USOO748.2138B2

(12) United States Patent (10) Patent No.: US 7482,138 B2 Minden (45) Date of Patent: Jan. 27, 2009

(54) PAK5-RELATED COMPOSITIONS AND Brown, J. et al. (1996) Human Ste20 homologue hPAK1 links METHODS GTPase to JNK MAP kinase pathway. Curr. Biol. 6,598-605. Burbelo, P.D. et al. (1995) “A conserved binding motif defines (75) Inventor: Audrey Minden, New York, NY (US) numerous candidate target proteins for both Cdc42 and Rac GTPases,” J. Biol. Chem. 270, 29071-29074. (73) Assignee: The Trustees of Columbia University Cvrckova, F. etal. (1995) "Ste20-like protein kinases are required for in the City of New York, New York, NY normal localization of cell growth and for cytokinesis in budding (US) yeast.” Genes Dev. 9, 1817-1830. Dascher, C. and Balch, W.E. (1994) “Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to Golgi transport and trigger (*) Notice: Subject to any disclaimer, the term of this disassembly of the Golgi apparatus.” J. Biol. Chem. 269, 1437-48. patent is extended or adjusted under 35 Dharmawardhane, S. et al. (1997) “Localization of p21-activated U.S.C. 154(b) by 314 days. kinase 1 (PAK1) to pinocytic vesicles and cortical actin structures in stimulated cells. J. Cell. Biol. 138, 1265-1278. (21) Appl. No.: 10/331,095 Erickson, J.W. etal. (1996)"Mammalian Cdc42 is a brefeldin A-sen sitive component of the Golgi apparatus.” J. Biol. Chem. 271,26850 (22) Filed: Dec. 27, 2002 26854. Erickson, J.W. et al. (1997) “Identification of an actin cytoskeleton (65) Prior Publication Data complex that includes IQGAP and the Cdc42 GTPase.” J. Biol. US 2003/O124107 A1 Jul. 3, 2003 Chem. 272, 24443-24447. Fukata, M. etal. (1997) “Regulation of cross-linking of actin filament Related U.S. Application Data by IQGAP1, a target for Cdc42,” J. Biol. Chem. 272; 29579-295.83. Harden, N. et al. (1996) "A Drosophila homolog of the Rac- and (60) Provisional application No. 60/343,972, filed on Dec. Cdc42-activated serine/threonine kinase PAK is a potential focal 28, 2001. adhesion and focal complex protein that colocalizes with dynamic actin structures. Mol. Cell. Biol. 16, 1896-1908. (51) Int. Cl. Hillier, L. et al. (1995) yg22e03.rl Soars infant brain 1NIB Homo CI2P 2/06 (2006.01) sapiens cDNA clone IMAGE:32974 5" similar to SP:KPAK-RAT (52) U.S. Cl...... 435/69.1; 435/6: 435/69.1; p35465, EST Database Accession No. R18825. 435/320.1; 435/252 Joneson, T. etal. (1996) "RAC regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase.” Science 274. (58) Field of Classification Search ...... None 1374-1376. See application file for complete search history. Kozma, R. et al. (1995) “The Ras-related protein Cdc42Hs and (56) References Cited bradykinin promote formation of peripheral actin microSpikes and filopedia in Swiss fibroblasts.” Mol. Cell. Biol. 15, 1942-1952. U.S. PATENT DOCUMENTS Kuroda, S. etal. (1996) “Identification of IQGAPasaputative target for the small GTPases, Cdc42 and Rac1, J. Bio. Chem. 271, 23363

5,518,911 A 5/1996 Abo et al...... 435.194 23367. 5,605,825 A 2f1997 Abo et al...... 435.194 5,698,428 A 12/1997 Abo et al...... 435.194 Manser, E. et al. (1997) “Expression of constitutively active alpha 5,698,445 A 12/1997 Abo et al...... 435,325 PAK reveals effects of the kinase on actin and focal complexes.” Mol. 6,013,464 A 1/2000 Abo et al...... 435/15 Cell. Biol. 17, 1129-1143. 6,013,500 A 1/2000 Minden ...... 435,194 Melnik, M.M. (1997) Genbank Accession No. AF005046. 6,048,706 A 4/2000 Abo et al...... 435/15 Pelech, S.L. (1996) “Kinase connections on the cellular intranet. 6,680, 170 B2 1/2004 Plowman et al. Signalling Pathways.” Curr. Biol. 6, 551-554. 2003/005O230 A1 3/2003 Plowman et al...... 514/12 Rana, A. et al. (1996) "The mixed lineage kinase SPRK phosphorylates and activates the stress-activated protein kinase acti FOREIGN PATENT DOCUMENTS vator SEK-1. J. Biol. Chem. 271, 19025-19028. EP 1085093 A2 9, 2000 Sells, M.A. et al. (1997) “Human p21-activated kinase (Pak1) regu WO OO73469 A2 5, 2000 lates actin organization in mammalian cells.” Curr. Biol. 7, 202-210. WO O1/366O2 A2 * 5, 2001 WO O1366O2 A2 5, 2001 (Continued) Primary Examiner Hope A Robinson OTHER PUBLICATIONS (74) Attorney, Agent, or Firm John P. White; Cooper & Jaffer et al. Int. J. Biochem. Cell B., vol. 34, pp. 713-717, 2002.* Dunham LLP Pandey et al. Oncogene, vol. 21, pp. 3939-3948, 2002.* Witkowski et al. Biochemistry, vol. 38, pp. 11643-1 1650, 1999.* (57) ABSTRACT Dang et al., Clin. Cancer Res., vol. 4, pp. 471-474, 1999.* Fox, J., Nat. Biotechnol., vol. 21, p. 217, 2003.* Jan. 10, 2007 Supplementary European Search Report issued in This invention provides nucleic acids encoding human connection with related European Patent Application No. 02794435. PAK5-related proteins, and provides the encoded proteins. 4. This invention also provides vectors, cells and compositions. Bashour, A.M. et al. (1997) “IQGAP1, a Rac- and Cdc42-binding Finally, this invention provides methods of inducing and protein directly bonds and cross-links microfilaments.” J. Cell. Biol. inhibiting various cellular processes using the instant nucleic 137, 1555-1566. acids and proteins. Benner, G.E. et al. (1995) “Activation of an S6/H4 kinase (PAK65) from human placenta by intramolecular and intermolecular autophosphorylation.” J. Biol. Chem. 270, 21121-21128. 16 Claims, 13 Drawing Sheets US 7482,138 B2 Page 2

OTHER PUBLICATIONS Coso, O.A. et al. (1995) The Small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Cell Szczepanowska, J. etal. (1997) “Identification by mass spectrometry 81, 1137-1146 (Exhibit 16). of the phosphorylated residue responsible for activation of the cata Cvrckova, F. etal. (1995) Ste20-like protein kinases are required for lytic domain of myosin I heavy chain kinase, a member of the PAK normal localization of cell growth and for cytokinesis in budding STE20 family.” Proc. Natl. Acad. Sci. U.S.A. 94,8503-8508. yeast. Genes Dev. 9, 1817-1830 (Exhibit 17). Teramoto, H. et al. (1996) "Signaling from the Small GTP-binding Dascher, C., and Balch, W.E. (1994) Dominant inhibitory mutants of proteins Rac1 and Cdc42 to the c-Jun N-terminal kinase? stress-acti ARF1 block endoplasmic reticulum to Golgi transport and trigger vated protein kinase pathway. A role for mixed lineage kinase 3/pro disassembly of the Golgi apparatus. J. Biol. Chem. 269, 1437-48 tein-tyrosine kinase 1, a novel member of the mixed lineage kinase (Exhibit 18). family.” J. Biol. Chem. 271, 27225-277228. Dharmawardhane, S. et al. (1997) Localization of p21-activated Van Aelst, L. and D'Souza-Schorey, C. (1997) “Rho GTPases and kinase 1 (PAK1) to pinocytic vesicles and cortical actin structures in signaling networks.” Genes Dev. 11; 2295-2322. stimulated cells. J. Cell. Biol. 138, 1265-1278 (Exhibit 19). Westwick, J.K. etal. (1997) “Rac regulation of transformation, gene Donaldson, J.G. et al. (1992) ABP-ribosylation factor, a small GTP expression, and actin organization by multiple, PAK-Independent binding of the coatomer proteinbeta-COP to Glogimembranes. Proc. pathways.” Mol. Cell. Biol. 17, 1324-1335. Natl. Acad. Sci. U.S.A. 89, 6408-6412 (Exhibit 20). Zhang, S. et al. (1995) “Rho family GTPases regulate p38 mitogen Donaldson, J.G. et al. (1992) Erefaldin A inhibits golgi membrane activated protein kinase through the downstream mediator Pak1.J. catalysed exchange of guanine nucleotide into ARF protein. Nature Biol. Chem. 270, 23934-23936. 360, 350-352 (Exhibit 21). Database EMBL, Oct. 1, 2000, Watanabe, et al., “Serine/Threonine Dutartre, H. et al. (1994) Cytokinesis arrest and redistribution of protein kinase Pak 5” XP002164869, retrieved from EBI accession actin-cytoskeleton regulatory components in cells expressing the Fho No. q9p286. GTPase CDC42HS.J. Cell. Sci. 109, 367-377 (Exhibit 22). Database EMBL, Apr. 26, 2000, Watanabe, et al., “Pak, a novel group Erickson, J.W. et al. (1996) Kammalian Cdc42 is a brefeldin A-sen II PAK family kinase that is predominantly expressed in the brain' sitive component of the Golgi apparatus. J. Biol. Chem. 271. 26850 XP002411019, retrieved from EBI accession No. BAA94194. 26854 (Exhibit 23). Database EMBL, Apr. 26, 2000, Watanabe, et al., “Pak, a novel group Erickson, J.W. et al. (1997) Identification of an actin cytoskeletal II PAK family kinase that is predominantly expressed in the brain' complex that includes IQGAP and the Cdc42 GTPase. J. Biol. Chem. XP002411020, retrieved from EBI accession No. AB040812. 272, 24443-24447 (Exhibit 24). Pandey, A. et al., “Cloning and characterization of PAK5, a novel Fukata, M. etal. (1997) Regulation of cross-linking of actin filament member of mammalian p21-activated kinase-II subfamily that is by IQGAP1, a target for Cdc42. J. Biol. Chem. 272, 29579-295.83 predominantly expressed in brain'. Oncogene, vol. 21. No. 24. May (Exhibit 25). 30, 2002, pp. 3939-3948. Hanks, S.K. et al. (1989) The protein kinase family: conserved fea Jaffer, Z. et al., “p21-Activated kinases: three more join the Pak”. tures and deduced phylogeny of the catalytic domains. Science 241, International Journal of Biochemistry and Cell Biology, vol. 34. No. 42-52 (Exhibit 26). 7, 2002, pp. 713-717. Harden, N. et al. (1996) A Drosophila homolog of the Rac- and Dan, C. et al., “PAK5, a new brain-specific kinase, promotes neurite Cdc42-activated serine/threone kinase PAK is a potential focal adhe outgrowth in N1E-115 Cells'. Molecular and Cellular Biology, vol. sion and focal complex protein that colocalizes with dynamic actin 22, No. 2, Jan. 2002, pp. 567-577. structures. Mol. Cell. Biol. 16, 1896-1908 (Exhibit 27). Cau, J. et al., “A novel p21-activated kinase binds the actin and Hart, M.M. et al. (1996) IQGAP, a calmodulin-binding protein with microtubule networks and induces microtubule stabilization', Jour a rasSAP-related domain, is a potential effector for cdc4Hs. EMBO nal of Cell Biology, vol. 155, No. 6, Dec. 10, 2001, pp. 1029-1042. J. 15, 2997-3005 (Exhibit 28). Daniels, R.H. et al., “Membrane targeting of p21-activated kinase 1 Helms, J.B., and Fothman, J.E. (1992) Inhibition by brefeldin A of a (PAK1) induces neurite outgrowth from PC12 cells”, EMBOJournal, golgi membrane enzyme that catalyses exchange of guanine vol. 17, No. 3, Feb. 2, 1998, pp. 754-764. nucleotide bound to ARF. Nature 360, 352-354 (Exhibit 29). Bagrodia, S. et al., “Pak to the future'. Trends in Cell Biology, vol.9, Hillier, L. et al. (1995) yg22eG3.rl Soars infant brain 1NIB Homo No. 9, Sep. 1999, pp. 350-355. sapiens cDNA clone IMAGE:32974 5" similar to SP:KPAK-RAT Xia, C. et al., “Regulation of the p21-activated kinase (PAK) by a p35465, EST Catatse Accession No. R18825 (Exhibit 30). human GB-like WD-repeat protein, hPIP1, Proceedings of the Johnson, L. et al. (1996) Active and inactive protein kinases: struc National Academy of Sciences of the United States of America, vol. tural basis for regulation. Cell 65, 149-158 (Exhibit 31). 98, No. 11, May 22, 2001, pp. 6174-6179. Joneson, T. etal. (1996) RAC regulation of actin polymerization and Aspenstrom, P. et al. (1996) Two GTPases, Cdc42 and Rac, bind proliferation by a pathway distinct from Jun kinase. Science 274. directly to a protein implicated in the immunodeficiency disorder 1374-1379 (Exhibit 32). Wiskott-Aldrich syndrome. Curr. Biol. 6, 70-75 (Exhibit 9). Kozma, R. et al. (1995) The Ras-related protein Cdc42Hs and Bagrcdia, S. etal. (1995) Cdc42 and PAK-mediated signaling leads to bradykinin promote formation of peripheral actin microSpikes and Jun kinase and p38 mitogen-activated protein kinase activation. J. filopodia in Swiss fibroblasts. Mol. Cell. Biol. 15, 1942-1952 Biol. Chem. 270, 27995-27998 (Exhibit 10). (Exhibit 33). Bashour, A.M. et al. (1997) IQGAP1, a Rac- and Cdc42-binding Kuroda, S. et al. (1996) Identification of IQGAF as a putative target protein, directly binds and cross-links microfilaments. J. Cell. Biol. for the Small GTPases, Cdc42 and Racl. J. Bio. Chem. 271, 23363 137, 1555-1566 (Exhibit 11). 23367 (Exhibit 34). Benner, G.E. et al. (1995) Activation of an S6/H4 kinase (PAK 65) Lamarche, N. et al. (1996) Rac and Cdc42 induce actin polymeriza from human placenta by intramolecular and intermolecular tion and G1 cell cycle progression independently of p65PAK and the autophosphorylation. J. Biol. Chem. 270,21121-21128 (Exhibit 12). JNK/SAFK MAP 10 kinase cascade. Cell 87,519-529 (Exhibit 35). Bershadsky, A., and Futerman, A. (1994) Disruption of the Golgi Manser, E. et al. (1993) A non-receptor tyrosine kinase that inhibits apparatus by brefeldin Ablocks cell polarization and inhibits directed the GTPase activity of p21cdc42. Nature 363, 364-367 (Exhibit 36). cell migration. Proc. Natl. Acad. Sci. U.S.A. 91,5685-5689 (Exhibit Manser, E. et al. (1994) A brain serine/threonine protein kinase 13). activated by Cdc42 and Facl. Nature 367, 40-46 (Exhibit 37). Brown, J. et al. (1996) Human Ste20 homologue hPAK1 links Manser, E. et al. (1997) Expression of constitutively active alpha GTPase to JNK MAP kinase pathway. Curr. Biol. 6,598-605 (Exhibit PAK reveals effects of the kinase on actin and focal complexes. Mol. 14). Cell. Biol. 17, 1129-1143 (Exhibit 38). Burbelo, P.D. etal. (1995) A conserved binding motif defines numer Manser, E. et al. (1998) PAK kinases are directly coupled to the PIX ous candidate target proteins for both Cdc42 and Rac GTPases. J. family of nucleotide exchange factors. Mol. Cell. 1, 183-192 (Exhibit Biol. Chem. 276, 29071-29074 (Exhibit 15). 39). US 7482,138 B2 Page 3

Marshall, C.J. (1994) Signal transduction. Hotlips and phosphoryla Szczepanowska, J. et al. (1997) Identification by mass spectrometry tion of protein kinases. Nature 367, 686 (Exhibit 40). of the phosphorylated residue responsible for activation of the cata Martin, G.A. et al. (1995) A novel serine kinase activated by rac1/ lytic domain of myosin I heavy chain kinase, a member of the PAK CDC42Hs-dependent autophosphorylation is related to PAK65 and STE.0 family. Proc. Natl. Acad. Sci. U.S.A. 94,8503-8508 (Exhibit STE20. EMBO J. 14, 1970-1979 (Exhibit 41). 54). Melnik, M.M. (1997) GenBank Accession No. AF005046 (Exhibit Takebe, Y. etal. (1988) SRalpha promoter: an efficient and versatile 42). mammalian cDNA expression system composed of the simian virus Minden, A. et al. (1994) Differential activation of ERK and JNK 40 early promoter and the F-U5 segment of human T-cell leukemia mitogen-activated protein kinases by Raf-1 and MEKK. Science 266, virus type 1 longterminal repeat. Mol. Cell. Biol. 8,466-472 (Exhibit 1719-1733 (Exhibit 43). 55). Minden, A. et al. (1995) Selective activation of the JNK signaling Teramoto, H. et al. (1996) Signaling from the Small GTP-binding proteins Rac1 and Cdc42 to the c-Jun N-terminal kinase? stress-acti cascade and c-Jun transcriptional activity by the Small GTPases Rac vated protein kinase pathway. A role for mixed lineage kinase 3/pro and Cdc42Hs. Cell 81, 1147-1157 (Exhibit 44). tein-tyrosine kinase 1, a novel member of the mixed lineage kinase Nobes, C.D., and Hall, A. (1995) Bho, rac, and cdc42 GTPases family. J. Biol. Chem. 271, 27225-277228 (Exhibit 56). regulate the assembly of multimolecular focal complexes associated Van Aelst, L. et al. (1996) Identification of a novel Rac1-interacting with actin stress fibers, lamellipodia, filopodia. Cell 83, 53-62 protein involved in membrane ruffling. EMBO J. 15, 3778-3786 (Exhibit 45). (Exhibit 57). Orci, L. et al. (1991) Brefelair. A, a drug that blocks secretion, Van Aelst, L., and D'Souza-Schorey, C. (1997) Bho GTPases and prevents the assembly of non-clathrin-coated buds on Golgi signaling networks. Genes Dev. 11, 2295-2322 (Exhibit 58). cisternae. Cell 64, 1183–1195 (Exhibit 46) Westwick, J.K. et al. (1997) Rac regulation cf transformation, gene Pelech, S.L. (1996) Kinase connections on the cellular intranet. Sig expression, and actin organization by multiple, PAK-Independent nalling pathways. Curr. Biol. 6, 551-554 (Exhibit 47). pathways. Mol. Cell. Biol 17, 1324-1335 (Exhibit 59). Rana, A. et al. (1996) The mixed lineage kinase SPRK Zhang, C. J. et al. (1994) Expression of a dominant allele of human phosphorylates and activates the stress-activated protein kinase acti AFF 1 inhibits membrane traffic in vivo. J. Cell. Biol. 124, 289-300 vator, SEK-1. J. Biol. Chem. 271, 19025-19026 (Exhibit 48). (Exhibit 60). Schekman, R., and Orci, L. (1996) Coat proteins and vesicle budding. Chang, F. et al. (1994) Atomic structure of the MAP kinase ERK2 at Science 271, 1526-1533 (Exhibit 49). 2.3. A resolution. Nature 367, 704-711 (Exhibit 61). Sells, M.A. et al. (1997) Humar, p21-activated kinase (Pak1) regu Chang, S. et al. (1995) Rhc family GTPases regulate p38 mitogen lates actin organization in mammalian cells. Curr. Biol. 7, 202-210 activated protein kinase through the downstream mediator Pak1. J. (Exhibit 50). Biol. Chem. 270, 23934-23936 (Exhibit 62). Sells, M.A., and Cherrof. J. (1997) Emerging from the Pak: the International Search Report, Oct. 20, 2004 from International p21-activated protein kinase family. Trends. Cell. Biol. 7, 166-167 Searching Authority on International Application No. PCT/US02/ (Exhibit 51). 41557. Sigma catalog, Biochemicals and Organic Compounds for Research Official Action issued Sep. 30, 2008 in connection with Japanese and Diagnostic Reagents, "Anonymous' ALA-VAL fragment, p. 64 Patent Application No. 2003-558137, filed Jun. 28, 2004. (Exhibit 52). Abo, A., et al. (1998) “PAK4, a novel effector for Cdc42Hs, is Symons, M. etal. (1996) Wiskott-Aldrich syndrome protein, a novel implicated in the reorganization of the actin cytoskeleton and in the effector for the GTPase CDC42Hs, is implicated in actin polymer formation of filopodia’, EMBO J. 17:6527-40. ization. Cell 84, 723-734 (Exhibit 53). * cited by examiner

U.S. Patent Jan. 27, 2009 Sheet 3 of 13 US 7482,138 B2 Figure 1C

C n

35 U.S. Patent Jan. 27, 2009 Sheet 4 of 13 US 7482,138 B2 Figure 1D

atgtttggga agaaaaagaa zi attatcga a at atctgg cc CatCca actt tgadcacagg 60 ytt catactg gatttgatcc aca a gag cag nag tt tactg gcct tccc.ca gCag togcac 120

gcc tottag Caga Cacago Cala Cagg CCC agcc.catgg tgga cc catc at gCat Caca 80 cocatacago tggctoccat gaaga catc 9tcagaggaa at aaatcottig caagga aa cc

tctatoaatg gtctgctaga ggattittgac aacatct cog to act cqct c cact Ct c tea BOC eggaaagada gcccaccac cc cagat cag ggagicagota gccgcattoa aggccactic g 360

gaag agaacg gct tcatcac tittct caca a tatt coagtg aatccga tac gactg.cggac 420 tacaca actg aaaagtacag aga Caggagt ctictatggag atgacctgga t ct gtact at & 8) aaaag.ca.gc.c atgcagccala gCaaaatggg catgccatga agatgaaa.ca tggaga.cgct tact accotg agatgaag to tttgaaalacc gacctgg.ccg. gatticcCtgt cgactatocac 600 accCacttgg act citctgag aaaat caagt gaatatggtg acct taggtg ggattatcag 660 ugagcc tota gtagctcc.cc totggacitac toattccagc toacgccttc tagaactgca 20 gggaccagca gg togctic cala gga gag totg g catacagtg aaagtgattg gg gacc cagc 780 ctggatgact atgacaggag gccaaaatca toatacctg.c atcagacgag cccticago.ca 840 gccatgcc.c a gag atccala gtc.cggctica g99 cittcagg a accoat gat gccatttgga 90)

gcaagtgcat ttaaaactCa to citcaagga cact cqtaca actCcta CaC ctacccitcga 360 ttgtc.cgagc ccacaatgttg CattcCaaag gtggattacg atcgag caca gatgg tottc agt cotccac tgtcaggg to cga cact tac Ccca gaggCC CCaCCaaact acctcaaagt caaa.gcaaag caggctactic tt Cagg cage caccagtacc cittctggg ta ccaca aa gca 40

tect citat acc acCatccatec cctgcaaacc agttcticagt a Catctocac cgct tct tac 1200

ttaa.gct citc toagitat cto ct cq agcacc accCtCCaC ctagctgggg ctocticctica 1260 gaccagcagc cctica agggt atcc.catgaa caatticcgag ctg.ccct gca actggtgg to 320

agcc.caggag acco caggga a tatttggat aact tatt a aaatcggaga. agggit cqa ca. 380

ggcatcgtgt gcatt gcaac agaaaaacac a caddocaaac aagtg acant gaagaaaatg 1440 gacct cogala agcag cagag acggga actic citttittaatg agg togtgat aatgcgtgat 1500 taccaccatg acaacgtagt tgacatgitac aa.ca.gct acc ttgttggaga tgagctctgg 560 gtgg teatgg agttt citaga agg togg togcc tga Calgaca ttgtcactica tacca gaatg 620 aatgaagagc agata gottac tgtctgcctg toagttctga aagct citgtc. Ctacct tca t 1680 aaccaaggag tgatt cacag gga cataaag agtgact coa ttct tctgac aag cqatiggc 40 cggataaagt tatctgacitt tgg tttctgt gct caagttct cca aa gaggit gccalaa gagg 800 aagt cactgg tggg tacccC a tactggatg gctacct gagg tgatt to cag gctacctitat 860 ggga Cagagg tgga Catctg gt coct cqgg a taatggtga tagagatgat tgatggggag 1920

coccCotatt toadtgagcC tcc to tigcag gccatgagga ggat CCggga Cagtttacct 980 cca a gag toga agga Cctaca Caagg tttct to catgcticc gaggatt CCt agatct tatg 20 40 U.S. Patent Jan. 27, 2009 Sheet 5 of 13 US 7482,138 B2 Figure 1E

tt. it's gg accCt c ticg : cagig caca jetchagac to:cttggaca to cattctta 2OO Aaattgg cag g tocaccatc t t cattgtt cotct cata citat chg Citcact ga 260

et ne (sly Lys Iys Lys Lys e Clu e ro e As 15

Ple His Arg Wall His Th ty Ele Pro Gn Glu Fhe

2) S. st

use. Fo Gn Tp is Get lel Leun Ala Asp T Ala Asn 3.5 4. 45

Arg Lys Po Met Wall Asp c e Pro e Gr en 55 60

Ala Met Lys e Wall Nrg As Lys ser s Glu Th 6S 70 75 80

le As Gly Let Lell As p Phe Asp As le al Arg 85 O 95.

Asn ser Leu Arg Glu Pro Pro Thr PG Gl Ala OO O

Alia Arg Ile Gl His Glu Glu s Ile T Ple 5

Tyr Glu T Thr Ala As p T T Glu 130 14

Asp Set Leb Asp Ieu Leu Tyr 45 150 155 s

Ser His Ala Ala Gi As His Ala et Met Lys 65 S.

His Asp Ala Tyr Tyr Po Glu Met Le Thr Asp Le 85 90

Ala Phe Pro Val Asp His Th; His e Asp Se Leu Arg 95 2O 2O5

Se Se Glu Tyr A sp Lel Trp Asp Gln Arg Ala Se Ser 20 25 220 U.S. Patent Jan. 27, 2009 Sheet 6 of 13 US 7482,138 B2 Figure 1F

Sier 'er Pro lieu Asp Tyr Ser the Gln lieu Thr Pro et Arg Thr Ala 25 230 23S O

Gly Thr Ser Arg Cys Ser Lys. Glu Ser Leu Ala Tyr Ser Glu Ser Asp 245 2SO 255

Trp Gly Pro Ser Leu Asp Asp yr Asp Arg Arg Pro Lys Ser Ser Tyr 260 265 2TO

Leu. His Glin Thr Ser Pro Gln Pro Ala Met Arg Glin Arg Ser Lys Ser 25 80 285

Gy Ser Giy lieu Gin Glu Pro Met Met Pro Phe Gly Ala Sex Ala Phe 290 29S 300

Lys Thr His Pro Glin Ghiy His Ser Tyr Asn. Ser Tyr Thr Tyr Pro Arg 30S 3O 315 320

Le Ser Glu Pro Thr Met Cys le Pro Lys Wall Asp Tyr Asp Arg Ala 325 330 335

Gln Met Val Phe Ser Pro Pro Leu Ser Gly Ser Asp Thr Tyr Pro Arg 340 345 350

Gly Pro Thr Lys Leu Pro Glin ger Glin Ser Lys Ala Gly Tyr Ser Ser 355 360 365

Gly Ser His Glin Tyr Pro Ser Gly Tyr His Lys Ala Ser Leu Tyr His 3 O 375 380

His Pro Ser Leu Gin Thr Ser Ser Glin Tyr Ile Ser Thr Ala Ser Tyr 385 390 395 400

Leu Ser Ser Leu Ser Ile Ser Ser Ser Thr Tyr Pro Pro Pro Ser Trp 405 AO 45

Gly Ser Ser Ser Asp Gln Gin Pro Ser Arg Val Ser His Glu Glin Phe 42O a 25 430

Arg Ala Ala Leu Gln Leu Val 'Jai Ser Pro Gly Asp Pro Arg Glu Tyr 435 40 445

Leu Asp Asn Phe Ile Lys Ile Gly Glu Gly Ser Thr Gly Elle Val Cys 45) AS5 450

Ile Ala Thr Glu Lys His Thr Gily Lys Glin Val Ala Wall Lys Lys Met 465 40 475 480

Asp Leu Arg Lys Gin Gin Arg Arg Glu Lieu. Leu Phe Asn Glu wa Wall a85 90 95 U.S. Patent Jan. 27, 2009 Sheet 7 of 13 US 7482,138 B2 Figure 1G

Ile Met Arg Asp Tyr His His Asp Asn Val Val Asp Met Tyr Asn Ser OS O

Tyr Leu Wai Gly Asp (Glu Leu Trp Wai Wal Met Glu Phe Leu Gu Gly S. 2O 25

Gly Ala Leu Thr Aup Ile Val Thr His Thr Arg Met Asn Glu Glu Glin 53 35 40

Ile Ala Thr Val Cys Leu Ser Val Leu Lys Ala Leu er Tyr Lieu. His 45 SO 5S 60

As in Glin Gly Val Ile His Arg Asp Ile Lys Ser Asp Ser Ile Leu Leu 65 STO 575

Thr Ser Asp Gly Arg Ile Lys Leu Ser Asp Phe Gly Phe Cys Ala Glin BO 8S SO

Val Ser Lys Glu Val Pro Lys Arg Lys Ser Leu Wall Gly Thr Pro Tyr 595 SO 605

Trp Met Ala Pro Glu Val Ile Ser Arg Leu Pro Tyr Gly Thr Giu Val E10 SS 62O

Asp Ile Trp Ser Leu Gly Ile Met Val Ile Glu Met Ile Asp Gly Glu 525 630 635 6 4.

Pro Pro Tyr Phe Asin Glu Pro Pro Leu Glin Ala Met Arg Arg Ile Arg 645 650 655

Asp ger Lea Pro Pro Arg Val Lys Asp Leu. His Lys val ger Ser Met 660 35 670

Leu Arg Gly Phe Leu Asp Leu Met Le Val Arg Glu Pro Ser Glin Arg 675 68O 585

Ala Thr Ala Gin Glu Lieu. Leu Gly. His Pro Phe Leu Lys i.eu Ala Giy 690 695 OO

Pro Pro Ser Cys Ile Val Pro Leu. Met Arg Glin Tyr Arg His His OS U.S. Patent Jan. 27, 2009 Sheet 8 of 13 US 7482,138 B2 Figure 2

GTP A. B. c in

Rac '3- - - c. - - - -l

Cdc42

WB: anti-Myc U.S. Patent Jan. 27, 2009 Sheet 9 of 13 US 7482,138 B2

Figures 3A and 3B

A B

g has 3. C r 40 Y S. ya S.&

Kinase Assay PAK5, PAK4

Kinase Assay HH4

Westernanti-Myc Biot: PAK5, PAK4 U.S. Patent Jan. 27, 2009 Sheet 10 of 13 US 7482,138 B2 Figure 4

s ^ R. t "2 D

as a or 2.

a s t N 2 U.S. Patent Jan. 27, 2009 Sheet 11 of 13 US 7482,138 B2

Figure 5

g 2 N. 90 92

5 ve& t ve 5 n U.S. Patent Jan. 27, 2009 Sheet 12 of 13 US 7482,138 B2 Figures 6A and 6B

A

E 1 oo 90 80 2 70 so S 3. SO 5 40 30 3, 20 10

Wecor PAK4 PAX4 PAKS AKS PAK PARS PARS PAK (S445N) (S573N) (S373N) (S573N) (S573N) (T47) w -- D. NK RhoW4 C3

90 80 O . 60 50 - 40 3O -- 2O O O Wector PAKS PAS PAK58) A.KSR). CAENT (K48M) AB) U.S. Patent Jan. 27, 2009 Sheet 13 of 13 US 7482,138 B2 Figure 7

i

US 7482,138 B2 1. 2 PAKS-RELATED COMPOSITIONS AND Members of the mammalian p21 activated kinase (“PAK) METHODS family of serine/threonine kinases constitute a family of kinases that bind to Rac and Cdc42, but not Rho (for review This application claims the benefit of U.S. Provisional see (7, 17. 43)). The PAK family members can be placed into Application 60/343,972, filed Dec. 28, 2001, the contents of 5 two categories based on their amino acid sequences. The first which are incorporated herein by reference. category includes human PAK1 and PAK2 and mouse PAK3. The invention disclosed herein was made with United Each of these protein kinases has a carboxyl terminal kinase States government support under grant number ROI CA domain and an amino terminal regulatory domain. Within the 76342 from the National Institutes of Health. Accordingly, regulatory domain is a GTPase binding domain (“GBD) that the United States government has certain rights in this inven 10 tion. binds to activated Cdc42 and Rac. The regulatory domain also Throughout this application, various references are cited. contains two to three proline-rich regions that bind to SH3 Disclosure of these references in their entirety is hereby domain-containing proteins including the adaptor protein incorporated by reference into this application to more fully Nck and the exchange factor PIX(7), and a motif that can bind to G protein By subunits (7). The members of this family are describe the state of the art to which this invention pertains. 15 all quite similar in sequence, exhibiting 73% overall sequence BACKGROUND OF THE INVENTION identity and approximately 92% sequence identity within the kinase and GBD domains (43). Members of this subfamily of The Rho family GTPases, including Cdc42, Rac, and Rho, PAKS are thought to have important roles in regulating cell were first identified as proteins that have key roles in regulat morphology and cytoskeletal organization, although they ing the organization of the actin cytoskeleton in mammalian may not specifically mediate cytoskeletal effects that are trig fibroblasts (18,35,37.38). Microinjection of activated Cdc42 gered by Cdc42 and Rac. (13, 21, 44, 46). into fibroblasts causes the induction of filopodia, while acti PAK4 is the first PAK family member to be identified as vated Rac leads to lamellipodia formation, and activated Rho belonging to a second category of PAKS based on its sequence causes the formation of stress fibers. Both Cdc42Hs and Rac 25 have also been shown to have a role in the dissolution of stress (1). PAK4 contains an amino terminal GBD and a carboxyl fibers (10, 18, 26), which may reflect an antagonism between terminal kinase domain, but it does not bind to PIX or Nick and these two GTPases and Rho (19,39). it does not have a G protein By-binding motif (1). Further While they were initially characterized in fibroblasts, the more, the GBD and kinase domains of PAK4 have only Rho GTPases have also been shown to regulate the morpholo 30 approximately 50% identity with those of the other PAKs, and gies of other types of cells. For example, the Rho GTPases the regulatory domain of PAK4 outside of the GBD is com have been shown to have important roles in the regulation of pletely different from the other PAKs (1). Unlike other PAKs, neurite outgrowth in C. elegans, drosophila, chick, and mam PAK4 was shown to be a link between Cdc42 and filopodia malian primary neurons and cell lines (5, 8, 14, 19, 22, 25, 47. formation (1). In addition to filopodia formation, PAK4 may 53). This is probably due, at least in part, to the fact that 35 also have other functions. For example, a constitutively active filopodia and lamellipodia play key roles in the elongation of PAK4 mutant also leads to the dissolution of stress fibers and neurites (24). Previous studies have indicated that neu focal adhesions, most likely by inhibiting the activity of rotrophic factors, such as NGF, BDGF, NT3, NT-4, and RhoA (36). chemoattractants such as metrin-1, can induce neurite out SUMMARY OF THE INVENTION growth or regulate axon guidance (3, 45). 40 In mammalian neuronal cell lines, Cdc42 and Rac appear to act antagonistically with Rho. Introduction of constitu This invention provides an isolated nucleic acid compris tively active mutants of Cdc42 and Racinto N1 E-115 neuro ing a sequence encoding a mammalian PAK5 domain, with blastoma cells leads to the formation of neurites (40. 51) and the proviso that the nucleic acid does not encode full-length the production of filopodia and lamellipodia in developing 45 human PAK5. growth cones (19), while introduction of dominant negative This invention also provides a nucleic acid comprising a mutants of Cdc42 and Rac inhibits neurite outgrowth in N1 E sequence encoding a mammalian PAK5 GTPase-binding 115 cells and PC12cells (8, 19, 40. 51). In contrast, activated domain and a mammalian PAK5 regulatory domain, but not a RhoAV 14 causes neurite retraction in PC12 cells and N1 E mammalian PAK5 kinase domain. 115 cells, while inhibition of RhoA stimulates the production 50 This invention further provides a nucleic acid comprising a of neurites in N1 E-115 cells (11, 19, 49-51). These results sequence encoding a mammalian PAK5 GTPase-binding Suggest that inactivation of RhoA actually leads to the acti domain and a mammalian PAK5 kinase domain, but not a vation of Cdc42 and Rac, thus leading to the production of mammalian PAK5 regulatory domain. neurites (19). Consistent with this, N1 E-115 cells form neu This invention further provides a nucleic acid comprising a rites when they are grown in the absence of serum, but not 55 when they are grown in the presence of serum. This is pre sequence encoding a mammalian PAK5 regulatory domain Sumably because components in serum, especially LPA, acti and a mammalian PAK5 kinase domain, but not a mammalian vate Rho, which in turn blocks the production of neurites in PAK5 GTPase-binding domain. response to Cdc42 and Rac (19). This invention further provides an isolated nucleic acid While Cdc42 and Rac clearly have important roles in regu 60 which specifically hybridizes to nucleic acid encoding a lating morphological changes that control growth cone for mammalian PAK5. mation and neurite outgrowth, the mechanisms by which the This invention further provides a nucleic acid comprising a GTPases operate in neuronal cells are still not entirely under mammalian PAK5-encoding sequence operatively linked to stood. The identification and characterization of molecular an exogenous regulatory element. targets for the Rho GTPases is an important step in determin 65 This invention further provides a nucleic acid comprising a ing how they control cell morphology in both neuronal cells mammalian PAK5-encoding sequence operatively linked to and non-neuronal cells. an endogenous regulatory element. US 7482,138 B2 3 4 This invention further provides a vector which comprises FIG 2 (a) one of the instant protein-encoding nucleic acids or (b) a PAK4 and PAK5 interact with activated Rac and Cdc42. nucleic acid encoding the instant nucleic acid which hybrid 293 cells were transfected with equal amounts of expression izes thereto. vectors, encoding the following Myc-tagged proteins: wild This invention further provides a cell comprising one of the 5 type PAK4 (Myc-PAK4), wild type PAK5 (Myc-PAK5), or instant regulatory element-linked nucleic acids. PAK5AGBD. After transient expression, the Myc-tagged This invention further provides proteins encoded by each proteins were immunoprecipitated from whole cell lysates of the instant nucleic acids. using a mouse anti-Myc antibody and protein A Sepharose. This invention further provides compositions, each com The immunocomplexes were separated by SDS-PAGE and position comprising a pharmaceutically acceptable carrier 10 transferred to a PVDF membrane. The membranes were then together with one of the instant nucleic acids or one of the probed with purified RhoV14, Rac1V12 or Cdc42V12, as instant proteins. indicated. The GTPases were pre-loaded with Y-PGTPas This invention further provides methods for regulating described in the Materials and Methods. A portion of the cells using the instant nucleic acids or proteins as appropriate. lysate was used for Western blot analysis (WB) with an anti These methods include methods of inducing and inhibiting 15 Myc antibody to measure the amount of each transfected protrusion formation by a mammalian cell, causing cytosk protein in the lysates. eletal reorganization in a mammalian cell, inducing and FIGS 3A and 3B inhibiting ruffle formation on a mammaliancell, inducing and PAK5 autophosphorylates and phosphorylates histone H4 inhibiting migration of a mammalian cell, and inducing and (HH4). 293 cells were transfected with equal amounts of inhibiting proliferation of a mammalian cell. either GFP vector or expression vectors containing one of the This invention further provides a method of inhibiting the following Myc-tagged proteins: PAK4, PAK5, or PAK5 transcription of a mammalian PAK5-encoding DNA mol (S573N). After transient expression, the amounts of Myc ecule using one of the instant nucleic acids. tagged proteins were normalized by Western blots probed This invention further provides a method of inhibiting the with a mouse anti-Myc antibody. Approximately equal translation of a mammalian PAK5-encoding mRNA mol 25 amounts of Myc-PAK4, Myc-PAK5, and Myc-PAK5 ecule using one of the instant nucleic acid molecules. (S573N) were immunoprecipitated from whole cell lysates This invention further provides a method of increasing using a mouse anti-Myc antibody and protein A Sepharose. neuronal outgrowth in a Subject comprising administering to The immunocomplexes were then incubated with histone H4 the Subject one of certain instant compositions as appropriate, and Y-PIATP in in vitro kinase buffer. Substrate phospho in an amount effective to increase neuronal outgrowth in the 30 rylation and autophosphorylation were analyzed after SDS Subject. PAGE (15% gel) and autoradiography. Both the autophos This invention still further provides a method of inhibiting phorylation of PAK4, PAK5, PAK5 (S573N) and the neuronal outgrowth in a Subject comprising administering to phosphorylation of Histone H4 are indicated. In Panel A, the the Subject one of certain instant compositions as appropriate, gel was exposed for 15 min, and in Panel B, the gel was in an amount effective to inhibit the subject’s neuronal out 35 exposed for 2 hr. Western blots showing expression of Myc growth. PAK5 and Myc-PAK4 are shown in the bottom panel (10% This invention further provides a method of determining gel). whether a mammalian cells reduced ability to form protru FIG. 4 sions is due to blockage of signal transduction either PAK5 activates the JNK pathway. 293 cells were trans upstream or at the level of PAK5, which comprises: (a) intro 40 fected with either empty vector, or 5 ug expression vector ducing PAK5 into the cell; and (b) determining whether its containing HA-tagged JNK (HA-JNK) either alone or with number of protrusions increases, such increase indicating that increasing doses of expression vectors containing Myc the cells reduced ability to form protrusions is due to block tagged PAK5 (1.3, and 5ug), or expression vectors contain age of signal transduction either upstream or at the level of ing Rac2L61 (2.5ug), or MEKK1A (2.5 g). After transient PAK5. 45 expression, cells were lysed, and the amount of HA-JNK was Finally, this invention provides a non-human transgenic normalized by Western blots probed with a mouse anti-HA mammal whose somatic cells lack PAK5-encoding DNA. antibody. Equal amounts of HA-JNK were then immunopre cipitated from whole cell lysates using a mouse anti-HA BRIEF DESCRIPTION OF THE FIGURES antibody and protein A Sepharose. The immunoprecipitates 50 were then incubated with recombinant GST-c-Jun in the pres FIG 1A ence of Y-PIATP in in vitro kinase buffer. Substrate phos The nucleic acid (SEQ. ID. NO:3) and amino acid (SEQ. phorylation was analyzed after SDS-PAGE and autoradiog ID. NO:4) sequences of human PAK5 are shown. Underlined raphy. The phosphorylation of GST-c-Jun is indicated. The regions of the amino acid sequence correspond to the GBD numbers indicate the fold of activation of JNK by PAK5, domain (amino acids 10-30) and the kinase domain (amino 55 Rac2L61 and MEKK1A quantitated by phosphorimager acids 452-702) analysis. FIG. 1B FIGSA Multiple sequence alignment of the PAK5 amino acid PAK5 induces neurite outgrowth and filopodia. Expression sequence (SEQ. ID. NO:4) with the amino acid sequences of vectors containing EGFP (control), PAK5, PAK5 (S573N), PAK4 (SEQ. ID. NO:7) and PAK6 (SEQ. ID. NO:8). 60 PAK4, PAK4 (S445N) or PAK1 (T423E) were transfected FIG. 1C into N1 E-115 cells. Vectors containing PAK4 and PAK5 were A human multiple tissue mRNA Northern blot was probed either co-transfected with an EGFP vector at a 1:3 (EGFP. with cDNA containing part of the kinase domain of PAK5. A PAK5) ratio or expressed as EGFP fusions, with similar band of about 5.5 kb is indicated. results. PAK1 (T423E) was co-transfected with EGFP. Cells FIG 1D-1G 65 were visualized by fluorescence microscopy 20hr after trans The nucleic acid (SEQ. ID. NO:1) and amino acid (SEQ. fection. Cells were then photographed using a 100x objective ID. NO:2) sequences of mouse PAK5 are shown. lens. Where more than one cell is shown, the transfected cells, US 7482,138 B2 5 6 as observed by fluorescence microscopy, are indicated by an “Mammalian cell' shall mean any mammalian cell. Mam arrow. Cells transfected with empty vector EGFP. PAK1 malian cells include, without limitation, cells which are nor (T423E), or PAK4 are shown in panels a, b, and c, respec mal, abnormal and transformed, and are exemplified by neu tively. Representative fields of PAK5, PAK5 (S573N), and rons, epithelial cells, muscle cells, blood cells, immune cells, PAK4 (S445N) expressing cells that exhibited filopodia but stem cells, osteocytes, endothelial cells and blast cells. not neurites are shown in panels d, e, and f, respectively. “Migration of a cell shall mean the movement or the Representative fields of cells exhibiting differentiated and extension of the cell from one point to another. extended neurites are shown in panels g, h, and i, respectively. “Neurite outgrowth' shall mean an outgrowth from a neu FIGS. 6A and 6B ron, as exemplified by axons and dendrites. Quantification of the effects of PAK5 on neurite formation. 10 “Outgrowth' shall mean, with respect to a cell, a process In Panel A, cells were transfected with EGFP expression which extends from the body of the cell. Outgrowths include, vectors encoding the indicated proteins along with a three but are not limited to, long spindle processes, short spindle fold excess of either dominant-negative JNK, RhoV 14, or C3 processes, long thick processes, short thick processes, long transferase as indicated. Following transfection, cells were thin processes and short thin processes. grown in the presence of serum. Cells bearing neurites were 15 counted and the percentage of transfected cells that had neu “PAK5 kinase substrate' shall mean a substrate which can rites is indicated. Co-transfection of PAK5 (S573N) vector be phosphorylated by PAK5. PAK5 kinase substrates include, with EGFP vector gave similar results as EGFP-PAK5 but are not limited to, PAK5 and histone H4. (S573N) (data not shown). In Panel B. Following transfection “PAK5 kinase activity” shall mean PAK5 phosphorylation with the indicated expression vectors, cells were cultured in of a PAK5 kinase substrate. serum free medium for 72 hrs and cells bearing neurites were "Pharmaceutically acceptable carriers' are well known to counted as in Panel A. Approximately 100 transfected cells those skilled in the art and include, but are not limited to, were counted in each experiment. The results are an average 0.01-0.1 M and preferably 0.05 Mphosphate buffer or 0.8% of at least 2 independent experiments for each condition. saline. Additionally, Such pharmaceutically acceptable carri FIG. 7 25 ers can be acqueous or non-aqueous solutions, Suspensions, Activated PAK5 inhibits Rho activity. 293 cells were trans and emulsions. Examples of non-aqueous solvents are pro fected with wild-type Myc-RhoA expression vector together pylene glycol, polyethylene glycol, vegetable oils such as with equal amounts of either empty vector, wild-type EGFP olive oil, and injectable organic esters such as ethyl oleate. PAK5, or EGFP-PAK5 (S573N) expression vectors (without Aqueous carriers include water, alcoholic/aqueous Solutions, Myc tags). After transient expression, cell lysates were incu 30 emulsions or Suspensions, including saline and buffered bated with GST-Rhotekin glutathione agarose complexes, media. Parenteral vehicles include sodium chloride solution, which bind specifically to GTP-loaded RhoA. Complexes Ringer's dextrose, dextrose and sodium chloride, lactated were thenwashed and separated by SDS-PAGE, and the GTP Ringer's or fixed oils. Intravenous vehicles include fluid and RhoA content was analyzed by Western immunoblotting nutrient replenishers, electrolyte replenishers such as those using and anti-Myc antibody. Total RhoA content is shown in 35 based on Ringer's dextrose, and the like. Preservatives and the bottom panel. other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases, DETAILED DESCRIPTION OF THE INVENTION and the like. “Protrusion formation' shall mean, with respect to a cell, 40 any outward growth from the cell surface. Protrusion forma Definitions tions include, but are not limited to, filipodia, lamelopodia, As used in this application, except as otherwise expressly outgrowths and spikes. provided herein, each of the following terms shall have the "Ruffle formation' shall mean, with respect to a cell, the meaning set forth below. formation of projections at the leading edge of the cell. Ruffle Administering shall mean delivery which is effected or 45 performed using any of the various methods and delivery formation is observed especially in crawling cells, which systems known to those skilled in the art. Administering can appear to be ruffled. be performed, for example, intravenously, pericardially, “Spike' shall mean, with respect to a cell, a projection from orally, via implant, transmucosally, transdermally, intramus the leading edge of the cell. Spikes include, for example, cularly, Subcutaneously, intraperitoneally, intra-thecally, nerve growth cones and “microSpikes', which are spikes intralymphatically, intralesionally, or epidurally. Administer 50 measuring about 100 nm by 5-10 um and supported by ing can be performed, for example, once, a plurality of times, loosely bundled microfilaments. and/or over one or more extended periods. “Subject' shall mean any mammal including, without limi "Cytoskeletal reorganization' shall mean a change in the tation, a mouse, a rat, a dog, a guinea pig, a rabbit and a cytoplasmic filaments or microfilaments of a cell. Cytoskel 55 primate. In the preferred embodiment, the Subject is a human etal reorganization includes, without limitation, an increase being. in the filamentous F- to monomeric G-actin ratio, the forma tion of condensed actin layers and intracellular actin poly Embodiments of the Invention merization. “Immune cell' shall mean a cell involved specifically in an 60 This invention provides ten nucleic acids. The first nucleic immune response, including but not limited to B-cells, acid is an isolated nucleic acid comprising a sequence encod T-cells, lymphocytes, antigen presenting cells and macroph ing a mammalian PAK5 domain, with the proviso that the ageS. nucleic acid does not encode full-length human PAK5. In an "Inhibit translation' shall mean to reduce the amount or embodiment of the first nucleic acid, the PAK5 domain is rate of translation, or to stop translation entirely. 65 selected from the group consisting of a mammalian PAK5 “Inhibit expression' shall mean to reduce the amount or GTPase-binding domain, a mammalian PAK5 regulatory rate of expression, or to stop expression entirely. domain and a mammalian PAK5 kinase domain. US 7482,138 B2 7 8 The second nucleic acid comprises a sequence encoding a domain, but not a mammalian PAK5 GTPase-binding domain mammalian PAK5 GTPase-binding domain, but not a mam or a mammalian PAK5 regulatory domain; (b) the sixth, malian PAK5 kinase domain or a mammalian PAK5 regula ninth, and tenth nucleic acids; (c) the protein encoded by the tory domain. nucleic acid of (a); and (d) the protein encoded by the sixth The third nucleic acid comprises a sequence encoding a 5 nucleic acid. Also for the sake of convenience, the following mammalian PAK5 kinase domain, but not a mammalian nucleic acids and proteins are referred to collectively as PAK5 GTPase-binding domain or a mammalian PAK5 regu "inhibiting agents: (a) the first nucleic acid comprising (i) a latory domain. sequence encoding a mammalian PAK5 GTPase-binding The fourth nucleic acid comprises a sequence encoding a domain, but not a mammalian PAK5 kinase domain or a mammalian PAK5 regulatory domain, but not a mammalian 10 mammalian PAK5 regulatory domain, or (ii) a sequence PAK5 GTPase-binding domain or a mammalian PAK5 kinase encoding a mammalian PAK5 regulatory domain, but not a domain. mammalian PAK5 GTAase-binding domain or a mammalian The fifth nucleic acid comprises a sequence encoding a PAK5 kinase domain; (b) the fifth, seventh, and eighth nucleic mammalian PAK5 GTPase-binding domain and a mamma acids; (c) the proteins encoded by the nucleic acids of (a); and lian PAK5 regulatory domain, but not a mammalian PAK5 15 (d) the proteins encoded by the fifth, seventh, and eighth kinase domain. nucleic acids. Compositions comprising Such agents are The sixth nucleic acid comprises a sequence encoding a referred to herein as “inducing or “inhibiting compositions.” mammalian PAK5 GTPase-binding domain and a mamma as appropriate. lian PAK5 kinase domain, but not a mammalian PAK5 regu The first method provides a method of inducing protrusion latory domain. formation by a mammaliancell which comprises contacting a The seventh nucleic acid comprises a sequence encoding a cell with an inducing agent in an amount effective to cause mammalian PAK5 regulatory domain and a mammalian protrusion formation by a cell. In an embodiment of this PAK5 kinase domain, but not a mammalian PAK5 GTPase method, the protrusion is a spike, an outgrowth, filopodia or binding domain. lamelipodia. In the preferred embodiment, the outgrowth is a In an embodiment of the first, fifth, sixth and seventh 25 neurite outgrowth. nucleic acids, the mammalian PAK5 is a human PAK5. In The second method is a method of causing cytoskeletal another embodiment of the first, fifth, sixth and seventh reorganization in a mammalian cell which comprises contact nucleic acids, the mammalian PAK5 is a murine PAK5. In an ing the cell with an inducing agent in an amount effective to embodiment of the first nucleic acid, the nucleic acid com cause cytoskeletal reorganization in the cell. prises a sequence encoding murine PAK5. 30 The third method is a method of inducing ruffle formation The eighth nucleic acid is an isolated nucleic acid which on a mammalian cell, which comprises contacting the cell specifically hybridizes to nucleic acid encoding a mammalian with an inducing agent in an amount effective to induce ruffle PAK5. In an embodiment of the eighth nucleic acid, the formation on the cell. nucleic acid is DNA. In another embodiment of the eighth The fourth method is a method of inducing migration of a nucleic acid, the nucleic acid is RNA. 35 mammalian cell, which comprises contacting the cell with an The ninth nucleic acid comprises a mammalian PAK5 inducing agent in an amount effective to induce migration of encoding sequence operatively linked to an exogenous regu the cell. latory element. The tenth nucleic acid comprises a mamma The fifth method is a method of inducing proliferation of a lian PAK5-encoding sequence operatively linked to an mammalian cell, which comprises contacting the cell with an endogenous regulatory element. In an embodiment of the 40 inducing agent in an amount effective to induce proliferation ninth and tenth nucleic acids, the nucleic acid is DNA. In of the cell. another embodiment of the ninth and tenth nucleic acids, the The sixth method provides a method of inhibiting protru nucleic acid is RNA. sion formation by a mammalian cell, which comprises con This invention further provides a vector which comprises tacting the cell with an inhibiting agent in an amount effective (a) the first, fifth, sixth, seventh, ninth or tenth nucleic acid or 45 to inhibit protrusion formation by the cell. In an embodiment (b) a nucleic acid encoding the eighth nucleic acid. In one of this method, the protrusion is a spike, an outgrowth, filopo embodiment, the vector is selected from the group consisting dia or lamelipodia. In the preferred embodiment, the out of a plasmid, a cosmid, a bacteriophage and a eukaryotic growth is a neurite outgrowth. virus. In a further embodiment, the above-mentioned eukary The seventh method is a method of inhibiting cytoskeletal otic virus is an adenovirus or a retrovirus. 50 reorganization in a mammalian cell, which comprises con This invention also provides a cell comprising the ninth or tacting the cell with an inhibiting agent in an amount effective tenth nucleic acid. In an embodiment of this cell, the cell is to inhibit cytoskeletal reorganization in the cell. selected from the group consisting of a bacterial cell, a fungal The eighth method is a method of inhibiting ruffle forma cell and an animal cell. In a further embodiment, the above tion on a mammalian cell, which comprises contacting the mentioned animal cell is selected from the group consisting 55 cell with an inhibiting agent in an amount effective to inhibit of a neuron, an epithelial cell, a muscle cell, a blood cell, an ruffle formation on the cell. immune cell, a stem cell, an osteocyte and an endothelial cell. The ninth method is a method of inhibiting migration of a This invention further provides each of the proteins mammalian cell which comprises contacting the cell with an encoded by the first through the seventh nucleic acids. inhibiting agent in an amount effective to inhibit migration of This invention further provides compositions, each com 60 the cell. position comprising a pharmaceutically acceptable carrier The tenth method is a method of inhibiting proliferation of and one of the instant nucleic acids or proteins. a mammalian cell which comprises contacting the cell with This invention provides methods for affecting cells with an inhibiting agent in an amount effective to inhibit prolifera the instant nucleic acids and proteins. For the sake of conve tion of the cell. nience, the following nucleic acids and proteins are referred 65 This invention further provides a method of inhibiting the to collectively as “inducing agents': (a) the first nucleic acid transcription of a mammalian PAK5-encoding DNA mol comprising a sequence encoding a mammalian PAK5 kinase ecule which comprises hybridizing the eighth (“hybridizing) US 7482,138 B2 10 nucleic acid to the DNA molecule under conditions which both filopodia formation and neurite outgrowth in N1 E-115 would otherwise permit DNA transcription so as to inhibit cells. Constitutively active PAK5 had an even more dramatic transcription of the DNA molecule. effect than wild type PAK5, while dominant negative PAK5 This invention further provides a method of inhibiting the mutants inhibited neurite outgrowth. In contrast to PAK5, translation of a mammalian PAK5-encoding mRNA mol activated PAK1 had no effect on neurite outgrowth in these ecule which comprises hybridizing the eighth (“hybridizing) cells. The results herein suggest that PAK5 is an important nucleic acid to the mRNA molecule under conditions which mediator in the signaling pathway by which Rho GTPases would otherwise permit mRNA translation so as to inhibit control the cytoskeletal changes that are necessary for pro translation of the mRNA molecule. moting neurite outgrowth. This invention further provides methods of use for the 10 instant compositions in a subject. The first method provides a Materials and Methods method of increasing neuronal outgrowth in a Subject com Cloning of PAK5 prising administering to the Subject an inducing composition in an amount effective to increase neuronal outgrowth in the The EST database was screened using a Blast search in subject. In an embodiment of this method, the subject is 15 order to identify new members of the PAK family. EST clone selected from the group consisting of a mouse, a rat, a rabbit, ts97b05.x1 showed similarity to the kinase domain of mam a dog, a guinea pig and a primate. In the preferred embodi malian PAK4 from amino acid 483 to the stop codon. To ment, the Subject is a human. obtain the 5' end of the corresponding clone, a RT-PCR reac The second method provides a method of inhibiting neu tion was carried out using cDNA derived from human testis ronal outgrowth in a subject comprising administering to the total RNA as a template. The 5' primer was a degenerate Subject an inhibiting composition in an amount effective to oligonucleotide corresponding to the sequence APSNFEH increase the Subject's neuronal outgrowth. In an embodiment (SEQ ID NO:5) within the GBD domain of PAK4 and the 3' of this method, the Subject is selected from the group consist primer, agtagggagtgccaaccaat (SEQID NO:6) was an oligo ing of a mouse, a rat, a rabbit, a dog, a guinea pig and a nucleotide corresponding to a region in ts97b05.x1 that dif primate. In the preferred embodiment, the Subject is a human. 25 fers from PAK4. The resulting PCR product was cloned and This invention further provides a method of determining sequenced. Further screening of the database revealed that whether a mammalian cells reduced ability to form protru both the PCR product and ts97b05.X1 were homologous to sions is due to blockage of signal transduction either human mRNA for KIAA1264. To obtain the full-length upstream or at the level of PAK5, which comprises: (a) intro cDNA in one piece, another PCR reaction was carried out ducing PAK5 into the cell; and (b) determining whether its 30 using oligonucleotides corresponding to the 5' and 3' ends of number of protrusions increases, such increase indicating that KIAA1264. The full-length PCR product was designated the cell's reduced ability to form protrusions is due to block PAK5. Later PAK5 was also found to be nearly identical to age of signal transduction either upstream or at the level of GenBank clone ABO40812. PAK5. In an embodiment of this method, the cell is a mouse Plasmids cell, a rat cell, a rabbit cell, a dog cell, a guinea pig cell or a 35 cDNA encoding PAK5, PAK5RD, and PAK5RDAGBD primate cell. In the preferred embodiment, the cell a human were subcloned between the ClaI and EcoRI sites on pCAN cell. Also in the preferred embodiment, the cell is selected Myc1 expression vector containing a Myc epitope tag. from the group consisting of a neuron, an epithelial cell, a PAK5RD, corresponding to amino acid 1 to 451, is the amino muscle cell, a blood cell, an immune cell, a stem cell, an terminal part of PAK5 without the kinase domain, and was osteocyte and an endothelial cell. 40 generated by PCR using PAK5 cDNA as the template. Finally, this invention provides a non-human transgenic PAK5RDAGBD, corresponding to amino acids 31 to 451, mammal whose somatic cells lack PAK5-encoding DNA. In lacks both the kinase domain and the GBD domain, and was the preferred embodiment, the mammal is a mouse. generated by PCR using PAK5 cDNA as the template. Con This invention will be better understood from the Experi stitutively active PAK5 (S573N) in pCAN-Myc 1 was gener mental Details that follow. However, one skilled in theart will 45 ated by site-directed mutagenesis (Stratagene QuickChange readily appreciate that the specific methods and results dis kit) and contains a serine to glutamic acid Substitution at cussed are merely illustrative of the invention as described amino acid 602 which is a putative autophosphorylation site, more fully in the claims which follow thereafter. and a serine to asparagine Substitution at amino acid 573 Experimental Details 50 within the kinase domain. PAK5 (K478M) was also gener This invention provides novel nucleic acids encoding a p21 ated by site-directed mutagenesis and contains a lysine to activated kinase, PAK5, and related proteins which can methionine substitution at amino acid 478. cDNAs encoding induce or inhibit several cell functions including but not lim PAK5, PAK5 (S573N), and PAK5 (K478M) were also sub ited to: cellular outgrowth, cellular migration, cellular prolif cloned between the HindIII and SacII sites on pEGFP-C3 eration, cellular protrusion formation and cytoskeletal reor 55 (Clontech) expression vector to obtain PAK5-EGFP vectors. ganization. PAK5 shares approximately 85% sequence Myc-tagged PAK4 is described in (1). HA-tagged JNK, GST identity with PAK4 in its kinase domain and GBD motif, but c-Jun and MEKK1A are described in (31). Dominant negative it is completely different from PAK4 throughout the rest of its JNK has point mutations in which its two phosphorylation regulatory domain. Like PAK4, PAK5 falls into the second sites (Thr-183 and Tyr-185) are converted to Ala and Phe, category of PAKS based on its predicted amino acid sequence. 60 respectively, and is described in (9). Cdc42V12, Rac V12, and Unlike PAK4, however, which is expressed in most tissues, RhoV14 are described (30). PAK5 is expressed in only a limited number of tissues and it Northern Blots is especially highly expressed in the brain. This is of particu Northern analysis was performed using a human multiple lar interest because PAK5 is similar to Drosophila MBT (28). tissue RNA blot (Clontech). Hybridization and washes were MBT is thought to have a role in development, proliferation, 65 carried out as recommended by the manufacturer. The probe or survival of cells in the mushroom body, a structure of was a 400 bp fragment from within the PAK5 kinase domain Drosophila brain. Strikingly, expression of PAK5 triggered that differs in sequence from PAK4 or any other sequences in US 7482,138 B2 11 12 the GenBank database. The probe was labeled with C.-P. C. The reaction was terminated with SDS-PAGE sample dCTP (Amersham) by using a random priming kit (Strat buffer, followed by SDS-PAGE and autoradiography. agene). To analyze the kinase activity of hemagglutinin (HA)- Overlay Assay tagged JNK., 293 cells were transfected with either 10 ug of The overlay assay is described in (27). Briefly, 293 cells empty vector or 5ug of HA-tagged JNK expression vector in were transfected with 10 ug of empty vector, MycPAK4, or the absence or presence of increasing doses of Myc-PAK5 (1. Myc-PAK5. PAK4 and PAK5 were then immunopurified 3, and 5ug), or expression vectors containing Rac2L61 (2.5 using anti-Myc antibody (9E10, Santa Cruz) and the immu ug), or MEKK1A (2.5ug). The total amount of DNA in each nopurified proteins were separated on SDS-PAGE and trans transfection was kept at 10 ug using empty vector. Cells were ferred to a PVDF membrane. The membrane was thenwashed 10 harvested 48 hr after transfection and the amount of HA-JNK and blocked with phosphate-buffered saline (PBS) contain in cell lysates was normalized by Western blot. Equal ing 1% bovine serumalbumin (BSA) and 100 mM dithiothrei amounts of HA-JNK were then immunopurified from tol (DTT). Recombinant GTPases (2 ug) were pre-loaded approximately 100 ug of cell lysates using an anti-HA anti with Y-P GTP and were incubated for 5 min with the body (12CA5, Boehringer Mannheim) and protein A PVDF membrane. The membrane was washed for 5 min and 15 sepharose in M2 buffer at 4° C. for 2 hr. The protein A was exposed to a film for 2 hr. sepharose beads were then washed twice in M2 buffer, and Production of GST-C21 Fusion Protein and Rho GTPase twice in a buffer containing 20 mM HEPES (pH 7.5) and 10 Activity Assays mM MgCl2, then incubated in a buffer containing 20 mM GST-C21 contains the N-terminal 90 amino acids of the HEPES (pH 7.5), 10 mM MgCl, 20 mM B-glycerol phos Rho effector protein Rhotekin, consisting of the Rho binding phate, 10 mM PNPP, 1 mM DTT,50MNaVO 20 uMATP, domain. Escherichia coli BL21 transformed with the GST and 5 uCi Y-‘P ATP together with 2 ug purified recombi C21 construct was grown at 30°C. to an optical density at 600 nant GST-c-Jun for 20 min at 30°C. The reaction was termi nm of 0.30. Expression and purification of the fusion protein nated with SDS-PAGE sample buffer, followed by SDS and the GTPase activity assays were performed as described PAGE and autoradiography. The phosphorylation of clun was in Sander et al. (1999). In brief, lysates were prepared from 25 quantitated by phosphorimager analysis. 293 cells that were transfected with Myc-RhoA expression Immunofluorescence vector together with either empty vector, PAK5, or activated After transient transfection, N1E-115 cells were fixed in PAK5 vector. Lysates were then incubated with bacterially 3% paraformaldehyde for 20 min, permeabilized in 0.1% expressed GST-C21 fusion proteins bound to glutathione Triton X-100, and blocked with 5% goat serum for 20 min at coupled agarose beads. The beads and the bound proteins 30 room temperature. Cells were stained for the presence of were washed three times with an excess of lysis buffer and Myc-PAK5, Myc-PAK5 (K478M), Myc-PAK5RD, Myc then eluted with Laemmli sample buffer. The bound RhoA PAK5RDAGBD, or Myc-Cdc42N17 with mouse anti-Myc proteins were analyzed by Western blotting with antibody antibody (9E10, Santa Cruz), then incubated with goat anti against the Myc tag. A portion of the lysate was saved for mouse IgG conjugated with rhodamine (PIERCE). direct Western blot analysis with ant-Myc antibody. 35 Neurite Outgrowth Scoring Assay Preparation of Recombinant Proteins Recombinant GST-c-Jun, GST-Rac1V12 and GST N1E-115 cells were grown on coverslips precoated with Cdc42V12 were prepared as described (42). mouse laminin, in 35 mm wells, and transfected with 4 ug of Cell Culture and Transfection the indicated expression vectors. 20 hr after transfection, All cells were grown at 37°C. in 5% Co. 293 and N1 E-115 40 N1E-115 were examined by fluorescence microscopy to cells were cultured in Dulbecco's Modified Eagle's medium detect the presence of the green fluorescent cells that contain (DMEM) containing 10% fetal bovine serum (GibcoBRL). the transfected plasmids. Transfected cells bearing neurite For transfections in 293 cells, a total of 10 ug of DNA was like structure with a length of at least one cell body were transfected into the cells in 10 cm plates (60% confluent) counted and scored as the percentage of total transfected using the calcium phosphate precipitation method. For N1 E 45 cells. The images were taken either with a Nikon DIAPHOT 115 cells, 4 ug of total DNA was transfected into the cells, 300 inverted microscope with epi-fluorescence attachments using FuGENE6 (Roche), in 35mm wells (seeded 1x10" cells and a color CCD camera using a 10x objective lens, or with a per well) containing coverslips that were precoated with 10 Nikon OPTIPHOT-2 fluorescence microscope and a digital ug ml mouse laminin (GibcoBRL) for 1 hr at 37° C. camera using a 60x objective lens. Western Blots 50 Generation of PAK5 and PAK4 Knockout Mice Western blots were carried out as described (1). A PAK5 targeting vector was generated by replacing exon Protein Kinase Assays 3, which contains the critical part of the kinase domain, with To assay histone H4 (HH4) phosphorylation by the PAKs, a neomycin resistance gene. This vector was electroporated 293 cells were transfected with 10 ug of empty vector, Myc into ES cells, and G418 resistant clones were isolated. South PAK4, or Myc-PAK5 (wild type or constitutively active) 55 ern blot analysis revealed that three clones contained the expression vectors. Cells were harvested in M2 buffer (32) 48 desired homologous recombination event. These clones were hr after transfection. Equal amounts of the Myc-tagged pro injected into blastocysts to generate chimeras. The chimeras teins, as assayed with Western blot, were then immunopuri were then crossed to generate PAK5 heterozygotes. PAK5 fied from approximately 100 g of cell extracts using anti heterozygous mice were crossed to give rise to PAK5 null body generated against the Myc epitope tag (9E10, Santa 60 1CC. Cruz) and protein Asepharose. After 2 hr incubation at 4°C., An alternative targeting vector has also been generated in the immunoprecipitates were washed twice in M2 buffer and which exon 1 is deleted instead of exon3. Exon 1 contains the twice in a buffer containing 20 mM HEPES (pH 7.5) and 10 start codon and the GTPase Binding domain. Using proce mM MgCl2, then incubated together with 5 ug HH4, in a dures similar to the ones described above, chimeras were buffer containing 20 mM HEPES (pH 7.5), 10 mMMgCl2, 20 65 generated using this vector. These chimeras will be back mMB-glycerol phosphate, 10 mMPNPP 1 mM DTT, 50 uM crossed to generate PAK5 heterozygotes and PAK5 knock NaVO 20 uMATP, and 5uCi Y-PATP for 20 minat30° outs as described above. US 7482,138 B2 13 14 Results amounts of PAK5, PAK5 (S573N), and PAK4 (as assessed by Identification of PAK5, a Novel Member of the PAK Fam Western blots) were immunopurified from cell lysates and ily of Kinases incubated with Histone H4 (HH4) in kinase buffer with The human PAK5 cDNA was cloned as described in the Y-PIATP Autophosphorylation and HH4 phosphorylation Materials and Methods section. The sequence of the full were analyzed after SDS-PAGE and autoradiography (FIGS. length PAK5 and the predicted amino acid sequence are 3A and 3B). The results indicate that both PAK5 and PAK5 shown in FIG. 1A. The kinase domain, comprising amino (S573N) could autophosphorylate and phosphorylate HH4. acids 10-30, and the GBD domain, comprising amino acids although the kinase activity of PAK5 (S573N) was stronger 452-702, are underlined in the figure. A comparison between than that of wild type PAK5 (FIG.3A). Wild type PAK5 had the amino acid sequences of these domains and those of 10 significantly stronger activity than an equivalent amount of hPAK4, MBT, hPAK6 and hPAK1 demonstrated that PAK5 PAK4. In fact, the autoradiogram had to be overexposed shares Surprising homology to the Drosophila MBT protein. relative to PAK5 activity, in order to detect PAK4 activity MBT is expressed in the mushroom body, a structure of the (FIG. 3B). Drosophila brain. For example, the PAK5 kinase domain PAK5 Activates the JNK Pathway shares an 80% sequence identity with the same domain of 15 In addition to regulation of the actin cytoskeleton, one of MBT (from amino acids 371-620 of MBT). This is only the functions of Cdc42Hs and Rac is to activate the JNKMAP slightly less than its 84% sequence identity PAK5 shares with Kinase pathway (2, 4, 6, 30, 52). Since PAK5 interacts with the same domain of PAK4 (from amino acids 324-573 of Rac and Cdc42, its ability to activate JNK was tested. 293 PAK4), and significantly greater than its 76% and 57% iden cells were transfected with a HA-tagged JNK expression tity with the kinase domains of PAK6 and PAK1, respectively vector together with increasing doses of an expression vector (from amino acids 273-523 of PAK1; and from amino acids containing the PAK5 cDNA. Activated Rac and MEKK1 420-659 of PAK6). PAK5 shares similarly high sequence expression vectors were used as positive controls. After tran homology with MBT in the GBD domain. The GBD domain sient expression, JNK was immunopurified from cell lysates, shares 86%, 76%, 70%, and 57% identity with the corre followed by an in vitro kinase assay using GST-c-Jun as a sponding domains of PAK4 (from amino acids 10-30 of 25 substrate. The results indicate that overexpression of the wild PAK4), MBT (from amino acids 10-30 of MBT), PAK6 (from type PAK5 led to activation of the JNK pathway that was amino acids 10-30 of PAK6) and PAK1 (from amino acids almost as strong as activation by Rac (FIG. 4). In contrast, 74-94 of PAK1), respectively. Outside of the GBD and kinase PAK4 activation of JNK was significantly lower than Rac domains, there is little sequence homology between PAK5 activation (1). PAK5 did not activate the ERK pathway and it and either PAK4 or any other known proteins. Furthermore, 30 only inefficiently activated the p38 pathway (data not shown). no obvious SH3 domain recognition sites or G BY binding Expression of PAK5 Leads to the Formation of Filopodia domains similar to those in PAK1 are evident in PAK5. North and Neurite Processes in N1 E-115 Cells ernanalysis of PAK5 indicates that it is expressed in brain and To determine whether expression of PAK5 could promote pancreas. Very little or no PAK5 could be detected in several morphological changes in neuronal cells, N1 E-115 neuro other human tissues that were examined (data not shown). 35 blastoma cells grown in the presence of serum were tran PAK5 Interacts with GTP-bound Rac and Cdc42Hs siently transfected with either empty vector containing only Sequencing analysis indicates that PAK5 has a putative Enhanced GFP (EGFP) or expression vectors containing GBD/CRIB motif similar to that of PAK4. PAK4 binds PAK5 or PAK5 (S573N) fused to EGFP. For comparison, strongly to Cdc42 and more weakly to Rac through this cells were transfected with a vector containing activated domain. To determine whether PAK5 interacts with the 40 PAK1 (T423E). Cells transfected with EGFP alone appeared GTPases, an overlay assay was used in which filters contain similar to non-transfected cells. Most of the cells had rounded ing immobilized PAK4 and PAK5 were probed with GTP morphologies, and approximately 7% of them had neurite loaded Rac1 V12 or Cdc42V12. We found that PAK5 interacts like extensions. In contrast, at least three times as many with both Cdc42 and Rac (FIG. 2), suggesting that PAK5 is a PAK5-expressing cells had neurite-like processes. Most target for these GTPases. Like PAK4, however, PAK5 45 strikingly, expression of PAK5 (S573N) led to the production appeared to interact more tightly with Cdc42 than Rac. PAK5 of long neurite-like processes in approximately 70% of the did not bind to GTP-loaded RhoA, and a PAK5 mutant lack transfected cells. In both PAK5- and PAK5 (S573N)-express ing the GBD (PAK5AGBD) was notable to bind to Cdc42 or ing cells, even the cells that did not have neurites had a Rac. dramatic increase in filopodia. In contrast to PAK5, expres PAK5 Autophosphorylates and Phosphorylates an Exog 50 sion of PAK1 (T423E) did not lead to the increased produc enous Substrate tion of either filopodia or neurites in these cells. Representa Previously, it was shown that wild type PAK4 can auto tive cells from each condition visualized at 60x magnification phosphorylate and phosphorylate Histone H4 (HH4)(1), and are shown in FIG. 5A. FIG. 5B shows fields of cells express that a constitutively active PAK4, PAK4 (S445N), has stron ing empty vector, PAK1 (T423E), or PAK5 (S573N) visual ger kinase activity than wild type PAK4 (36). PAK4 (S445N) 55 ized at a 10x magnification. The percentages of neurite bear has a serine to glutamic acid mutation at the putative auto ing cells under the different conditions are Summarized in phosphorylation site (amino acid 474) and a serine to aspar FIG. 6A. agine mutation at amino acid 445, which is thought to func The Cdc42 and Rac pathways appear to function antago tion by stabilizing the catalytic loop (36, 48). This mutant has nistically with the Rho pathway in N1 E-115 cells, where an elevated level of kinase activity, but its substrate specificity 60 Cdc42 and Rac are required for neurite outgrowth and Rho does not appear to be altered and it does not induce non causes neurite retraction (19, 40, 51). To see whether PAK5 specific morphological changes (36). functions antagonistically with Rho, cells were transfected In order to determine whether PAK5 functions similarly, with PAK5 (S573N) together with an activated RhoAV14 293 cells were transfected with Myc-tagged PAK5 expression vector. Expression of RhoAV 14 caused a significant reduc vector or Myc-tagged PAK5 (S573N), which contains the 65 tion in the percentage of PAK5 (S573N) transfected cells analogous mutations to PAK4 (S445N). Myc-tagged wild bearing neurites (see FIG. 6A). In contrast, approximately type PAK4 expression vector was used for comparison. Equal 90% of cells transfected with PAK5 and the Rho inhibitor C3 US 7482,138 B2 15 16 transferase had neurites. Dominant-negative JNK had no extension of new filopodia and lamellipodia so that the cycle inhibitory effect on neurite outgrowth (see FIG. 6A), of axon guidance and growth can continue (24, 33). Because although it effectively blocked MEKK activation of the c-Jun the formation offilopodia and lamellipodia is so important for promoter (data not shown). The results indicate that PAK5 neurite outgrowth and growth cone guidance, there has been triggers neurite outgrowth by a pathway that functions considerable interest in the possible role for the Rho GTPases antagonistically to the Rho pathway and that is independent in these processes. Of particular interest are Cdc42 and Rac, of JNK activation. To test whether PAK5 can actually inhibit which were first described as proteins that regulate filopodia RhoA activity, 293 cells were transfected with wild-type and lamellipodia formation in fibroblasts. Both Cdc42 and RhoA together with either empty vector, wild-type PAK5 or Rac have subsequently been found to play key roles in all PAK5 (S573N), and RhoA activity was assessed by a Rho 10 aspects of neural development, including growth cone guid tekin binding assay. As shown in FIG. 7, activated PAK5 ance and the extension of axons (24). caused a significant reduction in the amount of activated Rho, The effector proteins that mediate the morphological but had no effect on total RhoA levels. changes induced by the Rho GTPases in neuronal cells are not PAK5 is Necessary for Neurite Outgrowth in N1 E-115 yet clearly defined. The PAK serine/threonine kinases are Cells 15 good candidates because they are direct targets of Cdc42 and To see whether PAK5 is necessary for neurite outgrowth, Rac. PAKs 1, 2, and 3, however, may not be directly involved N1E-115 cells were transfected with either empty vector or in all of the cytoskeletal changes induced by these GTPases, vectors containing one of three different dominant negative and effector mutants of Cdc42 and Rac that can not bind to PAK5 mutants; PAK5 (K478M) has a single point mutation them can still induce filopodia and lamellipodia (13, 21). In within the kinase domain rendering it kinase inactive, contrast, PAK4, which is the founding member of a new PAK5RD lacks the kinase domain, and PAK4RDAGBD lacks group of PAKS, directly regulates filopodia formation in the kinase domain and the GBD domain. After transient trans response to Cdc42. PAK4 has a modified GTPase Binding fection cells were changed to serum free media to induce Domain (GBD) compared with the previously identified neurite outgrowth and cells were observed 72 hours later. PAKs, and it can even bind to Cdc42 effector mutants that do While approximately 70% of the empty vector transfected 25 not bind PAKs 1, 2, and 3, via this domain (1). PAK5 is similar cells had neurites, expression of each of the dominant nega to PAK4 in sequence, especially with the GBD and kinase tive mutants led to a reduction in the percentage of neurite domains, but it is expressed primarily in the brain. PAK5 is bearing cells. The levels of inhibition by the dominant nega therefore envisioned in this invention as a target for the tive PAK5 mutants were similar to the level of inhibition that GTPases involved in neurite outgrowth. resulted from expression of dominant negative Cdc42N17. 30 While members of the drosophila PAK family, including Expression of wild-type PAK5 did not cause any inhibition in Drosophila PAK and MBT, are thought to be involved in neurite outgrowth. These results are summarized in FIG. 6B. neuronal development (12, 34), the roles for mammalian Taken together, these results indicate that PAK5 is both nec PAKs in neurogenesis are less well defined. It was found that essary and sufficient to induce neurite outgrowth in N1 E-115 expression of activated PAK5 led to a dramatic increase in the cells. 35 formation of neurite-like extensions in N1 E-115 cells. Even PAK5 Heterozyous and Knockout Mice in the subset of PAK5-expressing cells in which neurites were Mice heterozygous for PAK5 deletion were generated as not seen, there was an increased production of filopodia, described in the Methods section and PAK5 null mice were which is an important step in the production of neurite pro generated by breeding the heterozygotes. Crosses between cesses. The instant results suggest, therefore, that PAK5 in two PAK5 heterozygotes gave rise to wild-type (+/-), PAK5 40 fact is a major target for Cdc42, and possibly Rac, in neuronal heterozygous (+/-), and PAK5 knockout (-/-) offspring, as cells, which regulates the formation of filopodia and neurite assessed by PCR analysis and Southern blot analysis of tail processes. Previous work has shown that PAK1 can also DNA. Western blot analysis of brain lysates will be carried trigger neurite outgrowth in PC12 cells. However, this out to confirm the absence of PAK5 protein in the (-/-) mice. required that it be targeted to the membrane by addition of a PAK5 (-/-) mice are both viable and fertile. 45 membrane targeting sequence, and it occurred by a mecha nism that did not require its kinase activity or its Cdc42/Rac Discussion binding domain (GBD). PAK1 might therefore function as a Described here is the characterization of a novel member of type of scaffolding protein which recruits other proteins to the the mammalian PAK family, PAK5, which interacts specifi membrane where they can promote neurite outgrowth (8). It cally with GTP-loaded Cdc42 and more weakly with Rac. 50 was found here that activated PAK1 did not promote neurite PAK5 shares sequence homology with PAK4 within the GBD outgrowth in N1 E-115 cells. In contrast, PAK5 clearly trig and kinase domains, although there is very little sequence gered both filopodia formation and neurite outgrowth in these similarity between these two protein kinases outside of these cells. This did not require membrane targeting of PAK5, and domains. Unlike PAK4, PAK5 is only expressed in a limited the extent of neurite outgrowth was directly related to the number of tissues, and it is especially highly expressed in the 55 level of its kinase activity. The instant results suggest, there brain. In this regard it is intriguing that PAK5 shares sequence fore, that PAK5 regulates the morphology of these cells by similarity with Drosophila MBT (28), a kinase which is phosphorylating target proteins that are specifically involved thought to regulate growth of cells in the mushroom body of in neurite outgrowth. The substrates for PAK5 and the mecha Drosophila brain. PAK5 is therefore an excellent candidate nism by which it triggers neurite outgrowth in N1 E-115 cells for a Cdc42/Rac target that regulates growth and morphology 60 remain to be elucidated. One possibility is that like Cdc42 and in neuronal cells. Rac, PAK5 may promote neurite outgrowth by a mechanism Cytoskeletal organization is a critical part of neuronal that is antagonistic to Rho (19, 40, 51). Consistent with this, development. For example, filopodia and lamellipodia play it was found that overexpression of a constitutively active Rho key roles in the guidance of neuronal growth cones towards mutant, RhoV 14, blocks neurite production by activated attractive cues and away from repulsive cues, and neurite 65 PAK5. It will be interesting to determine, therefore, whether extension occurs when these filopodia and lamellipodia are PAK5 functions by inhibiting the activity of Rho. It was also stabilized. Stabilization of these structures is followed by found that, like Cdc42 and Rac (2, 4, 6, 30, 52), PAK5 acti US 7482,138 B2 17 18 vates the JNK pathway. However, while JNK has been impli stimulated by UV light and Ha-Ras that binds and phos cated in PC12 cell differentiation (15, 16, 23), it was shown to phorylates the c-Jun activation domain. Cell 76:1025 be dispensable for differentiation of N1 E-115 cells (40), and 1037. it was found that a kinase inactive JNK has no inhibitory effect on neurite outgrowth triggered by PAK5. These results 10. Dutartre, H., J. Davoust, J. P. Gorvel, and P. Chavrier therefore suggest that JNK is part of a parallel PAK5-acti 1996. Cytokinesis arrest and redistribution of actin-cy vated pathway, and not part of the pathway leading to mor toskeleton regulatory components in cells expressing phological changes. the Rho GTPase CDC42HS.J Cell Sci. 109:367-377. The Drosophila protein MBT is quite similar to PAK5 in 11. Gebbink, M. F., O. Kranenburg, M. Poland, F. P. van sequence, especially within the kinase domain and GBD 10 Horck, B. Houssa, and W. H. Moolenaar 1997. Identifi motif. Interestingly, disruption of the mbt gene leads to a cation of a novel, putative Rho-specific GDP/GTP reduction in the number of cells in the mushroom body of exchange factor and a RhoA-binding protein: Control of drosophila brain. MBT was therefore proposed to be involved neuronal morphology. J Cell Biol. 137:1603-1613. in the regulation of proliferation or survival of neuronal cells 15 12. Hing, H., J. Xiao, N. Harden, L. Lim, and S. L. Zipur (28). It is interesting to note that cell death in the developing sky 1999. Pak Functions Downstream of Dock to regu nervous system can result from improper connections, or lack late photoreceptor axon guidance in Drosophilia. Cell of connections, between neurons and their targets (41). Since 97:853-863. MBT is similar to PAK5 in sequence, an intriguing possibility 13. Joneson, T., M. McDonough, D. Bar-Sagi, and L. Van is that cell death in mbt mutant flies might occur because cells Aelst 1996. RAC regulation of actin polymerization and fail to develop axons properly and therefore fail to make their proliferation by a pathway distinct from Jun kinase. proper connections. Another possibility is that MBT and Science 274:1374-1376. PAK5 could specifically trigger cell survival pathways. In this regard it is interesting that PAK5 activated JNK, since the 14. Kaufmann, N., Z. P. Wills, and D. Van Vactor 1998. JNK pathway has been implicated in the regulation of cell 25 Drosophila Rac1 controls motor axon guidance. Devel growth in mammalian cells (29), and it is thought to contrib opment 125:453-61. ute to both survival and apoptosis in different parts of the 15. Kick, G., G. Messer, G. Plewig, P. Kind, and A. E. brain (20). Goetz, 1996. Strong and prolonged induction of c-jun 30 and c-fos proto-oncogenes by photodynamic therapy. Br REFERENCES J Cancer 74:30-36. 16. Kita, Y., K. D. Kimura, M. Kobayashi, S. Ihara, K. 1. Abo, A.J. Qu, M. S. Cammarano, C. Dan, A. Fritsch, V. Kaibuchi, S. Kuroda, M. Ui, H. Iba, H. Konishi, U. Baud, B. Belisle, and A. Minden 1998. PAK4, a novel Kikkawa, S. Nagata, and Y. Fukui 1998. Microinjection effector for Cdc42Hs, is implicated in the reorganization 35 of activated phosphatidylinositol-3-kinase induces pro of the actin cytoskeleton and in the formation of filopo cess outgrowth in rat PC12 cells through the Rac-JNK dia EMBOI. 17:6527-6540. signal transduction pathway. J Cell Sci. 111:907-915. 2. Bagrodia, S., B. Derijard, R.J. Davis, and R. A. Cerione 17. Knaus, U.G., and G. M. Bokoch 1998. The p21 Rac/ 1995. Cdc42 and PAK-mediated signaling leads to Jun 40 Cdc42-activated kinases (PAKs) Int J Biochem Cell kinase and p38 mitogen-activated protein kinase activa Biol. 30:857-862. tion I Biol Chen. 270:27995-27998. 18. Kozma, R., S. Ahmed, A. Best, and L. Lim 1995. The 3. Berninger, B., and M. Poo 1996. Fast actions of neu Ras-related protein Cdc42Hs and bradykinin promote rotrophic factors. Curr Opin Neurobiol. 6:324-330. formation of peripheral actin microSpikes and filopodia 4. Brown, J. L., L. Stowers, M. Baer, J. Trejo, S. Coughlin, 45 in Swiss 3T3 fibroblasts. Mol Cell Biol. 15:1942-1952. and J. Chant 1996. Human Ste20 homologue hPAK1 19. Kozma, R., S. Sarner, S. Ahmed, and L. Lim 1997. Rho links GTPases to the JNK MAP kinase pathway. Curr family GTPases and neuronal growth cone remodelling: Biol. 6:598-605. relationship between increased complexity induced by 5. Brown, M. D., B. J. Cornejo, and J. R. Bamburg 2000. Cdc42Hs. Rac1, and acetylcholine and collapse induced Cdc42 Stimulates Neurite Outgrowth and Formation of 50 by RhoA and lysophosphatidic acid. Mol Cell Biol. Growth Cone Filopodia and Lamellipodia. J Neurobiol. 17:1201-1211. 43:352. 6. Coso, O.A., M. Chiariello, J. C. Yu, H. Teramoto, P. 20. Kuan, C.-Y. D. Yang, D. R. Samanta Roy, R. J. Davis, Crespo, N. Xu, T. Miki, and J. S. Gutkind 1995. The P. Rakic, and R. A. Flavell 1999. The Jnk1 and Jnk2 small GTP-binding proteins Rac1 and Cdc42 regulate 55 protein kinases are required for regional specific apop the activity of the JNK/SAPK signaling pathway. Cell tosis during early brain development. Neuron 22:667 81:1137-1146. 676. 7. Daniels, R. H., and G. M. Bokoch 1999. p21-activated 21. Lamarche, N. N. Tapon, L. Stowers, P. D. Burbelo, P. protein kinase: a crucial component of morphological Aspenstrom, T. Bridges, J. Chant, and A. Hall 1996. Rac signaling? Trends Biochem Sci. 24:350-355. 60 and Cdc42 induce actin polymerization and G1 cell 8. Daniels, R. H., P. S. Hall, and G. M. Bokoch 1998. cycle progression independently of p65PAK and the Membrane targeting of p21-activated kinase 1 (PAK1) JNK/SAPK MAP kinase cascade. Cell 87:519-529. induces neurite outgrowth from PC12 cells. EMBO.J. 22. Lamoureux, P. Z. F. Altun-Gultekin, C. Lin, J. A. 17:754-764. 65 Wagner, and S. R. Heidemann 1997. Rac is required for 9. Derijard, B., M. Hibi, I. H. Wu, T. Barrett, B. Su, T. Deng, growth cone function but not neurite assembly. J Cell M. Karin, and R. J. Davis 1994. JNK1: a protein kinase Sci. 110:635-641. US 7482,138 B2 19 20 23. Leppa, S., R. Saffrich, W. Ansorge, and D. Bohmann 38. Ridley, A.J. H. F. Paterson, C. L. Johnston, D. Diek 1998. Differential regulation of c-Jun by ERK and JNK mann, and A. Hall 1992. The small GTP-binding protein during PC12 cell differentiation. EMBO J. 17:4404 rac regulates growth factor-induced membrane ruffling. 4413. Cell 70:401-410. 39. Sander, E. E., J. P. ten Klooster, S. Van Delft, R. A. van 24. Luo, L. 2000. Rho GTPases in neuronal morphogen der Kammen, and J. G. Collard 1999. Rac downregu esis. Nat Rev Neurosci. 1:173-180. lates Rho activity: Reciprocal balance between both 25. Luo, L.,Y.J. Liao, L. Y. Jan, andY.N. Jan 1994. Distinct GTPases determines cellular morphology and migratory morphogenetic functions of similar small GTPases: behavior. J Cell Biol. 147:1009-1022. Drosophila Drac1 is involved in axonal outgrowth and 10 40. Sarner, S., R. Kozma, S. Ahmed, and L. Lim 2000. myoblast fusion. Genes Dev. 8:1787-802. Phosphatidylinositol 3-Kinase, Cdc42, and Rac1 Act 26. Manser, E. H. Y. Huang, T. H. Loo, X. Q. Chen, J. M. Downstream of Ras in Integrin-Dependent Neurite Out Dong, T. Leung, and L. Lim 1997. Expression of con growth in N1E-115 Neuroblastoma Cells Mol Cell Biol. stitutively active alpha-PAK reveals effects of the kinase 20:158-172. on actin and focal complexes. Mol Cell Biol. 17:1129 15 41. Sastry, P. S., and K. S. Rao 2000. Apoptosis and the 1143. nervous system. J Neurochem. 74:1-20. 27. Martin, G. A. G. Bolag, F. McCormick, and A. Abo 42. Self, A.J., and A. Hall 1995. Purification of recombi 1995. A novel serine kinase activated by rac1/ nant Rho/Rac/G25K from Escherichia coli. Meth Enzy CDC42Hs-dependent autophosphorylation is related to mol. 256:3-10. PAK65 and STE2O. EMBOI. 14:1970-1978. 43. Sells, M.A., and J. Chernoff 1997. Emerging from the 28. Melzig, J., K. H. Rein, U. Schafer, H. Pfister, H. Jackie, Pak: the p21-activated protein kinase family. Trends Cell M. Heisenberg, and T. Raabe 1998. A protein related to Biol. 7:162-167. p21-activated kinase (PAK) that is involved in neurogen 44. Sells, M.A., U.G. Knaus, S. Bagrodia, D. M. Ambrose, esis in the Drosophila adult central nervous system. 25 G. M. Bokoch, and J. Chernoff 1997. Human p21-acti Curr Biol. 8:1223-1226. vated kinase (Pak1) regulates actin organization in mammalian cells. Curr Biol. 7:202-210. 29. Minden, A., and M. Karin 1997. The JNK family of 45. Serafini, T., S. A. Colamarino, E. D. Leonardo, H. MAPKinases: regulation and function, p. 209-233. In B. Wang, R. Beddington, W. C. Skarnes, and M. Tessier W. O'Malley (ed.), Hormones and Signaling, vol. 1. 30 Lavigne 1996. Netrin-1 is required for commissural Academic Press, San Diego. axon guidance in the developing vertebrate nervous sys 30. Minden, A., A. Lin, F. X. Claret, A. Abo, and M. Karin tem. Cell 87: 1001-1014. 1995. Selective activation of the JNK signaling cascade 46. Stanyon, C.A., and O. Bernard 1999. LIM-kinasel. Int and c-Jun transcriptional activity by the small GTPases J Biochen Cell Biol. 31:389-394. Rac and Cdc42HS. Cell 81:1147-1157. 35 47. Steven, R., T. J. Kubiseski, H. Zheng, S. Kulkami, J. 31. Minden, A., A. Lin, M. McMahon, C. Lange-Carter, B. Mancillas, A. R. Morales, C. W. V. Hogue, T. Pawson, Derijard, R.J. Davis, G. L. Johnson, and M. Karin 1994. and J. Culotti 1998. UNC-73 activates the Rac GTPase Differential activation of ERK and JNK mitogen-acti and is required for cell growth cone migrations in C. vated protein kinases by Raf-1 and MEKK. Science elegans. Cell 92:785-795. 266:1719-1723. 40 48. Taylor, S. S., D. R. Knighton, J. Zheng, L. F. Ten Eyck, 32. Minden, A., A. Lin, T. Smeal, B. Derijard, M. Cobb, R. and J. M. Sowadski 1992. Structural framework for the Davis, and M. Karin 1994. c-Jun N-terminal phospho protein kinase family. Annu Rev Cell Biol. 8:429–462. rylation correlates with activation of the JNK subgroup 49. Tigyi, G. D. J. Fischer, A. Sebok, F. Marshall, D. L. but not the ERK subgroup of mitogen-activated protein 45 Dyer, and R. Miledi 1996. Lysophosphatidic acid-in kinases. Mol Cell Biol. 14:6683-6688. duced neurite retraction in PC12 cells: neurite-protec 33. Mueller, B. K. 1999. Growth cone guidance: first steps tive effects of cyclic AMP signaling. J Neurochem. towards a deeper understanding. Annu Rev Neurosci. 66:549-558. 22:35-388. 50. Tigyi, G. D. J. Fischer, A. Sebok, C. Yang, D. L. Dyer, 50 and R. Miledi 1996. Lysophosphatidic acid-induced 34. Newsome, T. P. S. Schmidt, G. Dietzl, K. Keleman, B. neurite retraction in PC12 cells: control by phosphoi Asling, A. Debant, and B. J. Dickson 2000. Trio com nositide-Ca" signaling and Rho. J Neurochem. 66:537 bines with dock to regulate Pak activity during photore 548. ceptor axon pathfinding in Drosophila. Cell 101:283-94. 51. van Leeuwen, F.N., H. E. Kain, R. A. Vander Kammen, 35. Nobes, C. D., and A. Hall 1995. Rho, rac, and cdc42 55 F. Michiels, O. W. Kranenburg, and J. G. Collard 1997. GTPases regulate the assembly of multimolecular focal The guanine nucleotide exchange factor Tiaml affects complexes associated with actin stress fibers, lamellipo neuronal morphology; opposing roles for the Small dia, and filopodia. Cell 81:53-62. GTPases Rac and Rho. J Cell Biol. 139:797-807. 36. Qu, J., M. S. Cammarano, Q. Shi, K. C. Ha, P. de 52. Zhang, S.J. Han, M. A. Sells, J. Chernoff, U.G. Knaus, Lanerolle, and A. Minden 2001. Activated PAK4 Regu 60 R. J. Ulevitch, and G. M. Bokoch 1995. Rho family lates Cell Adhesion and Anchorage-Independent GTPases regulate p38 mitogen-activated protein kinase Growth. Mol Cell Biol. 21:3523-3533. through the downstream mediator Pak1.J Biol Chem. 37. Ridley, A.J., and A. Hall 1992. The small GTP-binding 270:23934-23936. protein rho regulates the assembly of focal adhesions 65 53. Zipkin, I. D., R. M. Kindt, and C.J. Kenyon 1997. Role and actin stress fibers in response to growth factors. Cell of a New Rho Family Member in Cell Migration and 70:389-399. Axon Guidance in C. elegans. Cell 90:883-894.

US 7482,138 B2 23 24

- Continued cc cc cc tatt t caatgagcc t cct ctgcag gcc atgagga ggat.ccggga cagtttacct 198O ccalaga.gtga aggacctaca caaggtttct tccatgcticc gaggatt cot agatctt atg ttggtgaggg agc cct ct cq alaga.gc.caca gct Caagaac tcc ttggaca to cattctta 21OO aaattggcag gtccaccatc ttgcattgtt cct ct catga gacaatacag acat cactga 216 O

SEQ ID NO 2 LENGTH: 719 TYPE : PRT ORGANISM: mouse FEATURE: NAME/KEY: MISC FEATURE OTHER INFORMATION: mouse PAKS

<4 OO SEQUENCE: 2 Met Phe Gly Lys Llys Llys Llys Llys Ile Glu Ile Ser Gly Pro Ser Asn 1. 5 1O 15

Phe Glu His Arg Val His Thr Gly Phe Asp Pro Gln Glu Gln Llys Phe 25 3O

Thir Gly Luell Pro Glin Gln Trp His Ser Luell Luell Ala Asp Thir Ala Asn 35 4 O 45

Arg Pro Pro Met Val Asp Pro Ser Ile Thr Pro Ile Glin Lieu. SO 55 6 O

Ala Pro Met Llys Thir Ile Val Arg Gly Asn Lys Ser Cys Lys Glu Thr 65 70 8O

Ser Ile Asn Gly Lieu. Lieu. Glu Asp Phe Asp ASn Ile Ser Val Thr Arg 85 90 95

Ser Asn Ser Lieu. Arg Lys Glu Ser Pro Pro Thir Pro Asp Glin Gly Ala 105 11 O

Ala Ser Arg Ile Glin Gly His Ser Glu Glu ASn Gly Phe Ile Thr Phe 115 12 O 125

Ser Glin Tyr Ser Ser Glu Ser Asp Thir Thir Ala Asp Tyr Thir Thr Glu 13 O 135 14 O Lys Arg Asp Arg Ser Lieu. Tyr Gly Asp Asp Lieu. Asp Lieu. Tyr Tyr 145 150 155 160

Ser Ser His Ala Ala Lys Glin Asn Gly His Ala Met Lys Met Lys 1.65 17O 17s

His Gly Asp Ala Tyr Tyr Pro Glu Met Ser Lieu Lys Thr Asp Lieu. 18O 185 19 O

Ala Gly Phe Pro Val Asp Tyr His Thir His Luell Asp Ser Lieu. Arg Llys 195 2O5

Ser Ser Glu Tyr Gly Asp Lieu. Arg Trp Asp Glin Arg Ala Ser Ser 21 O 215 22O

Ser Ser Pro Lieu. Asp Tyr Ser Phe Glin Luell Thir Pro Ser Arg Thr Ala 225 23 O 235 24 O

Gly Thir Ser Arg Cys Ser Lys Glu Ser Luell Ala Tyr Ser Glu Ser Asp 245 250 255

Trp Gly Pro Ser Lieu. Asp Asp Tyr Asp Arg Arg Pro Llys Ser Ser Tyr 26 O 265 27 O

Lell His Glin Thir Ser Pro Glin Pro Ala Met Arg Glin Arg Ser Lys Ser 27s 28O 285

Gly Ser Gly Leul Glin Glu Pro Met Met Pro Phe Gly Ala Ser Ala Phe 29 O 295 3 OO

Lys Thir His Pro Glin Gly His Ser Asn Ser Tyr Thr Tyr Pro Arg 3. OS 310 315 32O US 7482,138 B2 25 26

- Continued

Lell Ser Glu Pro Thir Met Ile Pro Lys Wall Asp Tyr Asp Arg Ala 3.25 330 335

Glin Met Wall Phe Ser Pro Pro Luell Ser Gly Ser Asp Thir Tyr Pro Arg 34 O 345 35. O

Gly Pro Thir Lell Pro Glin Ser Glin Ser Ala Gly Tyr Ser Ser 355 360 365

Gly Ser His Glin Tyr Pro Ser Gly His Ala Ser Luell Tyr His 37 O 375

His Pro Ser Luell Glin Thir Ser Ser Glin Tyr Ile Ser Thir Ala Ser Tyr 385 390 395 4 OO

Lell Ser Ser Luell Ser Ile Ser Ser Ser Thir Pro Pro Pro Ser Trp 4 OS 415

Gly Ser Ser Ser Asp Glin Glin Pro Ser Arg Wall Ser His Glu Glin Phe 425 43 O

Arg Ala Ala Luell Glin Lell Wall Wall Ser Pro Gly Asp Pro Arg Glu Tyr 435 44 O 445

Lell Asp Asn Phe Ile Ile Gly Glu Gly Ser Thir Gly Ile Wall 450 45.5 460

Ile Ala Thir Glu His Thir Gly Glin Wall Ala Wall Met 465 470

Asp Luell Arg Glin Glin Arg Arg Glu Luell Luell Phe Asn Glu Wall Wall 485 490 495

Ile Met Arg Asp Tyr His His Asp Asn Wall Wall Asp Met Tyr Asn Ser SOO 505 51O

Luell Wall Gly Asp Glu Lell Trp Wall Wall Met Glu Phe Luell Glu Gly 515 525

Gly Ala Luell Thir Asp Ile Wall Thir His Thir Arg Met Asn Glu Glu Glin 53 O 535 54 O

Ile Ala Thir Wall Cys Lell Ser Wall Luell Ala Lell Ser Luell His 5.45 550 555 560

Asn Glin Gly Wall Ile His Arg Asp Ile Lys Ser Asp Ser Ile Luell Luell 565 st O sts

Thir Ser Asp Gly Arg Ile Luell Ser Asp Phe Gly Phe Cys Ala Glin 585 59 O

Wall Ser Lys Glu Wall Pro Arg Ser Luell Wall Gly Thir Pro 595 605

Trp Met Ala Pro Glu Wall Ile Ser Arg Luell Pro Tyr Gly Thir Glu Wall 610 615

Asp Ile Trp Ser Lell Gly Ile Met Wall Ile Glu Met Ile Asp Gly Glu 625 630 635 64 O

Pro Pro Phe Asn Glu Pro Pro Luell Glin Ala Met Arg Arg Ile Arg 645 650 655

Asp Ser Luell Pro Pro Arg Wall Asp Luell His Wall Ser Ser Met 660 665 67 O

Lell Arg Gly Phe Lell Asp Lell Met Luell Wall Arg Glu Pro Ser Glin Arg 675 68O 685

Ala Thir Ala Glin Glu Lell Lell Gly His Pro Phe Lell Luell Ala Gly 69 O. 695 7 OO

Pro Pro Ser Ile Wall Pro Luell Met Arg Glin Tyr Arg His His 7 Os 71O 71s

<210 SEQ ID NO 3 <211 LENGTH: 216 O &212> TYPE: DNA

US 7482,138 B2 29 30

- Continued

<210 SEQ ID NO 4 <211 LENGTH: 719 &212> TYPE: PRT <213> ORGANISM: Homo sapiens &220s FEATURE: <221 NAME/KEY: MISC FEATURE &223> OTHER INFORMATION: Human PAK5

<4 OO SEQUENCE: 4 Met Phe Gly Lys Llys Llys Llys Lys Ile Glu Ile Ser Gly Pro Ser Asn 1. 5 1O 15 Phe Glu. His Arg Val His Thr Gly Phe Asp Pro Glin Glu Glin Llys Phe 2O 25 3O Thr Gly Lieu Pro Glin Glin Trp His Ser Lieu. Lieu Ala Asp Thir Ala Asn 35 4 O 45 Arg Pro Llys Pro Met Val Asp Pro Ser Cys Ile Thr Pro Ile Glin Leu SO 55 6 O Ala Pro Met Lys Thr Ile Val Arg Gly Asn Llys Pro Cys Lys Glu Thr 65 70 7s 8O Ser Ile Asin Gly Lieu. Lieu. Glu Asp Phe Asp Asn. Ile Ser Val Thr Arg 85 90 95 Ser Asn. Ser Lieu. Arg Lys Glu Ser Pro Pro Thr Pro Asp Glin Gly Ala 1OO 105 11 O Ser Ser His Gly Pro Gly His Ala Glu Glu Asn Gly Phe Ile Thr Phe 115 12 O 125 Ser Glin Tyr Ser Ser Glu Ser Asp Thr Thr Ala Asp Tyr Thr Thr Glu 13 O 135 14 O Llys Tyr Arg Glu Lys Ser Lieu. Tyr Gly Asp Asp Lieu. Asp Pro Tyr Tyr 145 150 155 160 Arg Gly Ser His Ala Ala Lys Glin Asn Gly His Wal Met Lys Met Lys 1.65 17O 17s His Gly Glu Ala Tyr Tyr Ser Glu Val Llys Pro Lieu Lys Ser Asp Phe 18O 185 19 O Ala Arg Phe Ser Ala Asp Tyr His Ser His Lieu. Asp Ser Lieu. Ser Lys 195 2OO 2O5 Pro Ser Glu Tyr Ser Asp Lieu Lys Trp Glu Tyr Glin Arg Ala Ser Ser 21 O 215 22O Ser Ser Pro Leu Asp Tyr Ser Phe Glin Phe Thr Pro Ser Arg Thr Ala 225 23 O 235 24 O Gly. Thir Ser Gly Cys Ser Lys Glu Ser Leu Ala Tyr Ser Glu Ser Glu 245 250 255 Trp Gly Pro Ser Lieu. Asp Asp Tyr Asp Arg Arg Pro Llys Ser Ser Tyr 26 O 265 27 O Lieu. Asn Gln Thr Ser Pro Gln Pro Thr Met Arg Glin Arg Ser Arg Ser 27s 28O 285 Gly Ser Gly Lieu Gln Glu Pro Met Met Pro Phe Gly Ala Ser Ala Phe 29 O 295 3 OO Lys Thr His Pro Glin Gly His Ser Tyr Asn Ser Tyr Thr Tyr Pro Arg 3. OS 310 315 32O Lieu. Ser Glu Pro Thr Met Cys Ile Pro Llys Val Asp Tyr Asp Arg Ala 3.25 330 335 Gln Met Val Lieu Ser Pro Pro Leu Ser Gly Ser Asp Thr Tyr Pro Arg 34 O 345 35. O Gly Pro Ala Lys Lieu Pro Glin Ser Glin Ser Lys Ser Gly Tyr Ser Ser 355 360 365 US 7482,138 B2 31

- Continued

Ser Ser His Glin Tyr Pro Ser Gly Tyr His Lys Ala Thr Lieu. Tyr His 37 O 375 38O His Pro Ser Leu Gln Ser Ser Ser Glin Tyr Ile Ser Thr Ala Ser Tyr 385 390 395 4 OO Lieu. Ser Ser Leu Ser Leu Ser Ser Ser Thr Tyr Pro Pro Pro Ser Trp 4 OS 41O 415 Gly Ser Ser Ser Asp Glin Gln Pro Ser Arg Val Ser His Glu Glin Phe 42O 425 43 O Arg Ala Ala Lieu Gln Lieu Val Val Ser Pro Gly Asp Pro Arg Glu Tyr 435 44 O 445 Lieu Ala Asn. Phe Ile Lys Ile Gly Glu Gly Ser Thr Gly Ile Val Cys 450 45.5 460 Ile Ala Thr Glu Lys His Thr Gly Lys Glin Val Ala Val Lys Llys Met 465 470 47s 48O Asp Lieu. Arg Lys Glin Glin Arg Arg Glu Lieu. Lieu. Phe Asn. Glu Val Val 485 490 495 Ile Met Arg Asp Tyr His His Asp Asn Val Val Asp Met Tyr Ser Ser SOO 505 51O Tyr Lieu Val Gly Asp Glu Lieu. Trp Val Val Met Glu Phe Lieu. Glu Gly 515 52O 525 Gly Ala Lieu. Thir Asp Ile Val Thr His Thr Arg Met Asn Glu Glu Gln 53 O 535 54 O Ile Ala Thr Val Cys Lieu. Ser Val Lieu. Arg Ala Lieu. Ser Tyr Lieu. His 5.45 550 555 560 Asn Glin Gly Val Ile His Arg Asp Ile Llys Ser Asp Ser Ile Lieu. Lieu 565 st O sts Thir Ser Asp Gly Arg Ile Llys Lieu. Ser Asp Phe Gly Phe Cys Ala Glin 58O 585 59 O Val Ser Lys Glu Val Pro Lys Arg Llys Ser Leu Val Gly Thr Pro Tyr 595 6OO 605 Trp Met Ala Pro Glu Val Ile Ser Arg Lieu Pro Tyr Gly Thr Glu Val 610 615 62O Asp Ile Trp Ser Lieu. Gly Ile Met Val Ile Glu Met Ile Asp Gly Glu 625 630 635 64 O Pro Pro Tyr Phe Asn Glu Pro Pro Leu Glin Ala Met Arg Arg Ile Arg 645 650 655 Asp Ser Lieu Pro Pro Arg Val Lys Asp Lieu. His Llys Val Ser Ser Val 660 665 67 O Lieu. Arg Gly Phe Lieu. Asp Lieu Met Lieu Val Arg Glu Pro Ser Glin Arg 675 68O 685 Ala Thr Ala Glin Glu Lieu. Lieu. Gly. His Pro Phe Lieu Lys Lieu Ala Gly 69 O. 695 7 OO Pro Pro Ser Cys Ile Val Pro Leu Met Arg Glin Tyr Arg His His 7 Os 71O 71s

<210 SEQ ID NO 5 <211 LENGTH: 7 &212> TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OO SEQUENCE: 5

Ala Pro Ser Asn. Phe Glu. His 1. 5 US 7482,138 B2 33 34

- Continued <210 SEQ ID NO 6 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Homo sapiens <4 OO SEQUENCE: 6 agtagggagt gccalaccaat

<210 SEQ ID NO 7 <211 LENGTH: 591 &212> TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OO SEQUENCE: 7 Met Phe Gly Lys Arg Llys Lys Arg Val Glu Ile Ser Ala Pro Ser Asn 1. 5 1O 15 Phe Glu. His Arg Val His Thr Gly Phe Asp Gln His Glu Glin Llys Phe 2O 25 3O Thr Gly Lieu Pro Arg Glin Trp Glin Ser Lieu. Ile Glu Glu Ser Ala Arg 35 4 O 45 Arg Pro Llys Pro Leu Val Asp Pro Ala Cys Ile Thr Ser Ile Glin Pro SO 55 6 O Gly Ala Pro Llys Thir Ile Val Arg Gly Ser Lys Gly Ala Lys Asp Gly 65 70 7s 8O Ala Lieu. Thir Lieu Lleu Lieu. Asp Glu Phe Glu Asn Met Ser Val Thr Arg 85 90 95 Ser ASn Ser Lieu. Arg Arg Asp Ser Pro Pro Pro Pro Ala Arg Ala Arg 1OO 105 11 O Gln Glu Asn Gly Met Pro Glu Glu Pro Ala Thir Thr Ala Arg Gly Gly 115 12 O 125 Pro Gly Lys Ala Gly Ser Arg Gly Arg Phe Ala Gly His Ser Glu Ala 13 O 135 14 O Gly Gly Gly Ser Gly Asp Arg Arg Arg Ala Gly Pro Glu Lys Arg Pro 145 150 155 160 Llys Ser Ser Arg Glu Gly Ser Gly Gly Pro Glin Glu Ser Ser Arg Asp 1.65 17O 17s Lys Arg Pro Leu Ser Gly Pro Asp Val Gly Thr Pro Gln Pro Ala Gly 18O 185 19 O Lieu Ala Ser Gly Ala Lys Lieu Ala Ala Gly Arg Pro Phe Asn. Thir Tyr 195 2OO 2O5 Pro Arg Ala Asp Thr Asp His Pro Ser Arg Gly Ala Glin Gly Glu Pro 21 O 215 22O His Asp Wall Ala Pro Asn Gly Pro Ser Ala Gly Gly Lieu Ala Ile Pro 225 23 O 235 24 O Gln Ser Ser Ser Ser Ser Ser Arg Pro Pro Thr Arg Ala Arg Gly Ala 245 250 255 Pro Ser Pro Gly Val Lieu. Gly Pro His Ala Ser Glu Pro Glin Leu Ala 26 O 265 27 O Pro Pro Ala Cys Thr Pro Ala Ala Pro Ala Val Pro Gly Pro Pro Gly 27s 28O 285 Pro Arg Ser Pro Glin Arg Glu Pro Glin Arg Val Ser His Glu Glin Phe 29 O 295 3 OO Arg Ala Ala Lieu Gln Lieu Val Val Asp Pro Gly Asp Pro Arg Ser Tyr 3. OS 310 315 32O Lieu. Asp Asn. Phe Ile Lys Ile Gly Glu Gly Ser Thr Gly Ile Val Cys 3.25 330 335 US 7482,138 B2 35 36

- Continued

Ile Ala Thr Val Arg Ser Ser Gly Lys Lieu Val Ala Val Lys Llys Met 34 O 345 35. O Asp Lieu. Arg Lys Glin Glin Arg Arg Glu Lieu. Lieu. Phe Asn. Glu Val Val 355 360 365 Ile Met Arg Asp Tyr Gln His Glu Asn Val Val Glu Met Tyr Asn Ser 37 O 375 38O Tyr Lieu Val Gly Asp Glu Lieu. Trp Val Val Met Glu Phe Lieu. Glu Gly 385 390 395 4 OO Gly Ala Lieu. Thir Asp Ile Val Thr His Thr Arg Met Asn Glu Glu Gln 4 OS 41O 415 Ile Ala Ala Val Cys Lieu Ala Val Lieu. Glin Ala Lieu. Ser Val Lieu. His 42O 425 43 O Ala Glin Gly Val Ile His Arg Asp Ile Llys Ser Asp Ser Ile Lieu. Lieu 435 44 O 445 Thir His Asp Gly Arg Val Llys Lieu. Ser Asp Phe Gly Phe Cys Ala Glin 450 45.5 460 Val Ser Lys Glu Val Pro Arg Arg Llys Ser Leu Val Gly Thr Pro Tyr 465 470 47s 48O Trp Met Ala Pro Glu Lieu. Ile Ser Arg Lieu Pro Tyr Gly Pro Glu Val 485 490 495 Asp Ile Trp Ser Lieu. Gly Ile Met Val Ile Glu Met Val Asp Gly Glu SOO 505 51O Pro Pro Tyr Phe Asn Glu Pro Pro Leu Lys Ala Met Lys Met Ile Arg 515 52O 525 Asp Asn Lieu Pro Pro Arg Lieu Lys Asn Lieu. His Llys Val Ser Pro Ser 53 O 535 54 O Lieu Lys Gly Phe Lieu. Asp Arg Lieu. Lieu Val Arg Asp Pro Ala Glin Arg 5.45 550 555 560 Ala Thr Ala Ala Glu Lieu Lleu Lys His Pro Phe Lieu Ala Lys Ala Gly 565 st O sts Pro Pro Ala Ser Ile Val Pro Leu Met Arg Glin Asn Arg Thr Arg 58O 585 59 O

<210 SEQ ID NO 8 <211 LENGTH: 681 &212> TYPE: PRT <213> ORGANISM: Homo sapiens <4 OO SEQUENCE: 8 Met Phe Arg Llys Llys Llys Llys Lys Arg Pro Glu Ile Ser Ala Pro Glin 1. 5 1O 15 Asn Phe Gln His Arg Val His Thr Ser Phe Asp Pro Lys Glu Gly Lys 2O 25 3O Phe Val Gly Lieu Pro Pro Gln Trp Glin Asn. Ile Lieu. Asp Thir Lieu. Arg 35 4 O 45 Arg Pro Llys Pro Val Val Asp Pro Ser Arg Ile Thr Arg Val Glin Lieu SO 55 6 O Gln Pro Met Lys Thr Val Val Arg Gly Ser Ala Met Pro Val Asp Gly 65 70 7s 8O Tyr Ile Ser Gly Lieu. Lieu. Asn Asp Ile Glin Llys Lieu. Ser Val Ile Ser 85 90 95 Ser Asn. Thir Lieu. Arg Gly Arg Ser Pro Thir Ser Arg Arg Arg Ala Glin 1OO 105 11 O Ser Lieu. Gly Lieu. Lieu. Gly Asp Glu. His Trp Ala Thr Asp Pro Asp Met US 7482,138 B2 37 38

- Continued

115 12 O 125

Luell Glin Ser Pro Glin Ser Glu Arg Thir Asp Pro His Gly Luell 13 O 135 14 O

Lell Ser Asn Gly Gly Thir Pro Ala Gly His Glin Met Pro Trp 145 150 155 160

Pro Pro Glin Ser Pro Arg Wall Luell Pro ASn Gly Lell Ala Ala 1.65 17O 17s

Ala Ser Luell Gly Pro Ala Glu Phe Glin Gly Ala Ser Glin Arg 18O 185 19 O

Lell Luell Gly Ala Lell Glin Ser Ser Pro Pro Gly Ala Ser Pro 195

Pro Gly Thir Asn Arg His Gly Met Ala Ala His Gly Ser 2 O 215

Glu Ala Arg Pro Glin Ser Luell Wall Gly Ser Ala Thir Gly Arg 225 23 O 235 24 O

Pro Gly Glu Gly Ser Pro Ser Pro Lys Thir Arg Glu Ser Ser Luell 245 250 255

Arg Arg Luell Phe Arg Ser Met Phe Luell Ser Thir Ala Ala Thir Ala 26 O 265 27 O

Pro Pro Ser Ser Ser Pro Gly Pro Pro Pro Glin Ser Pro Asn 27s 285

Ser Ser Phe Arg Pro Pro Glin Asp Asn Pro Pro Ser Luell Wall Ala 29 O 295 3 OO

Lys Ala Glin Ser Lell Pro Ser Asp Glin Pro Wall Gly Thir Phe Ser Pro 3. OS 310 315

Lell Thir Thir Ser Asp Thir Ser Ser Pro Glin Lys Ser Lell Arg Thir Ala 3.25 330 335

Pro Ala Thir Gly Glin Lell Pro Gly Arg Ser Ser Pro Ala Gly Ser Pro 34 O 345 35. O

Arg Thir Trp His Ala Glin Ile Ser Thir Ser ASn Lell Tyr Luell Pro Glin 355 360 365

Asp Pro Thir Wall Ala Gly Ala Luell Ala Gly Glu Asp Thir Gly Wall 37 O 375

Wall Thir His Glu Glin Phe Ala Ala Luell Arg Met Wall Wall Asp Glin 385 390 395 4 OO

Gly Asp Pro Arg Lell Lell Lell Asp Ser Tyr Wall Ile Gly Glu Gly 4 OS 415

Ser Thir Gly Ile Wall Lell Ala Arg Glu Lys His Ser Gly Arg Glin 425 43 O

Wall Ala Wall Met Met Asp Luell Arg Glin Glin Arg Arg Glu Luell 435 44 O 445

Lell Phe Asn Glu Wall Wall Ile Met Arg Asp Glin His Phe Asn Wall 450 45.5 460

Wall Glu Met Lys Ser Luell Wall Gly Glu Glu Lell Trp Wall Luell 465 470

Met Glu Phe Luell Glin Gly Gly Ala Luell Thir Asp Ile Wall Ser Glin Wall 485 490 495

Arg Luell Asn Glu Glu Glin Ile Ala Thir Wall Cys Glu Ala Wall Luell Glin SOO 505

Ala Luell Ala Lell His Ala Glin Gly Wall Ile His Arg Asp Ile 515 525

Ser Asp Ser Ile Lell Lell Thir Luell Asp Gly Arg Wall Luell Ser Asp 53 O 535 54 O US 7482,138 B2 39 40

- Continued

Phe Gly Phe Ala Glin Ile Ser Asp Wall Pro Lys Arg Llys Ser 5.45 550 555 560

Lell Wall Gly Thir Pro Tyr Trp Met Ala Pro Glu Wall Ile Ser Arg Ser 565 st O sts

Lieu. Tyr Ala Thr Glu Val Asp Ile Trp Ser Lieu. Gly Ile Met Wall Ile 585 59 O

Glu Met Wall Asp Gly Glu Pro Pro Tyr Phe Ser Asp Ser Pro Wall Glin 595 605

Ala Met Lieu. Arg Asp Ser Pro Pro Pro Lys Lell Asn Ser 610 615 62O

His Lys Wall Ser Pro Wall Lell Arg Asp Phe Lieu. Glu Arg Met Luell Wall 625 630 635 64 O

Arg Asp Pro Glin Glu Arg Ala Thir Ala Glin Glu Lieu. Lieu. Asp His Pro 645 650 655

Phe Lieu. Luell Glin Thir Gly Lieu Pro Glu Cys Lieu Val Pro Luell Ile Glin 660 665 67 O

Lieu. Tyr Arg Lys Gn. Thir Ser Thir Cys 675

What is claimed is: 7. The vector of claim 6, wherein the vector is selected from 1. An isolated nucleic acid that encodes a p21-activated the group consisting of a plasmid, a cosmid, a bacteriophage kinase 5 GTPase-binding domain contained within consecu 30 and a eukaryotic virus. tive amino acid residues 10-30 of SEQID NO:4, but does not 8. The vector of claim 7, wherein the vector is a eukaryotic encode consecutive amino acid residues 452-702 of SEQID virus. NO:4. 9. An isolated host cell which comprises a nucleic acid 2. An isolated nucleic acid that encodes a p21-activated comprising nucleotides encoding a human p21-activated kinase 5 kinase domain contained within consecutive amino 35 kinase 5 kinase domain contained within consecutive amino acid residues 452-702 of SEQID NO:4, but does not encode acid residues 452-702 of SEQID NO:4 operatively linked to consecutive amino acid residues 10-30 of SEQID NO:4. nucleotides encoding an exogenous or endogenous regula 3. An isolated nucleic acid which comprises nucleotides tory element, wherein the nucleic acid does not comprise encoding a human p21-activated kinase 5 kinase domain con nucleotides encoding a p21-activated kinase 5 GTPase-bind tained within consecutive amino acid residues 452-702 of 40 ing domain contained within consecutive amino acid residues SEQID NO:4 operatively linked to nucleotides encoding an 10-30 of SEQID NO:4. exogenous or endogenous regulatory element, wherein the 10. The isolated host cell of claim 9, wherein the isolated isolated nucleic acid does not comprise nucleotides encoding host cell is selected from the group consisting of a bacterial a p21-activated kinase 5 GTPase-binding domain contained cell, a fungal cell and an animal cell. within consecutive amino acid residues 10-30 of SEQ ID 45 11. The isolated host cell of claim 1 wherein the isolated NO:4. host cell is an animal cell. 4. The isolated nucleic acid of claim3, wherein the isolated 12. A composition comprising the isolated nucleic acid of nucleic acid is DNA. claim 1 and a pharmaceutically acceptable carrier. 5. The isolated nucleic acid of claim3, wherein the isolated 13. A composition comprising the isolated nucleic acid of nucleic acid is RNA. 50 claim 2 and a pharmaceutically acceptable carrier. 6. A vector comprising a nucleic acid which comprises 14. A composition comprising the isolated nucleic acid of nucleotides encoding a human p21-activated kinase 5 kinase claim 3 and a pharmaceutically acceptable carrier. domain contained within consecutive amino acid residues 15. The vector of claim8, wherein the eukaryotic virus is an 452-702 of SEQ ID NO:4 operatively linked to nucleotides adenovirus or a retrovirus. encoding an exogenous or endogenous regulatory element, 55 16. The isolated hose cell of claim 11, wherein the animal wherein the nucleic acid does not comprise nucleotides cell is selected from the group consisting of a neuronal cell, an encoding a p21-activated kinase 5 GTPase-binding domain epithelial cell, a muscle cell, a blood cell, an immune cell, a contained within consecutive amino acid residues 10-30 of stem cell, an osteocyte and an endothelial cell. SEQID NO:4. k k k k k