin treated mice, lowering of the fungal load and changes showing improvement in the tissue morphology depicts the mild anticryptococcal activity of bacitracin. Although, bacitracin has proved to be a potent antifungal yet there are several limitations like low bioavailability and its peptide nature. However, these problems can be limited by developing suitable analogs of the compound.
Keywords: Cryptococcus neoformans; Bacitracin, in-vitro; in-vivo
INTRODUCTION of bacitracin (Dickerhof et al. 2011). Endoplasmic reticulum houses PDI protein that functions as a molecular chaperone and aids in the folding of the enzyme by Since recent past an upswing in the field of drug development has been observed. catalyzing the formation, cleavage, and rearrangement of the disulfide bonds in However, the antifungal drug development scenario still requires a major boost. unfolded or misfolded proteins (Wilkinson and Gilbert, 2004, Freedman et al. Two major classes of the antifungals, polyenes and azoles, have side effects. 2002, Serve et al. 2012, Wang et al. 2015). Even the most commonly used antifungal amphotericin B results in electrolyte This study aims to evaluate the antifungal potential of bacitracin against C. imbalances and also nephrotoxicity (Clements et al. 1990, Enoch et al. 2006). neoformans var. grubii (ATCC 6352). Further, the development of resistance is also seen as a common problem in immunosuppressed hosts who received long term treatment (Saravolatz et al. MATERIALS AND METHODS 2003). Side effects and narrow spectrum activity of synthetic antifungals and cost effectiveness of plant based antifungals have lead to the search of other options In this study C. n. grubii (ATCC 6352) was used as the test organism. including antifungal peptides. Cryptococcus neoformans var. grubii (ATCC 6352) was kindly provided by Prof. The scientific fraternity along with the pharmaceutical giants are striving hard to S.M. Singh (Retd.), Department of Biological Sciences, Rani Durgavati develop new antifungals that could counter these dreadful diseases even though Vishwavidyalaya, Jabalpur, India. All the isolates were sub-cultured on the situation is becoming graver by the day. This can be attributed to the lesser Sabouraud’s Dextrose Agar (SDA) medium, incubated at 32°C for 48 hours number of available targets against the fungi owing to their eukaryotic nature. (Perfect, 2006) and used for further experimentation. Therefore, this argument intensifies the need to look for new antifungals which have a broad spectrum activity and lesser toxicity (Roemer and Krysan, 2014). In-vitro susceptibility testing The concept of compounds produced by bacteria that have antifungal activity is not new. Many reports on this idea have already been published (Weidman, The susceptibility of C. n. grubii against bacitracin (HIMEDIA, CMS208) was 1927, Waksman, 1941). According to them, bacitracin is one of the compounds tested by qualitative (Agar Disc diffusion and Broth macrodilution) as well as that effects bacteria and also has antifungal effect on some fungal pathogens. It is quantitative (Flow cytometry) assays. In each case amphotericin B (Trade name: a group of cyclic peptides produced on the multi-enzyme complex as a Amphotret procured from Bharat Serums) was used as positive control. component of the innate defence system of Bacillus licheniformis and Bacillus subtilis. It has unique property to interact with metals which affects its Minimum Inhibitory Concentration (MIC) by broth macrodilution method antibacterial activity. Significant stability at lower temperatures, acidic pH, (CLSI M27- A3) solubility in water and certain organic solvents are other noticeable properties of bacitracin (Johnson et al. 1945). The minimum inhibitory concentration (MIC90) of bacitracin was determined by Antibacterial activity of bacitracin is already known against gram positive cocci broth macro-dilution method. The stock solution of bacitracin in distilled water and bacilli, including Staphylococcus, Streptococcus, and Clostridium difficile as (220 mg/ml) was diluted with MOPS buffered RPMI to attain concentrations well as some Archaebacteria such as Methanobacterium, Methanococcus, and ranging from 22 mg/ml to 1.375 mg/ml and 200 µl of each concentration was Halococcus (Johnson et al. 1945, Meleney and Johnson, 1949, Mescher et al. dispensed in separate tubes. Fungal inoculum (1.8 ml) was then added in each 1974) but less is known about its antifungal activity (Chitarra et al. 2013). tube. For amphotericin B, a concentration range of 1.95 µg/ml to 125 µg/ml was Bacitracin works by inhibiting the interaction of the components of the employed. The tubes were incubated without shaking at 32°C for 48 hours. peptidoglycan i.e. (NAG and NAM) with bactroprenol pyrophosphate which Absorbance was taken using spectrophotometer (Thermo Scientific UV1). The normally carries them to the outer membrane for the building up of the cell wall experiment was performed in triplicate and standard error mean was calculated. in bacteria. However, in fungi, protein disulfide isomerase (PDI) can be a target
176
J Microbiol Biotech Food Sci / Neelabh and Singh 2020 : 10 (2) 176-181
Determination of fungicidal activity For fungal load determination tissue homogenates were prepared which were Confocal microscopy diluted with PBS in the ratio of 1:2.5 (CSF and Blood) and 1:2 (tissue homogenates) and were spread on SDA plates. Fungal load was calculated on the Fungal inoculum was prepared in Yeast Extract–Peptone–Dextrose (YPD) broth basis of colonies recovered/100 µl of tissue homogenate/CSF/blood. having a concentration of 0.5 McFarland and 900 ul of the same was added to control and experimental tubes. Then 100 ul of distilled water and bacitracin (5.5 Histopathology mg/ml) was added to the control and experimental tube respectively. After incubation at 32° C for 48 hours, both the tubes were centrifuged (6000 rpm for The tissue samples fixed in 10% neutral buffered formalin were dehydrated with 10 minutes). Subsequently, the pellet was re-suspended in 1:1 ratio (v/v) of DAPI different grades of ethanol and embedded in paraffin wax (60-62°C). The (20 ul/ml of a 1 mg/ml stock in PBS) and PI (20 ul/ml of 1 mg/ml stock in PBS) sections (5μm) were cut and stained with Haematoxylene-Eosin and Southgate’s simultaneously for 1 hour (Martinez et al. 2008). One drop of the above solution mucicarmine. was now placed on the Poly-L-lysine coated slides, mounted with DABCO and observed in the confocal microscope (Zeiss). Determination of level of circulating leucocytes through Differential cell count (DLC): Determination of minimum fungicidal concentration (MFC) by Flow Cytometry For DLC, blood was obtained from each mouse belonging to each group and a thin smear was prepared. After drying, the blood smears were stained with For flow cytometric analysis, 220 mg/ml, 110 mg/ml, 55 mg/ml, 27.5 mg/ml and Leishman’s stain. 13.75 mg/ml concentrations of bacitracin were added to the cell suspension prepared in YPD broth having 2x106 cells of C. n. grubii (ATCC 6352) diluting it Biochemical assays in the ratio of 1:9. Tubes were incubated in shaker incubator at 32° C for 24 hours. Centrifugation (6000 rpm for 10 minutes) was done in order to pellet down Protein content in the tissues was determined by Lowry’s method (Lowry et al. the cells followed by re-suspension in propidium iodide solution (25µg/ml in 1951) following which Malondialdehyde (MDA) assay (Ohkawa et al. 1979), phosphate-buffered saline) for a period of 30 minutes at 32°C. For sample Catalase activity (Aebi 1974) and Superoxide dismutase assay (Das et al. 2000) analysis, cell size (forward scatter of incident laser light) and propidium iodide were carried out. (PI) fluorescence intensity data were collected for 10,000 cells with a BD FACS cell sorter (Green et al. 1994). Readings were recorded in triplicate. Minimum Statistical analyses fungicidal concentration (MFC) was calculated by determining R2/R1 (Ratio of the dead cells to the living cells in a population of 10,000 cells). Statistical analyses have been performed wherever necessary using GraphPad Prism version 6.0. Micro-morphological study RESULTS The micromorphology of the cryptococcal cells was examined through direct microscopy after treating them with 5.5 mg/ml concentration of bacitracin for 24 In-vitro susceptibility hours followed by staining with lactophenol cotton blue. Minimum inhibitory concentration In-vivo studies The minimum inhibitory concentration of bacitracin against C. n. grubii (ATCC Animals 6352) was found to be 5.5 mg/ml. The minimum inhibitory concentration of amphotericin B was also calculated against the same fungus and was found to be Swiss mice (C3HHC-Strain) weighing approximately 26 gm were selected for 3.125 µg/ml (Table 1). experimental induction of cryptococcosis. The animals were fed ad libitum and photoperiod of a diurnal cycle was maintained. The experimental animals were Table 1 Minimum inhibitory concentration of bacitracin and amphotericin B divided into five groups (5 mice/group): immunocompetent control (ICC), against C. n. grubii (ATCC 6352). immunosuppressed control (ISC), immunosuppressed diseased induced (ISD), Fungal pathogen Bacitracin* Amp B* immunosuppressed treated with bacitracin (IST) and immunosuppressed treated C.n.grubii (ATCC 6352) 5.5 mg/ml (±0.827) 3.125 µg/ml(±0.531) with amphotericin B (ISTA). Animals were maintained in accordance with the *All readings are Mean ± SEM recommendations of Animal Ethical Committee of Banaras Hindu University.
Determination of fungicidal activity Inoculum preparation
Confocal microscopy The test inoculum was prepared by transferring 2-3 loopful of the C.n. grubii
(ATCC 6352) in 100 ml normal saline containing 0.05 mg m1-1 chloramphenicol. All the nucleated cells were stained with DAPI (blue) whereas all the dead cells The fungal suspension was shaken for one hour then filtered through sterilized were stained with propidium iodide (red). Confocal microscopy depicts the anti- muslin cloth. The test inoculum was adjusted to 2x106 cfu/ml using cryptococcal nature of bacitracin because a very high number of propidium haemocytometer. iodide stained cells can be observed in the experimental panel (Figure 1e) as
compared to the control panel (Figure 1b). Treatment Plan
Apart from the mice of the ICC group all the other mice were subjected to immunosuppression and disease induction (Singh et al. 2017). Following immunosuppression, all the experimental mice of disease induced and treated groups (ISD, IST and ISTA) were injected with 50 µl of inoculum intravenously (IV) (Zaragoza et al. 2007) till two weeks on each alternate day. At 15th day of experiment, mice of the IST group were treated with 15 mg/kg bw/day of bacitracin divided into 2 doses through intramuscular route. Additionally, the ISTA group mice were treated with 5 mg/kg of amphotericin B through the intravenous route. The animals were sacrificed after 5 weeks of inoculation. The mortality/survival was recorded for each group. Visceral organs of the mice were removed and cut into two halves. One half was proceeded for histopathology and the other half was used for biochemical studies and fungal load determination.
Survivalship curve
Kaplan-Meier plot was drawn by using Graph Pad Prism ver. 6.0 exhibiting the survival ship curve.
Fungal load determination Figure 1 Confocal micrographs of cryptococcal cells: (a) all the nucleated cells stained with DAPI; (b) all the dead cells stained with PI (untreated); (c) merged
177
J Microbiol Biotech Food Sci / Neelabh and Singh 2020 : 10 (2) 176-181
image of a & b; (d) all the nucleated cells stained with DAPI; (e) all the dead As the concentration of bacitracin increased from 1.375 mg/ml to 11 mg/ml cells stained with PI (treated with bacitracin) and (f) merged image of d & e. (Figure 2b, 2c, 2d and 2e), the number of cells in R2 (dead) region increased in comparison to the live cells (R1) region. There is less than 20% difference in the Determination of minimum fungicidal concentration % gated R2/R1 values of 11 mg/ml concentration and 5.5 mg/ml, therefore 5.5 mg/ml can be considered as the MFC of bacitracin against C. n. grubii (ATCC 6352) (Figure 2f).
Figure 2 Effect of bacitracin at (b) concentration 1.375 mg/ml; (c) 2.75 mg/ml; (d) 5.5 mg/ml; (e) 11 mg/ml; (a) Control and (f) Ratio of % gated R2/R1. increased (40%) after the treatment with bacitracin in case of IST group. In ISTA Micro-morphological study group 60% survival rate was observed (Figure 4).
Bacitracin induced minor changes in the cell morphology of C. n. grubii. The wrinkled cell wall of cryptococci suggests that yeast cells are in stress (Figure 3).
Figure 3 Effect of bacitracin on micromorphology of C. n.grubii (a) untreated (× 400) and (b) treated after 24 hours (× 400) (Lactophenol Cotton blue).
In-vivo studies Figure 4 Kaplan–Meier plot for percentage survival.
Morphological and behavioral observations Fungal Load determination
Morphologically, all experimental mice appeared normal. However, mice of No cryptococcal colonies were seen in the normal control (ICC) and the immune- disease induced group (ISD) showed ataxia and torticollis (clinical suppressed control (ISC) groups. The disease induced group (ISD), however, manifestations of cryptococcal meningitis). showed the highest number of colonies in all the organs along with CSF and blood (maximum in CSF and minimum in liver). Bacitracin treated group showed Survival curve a reduction in the number of cryptococcal colonies validating the efficacy of the peptide (Table 2). Kaplan Meier survivalship curve depicts that the ISD group had a 20% survival rate till the end of the experiment however this percentage was found to be
Table 2 Fungal load (no. of colonies recovered/100 µl). Tissue homogenate (1:2 PBS) CSF Blood (1:2.5 PBS) (1:2.5 PBS)
Groups Liver Lung Kidney Spleen Heart Brain Stomach ICC 0 0 0 0 0 0 0 0 0 ISC 0 0 0 0 0 0 0 0 0 ISD* 52±2 97±3 115±5 161±6 0 128±7 195±8 735±19 187±6 IST* 11±1 15±1 56±2 0 0 74±3 150±6 155±3 70±2 ISTA* 15±1 25±3 25±2 0 0 33±1 35±1 140±4 45±2 *Mean±SEM
178
J Microbiol Biotech Food Sci / Neelabh and Singh 2020 : 10 (2) 176-181
Histopathology normal control group. However, DLC profile of amphotericin B treated animals showed neutropenia and lymphocytosis (Figure 7). Liver
Liver of disease induced mice showed highly dilated sinusoidal spaces, the presence of erythrocytes, binucleated cells, pyknotic cells and hemorrhage (Figure 5b) whereas histopathological sections of liver of treated group showed binucleated cells and pyknotic cells along with signs of recovery like normal ICC sinusoidal spaces and less number of hemorrhage spots (Figure 5c). * #
* # * ISC *
Figure 5 TS of liver: (a) Control, HE ( × 100); (b) Arrow shows irregular ISD sinusoidal spaces in disease induced mouse, HE ( × 100) and (c) Recovery with signs of pathogenesis in bacitracin treated mouse, HE ( × 100).
Lungs IST
Lungs of disease induced mice exhibited broken bronchiolar walls (Figure 6.6b) Figure 7 Differential leucocyte count of control as well as experimental mice while the lungs of the treated group showed intact bronchiolar wall with some (ICC -Immunocompetent control; ISC -Immunosuppressed control; ISD- regions of hemorrhage (Figure 6c). Immunosuppressed disease induced; IST- Immunosuppressed treated with bacitracin and ISTA- Immunosuppressed treated with amphotericin B. Values are Mean ± SEM, (n = 5); *P<0.05 and #*P<0.0001 (Statistically significant compared with normal control, ICC : using GraphPad style).
Biochemical assays
The SOD levels of both, liver and lungs were found to be reduced in the ISD group when compared to the control group. The SOD levels of the IST and ISTA Figure 6 TS of lung: (a) Control, HE ( × 400); (b) Bronchiole destruction (ISD groups were found to be higher than the ISD group for both liver and lungs group), HE ( × 400) and (c) Hemorrhage, HE ( × 100). (Figure 8a). Likewise, level of catalase, in liver and lungs was found to be higher in ISD Determination of the level of circulating leucocytes through Differential group and lower in mice of IST and ISTA groups in comparison to disease Leucocyte count (DLC) induced group (Figure 8b). Similar to the catalase levels, an increase in the MDA levels was also observed in Lowering in the number of neutrophils and increase in the number of the ISD group which was found to be reduced in the bacitracin treated group lymphocytes was seen in the disease induced group (ISD) in comparison to the (IST) and amphotericin B treated group (ISTA) (Figure 8c). normal control group (ICC). However, on intramuscular treatment of bacitracin, the level of both neutrophils and lymphocytes became in consistence with the
* *
** * * *
a b
#*
c
Figure 8 Levels of biochemical enzymes: (a) Superoxide dismutase; (b) Catalase and (c) Malondialdehyde in the liver and lungs of Immunocompetent control (ICC), Immunosuppressed control (ISC), Immunosuppressed disease induced (ISD), Immunosuppressed treated (IST) and Immunosuppressed treated with amphotericin B. (ISTA).Values are Mean ± SEM, (n = 5); * P < 0.05, **P<0.01 and #* P<0.0001 (Statistically significant compared with normal control, ICC: using GraphPad style).
179
J Microbiol Biotech Food Sci / Neelabh and Singh 2020 : 10 (2) 176-181
DISCUSSION catalase levels were found to be higher in the disease induced group and lowered down to the levels of control after treatment with bacitracin depicting In the effort to conquer the increasing threat of infectious fungi to humans, improvement in the diseased condition. natural products from microbial sources appear to be the most favorable Apart from being recognized as an end product of the lipid peroxidation, alternatives to current antifungals. In this context a number of antifungal peptides Malondialdehyde (MDA) is also considered to be a biomarker for oxidative stress have been isolated from bacteria for example bacitracin, iturins, polymyxin, (Grotto et al. 2009). The results obtained in this study are in unanimity with the subtilisin and fengycin that have potent antifungal activity. humongous scientific literature available which suggests that diseased condition Studies focused on deciphering the mechanism of action of bacitracin suggest causes an increase in the MDA levels (Grotto et al. 2009). But after treatment that it inhibits the formation of the bacterial cell wall (Stone and Strominger, with bacitracin a lowering of the MDA levels was evident exhibiting a reduction 1971). In the present study, both the flow cytometric and confocal microscopic in the lipid peroxidation. analyses exhibit the cidal nature of bacitracin against C. n. grubii. However, the An antifungal entity obtained from Bacillus licheniformis, the same organism minimum fungicidal concentration of bacitracin was found to be 5.5 mg/ml from which bacitracin is obtained, was found to be effective against Curvularia which indeed is very high. But even at higher concentrations (15 mg/kg bw/day) spp., Alternaria spp., Aspergillus spp. (e.g., A. flavus, A. niger), Diplodia maydis, bacitracin was found to be well tolerated and caused no harm to the animals. Penicillium spp., Fusarium spp. (including F. moniliforme, F. oxysporum, F. Neutrophils and lymphocytes are integral components of the innate immunity, roseum), Helminthosporeum spp. (including H. maydis), Magnaporthepoae, and their levels can indicate the presence of any pathological condition in the Rhizopus spp. and Rhizoctonia solani (Neyra and Sadasivan, 1997). body (Celkan and Şirin Koç, 2015). In case of the disease induced group, Polymyxin B, a surface active bactericidal antibiotic, showed activity at relatively decrease in the neutrophil levels and increase in the level of lymphocytes was low concentrations against S. cerevisiae and C. albicans (Schwartz et al. 1972). observed. However after treatment the level of the neutrophils and lymphocytes Polymyxin was found to be more effective for S. cerevisiae than C. albicans. became in consistence with the control group suggesting recovery due to Newton and co-workers (1956) reported that a difference in the composition of treatment. the membrane phospholipid creates a difference in the antibacterial activity of Reactive oxygen species (ROS) exercises a broad range of biological impacts polymyxin (Newton, 1956). However, there are also reports where contrasting ranging from physiological regulatory functions to harmful changes involved in results were achieved for instance 45 clinical isolates of C. albicans were found the pathogenesis of growing numbers of illnesses (Alfadda and Sallam, 2012). to be non-susceptible to the activity of polymyxin and 12 isolates of C. tropicalis In this study the levels of the enzymatic markers of oxidative stress like SOD, were found to be susceptible for the drug (Hsu et al. 2017). Polymyxin also Catalase and MDA were evaluated to ascertain the role of bacitracin as a showed variable activity against the capsular and acapsular strains of C. therapeutic. The level of superoxide dismutase was found to be lowered in the neoformans (Zhai and Lin, 2012). However, in our case bacitracin, which is also diseased condition which was increased after the treatment with bacitracin. a product of Bacillus species (Bacillus licheniformis), exhibited a high MIC value Probably chronic cryptococcal infection leads to mitochondrial damage which (5.5 mg/ml) against C. n. grubii. disables the production of SOD resulting in low SOD value in disease induced Source organism, target fungal pathogens and MIC range of some antifungals condition (Traykova, 2013). peptides of bacterial origin have been summarized in table 3. Catalase plays a pivotal role in the conversion of harmful hydrogen peroxide (produced due to the ROS) into non-harmful water and oxygen (Sies, 1997). The
Table 3 Antifungal activity of peptides obtained from bacteria. Peptide Origin Target organism MIC range Reference AF3, AF4, AF5 Bacillus subtilis (RLID 12.1) 64 Candidal and 17 Cryptococcal isolates 2.83-3.31 µg/ml Ramachandran et al. 2018 Bacillomycin D Bacillus subtilis AU195 Fusarium oxysporum 6 µg for both Moyne et al. 2001 (analog 1 and analog analogs 2) Fengycin Bacillus subtilis F-29-3 Fusarium sp. 10 µg/ml Vanittanakom et al. 1986 Bacillomycin Bacillus subtilis Microsporum sp. 0.010 mg/ml Trichophyton sp. 0.010 mg/ml C. albicans 0.010 mg/ml Landy et al. 1948 Blastomyces dermatitidis(Mycelial) 0.0025 mg/ml Blastomyces dermatitidis (Yeast) 0.001 mg/ml Coccidiodes immitis 0.005 mg/ml Histoplasma capsulatum 0.005 mg/ml Bacillomycin F Bacillus subtilis strain 1164 Aspergillus niger 40 µg/ml Mhammedi et al. 1982 Neurospora crassa 80 µg/ml Penicillium chrysogenum 20 µg/ml Rhodotorula pilimanae 80 µg/ml Trichophyton mentagrophytes 20 µg/ml C.albicans 40 µg/ml C.tropicalis 40 µg/ml Saccharomyces cerevisiae 10 µg/ml Lipopetides Bacillus amyloliquefaciens F. oxysporum 250-750 µg/ml Singh et al. 2014 Cladosporium cladosporioides 750-2000 µg/ml Scopulariopsis Acremonium 125-500 µg/ml Trichophyton rubrum 750-2000 µg/ml Microsporum gypseum 125-500 µg/ml A. alternate 500-2000 µg/ml
Iturin B. pumilus HY1 A. flavus 52 µg/ml Cho et al. 2009
CONCLUSION Acknowledgement: The authors would like to thank Principal, Mahila In this study, bacitracin, a group of cyclic peptides produced by B. licheniformis Mahavidyalaya for providing the infrastructure facilities. The authors also wish was tested for its antifungal activity. It was found to have moderate anti- to thank DST-SERB, New Delhi for providing grant (EMR/2016/001396). One cryptococcal activity. Although, its in-vivo treatment was not found effective but of the authors, Neelabh would like to thank Indian Council of Medical Research the structural diversity it possesses will be helpful in the synthesis of its (ICMR) for providing Senior Research Fellowship. However, this fellowship was derivatives and design of its mimetics. not used in any way to fund this work. The authors are also thankful to Dr.
180
J Microbiol Biotech Food Sci / Neelabh and Singh 2020 : 10 (2) 176-181
Radha Chaube and Sandhya Sharma for photomicrography, Dr. Biplob Koch and Das, K., Samanta, L., & Chainy, G. B. N. (2000). A modified spectrophotometric Mr. Nishant Kumar Rana for flow cytometry studies. assay of superoxide dismutase using nitrite formation by superoxide radicals. Indian Journal of Biochemistry and Biophysics 37(3), 201-204. REFERENCES http://nopr.niscair.res.in/handle/123456789/15379 Stone, K. J., & Strominger, J. L. (1971). Mechanism of action of bacitracin: Clements, J. J., & Peacock, J. J. (1990). Amphotericin B revisited: reassessment complexation with metal ion and C55-isoprenyl pyrophosphate. Proceedings of of toxicity. The American journal of medicine, 88(5N), 22N-27N.doi na the National Academy of Sciences, 68(12), 3223-3227. Enoch, D. A., Ludlam, H. A., & Brown, N. M. (2006). Invasive fungal infections: https://doi.org/10.1073/pnas.68.12.3223 a review of epidemiology and management options. Journal of medical Celkan, T., & Koç, B. Ş. (2015). Approach to the patient with neutropenia in microbiology, 55(7), 809-818. http://dx.doi.org//10.1099/jmm.0.46548-0 childhood. Turkish Archives of Pediatrics/Türk Pediatri Arşivi, 50(3), 136. Saravolatz, L. D., Johnson, L. B., & Kauffman, C. A. (2003). Voriconazole: a https://doi.org/10.5152/TurkPediatriArs.2015.2295 new triazole antifungal agent. Clinical infectious diseases, 36(5), 630-637. Alfadda, A. A., & Sallam, R. M. (2012). Reactive oxygen species in health and https://doi.org/10.1086/367933 disease. BioMed Research International, 2012. Roemer, T., & Krysan, D. J. (2014). Antifungal drug development: challenges, https://doi.org/10.1155/2012/936486 unmet clinical needs, and new approaches. Cold Spring Harbor perspectives in Traykova, Does Oxidative stress causes decrease or increase in SOD activity?, medicine, 4(5), a019703. https://doi.org/10.1101/cshperspect.a019703 2013. Available Weidman, F. D. (1927). Laboratory aspects of epidermophytosis. Archives of at:https://www.researchgate.net/post/Does_Oxidative_stress_causes_decrease_or Dermatology and Syphilology, 15(4), 415-450. _increase_in_SOD_activity. Accessed on June 7, 2019. doi na https://doi.org/10.1001/archderm.1927.02370280031002 Sies, H (1997). Physiological society symposium: Impaired endothelial and Waksman, S. A. (1941). Antagonistic relations of smooth muscle cell function in oxidative stress. Experimental Physiology, 82(2), microörganisms. Bacteriological reviews, 5(3), 231. doi na 291-5. doi na Johnson, B. A., Anker, H., & Meleney, F. L. (1945). Bacitracin: a new antibiotic Grotto, D., Maria, L. S., Valentini, J., Paniz, C., Schmitt, G., Garcia, S. C., et al. produced by a member of the B. subtilis group. Science, 102(2650), 376-377. (2009). Importance of the lipid peroxidation biomarkers and methodological https://doi.org/10.1126/science.102.2650.376 aspects for malondialdehyde quantification. Quimica Nova, 32(1), 169-174. Meleney, F. L., & Johnson, B. A. (1949). Bacitracin. The American journal of http://dx.doi.org/10.1590/S0100-40422009000100032 medicine, 7(6), 794-806. https://doi.org/10.1016/0002-9343(49)90418-0 Neyra, CA, Sadasivan, L U.S. Patent No. 5,665,354, Washington, DC: U.S. Mescher, M. F., Strominger, J. L., & Watson, S. W. (1974). Protein and Patent and Trademark Office, 1997. doi na carbohydrate composition of the cell envelope of Halobacterium Schwartz, S. N., Medoff, G., Kobayashi, G. S., Kwan, C. N., & Schlessinger, D. salinarium. Journal of Bacteriology, 120(2), 945-954. doi na (1972). Antifungal properties of polymyxin B and its potentiation of tetracycline Chitarra, G. S., Breeuwer, P., Nout, M. J. R., Van Aelst, A. C., Rombouts, F. M., as an antifungal agent. Antimicrobial agents and chemotherapy, 2(1), 36-40. & Abee, T. (2003). An antifungal compound produced by Bacillus subtilis YM http://dx.doi.org/10.1128/AAC.2.1.36 10–20 inhibits germination of Penicillium roqueforti conidiospores. Journal of Newton, B. A. (1956). The properties and mode of action of the Applied Microbiology, 94(2), 159-166. https://doi.org/10.1046/j.1365- polymyxins. Bacteriological reviews, 20(1), 14. doi na 2672.2003.01819.x Hsu, L. H., Wang, H. F., Sun, P. L., Hu, F. R., & Chen, Y. L. (2017). The Dickerhof, N., Kleffmann, T., Jack, R., & McCormick, S. (2011). Bacitracin antibiotic polymyxin B exhibits novel antifungal activity against Fusarium inhibits the reductive activity of protein disulfide isomerase by disulfide bond species. International journal of antimicrobial agents, 49(6), 740-748. formation with free cysteines in the substrate‐binding domain. The FEBS https://doi.org/10.1016/j.ijantimicag.2017.01.029 journal, 278(12), 2034-2043. https://doi.org/10.1111/j.1742-4658.2011.08119.x Zhai, B., & Lin, X. (2013). Evaluation of the anticryptococcal activity of the Wilkinson, B., & Gilbert, H. F. (2004). Protein disulfide isomerase. Biochimica antibiotic polymyxin B in vitro and in vivo. International journal of et Biophysica Acta (BBA)-Proteins and Proteomics, 1699(1-2), 35-44. antimicrobial agents, 41(3), 250-254. https://doi.org/10.1016/j.bbapap.2004.02.017 https://doi.org/10.1016/j.ijantimicag.2012.11.006 Freedman, R. B., Klappa, P., & Ruddock, L. W. (2002). Protein disulfide Ramachandran, R., Shrivastava, M., Narayanan, N. N., Thakur, R. L., isomerases exploit synergy between catalytic and specific binding Chakrabarti, A., & Roy, U. (2018). Evaluation of antifungal efficacy of three new domains. EMBO reports, 3(2), 136-140. https://doi.org/10.1093/embo- cyclic lipopeptides of the class bacillomycin from Bacillus subtilis RLID reports/kvf035 12.1. Antimicrobial agents and chemotherapy, 62(1), e01457-17. Serve, O., Kamiya, Y., & Kato, K. (2012). Redox-dependent chaperoning, https://doi.org/10.1128/AAC.01457-17 following PDI footsteps. Proteomics Research Journal, 3(1/2), 69. doi na Moyne, A. L., Shelby, R., Cleveland, T. E., & Tuzun, S. (2001). Bacillomycin D: Wang, S., Park, S., Kodali, V. K., Han, J., Yip, T., Chen, Z., & Kaufman, R. J. an iturin with antifungal activity against Aspergillus flavus. Journal of applied (2015). Identification of protein disulfide isomerase 1 as a key isomerase for microbiology, 90(4), 622-629. https://doi.org/10.1046/j.1365-2672.2001.01290.x disulfide bond formation in apolipoprotein B100. Molecular biology of the Vanittanakom, N., Loeffler, W., Koch, U., & Jung, G. (1986). Fengycin-a novel cell, 26(4), 594-604. https://doi.org/10.1091/mbc.E14-08-1274 antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. The Perfect, J. R. (2006). Cryptococcus neoformans: the yeast that likes it hot. FEMS Journal of antibiotics, 39(7), 888-901. https://doi.org/10.7164/antibiotics.39.888 yeast research, 6(4), 463-468. https://doi.org/10.1111/j.1567-1364.2006.00051.x Landy, M. W. G. H., Warren, G. H., RosenmanM, S. B., & Colio, L. G. (1948). Clinical and Laboratory Standards Institute (CLSI), Reference Method for Broth Bacillomycin: an antibiotic from Bacillus subtilis active against pathogenic Dilution Antifungal Susceptibility Testing of Yeasts, Approved Standard, 2nd fungi. Proceedings of the Society for Experimental Biology and Medicine, 67(4), ed., NCCLS document M27-A3, 2008. doi na 539-541. https://doi.org/10.3181/00379727-67-16367 Martinez, S. C., Tanabe, K., Cras-Méneur, C., Abumrad, N. A., Bernal-Mizrachi, Mhammedi, A., Peypoux, F., Besson, F., & Michel, G. (1982). Bacillomycin F, a E., & Permutt, M. A. (2008). Inhibition of Foxo1 protects pancreatic islet β-cells new antibiotic of iturin group: isolation and characterization. The Journal of against fatty acid and endoplasmic reticulum stress–induced antibiotics, 35(3), 306-311. https://doi.org/10.7164/antibiotics.35.306 apoptosis. Diabetes, 57(4), 846-859. https://doi.org/10.2337/db07-0595 Singh, A. K., Rautela, R., & Cameotra, S. S. (2014). Substrate dependent in vitro Green, L., Petersen, B., Steimel, L., Haeber, P., & Current, W. (1994). Rapid antifungal activity of Bacillus sp strain AR2. Microbial cell factories, 13(1), 67. determination of antifungal activity by flow cytometry. Journal of Clinical https://doi.org/10.1186/1475-2859-13-67 Microbiology, 32(4), 1088-1091. doi na Cho, K. M., Math, R. K., Hong, S. Y., Islam, S. M. A., Mandanna, D. K., Cho, J. Singh, K., Rani, J., Rai, G. K., & Singh, M. (2017). The Southeastern Asian J., ... & Yun, H. D. (2009). Iturin produced by Bacillus pumilus HY1 from house mouse (Mus musculus castaneus Linn.) as a new passenger host for Korean soybean sauce (kanjang) inhibits growth of aflatoxin producing Cryptococcus neoformans var. grubii molecular type VNI. Medical fungi. Food Control, 20(4), 402-406. mycology, 55(8), 820-827. https://doi.org/10.1093/mmy/myx001 https://doi.org/10.1016/j.foodcont.2008.07.010 Zaragoza, O., Alvarez, M., Telzak, A., Rivera, J., & Casadevall, A. (2007). The relative susceptibility of mouse strains to pulmonary Cryptococcus neoformans infection is associated with pleiotropic differences in the immune response. Infection and immunity, 75(6), 2729-2739. https://doi.org/10.1128/IAI.00094-07 Lowry, O. H., Rosebrough, N. J., Farr, A. L., & Randall, R. J. (1951). Protein measurement with the Folin phenol reagent. Journal of biological chemistry, 193, 265-275. doi na Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical biochemistry, 95(2), 351-358. https://doi.org/10.1016/0003-2697(79)90738-3 Aebi, H. (1974). Catalase. In Methods of enzymatic analysis (pp. 673-684). Academic press. https://doi.org/10.1016/B978-0-12-091302-2.50032-3
181
EXPLORING THE METABOLICALLY ACTIVE RUMEN MICROBIOTA AND ITS FIBROLYTIC POTENTIAL IN CROSSBRED CATTLE FED ON FIBROUS DIET THROUGH METATRANSCRIPTOMICS
Lyju Jose V.1, 2, Ravi P. More3, Pradeep Kumar Malik4*, Atul Purushottam Kolte4, Shraddha Trivedi4, Sha Arun2, G. Thirumalaisamy, Raghavendra Bhatta4
Address(es): 1 Rumen Microbiology Laboratory, Animal nutrition Division, National Institute of Animal Nutrition and Physiology, Bangalore, India. 2 PhD Scholar, Department of Biotechnology, Jain University, Bangalore, India. 3 Bioinformatician, National Centre for Biological Sciences, Bangalore, India. 4 Energy Metabolism Laboratory, Bioenergetics and Environmental Sciences Division, National Institute of Animal Nutrition and Physiology, Bangalore, India.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.182-189
ARTICLE INFO ABSTRACT
Received 30. 4. 2019 The rumen wharves conglomerate of symbiotic fibrolytic microflora with the potential to produce repertoire of carbohydrate-active Revised 9. 6. 2020 enzymes to elicit the degradation of recalcitrant plant lignocellulosic complex into simpler forms that can be utilized by the host. A Accepted 11. 6. 2020 metatranscriptomics approach was adopted to explore the metabolically active microbiota and the transcripts involved in the Published 1. 10. 2020 deconstruction of lignocellulose in Indian crossbred cattle rumen. The experimental animals were fed with mixed diet for a period of twenty-one days and the total RNA was isolated from the rumen digesta using a modified total RNA extraction protocol. After mRNA enrichment, the cDNA libraries were subjected to sequencing under Illumina HiSeq platform and generated about 2.89 GB of raw Regular article sequences. The contig assembly was accomplished using two different tools and the redundant sequences were removed before further processing. A total of 133,930 orfs were predicted from the assembled contigs using MetaGeneMark tool and the taxonomic affiliation of orfs were achieved using MEGAN 6.0 Community Edition. A total of 17 bacterial, 5 eukaryotic and 1 archaeal phylum were identified from rumen metatranscriptomic dataset. Phylum Bacteroidetes were acknowledged as the most abundant and metabolically active rumen bacterial populations in cattle rumen with 36,414 orfs corresponding to it, followed by Firmicutes with 6,349 orfs. Further, MEGAN annotation of metatranscriptomic data at species level revealed that Prevotella brevis and Prevotella ruminicola as the most metabolically active bacterial populations representing 4,022 and 2,725 orfs each. The functional annotation of metatranscriptomic data using COG database revealed that a large number of transcripts (~16%) were corresponding to translation, ribosomal structure and biogenesis and carbohydrate transport and metabolism (15%). dbCAN annotation of rumen metatranscriptomic data identified and classified 5,267 transcripts belonging to 168 CAZyme families (GH-52%, GT-26%, CBM-14%, CE-6%, PL-2% and AA-0%). The microbial community analysis of the CAZyme encoding transcripts using M5NR database revealed that a significant proportion of CAZymes were contributed by genera Prevotella (37%) and Bacteroides (21%). The cattle rumen microbiome metatranscriptome analysis presented in this study facilitated the detection of large number of transcripts encoding diverse CAZymes that actively take part in the hydrolysis of plant lignocellulose complex that may be useful for improving livestock and biofuel generation.
Keywords: Rumen, Metatranscriptomics, ORFs, MEGAN, CAZymes
INTRODUCTION Advances in DNA sequencing technologies and bioinformatics are transforming our understanding of complex microbial ecosystems, particularly the Rumen-the foremost chamber in ruminant’s stomach-encompasses a plethora of gastrointestinal tract of mammals. The DNA based culture independent obligate anaerobic microorganisms including bacteria, archaea, fungi and techniques form the majority of rumen microbial community studies, as protozoa that are essential for the bioconversion of plant lignocellulosic biomass traditional culture dependent methods can symbolise approximately 11% of total into simpler forms that can be utilized by the host (Deng et al., 2008). The highly microbiota (Fernando et al., 2010). Likewise, the sequencing of genomes from complex and diverse microbiota present in the rumen has evolved into a several cultured rumen bacterial and archaeal species is providing detailed symbiotic association with the host and can produce a battery of lignocellulolytic information about their physiology (Nathani et al., 2015; Kelly et al., 2016). enzymes (CAZymes) that in turn hydrolyse the complex plant polysaccharides Lately, metagenomics, mainly aimed at understanding the rumen microbial and release volatile fatty acids and microbial proteins which are the major community structure and its enzymatic machinery involved in the degradation of sources of carbon, nitrogen and energy for the host (Purushe et al., 2010; plant structural polysaccharides brings new insights by allowing access to the Youssef et al., 2013). The rumen microbial community structure had been total community and overcoming the limitations imposed by cultivation and other subjected to extensive studies by various researchers and the results designate PCR based assays (Li 2015; Pitta et al., 2016; Jose et al., 2017). Studies on that the rumen bacteria play a central role in cellulolysis due to their numerical rumen fibrolytic microbial genomes revealed they harbor a wide range of predominance and metabolic diversity (Cheng et al., 1991). The rumen microbial carbohydrate-active enzymes belonging to different classes that act ecosystem has fascinated the scientific community due to their direct synergistically to deconstruct the dietary fibre (Wang et al., 2013; Ribeiro et al., involvement in both economically and environmentally significant traits like feed 2016). conversion efficiency in livestock (Nkrumah et al., 2008; Garg et al., 2013), While metagenomics brings an insight into the overall microbial and fibrolytic their impact on global warming due to methanogenesis (Zhou et al., 2009, potential of rumen microbial ecosystem, metatranscriptomics approach is O’Brien et al., 2014) and also the recent discovery about the potential of rumen considered to be more reliable in scrutinizing the metabolically dynamic microbes and its fibrolytic enzymes in the production of biofuels from cellulosic microbial communities and its functional transcripts encoding fibrolytic enzymes. biomass (Azman et al., 2015; Carrillo-Reyes et al., 2016). Since metatranscriptomic approach focuses on the transcripts that are getting
182
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
expressed at the time of sampling, it can bring light into the active metabolic and System (M/s Bio-Rad, USA) using Experion RNA StdSens Analysis Kit (M/s functional profile of a microbial community. Rumen metatranscriptomic studies Bio-Rad, USA). The total RNA was further quantified using Qbit fluorometer can provide a snapshot of the transcriptional profiles that correspond to the before processing (M/s Invitrogen, USA). discrete populations, which are not essentially the dominant populations within the ecosystem. Qi et al., in 2011 published the first ever rumen mRNA enrichment and Illumina library preparation metatranscriptomic study from musk oxen rumen but limited the study to the eukaryotic microbial communities. Recently, Li & Guan (2017) and Comtet- The total RNA samples were initially treated with MICROBExpress Bacterial Marre et al., (2017) adopted RNA-sequencing technologies to identify the mRNA Enrichment Kit (Thermo Fisher Scientific, Waltham, USA) to deplete the fibrolytic microbial communities in beef cattle and dairy cow, respectively. In ribosomal RNA and enrich the mRNA population. The metatranscriptome present study, metatranscriptomic sequencing approach was employed to provide libraries from the enriched mRNA were prepared using Illumina Truseq mRNA an insight into the metabolically active rumen microbiota and its lignocellulolytic Stranded Library Preparation Kit (Illumina, San Diego, USA) as per enzyme profiles in HF cross cattle fed mixed diet. manufacturer's instructions
MATERIALS AND METHODS Quality and quantity check of library, cluster generation and sequencing
Animal diet and rumen sample collection Library quantification was performed using Quant-iT dsDNA High Sensitivity Assay Kit, (Thermo Fisher Scientific, Waltham, USA). The amplified libraries The study was conducted in three fistulated Holstein Friesian (HF) crossbred were further analyzed in Bioanalyzer 2100 using High Sensitivity (HS) DNA cattle (BW 380±15 kg) maintained at the Experimental Livestock Unit (ELU) in chip (Agilent Technologies, Santa Clara, USA) as per manufacturer's the National Institute of Animal Nutrition and Physiology. All experimental instructions. After obtaining the Qubit concentration for the libraries and the procedures adopted in the study were approved by the local institute ethical mean peak size from Bioanalyzer profile libraries were loaded into Illumina committee. The animals were fed with finger millet straw, green fodder and HiSeq (2 x 250) platform for cluster generation and paired-end sequencing. The concentrate mixture in 60:30:10 for a period of twenty-one days. The ingredient library molecules bind to complementary adapter oligos on paired-end flow cell. composition of concentrate mixture is given in Table S1 & S2. The animals had The adapters are designed to allow selective cleavage of the forward strands after free access to water twice a day. On the last day of feeding trial, the rumen re-synthesis of the reverse strand during sequencing. The copied reverse strand digesta samples were collected through the rumen fistula, before morning feeding was used to sequence from the opposite end of the fragment. from all three experimental animals. The entire rumen digesta samples comprising both solid and liquid fractions were collected in cryovials and flash Metatranscriptomic contig assembly, rRNA and ORF prediction frozen in liquid nitrogen and immediately transported to the laboratory in a portable cool rack. The raw reads obtained were checked for its quality and the presence of adapter sequences using in-house Perl scripts. De novo assembly of high-quality PE reads Table S1 Composition of concentrate mixture were accomplished using 2 different algorithms- Metavelvet (Namiki et al., Ingredient Quantity (%) 2012) and CLC Genomics Workbench 7.0- at default parameters. Further, both Maize 37 the assemblies were combined, and the redundant sequences were removed to get the final set of transcripts. The statistical elements of the assemblies were GNC* 32 calculated by in-house perl scripts. The assembled contigs were analyzed against WB** 28 in-house RNA database using BlastN algorithm (Zhao & Chu, 2014) at Mineral mix# 2 similarity threshold 100% and E-value cut-off 1e-06, to identify the ribosomal salt 1 RNA reads. The contigs generated from metatranscriptomic data were also #DCP: 52.5%; Calcite: 20%; ZnSO4: 6.5%; CuSO4: 1%; MgO: 2.5%; NaCl: analysed against the SSU and LSU rRNA sequences in RDP database. The reads 17.5%, *GNC: Ground nut cake; **WB: Wheat bran that were matching with the rRNA database were considered as rRNA reads and other reads are considered as non rRNA or mRNA sequences. The open reading Table S2 Chemical composition of finger millet straw, para grass and frames (orfs) from the contigs were predicted using MetaGeneMark tool (Zhu et concentrate mixture al., 2010). The predicted orfs along with the rRNA reads were uploaded on MG- Chemical Concentrate Mixture Finger millet Paragrass RAST web server (Meyer et al., 2008) for further analysis.
composition Taxonomic affiliation and functional annotation of metatranscriptomic data (%) ++ Straw DM 91.71 92.84 29.5 The function based taxonomic affiliation for the transcripts was achieved using the MEGEN 6.0 Community Edition (CE) (Huson et al., 2016). The functional CP 20.49 4.87 8.9 annotation and homology search for the assembled transcript sequences were EE 1.14 1.88 2.0 performed against COG database proteins downloaded from the database NDF 27.96 74.32 72.5 (https://www.ncbi.nlm.nih.gov/COG/) (Galperin et al., 2015) using NCBI-blast ADF 17.20 44.75 38.9 2.2.29 for homology search between the sequences. Total ash 3.52 6.88 8.1 COG annotation, Gene ontology and WEGO (Web Gene Ontology ++ On dry matter basis except for dry matter Annotation Plot) analysis
RNA extraction and purification The functional annotation and homology search for the assembled transcript sequences were performed against COG (cluster of orthologous genes) database The total RNA was isolated from the rumen digesta samples on the same day. All ° proteins downloaded from the database (https://www.ncbi.nlm.nih.gov/COG/) centrifugation steps were performed at 20 C until and otherwise specified. The using NCBI-blast2.2.29 for homology search between the sequences. COG frozen rumen digesta samples were crushed in liquid nitrogen using a motor and analysis (Galperin et al., 2015) was performed to classify the transcripts pestle and all three samples were pooled together. Into the pooled rumen digesta according to their homologous relationships from the assembled transcripts from sample, 1 ml of TRIzol reagent (M/s Thermo Fisher Scientific, USA) was added. the cattle rumen metatranscriptomic data. The functional gene ontology (GO) The sample was transferred to 2 ml screw cap tube containing 0.1 g of acid annotation of rumen metatranscriptomic dataset set was performed using washed 0.1mm glass beads and 0.1mm zirconia beads (M/s Biospec products, BLAST2GO tool (Götz et al., 2008) and the GO annotation results were further USA) and subjected to bead beating (2 x 1 minutes at room temperature, 2 min in analyzed using WEGO program (Ye et al., 2006), to classify the protein encoding ice flakes between bead beating) using a Mini-Beadbeater (M/s Biospec products, transcripts under three major functional classes viz. cellular location, molecular USA). The homogenate was then centrifuged at 5,000 rpm for 10 min. The function and biological process. Since the WEGO web tool can process only one supernatant was then transferred to a fresh 2 ml tube and centrifuged at 14,000 lakh GO annotation sequences, the output from BLAST2GO annotation were rpm for 10 minutes. The pellet obtained was then resuspended in 1 ml of TRIzol divided into two files and uploaded on WEGO server. The WEGO results from reagent (M/s Thermo Fisher Scientific, USA), mixed by pipetting and incubated two separate files were then merged and represented graphically. at 60 °C for 3 min. Then, 50 µL of lysozyme (500 μg/ml) (M/s Amresco, USA) ° was added, mixed by pipetting and incubated for 10 min at 37 C. The lysate CAZyme annotation and taxonomic assignment of CAZyme encoding obtained was further processed with RiboPure RNA Purification Kit (M/s transcripts Thermo Fisher Scientific, USA) as per manufacturer’s instructions. On Colum DNase treatment was performed using the RNase free DNase supplied along with To identify and classify different CAZyme families that are involved in the kit by adding 80 μl of PureLink DNase mixture to the spin cartridge and lignocellulose degradation in cattle rumen, the predicted orfs from the incubated at room temperature for 15 minutes. The quality and quantity of metatranscriptome data were further analyzed using a Pfam based Hidden isolated total RNA was checked using Experion Automated Electrophoresis
183
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
Markov Model (HMMs) in dbCAN database (Yin et al., 2012). The dbCAN was Table 1 Summary of NGS Illumina HiSeq metatranscriptomic sequencing data downloaded from dbCAN was downloaded statistics (http://csbl.bmb.uga.edu/dbCAN/download/CAZyDB.03172015.fa). The Sequencing parameters Data statistics predicted orfs were subjected to blastX search against the dbCAN sequences to Data in GB 2.98 identify and classify the metabolically active transcripts encoding different No of bases 47,043,232 CAZymes. The transcripts which showed resemblance with the dbCAN database Total no of reads 17,101,702 were then analyzed manually in detail to categorize them under different Total no of processed reads 16,645,780 CAZyme families. The transcripts encoding principal plant cell-wall degrading Mean GC content 52±10% enzymes were extracted from the metatranscriptomic dataset using Perl scripts. Artificial duplicate reads 1,431 1,431 Taxonomic affiliation of rumen metatranscriptomic sequences encoding cellulases, endo-hemicellulases, xyloglucanase, debranching and oligosaccharide Total no of contigs 143,666 degradation enzymes that are predominantly involved in the hydrolysis of plant Minimum Contig length 200 polymers were determined using M5NR database on MG-RAST server v3.2 Post QC sequence count 137,278 (Meyer et al., 2008). The CAZymes encoding transcripts identified through Maximum Contig length 8,539 metatranscriptomic approach in present study was also compared with other Average Contig length 327± 177 bp publically accessible herbivore metagenomes and metatranscriptomes. 47,043,232 (47.0 Total Contig length MB) Metabolic pathway predictions from rumen metatranscriptomic data Number of ORFs predicted 133,930 The protein coding regions that were predicted from rumen metatranscriptomic Contigs > 100 b 143,666 dataset were analyzed using KEGG Mapper tool. The occurrence of enzymes that Contigs > 500 b 12,669 are part of different key metabolic pathways in carbohydrate metabolism Contigs > 1 Kb 1,467 (glycolysis, starch and sucrose metabolism) was predicted using KEGG-Mapper rRNA contigs 1,419 tool (Kanehisa et al., 2011). Taxonomic mining using MEGAN RESULTS AND DISCUSSION Generally, the 16S and 18S rRNA reads obtained during metatranscriptome Metatranscriptome sequencing from cattle rumen digesta samples sequencing is widely used for the taxonomic mining of microbial communities from diverse ecosystems. A similar strategy was also adopted by the earlier Rumen-the foremost chamber in ruminant’s stomach, encompasses a plethora of reports from rumen metatranscriptome studies (Dai et al., 2015; Comtet-Marre obligate anaerobic microorganisms including bacteria, archaea, fungi, and et al., 2017). The main reason for this can possibly be the presence of higher protozoa that are essential for the bioconversion of plant lignocellulosic biomass proportion of the rRNA reads in total metatranscriptomic data sets, despite into simpler forms that can be utilized by the host (Deng et al., 2008). The highly performing either an mRNA enrichment or rRNA gene removal step. This is complex and diverse microbiota present in the rumen has evolved into a probably the first cattle rumen metatranscriptome study which reports ~99% of symbiotic association with the host and can produce a battery of lingocellulolytic reads were corresponding to coding sequences (mRNAs) rather than rRNAs. This enzymes (CAZymes) that in turn hydrolyze the complex plant polysaccharides was accomplished using a modified and highly efficient total RNA isolation and release volatile fatty acids and microbial proteins which are the major protocol adopted in present study from rumen digesta sample which ensured the sources of carbon, nitrogen, and energy for the host (Youssef et al., 2013). The isolation of intact rRNAs-the degraded rRNAs cannot be removed efficiently microorganisms residing in the rumen execute numerous critical biochemical since the probe will not bind efficiently to degraded rRNAs- that were removed processes that are advantageous to the host. These include the fibrolytic during mRNA enrichment, resulting in large number of mRNA transcript responses and the mechanisms that change over the recalcitrant plant polymers sequences. In a recent metatranscriptomic study on cow rumen by Dai et al. into short-chain unsaturated fats and vitamins and furthermore the detoxification (2015), a total of 75% of mRNA reads were obtained, after performing an of secondary compounds in the plant feed to a specific degree. Plant additional rRNA removal step. Due to the presence of substantially lower number lignocellulosic biomass encompasses cellulose and hemicellulose making it a rich of reads from rRNA genes in present study, they were excluded from further source of renewable energy (Sheehan & Himmel, 1999). The primary objective analysis and the coding sequences (mRNA reads) were used for the prediction of of our study was to provide an insight into the transcripts involved in the metabolically active cattle rumen microbiome using MEtaGenome ANalyzer deconstruction of plant cell wall polysaccharides and to identify the metabolically (MEGAN) Community Edition. active bacterial communities residing in the rumen. The plateau shown in the The metabolically active rumen microbial communities were predicted from the rarefaction curve (Supplementary file 4) after cattle rumen metatranscriptome orfs generated from rumen metatranscriptomic data, using MEGEN 6.0 sequencing in present study indicates that the sample had been sequenced to Community Edition (Huson et al., 2016) (https://ab. inf.uni- adequate depth to categorize maximum number of metabolically active tuebingen.de/software/megan6). A total of 133,930 protein coding sequences microbiota from the sample. from rumen metadata were used for MEGAN microbial community analysis. At domain level 51,235 orfs were corresponding to bacteria, 900 orfs with archaea, Rumen metatranscriptome data statistics 1,527 orfs with eukaryote, and 160 orfs were matching with viruses. A total of 203 orfs were falling under unclassified sequences whereas, the remaining 79,905 The Next Generation Sequencing of the rumen metatranscriptome sample using orfs could not be either assigned to any of the above class or had no similarity Illumina HiSeq platform generated ~2.98 GB of raw sequences comprising about hits during MEGAN analysis (Supplementary file 5). The microbial community 17,101,702 paired-end reads accounting a total of 47,043,232 bases. The de novo analysis of the annotated transcripts at phylum level could identify 17 different assembly of the raw sequences was performed using two different algorithms: (i) phyla under bacteria, 1 phylum under archaea and 5 phyla under eukaryota CLC genomics workbench 7.0 and (ii) MetaVelvet program (Namiki et al., domains. MEGAN analysis revealed the abundance of bacteria belonging to 2012) using the default parameters, except the minimum contig length. The phylum Bacteroidetes as the metabolically most active group of microorganisms minimum contig length was set at 100 bp in both the programs. The contigs in cattle rumen with 36,414 orfs corresponding to it. Similarly, phylum generated from both the assembly tools were merged together and the redundant Firmicutes were the second most predominant phyla with 6,349 orfs followed by data was removed before further processing. The metatranscriptomic data phylum Proteobacteria and Spirochaetes with 2,430 and 1,334 orfs, respectively, statistics were generated using in house Perl scripts. Out of 143,666 contigs that assigned to it. generated after de novo assembly, 6,388 contigs (4.4%) failed the QC pipeline. In depth analysis of rumen metatranscriptomic data at genus level displayed the Among these 1,431 sequences were identified as artificial duplicate reads and predominance of genera Prevotella (18,571 orfs), Bacteroides (5,053 orfs), therefore removed from further analysis. Among the sequences that passed QC Porphyromonas (680 orfs), Flavobacterium (658 orfs), Parabacteroides (640 1,419 sequences were identified as 16S rRNA gene sequences. A total of 133,930 orfs), and Fibrobacter (464 orfs) under phylum Bacteroidetes. Interestingly, 823 orfs were predicted from the metatranscriptomic dataset using MetaGeneMark orfs were affiliated with genus Treponema under phylum Spirochaetes. Under the tool (Zhu et al., 2010) (Table 1). phylum Firmicutes, genera Butyrivibrio, Ruminococcus and Clostridium were observed as the predominant group of bacteria with 749, 703 and 407 orfs, respectively. Strikingly, a large number of transcripts were assigned with unclassified Lachnospiraceae family (821 orfs) under the order Clostridiales and phylum Firmicutes. Under phylum Euryarchaeota, genera Methanoplanus and Methanolacinia were the largest group with signifying 114 and 109 orfs, respectively (Figure 1). Further MEGAN analysis of rumen metatranscriptome data revealed the metabolically active bacterial population in Indian crossbred cattle rumen at species level. Maximum numbers of orfs at species level were assigned to Prevotella brevis and Prevotella ruminicola with 4,022 and 2,725 orfs
184
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
respectively, consigned to it. Similarly, maximum number of orfs (275 orfs) was matching with Bacteroides fragilis under genus Bacteroides.
Figure 1 Taxonomic affiliation of rumen metatranscriptomic dataset using MEGAN. The cladogram showing the microbial diversity of Indian crossbred cattle rumen metatranscriptome sample at genus level along with the number of transcripts
The protein coding regions from the assembled contigs were predicted using the the rumen. The MEGAN analysis of microbial diversity was performed up to the GeneMark program and the taxonomic affiliation of predicted orfs from rumen species level. Under phylum Bacteroidetes, genus Prevotella was the most metatranscriptomic datasets using RefSeq protein database at domain level abundant and at species level Prevotella brevis was the most metabolically indicated that bacteria are highly abundant in cattle rumen and the majority of involved organism followed by Prevotella ruminicola. transcripts identified in the present study were assigned to bacteria. This result was in consistent with other published metagenomic studies from the authors Functional annotation of rumen metatranscriptome data (Jose et al., 2017a; 2017b) and other published metatranscriptomic study from the rumen. The taxonomic binning of the predicted orfs using MEGAN To reconnoitre the distribution of transcripts that involved in different Community Edition program unravelled the microbial communities that metabolisms and functional class, we assigned the contigs obtained from the contribute these transcripts. The results obtained in present cattle rumen cattle rumen metatranscriptomic data to COG database based on BLAST search. metatranscriptomic study are in parallel to the earlier metagenomic study Out of the 137,278 contigs that were analyzed, 49,117 contigs (about 36%) were conducted by the authors (Jose et al., 2017a) under the same feeding regimen annotated by COG database and the remaining contigs did not match with any were the maximum number of transcripts were corresponding to phylum sequences in COG data base. Among the COG annotated transcripts (49,117), Bacteroidetes. The results obtained from the metatranscriptomic analysis in our 88% of sequences were corresponding to 13 major functional classes. The study authenticate the abundance of this phylum in cattle rumen. The maximum functional annotation and classification of rumen metatranscriptomic dataset number of transcripts matching with phylum Bacteroidetes designates the role of based on COG database showed that maximum numbers of transcripts were different microbes belonging to this phylum in different metabolic activities in corresponding to translation, ribosomal structure and biogenesis (16% of
185
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
transcripts). Carbohydrate transport and metabolism was the second most Carbohydrate-Active enZyme (CAZyme) annotation of transcripts prominent metabolism representing about 15% of sequences. Transcripts belonging to cell wall/membrane/envelope biogenesis and amino acid transport To identify and annotate the transcripts encoding different classes of CAZymes and metabolism represented 8% and 7% of total annotated transcripts, from the Indian crossbred cattle rumen metatranscriptome dataset by the Pfam respectively. The pie chart depicting the COG functional class annotation and the based Hidden Markov Model (HMMs), the predicted open reading frames by the percentage level involvement of all major transcripts in diverse metabolisms are GeneMark program were analyzed using the dbCAN database (Yin et al., 2012) shown in figure 2a. (http://csbl.bmb.uga.edu/dbCAN/) using the default parameters. The results To explore the potential metabolisms involved in the rumen microbiome, the obtained were manually analyzed further to find the abundance of each CAZyme assembled contigs generated from our study was annotated with COG database. class in the rumen metatranscriptomic dataset. The dbCAN annotation of The reads that were obtained from rRNA genes were excluded from COG metatranscriptomic dataset could identify a total of 5,267 transcripts belonging to annotation. The search was done by using BLASTX program against COG 168 CAZyme families from different classes of CAZymes viz. glycoside database. Less than 50% of sequences obtained from metatranscriptomic dataset hydrolases, glycosyltransferases, carbohydrate-binding modules, carbohydrate could be annotated by COG database and the rest of the sequences could not esterases, auxiliary activities, and polysaccharide lyases. Among these diverse assign any of the functional classes in COG database. This could be primarily CAZyme families that were identified and classified from the transcripts, GHs because of the lack of an exclusive rumen microbial metatranscriptome database were the most abundant CAZyme class with 2,764 transcripts corresponding to for the data annotation and analysis. We also assume that the sequences that 84 GH families and they accounted about 52% of total CAZymes from cattle could not be assigned to any functions might code or represent novel dataset that rumen metatranscriptome. The transcripts belong to CAZyme class GTs were the are not reported so far. Transcripts encoding translation, carbohydrate, and second most abundant (1,346 transcripts) and 35 GT families were identified, and transport metabolism, and replication, recombination and repair were seen be the it represented about 26% of total CAZyme encoding transcripts. The transcripts prominent functional classes that identified in present study. COG annotation of encoding other major CAZymes classes like CBMs (23 families), CEs (12 metatranscriptomic data is widely being used for human gut microbiome studies families), PLs (8 families), and AAs (5 families) were represented by 738, 301, and quite surprisingly the above-mentioned metabolisms were also seen to be 108 and 10 transcripts, respectively (Supplementary file 7). dominant in a human gut metatranscriptomic study conducted by Gosalbes et al. Among the principal plant cell wall degrading GH families, 5 families (GH5, (2011). GH9, GH44, GH45, and GH48) are known for its exclusive cellulose degrading The Gene Ontology (GO) annotation of the predicted orfs followed by WEGO ability and these families signified a total of 1,466 transcripts in cattle rumen. analysis of GO terms revealed the diverse functional classes and categorized the Amongst these, the transcripts representing GH5 (108 transcripts) and GH9 (42 transcripts into three major groups viz. cellular component, molecular function transcripts) families encoding endo-β-1, 4-glucanases that hydrolyze the β-1, 4- and biological process. Under the cellular component category, maximum linked glucose residues from cellulose, were relatively high in number as numbers of transcripts were assigned to cell, cell part, macromolecular complex, compared to other cellulase encoding GH families. Transcripts encoding eleven and organelle related functions. Transcripts encoding the catalytic activity and GH families under the principal plant cell wall degrading category (GH8, GH10, binding functions were the most predominant under molecular functions set. GH11, GH12, GH26, GH28, GH51, GH53, GH54, GH67, and GH78) are Under the biological process category, the transcripts encoding metabolic process efficient endo-hemicellulose degrading and debranching enzymes and a total of were prominent followed by cellular process and establishment of localization. 410 transcripts were corresponded by these CAZyme families. dbCAN WEGO analysis displayed that the maximum number of transcripts in cattle annotation revealed the presence of number of transcripts encoding α-l- rumen was represented by catalytic activity and accounted about 16.2% of total arabinofuranosidases (GH51) (74 transcripts), α-glucuronidases (GH67) (9 predicted orfs from metatranscriptomic data (Figure 2b). transcripts) and, α-l-rhamnosidases (GH78) (30 transcripts), that efficiently involved in depolymerization of hemicellulose. A large number of transcripts (137 transcripts) encoding GH10 family and 8 transcripts encoding GH11 families representing endo-1,4-β-xylanase and endo-1, 3-β-xylanase that degrade the xylan main chains were also defined from the cattle rumen metatranscripts. Maximum number of principal plant cell wall degrading CAZymes encoding transcripts (about 60.5%) was identified under oligosaccharide degrading enzymes category and these were represented by 9 GH families (GH1, GH2, GH3, GH29, GH35, GH38, GH39, GH43 and GH94). Among these 3 GH families (GH2, GH3, and GH43) represented >50% of total CAZyme encoding transcripts that were identified in present study (Table 2). Although cellulose is chemically homogeneous in nature, it is highly resilient and cannot be hydrolyzed by a lone enzyme. It requires the synchronized or concerted action of an assemblage of enzymes or multi-enzyme complexes to break it down into simpler forms that can be utilized. Enzymatic degradation of cellulose is a slow and incomplete process in the rumen. The rumen microflora is competent of hydrolyzing only 60-65% of cellulose present in the feed (Flint et al., 2012). However, termites are affirmed to have almost 90% efficiency in breaking down this complex polymer (Breznak & Brune, 1994). In general, the process of cellulolysis is accomplished by the contemporaneous actions of three genre of enzymes: (i) endoglucanases (EC:3.2.1.4) that cleave the polymeric chain at random, (ii) exoglucanases that liberate D-glucose (EC:3.2.1.74) and D- cellobiose (EC:3.2.1.91) from β–glucan and cellodextrins, and (iii) β-
Figure 2a The functional annotation of rumen metatranscriptomic dataset glucosidases (EC:3.2.1.21) that release D-glucose from cellodextrins (Henrissat et al., 1998; Corpet et al., 1999). The cellulases that are mainly involved in the deconstruction of plant polymers are belonging to different families and they have different substrate specificities and mechanism of action of action. The efficient degradation or hydrolysis of plant cell wall polymers requires the synergistic action of many CAZyme families altogether (Lynd et al., 2002). Not surprisingly, our study on rumen microbial metatranscriptomics could identify transcripts representing a wide range of CAZyme families and it showed some substantial difference with the previous published rumen metatranscriptomic studies (Table 2). To the best of our knowledge, any previous rumen metagenomic and metatranscriptomic studies have ever reported any contigs or orfs belonging GH12 family. This is the first rumen metatranscriptomic study where we report the metabolically active transcripts belonging to GH12 family encoding xylanoglucanases in Indian crossbred cattle rumen ecosystem. The major differences among the transcripts that were reported in all three studies could be mainly due to (i) the difference in the geographical location (ii) diet (iii) mode of sampling and processing of samples (iv) analysis pipelines followed. In the very first rumen metatranscriptomic study conducted by Qi et al. (2011) on Muskoxen rumen and
Figure 2b WEGO analysis of cattle rumen metatranscriptomic dataset the second report by Dai et al. (2015) on cow rumen did not report any transcripts belong to this family. Similarly, many transcripts belonging to GH28, GH51, and GH78 families, which are mainly concerned with the degradation of
186
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
endo-hemicellulose, are also recognized in our study. Likewise, a higher debranching percentage of oligosaccharide degrading enzyme encoding families, GH2, GH3, GH8 endoxylanase 1.33 1.11 0.98 GH29, and GH43 were also identified. The presence of high degree of endo- endo-1,4-β- hemicellulose and oligosaccharide degrading enzyme encoding transcripts in our GH10 9.56 8.48 11.64 xylanases metatranscriptomic data set could be purely due to the dietary manipulations employed in our study and also due to the differences in sequencing platforms GH11 xylanases 0.56 4.78 7.38 and advanced analysis pipelines used in this study. Broadly, our study based on GH12 xyloglucanases 0.63 0.00 0.00 rumen metatranscriptome sequencing could identify and annotate comparatively β-mannase and GH26 0.63 3.12 2.13 larger proportion of endo-hemicellulose and oligosaccharide degrading enzymes xylanases families, indicating their abundance in cattle rumen ecosystem. Most of these GH28 galacturonases 6.56 1.26 0.16 enzyme families are the primary degraders that attack the side chains of plant endo-1,4-β- cell-wall polysaccharides. GH53 1.05 1.84 0.66 galactanases In one of the most recent publications about cow rumen metatranscriptome, Comtet-Marre et al. (2017), reported 96 GH, 14 CE, and 13 PL families. Present α-L- study on Indian crossbred cattle rumen could identify 84 GH, 12 CE and 8 PL GH51 arabinofuranosi 5.16 1.50 0.16 CAZyme families. In consistent with the earlier study, our samples also had the dases prevalence of CAZymes encoding transcripts targeting hemicellulose and α-L- oligosaccharides. The abundance of the later was also been reported in several GH54 arabinofuranosi 0.42 0.08 0.00 rumen metagenomic studies and by previous published studies by the authors dases (Brulc et al., 2009; Hess et al., 2011; Jose et al., 2017a). The lignolytic activities of most enzymes belong to diverse GH families is highly α-L- influenced by the catalytic modules CBM, as they can maintain the catalytic GH62 arabinofuranos 0.00 0.00 0.00 domain near the substrate. In the present study, a total of 23 CBMs were detected idases from cattle rumen metatranscriptome and among the CBMs identified CBM37 α- GH67 0.63 0.43 0.16 family represents the maximum number of transcripts (251). Ruminococcus albus glucuronidases is the only bacterial strain that is reported to have the ability to produce CBM37 α-L- enzymes and therefore facilitate the attachment of rumen bacteria to the substrate. GH78 2.09 1.80 0.82 rhamnosidases Therefore, the large number transcripts from CBM37 family suggest the contribution of this bacterium in rumen fibrolytic activities. Subtotal 28.61 24.40 24.09 Noticeably, the taxonomic assignment of the major CAZymes identified in the Oligosacchar present study revealed that most of them were contributed by a limited number of ide genera and typically by the numerically prominent genera. The taxonomic degrading affiliation of sequences encoding different cellulases, endo-hemicellulases, enzymes debranching and oligosaccharide degrading enzymes revealed that the microbes GH1 β-glucosidases 1.19 5.07 3.93 belonging to genera Prevotella, Bacteroides, Ruminococcus, Spirosoma, Plaudibacter, Parabacteroides, and Fibrobacter contribute a major proportion of GH2 β-galactosidases 13.54 6.01 1.97 these enzymes. These results are not surprising as the bacteria belonging to GH3 β-glucosidases 14.24 12.20 8.20 genera Prevotella and Bacteroides are proven to be numerically predominant and GH29 α-L-fucosidases 2.72 1.64 0.00 they encode diverse CAZyme families and therefore take part actively in the GH35 β-galactosidases 2.58 0.67 0.00 mechanism of plant cell-wall hydrolysis in the rumen. However, Dai et al. (2015) GH38 α-mannosidases 0.49 0.47 0.16 in their cow rumen metatranscriptomic study reported they found ~62% of GH39 β-xylosidases 1.33 0.37 0.00 cellulases were contributed by genera Ruminococcus, Eubacterium, and Fibrobacteres. Our results are contradictory to the earlier observation and were GH42 β-galactosidases 0.00 0.79 0.00 Arabino/xylosid we report the contributions from microbes belong to these genera were in much GH43 22.26 9.53 13.28 lower percentages than genera Prevotella and Bacteroides in the Indian crossbred ases cattle rumen. Cellobiose GH94 2.16 3.45 0.17 The chief plant cell wall-degrading transcripts that were identified in present phosphorylase cattle rumen metatranscriptomic study were compared with other published Subtotal 60.50 40.20 27.71 rumen metatranscriptomic and metagenomic datasets. Transcripts belonging to Total 100 100 100 twenty-four GH families were identified from the HF cross rumen metatranscriptome that were inferred to be involved principally in cell wall Table lists the percentages of different carbohydrate-active enzyme families polysaccharide degradation. The transcripts representative of GH43 family that targeting plant structural polysaccharides along with its principal activity. In encodes xylosidases was one of the largest enzyme families that were identified addition to enzymes belonging to glycoside hydrolases table shows the numbers in present study (Table 2). of two more proteins presumably involved in cellulosome mediated plant biomass conversion *CAZy database (http://www.cazy.org) Table 2 Comparative analysis of major plant cell wall degrading enzymes # a b belonging to different GH families identified from HF cross rumen with other Samples used in present study, Dai et al., (2015), Qi et al., (2011) large herbivore metatranscriptomes. Putative GHs are divided into different groups based on their major enzyme activities Phylogenetic analysis of CAZyme encoding transcripts CAZyme HF cross Holstein Muskoxen Major activity The primary plant cell wall degrading enzymes encoding orfs were extracted family* rumen# cowa rumenb from the metatranscriptomic datasets using perl scripts and the microbial Cellulases community analysis was performed using the M5NR database. A significant GH5 Cellulases 7.54 9.40 12.30 proportion of all these CAZyme classes were contributed by bacteria belonging GH6 Endoglucanase 0.00 0.35 9.02 to genera Prevotella and Bacteroides. About 37% of principal plant cell wall GH7 Endoglucanase 0.00 0.00 0.00 degrading CAZymes was contributed by genus Prevotella whereas 21% of GH9 Endoglucanase 2.93 13.71 8.52 CAZymes were contributed by genus Bacteroides. Present study also acknowledged the microbes belonging to the genus Spirosoma contributed about GH44 Endoglucanase 0.14 0.35 0.00 3% of CAZymes, and genera Paludibacter, Parabacteroides, Fibrobacter, GH45 Endoglucanase 0.00 3.94 9.51 Clostridium, and Opitutus produced about 2% CAZymes each, in Indian Cellobiohydrola GH48 0.28 7.65 8.85 crossbred cattle rumen. The figure showing the percentage level contributions ses principal plant cell-wall degrading CAZymes by different bacterial genera is Subtotal 10.89 35.40 48.20 given figure 3. Endo- hemicellulase
s and
187
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
Prevotella Bacteroides Ruminococcus 21% Spirosoma 1% Paludibacter 1% Parabacteroides 37% 1% Fibrobacter 1% Clostridium 1% Opitutus 1% 1% Propionibacterium 1% unclassified 2% Alistipes 2% Yersinia 2% Pedobacter 2% Eubacterium 2% Paenibacillus 2% Bacillus 3% 21% Others
Figure 3 Taxonomic affiliation of major plant cell wall degrading enzyme encoding orfs using M5NR database starch and sucrose metabolisms are shown in figure 4a and 4b. The presence of Metabolic pathways prediction using KEGG Mapper transcripts involved in TCA cycle, pentose phosphate pathway, and oxidative phosphorylation were also predicted using the KEGG Mapper tool The KEGG annotation and the metabolic pathway analysis using KEGG Mapper (Supplementary file 8a, 8b and 8c, respectively). The metabolic pathway analysis from the predicted orfs from the rumen metatranscriptomic dataset revealed the revealed that the Indian crossbred cattle rumen possess wide range of enzymes presence of different metabolic enzymes that were involved in the carbohydrate that actively take part in diverse metabolic pathways. metabolism. The metabolic pathways and the enzymes involved in glycolysis,
Figure 4a & 4b The KEGG mapper analysis indicating the occurrence of different key enzymes involved in glycolysis and starch and sucrose metabolisms
CONCLUSION REFERENCES
In nature, plant lignocellulose biomass remains mostly as an unexploited source Azman, S., Khadem, A. F., Van Lier, J. B., Zeeman, G., & Plugge, C. M. (2015). of renewable energy presumably due to its recalcitrant nature. Currently, only Presence and role of anaerobic hydrolytic microbes in conversion of limited understanding is available about the metabolically active rumen lignocellulosic biomass for biogas production. Critical Reviews in Environmental microbiome and transcripts involved in deconstruction of plant polysaccharides Science and Technology, 45(23), 2523-2564. from Indian crossbred cattle. The comprehensive rumen metatranscriptomic doi.org/10.1080/10643389.2015.1053727 approach used in present study brings an insight into the naturally active and Brulc, J. M., Antonopoulos, D. A., Miller, M. E. B., Wilson, M. K., Yannarell, A. functionally dynamic rumen microflora and its fermentation strategies in cattle C., Dinsdale, E. A., ... & Coutinho, P. M. (2009). Gene-centric metagenomics of rumen. Present study reports that, the bacteria belonging to phylum Bacteroidetes the fiber-adherent bovine rumen microbiome reveals forage specific glycoside and Firmicutes represent a significant proportion of functionally active rumen hydrolases. Proceedings of the National Academy of Sciences, 106(6), 1948- microbiome and Prevotella brevis and Prevotella ruminicola as the most 1953. . doi: 10.1073/pnas.0806191105 metabolically active rumen microbes residing in Indian crossbred cattle rumen. Carrillo-Reyes, J., Barragán-Trinidad, M., & Buitrón, G. (2016). Biological Unravelling the complex enzymatic phenomena behind the plant lignocellulose pretreatments of microalgal biomass for gaseous biofuel production and the bioconversion is a formidable challenge and hence the functional transcripts potential use of rumen microorganisms: A review. Algal research, 18, 341-351. corresponding to a large number of CAZyme families (168) reported in this study doi.org/10.1016/j.algal.2016.07.004 can be further reconnoitred for its potential applications in various industries and Cheng, K. J., Forsberg, C. W., Minato, H., & Costerton, J. W. (1991). Microbial also for the development of a sustainable bio-based economy. ecology and physiology of feed degradation within the rumen. In Physiological aspects of digestion and metabolism in ruminants (pp. 595-624). Academic Press. Acknowledgments:The authors are thankful to late Dr. A Thulasi for providing doi.org/10.1007/978-94-009-1453-7_12 the technical inputs to conduct the research work. The authors also would like to Comtet-Marre, S., Parisot, N., Lepercq, P., Chaucheyras-Durand, F., Mosoni, P., acknowledge Jain University, Bangalore for supporting the research program. Peyretaillade, E., ... & Forano, E. (2017). Metatranscriptomics reveals the active bacterial and eukaryotic fibrolytic communities in the rumen of dairy cow fed a mixed diet. Frontiers in microbiology, 8, 67. DOI:10.3389/fmicb.2017.00067
188
J Microbiol Biotech Food Sci / Lyju et al. 2020 : 10 (2) 182-189
Corpet, F., Gouzy, J., & Kahn, D. (1999). Recent improvements of the ProDom genome extracted from rumen metagenomic studies. Journal of molecular database of protein domain families. Nucleic Acids Research, 27(1), 263-267. microbiology and biotechnology, 25(4), 292-299. doi: 10.1159/000437265 doi: 10.1093/nar/27.1.263 Guan, L. L., Nkrumah, J. D., Basarab, J. A., & Moore, S. S. (2008). Linkage of Dai, X., Tian, Y., Li, J., Su, X., Wang, X., Zhao, S., ... & Wang, J. (2015). microbial ecology to phenotype: correlation of rumen microbial ecology to Metatranscriptomic analyses of plant cell wall polysaccharide degradation by cattle's feed efficiency. FEMS microbiology letters, 288(1), 85-91. doi: microorganisms in the cow rumen. Appl. Environ. Microbiol., 81(4), 1375-1386. 10.1111/j.1574-6968.2008.01343.x . doi: 10.1128/AEM.03682-14 O’Brien, M., Navarro-Villa, A., Purcell, P. J., Boland, T. M., & O’Kiely, P. Deng, W., Xi, D., Mao, H., & Wanapat, M. (2008). The use of molecular (2014). Reducing in vitro rumen methanogenesis for two contrasting diets using a techniques based on ribosomal RNA and DNA for rumen microbial ecosystem series of inclusion rates of different additives. Animal production science, 54(2), studies: a review. Molecular biology reports, 35(2), 265-274. 141-157. doi: 10.1071/AN12204 doi:10.1007/s11033-007-9079-1 Pitta, D. W., Indugu, N., Kumar, S., Vecchiarelli, B., Sinha, R., Baker, L. D., ... Fernando, S. C., Purvis, H. T., Najar, F. Z., Sukharnikov, L. O., Krehbiel, C. R., & Ferguson, J. D. (2016). Metagenomic assessment of the functional potential of Nagaraja, T. G., ... & DeSilva, U. (2010). Rumen microbial population dynamics the rumen microbiome in Holstein dairy cows. Anaerobe, 38, 50-60. during adaptation to a high-grain diet. Appl. Environ. Microbiol., 76(22), 7482- doi.org/10.1016/j.anaerobe.2015.12.003 7490. doi:10.1128/AEM.00388-10 Purushe, J., Fouts, D. E., Morrison, M., White, B. A., Mackie, R. I., Coutinho, P. Flint, H. J., Scott, K. P., Duncan, S. H., Louis, P., & Forano, E. (2012). Microbial M., ... & North American Consortium for Rumen Bacteria. (2010). Comparative degradation of complex carbohydrates in the gut. Gut microbes, 3(4), 289-306. genome analysis of Prevotella ruminicola and Prevotella bryantii: insights into doi:10.4161/gmic.19897 their environmental niche. Microbial ecology, 60(4), 721-729. doi: Galperin, M. Y., Makarova, K. S., Wolf, Y. I., & Koonin, E. V. (2015). 10.1007/s00248-010-9692-8 Expanded microbial genome coverage and improved protein family annotation in Qi, M., Wang, P., O'Toole, N., Barboza, P. S., Ungerfeld, E., Leigh, M. B., ... & the COG database. Nucleic acids research, 43(D1), D261-D269. doi: Forster, R. J. (2011). Snapshot of the eukaryotic gene expression in muskoxen 10.1093/nar/gku1223 rumen—a metatranscriptomic approach. PloS one, 6(5). doi: Garg, M. R., Sherasia, P. L., Bhanderi, B. M., Phondba, B. T., Shelke, S. K., & 10.1371/journal.pone.0020521 Makkar, H. P. S. (2013). Effects of feeding nutritionally balanced rations on Ribeiro, G. O., Gruninger, R. J., Badhan, A., & McAllister, T. A. (2016). Mining animal productivity, feed conversion efficiency, feed nitrogen use efficiency, the rumen for fibrolytic feed enzymes. Animal Frontiers, 6(2), 20-26. rumen microbial protein supply, parasitic load, immunity and enteric methane doi.org/10.2527/af.2016-0019 emissions of milking animals under field conditions. Animal Feed Science and Sheehan, J., & Himmel, M. (1999). Enzymes, energy, and the environment: a Tech strategic perspective on the US Department of Energy's research and nology, 179(1-4), 24-35. doi.org/10.1016/j.anifeedsci.2012.11.005 development activities for bioethanol. Biotechnology Progress, 15(5), 817-827. Götz, S., García-Gómez, J. M., Terol, J., Williams, T. D., Nagaraj, S. H., Nueda, doi:10.1021/bp990110d M. J., ... & Conesa, A. (2008). High-throughput functional annotation and data Wang, L., Hatem, A., Catalyurek, U. V., Morrison, M., & Yu, Z. (2013). mining with the Blast2GO suite. Nucleic acids research, 36(10), 3420-3435. doi: Metagenomic insights into the carbohydrate-active enzymes carried by the 10.1093/nar/gkn176 microorganisms adhering to solid digesta in the rumen of cows. PloS one, 8(11). Henrissat, B., Teeri, T. T., & Warren, R. A. J. (1998). A scheme for designating doi.org/10.1371/journal.pone.0078507 enzymes that hydrolyse the polysaccharides in the cell walls of plants. Febs Ye, J., Fang, L., Zheng, H., Zhang, Y., Chen, J., Zhang, Z., ... & Wang, J. (2006). Letters, 425(2), 352-354. doi: 10.1016/s0014-5793(98)00265-8 WEGO: a web tool for plotting GO annotations. Nucleic acids research, Hess, M., Sczyrba, A., Egan, R., Kim, T. W., Chokhawala, H., Schroth, G., ... & 34(suppl_2), W293-W297. doi:10.1093/nar/gkl031 Mackie, R. I. (2011). Metagenomic discovery of biomass-degrading genes and Yin, Y., Mao, X., Yang, J., Chen, X., Mao, F., & Xu, Y. (2012). dbCAN: a web genomes from cow rumen. Science, 331(6016), 463-467. doi: resource for automated carbohydrate-active enzyme annotation. Nucleic acids 10.1126/science.1200387 research, 40(W1), W445-W451. doi: 10.1093/nar/gks479 Huson, D. H., Beier, S., Flade, I., Górska, A., El-Hadidi, M., Mitra, S., ... & Youssef, N. H., Couger, M. B., Struchtemeyer, C. G., Liggenstoffer, A. S., Prade, Tappu, R. (2016). MEGAN community edition-interactive exploration and R. A., Najar, F. Z., ... & Elshahed, M. S. (2013). The genome of the anaerobic analysis of large-scale microbiome sequencing data. PLoS computational fungus Orpinomyces sp. strain C1A reveals the unique evolutionary history of a biology, 12(6). doi.org/10.1371/journal.pcbi.1004957 remarkable plant biomass degrader. Appl. Environ. Microbiol., 79(15), 4620- Breznak, J. A., & Brune, A. (1994). Role of microorganisms in the digestion of 4634. doi: 10.1128/AEM.00821-13 lignocellulose by termites. Annual review of entomology, 39(1), 453-487. Zhao, K., & Chu, X. (2014). G-BLASTN: accelerating nucleotide alignment by doi.org/10.1146/annurev.en.39.010194.002321 graphics processors. Bioinformatics, 30(10), 1384-1391. Jose, V. L., Appoothy, T., More, R. P., & Arun, A. S. (2017b). Metagenomic doi.org/10.1093/bioinformatics/btu047 insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle Zhou, M. I., & Hernandez-Sanabria, E. (2009). Assessment of the microbial fed finger millet straw. AMB Express, 7(1), 13. doi: 10.1186/s13568-016-0310-0 ecology of ruminal methanogens in cattle with different feed efficiencies. Appl. Jose, V. L., More, R. P., Appoothy, T., & Arun, A. S. (2017a). In depth analysis Environ. Microbiol., 75(20), 6524-6533. doi: 10.1128/AEM.02815-08 of rumen microbial and carbohydrate-active enzymes profile in Indian crossbred Zhu, W., Lomsadze, A., & Borodovsky, M. (2010). Ab initio gene identification cattle. Systematic and applied microbiology, 40(3), 160-170. doi: in metagenomic sequences. Nucleic acids research, 38(12), e132-e132. 10.1016/j.syapm.2017.02.003 doi.org/10.1093/nar/gkq275 Kanehisa, M., Goto, S., Sato, Y., Furumichi, M., & Tanabe, M. (2012). KEGG for integration and interpretation of large-scale molecular data sets. Nucleic acids research, 40(D1), D109-D114. doi: 10.1093/nar/gkr988 Kelly, W. J., Li, D., Lambie, S. C., Cox, F., Attwood, G. T., Altermann, E., & Leahy, S. C. (2016). Draft genome sequence of the rumen methanogen Methanobrevibacter olleyae YLM1. Genome Announc., 4(2), e00232-16. doi: 10.1128/genomeA.00232-16 Li, F. (2017). Metatranscriptomic profiling reveals linkages between the active rumen microbiome and feed efficiency in beef cattle. Appl. Environ. Microbiol., 83(9), e00061-17. doi.org/10.1128/AEM.00061-17 Li, R. W. (2015). Rumen metagenomics. In Rumen Microbiology: From Evolution to Revolution (pp. 223-245). Springer, New Delhi. doi.org/10.1007/978-81-322-2401-3 Lynd, L. R., Weimer, P. J., Van Zyl, W. H., & Pretorius, I. S. (2002). Microbial cellulose utilization: fundamentals and biotechnology. Microbiol. Mol. Biol. Rev., 66(3), 506-577. doi:10.1128/mmbr.66.3.506-577.2002 Meyer, F., Paarmann, D., D'Souza, M., Olson, R., Glass, E. M., Kubal, M., ... & Wilkening, J. (2008). The metagenomics RAST server–a public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC bioinformatics, 9(1), 386. doi: 10.1186/1471-2105-9-386 Namiki, T., Hachiya, T., Tanaka, H., & Sakakibara, Y. (2012). MetaVelvet: an extension of Velvet assembler to de novo metagenome assembly from short sequence reads. Nucleic acids research, 40(20), e155-e155. doi.org/10.1093/nar/gks678 Nathani, N. M., Kothari, R. K., Patel, A. K., & Joshi, C. G. (2015). Functional characterization reveals novel putative coding sequences in Prevotella ruminicola
189
PRODUCTION OF SYNBIOTIC PRODUCT CONTAINING GALACTO-OLIGOSACCHARIDES AND SACCHAROMYCES BOULARDII AND EVALUATION OF ITS IN-VITRO BIFIDOGENIC EFFECT
Farah Javed1, Zeshan Ali2, Sanaullah Iqbal*1, Naveed Ahmed3, Zubair Farooq1, Faiza Masood4 and Muhammad Nawaz4
Address(es): 1Department of Food Science and Human Nutrition, University of Veterinary and Animal Sciences, Lahore, Pakistan. 2College of Food Engineering and Nutritional Sciences, Shaanxi Normal University. Xi’an 710119, China. 3Department of Microbiology, Pakistan Kidney and Liver Institute and Research Center (PKLI & RC), Lahore, Pakistan. 4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.197-200
ARTICLE INFO ABSTRACT
Received 22. 12. 2019 The galacto-oligosaccharides and Saccharomyces boulardii are very useful for the intestinal microbiota. The yeast acts as probiotic and used for the reduction of monosaccharides from GOS mixture. The present study was concerned with the production of synbiotic Revised 2. 6. 2020 product from GOS and S. boulardii through transgalactosylation process. The GOS was produced from β-galactosidase (156 U/1 ml of Accepted 11. 6. 2020 lactose solution) of Kluyveromyces lactis using lactose (250g/L) as substrate at 37ºC. The GOS mixture was analyzed through thin layer Published 1. 10. 2020 chromatography and megazyme kit. The maximum production of GOS occurs after 5 hr at 37ºC with phosphate buffer (pH 6.5). The GOS mixture was treated with probiotic S. boulardii. The monosaccharides were reduced at 37ºC after 4 hrs using 300µl yeast/5 ml 4 Regular article GOS mixture. Then synbiotic product was formed and undergoes lyophilization procedure. The total yeast count was 3.9 × 10 CFU/g in lyophilized product. The in vitro bifidogenic effect was determined. Bifidobacterium shows more positive effect towards prebiotic and combined effect of prebiotic and probiotic as compared to Lactobacillus.
Keywords: GOS, Saccharomyces boulardii, Transgalatosylation, Synbiotic product
INTRODUCTION dietary supplement. It reduces the diarrhea, alleviates inflammatory diseases related to intestine, helpful in prevention of infection of Helicobacter pylori, The synergistic combination of prebiotic and probiotic is known as synbiotic. The inhibits the growth of pathogens (Geyik et al., 2006) and stimulates antibody prebiotic favors the probiotic and activates the host’s beneficial intestinal production against diarrhea causing toxin (Qamar et al., 2001). microflora (Underwood et al., 2009). The combination of oligofructose and In Pakistan there is no pharmaceutical and food industry which produces bifidobacteria is the example of symbiotic (Schaafsma, 2008). synbiotic such as combination of (GOS) and S. bulardii. Mostly GOS are Prebiotics are classified as those ingredients that are fermented and permit imported from Yakult central institute for microbiological research, Kunitachi, changes in composition and activity in the intestinal microbes that are beneficial Tokyo, Japan and Nissin sugar manufacturing Co Ltd. There is a need to produce to host. The examples are fructooligosaccharides (FOS), galactooligosaccharides synbiotic at commercial level in Pakistan due to its beneficial effects and (GOS), and inulin. The health benefits of prebiotic are prevention of diarrhoea or increasing demands. obstipation, modulation of the metabolism of the intestinal flora and cancer prevention. GOS are carbohydrates that are non-digestible and fermented by MATERIALS AND METHODS colon bacteria. They have great role in functional foods due to their benefits such as mineral absorption, role in lipid breakdown and anti-inflammatory All chemicals required in this research were of highest possible purity and were (Schaafsma, 2008), show less potential to dental caries. procured from (Merck, Germany) unless otherwise stated. The β-galactosidase GOS can be produced using lactose through transgalactosylation process with the from Kluveromyces lactis enzyme was purchased from Sigma Aldrich, UK. help of β-galactosidase enzyme. The transgalactosylation is a process in which Thymol (applichem, Germany), and Lactobacillus selective agar from (LAB, transgalacto-oligosaccharides (TOS) are produced by enzyme using lactose as Germany). substrate. The mono and disaccharides are also produced that are not required in prebiotic production. They are undesirable because they increase the caloric Transgalactosylation value of product by absorbing in small intestine. The hydrolysis of glycosidic bonds is done by β-galactosidase enzyme. Therefore, purity of GOS is necessary The transgalactosylation process was done with lactose (250g/L of phosphate from these byproducts. It helps to evaluate the functional properties of GOS such buffer). Different pH (5-7), enzyme concentration (156U/1 ml of lactose solution) as in vitro prebiotic activity and determination of structures (Hernandez et al., and time of incubation (0-5h) were optimized. The process was carried out at 2009). The GOS with less monosaccharides can be produced through several 37°C. methods which include size exclusion chromatography, activated charcoal treatment, diafilteration and yeast treatments. Hernandez et al. (2009) purified Analysis of GOS GOS using S. cerevisiae and removed all monosaccharides from mixture (Hernandez et al., 2009). Gaulas et al. (2007) examined the reduction of GOS was analyzed by thin layer chromatography (TLC). The glucose (GOPOD galactose with S. cerevisiae (Goulas et al., 2007). Kunova et al. (2011) removed Assay), galactose and lactose were measured using megazyme assay kits mono as well as disaccharides from GOS mixture through Lactobacillus (Wicklow, Ireland) following standard procedure given in manual. The GOS helveticus (Kunova et al., 2012). The chromatographic purification was done by mixture was analyzed through TLC using following method. The standards (Rodriguez Colinas et al., 2013). samples and samples obtained after transgalactosylation process (2µl) were The term probiotic is defined as microorganisms that are beneficial to host when applied on silica gel plate. The running buffer (n-butanol, n-propanol, ethanol, sufficient amount of which enters into small intestine. The examples of probiotics and distilled water) was used in ratio of 2:3:3:2, respectively. The staining buffer used in food are Lactobacillus reuteri, L. casei and L. acidophilus. (0.6% thymol, 95ml ethanol and 5 ml H2SO4) was sprayed on dried plate. The Saccharomyces bulardii is well known yeast which often used as probiotic and sugar stains were visible after 110°C heating in hot air oven.
197
J Microbiol Biotech Food Sci / Farah et al. 2020 : 10 (2) 197-200
Saccharomyces boulardii time of incubation (15 min-5h) was examined to obtain optimal time for the higher production of GOS. After 4hr maximum GOS was produced. At 2 or 3hr Biflor sachet (Bocodex) (250mg) was added in 50ml sabouraud dextrose broth very less quantity of GOS was produced. Therefore, 4hr was considered optimal aseptically and incubated at 37°C on shaking incubator for 3 days. for further experiments.
Removal of monosaccharides from GOS through S. boulardii Production of galacto-oligosaccharides
Different probiotic concentrations (100µl-400µl) were examined for the Lactose (250g/L) was used for the production of GOS. The high concentration of maximum removal of monosaccharides from GOS mixture. The effect of lactose facilitates the reaction of transgalactosylation. Lactose solution (10ml) different time of incubation (0-48 hr) was evaluated for removal of was used to optimize the all conditions. After optimization, the GOS was monosaccharides. After optimization the following procedure was performed. S. prepared using 500ml lactose (250g/L), lactose was dissolved in 50mM sodium boulardii (300µl) was added in 5ml of GOS solution. The reaction was carried on dihydrogen phosphate buffer (pH 6.5), and 1500µl enzyme. The reaction was 37ºC for 4 hr. The samlpe was heated at 90ºC for 5 min and centrifuged at 10000 carried on at 37ºC for 4hr at 150rpm. Initially, the glucose and galactose were rpm for 5 min. The supernatants were separated in eppendorfs. The analysis was formed as the reaction proceeded. As the reaction catalyzed further by enzyme, done through thin layer chramotgraphy (TLC) and megazyme kit. After the GOS were prepared. After the fourth hour the maximum GOS were produced, optimization conditions of transgalactosylation and monosaccharides removal, approximately 40% of total sugars present in the mixture. As the time was the synbiotic product was prepared. At the time of maximum amount of GOS, the increased the concentration of GOS was decreased because these are not product was freezed at -20°C followed by lyophilization. thermodynamically stable products. These are formed for very short interval of time. Lyophilization Analysis of GOS The product was frozen. After freezing, the product was placed under vacuum.Heat was applied to frozen product. Low temperature condenser plates Thin layer chromatography were allowed to convert it into solid (Sharma et al., 2019). Thin layer chromatography (TLC) was used various time to check the Total count of S. boulardii composition of GOS mixture produced at the end of transgalactosylation procedure. TLC was performed using lactose at different interval of time and The synbiotic (1ml) was taken in 9ml normal saline solution. Tenfold serial with different concentration of enzyme to optimize the conditions where dilutions were made in different seven test tubes. The sample (100µl) from each maximum GOS was produced. Figure 1 shows the TLC (10ml lactose solution test tube was separated on sabouraud dextrose agar (SDA) and was incubated at and 30µl enzyme concentrations). 37°C for 3 days. The plate containing 30-300 colonies was considered for colony forming unit (CFU). The CFU/g was calculated as follows;
CFU/g = No of colonies × dilution factor × 10
In vitro bifidogenic effect of GOS
Bifidogenic effect of GOS was checked in vitro by comparing with other sugars. The assays were done for each sugar and 10% w/v of the particular sugar was added aseptically. MRS broth was taken in five (labeled as 1, 2, 3, 4 and 5) sterilized test tubes containing 4 ml broth in each. In test tube 1 no sugar was added. It was treated as control. In test tube 2, GOS (10% w/v) was added. In test Figure 1 Thin layer chromatography (TLC) at 37ºC at different interval of time tube 3, 4 and 5 glucoses (10% w/v), lactose (10% w/v) and GOS treated with S. (15min–5hr) with 30µl enzyme per 10ml of lactose solution (pH 6.5). Production boulardii (10% w/v) respectively. of GOS is compared with standard solutions (20g/l glucose, 20g/l galactose, 20g/l Fecal sample of infant was used as a source of bifidogenic bacteria. For the lactose and 20g/l mixture of glucose, galactose and lactose isolation of bifidobacterium species, fresh infants stool specimens were suspended in sterile saline (9g of NaCl per liter), followed by tenfold dilutions in Quantification of GOS through megazyme kit the same suspension medium. Sample (100µl) of each dilution (e.g. 10-1 to 10-7) was pipetted onto MRS Agar + 0.05% cystiene (bifidus selective agar) and MRS The maximum GOS production was at ~75% lactose conversion after 4hr of Agar (lactobacillus selective Agar), which was then spread, inoculated and reaction. The final mixture contained 30% GOS, 30% D-glucose, 15% D- incubated anaerobically in anaerobic jar having anaerobe sachet at 37°C. A loop galactose and 25% untransgalactosylated lactose. full of the isolated bifidobacterium and lactobacillus cultures were inoculated in MRS broth in different test tubes with different sugars as illustrated in above Saccharomyces boulardii mentioned table. Cultivation was monitored at 37°C for 48hr anaerobically (Rossi et al., 2005). Growth of bacteria was checked by measuring optical Saccharomyces boulardii was produced using biflor sachet (250mg) grown in 50ml sabouraud dextrose broth aseptically at 37°C on shaking incubator for 3 density at OD600. days. The simple and negative staining was performed for the identification of Statistical Design the yeast. The various concentrations of probiotic (S. boulardii) were examined to check the optimal reduction of monosaccharides from GOS mixture. The The comparison between GOS and treated GOS with yeast will be done using T- probiotic concentrations were 100µl-400µl. The maximum reduction was test. The data regarding growth of bifidobacteria and lactobacilli will be occurred with 300µl probiotic in 5ml prebiotic solution (GOS mixture). analyzed by one-way ANOVA using SPSS version 18.0. P values ≤ 0.05 will be Therefore, 300µl culture of yeast was used for further experiments. Different considered significant. time of incubation (15min-5h) was evaluated to obtain optimal time for the highest reduction of monosaccharides from GOS mixture. After 4hr maximum RESULTS reduction was occurred. At 2 or 3hr very less quantity of glucose was reduced. Therefore, 4hr was considered optimum. Optimization conditions of transgalactosylation reaction Removal of monosaccharides from GOS through S. boulardii The effect of different pH of phosphate buffer on transgalactosylation process was recorded. The pH was adjusted from 5 to 7. The highest conversion of S. boulardii (300µl) was used for the removal of monosaccharides especially lactose occurs at pH 6.5 of phosphate buffer. At pH lower or higher than 6.5, glucose. The conditions were optimized using 5ml of GOS mixture. The reaction there is no or very mild transgalactosylation occur. The various concentrations of was carried on 37ºC for 4 hr. At the beginning of reaction, no glucose was enzyme were evaluated to check the optimal enzyme concentration at which removed. But with the passage of time, the glucose was reduced. The maximum maximum transgalactosylation process occur. The enzyme concentrations were reduction was occurred after 4 hr. The samlpe was heated at 90ºC for 5 min and 10µl-200µl. At equal concentration of lactose solution and enzyme concentration centrifuged at 10000rpm for 5 min. The supernatants were separated in (1:1), there is no production of galactooligosaccharides (GOS). The maximum eppendorfs. The analysis was done through thin layer chramotgraphy (TLC) GOS was produced with 30µl enzyme. As enzyme concentration increases (50µl- shown in. The synbiotic product containing GOS and S. boulardii was prepared. 200µl), the transgalactosylation process decreases. Hence, 30µl enzyme The product was lyophilized under the following conditions. concentration was considered optimal for further whole experiments. Different
198
J Microbiol Biotech Food Sci / Farah et al. 2020 : 10 (2) 197-200
DISCUSSION
The mixture of prebiotics and probiotics is known as Synbiotic product. The prebiotics enhance the growth of probiotic bacteria in the synbiotic product and also helpful for host’s microflora (Underwood et al., 2009). The present study is done to check either the combination containing galactooligosaccharde (GOS) and S. boulardii is more effective than the separate effect of prebiotics and probiotics. There is no review on the synbiotic at the clinical side as in formula fed term infants. Only the impact of prebiotics and probiotics has been examined Figure 2 Thin layer chromatography (TLC) for the reduction of monosaccharides in term of infants to prevent diseases (Osborn and Sinn, 2007). with time (15 min to 4 hr). Reduction of monosaccharidesis compared with The pronounced role of prebiotics has been determined through advanced standard solutions (20g/l glucose, 20g/l galactose, 20g/l lactose and 20g/l mixture research based on in vitro and in vivo studies. Now a day there is much awareness of glucose, galactose and lactose of prebiotics in nutritional and medical aspects. Prebiotics was first defined as non-digestible and fermented ingredients that allow specific changes in Colony forming unit of S. boulardii in lyophilized product composition and activity in the intestinal microflora that give benefits to host health (Sanders et al., 2019). GOS are transparent in nature, high soluble in The colony count of yeast in lyophilized synbiotic product was identified using water and more viscous than high fructose syrups. The sweetness of GOS is third 10-fold dilution procedure. The plate containing 39 colonies was selected time less than sucrose and has low potential to cause dental cares as determined because it was within the standard range i.e.; 30–300 colonies. The CFU/g was in in vitro studies (Kirsten et al., 2019). GOS can be added in several foods due calculated using following formula to its stability, good taste, ability to enhance texture and mouth feels of foods. Therefore, GOS and other prebiotics such as FOS are widely used for commercial purposes in infant formulas, dairy products, sauces, soups, breakfast CFU/g = No of colonies × dilution factor × 10 cereals, beverages, snack bars, ice creams, animal feeds, and as sugar replacements (Macfarlane et al., 2008). The physiochemical and physiological properties of GOS mainly depend on the CFU/g = 39 × 102 × 10 degree of polymerization and end products of transgalactosylation. The linkages formed in final products depend on the source of enzyme and conditions during 4 CFU/g = 3.9 × 10 the reaction. The galactosyl acceptor and active site of catalyst play a major role in formation of GOS mixture. β-galactosidase from microbial sources produces different linkages such as β-(1→3), β-(1→4), β-(1→6) and combination of these In vitro bifidogenic effect linkages. The β-galactosidase derived from Bacillus circulans and Cryptococcus laurentii has β-(1→4) linkage between two galactose units. While the β- The in vitro bifidogenic effect was studied for maximum production. Different galactosidase of Aspergillus oryazae and Streptococcus thermophilus produces sugars glucose, lactose, GOS, GOS treated with S. boulardiiwere examined after product having β-(1→6) linkages (Tzortzis and Vulevic, 2009). In present inoculation of Lactobacillus and Bifidobacterium. The values of control were research work β-galactosidase from Kluyveromyces lactis is used that containing 0.337 in case of Lactobacillus and 0.357 in case of Bifidobacterium. The higher β-(1→4) linkage (Kaplan and Hutkins, 2000). Due to these linkages GOS are results in terms Lactobacillus growth (p≤0.05) was with glucose (0.567). The resistant to adverse conditions of temperature and acidity. They remain stable at value of GOS treated with yeast (0.508) was closer to the value of glucose. It high temperature in acidic conditions even at 160ºC for 10 min at pH 7. GOS are showed that the synbotic product has good effect. The best results in terms also stable at room temperature in acidic environment even for long time. Due to Bifidobacterium growth was with GOS (0.433). In this case the value of glucose this property GOS can be used in beverages that stored at room temperature for (0.402) was less than that of both GOS and GOS treated with yeast (0.432). It several months (Leroy and De Vuyst, 2004). They are used as low caloric means that Bifidobacterium shows more positive effect towards prebiotic and sweeteners in fermented milk products, bread and beverages. The products of combined effect of prebiotic and probiotic as compared to Lactobacillus. transgalactosylation containing β-(1→6) linkage showed selectivity towards Bifidobacteria (Kaplan and Hutkins, 2000). 0,8 The production of GOS through β-galactosidaseenzyme using lactose as substrate 0,7 has been studied over the last 50 years because of its several functions as prebiotics (Yazdi et al., 2019). In present studies β-galactosidase was procured 0,6 from Sigma, Aldrich. 10ml of lactose solution (250g/L) was taken and 0,5 transgalactosylation process was performed to optimize the conditions. The 0,4 sampling was done at different interval of time and subjected to heat for 5 min at
OD600 OD600 90ºC to denature the enzyme. After that samples were analyzed through thin layer 0,3 chromatography (TLC) and megazyme kit. 0,2 The results in fig 1 show that transgalactosylation was occurred maximum after 4th hours of reaction. The lactose is converted in to various products. The 0,1 conversion of lactose can be easily seen in fig when compared to standards i.e.; 0 glucose, galactose, lactose and mixture of these three sugars. The lactose was control glucose lactose GOS GOS treated converted into GOS mixture by breaking β-linkages using 30 µl enzyme/10ml with yeast lactose solution at 37ºC for 4 hrs. sugars added to MRS broth + Lactobacillus sp In another study GOS was produced from β-galactosidase of Lactobacillusreuteri L103 andLactobacillus plantarum. The process was carried out at 37 ºC using Figure 3 Behavior of Lactobacillus sp. with different sugars in MRS broth. The lactose (600mM in 50mM sodium phosphate buffer, pH 6.5). MgCl2 (1mM) was standard error bars indicate standard deviation (±sd) among the three parallel also added in reaction mixture. The β-galactosidase activity was determined in replicates. The values differ significantly at a level ofp≤0.05 term of lactose unit (Ulac). The yield of GOS was 41% w/w of total sugars in case of L. plantarum and 36% w/w of total sugars in case of L. reuteri L 103. The 0,5 major components of GOS mixture were characterized using TLC, high 0,4 performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) and capillary electrophoresis (Splechtna et al., 2007a). 0,3 The production of GOS from purified recombinant β-galactosidase of 0,2 Lactobacillus sakei Lb790 was also examined. The process was carried out at 0,1 37ºC using 1.2 lactase U per ml of reaction mixture at 300rpm. The initial OD600 concentration of lactose was 215g/L. The lactose was dissolved in sodium 0 phosphate buffer (50mM, pH 6.5). After the reaction was completed, the GOS Control Glucose Lactose GOS GOS treated mixture was analyzed through TLC, (HPAEC-PAD) and capillary electrophoresis with S. (CE) (Splechtna et al., 2007b). boulardii The GOS mixture was produced by β-galactosidase of selected probiotic bacteria Sugars added to MRS broth + Bifidobacterium sp (Bifidobacterium bifidum BB-12, Bifidobacterium infantis DSM-20088, Figure 4 Behavior of Bifidobacterium sp. with different sugars in MRS broth. Bifidobacterium pseudolongum DSM-20099, Bifidobacteriium adolescentis B-7, The standard error bars indicate standard deviation (±sd) among the three parallel Bifidobacterium angulatum). When this mixture was analyzed through TLC, the replicates. The values differ significantly at a level of p≤0.05 different spectra were seen which was different from standard i.e. Oligomate 55.
199
J Microbiol Biotech Food Sci / Farah et al. 2020 : 10 (2) 197-200
In present study the GOS mixture was treated with probiotic (S. boulardii). The Kunová, G., Rada, V., Lisová, I., Ročková, Š., & Vlková, E. (2012). In vitro ferm conditions were optimized using 5ml of GOS mixture. S. boulardii (300µl) was entability of prebiotic oligosaccharides by lactobacilli. Czech Journal of Food Sci used. The reaction was carried on 37ºC for 4 hr. At the beginning of reaction, no ences, 29(Special Issue), S49–S54. http://dx.doi:10.17221/306/2011-cjfs glucose was removed. But with the passage of time, the glucose was reduced. Leroy, F., & De Vuyst, L. (2004). Lactic acid bacteria as functional starter cultur The maximum reduction was occurred after 4 hr. The samlpe was heated at 90ºC es for the food fermentation industry. Trends in Food Science & Technology, 15( for 5 min and centrifuged at 10000rpm for 5 min. The supernatants were 2), 67–78. http://dx.doi:10.1016/j.tifs.2003.09.004 separated in eppendorfs. The analysis was done through thin layer chramotgraphy Macfarlane, G. T., Steed, H., & Macfarlane, S. (2007). Bacterial metabolism and (TLC). health-related effects of galacto-oligosaccharides and other prebiotics. Journal of A study was showed by (Splechtna et al., 2007b) on the removal of glucose and Applied Microbiology, 0(0), 070907095856003–??? http://dx.doi:10.1111/j.1365- galactose from GOS mixture. The separation was done using the Unibead UBK- 2672.2007.03520.x 530 strongly acidic cation-exchange resin (Mitsubishi Chemical Industries). The Osborn, D. A., & Sinn, J. K. (2007). Prebiotics in infants for prevention of allergi sample was subjected to freeze dried and desalted. After that it was dissolved in c disease and food hypersensitivity. Cochrane Database of Systematic Reviews. h water. The sugars were approximately 70% (w/v) in solution. The 3.5ml of the ttp://dx.doi:10.1002/14651858.cd006474.pub2 solution was added to a column. The reaction was carried out at 70°C. The Qamar, A., Aboudola, S., Warny, M., Michetti, P., Pothoulakis, C., LaMont, J. T. sampling was done and analyzed through TLC, CE and HPAEC-PAD. Various , & Kelly, C. P. (2001). Saccharomyces boulardii Stimulates Intestinal Immunogl methods were used for the fractionation of oligosaccharides such as diafiltration, obulin A Immune Response to Clostridium difficile Toxin A in Mice. Infection a yeast treatment, activated charcoal adsorption. Many researchers used size nd Immunity, 69(4), 2762–2765. http://dx.doi:10.1128/iai.69.4.2762-2765.2001 exclusion chromatography for the separation of carbohydrates (Tzortzis et al., Rodriguez-Colinas, B., Kolida, S., Baran, M., Ballesteros, A. O., Rastall, R. A., 2005). After reduction of monosaacharides, the synbiotic product containing S. & Plou, F. J. (2013). Analysis of fermentation selectivity of purified galacto-olig boulardii and GOS was produced and lyophilized. The previous studies showed osaccharides by in vitro human faecal fermentation. Applied Microbiology and Bi that S. boulardii was preserved after lyophilization and used as treatment for otechnology, 97(13), 5743–5752. http://dx.doi:10.1007/s00253-013-4892-z gastrointestinal disorders. But there is no study that shows the combination of S. Rossi, M., Corradini, C., Amaretti, A., Nicolini, M., Pompei, A., Zanoni, S., & M boulardii and GOS in lyophilized form. This yeast is non-pathogenic and shows atteuzzi, D. (2005). Fermentation of Fructooligosaccharides and Inulin by Bifido its beneficial effects through several modes of action i.e. competition with bacteria: a Comparative Study of Pure and Fecal Cultures. Applied and Environm pathogens, inhibits pathogens from adhesion and neutralize the bacterial ental Microbiology, 71(10), 6150–6158. http://dx.doi:10.1128/aem.71.10.6150-6 virulence factors and toxins (Sougioultzis et al., 2006). 158.2005 The in vitro bifidogenic effect of sugars, GOS and synbiotic product was Sanders, M. E., Merenstein, D. J., Reid, G., Gibson, G. R., & Rastall, R. A. (2019 determined in present research work. Lactobacillus and Bifidobacterium were ). Probiotics and prebiotics in intestinal health and disease: from biology to the cli isolated from infant fecal sample on MRS agar through serial dilution method. nic. Nature Reviews Gastroenterology & Hepatology, 16(10), 605–616. http://dx. After isolation, one colony of each bacterium was inoculated in MRS broth in doi:10.1038/s41575-019-0173-3 two different set of test tubes containing glucose, lactose, GOS and GOS treated Schaafsma, G. (2008). Lactose and lactose derivatives as bioactive ingredients in with S. boulardii. The incubation was occurred at 37°C anaerobically for 48 hr. human nutrition. International Dairy Journal, 18(5), 458–465. http://dx.doi:10.10 Then, the growth of bacteria was checked spectophotometrically at OD600. 16/j.idairyj.2007.11.013 In case of Lactobacillus the OD values were 0.567 for glucose, 0.490 for GOS Sharma, P., Kessler, W. J., Bogner, R., Thakur, M., & Pikal, M. J. (2019). Applic and 0.508 for synbotic product. It shows that synbiotic product is more effective ations of the Tunable Diode Laser Absorption Spectroscopy: In-Process Estimati as compared to GOS. The OD values for Bifidobacterium were 0.402 for glucose, on of Primary Drying Heterogeneity and Product Temperature During Lyophiliza 0.433 for GOS and 0.432 for synbiotic product. It shows that the effect of GOS tion. Journal of Pharmaceutical Sciences, 108(1), 416–430. http://dx.doi:10.1016 and synbiotic product are almost same. /j.xphs.2018.07.031 Sougioultzis, S., Simeonidis, S., Bhaskar, K. R., Chen, X., Anton, P. M., Keates, CONCLUSION S., … Kelly, C. P. (2006). Saccharomyces boulardii produces a soluble anti-infla mmatory factor that inhibits NF-κB-mediated IL-8 gene expression. Biochemical The GOS was produced from β-galactosidase enzyme using lactose through and Biophysical Research Communications, 343(1), 69–76. http://dx.doi:10.1016 transgalactosylation. The maximum production of GOS occurs after 5 hr at 37ºC /j.bbrc.2006.02.080 with phosphate buffer (pH 6.5). The probiotic S. boulardii was grown and used Splechtna, B., Nguyen, T.-H., & Haltrich, D. (2007). Comparison between Disco for the treatment of GOS mixture. After that synbiotic product was developed ntinuous and Continuous Lactose Conversion Processes for the Production of Pre and subjected to lyophilized procedure. Then, total yeast count was determined. biotic Galacto-oligosaccharides Using β-Galactosidase fromLactobacillus reuteri. The in vitro bifidogenic effect was determined. Bifidobacterium shows more Journal of Agricultural and Food Chemistry, 55(16), 6772–6777. http://dx.doi:10 positive effect towards prebiotic and combined effect of prebiotic and probiotic .1021/jf070643z as compared to Lactobacillus. Splechtna, B., Nguyen, T.-H., Zehetner, R., Lettner, H. P., Lorenz, W., & Haltric h, D. (2007). Process development for the production of prebiotic galacto-oligosa Acknowledgments: We thank Amber Javid and Waqas Saleem from PKLI & ccharides from lactose using β-galactosidase fromLactobacillus sp. Biotechnolog RC for their assistance in preparing the manuscript and providing guidelines to y Journal, 2(4), 480–485. http://dx.doi:10.1002/biot.200600230 this work. We are also thankful to the Department of Microbiology, University of Tzortzis, G., Goulas, A. K., Gee, J. M., & Gibson, G. R. (2005). A Novel Galacto Veterinary and Animal Sciences for providing all the facilities related to this oligosaccharide Mixture Increases the Bifidobacterial Population Numbers in a C research. The content is solely responsibility of the authors ontinuous In Vitro Fermentation System and in the Proximal Colonic Contents of Pigs In Vivo. The Journal of Nutrition, 135(7), 1726–1731. http://dx.doi:10.1093/ REFERENCES jn/135.7.1726 Tzortzis, G., & Vulevic, J. (2009). Galacto-Oligosaccharide Prebiotics. Prebiotic Geyik, M. F., Aldemir, M., Hosoglu, S., Ayaz, C., Satilmis, S., Buyukbayram, H. s and Probiotics Science and Technology, 207–244. http://dx.doi:10.1007/978-0- , & Kokoglu, O. F. (2006). The Effects ofSaccharomyces boulardiion Bacterial T 387-79058-9_7 ranslocation in Rats with Obstructive Jaundice. The Annals of The Royal College Underwood, M. A., Salzman, N. H., Bennett, S. H., Barman, M., Mills, D. A., M of Surgeons of England, 88(2), 176–180. http://dx.doi:10.1308/003588406x9498 arcobal, A., … Sherman, M. P. (2009). A Randomized Placebo-controlled Comp 6 arison of 2 Prebiotic/Probiotic Combinations in Preterm Infants: Impact on Weig Goulas, T. K., Goulas, A. K., Tzortzis, G., & Gibson, G. R. (2007). Molecular clo ht Gain, Intestinal Microbiota, and Fecal Short-chain Fatty Acids. Journal of Pedi ning and comparative analysis of four β-galactosidase genes from Bifidobacteriu atric Gastroenterology and Nutrition, 48(2), 216–225. http://dx.doi:10.1097/mpg. m bifidum NCIMB41171. Applied Microbiology and Biotechnology, 76(6), 1365 0b013e31818de195 –1372. http://dx.doi:10.1007/s00253-007-1099-1 Yazdi, M., Hafezi, P., & Abbassi, R. (2019). A methodology for enhancing the Hernández, O., Ruiz-Matute, A. I., Olano, A., Moreno, F. J., & Sanz, M. L. (2009 reliability of expert system applications in probabilistic risk assessment. Journal ). Comparison of fractionation techniques to obtain prebiotic galactooligosacchari of Loss Prevention in the Process Industries, 58, 51–59. des. International Dairy Journal, 19(9), 531–536. http://dx.doi:10.1016/j.idairyj. http://dx.doi:10.1016/j.jlp.2019.02.001 2009.03.002 Kaplan, H., & Hutkins, R. W. (2000). Fermentation of Fructooligosaccharides by Lactic Acid Bacteria and Bifidobacteria. Applied and Environmental Microbiolog y, 66(6), 2682–2684. http://dx.doi:10.1128/aem.66.6.2682-2684.2000 Kirsten, M., Kimaro, D. N., Feger, K.-H., & Kalbitz, K. (2019). Impact of land us e on soil organic carbon stocks in the humid tropics of NE Tanzania. Journal of P lant Nutrition and Soil Science, 182(4), 625–636. http://dx.doi:10.1002/jpln.2018 00595
200
CHEMICAL COMPOSITION AND ANTIBACTERIAL ACTIVITIES OF HOMALOMENA VIETNAMENSIS BOGNER & V. D. NGUYEN (ARACEAE)
Hong Thien Van1*, Quang Phuc Nguyen1, Gia Buu Tran1, Nguyen Tuong An Huynh2
Address(es): Hong Thien Van, PhD. 1Institute of Biotechnology and Food-technology, Industrial University of Ho Chi Minh City, 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam. 2Office of Postgraduate Management, Industrial University of Ho Chi Minh City, 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.201-204
ARTICLE INFO ABSTRACT
Received 29. 11. 2019 Homalomena vietnamensis is a rare species of the Homalomena genus and only found in Middle region of Vietnam. In this study, we Revised 11. 6. 2020 found 10 compounds in ethanol extracts of leaf and rhizome of H. vietnamensis, such as cadinane-4β,5α,10α-triol, oplopanone, 4-epi- Accepted 11. 6. 2020 oplopananol, 2α-hydroxy homalomenol A, 1β,4β,7β-Trihydroxyeudesmane, homalomentetraol, 4-acetoxyoplopananol, 5,7-diepi-2a- Published 1. 10. 2020 acetoxyoplopanone, eudesma 4β, 7α- diol-1β-fumarate), and homalomenol F, via liquid chromatography-mass spectrometry (LC/MS). Moreover, the antibacterial activity of ethanol extracts of leaf and rhizome from this species has been evaluated by disc diffusion method for the first time. The results showed that rhizome extract of could inhibit the growth of 5 tested micro-organisms, including of Regular article Bacillus cereus (28.3 ± 1.5 mm), Salmonella enteritidis (19.5 ± 1.5 mm), Staphylococcus aureus (16.3 ± 1.5 mm), Escherichia coli (14.7 ± 1.2 mm), and Pseudomonas aeruginosa (8.2 ± 0.8 mm), while the leaf extract showed antibacterial effect against Bacillus cereus (22.0 ± 2.0 mm), S. enteritidis (14.7 ± 0.6 mm), and S. aureus (12.5 ± 1.8 mm).
Keywords: ethanol extracts, antibacterial activities, LC/MS, Homalomena vietnamensis
INTRODUCTION ethanol extracts of leaf and rhizome from this species for the first time, which will support the information for further application of this species in future. Homalomena Schott is a genus of the Araceae family and comprises of 250 species growing over the world (Boyce et al., 2012). Several members of the MATERIALS AND METHODS Homalomena genus are extensively used as traditional remedies in Vietnamese medicine (Pham, 2000). Chemical composition, antimicrobial and antioxidant Plant material activities of the compounds extracted from many species of Homalomena genus have been well-documented in literature (Singh et al., 2000; Rana et al., 2009; Specimens (leaves and rhizomes) of H. vietnamensis were collected from Nam Liliwirianis et al., 2011; Yang et al., 2016). For example, the essential oil of H. Tra My District, Quang Nam Province, location of about 15°07'22"N; aromatica contains 55 compounds, such as linalool, terpene-4-ol, δ-cadinene, T- 108°08'27"E, April 6, 2019, 426 m in elevation (Figure 1). muurolol, viridiflorol, α-cadinol, α-selinene, M-cymene, γ-Muurolene, and spatulenol… and exhibits a strong antifungal effect against dermatophytes and yeasts, such as Trichophyton rubrum, Trichophyton mentagrophytes, Microsporum fulvum, Microsporum gypseum, Trichosporon beigelii and Candida albicans (Policegoudra et al., 2012). Furthermore, H. aromatica oil also has antibacterial activity against five common and significant pathogens such as S. aureus, E. coli, P. aeruginosa, Klebsiella pneumoniae, and Proteus vulgaris (Laishram et al., 2006). These data suggest the essential oil of H. aromatica as a potential antimicrobial agent or the bioactive component of pharmaceutical preparations. According to Hu et al. (2008), some sesquiterpenoids from H. occulta, such as oplodiol, oplopanone, homalomenol C, bullatantriol, could stimulate osteoblast proliferation and differentiation, whereas chloroform extract and oplodiol enhance osteoblast mineralization. Recently, Eldeen et al. (2016) also shows that diacylglycerolglycolipid isolated from H. sagittifolia possesses the strong anti-inflammatory and anticholinergic effects, as well as hinders the growth of two Gram negative bacteria, including Klebsiella pneumonia and Pseudomonas stutzeri. In Vietnam, five species of this genus are recorded, including H. pierreana, H. vietnamensis, H. occulta, H. pendula and H. tonkinensis (Van et al, 2017). Among them, H. vietnamensis is an extremely rare species and is described for the first time by Bogner and Nguyen in Bach Ma National Park, Thua Thien-Hue province, Vietnam (Bogner and Nguyen, 2008). Nowadays, the presence of this species also has only been recorded in some provinces in Middle region of Figure 1 Homalomena vietnamensis. A – Habitat, B – Leaf, C – Rhizome. Vietnam, such as Thua Thien-Hue, Khanh Hoa and Quang Nam Provinces,
Vietnam (Bogner and Nguyen, 2008). Due to the limit of the number of specimens, the bioactivity this species is still unknown. In this study, we identifies the chemical composition and proves the antibacterial activity of
201
J Microbiol Biotech Food Sci / Van et al. 2020 : 10 (2) 201-204
Bacterial strains belonging to sesquiterpenoids in rhizome and leaf of H. vietnamensis, including of cadinane-4β,5α,10α-triol, oplopanone, 4-epi-oplopananol, 2α-hydroxy Five bacterial strains, including two Gram-positive bacteria, Bacillus cereus homalomenol A, 1β,4β,7β-Trihydroxyeudesmane, homalomentetraol, 4- (ATCC 11774) and Staphylococcus aureus (ATCC 25923), and three Gram- acetoxyoplopananol, 5,7-diepi-2a-acetoxyoplopanone, eudesma 4β, 7α- diol-1β- negative bacteria, Escherichia coli (ATCC 25922), Pseudomonas aeruginosa fumarate, and homalomenol F (Figure 2 and Table 2). Among them, (ATCC 27853), Salmonella enteritidis (ATCC 13976), were used to evaluate the homalomenol F, 4-epi-oplopananol, 5,7-diepi-2a-acetoxyoplopanone, eudesma antibacterial activity of ethanol extracts. Microorganisms were kindly provided 4β, 7α- diol-1β-fumarate were found in both rhizome and leaf of H. vietnamensis from the microbiology collection, Department of Biotechnology, Institute of whereas cadinane-4β,5α,10α-triol, oplopanone, 2α-hydroxy homalomenol A, Food and Biotechnology, Industrial University of Ho Chi Minh city, Viet Nam. 1β,4β,7β-trihydroxyeudesmane, and homalomentetraol were only found in All bacterial strains were cultured in Luria-Bertani broth at 37oC for 24 h to be ethanol extract of rhizome. On the other hand, leaf extract contained 4- re-activated again before using in further experiments. acetoxyoplopananol which was not found in rhizome extract. Moreover, most of 10 compounds determined in leaf and rhizome extract of H. Extraction procedure vietnamensis were found extracts of rhizome and leaf of H. oculta, another member of Homalomena genus which is widely distributed and commonly used Fresh rhizomes of H. vietnamensis were peeled and subsequently cut into slices. medicinal plant in several Asian countries (Pham, 2000; Van, 2017; Hu et al., The fresh leaves and sliced rhizomes were moderate dried at 50-55oC until 2008; Xie et al., 2012; Yang et al., 2016; Zhao et al., 2016). For example, masses of samples were unchanged. The samples were pulverized by an electric 1β,4β,7β-trihydroxyeudesmane and Homalomentetraol were 2 compounds grinder into fine powder and kept at 4oC. 50 g of the dried powder of leaves and identified from ethanol extracts of leaf and petioles of H. occulta (Wang et al., rhizomes of H. vietnamensis were immersed with 450 mL of 98% ethanol for 5 2007). Cadinane-4β,5α,10α-triol, Homalomenol F, 4-epi-oplopananol, 2α- weeks. The extracts were filtrated via Whatman filter paper, and subsequently hydroxy homalomenol A, 5,7-diepi-2a-acetoxyoplopanone, and Eudesma 4β, 7α- concentrated in reduced pressure at 60oC until the residue remained ½ volume of diol-1β-fumarate were 6 compounds identified from rhizome extract of H. the initial filtrate (Altemimi et al., 2017), then sublimation drying was occulta (Hu et al., 2008; Xie et al., 2012; Yang et al., 2016; Zhao et al., 2016). performed to remove ethanol in extracts. The obtained residue was stored at 4oC Furthermore, Wong et al. also found oplopanone, a member of sesquiterpenoids, until further use. in methanol extract of rhizome H. sagittifolia (Wong et al., 2012). All of 10 compounds identified in H. vietnamensis rhizome and leaf extracts are Liquid chromatography mass spectrometry (LC/MS) the members of sesquiterpenoids, a group of several bioactive compounds. According to Chadwick et al. (2013), sesquiterpenoids lactones, a class of Ethanol extracts were sent to the Central Laboratory for Analysis, University of sesquiterpenoids containing lactone ring in its structure, have anti-inflammatory Science, Vietnam National University of Ho Chi Minh City to conduct LC/MS and anti-cancer effects and are used to treat several diseases such as diarrhea, analysis and elucidate the chemical composition of ethanol extract. In brief, influenza, neurodegradation, and cardiovascular diseases. Furthermore, aliquot of ethanol extract was injected to HPLC Agilent 1200 infinity liquid antimicrobial, antitumor, and cytotoxic effects of sesquiterpenoids have been chromatography system (Agilent Technologies, CA, USA) coupled with documented (Chen et al., 2011). MicroTOF-QII mass spectrometer (Bruker Daltonics, Germany). The chromatographic separation was carried out in an ACE3- C18 analytical column (4.6 ×150 mm, 3.5 µm). In mobile phase, deionized water with 0.1% formic acid was used as solvent A and acetonitril with 0.1% formic acid was used as solvent B. Gradient elution program for the chromatographic separation was presented in Table 1 with the flow rate at 0.3 mL/min. The mass spectrometer was implemented with electrospray ionization source (ESI) at positive mode and mass spectra data were recorded for a mass range 50-2000 m/z. Data analysis was performed using Data Analysis software (Bruker, Germany). To determine the compounds in extract, the mass spectra of compounds were compared with mass spectra of reference compounds which were identified in other species of Homalomena genus from previous studies (Wang et al., 2007; Hu et al., 2008; Xie et al., 2012; Wong et al., 2012; Zhao et al., 2016; Yang et al., 2016).
Table 1 Gradient elution program for the chromatographic separation Time (min) Solvent A* Solvent B* 0 90 10 15 0 100 30 0 100 31 90 10 40 90 10 (): presented as the percentage of volume of mobile phase
Antibacterial activities
The antibacterial activity of ethanol extracts of leaf and rhizome of H. vietnamensis was analyzed according to Bauer protocol (Bauer et al., 1996). The bacteria were inoculated in LB Broth until reached a turbidity of 0.5 McFarland standard. 100 µl of bacterial suspensions were inoculated on Mueller Hinton plate, and a sterilized 6 mm diameter disc was placed on the plate. 10 µl of sample were put onto each disc and the plate was kept at 4oC for 2 hours to fully diffuse extract into the medium. Diameters of zones of inhibition of extracts against tested bacteria were observed and measured after inoculation at 37oC for 24 hours. Sterile distilled water was used as negative control and Gentamycin antibiotic disc (Nam Khoa BioTek, Viet Nam) was used as positive control.
Data analysis Figure 2 Mass spectrometry diagrams of 10 compounds of ethanol extracts of leaf and rhizome of H. vietnamensis. A, C, E, G, I, J, K, L, M are compounds of The experiments were repeated in triplicate. The average and standard deviation rhizome, B, D, F, H, N are compounds of leaf. of measurements were calculated using The Excel 2010 software. The data of experiments were expressed as mean ± standard deviation (SD). Antibacterial activity
RESULTS AND DISCUSSIONS Antibacterial activity of ethanol extracts from rhizome and leaf of H. vietnamensis was evaluated by the diameter of inhibition zone against tested Ethanol extract composition bacteria (Table 3 and Figure 3). Ethanol extract of rhizome of this species showed the antibacterial effect against 5 tested microorganisms while those from Based on comparison of mass of compounds (m/z) which were identified in other leaf inhibited the growth of 3 bacterial strains, including of B. cereus, S. species of Homalomena genus in previous studies, we determined 10 compounds enteritidis, and S. aureus. We observed that diameters of inhibition zones of the
202
J Microbiol Biotech Food Sci / Van et al. 2020 : 10 (2) 201-204
rhizome extract against B. cereus, S. enteritidis, S. aureus, E. coli, and P. aeruginosa were 28.3 ± 1.5, 19.5 ± 1.5, 16.3 ± 1.5, 14.7 ± 1.2, and 8.2 ± 0.8 mm, respectively. On the other hand, the leaf extract showed the strongest antibacterial effect against B. cereus (22.0 ± 2.0 mm), following by S. enteritidis (14.7 ± 0.6 mm) and S. aureus (12.5 ± 1.8 mm). The results suggested that antibacterial effect of rhizome extract was stronger that of leaf extract, both the number of bacterial strains and the diameter of inhibition zone of each strain.
Table 2 Phytochemical composition of ethanol extracts of rhizome and leaf of H. vietnamensis Compounds m/z References Rhizome Leaf Cadinane-4β,5α,10α- - 221 Xie et al. (2012) triol Oplopanone - 237 Wong et al. 2012 Homalomenol F Homalomenol F 352 Hu et al. (2008) 4-epi-oplopananol 4-epi-oplopananol 259 Yang et al. (2016) 2α-hydroxy - 277 Zhao et al. (2016) homalomenol A 1β,4β,7β- - 279 Wang et al. (2007) trihydroxyeudesmane Homalomentetraol - 295 Wang et al. (2007) 4- - 305 Yang et al. (2016) acetoxyoplopananol 5,7-diepi-2a- 5,7-diepi-2a- 318 Yang et al. (2016) acetoxyoplopanone acetoxyoplopanone Eudesma 4β, 7α- Eudesma 4β, 7α- Figure 3 Antibacterial activity of ethanol extracts from rhizome and leaf of H. 378 Zhao et al. (2016) diol-1β-fumarate diol-1β-fumarate vietnamensis against tested bacteria. Rhizome. A – B. cereus, B – E. coli, C – P. aeruginosa, D – S. enteritidis, E – S.
aureus. Leaf. F – B. cereus, G – E. coli, H – S. aureus. (-) Negative control with Some previous studies have proven the antibacterial activity of methanol and sterilized distilled water, (+) Positive control with discs containing gentamycin, ethanol extracts of rhizome of some plant species of the Homalomena genus. For (S) sample of ethanol extract. example, Liliwirianis et al. suggested that methanol extract of rhizome of H. propinque collected at Pahang Natural Reserve, Malaysia exhibited the CONCLUSION antibacterial effect against 3 tested bacteria, such as E. coli, B. subtilis, and S. aureus (Liliwirianis et al., 2011). Those results are in line with the results from In this study, 10 compounds of sesquiterpenoids are determined in rhizome and Wong et al. study, in which ethanol extract of rhizome of H. sagittifolia collected leaf of H. vietnamensis, including of cadinane-4β,5α,10α-triol, oplopanone, 4- in China inhibited the growth of 2 Gram positive bacteria, including of B. subtilis epi-oplopananol, 2α-hydroxy homalomenol A, 1β,4β,7β-Trihydroxyeudesmane, and S. aureus, as well as 3 Gram negative bacteria, such as E. coli, Klebsiella homalomentetraol, 4-acetoxyoplopananol, 5,7-diepi-2a-acetoxyoplopanone, pneumoniae and Pseudomonas stutzeri (Wong et al., 2012). Furthermore, eudesma 4β, 7α- diol-1β-fumarate, and homalomenol F. Moreover, ethanol methanol extracts of rhizome and leaf of H. aromatica, another member of the extract of rhizome of this species showed the antibacterial effect against 5 tested Homalomena genus, also showed the antibacterial activity against 3 bacteria, microorganisms (B. cereus, E. coli, P. aeruginosa, S. enteritidis, and S. aureus) such as B. subtilis, E. coli, and S. aureus, and the anti-fungal effect against 3 whereas leaf extract just inhibited the growth of 3 bacteria strains, such as B. fungal strains, including Aspergillus niger, Fusarium moniliforme, and Candida cereus, S. enteritidis, and S. aureus. albicans (Talukdar and Baruah, 2015). Of note, some of identified compounds in rhizome and leaf of H. vietnamensis also showed antibacterial effect in previous REFERENCES studies. In previous study, Wang et al. (2007) indicated that 1β,4β,7β- trihydroxyeudesmane could inhibit the growth of pathogenic bacteria, Altemimi, A., Lakhssassi, N., Baharlouei, A., Watson, D. G. (2017). Streptococcus pneumoniae and Mycobacterium tuberculosis, while Phytochemicals: Extraction, Isolation, and Identification of Bioactive Homalomentetraol inhibited the growth of Mycobacterium tuberculosis. Coumpounds from Plant Extracts. Plants, 6, 1-23.
https://doi.org/10.3390/plants6040042 Table 3 The inhibition zone of ethanol extract from rhizome and leaf of H. Bogner, J., & Nguyen, V.D. (2008). A new Homalomena species (Araceae) from vietnamensis against five tested bacteria Vietnam. Willdenowia, 3, 527-531. https://doi.org/10.3372/wi.38.38212. Zone of inhibition (mm) Tested bacteria Boyce P. C, Sookchaloem D., Hetterscheid, W. L. A., Gusman, G., Jacobsen, Rhizome Leaf N., Idei, T., Nguyen, V. D. (2012). Araceae. The Flora of Thailand, 11, 101– Bacillus cereus 28.3 ± 1.5 22.0 ± 2.0 321. Escherichia coli 14.7 ± 1.2 - Chadwick, M., Trewin, H., Gawthrop, F., Wagstaff, C., Sesquiterpenoids Pseudomonas aeruginosa 8.2 ± 0.8 - Lactones: Benefits to Plants and People. (2013). Int. J. Mol. Sci., 14, 12780- Salmonella enteritidis 19.5 ± 1.5 14.7 ± 0.6 12805. https://doi.org/10.3390/ijms140612780 Staphylococcus aureus 16.3 ± 1.5 12.5 ± 1.8 Chen, Q. F., Liu Z. P., Wang F. P. Natural Sesquiterpenoids as Cytotoxic Anticancer Agents. (2011). Mini-Reviews in Medicinal Chemistry, 11, 1153- 1164. https://doi.org/10.2174/138955711797655399 Hu, Y. M., Liu, C., Cheng, K. W., Sung, H. H. Y., Williams, L. D., Yang, Z. L, Ye, W. C. (2008). Sesquiterpenoids from Homalomena occulta affect osteoblast proliferation, differentiation and mineralization in vitro. Phytochemistry, 69, 2367-2373. https://doi.org/10.1016/j.phytochem.2008.05.023 Eleen, I. M. S., Hamid, A., Wong, K. C., Abdullah, M.A., Tengku, S. T. M., Abdillahi, H.S., Staden, J. V. (2016). In vitro repression of cyclooxygenase, acetylcholinesterase activities and bacterial growth by trans-phytol and a glycolipid from the leaves of Homalomena sagittifolia. Research journal of Medicinal plants, 10, 320-329. https://doi.org/10.3923/rjmp.2016.320.329 Liliwirianis, N., Wan, Z. W. M. Z.., Jamaluddin, K., Shaikh, A. K. (2011). Antimicrobial Activity of Plant Extracts against Bacillus subtilis, Staphylococcus aureus and Escherichia coli. E-Journal of Chemistry, 8, 282-284. http://dx.doi.org/10.1155/2011/824697. Pham H. H. (2000). Araceae. In: Pham-hoang H. (ed.), An Illustrated Flora of Vietnam, Vol. 3. Youth Publishing House, Ho Chi Minh City, Vietnam, (In Vietnamese). Policegoudra, R.S., Goswami, S., Aradhya, S.M., Chatterjee, S., Datta, S., Sivaswamy, R., Chattopadhyay, P., Singh, L. (2012). Bioactive constituents of
203
J Microbiol Biotech Food Sci / Van et al. 2020 : 10 (2) 201-204
Homalomena aromatica essential oil and its antifungal activity against dermatophytes and yeasts. Journal de Mycologie Médicale, 22, 83-87. https://doi.org/10.1016/j.mycmed.2011.10.007. Rana, V. S., Pukhrambamb, M., Singh, H. B., Verdeguer, M., BIazquez, M. A. (2009). Essential oil composition of Homalomena aromatica roots. Indian Perfumer, 53, 43-45. Laishram S. N., Bailung, D. B., Baruah, I. (2006). In vitro antibacterial activity of essential oil from rhizome of Homalomena aromatica against pathogenic bacteria. Journal of Cell and Tissue Research, 6, 849-851. Singh, G., Kapoor, I. P. S., Singh, O. P., Rao, G. P., Prasad, Y. R., Leclercq, P. A., Klinkby, N. (2000). Studies on essential oils, part 28: Chemical composition, antifungal and insecticidal activities of rhizome volatile oil of Homalomena aromatica Schott. Flavour Frarg. J, 15, 278-280. https://doi.org/10.1002/1099- 1026(200007/08)15:4<278::AID-FFJ913>3.0.CO;2-L. Talukdar, M., Baruah, S, (2015). Microorphology and Antimicrobial Activity of Homalomena aromatica (Spreng.) Schott: A Potential Aromatic Plant of North- east India in: Advance in plant research. EBS Publisher India. ttps://www.researchgate.net/publication/305280643. Van, H. T. (2017). Building phylogenetic trees for the Araceae in southern Vietnam based on morphological and molecular markers. Doctoral thesis, Graduate University Science and Technology, Vietnam Academy of Science and Technology, Vietnam. Wang, Y. F., Wang, X. Y., Lai, G. F., Lu, C. H., Luo, S. D. (2007). Three New Sesquiterpenoids from the Aerial Parts of Homalomena occulta. Chemistry & Biodiversity, 4, 925-931. https://doi.org/10.1002/cbdv.200790081 Wong, K. C., Hamid, A., Eldeen, I. M. S., Asmawi, M. Z., Baharuddin, S., Abdillahi, H. S., Stadend, J. V. (2012). A new sesquiterpenoid from the rhizomes of Homalomena sagittifolia. Natural Product Research, 26, 9, 850-858 https://doi.org/10.1080/14786419.2010.551770 Xie, X. Y., Wang, R., Shi, Y. B. (2012). Sesquiterpenoids from the Rhizomes of Homalomena occulta. Planta Med, 78, 1010-1014. http://dx.doi.org/10.1055/s- 0031-1298539. Yang, J. L., Zhao, Y. M., Shi, Y. P. (2016). Sesquiterpenoids from the Rhizomes of Homalomena occulta. Nat. Prod. Bioprospect, 6, 211-216. https://doi.org/10.1007/s13659-016-0104-8 Zhao, F., Sun, C., Ma, L., Wang, Y. N., Wang, Y. F., Sun, J. F., Hou, G. G., Cong, W., Li, H. J., Zhang, X. H., Ren, Y., Wang, C. H. (2016). New sesquiterpenes from the rhizomes of homalomena occulta. Fitoterapia, 109, 113- 118. https://doi.org/10.1016/j.fitote.2015.12.015.
204
ANTI-STAPHYLOCOCCAL POTENTIAL OF FUSARIUM SP: FUNGAL ENDOPHYTE ISOLATED FROM RAUWOLFIA SERPENTINA
Lokesh Gambhir 1, Neha Kapoor 2 and Sanjai Saxena 3*
Address(es): Dr. Sanjai Saxena, 1Department of Biotechnology, School of Basic & Applied Sciences, Shri Guru Ram Rai University, Dehradun, Uttrakhand, 248001. 2School of Applied Sciences, Suresh Gyan Vihar University, Jaipur, Rajasthan, 302017. 3Department of Biotechnology, Thapar Institute of Engineering & Technology, Patiala, Punjab, 147004.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.235-240
ARTICLE INFO ABSTRACT
Received 30. 3. 2020 Fungal endophytes are considered as repository of potent novel bioactive compounds with profuse chemical diversity. These bioactive Revised 14. 6. 2020 compounds have been widely utilized in pharmaceutical and agrochemical industries. The present work was undertaken to bio-prospect Accepted 18. 6. 2020 the fungal endophytes from Rauwolfia serpentina, a medicinal plant used in multiple indigenous preparations, for possible therapeutic Published 1. 10. 2020 interventions. 21 fungal endophytes were isolated from Rauwolfia serpentina with maximum colonization in leaf (42.8 %) followed by bark (33.3%) and stem (23.8%). In the enzymatic activity screening, #15RSBNEY was found to be potent amylase producer and #3RSSTNEY as potential cellulase producer. Further, three isolates viz. #16RSLBRT, #10RSLBRT and #23RSSTNEY exhibited Regular article promising antibacterial activity with maximum activity exhibited by #10RSLBRT against all test strains of Staphylococcus aureus. Interestingly, it was observed that antibacterial activity of #10RSLBRT increased by two fold after fractionation with acetone and chloroform. Based on above result, the culture filtrate of #10RSLBRT was extracted with hexane, chloroform and ethyl acetate followed by agar well gel diffusion method for antibacterial activity. The crude ethyl acetate residue of #10RSLBRT hereby exhibited potent antibacterial activity. The potential isolate i.e. #10RSLBRT was identified by molecular taxonomic tools using internal transcribed spacer rDNA analysis and was clustered in the Fusarium incarnatum-equiseti complex. Further studies on the characterization of bioactive compounds of ethyl acetate extract of # 10RSLBRT are warranted for the development of anti-staphylococcal therapy.
Keywords: Rauwolfia serpentina, Fusarium sp, Staphylococcus, antimicrobial activity, Molecular taxonomy
INTRODUCTION in every part of the plant along with stem and leaves (Yarnell et al., 2004). Reserpine is the most extensively deliberated alkaloid found in R. serpentina Endophytic fungi are the ingenious collection of microorganisms which resides which is used in traditional indigenous medicinal preparations in India for within the plant tissues, for entire or part of their life cycle with no apparent centuries as a remedy to various problems, including snake bites, hypertension, symptoms of any infection (Saikkonen et al., 1998). Various fungal endophytes uterine stimulant, malaria, abdominal pain, and dysentery (Roy, 2010). Extracts have been recognized to encompass potent anticancer, anti diabetic, insecticidal of Rauwolfia serpentina has been shown to encompass potent anti-microbial and immunosuppressive agents (Strobel et al., 1999). The era of discovery of activity against pathogenic Staphylococcus aureus, Salmonella typhi, Salmonella novel therapeutic scaffolds from fungal endophytes was marked with isolation of typhimurium, Yersinia enterocolitica, Escherichia coli and Candida albicans the anticancer drug, Paclitexel (Taxol) from endophytic fungi Pestalotiopsis (Elizabeth, 2017). However, associated side effects including nausea congestion, microspora, recovered from Himalayan yew tree, Taxus wallichiana, without lethargy, sedation, hypotension, vomiting, abdominal cramping and gastric resulting any visible injury to the host plant (Strobel et al., 2002). Thus, ulceration limits its use (Lobay, 2015). biodiversity of endophytes is an imperative resource of the chemically diversified Based on these observations, the present work was undertaken to unravel the bioactive compounds based on their relationship with the plants. Endophytic diversity of fungal endophytes in Rauwolfia serpentina as a potent source of metabolites produced share the same chemistry as their respective host plant and novel fungal endophytes with bioactive potential for pharmaceutical and produce the same compound with more bioactive potential (Strobel et al., 2002; therapeutic interventions. Rauwolfia serpentina inhabiting the BRT wildlife Jia et al., 2016). These are recognized as reasonable untapped and prospective sanctuary, Karnataka and Neyyer Wildlife Sanctuary, Kerala was collected for resource of novel natural products for utilization in Pharmaceutical and agro the recovery of endophytic fungi and further prospecting for various enzymatic industries. The selection of plant species as a source outlines the screening of and antibacterial bioactivities. fungal endophytes and thereby provides huge spectrum of bioactive metabolites having immense potential as pharmacophores. Rationale of plant selection is MATERIALS AND METHODS based upon their pharmaceutical usage and their ecological niche. Tropical and temperate rainforests are the most biologically diverse terrestrial ecosystems on Sample Collection and isolation of fungal endophytes earth and plants growing in these areas are being surveyed for harboring endophytes. Thus, immense potential exists in screening biodiversity of BRT wildlife sanctuary, Karnataka and Neyyer wildlife sanctuary, Kerala were endophytic fungi for exploring novel chemistries possessing enzymatic and anti- explored for collection of fresh Leaves, stem and bark of Rauwolfia serpentina. bacterial properties (Uzma et al., 2018). The collected plant parts were transported to the laboratory in sealed zip pouches Natural compounds isolated from medicinally important plants are considered to and preserved at 4˚C. The samples were subjected to surface sterilization by be conventionally leading agents revealing the unexplored chemical diversity treating with 0.1% sodium hypochlorite for 3 min followed by 70% ethanol for incomparable to the principal combinatorial databases (Rajamanikyam et al., 45 sec and 30% ethanol for 30 sec under aseptic conditions (Mitchell et al., 2017). Rauwolfia serpentina, commonly known as 2001). The pre-sterilized samples were incised into pieces of 1-2mm in size sarpagandha and chandrika, is an ethnomedicinal evergreen shrub of the under sterilized conditions and were cultured on potato dextrose agar (PDA) dogbane or Apocynaceae. It is rich source of indole alkaloids which are available plates at 28˚C for 8-10 days. The inoculated plates were recurrently examined for
235
J Microbiol Biotech Food Sci / Gambhir et al. 2020 : 10 (2) 235-240
the emergence of fungal hyphae from inoculated segments. Appearing fungal activity by KB disc diffusion method. A 5 mm size disc were used having hyphae were transferred on PDA plates to attain pure culture. The pure active loading capacity of 30µl. Fungal extract (6.4mg/ml) was loaded in sterile discs culture was stored on 10% glycerol-PDA slants (Kapoor and Saxena, 2018). under laminar conditions and left for drying. The turbidity of test organism was adjusted with 0.5 McFarland solution followed by swabbing of MHA plates. The Screening for extracellular enzyme production loaded discs were placed on MHA plates and incubated at 37°C overnight for 18h to 24h. Anti-staphylococcal activity was analyzed by measuring diameter of zone a) Amylase activity assay- The endophytic isolates were examined for the of inhibition in mm (Magaldi et al., 2004). Three independent experiments were production of extracellular amylase by culturing them on 2% soluble starch- performed and the average values of anti-staphylococcal activity were calculated. Glucose Yeast Peptone (GYP) agar medium. The plates were incubated at 28˚C for 72h followed by flooding with staining solution containing 1% iodine. The zone of clearance appeared around the colony indicated amylase production (Kapoor et al., 2018; Sunitha et al., 2012). Agar well diffusion assay b) Cellulase activity assay- The endophytic fungal isolates were screened for cellulose production on Yeast-Peptone Agar (YPA) medium containing The agar well diffusion assay was carried out to assess the anti-staphylococcal 0.5% carboxymethyl cellulose (CMC). The plates were incubated at 28˚C activity of the crude solvent extracts. Stock solutions of extracts (1 mg/ml) were for 72h. Staining was done using 0.2% aqueous Congo red dye followed by prepared in 10% DMSO and stored at -4˚C till further use. 20μl of test extracts destaining with 1M sodium chloride. The zone of clearance appeared were dispended in 5mm wells prepared using a sterile cork borer on 24h old MH around the colony indicated the cellulase activity (Teather and Wood, agar plate aseptically. Further, the wells were sealed and kept for 20 minutes for 2012). solidification. The turbidity of test organism was adjusted with 0.5 McFarland solution followed by swabbing of MHA plates and incubated at 37˚C overnight c) Laccase activity assay- The extracellular laccase production by fungal for 18h to 24h. The anti-staphylococcal activity was determined by measuring the endophytes was screened by inoculating 5 mm mycelial plug on GYP agar zone of inhibition around the test and control samples (Magaldi et al., 2004; medium containing 0.005% α-naphthol. The plates were incubated at 28˚C Valgas et al., 2007). Three independent experiments were performed and the for 24h. Laccase induced oxidation of α-naphthol resulted in the color average values of anti-staphylococcal activity were calculated. change of the medium from transparent to blue. Hence formation of blue color around the colony confirms the laccase production (Rao et al., 2019). Molecular identification of potent endophytic fungus
Secondary metabolites prodcution PCR Amplification
Broth cultures of isolates were produced by following the method of Rodriguez The potential fungal endophyte was identified by Molecular tools employing et al (2000). Briefly, 5 mm mycelial plug of cultured endophytic fungal isolate ITS1 and ITS4 primers mediated amplification of ITS1-5.8S-ITS2 region was inoculated in Tryptone Soya Broth (TSB), Potato Dextrose broth (PDB), (Felsenstein, 1985; White et al., 1990). Genomic DNA extracted from the Czpek-Dox broth (CDB), yeast extract-peptone broth (YEPD) medium, endophytic fungal isolates was taken as template along with 0.8 μM primer, 0.2 PDB:YEPDB (PY) media, PDB:CDB (PC) media, PDB:TSB (PT) media, mM dNTP, 1.5 U Taq polymerase to a final volume of 25 μl. The reaction PDB:YEPD:TSB:CDB (PYTC) media followed by incubation at 28˚C with mixture was subjected to PCR amplification following 39 cycles and a final continuous shaking for 10 days. Post incubation period, the fungal mass was extension of 5 mins at 72˚C (Kapoor and Saxena, 2014). PCR amplicon was separated from the supernatant to obtained cell free filtrates that were further purified using Wizard® SV Gel and PCR clean up system kit, Promega, USA stored at -4˚C. following manufacturer’s protocol. The Purified PCR product was sent for direct sequencing to Xcelris Labs, Gujarat. Liquid-liquid Extraction Sequence assembly and Phylogenetic identification: The culture filtrates of selected fungal endophytes were subjected to extraction with diverse solvent systems viz. Hexane, ethyl acetate, chloroform and acetone. Sequencher ver. 5 (www.genecodes.com) was used to edit and verify the attained The culture filtrate was extracted with each solvent thrice, organic layers were chromatograms and were submitted in the GenBank under the accession number taken out and dehydrated using sodium sulphate. The organic layer so obtained MH237828. BLAST tool was used to analyze the homology in the consensus was evaporated to dryness by using Rotatory evaporator. The obtained crude sequence. Clustal W in MEGA 5.2 was utilized for obtaining the alignment with residue was dissolved in Dimethylsulfoxide (DMSO) and preserved at 4˚C for the reference taxa (Tamura et al., 2011). The phylogenetic history was further use. determined by the Maximum Parsimony method using the Close-Neighbor- Interchange algorithm (Arnold et al., 2005) in which the tree is formed based on Maintenance of Test microorganisms random addition of sequences with 20 replicates. The analysis involved 19 nucleotide sequences. Alignment gaps were taken as missing characters. The test organisms included bacterial isolates and were broadly grouped into Bootstrap analysis (1000 bootstrap) was executed to deduce the consensus tree standard and clinical isolates. The clinical isolates included the following for the demonstration of evolutionary relationship (Kapoor and Saxena, 2014; organisms: Staphylococcus aureus (G3), Staphylococcus aureus (G26) procured González-Menéndez et al., 2018). from Government Medical College, Patiala. The standard isolate was Staphylococcus aureus (NCTC 6571) taken from the Microbial type culture RESULTS collection (MTCC), IMTECH, Chandigarh. The bacterial cultures were maintained on Muller Hinton Broth (MHB) with 2 % glycerol and stored at 4°C. Isolation of endophytic fungi These cultures were further streaked on Muller Hinton Agar (MHA) plate and incubated at 37°C overnight. A single pure colony was transferred to the MHB Leaves, stem and bark samples of Rauwolfia serpentina were subjected to and incubated 16- 18h at 37°C before being used as test organism. The visual isolation of fungal endophytes on PDA plates. A total of 21 fungal endophytes turbidity of the culture was tested against the standard 0.5 McFarland solution. were recovered from Rauwolfia serpentina. Each host explant showed disparity in the endophytic fungal colonization (Table 1). The maximum colonization was Kirby-Bauer Antimicrobial Susceptibility Test observed in leaf (42.8 %) followed by bark (33.3 %) and stem (23.8 %). No endophytic fungi were recovered from the stem internal issue of the plant. A total of 8 different combinations of crude EA and aqueous extract (PDB, CDB, Isolated endophytes were further sub cultured for preservation of pure colonies. TSB, YEPDB, PY, PT, PC, PYTC media) were investigated for antibacterial
Table 1 fungal endophytes isolated from Rauwolfia serpentina along with plant part, place of sample collection and bioactivity profiling S. NO Culture Code Plant part Place of sample collection Bioactivities Amylase Cellulase Laccase 1. #1RSLBRT Leaves BRT wildlife sanctuary, Karnataka - + - 2. #3RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 3. #5RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 4. #7RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 5. #10RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - -
236
J Microbiol Biotech Food Sci / Gambhir et al. 2020 : 10 (2) 235-240
6. #11RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - + 7. #15RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 8. #16RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 9. #27RSLBRT Leaves BRT wildlife sanctuary, Karnataka - - - 10. # 1RSBANEY Bark Neyyer wildlife sanctuary Kerala ++ + - 11. # 7RSBANEY Bark Neyyer wildlife sanctuary Kerala + - ++ 12. # 11RSBANEY Bark Neyyer wildlife sanctuary Kerala - - 13. # 12RSBANEY Bark Neyyer wildlife sanctuary Kerala - - + 14. # 14RSBANEY Bark Neyyer wildlife sanctuary Kerala - - +++ 15. # 15RSBANEY Bark Neyyer wildlife sanctuary Kerala +++ - - 16. # 22RSBANEY Bark Neyyer wildlife sanctuary Kerala - - - 17. #2RSSTNEY Stem Neyyer wildlife sanctuary Kerala + - - 18. #3RSSTNEY Stem Neyyer wildlife sanctuary Kerala - ++ - 19. #4RSSTNEY Stem Neyyer wildlife sanctuary Kerala - - - 20. #15RSSTNEY Stem Neyyer wildlife sanctuary Kerala - - - 21. #23RSSTNEY Stem Neyyer wildlife sanctuary Kerala - - - Note: poor activity (+);Good activity (++), Excellent activity(+++), No activity (-)
Isolated fungal endophytes exhibited potent enzyme production
Isolated fungal endophytes were examined for the production of commercially important enzymes including amylase, cellulose and laccase. In the preliminary screening of fungal endophytes, four isolates were found to be positive for producing amylase. Out of 4 positive isolates, maximum amylase activity was observed in #15RSBNEY followed by #7RSBANEY, #1RSBANEY and #2RSSTNEY. Similarly, three isolates exhibited promising cellulase activity, of which #3RSSTNEY was found to be potent cellulase producer. In laccase assay, four isolates showed positive results. # 11 RSLBRT, # 12 RSBANEY, # 14 RSBANEY and # 7 RSBANEY showed blue color around their colony after 4 days of incubation indicating the production of laccase activity showing the ability of fungal isolates to produce de-lignifying enzyme (Figure 1).
Figure 2 Screening of the antibacterial activity of the isolated endophytes: (A-C) Images represents the KB disc diffusion assay based anti-bacterial activity of ethyl acetate and aqueous extract of #10RSLBRT evident from zone of inhibition. Aqueous extract exhibited maximum anti-bacterial activity against pathogenic strains of S. aureus (D-F) Images represents the KB disc diffusion assay based anti-bacterial activity of ethyl acetate and aqueous extract of #23RSSTNEY evident from zone of inhibition. Ethyl activity extract exhibited anti-bacterial activity against pathogenic strains of S. aureus
Aqueous extract of #10RSLBRT was found to exhibit potent antibacterial action against all test organisms and hence the aqueous spent broth was further analyzed for the optimum pH needed to exhibit antibacterial activity. A pH gradient ranging from 4 to 7 was prepared and the extracts were subjected to agar well diffusion method for examining the antimicrobial action. It was observed that Figure 1 Production of commercially imperative enzymes from the endophytic maximum activity appeared in range of pH 5 to 6 (Figure 3). Since potent activity fungal isolates: (A-C) Image represents the production of amylase evident from was shown by aqueous extract, further fractionation with acetone and chloroform the zone of clearance after iodine solution. #15RSBNEY, #7RSBANEY and for evaluation of antibacterial activity was carried out. The anti-staphylococcal #1RSBANEY exhibited starch digesting properties by production of amylase. (D- activity of aqueous layer was observed to get increase by two folds after E) Images represent the production of laccase evident from the transition of fractionation with maximum activity against S. aureus G3 followed by S. aureus colour around the colony from transparent to blue. #7RSBANEY, #12RSBANEY G26 and S. aureus NCTC 6571 (Table 3). These results indicated that and #14RSBANEY exhibited production of laccase enzyme. fractionation with non polar solvents tends to increase the potency of aqueous layer. Isolated fungal endophytes exhibited potent anti-staphylococcal activity
For evaluation of antimicrobial activity, substrate specificity testing using EA and aqueous extracts of 8 different media combinations using KB disc diffusion method revealed TSB to be the best media for secondary metabolite production. In KB disc diffusion assay, three isolates viz. #16RSLBRT, #10RSLBRT and #23RSSTNEY exhibited promising antibacterial activity (Table 2, Figure 2).
Figure 3 Effect of pH on anti-staphylococcal activity of #10RSLBRT: (A-C) Images represent the effect of pH from 4 to 7 on anti-bacterial potential of the #10RSLBRT by agar well diffusion assay. Interestingly, pH range of 5 to 6 showed an increase in the antibacterial activity against S. aureus G3 followed by S. aureus G26 and S. aureus NCTC 6571.
237
J Microbiol Biotech Food Sci / Gambhir et al. 2020 : 10 (2) 235-240
Table 2 Data represents the zone of clearance in mm obtained from KB disc diffusion assay of selected isolates. Zone size (in mm) S. No Culture Code S. aureus NCTC 6571 S. aureus G3 S. aureus G26 EA Aqueous EA Aqueous EA Aqueous 1. #16RSLBRT 8.33 ± 0.577 0 8.33 ± 0.577 0 0 0 2. #10RSLBRT 7.66 ± 0.577 7.66 ± 0.577 0 11± 0 6.66 ± 0.577 9.33 ± 0.577 3. #23RSSTNEY 8.33 ± 0.577 0 10.33 ± 0.577 0 10 ± 0.577 0
Table 3 Data represents the zone of clearance in mm obtained from KB disc diffusion assay of selected isolates. Zone size (in mm) Culture S. aureus NCTC 6571 S. aureus G3 S. aureus G26 Code AC CH Mid AQ AC CH Mid AQ AC CH Mid AQ 0 0 0 13 0 0 12 21 0 0 10 17 #10RSLBRT 0 0 0 12 0 0 11 20 0 0 9 17 0 0 0 13 0 0 11 20 0 0 9 16 12.66 ± 11.33 ± 20.33 ± 9.33 ± 16.66 ± Mean ± SD 0 0 0 0 0 0 0 0.577 0.577 0.577 0.577 0.577
Enhanced anti-staphylococcal activity by solvent fractionation hexane was used for fractionation of culture filtrate of #10RSLBRT followed by extraction with chloroform, Acetone and EA. The agar well gel diffusion assay of Based on above observations, it was hypothesized that antibacterial compound obtained extracts revealed that EA and hexane extracts exhibited antibacterial resided in aqueous layer may be a strong non polar compound or increasing the action against all test organisms. Maximum activity was exhibited by EA extract non polarity in extraction may channelize the removal of non polar molecules against S. aureus NCTC 6571 with zone size of 11.33 mm (Table 4, Figure 4). that may hinder in potent antimicrobial activity. To test the proposed hypothesis,
Table 4 Data representing the anti-staphylococcal activity of ethyl acetate and hexane extracts of #10RSLBRT Zone size (in mm) Culture Code S. aureus NCTC 6571 S. aureus G3 S. aureus G26 EA Hexane EA Hexane EA Hexane 12 8 10 7 10 8 #10RSLBRT 11 7 9 7 9 7 11 8 10 7 9 8 Mean ± SD 11.33 ± 0.57 7.66 ± 0.57 9.66 ± 0.57 7 ± 0 9.66 ± 0.57 8.66 ± 0.57
Figure 5 The isolated #10RSLBRT was clustered in Fusarium incaranatum- equiseti clade: The Neighbour-joining tree based on the ITS1-5.8S-ITS2 region with the sum of branch length=0.452 is shown. Bootstrap test of 1000 replicates was taken to represent the clustering of associated taxa.
Figure 4 Ethyl acetate extract of #10RSLBRT exhibited more potent DISCUSSION antibacterial activity: To test the possibility of removing the non polar hindering compounds thereby enhancing the antibacterial activity, sequential extraction was Endophyte inhabiting the host plant acts as defense armor against pathogenic done using non polar to polar solvents. (a-c) Images represent the agar well (Strobel and Daisy, 2003). Fungal endophytes have been isolated many plant diffusion assay of hexane extracts against S. aureus G3 followed by S. aureus species including terrestrial plants from different parts like fruits, stems or bark, G26 and S. aureus NCTC 6571. No antibacterial action was professed against the roots, leaves, tubers, buds, xylem and rachis of grasses, palms, banana, test organisms. (d-f) Images represent the antibacterial activity of ethyl extract mangroves and halophytes. Fungal endophytes have been the repository of potent post sequential extraction evident from the agar well diffusion assay. bioactive metabolites with diverse action including anti-cancer, antioxidant, antifungal, antibacterial, antiviral, anti-insecticidal and immunosuppressant (Tan The isolated endophytic fungus was clustered in Fusarium incaranatum- and Zou, 2001; Toghueo, 2019). Endophytic fungi are potent source of enzyme equiseti clade by phylogenetic identification. producers. Fungal bio-resource is being exploited by researchers in quest of commercially important enzymes like laccase, cellulase, amylase, L- The BLAST analysis of the sequence data showed close association of the isolate asparaginase etc. For penetrating the host plant and colonizing its tissue, with Fusarium sp. For the speciation of the isolate, Maximum parsimony tree endophytic fungi synthesizes different type of enzymes (Jia et al., 2011). was constructed with consistency index of 0.822917, retention index of 0.910995, Endophytic fungi are commercially viable as producer of starch digesting and the composite index of 0.815983 (0.749673) for all the sites and parsimony- enzymes because of efficient conversion of numerous starch sources to sugars informative sites (in parentheses). The tree was divided into 4 different clades of without prior gelatinization (Marlida et al., 2015; Toghueo et al., 2017). respective Fusarium species viz. Fusarium incarnatum-equiseti complex clade, Medicinal plants have been the potent repository of novel chemistries destined Fusarium oxysporum clade, Fusarium lateritum clade, Fusarium solani clade. for pharmaceutical and therapeutic interventions. Recent trends in mycology have The isolate #10RSLBRT was clustered in Fusarium incaranatum-equiseti clade focused in isolating novel endophytic fungi from aboriginal medicinal plants for thereby confirming its placement in Fusarium incaranatum-equiseti complex extraction of potent bioactive agents. Rauwolfia serpentina, a medicinal shrub (Figure 5). Aspergillus niger was taken as outgroup to root the tree. has been studied as a source of endophytic fungal diversity with a colonisation of 18% (Nath et al., 2017). Also, the isolated endophytes were shown to exhibit
238
J Microbiol Biotech Food Sci / Gambhir et al. 2020 : 10 (2) 235-240
antibacterial activity. In the present study, Rauwolfia serpentina, a medicinal Kapoor, N., Saxena, S. (2018). Endophytic fungi of Tinospora cordifolia with shrub, was taken as a source of exploring endophytic fungal diversity. anti-gout properties. 3 Biotech, 8, 264. https://doi.org/10.1007/s13205-018-1290- Endophytic fungi isolated from the plant were maintained as pure culture and 3 were further assessed for the production of anti‐bacterial compound. In all 21 Kapoor N, Saxena S. (2014). Potential xanthine oxidase inhibitory activity of isolates were recovered from different plant parts of Rauwolfia serpentina. Since endophytic Lasiodiplodia pseudotheobromae. Appl Biochem Biotechnol, 173(6), endophytic fungus have been utilised in production of commercially imperative 1360‐1374. https://doi.org/10.1007/s12010-014-0927-x enzymes, we assessed the isolates for the production of enzymes such as amylase, Khan, N., Afroz, F., Begum, M. N., Roy Rony, S., Sharmin, S., Moni, F., cellulase and laccase. # 11 RSLBRT, # 12 RSBANEY, # 14 RSBANEY and # 7 Mahmood Hasan, C., Shaha, K., & Sohrab, M. H. (2018). Endophytic Fusarium RSBANEY showed potent amylase production. Laccase production was shown solani: A rich source of cytotoxic and antimicrobial napthaquinone and aza- by # 1 RSBANEY, # 7 RSBANEY, # 15 RSBANEY and # 2 RSSTNEY and # 3 anthraquinone derivatives. Toxicology reports, 5, 970–976. RSSTNEY, # 1 RSLBRT and # 1 RSBANEY showed cellulase production. https://doi.org/10.1016/j.toxrep.2018.08.016 Further, the antibacterial potential of the isolates was evaluated in variety of Kumar, S., Tamura, K., Nei, M. (2004). MEGA3: Integrated software for media composition to decipher the required substrate for potent production of Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in secondary metabolite. Tryptone soya broth as substrate elicited the production of Bioinformatics, 5(2), 150–163. https://doi.org/10.1093/bib/5.2.150 secondary metabolites which was evident with the presence of antibacterial Lobay, D. (2015). Rauwolfia in the Treatment of Hypertension. Integrative action of the isolates #16RSLBRT, #10RSLBRT and #23RSSTNEY. Since Medicine: A Clinician's Journal, 14(3), 40–46. PMCID: PMC4566472 #10RSLBRT exhibited potent antibacterial action against Staphylococcus aureus Magaldi, S., Essayag, C.M., Capriles, H. et al. (2004). Well diffusion for viz. NCTC 6571 (control), G3 and G26 (clinical), it was chosen for further antifungal susceptibility testing. International Journal of Infectious Diseases, 8, evaluation. In sequentially design study the spent broth was fractionated with 39–45. DOI: 10.1016/j.ijid.2003.03.002 different solvents and evaluated for antimicrobial action. It was observed that the Mitchell, A., Strobel, G., Moore, E., Robinson, R., Sears, J. (2010). Volatile highest yield and efficacy against S. aureus appeared in ethyl acetate extract of antimicrobials from Muscodor crispans, a novel endophytic fungus. #10RSLBRT endophytic fungal isolate recovered from Rauwolfia serpentina. In Microbiology, 156(Pt 1), 270-7. https://doi.org/10.1099/mic.0.032540-0 agar well diffusion assay it exhibited a zone of inhibition of 11.33 ± 0.577 Nath, A., Chattopadhyay, A., Joshi, S. R. (2015). Biological activity of (S.aureus NCTC6571), 9.66±0.577 and 9.66 ± 0.577 against S. aureus G3 and S. endophytic fungi of Rauwolfia serpentine Benth: an ethnomedicinal plant used in aureus G26 respectively. To address the fungal diversity and to determine the folk medicines in northeast India. Proceeding of the National Academy of identity of the fungus, phylogenetic characterisation of the fungus was Sciences, 85, 233–240. https://doi.org/10.1007/s40011-013-0184-8 performed. The isolated fungus showed close relationship based on sequence Rajamanikyam, M., Vadlapudi, V., Amanchy, R., Upadhyayula, S. M. (2017). similarities of ITS regions with Fusarium sp. Interestingly, the isolate was found Endophytic Fungi as Novel Resources of natural Therapeutics. Brazilian to be huddled in Fusarium incaranatum-equiseti clade on building a phylogeneic Archives of Biology and Technology, 60, e17160542. tree. Fusarium sp. has been documented in the literature to possess potent http://dx.doi.org/10.1590/1678-4324-2017160542 antimicrobial action (Khan et al., 2018; Zhang et al., 2016). Rao, A., Ramakrishna, N., Arunachalam, S. et al. (2019). Isolation, Screening and Optimization of Laccase-Producing Endophytic Fungi from Euphorbia CONCLUSION milii. Arabian Journal for Science and Engineering, 44, 51–64. https://doi.org/10.1007/s13369-018-3431-8 Staphylococcus aureus is a prime reason of clinical infections in community and Rodrigues, K. F., Manfred, H., Christa, W. (2000). Antimicrobial activity of healthcare settings. It has a broad spectrum of clinical syndromes from folliculitis secondary metabolites produced by endophytic fungi from Spondias mombin. to bloodstream infections. It is major causative agent of bacteremia and infective Journal of Basic Microbiology, 40, 261-267. https://doi.org/10.1002/1521- endocarditis. Health associated and surgical site infections are major cause of 4028(200008)40:4<261::AID-JOBM261>3.0.CO;2-D mortality in clinical settings (. Further the aggravation in the threat of infection is Roy, P. (2018). Global Pharma and Local Science: The Untold Tale of due to the emergence of infections caused by Methicillin Resistant Reserpine. Indian journal of psychiatry, 60(Suppl 2), S277–S283. Staphylococcus aureus (MRSA). Thus, discovering novel chemistries as https://doi.org/10.4103/psychiatry.IndianJPsychiatry_444_17. therapeutics against S. aureus has kindled the interest of researchers. The present Saikkonen, K., Faeth, S. H., Helander, M., Sullivan, T. J. (1998). Fungal study was aimed at identifying fungal endophytes with anti-staphylococcal endophytes: a continuum of interactions with host plants. Annual Review of potential from Rauwolfia serpentina. 21 fungal endophytes were isolated from Ecology and Systematics, 29, 319–343. Rauwolfia serpentina. Three isolates viz. #16RSLBRT, #10RSLBRT and https://doi.org/10.1146/annurev.ecolsys.29.1.319 #23RSSTNEY exhibited promising anti-staphylococcal activity with maximum Strobel, G., Daisy, B. (2003). Bioprospecting for microbial endophytes and their activity exhibited by #10RSLBRT against all clinical and standard isolates natural products. Microbiol. Microbiology and Molecular Biology Reviews, 67: Staphylococcus aureus. Further, #10RSLBRT was identified and clustered in the 491-502. doi: 10.1128/MMBR.67.4.491-502.2003 Fusarium incarnatum-equiseti complex based on molecular taxonomy. Thus, Strobel, G. A., Sugawara, F., Harper, J., Hess, W. M. (1999). Oocydin A, a these results corroborate our hypothesis of isolating potent endophytic fungus chlorinated macrocyclic lactone with potent anti-oomycete activity from Serratia from a medicinal shrub Rouwolfia serpentina. The study paves way for marcescens. Microbiology, 145, 3557-3564. https://doi.org/10.1099/00221287- bioprospecting fungal endophytes from endangered medicinal plants to exploit 145-12-3557 the chemical diversity for pharmaceutical interventions. Further studies are Strobel, G. A. (2002). Rainforest endophytes and bioactive products. Critical required for the purification and characterization of the bioactive compound Reviews in Biotechnology, 22, 3SS15-333. DOI: 10.1080/07388550290789531 present in extract of #10RSLBRT for its potential towards anti-staphylococcal Sunitha, V. H., Ramesha, A., Savitha, J., & Srinivas, C. (2012). Amylase drug development and finding out the mode of action. production by endophytic fungi Cylindrocephalumsp. isolated from medicinal plant Alpinia calcarata (Haw.) Roscoe. Brazilian journal of microbiology], 43(3), Conflict of interest: There is no actual or potential conflicts of interest. 1213–1221. https://doi.org/10.1590/S1517-838220120003000049 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011). REFERENCES MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology Elizabeth (2017). Antimicrobial Activity of Rauwolfa serpentine. Journal of and Evolution, 28, 2731-9. DOI: 10.1093/molbev/msr121 Human Ecology. 12, 375-377. https://doi.org/10.1080/09709274.2001.11907636 Tan, R.X., Zou, W.X. (2001). Endophytes: a Rich Source of Functional Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the Metabolites. Natural Product Reports, 18, 448-459. bootstrap. Evolution. 1985; 39:783-791. https://doi.org/10.1111/j.1558- https://doi.org/10.1039/B100918O 5646.1985.tb00420.x. Tong, S.Y.C., Davis, J.S., Eichenberger, E., Holland, T.L., Fowler, V.G. Jr. González-Menéndez, V., Crespo, G., de Pedro, N. et al. (2018). Fungal (2015). Staphylococcus aureus infections: epidemiology, pathophysiology, endophytes from arid areas of Andalusia: high potential sources for antifungal clinical manifestations, and management. Clinical Microbiology Review, and antitumoral agents. Sci Rep, 8, 9729. https://doi.org/10.1038/s41598-018- 28(3), 603-661. https://doi.org/10.1128/CMR.00134-14 28192-5 Toghueo, R.M.K. (2019) Anti-leishmanial and Anti-inflammatory Agents from Jia, M., Chen, L., Xin, H.L., Zheng, C.J., Rahman, K., Han, T., Qin, L.P. (2016). Endophytes: A Review. Natural Products and Bioprospecting, 9(5), 311-328. A Friendly Relationship between Endophytic Fungi and Medicinal Plants: A https://doi.org/10.1080/21501203.2019.1645053 Systematic Review. Frontiers in Microbiology, 7, 906. Toghueo, R. M. K., Zabalgogeazcoabc, B. R., Vázquez de Aldanab, Boyoma, https://doi.org/10.3389/fmicb.2016.00906 F.F. (2017). Enzymatic activity of endophytic fungi from the medicinal plants Kapoor, N., Rajput, P., Mushtaque, M. A., Gambhir, L. (2018). Bio-Prospecting Terminalia catappa, Terminalia mantaly and Cananga odorata. South African Fungal Endophytes of High Altitude Medicinal Plants for Commercially Journal of Botany, 109, 146-153. 10.1016/j.sajb.2016.12.021 Imperative Enzymes. Biosc.Biotech.Res.Comm., 11(3), 370-375. Teather, R.M., Wood, P.J. (1982). Use of Congo red-polysaccharide interactions http://dx.doi.org/10.21786/bbrc/11.3/4 in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Applied and Environmental Microbiology, 43, 777-780. PMCID: PMC241917
239
J Microbiol Biotech Food Sci / Gambhir et al. 2020 : 10 (2) 235-240
Uzma, F., Mohan, C.D., Hashem, A., Konappa, N.M., Rangappa, S., Kamath, P.V., Singh, B.P., Mudili, V., Gupta, V.K., Siddaiah, C.N., Chowdappa, S., Alqarawi, A.A., Abd Allah, E.F. (2018). Endophytic Fungi—Alternative Sources of Cytotoxic Compounds: A Review. Frontiers in Pharmacology, 9, 309. https://doi.org/10.3389/fphar.2018.00309 Valgas, C., De Souza, S.M., Smânia, E.F.A., Artur, S. (2007). Screening methods to determine antibacterial activity of natural products. Brazilion Journal of Microbiology, 38, 369–380. https://doi.org/10.1590/S1517-83822007000200034 White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, New York (NY) Academic Press, 315–22. https://doi.org/10.1016/b978-0-12-372180-8.50042-1 Yarnell, E., Abascal, K. (2004). Treating hypertension botanically. Alternative and Complementary Therapies, 7, 284– 290. https://doi.org/10.1089/107628001753312121 Marlida, Y., Saari, N., Hassan, Z., Son, R. (2000). Raw starch-degrading enzyme from newly isolated strains of endophytic fungi. World Journal of Microbiology and Biotechnology, 16, 573–578. https://doi.org/10.1023/A:1008935814516 Zhang, H., Sun, X., Xu, C. (2016). Antimicrobial activity of endophytic fungus Fusarium sp. isolated from medicinal honeysuckle plant. Archives of Biological Sciences, 68, 25–30. https://doi.org/10.2298/ABS140401004Z
240
ISOLATION, SCREENING, AND CHARACTERIZATION OF BIOSURFACTANT-PRODUCING Bacillus spp. FROM SOIL AND THEIR POTENTIAL BIOFILM INHIBITORY ACTIVITIES AGAINST Pseudomonas aeruginosa
John Paul Matthew D. Guzman*1,2, Jeun Marianne T. Alba2, Mark Louie S. Torres2
Address(es): Mr. John Paul Matthew D. Guzman, 1 Environment and Biotechnology Division, Industrial Technology Development Institute, Department of Science and Technology, Bicutan, Taguig City, Philippines 1631. 2 The Graduate School, University of Santo Tomas, España, Manila, Philippines 1008.
*Corresponding author: [email protected] / [email protected] doi: 10.15414/jmbfs.2020.10.2.245-248
ARTICLE INFO ABSTRACT
Received 15. 6. 2019 Biosurfactants are surface-active compounds usually produced by microbial cells, thus, their biodegradable nature and low toxicity. The Revised 12. 6. 2020 capability to lessen surface and interfacial tensions characteristic of these compounds paved the way for their potential to inhibit biofilm Accepted 25. 6. 2020 formation. Biofilms are complex matrices of microbial cells formed on surfaces which provide microorganisms protection against Published 1. 10. 2020 substances found in the environment, including antimicrobials. In this study, Bacillus spp. isolated from soil samples were screened for their production of biosurfactants through Oil Drop Collapse and Parafilm M assays. Out of 12 isolates, four, GAT-01, GAT-04, GAT- 05, and GAT-07, tested positive, and were identified based on their phenotypic and genotypic characteristics as B. pseudomycoides, B. Regular article cereus, B. pseudomycoides, and B. mycoides, respectively. GAT-01 was able to yield the highest biofilm inhibition activity against Pseudomonas aeruginosa ATCC 27853 with 43.12%, GAT-04 with 32.42%, GAT-05 with 35.78%, while GAT-07 showed the lowest activity with 26.91%. No antibacterial activities against P. aeruginosa ATCC 27853 were observed. Quorum sensing inhibition assay using Chromobacterium violaceum ATCC 12472 also showed negative results for all the biosurfactants. These present the potential of biosurfactants from Bacillus spp. as bioactive substances against biofilm formation through physical interactions.
Keywords: Bacillus, Biofilm inhibition, Biosurfactants, Chromobacterium violaceum, Pseudomonas aeruginosa, Quorum sensing
INTRODUCTION MATERIAL AND METHODS
Microorganisms are often described as the simplest form of organisms. However, Soil smple collection further studies of microbial forms reveal that most are capable of complex differentiation and behavior (O’Toole, 2000). One of which is the capability of Approximately 50 grams of top soil was collected along the perimeter of different microorganisms to form biofilms. Biofilm refers to an interlinking network buildings in the Department of Science and Technology (DOST) Compound, formed by multiple microorganisms that is attached on a surface (Donlan, 2001). Bicutan, Taguig City, Philippines namely: Environment and Biotechnology It is considered a community of microorganisms that thrive on a surface that Division (EBD) Building, Standards and Testing Division (STD) Building, and subsequently form a polymeric matrix (Costerton et al., 1999). This matrix often National Metrology Laboratory (NML) Building. Collected soil samples were exhibits resistance to antibiotics; thus, biofilm formation is considered one of the placed in properly-labeled sterile plastic bags and were immediately transported many challenges in the field of medicine. to the laboratory for analyses. Currently, preventive strategies against biofilm formation include alteration of the surface coating or material of hospital instruments. However, recent studies Isolation of Bacillus spp. suggest that molecules secreted within bacterial communities could interfere with formation of biofilm, thus limiting bacterial adhesion on surfaces (Valle et al., The soil samples were homogenized with sterile distilled water and two-fold 2006). Several studies show promising results of biosurfactants against biofilm serial dilution was done to obtain a 10-3 dilution. One hundred microliters of the formation (Walencka et al., 2008). Biosurfactants are low molecular weight soil suspension were inoculated onto Mannitol-Yolk-Polymyxin B (MYP) Agar compounds produced by microorganisms capable of reducing surface and and incubated at 35°C for 24 h. Colonies visibly distinct from each other were interfacial tensions. These structurally-diverse compounds include lipopeptides, selected and then isolated and purified on Nutrient Agar (NA) plates and were glycolipids, and phospholipids among others. Their surface-active characteristic incubated at 35°C for 24 h. paved the way for their applications in bioremediation, food processing, oil recovery, and pharmaceuticals, to name a few. They are also highly regarded as Phenotypic identification of the isolates more sustainable due to their capacity to endure a wider range of conditions, higher biodegradability, and low toxicity relative to their synthetic counterparts The colonial morphological characteristics of the isolates grown on NA plates (Banat et al., 2000). were noted. Gram-staining was also done to characterize the cellular In this study, local isolates of Bacillus spp. from soil were screened for morphologies of the isolates. A number of biochemical tests were employed biosurfactant production and then tested for their capability to inhibit biofilm including lecithinase test, catalase test, oxidase test, indole test, methyl red test, formation. Vogues-Proskauer test, citrate utilization and motility test. To further characterize and differentiate the isolates, their metabolic profiles were determined using a variety of carbohydrates including triple sugar iron agar test, mannitol, xylose, arabinose, and sorbitol. Isolates which showed characteristics typical of Bacillus species based on literature were selected.
245
J Microbiol Biotech Food Sci / Guzman et al. 2020 : 10 (2) 245-248
Preparation of crude biosurfactants washed with distilled water to remove planktonic cells. The biofilms adhering to the wells were then stained with 125 µL 0.1% crystal violet for 15 min. The wells The crude biosurfactants were extracted according to the method of Hisham et al. were again washed to remove excess dye. The stained biofilms were dissolved (2019) with few modifications. The isolates were grown statically in Tryptic Soy using 125 µL 30% acetic acid and were left for 15 min at room temperature to Broth (TSB) (Oxoid, UK) at 35°C for 24 h. Afterwards, the cultures were allow them to solubilize. Afterwards, the absorbance (OD 550 nm) of each well centrifuged at 10,000 rpm for 10 min and the supernatants were collected, and was measured using a spectrophotometer to quantify the biofilms formed then filtered using 0.22-µm syringe filter to obtain cell-free supernatants (CFS). (O'Toole, 2011). The CFS of the isolates were used to screen for biosurfactants. Percentage (%) Biofilm Inhibition was computed using this formula (Karnjana et Screening for biosurfactant production al., 2019):
Oil dispersion assay (퐴푏푠퐶표푛푡푟표푙 − 퐴푏푠푇푟푒푎푡푒푑) % 퐵𝑖표푓𝑖푙푚 퐼푛ℎ𝑖푏𝑖푡𝑖표푛 = (100) 퐴푏푠퐶표푛푡푟표푙 Twenty milliliters of distilled water was placed in a Petri dish, followed by the overlaying of 20 µL of engine oil on the surface. Thereafter, 10 µL of CFS was Quorum Sensing (QS) inhibition assay added onto the center of the pre-formed oil layer (Youssef et al., 2004). The oil displaced circles formed by CFS were visualized under visible light. TSB was The crude biosurfactants were subjected to disk diffusion assay against used as the negative control in all the assays performed with CFS. Chromobacterium violaceum ATCC 12472. Standardized inocula were spread evenly and disks impregnated with the crude biosurfactants were placed on Parafilm M test MHA. TSB served as the negative control. The plates were incubated at 30 °C for 24 h. The presence of an opaque halo of which growth without pigmentation is Ten microliters of the CFS were dropped on the hydrophobic surface of a observed signified the inhibition of QS (McClean et al., 1997). Parafilm M strip. The shape of the drop was observed after 1 min of incubation. The drop is positive for biosurfactants if it became flat, otherwise, if it remained Statistical analysis dome-shaped, it indicates the absence of biosurfactants (Korayem et al., 2015). TSB served as the negative control. Statistical analysis was performed using IBM SPSS Statistics 2.0 software. One- way Analysis of Variance (ANOVA) was employed to determine the existence of Molecular identification of biosurfactant-producing isolates significant differences among the ZOGIs and the absorbance values of the different concentrations of crude biosurfactants. Similarly, ANOVA was used to The isolates which showed the ability to produce biosurfactants were selected for compare the treatments with the controls. To determine where the significant molecular identification. DNA extraction and PCR amplification were performed difference lies, Tukey's post hoc test was conducted. using Phire Plant Direct PCR Mastermix (Thermofisher Scientific, USA). The DNA sequences were amplified through PCR for 40 cycles using general RESULTS AND DISCUSSION bacterial 16S rRNA primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’). The PCR conditions were as Isolation of biosurfactant-producing bacteria from soil follows: Initial denaturation at 98°C for 5 min; denaturation at 95°C for 5 s; annealing at 58.6°C for 5 s; extension at 72°C for 20 s; and final extension at A total of 12 isolates were collected from the soil samples (Figure 1). The 72°C for 1 min. The PCR products were then sent to Macrogen, Korea for isolates were screened for biosurfactant production using Oil Dispersion Assay. sequencing analyses. BLAST search was done to determine the identity of the One of the characteristics of a biosurfactant is its ability to alter surface tension isolates based on gene sequence similarity. Phylogenetic tree was constructed (Banat et al., 2000). The results showed that the CFS of four isolates (GAT-01, through Maximum Likelihood algorithm with MEGA 7 software. GAT-04, GAT-05, and GAT-07) were able to disperse the oil layer on the surface of the water which indicate the presence of biosurfactants. This method is Antibacterial activity selected since it is able to detect even low concentrations of biosurfactants, which is suitable for the screening of biosurfactant production (Youssef et al., 2004). Determination of Minimum Inhibitory Concentration (MIC)
Initially, a two-fold serial dilution of the crude biosurfactants (100 µL) was prepared in a 96-well microtitre plate. Thereafter, 100 µL of inoculum was added in each well. Similarly, TSB was also used as the negative control. Thereafter, the microtitre plates were incubated at 30°C for 24 h. Growth was indicated by the presence of white pellets at the bottom of the wells. The MIC is defined as the Figure 1 Presumptive Bacillus spp. from soil lowest concentration that yielded inhibition of growth (Guzman et al., 2018). To further verify the presence of biosurfactants, Parafilm M Test was employed. Determination of Minimum Bactericidal Concentration (MBC) The drops of CFS on Parafilm M strips were observed to become flat after incubation, thus, indicating the presence of biosurfactants (Figure 2). The results To confirm the results of the MIC and to determine the MBC, the contents of the were due to the interaction between the biosurfactants present in the CFS and the wells previously used to determine the MIC were streaked onto freshly-prepared hydrophobic surface of the Parafilm M strip (Korayem et al., 2015). TSA plates. The results of the MIC was confirmed when at least a single colony, an indication of growth, was observed. Meanwhile, the MBC was selected as the lowest concentration that showed absolutely no growth (Guzman et al., 2018).
Agar well diffusion assay
The agar well diffusion method was used to determine the antibacterial activity of the crude biosurfactants against P. aeruginosa ATCC 27853. Using a sterile Figure 2 Parafilm M test. cotton swab, standardized cell suspension was inoculated by spreading evenly over the surface of the Mueller-Hinton Agar (MHA). The plates were left to dry Phenotypic and genotypic identification of isolates and a sterile cork borer (5 mm) was used to cut uniformly-sized wells in the agar. One hundred (100 µL) of the different concentrations of the crude biosurfactants The four biosurfactant-producing isolates (GAT-01, GAT-04, GAT-05, and were added on each well. TSB also served as the negative control. The plates GAT-07) were selected and preliminarily identified as Bacillus spp. based on were then incubated at 30°C for 24 h, and the zones of growth inhibition (ZOGI) their morphological and biochemical characteristics (Figure 3). Previous reports were measured using a Vernier caliper (Guzman et al, 2018). show that members of Bacillus spp. isolated from soil were capable of producing biosurfactants (Joshi et al., 2012; Zhou et al., 2015). Biofilm inhibition assay
The crude biosurfactants were tested against P. aeruginosa ATCC 27853. First, a two-fold serial dilution of the crude biosurfactants (100 µL) was prepared in a 96-well microtitre plate. TSB served as the negative control. Afterwards, 100 µL of the inoculum was added in each well. The microtitre plates were incubated at 30°C for 24 h. Thereafter, the contents of the wells were carefully discarded and
246
J Microbiol Biotech Food Sci / Guzman et al. 2020 : 10 (2) 245-248
Biosurfactants from Bacillus spp. inhibit biofilm in P. aeruginosa
The different concentrations of the four crude biosurfactants (GAT-01, GAT-04, GAT-05, GAT-07) were tested for their ability to inhibit biofilm formation on P. aeruginosa ATCC 27853 (Figure 5). The results showed that all four crude biosurfactants were able to significantly inhibit biofilm formation when compared with the control (p < 0.001). GAT-01 was able to inhibit biofilm formation even at the highest dilution (10-9) (p < 0.001), and was able to yield the greatest activity (43.12%) at the starting concentration (100). Furthermore, both GAT-04 (p < 0.05) and GAT-05 (p < 0.001) were only able to inhibit until the 10- 8 dilution. However, no significant difference (p = 0.296) was observed at the 100 -1 -1 Figure 3 Gram-stain reaction of presumptive Bacillus spp. under the light and 10 dilutions for GAT-04, signifying that at 10 , the crude biosurfactants were able to yield the highest activity (32.42%). Whereas, the starting microscope (1000x) 0 concentration 10 was able to yield the highest activity (35.78%) for GAT-05. Molecular identification through the amplification of 16S rRNA gene of the four Similarly, GAT-07 was also able to inhibit biofilm formation until the highest dilution 10-9 (p < 0.001) and was also able to yield the highest activity of 26.91% selected biosurfactant-producing isolates was conducted (Figure 4). Based on 0 sequence similarity, GAT-01 and GAT-05 were identified as B. pseudomycoides. at the starting concentration (10 ). A strain of B. pseudomycoides isolated from oil-contaminated soil was previously The results showed that GAT-01 yielded the highest activity among the crude observed to be a potent producer of biosurfactants. Further characterization of its biosurfactants used (p < 0.05). No significant differences, however, was observed biosurfactant showed that the compound is a cyclic lipopeptide (Li et al., 2016). between GAT-04 and GAT-05 (p = 0.439). Lastly, GAT-07 showed the lowest Furthermore, isolate GAT-07 was identified as B. mycoides. A previous study on activity among the four crude biosurfactants (p < 0.05). a B. mycoides strain isolated from an Iranian oil field showed its capability to 50 produce a lipopeptide biosurfactant that was able to reduce surface tension by 34 mN/m (Najafi et al., 2010). Lastly, GAT-04 was identified as B. cereus. An 40 earlier report of a cadmium-tolerant B. cereus strain isolated from coffee grain showed its capability to produce biosurfactants composed mostly of proteins and 30 lipids (Velasquez-Aradillas et al., 2011). A heavy metal-tolerant strain of B. GAT-01 cereus from a similar study was able to yield biosurfactants which were identified 20 GAT-04 as a lipopeptide (Sriram et al., 2011). These results present the potential of exploiting locally-isolated strains of Bacillus spp. in the production of GAT-05 biosurfactants. 10 GAT-07
0 % Biofilm Inhibition Biofilm %
Dilution factor
Figure 5 Biofilm inhibition activities of crude biosurfactants from Bacillus spp.
The results of the biofilm inhibition assays agree with previous studies that showed that biosurfactants from Bacillus sp. possess antibiofilm properties against a number of bacterial species (Freire et al., 2009; Rivardo et al., 2009). Moreover, a previous work states that purified lipopeptide biosurfactants from Bacillus sp. are capable of inhibiting biofilm formation in P. aeruginosa at around 40% to 50% (Sriram et al., 2011). Interestingly, one of the biosurfactants in this study, GAT-01, which yielded the highest activity among all tested biosurfactants, was able to exert an activity (43.12%) comparable to that of previous studies. Therefore, the purification and isolation of the biosurfactants of this isolate may further enhance its biofilm-inhibitory activity.
Figure 4 Phylogenetic tree of the biosurfactant-producing isolates.
Antibacterial activity of Bacillus spp.
The MICs of all the isolates were determined using two-fold serial dilution assay. The results showed that all the concentrations were able to yield growth as evident from the turbidity and white pellets at the bottom of the wells, hence, the Figure 6 Quorum sensing inhibition assay of crude biosurfactants against C. MIC was not determined. To confirm the results of the MIC, the MBC of the violaceum ATCC 12472 isolates were also determined. After streaking the contents of the wells used in the determination of MIC onto freshly-prepared NA plates, growth was observed To provide a putative mechanism as to how the crude biosurfactants were able to after incubation at all the concentrations. These results signified the possibility inhibit biofilm formation, quorum sensing inhibition (QSI) assay was done for all that the crude biosurfactants of all the isolates do not have any antibacterial the biosurfactants in this study. Biofilm formation was proven to be dependent on activity against P. aeruginosa ATCC 27853. However, previous studies showed quorum sensing, a cell-to-cell bacterial communication system exploiting the that lipopeptide biosurfactant from Bacillus cereus NK1 have antimicrobial interactions between extracellular autoinducers and receptors found on the cells activities against select Gram-negative and Gram-positive organisms as well as to initiate the transcription of a number of virulence factors including biofilm against the yeast Saccharomyces cerevisiae (Sriram et al., 2011). Similarly, formation (Miller and Bassler, 2001). The results of the QSI assays using the lipopeptide biosurfactant from Bacillus subtilis SPB1 showed antifungal activity biosensor strain C. violaceum ATCC 12472 revealed that the crude biosurfactants against Rhizoctonia sp. (Mnif et al., 2015). were not able to inhibit quorum sensing (Figure 6). Hence, the crude Hence, to further confirm the results, agar well diffusion assay was done. The biosurfactants did not act on the different mechanisms involved in quorum different concentrations did not show any zones of inhibition. Therefore, the sensing, but may have modulated the formation of biofilm through other means. crude biosurfactants of all the isolates indeed do not have antibacterial activities. Instead, these surface-active compounds may have lowered the hydrophobicity Nonetheless, crude biosurfactants were used in this study, wherein there might be resulting in the exposure of negatively-charged groups of the surface (Quinn et negative pharmacodynamic interactions between the compounds present similar al., 2012). The biosurfactants may have also bound to the lipopolysaccharide of to those of the crude extracts in plants (Rasoanaivo et al., 2011), hence, the P. aeruginosa, thereby, increasing the net charge of the cells (Astuti et al., 2018). obtained results on the antibacterial assays. This resulted in the electrostatic repulsion between them and the negatively- charged surface, thus inhibiting the formation of biofilms or resulting in the formation of weak biofilms (Gomes and Nitschke, 2012; Kuiper et al., 2004).
247
J Microbiol Biotech Food Sci / Guzman et al. 2020 : 10 (2) 245-248
CONCLUSION sensing and Chromobacterium violaceum: Exploitation of violaceinproduction and inhibition for the detection of N-acylhomoserine lactones. Microbiology. The growing interest in the novel means of combating bacterial infections, 143(12):3703-3711. https://doi.org/10.1099/00221287-143-12-3703 including inhibition of bacterial mechanisms, paved the way to look for new Miller, M. & Bassler, B. (2001) Quorum sensing in bacteria. Annu Rev bioactive compounds. These include surface-active compounds produced by Microbiol. 55:165-199. https://doi.org/10.1146/annurev.micro.55.1.165 microorganisms called biosurfactants. In this study, four out of 12 isolated Mnif, I., Gran-Campistany, A., Coronel-Leon, J., Hammami, I., Triki, M., Bacillus spp. from different soil samples were able to produce biosurfactants. Manresa, A. & Ghribi, D. (2015). Purification and identification of Bacillus These crude biosurfactants also showed biofilm inhibitory activities against P. subtilis SPB1 lipopeptide biosurfactant exhibiting antifungal activity against aeruginosa ATCC 27853, may be through the modulation of cell-surface Rhizoctonia bataticola and Rhizoctonia solani. Environ Sci Pollut Res. hydrophobicity, with one of the biosurfactants yielding a relatively high activity 7:6690-6699. http://doi.org/10.1007/s11356-015-5826-3 comparable to that of previous studies. Hence, this shows the potential use of Najafi, A., Rahimpour, M., Jahanmiri, A., Roostaazad, R., Arabian, D., & locally-isolated Bacillus spp. from soil in the production of biosurfactants and Ghobadi, Z. (2010). Enhancing biosurfactant production from an indigenous utilization in combating bacterial infections through the inhibition of biofilm strain of Bacillus mycoides by optimizing the growth conditions using a response formation. Isolation, purification, and further characterization of these surface methodology. Chem Eng J. 163:188-194. compounds may enhance its effectiveness. http://doi.org/10.1016/j.cej.2010.06.044 O’Toole, G. (2011). Microtiter Dish Biofilm Formation Assay. JoVE. 47:1-2. Acknowledgments: The researchers would like to express their gratitude to Prof. http://doi.org/10.3791/2437 Paul Williams and Prof. Matthew Fletcher of the Centre for Biomolecular O’Toole, G., Kaplan, H. & Kolter, R. (2000). Biofilm formation as microbial Sciences, University of Nottingham, United Kingdom for the biosensor strain; the development. Annu Rev Microbiol, 54:49-79. Environment and Biotechnology Division of the Industrial Technology https://doi.org/10.1146/annurev.micro.54.1.49 Development Institute, Department of Science and Technology for the assistance Quinn, G., Maloy, A., McClean, S., Carney, B., & Slater, J. (2012). Lipopeptide on the conduct of assays; Ms. Christine Eden Cortez of the Service Laboratory biosurfactants from Paenibacillus polymyxa inhibit single and mixed species Group of the Food and Nutrition Research Institute for the help in the use of biofilms. Biofouling, 28(10), 1151–1166. microplate reader; Dr. Thomas Edison dela Cruz of The Graduate School, http://doi.org/10.1080/08927014.2012.738292 University of Santo Tomas for his input; and Ms. Sheila Mantaring for Rasoanaivo, P., Wright, C., Wilcox, M. & Gilbert, B. (2011). Whole plant extract proofreading the manuscript. versus single compounds for the treatment of malaria: synergy and positive interactions. Malaria J. 10(1): 1-12. https://doi.org/10.1186/1475-2875-10-s1-s4 REFERENCES Rivardo, F., Turner, R., Allegrone, G., Ceri, H. & Martinotti, M. (2009). Anti- adhesion activity of two biosurfactants produced by Bacillus spp. prevents Astuti, D., Purwasena, I., & Putri, F. (2018). Potential of biosurfactant as an biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol alternative biocide to control biofilm associated biocorrosion. J. Environ Sci 83:541-553. https://doi.org/10.1007/s00253-009-1987-7 Technol. 11:104-111. http://doi.org/10.3923/jest.2018.104.111 Sriram, M., Kalishwaralal, K., Deepak, V., Gracerosepat, R., Sriskathi, K. & Banat, I., Makkar, R. & Cameotra, S. (2000). Potential commercial applications Gurunathan, S. (2011). Biofilm inhibition and antimicrobial action of lipopeptide of microbial surfactants. Appl. Microbiol Biotechnol, 53: 495-508. biosurfactant produced by heavy metal tolerant strain Bacillus cereus NK1. https://doi.org/10.1007/s002530051648 Colloids and Surfaces B, 85:174-181. Costerton, J., Stewart, P. & Greenberg, E. (1999). Bacterial Biofilms: A common https://doi.org/10.1016/j.colsurfb.2011.02.026 cause of persistent infections. Science, 284: 1318-1322. Tenover, F.C. (2009). Antibiotic susceptibility testing. In: Schaechter M, ed. http://doi.org/10.1126/science.284.5418.1318 Encyclopedia of Microbiology. 3rd ed. USA: Elsevier 67-77 Donlan, R. (2001). Biofilm Formation: A clinically relevant microbiological Valle, J., Da Re, S., Henry, N., Fontaine, T., Balestrino, D., Latour-Lambert, P., process. Healthcare Epidemiology: Clinical Infectious Diseases, 33: 1387- & Ghigo, JM. (2006). Broad-spectrum biofilm inhibition by a secreted bacterial 1392. https://doi.org/10.1086/322972 polysaccharide. PNAS, 103(33): 12558-12563. Freire, D., de Araujo, L., Kronemberger, F. & Nitschke, M. (2009). Velasquez-Aradillas, J., Toribio-Jimenez, J., Gonzalez-Chavez, M., Bautista, F., Biosurfactants as emerging additives in food processing. Innovation in Food Cebrian, M., Esparza-Garcia, F., & Rodriguez-Vazquez, R. (2011). Engineering: New Techniques and Products. CRC Press: USA. Characterisation of a biosurfactant produced by a Bacillus cereus strain http://doi.org/10.1201/9781420086072-c23 tolerant to cadmium and isolated from green coffee grain. World J Gomes, M., & Nitschke, M. (2012). Evaluation of rhamnolipid and surfactin to Microbiol Biotechnol. 27:907-913. http://doi.org/1 0.1007/s11274-010-0533- 1 reduce the adhesion and remove biofilms of individual and mixed cultures of Walencka, E., Rozalska, S., Sadowska, B. & Rozalska, B. (2008). The influence food pathogenic bacteria. Food Control. 25(2): 441-447. of Lactobacillus acidophilus-derived surfactants on Staphylococcal adhesion and https://doi.org/10.1016/j.foodcont.2011.11.025 biofilm formation. Folia Microbiol, 53(1): 61-66. Guzman, J., Cortes, A., Neri, K., Cortez, C., & De las Alas, T. (2018). https://doi.org/10.1007/s12223-008-0009-y Antibacterial and Antibiofilm Activities of Sesbania grandiflora Against Youssef, N., Duncan, E., Nagle, D., Savage, K., Knapp, R. & McInerney, M. Foodborne Pathogen Vibrio cholerae. J App Pharm Sci, 8(03): 067-071. (2004). Comparison of methods to detect biosurfactant production by diverse http://doi.org/10.7324/JAPS.2018.8310 microorganisms. J Microbiol Met, 56:339-347. Hisham, N, Ibrahim, M., Ramli, N., & Abd-Aziz, S. (2019). Production of https://doi.org/10.1016/j.mimet.2003.11.001 Biosurfactant Produced from Used Cooking Oil by Bacillus sp. HIP3 for Heavy Zhou, H., Chen, J., Yang, Z., Qin, B., Li Y., & Kong, X. (2015). Biosurfactant Metals Removal. Molecules. 24(14): 1-16. production and characterization of Bacillus sp. ZG0427 isolated from oil- https://doi.org/10.3390/molecules24142617 contaminated soil. Ann Microbiol. 65(4): 2255-2264. http://doi.org/1 Joshi, S., Suthar, H., Yadav, A., Hingurao, K., & Nerurkar, A. (2012). 0.1007/s13213-015-1066-5 Occurrence of Biosurfactant Producing Bacillus spp. in Diverse Habitats. ISRN Biotechnol. 2013:1-6. http://doi.org/10.5402/2013/652340 Karnjana, K., Soowannayan, C. & Wongprasert, K. (2019). Ethanolic extract of red seaweed Gracilaria fisheri and furanone eradicate Vibrio harveyi and Vibrio parahaemolyticus biofilms and ameliorate the bacterial infection in shrimp. Fish Shellfish Immunol. 88:98- 101. http://doi.org/10.1016/j.fsi.2019.01.058 Korayem, A.S., Abdelhafez, A.A., Zaki, M.M. & Saleh, E.A. (2015). Optimization of biosurfactant production by Streptomyces isolated from Egyptian arid soil using Plackett-Burman design. Ann. Agric. Sci. 60(2): 209-217. https://doi.org/10.1016/j.aoas.2015.09.001 Kuiper, I., Lagendijk, E., Pickford, R., Derrick, J., Lamers, G., Thomas-Oates, J., Lugtenberg, B. & Bloemberg, G. (2004). Characterization of two Pseudomonas putida lipopeptide biosurfactants, putisolvin I and II, which inhibit biofilm formation and break down existing biofilms. Mol Microbiol, 51(1):97-113. https://doi.org/10.1046/j.1365-2958.2003.03751.x Li, J., Deng, M., Wang, Y., & Chen, W. (2016). Production and characteristics of biosurfactant produced by Bacillus pseudomycoides BS6 utilizing soybean oil waste. Int Biodeterior Biodegradation. 112: 72-79. http://dx.doi.org/10.1016/j.ibiod.2016.05.002 McClean, K., Winson, M., Fish, L., Taylor, A., Chhabra, S., Camara, M., Daykin, M., Lamb, J., Swift, S., Bycroft, B., Stewart, G., & Williams, P. (1997). Quorum
248
PURIFICATION AND CHARACTERIZATION OF AN ENDOGLUCANASE PRODUCED FROM Streptomyces sp. STRAINBPNG23
Azzeddine Bettache*1,2, Estelle Copinet2, Zahra Azzouz1, Nawel Boucherba1, Cilia Bouiche1, Samir Hamma1, Rima Maibeche1, Francis Duchiron2, Said Benallaoua1
Address(es): Azzeddine Bettache 1Laboratoire de Microbiologie Appliquée, faculté des sciences de la nature et de la vie, université de Bejaia, 06000 Bejaia, Algéria. 2UMR FARE 614 INRA/URCA. Laboratoire de Microbiologie Industrielle, UFR Sciences, université de Reims Champagne-Ardenne, Moulin de la Housse, 51687 Reims, France.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.284-288
ARTICLE INFO ABSTRACT
Received 25. 5. 2018 Streptomyces sp. strain BPNG23 produces five endoglucanases: endo1, endo 2, endo 3, endo 4 and endo 5.The endo2 has been purified Revised 21. 6. 2020 and characterized by two subsequent purification steps with ultrafiltration and anion exchange chromatography. The specific activity of Accepted 29. 6. 2020 the endoglucanase has been found to be 380.65 U/mg. The molecular weight to the endoglucanase 2 has been estimated with sodium Published 1. 10. 2020 dodecyl sulfate-polyacrylamide gel electrophoresis, revealing that this isoenzyme is a 66 KDa monomeric enzyme. It showed an optimum temperature and pH values respectively of 6.0 and 50 °C. It was thermostable, it exhibited a half-life time 6 h with a temperature of 50 °C, the enzyme was activated by several metal ions Mn+2, NH4+, Zn2+, Ca2+, Fe2+, Ni2+ and Co2+. It presents a higher Regular article affinity towards carboxymethyl cellulose (CMC) with a Km of 6.37 mg/mL and Vmax of 0.056 μmol/mn. This the first of a study of purification and characterization of an endoglucanase produced by a newly isolated actinobacteria strain in Kabylia region (Algeria).
Keywords: Streptomyces, endoglucanase, purification, characterization, wheat bran
INTRODUCTION more active cellulase or developing low-cost methods of pretreatment for the substrates, by making more accessible them suitable for enzymatic degradation. Cellulose is one of the most abundant organically produced compounds available Thus, to mitigate of this problem, the purpose of the present study has been in the world and is a kind of sustainable energy which human beings are able to purified and characterized an endoglucanase producing by Streptomyces sp. strain easily utilize (Bataillon et al., 2000). The previous research studies have shown BPNG23. the occurrence of several various bacterial and fungal cellulases which can be classed in three different types: endoglucanases (EC 3.2.1.4), exoglucanases (EC MATERIAL AND METHODS 3.2.1.91) and β-glucosidases (EC 3.2.1.21) (Battan et al., 2007). However, a complete degradation of cellulose implies a complex interaction with different Microbial strain cellulolytic enzymes. It was widely agreed and accepted for three types of cellulolytic enzymes which include endoglucanases (EC 3.2.1.4) hydrolyze Strain BPNG23 was isolated from forest soil of Bejaia in Kabylia region randomly internal glycosidic linkages in cellulose, whereas exoglucanases cleave (Algeria). The strain was selected for its potential to produce endoglucanase long chains of the ends in the progressive chain, β-glucosidases transform enzymes. The 16S rRNA gene sequence of the strain BPNG23 has been cellobiose into glucose (Beg, 2001). deposited in GenBank Streptomyces under accession number “JQ678705”. Cellulase is used in bio-fuels biomass fermentation, though the process was relatively experiential in the present. Cellulase has been used for a treatment of Preparation of extracellular crude enzyme phytobezoars, as a form for cellulose bezoar located in the human stomach (Béguin and Aubert, 1994). Cellulases attracted attention with their various For the cellulases production, 3% pre-culture of Streptomyces sp. strain BPNG23 applications in both medical and industrial applications. For example, they have was cultured in medium based on wheat bran: yeast extract (10 g/L), NH4Cl (2.5 been used in decreasing the high level of serum cholesterol, by improving g/L), MgSO4 (0.4 g/L), NaCl (2 g/L) and 10 g/L of wheat bran. The pH was nutrient quality and digestibility (Blanco et al., 1999), in animal feed (Mandels, adjusted to 7 and the incubation was performed at 28°C at under agitation rate of 1985), in waste/water management (Biely and Mackenzie, 1986), in textile ( 100 rpm, finally the fermentation broth was centrifuged at 10,000×g for 10 biodegradable textile and producing washed look of denim, etc.) (Cavaco-Paulo, minute at 4°C. 1998; Celestino and Felix, 2006), in the pulp and the paper industry, and starch transformation (Beg, 2001), in breach and wine-making and in house keep Purification of the enzyme washing detergents (Mandels, 1985). Actinobacteria are Gram positive filamentous soil bacteria which as the first The supernatant culture contains secreted cellulases, was concentrated using producers from a large variety of antibiotics and the important bioactive Minimate PALL system, (France, 10KDa cut-off membrane Millipore, 20 cm x compounds and enzymes, among them major industrial enzymes implicated in 3.8 cm x 1.8 cm). The concentrated crude enzyme (2 mL) was applied to AKTA lignocelluloses conversion (Blanco et al., 1999). The degradation of cellulose, Explorer 10 (England) equipped with a strong anion-exchange column Q hemicelluloses and lignin, that are abundant of plants, various strains from the Sepharose (Hitrap, 5mL) equilibrated with 50 mM Tris–HCl buffer (pH 8.5). Streptomyces genus were studied, and were found as good cellulase producers Protein was eluted using NaCl gradient (0–1M) in 50 mM Tris–HCl buffer (pH (Budihal and Patil, 2016; Shaik et al., 2017; Wu et al., 2017; Gobalakrishnan 8.5) at a flow rate of 4 mL/min. A total of number fractions (2mL in each test and Sivakumar, 2017; Schrempf, 2017; Kumarand Henehan, 2017). tube) have been collected and assessed by enzyme activity with protein Commercial production and efficient utilization of cellulases are infested with quantification. many problems. For increasing the efficiency of the process, we could search of a
284
J Microbiol Biotech Food Sci / Bettache et al. 2020 : 10 (2) 284-288
Analytical methods Effect of metal ions and reagents on endoglucanase activity
SDS-PAGE and zymogram analysis of endoglucanase For the investigation the effects of diverse metal ions on endoglucanase activity, the solutions with 5 mM of Na+, Mg2+, Ca2+, Mn2+, Fe2+, Zn2+, Cu2+, NH4+, The crude enzyme (25 µg) in the sample treatment buffer has been boiled for 5 Hg2+, K+, Ni2+, Sr2+ and Co2+ were additioned in the reaction mixtures which min and was submitted to sodium dodecyl sulfate-polyacrylamide gel contained the purified endoglucanase into 50 mM sodium phosphate buffer (pH electrophoresis utilizing 10% polyacrylamide. Electrophoresis was carried out 7. 0), the reaction mixture was considered as control without any additive and the using Mini-Gel Electrophoresis unit (Biorad, France).This analysis was activity of endoglucanase was determined to be 100%. Effect of some inhibitors / performed by Laemmli method, 1970. After the electrophoresis, 0.1% of CMC chelators: ethylenediaminetetraacetic acid (EDTA), sodium dodecyl sulfate has been incorporated into running polyacrylamid gel, on completion by (SDS), dithiothreitol (DTT) and phenylmethanesulfonyl fluoride (PMSF) were electrophoresis; the gel has been cut into two parts. One part has been utilised for also tested. Coomassie brilliant blue R-250 staining and the other has been utilised for zymography. This analysis was performed using the basic protocol; the gel was Kinetic parameters soaked in triton X-100 at 2.5% (w/w) for 30 min, and then incubated in the phosphate buffer 50 mM (pH 7.0) for 30 min at 50°C. The gel was reavaled using The effect of carboxymethyl cellulose, varying from 1 to 10 mg/mL on 0.1% Congo red solution for 15 min at room temperature (15°C), thereafter endoglucanase activity was assessed at optimal assay conditions (50°C, pH 6.0). washing 1M NaCl and inserted in 0.5% acetic acid for exposing the Kinetic parameters were evaluated using linear regression of double-reciprocal endoglucanase active bands that contrasts to the dark background. plots according to Lineweaver-Burk, and all tests were carried out in triplicate.
Enzymatic assay and protein quantification RESULTS AND DISCUSSION
The supernatant of the fermentation broth has been used for determining the Purification of endoglucanase endoglucanase activity; it was assayed using 20g/L (w/v) carboxymethyl cellulose such as the substance that has been suspended in a 50 mM sodium After 7 days of fermentation, the medium was centrifuged and the activity was phosphate buffer (pH 7.0). The reaction mixture has been compounded of 250 µl measured in the culture supernatant. The endoglucanase activity obtained was 1.2 substrate and 250 µl of crude enzyme. The reaction mixture has been incubated at U/mL, with specific activity of 1.81 U /mg protein. The culture supernatant was 50°C during 30 min. The releasing reducing sugar has been measured using the concentrated 20-fold by ultrafiltration to obtain a final volume of 50 mL. At this 3,5- dinitrosalicylic acid (DNS). The reducing sugar liberated has been measured step, impurities having a molecular weight equal or less than 10 kDa were at 540 nm, utilizing a standard curve with glucose absorbance generated as the eliminated. This explains the decrease of protein in the culture supernatant from standard, in which one unit (U) of endoglucanase activity has been defined as the 660 mg to 22.5 mg in the retentate. The specific activity after ultrafiltration was amount of enzyme that Releases 1 µmol glucose/min/mL in the above conditions. 23.11U /mg protein. This step improved the purity of the enzyme so that its Protein has been quantified using Bradford method (Bradford, 1976), utilizing specific activity was 1.81U/mg in crude supernatant. The yield of this bovine serum albumin as the standard. Enzymatic activity and protein assays purification process was estimated at 43.3% with a purification factor of 12.76. have been performed in triplicate.
Characterization of the enzyme Anion exchange chromatography
Molecular weight estimation The chromatogram shows seven protein peaks including three with endoglucanase activity for 0.15 M, 0.35 M and 0.6 M of NaCl (figure 1). All The molecular weight for the purified protein has been evaluated using the proteins were eluted once the NaCl gradient was realized, this, indicate that the method of Laemmli, 1970 employing sodium dodecyl sulphate-polyacrylamide protein fractions were retained by the column. The negatively charged proteins gel electrophoresis. are retained on the column while the neutral and positively charged proteins will be eluted first. Effect of pH and temperature
The endoglucanase activity has been evaluated at various temperatures (ranging from 30-70°C) and pH values (pH 4-5, sodium acetate; pH 6-7, sodium phosphate pH 8-9 and 10, Tris-HCl) under the method previously described.
Thermostability
Thermostability of endoglucanase has been established by incubating the samples with substrate in a 50 mM sodium phosphate buffer (pH 6.0) from temperatures of 40, 50 and 60°C with an interlude period between 1 and 10 hours. The residual endoglucanase has then been determined by the DNS method.
Substrate specificities
The substrate specificities for the endoglucanase purified were established with the following substrates: 20g/Lbirchwoodxylan, 20g/Lavicel, 20g/L cellobiose Figure 1Proteins quantification and elution profil of endoglucanase activity on and 20 g/L carboxymethyl cellulose prepared in 50 mM sodium phosphate buffer Qsepharose HI Trap 5mL. (pH 7.0).
A synthesis for a representative purification procedure was presented in table 1.
Table 1 Purification steps of endoglucanases from Streptomyces sp. strain BPNG23 Purification Total volume Total proteins Specific activity Purification Volume (mL) Yield (%) steps activity (U) (mg) (U/mg) Factor Culture 1000 1200 660 1.81 100 1 supernatant Ultrafiltration 50 520 22.5 23.11 43.3 12.76 A:12 0.037 324.32 2.3 14.03 Anion exchange 50 B: 7.5 0.048 154 1.44 6.66 chromatography C: 19.5 0.22 88.6 3.75 3.83
Anion exchange chromatography was the supreme step in the purification of exchange chromatography gives a purification yield of 9.06 with a Bacillus sp endoglucanases, the yield decreased respectively to 2.3, 1.44 and 3.75% for the strain M-9 (Bajaj et al., 2009)and 17.5 for Cellulomonas sp. YJ5 (Theberge et three proteins A, B and C. After each purification step the specific activity of the al., 1992). enzyme increased, the final yield was increased more than 14-fold. It was previously reported than ammonium sulfate precipitation following with anion Enzyme characterization
285
J Microbiol Biotech Food Sci / Bettache et al. 2020 : 10 (2) 284-288
Molecular weight incubation, the relative activity decreased dramatically (figure 4). The endoglucanases of Streptomes sp. strain BPNG23 exhibit similar optimal There were five distinct endoglucanases were detected on zymogram analysis, temperatures to those described forFusarium oxysporum (50 and 55°C) called: Endo1, Endo2, Endo3, Endo4 and Endo5, in which the molecular weights (Christakopoulos, 1995), but with higher thermal stability. were 97 KDa, 66 KDa, 62.5 KDa, 53 KDa and 50 KDa, respectively, more details are given in our paper (Bettache et al., 2013). The enzyme purified appears of being homogeneous since it migrated in a single band in SDS-PAGE (figure 2). From the zymogram and the SDS-PAGE profil, it was found of the molecular weight of the endoglucanase A was 66 KDa, which corresponds to endoglucanase 2 found in the concentrated supernatant (figure 2). Some molecular weights of CMCases produced by various microorganisms were reported: 33 KDa for the CMCase from Bacillus sp (Gupta and Vadehra, 1990), 70 kDa in Neurospora crassa (Yazdi et al., 1990),the endoglucanases obtained from Trichoderma viride have molecular weights of 38, 42, 52 and 60 kDa (Kim et al., 1994), 38 kDa for Thermomonospora (George and Rao, 2001), 38 and 74 kDa for Anabaena laxa (Gupta et al., 2012).
Figure 4 Thermostability of endoglucanase A in the presence of substrate
Substrate specificity
The results show that the purified endoglucanase has more affinity for CMC with a relative activity of 100%. It also degrades cellobiose with a relative activity of 15.35%. For avicel and birch xylan, endoglucanase has no relative activity (figure 5). The use of a variety of polysaccharides checks that the enzyme purified in the present study was an endoglucanase. The "endo" nature of the endoglucanase was confirmed by its high activity on carboxymethyl cellulose and no hydrolysis of the crystalline cellulose (Béguin and Aubert, 1994). Trichodermareeseiendoglucanase also revealed hydrolytic activity on a wide
range of substrates, namely β-glucan, carboxymethyl cellulose, Figure 2 Migration profile of endoglucanase A (SDS-PAGE) and zymogram (a: hydroxyethylcellulose, xylan, methylumbelliferyl-β-D-cellobioside and protein profil; b: Zymogram, c: SIGMA markers) methylumbelliferyl-β -D-lactoside(Domain et al., 1998).
Effect of pH and temperature on enzyme activity
The purified endoglucanase showed good stability at pH 5.0-8.0, it posted optimum activity a pH 6 (figure 3b) and only 27.68% relative activity a pH 9.The optimum temperature for this endoglucanase activity as shown in Figure 3b at 50°C. Depending on the optimum temperature, enzymes can be classified such as mesophiles (40-60°C), thermophilic (50-80°C) and hyperthermophilic (>80°C) (Maheshwari and Bhat, 2000), most endoglucanases were stable between 50- 55°C (Lucas et al., 2001).The optimum CMCase temperature produced by Streptomyces sp. strain B-PNG23 was similar to those produced by B. amyloliquefaciens DL-3 (Lee et al., 2008). The thermophilic endoglucanases with optimal activity at 80°C were often reported by thermophilic microorganisms such as Fervidobacterium Nodosum (Wang et al., 2010), and Acidothermus cellulolyticus (Lindenmuth and Mcdonald, 2011). Figure 5 Substrate specificity of endoglucanase A. The effect of pH on the endoglucanase activity of Streptomyces sp. strain BPNG23 was evaluated at 50°C in a buffer system. The optimum pH of the Effect of metal ions and reagents on activity endoglucanase activity of the purified enzyme was 6. In general, endoglucanases are not active at low pH (Wang et al. 2010; Yu, 2012).The endoglucanase The endoglucanase from Streptomyces sp. strain BPNG23 was strongly produced by Streptomyces sp. strain BPNG23 was active in a wide pH range, stimulated by manganese (Mn2+) with a relative activity of 305.4%. The enzyme which proves to be an advantage for use under different reaction conditions or was also stimulated by Cu+2, NH+4, Zn+2, Ca+2, Fe+2, Ni+2 and Co+2, this may be biotechnology processes. due to the stabilization of the structure of the enzyme (table 2). Higher activity in the presence of Mn+2 and Co+2 ions was observed in the studies forAnabaena laxaendoglucanase(Gupta et al., 2012) and endoglucanase of Daldiniae schscholzii (Karnchanatat et al., 2008). However, an inhibitory effect by these two ions was observed for the endoglucanases of Penicillium purpurogenum (Lee et al., 2008) and Bacillus sp. (Yu, 2012). The purified endoglucanase was inhibited by SDS, EDTA, and DTT. Inhibition by EDTA suggests that the enzyme was a metalloprotein. In addition, DTT was a purified endoglucanase inhibitor, suggesting that disulfide bridges are essential for enzymatic activity. The lack of inhibition by PMSF suggests that the serine residue does not play an important role in catalytic activity (Annamalai and Elayaraja, 2013).
Figure 3 Effect of temperature (a) and pH (b) on the activity of endoglucanase A
Thermostability
At 40°C, the activity was stable it was not significant decrease of endoglucanase activity for 4 h. This enzyme showed a good stability at 50°C, with a half-life of 6 h. At 60°C, there was a sharp drop in relative activity (7.65%); after 4 h of
286
J Microbiol Biotech Food Sci / Bettache et al. 2020 : 10 (2) 284-288
Table 2 Effect of metal ions and chemical reagents on the activity of FEMS Microbiology, 13, 25–58. https://doi.org/10.1111/j.1574- endoglucanase A 6976.1994.tb00033.x Metal ions Metal ions and BETTACHE, A., MESSIS, A., COPINET, E., KECHA, M., BOUCHERBA, N., Relative activity Relative activity and chemical chemical BELHAMICHE, N., DUCHIRON, F., BENALLAOUA, S. (2013). Optimization (%) (%) reagents reagents and partial characterization of endoglucanase produced by Streptomyces sp. B- No 100 Na2+ 90.67 PNG23. Archives of Biological Sciences Belgrade,65 (2), 549–58. Ca2+ 115.09 Fe2+ 136.02 https://doi.org/10.2298/ABS1302549A Mg2+ 97.79 Sr2+ 99.87 BIELY, P., MACKENZIE, CR. (1986). Cooperativity of esterases and xylanases Zn2+ 110.6 Ni2+ 111. 83 in the enzymatic degradation of acetyl xylan. Bio/Technology 4 (8), 731–733. https://doi.org/10.1038/nbt0886-731 NH4+ 149.42 Co2+ 117.14 BLANCO, A., PILAR, D́ ., JESÚS, Z., PALMA, P., JAVIER PASTOR, FI. Hg2+ 107 PMSF 105.68 (1999). A Multidomain xylanase from a Bacillussp. with a region homologous to Cu2+ 152.75 DTT 80.7 + thermostabilizing domains of thermophilic enzymes. Microbiology 145 (8), K 96.83 SDS 86.55 2163–2170. https://doi.org/10.1099/13500872-145-8-2163 Mn2+ 305.4 EDTA 87. 36 BRADFORD, M.(1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Kinetic parameters Analytical Biochemistry, 72 (1–2), 248–254. https://doi.org/10.1016/0003- 2697(76)90527-3 The Km value is an amount from substrate necessary to achieve the half of initial BUDIHAL, SR., DAYANAND, A., SARVAMANGALA, RP. (2016). maximum speed of enzyme; it is also a measurement from the apparently affinity Bioresource technology enhanced production and application of from enzyme of its substrate. acidothermophilic Streptomyces cellulase. Bioresource Technology, 200, 706– The endoglucanase activity of the Streptomyces sp. strain BPNG23 was strongly 712. http://dx.doi.org/10.1016/j.biortech.2015.10.098 influenced by the substrate concentration. CAVACO-PAULO, A. (1998). Mechanism of cellulase action in textile A Lineweaver-Burk plot for the activity indicated that the km value of the processes.Carbohydrate Polymers, 37 (3), 273–277. -1 enzyme to carboxymethyl cellulose was 6.37 mg mL ; Vmax of this enzyme was https://doi.org/10.1016/S0144-8617(98)00070-8 -1 0.056 µmol mn . The endoglucanase with a lower Km for carboxymethyl CELESTINO, KR, CUNHA, RB., FELIX, CR. (2006). Characterization of a β- cellulose indicates a greater affinity for this substrate. glucanase produced by Rhizopus microsporusvar. microsporus, and its potential -1 The Km values of endoglucanase reported were 3.6 mg mL for Pseudomonas for application in the brewing industry. BMC Biochemistry,5, 7-23. fluorescens (Bakare et al., 2005), 4.97 mg mL-1 for the Actinobacteria anitratus https://doi.org/10.1186/1471-2091-7-23 strain, and 7.90 mg mL-1 for Branhamella sp (Ekperigin, 2007). Theberge et al., TAKASHIMA, S., IIKURA, H., NAKAMURA, A., HIDAKA, M., MASAKI, 1992 reported that the endoglucanase of Streptomyces lividans has a Vmax of 24.9 H., UOZUMI T. (1998). Isolation of the gene and characterization of the -1 U mg and Km of 4.2 mg mL . enzymatic properties of a major exoglucanase of Humicola grisea without a cellulose-binding domain. Journal of Biochemistry, 124(4), 717-725. CONCLUSION https://doi.org/10.1093/oxfordjournals.jbchem.a022172 EKPERIGIN, MM. (2007). Preliminary studies of cellulase production by Streptomyces sp. strain B-PNG23 was selected for its important productions of Acinetobacter anitratus and Branhamella sp. African Journal of Biotechnology, 6 endoglucanases. Purification of the endoglucanase of the B-PNG23 strain needed (1), 28–33.https://www.ajol.info/index.php/ajb/article/view/56088 three steps of purification: ultrafiltration, which gives a specific activity of 23.11 GEORGE, SP., ABSAR, A., MALA, BR. (2001). Studies on carboxymethyl and a purification factor of 12.76; anion exchange chromatography which was the cellulase produced by an alkalothermophilic actinomycete. Bioresource main step in the purification procedure, three endoglucanases were detected and Technology, 77(2), 171–175. https://doi.org/10.1016/S0960-8524(00)00150-4 eluted at different NaCl concentrations, at this phase the purification yield was GOBALAKRISHNAN, R., KANNAN, S. (2017). Systematic characterization of greater than 14; molecular sieving which followed the anion exchange potential cellulolytic marine Actinobacteria actinoalloteichussp. MHA15. chromatography step allowed to increase the specific activity (380.65 U/mg), Biotechnology Reports, 13, 30–36. https://doi.org/10.1016/j.btre.2016.12.003 thus eliminating a very large part of protein contaminants. The enzyme purified PRINCE, S., GUPTA, JK.,VADEHR, DV.,DUBE, DK. (1990). Purification and was found to be active in a broad range of pH and temperature, which suggests properties of an endoglucanase from a Bacillus Isolate. Enzyme and Microbial that the enzyme from this strain could be used in the bioconversion to Technology, 12(2), 132-137. https://doi.org/10.1016/0141-0229(90)90087-7 fermentable sugars of lignocellulosic biomass. GUPTA, V., RADHA, P., VIDHI, C., LATA, N. (2012). Biocatalysis and agricultural biotechnology biochemical , structural and functional Acknowledgments: This study was financially sustained by Directorate-General characterization of two novel antifungal endoglucanases from Anabaena laxa. for Scientific Research and Technological Development (DGRSDT)/ CNEPRU Biocatalysis and Agricultural Biotechnology 1(4), 338–347. Project, N° F00620140027. https://doi.org/10.1016/j.bcab.2012.08.001 KARNCHANATAT, A., AMORN, P., POLKIT, S., JITTRA, P., ANTHONY, J., REFERENCES WHALLEY, S., COLIN, DR., GEOFFREY, MG., PRAKITSIN, S. (2008). A novel thermostable endoglucanase from the wood-decaying fungus Daldinia ANNAMALAI, N., MAYAVAN, V., SIVARAMASAMY, E. (2013). eschscholzii. Rehm. Enzyme and Microbial, 42(5), 404–413. Thermostable, haloalkaline cellulase from Bacillus halodurans CAS 1 by https://doi.org/10.1016/j.enzmictec.2007.11.009 conversion of lignocellulosic wastes. Carbohydrate Polymers 94 (1), 409–415. DONG, WK., YOUNG, KJ.,YOUNG, HJ., JAE, KL. (1994). Purification and https://doi.org/10.1016/j.carbpol.2013.01.066 characterization of endoglucanase and exoglucanase components from BIJENDRE, KB., HIMANI, P., MASOOD, A., PRIYANKA S, AJAY, S.(2009). Trichoderma viride. Journal of Fermentation and Bioengineering,77(4), 363– Partial purification and characterization of a highly thermostable and pH stable 369. https://doi.org/10.1016/0922-338X(94)90005-1 endoglucanase from a newly isolated Bacillus strain M-9.Indian Journal of KUMAR, P., RYAN, B., HENEHAN, GTM. (2017).β-Glucosidase from Chemical Technology, 16, 382–387. Streptomyces griseus: Nanoparticle immobilisation and alkyl http://nopr.niscair.res.in/handle/123456789/6161 glucoside synthesis. Protein Expression and Purification. 132, 164-170. BAKARE, MK., ADEWALE, IO., AJAYI, A., SHONUKAN, OO. (2005). https://doi.org/10.1016/j.pep.2017.01.011 Purification and characterization of cellulase from the wild-type and two LEE, Y., BO-KYUNG, K., BO-HWA, L., KANG-IK, J., NAM-KYU, L., improved mutants of Pseudomonas fluorescens. African Journal of CHUNG-HAN, C., YOUNG-CHOON, L., JIN-WOO, L. (2008). Purification and Biotechnology, 4, 898–904. Characterization of Cellulase Produced by Bacillus amyoliquefaciens DL-3 https://www.ajol.info/index.php/ajb/article/view/71111 Utilizing Rice Hull. Bioresource Technology, 99: 378–386. BATAILLON, MA., NUNES, C., CASTILLON, N., DUCHIRON, F. (2000). https://doi.org/10.1016/j.biortech.2006.12.013 Purification and Characterization of a Moderately Thermostable Xylanase from LINDENMUTH, BE., KAREN, AM. (2011). Production and characterization of Bacillussp. Strain SPS-0. Enzyme and Microbial Technology, 26(2), 187–192. Acidothermus cellulolyticus endoglucanase in Pichia pastoris. Protein https://doi.org/10.1016/S0141-0229(99)00143-X Expression and Purification, 77 (2), 153–158. BATTAN, B., JITENDER, S., SAURABH, S., RAMESH, C. (2007). Enhanced https://doi.org/10.1016/j.pep.2011.01.006 production of cellulase-free thermostable xylanase by Bacillus pumilus ASH and LUCAS, R., ROBLES, A., GARCÍA, MT., ALVAREZ, DCG., GÁLVEZ, A. its potential application in paper industry. Enzyme and Microbial Technology, (2001). Production, purification, and properties of an endoglucanase produced by 41,733–739. https://doi.org/10.1016/j.enzmictec.2007.06.006 the hyphomycete Chalara (Syn. Thielaviopsis) paradoxa CH32. Journal of BEG, Q., KAPOOR, M., MAHAJAN, L., HOONDAL, G. (2001). Microbial Agricultural and Food Chemistry,49(1), 79-85. https://doi.org/10.1021/jf000916p xylanases and their industrial applications: a review. Applied Microbiology and MAHESHWARI, R., GIRISH, B., MAHALINGESHWARA, KB. (2000). Biotechnology,56(3), 326–338. https://doi.org/10.1007/s002530100704 Thermophilic Fungi: Their Physiology and Enzymes. Microbiology and BÉGUIN, P., JEAN-PAUL, A. (1994). The biological degradation of cellulose. molecular biology reviews, 64 (3), 461-488.
287
J Microbiol Biotech Food Sci / Bettache et al. 2020 : 10 (2) 284-288
https://doi.org/10.1128/MMBR.64.3.461-488.2000 MANDELS, M. (1985). Applications of cellulases. Biochemical Society Transactions 13 (2), 414–16. https://doi.org/10.1042/bst0130414 SCHREMPF, H. (2017).Elucidating biochemical features and biological roles 1 of Streptomyces proteins recognizing crystalline chitin- and cellulose-types and their soluble derivatives.Carbohydrate Research. 448, 220-226. https://doi.org/10.1016/j.carres.2017.06.010 SHAIK, M., GIRIJA, GS., ISWARYA, M, RAJITHA, P. (2017). Isolation and characterization of bioactive metabolites producing marine Streptomyces parvulus strain sankarensis-A10. Journal of Genetic Engineering and Biotechnology. 15 (1), 87–94. https://doi.org/10.1016/j.jgeb.2017.02.004 THEBERGE, M., PASCAL, L., FRANCOIS, S., ROLF, M., DIETER, K. (1992). Purification and characterization of an endoglucanase from Streptomyces lividans 66 and DNA sequence of the gene. Applied and Environmental Microbiology,58 (3), 815–820. https://aem.asm.org/content/58/3/815.short
LAEMMLI, UK. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature,227, 680–685. https://doi.org/10.1038/227680a0 WANG, Y., XIAONAN, W., RENTAO, T., SHANSHAN, Y., BAISONG, Z., YAN, F. (2010). A novel thermostable cellulase from Fervidobacterium nodosum. Journal of Molecular Catalysis B: Enzymatic, 66, 294–301. https://doi.org/10.1016/j.molcatb.2010.06.006 HAO, W., XIANBO, C., YONGFENG, Z., WEI, Z., GUIGUANG, C., ZHIQUN, L. (2017). Purification and characterization of a cellulase-free, thermostable endo-xylanase from Streptomyces griseorubens LH-3 and its use in biobleaching on eucalyptus kraft pulp. Journal of Bioscience and Bioengineering,125(1),46– 51. https://doi.org/10.1016/j.jbiosc.2017.08.006 YAZDI, MT., RADFORD, A., KEENS, JN., WOODWARD, JR. (1990). Cellulase production by Neurospora crassa : Purification and characterization of cellulolytic enzymes. Enzyme and Microbial Technology, 12(2),120-123. https://doi.org/10.1016/0141-0229(90)90084-4 XIN, L., HUI-YING, Y. (2012). Purification and characterization of an organic- solvent-tolerant cellulase from a Halotolerant Isolate , Bacillus sp . L1. Journal of Industrial Microbiology and Biotechnology, 39, 1117–1124. https://doi.org/10.1007/s10295-012-1120-2
288
PROKARYOTIC DIVERSTY OF ACID MINE DRAINAGE PONDS IN ORE ENRICHMENT PLANT
Yağmur TOPTAŞ1, Ahmet ÇABUK2, 3
Address(es): 1 Department of Biology, Graduate School of Natural and Applied Sciences, Eskisehir Osmangazi University, 26480, Eskisehir, Turkey. 2 Department of Biotechnology and Biosafety, Graduate School of Natural and Applied Sciences, Eskisehir Osmangazi University, 26480, Eskisehir, Turkey. 3 Department of Biology, Faculty of Arts and Science, Eskisehir Osmangazi University, 26480, Eskisehir, Turkey.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.310-316
ARTICLE INFO ABSTRACT
Received 24. 2. 2020 The biodiversity of acidophilic prokaryotes was determined in three AMD ponds (pH 2.7-6.5) in Turkey (İzmir-Halıköy antimony ore Revised 27. 6. 2020 enrichment plant) using 16S rRNA cloning and denaturing gradient gel electrophoresis methods. Water samples were taken two times in Accepted 30. 6. 2020 March 2014 and June 2015. The microbial diversity identified includes species such as Acidiphilium angustum, Acidocella sp., Published 1. 10. 2020 Ferroplasma acidiphilum, Acidithiobacillus ferriphilus, Acidithiobacillus ferrivorans, Acidiphilium rubrum, Thiomonas sp., Acidiphilium multivorum, Acidiphilium cryptum, Ferrovum myxofaciens, Acidocella aluminiidurans with the used techniques. In addition to, it has been determined that biodiversity is variable in the operating mine pools. Aciditihobacillus ferriphilus, Acidiphilium Regular article angustum, and Acidiphilium rubrum are new records for Turkey.
Keywords: acidic mine drainage, acidophiles, prokaryotic diversity, Turkey
INTRODUCTION MATERIALS AND METHODS
Acid mine drainage (AMD) is the largest environmental problem caused by Site description and sample collection normally associated with mining activities (Garcia-Moyano et al., 2015). The mining wastewater is defined by properties such as low pH, high metal ions (e.g., The water samples were collected from the operating antimony mine, ore iron, nickel, copper) and mineral concentrations. Acidophilic microorganisms enrichment plant Halıköy site (38°5’28.09”N, 28°10’09.6”E) in İzmir, Turkey living in this habitat are very interesting because of their adaptability to extreme (Fig 1), in two different time (March 2014 and June 2015). The samples were pH values, their metabolic diversity, and their ability to be used in biomining taken three different points from mine area as drainage water (sample #1 and applications. Especially, due to their availability in biomining and bioremediation sample #4), iron oxide pool water (sample #2 and sample #5), and stationary applications, it is important to identify the acidophiles living in AMD. As water before iron oxide pool (sample #3 and sample #6) (Fig 2). Water samples determined in previous studies, the AMD microbial community changes over were taken in sterile Duran bottles and were filtered from 0.2 um GTTP filter. In time (McGinnes and Johnson, 1993; Edwards et al., 1999; Volant et al., situ measurements for pH were made using a WTW Multi350i/SET (WTW, 2014). The variety of microbial community is attached to seasonal changes and Germany). Metal concentrations of water samples were measured by inductively environmental conditions in AMD (Auld et al., 2017). coupled plasma atomic emission spectrometry (ICP-AES). Classical microbial ecology methods remain limited in determining microbial diversity. Therefore, culture-independent methods such as 16s rRNA gene cloning, fluorescent in situ hybridization (FISH) and denaturing gradient gel electrophoresis (DGGE) are often used to investigate the diversity of microbial community that adapts to this unique environments (Gonzalez-Toril et al., 2003; Nicomrat et al., 2006; Garcia-Moyano et al., 2015). Acidophilic chemolithotrophs such as Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans, Leptospirillium ferrooxidans have been identified in AMD which extremely low pH and high concentrations of iron, sulfates and other heavy metals (Edwards et al., 1999; Kuang et al., 2012). At the same time, the investigation of microbial community by molecular methods is difficult because of the inhibition of PCR by metals such as Fe and Cu (Nicomrat et al., 2006). For the reason, DGGE and 16s rRNA gene cloning methods are used together to support each other in determining the microbial diversity of AMD. The aim of this research was to determine the acidophilic prokaryotic community of acid mine drainage in ore enrichment plant Halıköy, İzmir (Turkey). Our study area in Halıköy is within the Menderes Massif in western Turkey. The antimony mine was discovered in 1870 and continued to operate until 1918 in Halıköy area. After a long-standing period, production began again in 1974 (Akcay et al., 2006). Our results are the first knowledge about the prokaryotic community of the selected AMD area.
Figure 1 Map of Halıköy, İzmir (Turkey), where AMD ponds are located in antimony mine site
310
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
RESULTS
Characteristics of site and samples
The sampling site is antimony mine site being operated. The AMD samples were characterized by acidic pH values ranging from 2.7 to 6.5 and high concentrations of dissolved metals (Table 1). The sample points show the typical orange and red colors of dissolved ferric iron as shown in Figure 1. It was determined that the samples had high iron, zinc, lead and manganese ratios. Treatment and neutralization studies of outlet water caused increase the pH value and decrease iron concentration between two sampling times (sample #5). This pH change also affected the prokaryotic diversity at the sample site (Table 1).
Table 1 pH values and dissolved metal concentrations of water samples #1 #2 #3 #4 #5 #6 Samples code- pH Figure 2 Points of water samples (a: #1 and #4; b: #2 and #5; c: #3 and #6) 3.0 2.9 2.7 2.8 6.5 3.6 -1 Elements Concentrations (mg L ) DNA isolation and 16S rRNA gene amplification Fe 205.3 237.8 * 198.4 40.959 200.7 Zn 1.693 7.547 28.98 2.006 5.328 15.952 DNA isolations were performed following the procedure explained by Cifuentes Mn 4.701 * * 4.351 8.937 * et al. (2000) and Nogales et al. (1999) as modified. We used the primer set 27F Cr 0.185 0.302 0.784 0.145 0.267 0.935 (AGAGTTTGATCMTGGCTCAG)-1387R (GGGCGG(AT)GTGTACAAGGC) Co 0.066 1.794 6.643 0.045 1.539 5.628 and 20F (AGAGTTTGATC(AC)TGGCTCAG)-915R Cu 0.077 0.820 1.637 0.058 0.754 1.756 (GTGCTCCCCCGCCAATTCCT) for bacteria and archaea, respectively. Ni 0.241 1.624 6.481 0.321 0.954 4.522 PCR cycles were as follows: one cycle at 95 °C for five minutes, 30 cycles at 95 Pb 0.029 0.065 0.063 0.019 0.017 0.052 °C for 30 seconds, one minute at the corresponding annealing temperature 55 °C and 62 °C (for bacteria and archaea, respectively) and 72 °C for 1.5 minutes, and *Not determined because it has a high concentration. a final extension step at 72 °C for ten minutes. Cloning 16S rRNA gene cloning Clone library technique offers the opportunity to do very sensitive taxonomic The PCR products were cloned using the pGEM-T easy vector system II and studies. By this method, uncultured and unspecified microorganisms are also colony PCRs were set up with 27F and 1387R; 20F and 907R primer sets of possible to define (Sanz and Kochling, 2007). The clones from sample #1 and selected colonies, for bacteria and archaea, respectively. Similar profiles were #3 YT_K1, YT_2, YT_K12, YT_K14, YT_K16 matched with an uncultured determined by amplified ribosomal DNA restriction analysis (ARDRA) in the bacterium (%99), an uncultured archaeon (%97), Acidithiobacillus ferrivorans 16S rRNA gene libraries. Clones were divided into categories (3 h, 37°C) based (%99), Acidithiobacillus ferriphilus (%99), and Acidiphilium rubrum, on pattern generated by the restriction enzymes MspI and HaeIII (5 units each). respectively. According to ARDRA of the plasmid insert, it has been determined that there are 4 and 14 different profiles from sample #2 and #5 (same points, DGGE different periods) coded samples taken in March 2014 and June 2015, respectively (Fig. 3). The sequence of clones (from water samples #2) YT_K3, Amplification of the 16S rRNA gene was carried out with specific primers for YT_K4, YT_K7, and YT_K8 showed 99% similarities with Acidiphilium sp., DGGE analysis. Primer set including 344F-GC Acidithiobacillus ferriphilus, Acidocella sp., Acidiphilium angustrum, (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGACGGGGC respectively. Clones from water sample #3, YT_K12 and YT_K13 matched with GCAGCAGGCGCGA) and 907R (CCGTCAATTCCTTTGAGTTT) was used Acidithiobacillus ferrivorans (similarity 99%), YT_K14 and YT_K16 matched for the archaeal gene amplification while for the bacterial gene, the forward with Acidithiobacillus ferriphilus, Acidiphilium rubrum (similarity 99%), primer, 341F-GC respectively. The archaeal profile was only determined on AMD samples #1 and (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGCCTACGG #3. According to the results of sequence analysis the clones YT_K11, and GAGGCAGCAG) in combination with 907R were used (Muyzer et al., 1993). YT_K20 matched with Ferroplasma acidiphilium (similarity 99%), and clone DGGE PCR condition for bacteria: one cycle at 94 °C for five minutes, one YT_K9 showed 99% similarities with Thermoplasmatales archaeon. Other clones minute at 65 °C and three minutes at 72 °C and nine cycles at 94 °C for one from water samples #4 and #6 showed 99% similarities with Acidiphilium sp. and minute, one minute at the annealing temperature was decrease 64- 55 °C and 72 Thiomonas sp. The sequencing results of the clones were given in Table 2. °C for three minutes, and one cycle at 94 °C for five minutes, one minute at 55 °C and three minutes at 72 °C and a final step 94 °C for five minutes, one minute at 55 °C and ten minutes at 72 °C. DGGE PCR condition for archaea: one cycle at 94 °C for five minutes, 29 cycles at 94 °C for three seconds, 56 °C for 45 seconds, 72 °C for two minutes, and one cycle at 94 °C for 30 seconds, 56 °C for 45 seconds, 72 °C for seven minutes. The PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega, Italy). Denaturing gradient gel electrophoresis (DGGE) was performed with the DCode Universal Mutation Detection System (Bio-Rad Laboratories, Inc.). PCR product was loaded on 1 mm thick 8% (w/v) polyacrylamide (37.5: 1 acrylamide: bisacrylamide) gels containing a 45-60% linear denaturing gradient. Gels were run in 1X TAE buffer at 60°C and 90 V for 18 h. Gels were stained in 1X TAE buffer containing ethidium bromide solution (1 μg/ ml) and photographed under UV transillumination. Each band in different positions was cut with a sterile lancet from the polyacrylamide gel and was stored at 37 °C in solvent buffer (ammonium acetate 5M, magnesium acetate 10 mM, EDTA (pH 8.0) 1mM, SDS 0.1%) during overnight and DNA fragments were isolated. The DNA fragments were used re- amplification with same primer pairs without GC clamps and were sequenced.
Accession numbers and construction phylogenetic tree of nucleotide sequences
Multiple gene alignments were applied using MUSCLE software. Phylogenetic trees were made using MEGA version 7 and the neighbor-joining method (Saitou Figure 3 ARDRA profiles of water samples (for bacteria: a, b, c, d, e, f, g: #1, #2 and Nei, 1987). The 16S rRNA gene sequences and results of DGGE analyses #3, #4, #5, #6; for archaea: h, i: #1, #3 respectively). were uploaded into the GenBank Database.
311
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
Table 2 Prokaryotes16S rRNA gene clones of environmental water samples and their closest matches in GenBank GenBank Water 16S rRNA Gene Number of Clone no Organism accession no sample no Sequence Similarity (%) sequencing base Uncultured bacterium partial 16S rRNA gene, clone BioPlate3_A12 YT_K1 MH057124 1 99% 754 HE587229.1 Uncultured archaeon gene for 16S rRNA, partial sequence, clone: YT_K2 MH057125 1 97% 650 HO28S9A63 AB600346.1 Acidiphilium sp. DBS4-1 16S ribosomal RNA gene, partial sequence YT_K3 MH057126 2 99% 1004 EU003879.1 Acidithiobacillus ferriphilus strain DSM 100412 tyrosyl-tRNA synthetase YT_K4 MH057127 2 99% 850 gene, complete cds; KY002491.1 Acidocella sp. M21 16S ribosomal RNA gene, partial sequence YT_K7 MH057128 2 99% 854 AY765998.1 Acidiphilium angustum strain Colony6 16S ribosomal RNA gene, partial YT_K8 MH057129 2 99% 873 sequence KC924944.1 Uncultured Thermoplasmatales archaeon clone B_DKE 16S ribosomal YT_K9 MH057130 3 99% 546 RNA gene, partial sequence KY825129.1 Uncultured archaeon clone AMD-archD26 16S ribosomal RNA gene YT_K10 MH057131 3 98% 941 sequence KC537536.1 YT_K11 MH057132 Ferroplasma acidiphilum strain Y, complete genome CP015363.1 3 99% 809 Acidithiobacillus ferrivorans strain NO-37 16S ribosomal RNA gene, YT_K12 MH057133 3 99% 1024 partial sequence NR_114620.1 YT_K13 MH057134 Acidithiobacillus ferrivorans SS3, complete genome CP002985.1 3 99% 704 Acidithiobacillus ferriphilus strain DSM 100412 tyrosyl-tRNA synthetase YT_K14 MH057135 3 99% 1010 gene, complete cds; KY002491.1 Acidiphilium rubrum strain Colony11 16S ribosomal RNA gene, partial YT_K16 MH057136 3 99% 1016 sequence KC924949.1 Uncultured Thiomonas sp. clone dw10 16S ribosomal RNA gene, partial YT_K17 MH057137 4 99% 865 sequence KF287769.1 Uncultured bacterium clone RT11-ant10-e08-W 16S ribosomal RNA gene, YT_K18 MH057138 4 100% 862 partial sequence JF737920.1 Ferroplasma acidiphilum strain DX-m 16S ribosomal RNA gene, partial YT_K20 MH057139 3 99% 747 sequence KX694511.1 Uncultured bacterium clone NSC0m-bac_d12 16S ribosomal RNA gene, YT_K21 MH057140 4 98% 671 partial sequence KC619550.1 Uncultured bacterium partial 16S rRNA gene, clone BioPlate2_H11 YT_K23 MH057141 4 95% 894 HE587131.1 Acidiphilium multivorum strain AIU301 16S ribosomal RNA gene, YT_K25 MH057142 4 99% 877 complete sequence NR_074327.1 Uncultured bacterium clone LRE22B44 16S ribosomal RNA gene, partial YT_K27 MH057143 4 99% 963 sequence HQ420129.1 YT_K28 MH057144 Acidiphilium cryptum JF-5, complete genome CP000697.1 4 99% 824 Uncultured bacterium clone A13 16S ribosomal RNA gene, partial YT_K29 MH057145 5 98% 805 sequence KF031176.1 Uncultured alpha proteobacterium clone AKYG835 16S ribosomal RNA YT_K30 MH057146 5 99% 809 gene, partial sequence AY922070.1 Uncultured bacterium clone BE326_BF2_otu4 16S ribosomal RNA gene, YT_K31 MH057147 5 96% 848 partial sequence JX298447.1 Uncultured bacterium clone BDP28WS24 16S ribosomal RNA gene, YT_K32 MH057148 5 98% 668 partial sequence KF841202.1 Uncultured bacterium clone T7-82 16S ribosomal RNA gene, partial YT_K33 MH057149 5 99% 857 sequence GQ487952.1 Uncultured beta proteobacterium clone 220T36 16S ribosomal RNA gene, YT_K34 MH057150 5 98% 816 partial sequence DQ110071.1 Uncultured bacterium partial 16S rRNA gene, clone Iron-rich microbial YT_K35 MH057151 5 96% 726 mat clone Hoffnungsstollen_#5-1A_E11 LN870830.1 Uncultured bacterium clone SX2-12 16S ribosomal RNA gene, partial YT_K36 MH057152 5 99% 858 sequence DQ469219.1 Uncultured bacterium clone EPS09_OK_001A_57 16S ribosomal RNA YT_K37 MH057153 5 99% 838 gene, partial sequence JX521231.1 Uncultured bacterium clone F-19 16S ribosomal RNA gene, partial YT_K38 MH057154 5 97% 702 sequence HQ132424.1 Uncultured bacterium clone SH201209-31 16S ribosomal RNA gene, YT_K40 MH057155 5 98% 646 partial sequence KX508591.1 Uncultured bacterium clone SX2-10 16S ribosomal RNA gene, partial YT_K41 MH057156 5 99% 752 sequence DQ469201.1 Uncultured bacterium clone AMD1-Plate1-B06 16S ribosomal RNA gene, YT_K42 MH057157 5 99% 455 partial sequence JN127499.1 Uncultured bacterium clone BCWCWP1A42 16S ribosomal RNA gene, YT_K43 MH057158 5 99% 925 partial sequence FJ598380.1 Acidiphilium sp. BGR 75a 16S ribosomal RNA gene, partial sequence YT_K44 MH057159 6 99% 843 GU167999.1 Uncultured Thiomonas sp. clone S-K6-C18 16S ribosomal RNA gene, YT_K45 MH057160 6 99% 878 partial sequence EF612428.1 Uncultured bacterium partial 16S rRNA gene, clone BioPlate2_G10 YT_K46 MH057161 6 99% 798 HE587210.1 Uncultured bacterium partial 16S rRNA gene, clone BioPlate2_A10 YT_K47 MH057162 6 99% 827 HE587139.1
312
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
DGGE Accession numbers and construction phylogenetic tree of nucleotide DGGE analyses were performed with each different sample to determine the sequences level of microbial diversity in the mine area. (Fig 4). The samples collected from the same sample points determined to have different profiles. Especially, due to 16S rRNA gene sequences were deposited in GenBank under accession numbers pH change, it was found that bacterial diversity quite different sample #5 and MH057089-H057162. In order to determine the phylogenetic group, the sample #2. Blast analyses of DGGE bands sequences are given in Table 3. phylogenetic tree was constructed with sequences obtained by 16 rRNA clone Archaeal diversity was determined only in sample #1 and sample #3. The library and DGGE analyses (Fig 5, 6). sequence of bands YT_D1, YT_D2, YT_D3, YT_D4, and YT_D5 showed similarity with uncultured archaeon clones, as a show that in Table 3. Differences were observed in the DGGE profiles of taken water samples at different times from the same sampling points. It was determined that the sample #4 have more bacterial diversity from sample #1. According to sequence analysis results, there are bands matched with Ferrovum myxofaciens, Acidithiobacillus ferrooxidans, Acidithiobacillus ferrivorans, Acidithiobacillus ferriphilus and uncultured Acidithiobacillus sp. in sample #1. In the case of water sample #4, it was determined that the majority of the species are Acidocella (Table 3). Although samples #2 and #5 were taken from the same spot, it was thought that the change in pH at sample #5 caused the formation of different profiles. Bands at sample #5 were showed similarity with Acidocella aluminiidurans, uncultured Acidocella sp. and uncultured Acidiphilium sp. In sample #3, bacterial diversity is less than in sample #6. The band of sample #6, it was determined to match with Thiomonas sp. (Table 3).
Figure 5 Phylogenetic tree based on 16S rRNA gene sequences of 16S rRNA clone libraries.
Figure 4 DGGE profiles of the AMD water samples.
313
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
Table 3 Prokaryotes of environmental water samples closest matches of DGGE bands in GenBank 16S rRNA Gene Number of GenBank Water Clone no Organism Sequence sequencing accession no sample no Similarity (%) base Uncultured archaeon clone AMD-archI04 16S ribosomal RNA gene sequence YT_D1 MH057089 3 99% 520 KC537677.1 Uncultured Thermoplasmatales archaeon clone B_DKE 16S ribosomal RNA YT_D2 MH057090 3 100% 437 gene, partial sequence KY825129.1 Uncultured euryarchaeote clone RT10A_3A_4 16S ribosomal RNA gene, partial YT_D3 MH057091 1 99% 457 sequence EF441876.1 Uncultured archaeon clone AMD-archF17 16S ribosomal RNA gene sequence YT_D4 MH057092 1 99% 449 KC537589.1 Uncultured archaeon clone AMD-archE05 16S ribosomal RNA gene sequence YT_D5 MH057093 1 99% 458 KC537545.1 YT_D7 MH057094 Uncultured Acidiphilium sp. partial 16S rRNA gene, clone A4_89 AM940514.1 5 93% 542 Uncultured Acidocella sp. clone M3O29 16S ribosomal RNA gene, partial YT_D8 MH057095 5 94% 519 sequence JX568779.1 Ferrovum myxofaciens strain P3G 16S ribosomal RNA gene, partial sequence YT_D9 MH057096 1 97% NR_117782.1 477 Acidithiobacillus ferrooxidans strain S1 16S ribosomal RNA gene, partial YT_D10 MH057097 1 95% 465 sequence FJ913262.1 Acidithiobacillus ferriphilus strain M20 16S ribosomal RNA, partial sequence YT_D11 MH057098 1 98% 308 NR_147744.1 Acidithiobacillus ferrivorans strain NO-37 16S ribosomal RNA gene, partial YT_D12 MH057099 1 99% 297 sequence NR_114620.1 Acidithiobacillus sp. YB18 16S ribosomal RNA gene, partial sequence YT_D13 MH057100 1 99% 443 KM369916.1 Ferrovum myxofaciens strain EHS8 16S ribosomal RNA gene, partial sequence YT_D15 MH057101 1 99% 522 KC155322.1 YT_D17 MH057102 Acidocella sp. CFR23 16S ribosomal RNA gene, partial sequence KC662252.1 2 98% 529 Uncultured Acidocella sp. clone M3O29 16S ribosomal RNA gene, partial YT_D18 MH057103 2 95% 515 sequence JX568779.1 Acidiphilium sp. strain MPLK-302 16S ribosomal RNA gene, partial sequence YT_D19 MH057104 2 93% 542 KX689773.1 Uncultured Acidocella sp. clone M3O29 16S ribosomal RNA gene, partial YT_D20 MH057105 2 93% 511 sequence JX568779.1 YT_D22 MH057106 Acidocella aquatica gene for 16S ribosomal RNA, partial sequence LC199502.1 3 93% 562 Acidocella facilis strain PW2 16S ribosomal RNA gene, partial sequence YT_D23 MH057107 3 95% 520 NR_025852.1 Acidiphilium sp. strain MPLK-302 16S ribosomal RNA gene, partial sequence YT_D24 MH057108 3 91% 532 KX689773.1 Acidocella facilis strain PW2 16S ribosomal RNA gene, partial sequence YT_D25 MH057109 3 86% 523 NR_025852.1
YT_D27 MH057110 Uncultured Acidiphilium sp. partial 16S rRNA gene, clone A4_89 AM940514.1 4 93% 544 Acidocella aluminiidurans strain AL46 16S ribosomal RNA gene, partial YT_D28 MH057111 4 97% 546 sequence NR_112716.1 Acidiphilium angustum strain KLB 16S ribosomal RNA gene, partial sequence YT_D29 MH057112 4 91% 523
NR_025850.1 Uncultured Acidocella sp. clone G16O27 16S ribosomal RNA gene, partial YT_D30 MH057113 4 95% 533
sequence JX568562.1 Uncultured Acidocella sp. clone M2C26 16S ribosomal RNA gene, partial YT_D31 MH057114 4 97% 519
sequence JX568698.1 Uncultured Acidocella sp. clone M3O29 16S ribosomal RNA gene, partial YT_D32 MH057115 4 93% 525
sequence JX568779.1 Acidiphilium multivorum strain AIU301 16S ribosomal RNA, complete sequence YT_D33 MH057116 4 94% 513 NR_074327.1 Acidocella aminolytica strain 101 16S ribosomal RNA gene, partial sequence YT_D34 MH057117 4 91% 481
NR_025849.1 Uncultured alpha proteobacterium clone LKC_Acid_38p 16S ribosomal RNA YT_D35 MH057118 4 87% 534
gene, partial sequence EU038054.1 Acidocella facilis strain PW2 16S ribosomal RNA gene, partial sequence YT_D36 MH057119 4 93% 505
NR_025852.1 Acidocella aluminiidurans strain NBRC 104303 16S ribosomal RNA gene, YT_D38 MH057120 5 95% 514
partial sequence NR_114266.1 Acidocella sp. strain MPLK-72 16S ribosomal RNA gene, partial sequence YT_D40 MH057121 5 93% 517
KX689753.1 Uncultured alpha proteobacterium gene for 16S ribosomal RNA, partial YT_D41 MH057122 5 97% 519 sequence, clone: AN037 AB809968.1 YT_D43 MH057123 Thiomonas sp. Dg-E17 partial 16S rRNA gene, isolate Dg-E17 LN864672.1 6 96% 521
314
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
Figure 7 The diversity profile of AMD ponds obtained by 16S rRNA clone libraries and DGGE methods.
Gonzalez-Toril and collaborates studied by DGGE using 16S rRNA and, by 16S rRNA gene amplification for research molecular ecology an extreme acidic Tinto River (Spain). Comparative sequence analysis of DGGE bands determined the entity of the respective microorganisms like Leptospirillum spp., Acidithiobacillus ferrooxidans, Acidiphilium spp., Ferrimicrobium acidiphilum, Ferroplasma acidiphilum, and Thermoplasma acidophilum (Gonzalez-Toril et al., 2003). Aytar and coworkers have identified prokaryotic diversity in two different AMD sites (Balya and Çan) in Turkey (Aytar et al., 2014). Some species identified in this study were as Acidithiobacillus sp., Leptosipirillum sp., Ferooplasma sp. Saglam and colleagues determined bacterial diversity in the Figure 6 Phylogenetic tree based on 16S rRNA gene sequences of DGGE bands. Acisu effluent with cloning 16s rRNA sequences. The bacterial population was identified to occur Acidithiobacillus ferrivorans, Ferrovum myxofaciens, DISCUSSION Leptospirillum ferrooxidans, Acidithiobacillus ferrooxidans, Acidocella facilis, Acidocella aluminiidurans, Acidiphilium cryptum, Acidiphilium multivorum, Determining of communities in AMD provides important clues in terms of the Acidithiobacillus ferrivorans, Acidithiobacillus ferrooxidans, Acidithiobacillus diversity and functions of these organisms with the development of molecular thiooxidans, Acidiphilium cryptum (Saglam et al., 2016). approaches. Furthermore, the development of sequencing technologies is rare in Alphaproteobacteria (Acidiphilium, Acidocella) (Liu et al., 2011; Falagan et al., acidic environments allowing the identification of numerous taxa found (Kuang 2013), Betaproteobacteria (Thiomonas, Ferrovum), (Mendez et al., 2008; et al., 2012; Aliaga Goltsman et al., 2014). Johnson et al., 2013), Acidithiobacillia (Acidithiobacillus) (Williams and Kelly, The pH value and metal concentrations of the AMD ponds seem to be suitable for 2013) are seen in other studies. Betaproteobacteria, mostly belonging to the existence in the determined species. Especially, high iron concentration is ‘Ferrovum’ genus, was clearly predominant in the community below middle pH determinant for the life of species such as Acidithiobacillus ferrivorans, conditions, whereas Alphaproteobacteria, Euryarchaeota, Gammaproteobacteria, Aciditihobacillus ferriphilus. Mendez and coworkers have determined and Nitrospira exposed a powerful adaptation to more acidic conditions (Kuang Acidithiobacillus ferrivorans with similar properties samples (pH 2.7, Fe: 38.100 -1 et al., 2012). mg kg ) (Mendez et al., 2008). One of the sequences identified in the study of As a result of matches, it has been determined that some sequences are similar to microbial diversity of Xiang Mountain sulfide mine was matched with Ferrovum those of Aciditihobacillus ferriphilus (Nunez et al., 2017), Acidiphilium myxofaciens, which was recently isolated from an abandoned copper mine (pH -1 angustum, and Acidiphilium rubrum (Auld et al., 2013). These species are new 3.0, Fe: 100.6 mg L ) (Hao et al., 2010). Acidiphilium sp. was determined by records for Turkey. The iron-oxidizing acidithiobacilli Acidithiobacillus community composition analysis in acid mine drainage from Fankou Pb/Zn mine, -1 ferriphilus was also isolated from different global locations such as metal-rich China (pH 1.9, Fe 1240 mg L ) (Chen et al., 2014,a). waters sample deep within the mine (Kay et al., 2014). The type strain M20T was Autotrophic and heterotrophic groups were identified from selected sample isolated from a pond in a geothermal area of Montserrat (pH 1.5-3.0) (West points in this study. It is noteworthy that archaea domain members cannot be Indies) which lived optimally pH 2.0 and 30 °C of temperature (Atkinson et al., determined from samples #4 and #6 in June 2015, while the archaea were 2000). It was determined later that this strain separated from other determined in March 2014 (samples #1 and #3). It is thought that this may be due acidithiobacilli (Falagan and Johnson, 2016). The clones and DGGE bands to the continuing effects of the mining activity. Changes in the environment sequences showed to match the most Acidiphilium genus. The mesophilic and created by anthropogenic effects are rapidly affecting microbial diversity. obligately acidophilic bacteria Acidiphilium angustum grow in the pH range of Ferroplasma spp., which was identified in this study, has been determined as 2.0-5.9. The clone YT_K8 matched with Acidiphilium angustum (99% similarity) dominant after the period of the acidification processes of mine wastes (Chen et was obtained from water sample #2 (pH 2.9). Auld and coworkers have isolated al., 2013; Chen et al., 2014,b). Acidiphilium rubrum from an AMD site in Copper Cliff, Ontario (Auld et al., As seen in Figure 7, the variety of prokaryotic diversity was observed by used 2013). The isolate was isolated from AMD water at pH 2.5, similar to the water molecular techniques in AMD ponds. As one of the reasons for this, some of the sample (pH 2.7) in which identified YT_K16. technical difficulties of the methods used can be shown. While sequencing over a short region of DNA by the DGGE method, the cloning longer base chain can be CONCLUSION evaluated. With all of these drawbacks, both methods complement each other’s deficiencies so that can determine the prokaryotic diversity of AMD ponds to a Future studies will focus on the roles of these species on the biogeochemical significant extent. For example, Ferroplasma sp., Thiomonas sp. species could be cycles of the region where microbial diversity is determined. The AMD is also identified only by 16S cloning, while Ferrovum sp. could be identified only by likely to contain new species. To better understand community dynamics in acid DGGE method. Other less frequently detected bacterial taxa the heterotrophic formation, more studies are needed to identify predominant species in AMD growers Thiomonas spp. (Chen et al., 2016) that has been isolated was not environments. detected by molecular techniques, probably reflecting its low abundance (Bruneel et al., 2005). Acknowledgment: This study is based partly on the Ph.D. thesis of Y. Toptaş. Also, the study was supported by Eskisehir Osmangazi University, Scientific Research Projects Committee (Project No: 2016/19A223).
315
J Microbiol Biotech Food Sci / TOPTAŞ and ÇABUK et al. 2020 : 10 (2) 310-316
REFERENCES Kuang, J. L., Huang, L.N., Chen, L.X., Hua, Z.S., Li, S.J., Hu, M., … Shu, W.S. (2012). Contemporary environmental variation determines microbial diversity Akçay, M., Özkan, H. M., Moon, C. J., & Spiro, B. (2006). Geology, mineralogy patterns in acid mine drainage. The ISME Journal, 7(5), 1038–1050. and geochemistry of the gold-bearing stibnite and cinnabar deposits in the Emirli http://doi:10.1038/ismej.2012.139 and Halıköy areas (Ödemiş, İzmir, West Turkey). Ore Geology Reviews, 29(1), 19–51. http://doi:10.1016/j.oregeorev.2004.12.006 Liu, H., Yin, H., Dai, Y., Dai, Z., Liu, Y., Li, Q., … Liu, X. (2011). The co- Aliaga Goltsman, D. S., Comolli, L. R., Thomas, B. C., & Banfield, J. F. (2014). culture of Acidithiobacillus ferrooxidans and Acidiphilium acidophilum enhances Community transcriptomics reveals unexpected high microbial diversity in the growth, iron oxidation, and CO2 fixation. Archives of Microbiology, 193(12), acidophilic biofilm communities. The ISME Journal, 9(4), 1014–1023. 857–866. http://doi:10.1007/s00203-011-0723-8 http://doi:10.1038/ismej.2014.200 McGinness, S., & Barrie Johnson, D. (1993). Seasonal variations in the Atkinson, T., Cairns, S., Cowan, D. A., Danson, M. J., Hough, D. W., Johnson, microbiology and chemistry if an acid mine drainage stream. Science of The D. B., … Sharp, R. J. (2000). A microbiological survey of Montserrat Island Total Environment, 132(1), 27–41. http://doi:10.1016/0048-9697(93)90259-9 hydrothermal biotopes. Extremophiles, 4(5), 305–313. http://doi:10.1007/s007920070018 Mendez, M. O., Neilson, J. W., & Maier, R. M. (2008). Characterization of a Auld, R. R., Myre, M., Mykytczuk, N. C. S., Leduc, L. G., & Merritt, T. J. S. Bacterial Community in an Abandoned Semiarid Lead-Zinc Mine Tailing Site. (2013). Characterization of the microbial acid mine drainage microbial Applied and Environmental Microbiology, 74(12), 3899–3907. community using culturing and direct sequencing techniques. Journal of http://doi:10.1128/aem.02883-07 Microbiological Methods, 93(2), 108–115. Muyzer, G., Smalla, K. (1999). Application of denaturing gradient gel http://doi:10.1016/j.mimet.2013.01.023 electrophoresis (DGGE) and temperature gradient gel electrophoresis in Auld, R. R., Mykytczuk, N. C. S., Leduc, L. G., & Merritt, T. J. S. (2017). microbial ecology. Antonie van Leeuwenhock, 73, 127– 141. Seasonal variation in an acid mine drainage microbial community. Canadian Journal of Microbiology, 63(2), 137–152. http://doi:10.1139/cjm-2016-0215 Nicomrat, D., Dick, W. A., & Tuovinen, O. H. (2006). Assessment of the Aytar, P., Kay, C. M., Mutlu, M. B., Çabuk, A., & Johnson, D. B. (2014). Microbial Community in a Constructed Wetland that Receives Acid Coal Mine Diversity of acidophilic prokaryotes at two acid mine drainage sites in Turkey. Drainage. Microbial Ecology, 51(1), 83–89. http://doi:10.1007/s00248-005-0267- Environmental Science and Pollution Research, 22(8), 5995–6003. z http://doi:10.1007/s11356-014-3789-4 Nogales, B., Moore, E. R. B., Abraham, W.-R., & Timmis, K. N. (1999). Bruneel, O., Duran, R., Casiot, C., Elbaz-Poulichet, F., & Personné, J.-C. (2006). Identification of the metabolically active members of a bacterial community in a Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoulès, France. Applied and Environmental Microbiology, 72(1), 551–556. polychlorinated biphenyl-polluted moorland soil. Environmental Microbiology, http://doi:10.1128/aem.72.1.551-556.2006 1(3), 199–212. http://doi:10.1046/j.1462-2920.1999.00024.x Chen, L., Li, J., Chen, Y., Huang, L., Hua, Z., Hu, M., & Shu, W. (2013). Shifts Nuñez, H., Moya-Beltrán, A., Covarrubias, P. C., Issotta, F., Cárdenas, J. P., in microbial community composition and function in the acidification of a González, M., … Quatrini, R. (2017). Molecular Systematics of the Genus lead/zinc mine tailings. Environmental Microbiology, 15(9), 2431–2444. Acidithiobacillus: Insights into the Phylogenetic Structure and Diversification of http://doi:10.1111/1462-2920.12114 the Taxon. Frontiers in Microbiology, 8. http://doi:10.3389/fmicb.2017.00030 Chen, L., Hu, M., Huang, L., Hua, Z., Kuang, J., Li, S., & Shu, W. (2014,a). Sağlam, E. S., Akçay, M., Çolak, D. N., İnan Bektaş, K., & Beldüz, A. O. (2016). Comparative metagenomic and metatranscriptomic analyses of microbial communities in acid mine drainage. The ISME Journal, 9(7), 1579–1592. Generation of acid mine drainage around the Karaerik copper mine (Espiye, http://doi:10.1038/ismej.2014.245 Giresun, NE Turkey): implications from the bacterial population in the Acısu Chen, Y., Li, J., Chen, L., Hua, Z., Huang, L., Liu, J., … Shu, W. (2014,b). effluent. Extremophiles, 20(5), 673–685. http://doi:10.1007/s00792-016-0857-3 Biogeochemical Processes Governing Natural Pyrite Oxidation and Release of Saitou, N., Nei, M. (1987). The neighbor-joining method: A new method for Acid Metalliferous Drainage. Environmental Science & Technology, 48(10), reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406-425. 5537–5545. http://doi:10.1021/es500154z http://doi:10.1093/oxfordjournals.molbev.a040454 Chen, L., Huang, L., Méndez-García, C., Kuang, J., Hua, Z., Liu, J., & Shu, W. Sanz, J. L., and Köchling, T. (2007). Molecular biology techniques used in (2016). Microbial communities, processes and functions in acid mine drainage ecosystems. Current Opinion in Biotechnology, 38, 150–158. wastewater treatment: An overview. Process Biochemistry, 42(2), 119–133. http://doi:10.1016/j.copbio.2016.01.013 http://doi:10.1016/j.procbio.2006.10.003 Cifuentes, A., Antón, J., Benlloch, S., Donnelly, A., Herbert, R. A., & Rodríguez- Volant, A., Bruneel, O., Desoeuvre, A., Héry, M., Casiot, C., Bru, N., … Lauga, Valera, F. (2000). Prokaryotic Diversity in Zostera noltii Colonized Marine B. (2014). Diversity and spatiotemporal dynamics of bacterial communities: Sediments. Applied and Environmental Microbiology, 66(4), 1715–1719. physicochemical and other drivers along an acid mine drainage. FEMS http://doi:10.1128/aem.66.4.1715-1719.2000 Microbiology Ecology, 90(1), 247–263. http://doi:10.1111/1574-6941.12394 Edwards, K. J., Gihring, T. M., & Banfield, J. F. (1999). Seasonal Variations in Microbial Populations and Environmental Conditions in an Extreme Acid Mine Williams, K. P., & Kelly, D. P. (2013). Proposal for a new class within the Drainage Environment. Applied and Environmental Microbiology, 65(8), 3627– phylum Proteobacteria, Acidithiobacillia classis nov., with the type order 3632. http://doi:10.1128/aem.65.8.3627-3632.1999 Acidithiobacillales, and emended description of the class Gammaproteobacteria. Falagán, C., & Johnson, D. B. (2016). Acidithiobacillus ferriphilus sp. nov., a International Journal of Systematic and Evolutionary Microbiology, 63(Pt_9), facultatively anaerobic iron- and sulfur-metabolizing extreme acidophile. 3547–3548. http://doi:10.1099/ijs.0.057166-0 International Journal of Systematic and Evolutionary Microbiology, 66(1), 206– 211. http://doi:10.1099/ijsem.0.000698 Falagán, C., Sánchez-España, J., & Johnson, D. B. (2013). New insights into the biogeochemistry of extremely acidic environments revealed by a combined cultivation-based and culture-independent study of two stratified pit lakes. FEMS Microbiology Ecology, 87(1), 231–243. http://doi:10.1111/1574-6941.12218 García-Moyano, A., Austnes, A., Lanzén, A., González-Toril, E., Aguilera, Á., & Øvreås, L. (2015). Novel and Unexpected Microbial Diversity in Acid Mine Drainage in Svalbard (78° N), Revealed by Culture-Independent Approaches. Microorganisms, 3(4), 667–694. http://doi:10.3390/microorganisms3040667 González-Toril, E., Llobet-Brossa, E., Casamayor, E. O., Amann, R., & Amils, R. (2003). Microbial Ecology of an Extreme Acidic Environment, the Tinto River. Applied and Environmental Microbiology, 69(11), 6959–6959. http://doi:10.1128/aem.69.11.6959.2003 Hao, C., Wang, L., Gao, Y., Zhang, L., & Dong, H. (2010). Microbial diversity in acid mine drainage of Xiang Mountain sulfide mine, Anhui Province, China. Extremophiles, 14(5), 465–474. http://doi:10.1007/s00792-010-0324-5 Johnson, D. B., Hallberg, K. B., & Hedrich, S. (2013). Uncovering a Microbial Enigma: Isolation and Characterization of the Streamer-Generating, Iron- Oxidizing, Acidophilic Bacterium “Ferrovum myxofaciens.” Applied and Environmental Microbiology, 80(2), 672–680. http://doi:10.1128/aem.03230-13 Kay, C.M., Haanela, A., Johnson, D.B. (2014). Microorganisms in subterranean acidic waters within Europe’s deepest metal mine. Res Microbiol, 165, 705–712. https://doi.org/10.1016/j.resmic.2014.07.007
316
PURIFICATION, CHARACTERIZATION AND EXPRESSION, OF RECOMBINANT OUTER MEMBRANE PROTEIN A (OMP A) OF ACINETOBACTER BAUMANNII LI311
Aamal Ghazi Mahdi Al-Saadi 1*, Aalaa Fahim Abbas2
Address(es): 1,2 University of Al-Qadisiyah , College of Science, Department of Ecology, Al Diwaniyah58001, Iraq.
*Corresponding author: [email protected] doi: 10.15414/jmbfs.2020.10.2.317-320
ARTICLE INFO ABSTRACT
Received 16. 3. 2020 Acinetobacter baumannii is a known hospital aquired pathogenic bacterium that increasingly resists antibiotics treatment. In order to Revised 29. 6. 2020 characterize and produce a soluble OmpA protein that can be used to develop Acinetobacter vaccine, polymerase chain reaction (PCR) Accepted 30. 6. 2020 was used to produce the ompA gene, of A. baumannii strain LI311, which was cloned into the histidin taged pET19b expression Published 1. 10. 2020 plasmid. Immobilized metal affinity chromatography (IMAC) was utilized to purify the recombinant protein, and amino acid sequences for OmpA protein homologs were attained from the National Center for Biotechnology Information (NCBI) protein resource then analyzed using the blast tool and Jalview program. Protein topology prediction was done using NCBI tools and PRED-TMBB2. Regular article Analysis of amino acid sequence of OmpA of A. baumannii strain LI311 showed that it has homologies to other clinical Acinetobacter spices , including: A. pittii , A.nosocomialis , A.seifertii, A. calcoaceticus, and A. ursingii with identity percentages of 100%, 100%, 96%, 92%, and 91%. Protein topology prediction revealed two conserved domains belonging to OmpA family protein ,which are beta-barrel domain outer membrane protein (OMP_b-brl) and OmpA-C-like domain, and it is a 10-βeta -stranded transmembrane Outer Membrane Protein with a signal peptide at residues 1–22A. A recombinant Histidine tagged- OmpA (39.31kDa )was successfully expressed and purified in this study. In conclusion, OmpA protein of A.baumannii strain LI31 is highly conserved across clinical species of Acinetobacter, and the soluble recombinant OmpA created in this study can be used to develop a putative vaccine that may prevent infections caused by the clinical species of Acinetobacter.
Keywords: Acinetobacter baumannii, ompA gene, expression, homology, putative vaccine
INTRODUCTION active and passive immunization to the outer membrane protein A(OmpA) (Fattahian et al., 2011 ) (Luo et al., 2012) and a multifunctional trimeric The Gram-negative genus, Acinetobacter, involves a naturally varied group of autotransporter (Ata) antigens (Bentancor et al., 2012a ). Nevertheless, the aerobic bacteria, non-fastidious , oxidase negative , unable to motile ,catalase- prevalence and solubility of these antigens represent major obstructions for positive bacilli (Peleg et al., 2008). Although Acinetobacter members are achievement of a generally protecting vaccine. generally depicted as ubiquitous nonpathogenic bacteria, strains of the The outer membrane proteins (OMPs) in Gram negative bacteria are distinctive Acinetobacter baumannii-Acinetobacter calcoaceticus become apparent as classes of essential membrane proteins. These proteins have vital functions for important opportunistic pathogenic bacteria to humans(Dijkshoorn et al., 2007; the cell, such as adhesion , nutrients utilization, signaling, secretion of waste as Perez et al., 2007). The capability of A. baumannii to have numerous virulence well as serving as a virulence factor in pathogenic strains. OMPs are highly factors, such as iron gaining mechanisms, motility, and efflux force in stabile in membrane and capable of resisting very severe environments because unfavorable environmental circumstances helps this bacterium to develop their β-barrel domains have 8 to 26 strands. The large, expanded loops linking infections. A. baumannii has the ability to survive and resist in hospitals the strands on the extracellular region, while the small loops were found on the conditions, so it has become one of the highly thriving hospital acquired periplasmic area (Rollauer et al., 2015). The OMPs possess comparable pathogenic bacterium that can stimulate cruicial infections to composition and biological features even though they have diverse sequences humans((Howard et al., 2012; Montefour et al., 2008; Peleg et al., 2008). (Chaturvedi and Mahalakshmi, 2017). The variety of OMPs sequence is much Moreover, this bacterium is implicated in outbreaks happening in rigorous more at N terminal significantly than C terminal, and proper assembly and hospital rooms((Bergogne-Berezin and Towner, 1996) , and it is frequently a folding of OMPs is controlled by the conserved β strands (Gessmann et al., source of pneumonia, blood poisoning, and cystisis after hospitalization of 2014). Nevertheless, the kinds of OMPs in A. baumannii have not been people with further strict diseases (Coelho et al., 2004). The potential characterized evidently, up to now, and only some reports are exist, including pathogenicity of A. baumannii includes the surfaces adherence capability, Omp33–36, OmpW, and OmpA (Choi & Lee, 2019). Amomg them, OmpA is biofilms formation, antimicrobial resistance, and acquisition of genetic materials extremely abundant protein on A. baumannii surface, and it is implicated in from distinct genera(Anstey et al., 2002; Howard et al., 2012). As resistance to bacterial growth, virulence, and drugs resistance. Due to the high immunogenic multiple antibiotics among A. baumannii are increasing (Kuo et al., 2007; properties of OmpA, it has been previously identified as a putative antigen to Qureshi et al., 2015 ), prevention and cure of diseases caused by this pathogen develope vaccines as well as passive immunotherapy for diseases caused by this have become a major health care threat; therefore, novel approaches to manage bacterium (Fajardo Bonin et al., 2014; Moriel et al., 2013). Interestingly, and prevent A. baumannii infections are required. Although vaccination OmpA of strain LI31 of A. baumannii is found to be a homolog to OmpA of signifies the greatest strategy to prevent A. baumannii infections ((Mishra et al., other clinical Acinetobacter spices, including, Acinetobacter pittii, 2012; Pachon & McConnell, 2014 ) , no effective vaccine has been developed Acinetobacter nosocomialis, Acinetobacter seifertii, Acinetobacter ursingii ,the for this pathogen to date. Antigens that induce immunity against proteins of the possible causes of bacterimia (Kishii et al., 2016; Liu et al., 2017; Loubinoux et bacterial outer membrane are vital antigen candidates because of their ability to al., 2003 ), Acinetobacter calcoaceticus that causes burns and wounds infections interact with the host as well as their position on the cell surface, which make (Pavlica and Tomanovic, 1989 ). A successful vaccine antigen to A. baumannii them available for antibody neutralization (McConnell et al., 2011). The infections may be helpful to protect against Acinetobacter spices; therefore , the potential and viability of immunization have previously been validated through current study aimed to:
317
J Microbiol Biotech Food Sci / Al-Saadi and Abbas 2020 : 10 (2) 317-320
1. Create a soluble recombinant OmpA protein that can be used as an antigen One colony of the expresion E. coli strain having pET19b-ompA, was inoculated candidate in Acinetobacter vaccine through cloning the corresponding ompA in a tube having three milliliters of LB broth suplimented with ampicillin then open reading frame from A.baumannii strain LI31 into pET19b vector, put in a shaker incubator at 37 °C overnight. Samples then were sub-cultured at expressing the histidine tagged OmpA protein, and purifying the fused OmpA 1:100 in six milliliters of LB/ ampicillin broth then put in an incubater adjusted using immobilized metal affinity chromatography (IMAC). to 37 °C. A spectrophotometer was used to measure the (OD) at 600 nm, and 2. Analyze the sequence of OmpA amino acid sequence of A.baumannii strain when it was about 0.6-0.8 and before protein production, 500 μL of each sample LI31 for toplogy prediction and conservation . was taken; then isopropyl-D-thiogalactopyranoside( IPTG ) was mixed at 1 mM with the growing cultures. The induced bacterial cells were cultivated in a shaker MATERIAL AND METHODS incubator at 37 °C for a period of 3 hours; a post induction sample (500 μL) was possessed then centrifuged at 13 rpm, 4 °C for two minutes. Supernatants were Amplification of ompA gene removed and 125 μL of 1X laemmli buffer was mixed with the pellet. Pellets were vortexed and placed in a 90 °C hot block for five minutes prior to storage at DNA of Acinetobacter baumannii strain LI311( standard strain obtained from the – 20 °C. Protein samples were examined utilizing SDS-PAGE and western central health lab in Baghdad )was elicited using bacterial RTP® extraction Kit blotting(10% gels) using Mouse monoclonal IgG anti-His (Millipore) (NEB) (InVitek- Germany). Primers used for detection of ompA gene were designed primary antibodies and the Goat anti-mouse IgG secondary antibody (Millipore). using clone manager software based on the published sequence of the gene on The blots images were captured using a Bio-Rad (ChemiDoc MP).Protein NCBI (Accession number: EU332799). The sequence of the forward primer induction and expression was done following the istructions of pET System including XhoI restriction site was:- 5’ CTCGAGGGAATGAAATTGAG3’. The Manual2 (Novagen). sequence of the reverse primer with BlpI restriction site was: - 5’ GTGTATTCGCGACAGCTGAGC3’. The entire ompA code (1002 bps) was Purification of the histidine-tagged OmpA synthesized utilizing the PCR Kit, Phusion ™ High-Fidelity from Thermo Fisher scientific. PCR testing was executed in a final amount of 50 μL of test Immobilized metal affinity chromatography (IMAC) (Nickel-chelated) was combination which contains 0.5 μM for each primer, 25 μL of 2X Phusion utilized in order to purify the histidine-tagged OmpA from the expression E. Master Mix, 100 ng/ 50 μL of DNA, and nuclease liberated water. DNA was coli strain as described in(Chiang et al., 2015). The fusion histidine-tagged synthesized to be first denatured for 30 seconds on 98°C then for 10 seconds (30 OmpA, was validated using SDS-PAGE as well as western blot. rounds), annealed at 54°C intended for half a minute, elongated by 72°C for a period of 40 seconds, and last extended on 72°C for a period of 5 minutes. The product was visualized by agarose gel system using 1% gels supplemented with ethidium bromide(0.5 μg/ml). Gels were explicated via a ChemiDoc MP (Bio- Sequencing alignments Rad). Bands matching the predictable size of ompA gene with restriction sites (1018 bp) then extracted from the gel by the Thermo scientific Gene Extraction Amino acid sequences for OmpA protein homologs were attained from (NCBI) Kit. protein resource then analyzed using the blast tool (NCBI). Homologs for Omp A protein from other pathogenic Acinetobacter spp were chosen [Accession Creation and validation of recombinant construct numbers: ABY47586.1, WP_044100281.1,WP_107972446.1, WP_111034814.1,PMC94806.1, WP_016137162.1] and aligned using clustal The histidne tagged pET19b and PCR fragment were cut by Fast Digest Omega website. The color shades were given according to % identity coloring of restriction enzymes (XhoI and BlpI) (Thermo scientific). The cut PCR fragments Jalview. were then cloned into the digested vector using T4 DNA ligase and ligase buffer. The ligated recombinant vectors were then moved into E. coli strain Topology prediction DH5a(Thermo Fisher Scientific) then cultivated on Luria-Bertani (LB) plates having hundred microgram per mililiter of ampicillin for selection. Clones were Protein topology prediction was done using NCBI tools and PRED- chosen randomly and cultivated on 37 °C in a test tube having five mliliters of TMBB2(Elofsson et al., 2016) LB broth and ampicillin (100 μg/ ml). Constructs were extracted from overnight cultures employing the Gene JETTM Plasmid Mini prep Kit (Thermo scientific). RESULTS Recombinant vectors were validated by colony PCR, cutting by restriction enzymes, and DNA base Sequencing using a DNA automatic sequencer. For Topology prediction of OmpA from A.baumannii strain LI31 protein production, the created construct was moved to E. coli BL21 (DE3)(NEWENGLAND Biolabs).The creation and validation of our construct Sequence analysis of OmpA from A.baumannii strain LI31 revealed two was done following the istructions of pET System Manual2 (Novagen). conserved domains belonging to OmpA family protein: OMP_b-brl and OmpA_C-like ( Figure 1.A). These domains are highly conserved acrooss Omp A protein induction and expression Acinetobacter spp. Results from topology prediction revealed the OmpA peptide as a 10-βeta -stranded transmembrane outer membrane protein categorized as the Outer Membrane Protein beta-barrel domain Family(Figure1.B)
Figure 1 Topology prediction of OmpA of A.baumannii strain LI31.A. Conserved domains were identified based on the BLAST search tool of NCBI. B. External loops: L1–L5, transmembrane β- strands: B1–B10 based on PRED-TMBB2 Acinetobacterspp is shown in Figure2. Selected homologous sequnces belong to Analysis of OmpA conservation within Acinetobacter spp Acinetobacter pittii, Acinetobacter seifertii, Acinetobacter nosocomialis , Acinetobacter calcoaceticus , Acinetobacter ursingii with identity percentages of Representative alignments for Sequence of the Omp A of A. baumannii strain 100%, 100%, 96%,92%, 91% respectively . LI311 with homologous sequences of OmpA protein from other
318
J Microbiol Biotech Food Sci / Al-Saadi and Abbas 2020 : 10 (2) 317-320
Figure 2 OmpA amino acid alignment within Acinetobacter spp. Alignment was performed using clustal , and the colors were given according to % identity coloring of Jalview. OMP_b-brl is denoted by red and OmpA_C-like is denoted by purple
Creation and validation of recombinant construct DISCUSSION
The amplified ompA gene from Acinetobacter baumannii strain LI311 (1018 bp) Acinetobacter baumannii is a significant microorganism that can affect humans was cut by XhoI and BlpI and ligated into the matching positions of pET19b health nowadays due to the brisk appearance and dissemination of strains plasmid digested with the same restriction enzymes. Clones were selected capable of resistting antimicrobial agents with elivated mortality rates related to randomly from LB/ Ampicillin plates for PCR verification (Figure 3.A).The their infections((Wang-Lin et al., 2017). Despite that there is no authorized recombinant plasmid, pET19b-ompA, was also validated by restriction digestion vaccine at present to A.baumannii , immunization approaches are promising as a using XhoI and BlpI and analyzed by agarose gel electrophoresis (Figure 3.B). feasible choice to control multi- resistant infections. One of the most important Sequencing of DNA was utilized using a DNA automatic sequencer in order to principles that should be taken for consideration when selecting an antigen from ensure there is no mutation. The nucleotide sequence of ompA gene in the created the proteome of a specified pathogen is that it has to be ubiquitous and construct of pET19b-ompA was consistent with ompA gen sequenc of conserved among diverse bacterium strains((Ahmad et al., 2016; Chen, 2015 ). Acinetobacter baumannii strain LI311 published in the GenBank (Accession: OmpA of A.baumannii strain LI31, encodes the polypeptides of 334 amino acids, EU332799). was selected as a putative vaccine in this study because the blast analysis of OmpA of this bacterium showed that this protein is not only completely conserved across various strains of A.baumannii, but it is also a homolog to A B OmpA of some clinical Acinetobacter species, among them, A. pittii , A. nosocomialis , A. seifertii, A. calcoaceticus, and A. ursingii with identity percentages of 100%, 100%, 96%,92%, 91% respectively. In addition, the OmpA protein of A.baumannii possesses high immunogenic property making it as a putative antigen for vaccines development(Fajardo Bonin et al., 2014). Sequence analysis of OmpA from A.baumannii strain LI31 revealed two conserved domains belonging to OmpA family protein (domain architecture ID 10607194) . The first is OMP_b-brl, which is identified in a broad range of outer membrane proteins as a membrane bound beta. The second domain is OmpA_C- like , which is peptidoglycan binding domain like the carboxyl terminal domain of OmpA ( Marchler-Bauer et al., 2017). These domains are highly conserved Figure 3 Agarose gel electrophoresis analysis and confirmation of the fused acrooss Acinetobacter spp. The topology prediction revealed the OmpA peptide pET19b-ompA by A. colony PCR.Lane1: 10000bp DNA marker, Lanes 2-11: as a 10-βeta -stranded transmembrane outer membrane protein categorized as the the target amplification of ompA gene (Predicted size is 1018bp), lane 12: Outer Membrane Protein beta-barrel domain Family). Residues 1–22 were negative control, and lane 13: positive control. B. Restriction digestion. Lane1: considerd as a signal peptide. 10000 bp DNA marker, Lane 2: pET19b-ompA digested with XhoI and BlpI, A. baumannii is the favored genus of Acinetobacter for scientists to produce Lane 3: ompA gene, Lane 4: uncut pET19b-ompA. Expected size of pET19b : vaccine because it is linked to the greatest rate of morbidness, lethality, and 5671 bp, pET19b-ompA : 6673bp, ompA gene :1018bp antibiotics resistance (ournier & Richet, 2006 ). To present, confined research were done on A. baumannii to find effective immunization approaches. Among Expression and purification of Hist-tagged OmpA fusion protein which, active and passive immunization against the biofilm assiociated protein (Bap) ((Fattahian et al., 2011), OmpA(Luo et al., 2012 ) , poly-N-acetyl-β-(1- The Hist-tagged OmpA was successfully expressed using 1 mM of IPTG, and 6)-glucosamine (PNAG)( Bentancor et al., 2012b ), Ata(Bentancor et al., 2012 purification is done by Nickel-chelated immobilized metal affinity ) ,and polysacharade capsule (Russo et al., 2010) were tested. In addition,62 chromatography (Figure 4). antigens were determined in the entire species of A. baumannii , which could be utilized as vaccin candidates; among them ompA was considers as one of these A B possible targets (Moriel et al., 2013).Furthermore, a previous study showed that active and passive immunization can be produced by recombinant OmpA protein after infecting diabetic mice by A. baumannii eventhough sera resistance was not accomplished (Luo et al., 2012) . OmpA protein is also demonstrated to be able prevent infections of A. baumannii in mice by trigaring signal pathways of INF-γ and IL-4(Lin et al., 2013 ). In addition,in a recently published study, eukaryotic expression vector ,pBudCe4.1, was used to clone and express ompA gene of A. baumannii as a DNA vaccine, but the researchers reffered to the oncogenic posibility of the created recombinant molecules after an irregular combination with hosts genomes (Ansari et al., 2018).
CONCLUSION
In this report, a soluble recombinant OmpA protein of A.baumannii strain LI31, immensely conserved across clinical species of Acinetobacter, was successfully Figure 4 Sodium Dodisyle Sulfate -PAGE (A) and Western bloting (B) of produced and purified. The outcome of our research can be employed to develop purified His-OmpA. Lane1: molecular protein marker, Lane2: cell lysate after a vaccine candidate for Acinetobacter infections. induction of His- OmpA by 1 mM IPTG, Lane3: purified His-OmpA. The expected molecular weight of His– OmpA is 39.31kDa)
319
J Microbiol Biotech Food Sci / Al-Saadi and Abbas 2020 : 10 (2) 317-320
Acknowledgments: Thanks for University of Al -Qadisiyah, Iraq to support us dose alters immune polarization and immunodominant epitopes. Vaccine, 31(2), for performing our research. 313-318. https://doi.org/10.1016/j.vaccine.2012.11.008 Liu, Y.-M., Lee, Y.-T., Kuo, S.-C., Chen, T.-L., Liu, C.-P., & Liu, C.-E. (2017). REFERENCES Comparison between bacteremia caused by Acinetobacter pittii and Acinetobacter nosocomialis. Journal of Microbiology, Immunology and Infection, Ahmad, T. A., Tawfik, D. M., Sheweita, S. A., Haroun, M., & El-Sayed, L. H. 50(1), 62-67. https://doi.org/10.1016/j.jmii.2015.01.003 (2016). Development of immunization trials against Acinetobacter baumannii. Loubinoux, J., Mihaila-Amrouche, L., Le Fleche, A., Pigne, E., Huchon, G., Trials in Vaccinology, 5, 53-60. doi:https://doi.org/10.1016/j.trivac.2016.03.001 Grimont, P. A. D., & Bouvet, A. (2003). Bacteremia Caused by Acinetobacter Ansari, H., Doosti, A., Kargar, M., Bijanzadeh, M., & Jaafarinia, M. (2018). ursingii. Journal of clinical microbiology, 41(3), 1337-1338. Cloning of ompA gene from Acinetobacter baumannii into the eukaryotic https://doi.org/10.1128/jcm.41.3.1337-1338.2003 expression vector pBudCE4.1 as DNA vaccine. Indian J Microbiol, 58(2), 174- Luo, G., Lin, L., Ibrahim, A. S., Baquir, B., Pantapalangkoor, P., Bonomo, R. A., 181. https://doi.org/10.1007/s12088-017-0705-x Doi, Yohei., Adams, Mark D., Russo, Thomas A. Spellberg, B. (2012). Active Anstey, N. M., Currie, B. J., Hassell, M., Palmer, D., Dwyer, B., & Seifert, H. and Passive Immunization Protects against Lethal, Extreme Drug Resistant- (2002). Community-acquired bacteremic Acinetobacter pneumonia in tropical Acinetobacter baumannii Infection. PLoS One, 7(1), e29446. Australia is caused by diverse strains of Acinetobacter baumannii, with carriage https://doi.org/10.1371/journal.pone.0029446 in the throat in at-risk groups. J Clin Microbiol, 40(2), 685-686. Marchler-Bauer, A., Bo, Y., Han, L., He, J., Lanczycki, C. J., Lu, S., Marchler, https://doi.org/10.1128/jcm.40.2.685-686.2002 G. H., Song, J. S.,Thanki, N.,Wang, Z.,Yamashita, R. A.,Zhang, D.,Zheng, Bentancor, L. V., Camacho-Peiro, A., Bozkurt-Guzel, C., Pier, G. B., & Maira- C.,Geer, L. Y. Bryant, S. H. (2017). CDD/SPARCLE: functional classification of Litrán, T. (2012)a. Identification of Ata, a multifunctional trimeric proteins via subfamilydomain architectures. Nucleic Acids Res, 45(D1), D200- autotransporter of Acinetobacter baumannii. J Bacteriol. d203. https://doi.org/10.1093/nar/gkw1129 https://doi.org/10.1128/JB.06769-11 McConnell, M. J., Dominguez-Herrera, J., Smani, Y., Lopez-Rojas, R., Docobo- Bentancor, L. V., O'Malley, J. M., Bozkurt-Guzel, C., Pier, G. B., & Maira- Perez, F., & Pachon, J. (2011). Vaccination with outer membrane complexes Litran, T. (2012)b. Poly-N-acetyl-beta-(1-6)-glucosamine is a target for elicits rapid protective immunity to multidrug-resistant Acinetobacter baumannii. protective immunity against Acinetobacter baumannii infections. Infect Immun, Infect Immun, 79(1), 518-526. https://doi.org/10.1128/IAI.00741-10 80(2), 651-656. https://doi.org/10.1128/IAI.05653-11 Mishra, R. P., Oviedo-Orta, E., Prachi, P., Rappuoli, R., & Bagnoli, F. (2012). Bergogne-Berezin, E., & Towner, K. J. (1996). Acinetobacter spp. as nosocomial Vaccines and antibiotic resistance. Curr Opin Microbiol, 15(5), 596-602. pathogens: microbiological, clinical, and epidemiological features. Clin https://doi.org/10.1016/j.mib.2012.08.002 Microbiol Rev, 9(2), 148-165. Montefour, K., Frieden, J., Hurst, S., Helmich, C., Headley, D., Martin, M., & Chaturvedi, D., & Mahalakshmi, R. (2017). Transmembrane β-barrels: Evolution, Boyle, D. A. (2008). Acinetobacter baumannii: an emergingmultidrug-resistant folding and energetics. Biochim Biophys Acta Biomembr, 1859(12), 2467-2482. pathogen in critical care. Crit Care Nurse, 28(1), 15-25. https://doi.org/10.1016/j.bbamem.2017.09.020 https://doi.org/10.4037/ccn2008.28.1.15 Chen, W. (2015). Current advances and challenges in the development of Moriel, D. G., Beatson, S. A., Wurpel, D. J., Lipman, J., Nimmo, G. R., Paterson, Acinetobacter vaccines. Hum Vaccin Immunother, 11(10), 2495-2500. D. L., & Schembri, M. A. (2013). Identification of Novel Vaccine Candidates https://doi.org/10.1080/21645515.2015.1052354 against Multidrug-Resistant Acinetobacter baumannii. PLoS One, 8(10), e77631. Chiang, M. H., Sung, W. C., Lien, S. P., Chen, Y. Z., Lo, A. F., Huang, J. H., https://doi.org/10.1371/journal.pone.0077631 Kuo, S. C. Chong, P. (2015). Identification of novel vaccine candidates against Pachon, J., & McConnell, M. J. (2014). Considerations for the development of a Acinetobacter baumannii using reverse vaccinology. Hum Vaccin Immunother, prophylactic vaccine for Acinetobacter baumannii. Vaccine, 32(22), 2534-2536. 11(4), 1065-1073. https://doi.org/10.1080/21645515.2015.1010910 https://doi.org/10.1016/j.vaccine.2013.10.064 Choi, U., & Lee, C. R. (2019). Antimicrobial Agents That Inhibit the Outer Pavlica, R., & Tomanovic, B. (1989). [Acinetobacter calcoaceticus as a cause of Membrane Assembly Machines of Gram-Negative Bacteria. J Microbiol infection in wounds and burns]. Srp Arh Celok Lek, 117(5-6), 319-324. Biotechnol, 29(1), 1-10. https://doi.org/10.4014/jmb.1804.03051 Peleg, A., Seifert, H., & Paterson, D. L. (2008). Acinetobacter baumannii: Coelho, J., Woodford, N., Turton, J., & Livermore, D. M. (2004). Multiresistant emergence of a successful pathogen. Clin Microbiol Rev, 21(3), acinetobacter in the UK: how big a threat? J Hosp Infect, 58(3), 167-169. https://doi.org/10.1128/CMR.00058-07 https://doi.org/10.1016/j.jhin.2003.12.019 Perez, F., Hujer, A. M., Hujer, K. M., Decker, B. K., Rather, P. N., & Bonomo, Dijkshoorn, L., Nemec, A., & Seifert, H. (2007). An increasing threat in R. A. (2007). Global Challenge of Multidrug-Resistant Acinetobacter baumannii. hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol, Antimicrob Agents Chemother, 51(10), 3471-3484. 5(12), 939-951. https://doi.org/10.1038/nrmicro1789 https://doi.org/10.1128/AAC.01464-06 Elofsson, A., Tsirigos, K. D., & Bagos, P. G. (2016). PRED-TMBB2: improved Qureshi, Z. A., Hittle, L. E., O'Hara, J. A., Rivera, J. I., Syed, A., Shields, R. K., topology prediction and detection of beta-barrel outer membrane proteins. Pasculle, A. W.,Ernst, R. K. Doi, Y. (2015). Colistin-resistant Acinetobacter Bioinformatics, 32(17), i665-i671. https://doi.org/10.1093/bioinformatics/btw444 baumannii: beyond carbapenem resistance. Clin Infect Dis, 60(9), 1295-1303. Fajardo Bonin, R., Chapeaurouge, A., Perales, J., Silva, J. G., do Nascimento, H. https://doi.org/10.1093/cid/civ048 J., D'Alincourt Carvalho Assef, A. P., & Moreno Senna, J. P. (2014). Rollauer, S. E., Sooreshjani, M. A., Noinaj, N., & Buchanan, S. K. (2015). Outer Identification of immunogenic proteins of the bacterium Acinetobacter membrane protein biogenesis in Gram-negative bacteria. Philos Trans R Soc baumannii using a proteomic approach. PROTEOMICS – Clinical Applications, Lond B Biol Sci, 370(1679). https://doi.org/10.1098/rstb.2015.0023 8(11-12), 916-923. https://doi.org/10.1002/prca.201300133 Russo, T. A., Luke, N. R., Beanan, J. M., Olson, R., Sauberan, S. L., MacDonald, Fattahian, Y., Rasooli, I., Mousavi Gargari, S. L., Rahbar, M. R., Darvish Alipour U., Schultz, L. W., Umland, T. C.,Campagnari, A. A. (2010). The K1 capsular Astaneh, S., & Amani, J. (2011). Protection against Acinetobacter baumannii polysaccharide of Acinetobacter baumannii strain 307-0294 is a major virulence infection via its functional deprivation of biofilm associated protein (Bap). factor. Infect Immun, 78(9), 3993-4000. https://doi.org/10.1128/IAI.00366-10 Microb Pathog, 51(6), 402- 406. Wang-Lin, S. X., Olson, R., Beanan, J. M., MacDonald, U., Balthasar, J. P., & doi:https://doi.org/10.1016/j.micpath.2011.09.004 Russo, T. A. (2017). The Capsular Polysaccharide of Acinetobacter baumannii Is Fournier, P. E., & Richet, H. (2006). The epidemiology and control of an Obstacle for Therapeutic Passive Immunization Strategies. Infect Immun, Acinetobacter baumannii in health care facilities. Clin Infect Dis, 42(5), 692-699. 85(12), e00591-00517. https://doi.org/10.1128/IAI.00591-17 https://doi.org/10.1086/500202 Gessmann, D., Chung, Y. H., Danoff, E. J., Plummer, A. M., Sandlin, C. W., Zaccai, N. R., & Fleming, K. G. (2014). Outer membrane β-barrel protein folding is physically controlled by periplasmic lipid head groups and BamA. Proc Natl Acad Sci U S A, 111(16), 5878-5883. https://doi.org/10.1073/pnas.1322473111 Howard, A., O’Donoghue, M., Feeney, A., & Sleator, R. D. (2012). Acinetobacter baumannii: An emerging opportunistic pathogen. Virulence, 3(3), 243-250. https://doi.org/10.4161/viru.19700 Kishii, K., Kikuchi, K., Tomida, J., Kawamura, Y., Yoshida, A., Okuzumi, K., & Moriya, K. (2016). The first cases of human bacteremia caused by Acinetobacter seifertii in Japan. Journal of Infection and Chemotherapy, 22(5), 342-345. doi:https://doi.org/10.1016/j.jiac.2015.12.002 Kuo, L. C., Lai, C. C., Liao, C. H., Hsu, C. K., Chang, Y. L., Chang, C. Y., & Hsueh, P. R. (2007). Multidrug-resistant Acinetobacter baumannii bacteraemia: clinical features, antimicrobial therapy and outcome. Clin Microbiol Infect, 13(2), 196-198. https://doi.org/10.1111/j.1469-0691.2006.01601.x Lin, L., Tan, B., Pantapalangkoor, P., Ho, T., Hujer, A. M., Taracila, M. A., Bonomo, R. A. Spellberg, B. (2013). Acinetobacter baumannii rOmpA vaccine
320