The Pennsylvania State University

The Graduate School

The College of Health and Human Development

EXOGENOUS LIPIDS REGULATE

THE DEVELOPMENT OF HEPATIC STEATOSIS IN A LEAN NAFLD

MODEL-FED A HIGH CARBOHYDRATE DIET

A Dissertation in

Nutritional Sciences

by

Kuan-Hsun Huang

ã 2016 Kuan-Hsun Huang

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

December 2016 The dissertation of Kuan-Hsun Huang was reviewed and approved* by the following:

A. Catharine Ross Professor of Nutrition and Physiology Dissertation Advisor Chair of Committee

Michael H. Green Professor of Nutrition and Physiology Interim Department Head

Connie J. Rogers Associate Professor of Nutrition and Physiology

Andrew D. Patterson Associate Professor of Molecular Toxicology

Rebecca L. Corwin Professor of Nutritional Neuroscience Professor in Charge, Graduate Program in Nutritional Sciences

*Signatures are on file in the Graduate School.

ii ABSTRACT

Non-alcoholic fatty liver disease (NAFLD), an umbrella term that encompasses hepatic steatosis, steatohepatitis, fibrosis, and cirrhosis, has become the most common chronic liver disease in the developed countries. NAFLD has been shown to be positively associated with obesity, and thus not surprisingly the majority of NAFLD studies have utilized obese models to explore NAFLD causality. However, previous studies indicated that 25% of patients with NAFLD are not obese and that 7.4% of lean adults have steatosis, and they are more likely to be younger and female, suggesting that these people with lean

NAFLD were metabolically obese. Additionally, insulin resistance is an independent risk factor to the development of lean NAFLD, which has been shown to be related to cardiovascular disease and diabetes mellitus. Therefore, understanding the etiology of lean

NAFLD in the early stage of the development of steatosis becomes an urgent need. On the other hand, lifestyle modification intervention including diet and physical activity is believed to improve NAFLD or even reverse it, but very few studies have focused on the reversal of hepatic steatosis in the lean NAFLD model. Thus, the overall research hypothesis in this dissertation is that the exogenous lipids as a form of lipid emulsion (LE) and physical activity are capable to reverse hepatic triacylglycerol (TG) accumulation in the lean mouse model with preexisting steatosis.

Previous work in our laboratory indicated that 13.5% (percent of total energy, en-%)

Intralipid® given orally ameliorated TG accumulation in the liver of nonobese mice fed a high carbohydrate diet (HCD) for 5 weeks. Here, in my first study (chapter 3) I examined whether HCD can induce hepatic steatosis in a short period of time (8d) and whether

Intralipid® and voluntary exercise can prevent liver triacylglycerol (TG) accumulation by

iii regulating the de novo lipogenesis-associated transcripts and the concentrations of total fatty acids, in 8 d, on the development of steatosis in a lean mouse model. The results revealed that hepatic TG contents in the HCD-fed mice were significantly increased, confirmed by Oil Red O staining, suggesting the 8d period of induction of steatosis was sufficient to induce mild steatosis. Supplementation with 13.5% Intralipid®, with or without exercise, also suppressed HCD-induced steatosis. qRT-PCR analysis showed that including 13.5% Intralipid® to the HCD significantly decreased the transcript levels for lipogenesis-associated genes, whereas mice-fed HCD with exercise had less beneficial effect in the early stage of steatosis, as compared to HCD supplemented with 13.5%

Intralipid®. Fatty acid profiling also showed a consistency with transcriptional data that the concentration of monounsaturated FA was decreased significantly.

As noted in the previous study that HCD is capable to induce mild hepatic steatosis within 8d, I conducted a second study (chapter 4) to test whether the beneficial effect contributed by 13.5% Intralipid® supplementation will be extended to the mouse with preexisting steatosis. To investigate this, the mice were fed a HCD for 2.5 weeks to establish hepatic steatosis, then switched to HCD+13.5%LE for the final 2.5 wk. A combined targeted biochemical and untargeted metabolomics approach was employed, and biochemical analyses revealed that hepatic TG level and the lipogenic genes were significantly decreased in mice fed HCD with 13.5% Intralipid®. Total fatty acids and metabolomic profiles in liver and plasma indicated that the mice fed a HCD supplemented with 13.5% Intralipid® exhibited reduced hepatic lipogenesis, but increases in hepatic

Krebs cycle intermediates, and in plasma very-low density lipoprotein.

iv Many studies have shown that n-3 and n-9 FA have beneficial effects on lipid metabolism. In a third study (chapter 5), I compared 3 LEs-- Intralipid®, Omegaven® and

ClinOleic®-- for their ability to reverse hepatic TG accumulation after the onset of steatosis.

At this time, we used biochemical, transcriptomic and metabolomic approaches to capture an overall metabolic change in the lean NAFLD mouse model. The results showed that

HCD-induced hepatic steatosis did not develop insulin resistance and that 13.5%

Omegaven® had the strongest reversal effect on hepatic TG accumulation, as well as on the genes involved in the hepatic glucose and lipid metabolism, which can further maintain energy homeostasis in the mice with preexisting steatosis. Additionally, lipolysis in the adipose tissue was greatly improved by introduction of Omegaven®; the metabolites, assayed by nuclear magnetic resonance spectroscopy, were consistent with the transcriptomic data, suggesting a plausible mechanism of how n-3 FA-based LE reversed hepatic steatosis.

In summary, adding 13.5% Intralipid® to a HCD not only prevents the development of steatosis in the early dynamic stage by reducing de novo lipogenesis, but also mitigates the preexisting hepatic steatosis and energy homeostasis in the liver in a 5-wk study. However,

Omegaven® provides beneficial effect on the reversal of preexisting steatosis as well as an improvement on energy homeostasis in both liver and adipose tissue.

v TABLE OF CONTENTS

List of Figures ...... x

List of Tables ...... xiii

List of Abbreviations ...... xiv

Acknowledgment ...... xviii

Chapter 1 Review of the Literature ...... 1

1.1 Non-alcoholic fatty acid disease (NAFLD) ...... 1

1.1.1 NAFLD Epidemiology ...... 1

1.1.2 Diagnosis of NAFLD ...... 2

1.1.3 The pathogenesis of NAFLD ...... 4

1.1.4 The treatment of NALFD ...... 8

1.2 Lipid metabolism ...... 9

1.2.1 Digestion and absorption of lipid ...... 9

1.2.2 Lipid transport ...... 10

1.2.3 NAFLD and lipid metabolism ...... 12

1.3 NAFLD and lipid supplementation ...... 13

1.3.1 NAFLD and n-6 fatty acids ...... 13

1.3.2 NAFLD and n-3 fatty acids ...... 14

Chapter 2 Hypotheses and Objectives ...... 16

2.1 Hypotheses ...... 17

2.2 Specific aims ...... 17

2.2.1 Specific aim to the hypothesis 1 ...... 17

vi 2.2.2 Specific aim to hypothesis 2 ...... 17

2.2.3 Specific aim to the hypothesis 3 ...... 18

Chapter 3 Lipid Emulsion and Voluntary Exercise Reduce Lipogenesis and

Ameliorate Early-Stage Hepatic Steatosis in High Carbohydrate Diet-Fed Mice .... 19

3.1 Materials and Methods ...... 19

3.1.1 Animal protocol ...... 19

3.1.2 Diets and Study Design ...... 19

3.1.3 Hepatic TG quantification ...... 22

3.1.4 RNA isolation and quantitative gene expression analysis ...... 22

3.1.5 Oil red O staining ...... 22

3.1.6 Western blotting ...... 23

3.1.7 FA profiling, n-6 to n-3 FA ratio, and lipogenic and SCD1 activity indices ... 24

3.1.8 Statistical analysis ...... 25

3.2 Results ...... 26

3.2.1 Body weight, diet consumption status ...... 26

3.2.2 Liver weight, TG and histology ...... 28

3.2.3 The transcript levels for de novo lipogenesis ...... 32

3.2.4 FA concentrations in liver of HCD-fed mice ...... 38

3.3 Discussion and Summary of Study I ...... 42

Chapter 4 Lipid Emulsion Mitigates Preexisting Hepatic Steatosis and Improves

Energy Homeostasis in High Carbohydrate Diet Fed Mice ...... 49

4.1 Materials and Methods ...... 49

4.1.1 Ethical statement ...... 49

vii 4.1.2. Animals, diets and study design ...... 49

4.1.3 Liver TG quantification ...... 52

4.1.4 RNA isolation and quantitative gene expression analysis ...... 52

4.1.5 Hepatic fatty acids profiling, ratio of n-6 fatty acid to n-3 fatty acid, and

lipogenic and SCD1 activity indices ...... 52

4.1.6 Nuclear magnetic resonance (NMR) analysis ...... 54

4.1.7 Statistical analysis ...... 55

4.2 Results ...... 56

4.2.1 Body weight, diet consumption ...... 56

4.2.2 Relative liver weight, liver TG, glycogen, and other metabolites ...... 58

4.2.3 Hepatic fatty acid composition ...... 63

4.2.4 Transcript levels for genes of de novo lipogenesis ...... 67

4.2.5 NMR analysis of plasma ...... 71

4.2 Discussion and Summary of Study II ...... 75

Chapter 5 Lipid emulsions, Rich in n-3 or n-9 Fatty Acids, Reverse the Development of High Carbohydrate Diet-Induced Hepatic Steatosis in Mice ...... 81

5.1 Methods and Materials ...... 81

5.1.1 Ethical statement ...... 81

5.1.2 Animals, diets and study design ...... 81

5.1.3 Liver TG quantification ...... 85

5.1.4 Liver hematoxylin and eosin (H&E) staining ...... 85

5.1.5 RNA isolation and quantitative gene expression analysis ...... 85

5.1.6 Liver RNA sequencing analysis ...... 86

viii 5.1.7 Biological process and Pathway analysis ...... 86

5.1.8 Hepatic fatty acids profiling, ratio of n-6 fatty acid to n-3 fatty acid, and

lipogenic and SCD1 activity indices ...... 87

5.1.9 Nuclear magnetic resonance (NMR) analysis ...... 88

5.1.10 Statistical analysis ...... 89

5.2 Results ...... 90

5.2.1 Body weight and dietary intake ...... 90

5.2.2 Relative liver weight, liver TG, and H&E staining ...... 92

5.2.3 Transcript levels for genes of de novo lipogenesis ...... 95

5.2.4 Hepatic fatty acid composition ...... 99

5.2.5 Liver NMR analysis ...... 103

5.2.6 Transcript levels for genes of lipolysis in adipose tissue ...... 107

5.2.7 Plasma glucose, insulin, FGF-21, and alanine aminotransferase ...... 110

5.2.8 Liver RNA sequencing pathway analysis ...... 112

5.3 Discussion and Summary of Study III ...... 120

Chapter 6 Disscussion and Future Directions ...... 127

6.1 The dose of lipid emulsion added to a HCD ...... 127

6.2 Lean NAFLD mouse model...……………………………………………………129

6.3 The effects of liquid HCD-based diets on the development of steatosis ...... 132

6.5 Limitations and future directions ...... 143

6.5 Conclusions ...... 144

References ...... 146

Appendix. Supplemental Tables ...... 170

ix

LIST OF FIGURES

Figure 1.1. Multifactorial involved in the progression of NAFLD…………………….6

Figure 1.2. A two-hit hypothesis of NAFLD…………………………………………..7

Figure 3.1. Initial and final body weight in C57BL/6J mice fed chow or HCD with or

without 13.5%LE and/or voluntary exercise for 8 days…………………..27

Figure 3.2. Relative liver weight, and hepatic TG in C57BL/6J mice fed chow or HCD

with or without 13.5%LE and/or voluntary exercise for 8 days………….29

Figure 3.3. Representative images and quantification of the Oil Red O stained area in

mouse liver……………………………………………………………….30

Figure 3.4. Relative mRNA transcripts for lipogenesis and protein expression for FA

synthase (FAS) in the liver of mice administered a chow or HCD with or

without 13.5%LE and/or voluntary exercise for 8 days………………….34

Figure 3.5. The concentrations of saturated FA, monounsaturated FA, polyunsaturated

FA, cholesterol, and lipogenic, SCD1 activity indices and n-6:n-3 ratio in

the liver of mice fed chow or HCD with either 0.5% or 13.5% LE………40

Figure 4.1. Body weight and energy intake (Kcal/day) in C57BL/6J mice given a high

carbohydrate diets with or without 13.5%LE for 5 weeks………………..57

Figure 4.2. Relative liver weight and hepatic TG in C57BL/6J mice fed a high

carbohydrate diets with or without 13.5%LE for 5 weeks………………..60

Figure 4.3. OPLS-DA score plots and loading plots derived from NMR spectra of the

liver obtained from mice in the HCD groups in this study………………..61

Figure 4.4. Total fatty acids, lipogenic, and SCD1 activity indices in the liver of mice

fed HCD or HCD+LE for 5 weeks……………………………………….65

x Figure 4.5. Relative mRNA transcripts involved in lipogenesis and lipid metabolism in

the liver of C57BL/6J mice fed a HCD without or with 13.5%LE……….69

Figure. 4.6. Score plot and OPLS-DA regression coefficient plot derived from NMR

spectra of the plasma obtained from a lean NAFLD mice fed a HCD without

or with 13.5%LE…………………………………………………………73

Figure 5.1. Body weight in C57BL/6J mice given a HCD, HCDF, HCDO, or HCDS for

5 weeks…………………………………………………………………...91

Figure 5.2. Relative liver weight and hepatic TG in C57BL/6J mice given a HCD,

HCDF, HCDO, or HCDS for 5 weeks……………………………………93

Figure 5.3. Representative photomicrographs of liver sections………………………94

Figure 5.4. Relative mRNA transcripts involved in lipogenesis and lipid metabolism in

the liver of C57BL/6J mice fed a HCD, HCDF, HCDO, or HCDS for 5

weeks……………………………………………………………………..97

Figure 5.5. Total fatty acids, lipogenic, and SCD1 activity indices in the liver of mice

fed HCD or HCD+LE for 5 weeks………………………………………101

Figure 5.6. OPLS-DA score plots and loading plots derived from NMR spectra of the

liver obtained from mice in the HCD groups in this study………………104

Figure 5.7. Relative adipose tissue weight and the transcripts involved in lipogenesis

and lipid metabolism in the adipose tissue of C57BL/6J mice fed chow or a

HCD, HCDF, HCDO, or HCDS for 5 weeks……………………………108

Figure 5.8. Plasma glucose, plasma insulin level, alanine aminotransferase activity, and

plasma FGF21 protein in mice fed chow or a HCD, HCDF, HCDO, or

HCDS for 5 weeks………………………………………………………111

xi Figure 5.9. An overview of genes involved in the insulin signaling pathway……….116

Figure 5.10. Differential expression analysis in the liver of C57BL/6J mice fed a HCD,

or a HCDF for 5 weeks...... 118

Figure 6.1. Summary of the significant changes in the mouse fed a HCD for 5 weeks

…………………………………………………………………………..136

Figure 6.3. Summary of the significant changes in the mouse fed a HCDF…………141

xii LIST OF TABLES

Table 3.1. Macronutrient composition used in this study……………………………21

Table 3.2. Correlation matrix of TG, Cly, Acc1, Fasn, Scd1, and Pnpla3 gene transcript

levels in liver of chow, HCD, and HCD+13.5%LE-fed mice

combined…………………………………………………………………36

Table 4.1. Macronutrient composition used in this study……………………………51

Table 4.2. Correlation matrix of TG, Cly, Acc1, Fasn, Scd1, and Pnpla3 in liver of

HCD, and HCD+LE mice………………………………………………...70

Table 5.1. Macronutrient composition used in this study……………………………83

Table 5.2. Lipid composition of three lipid emulsions used in the present study……84

Table 5.3. Relative abundance for the hepatic metabolites analyzed by NMR analysis

…………………………………………………………………………..106

Table 5.4. The related biological processes of the genes altered by HCD and HCDF

…………………………………………………………………………..114

Table 5.5. The gene expression involved in acute inflammatory response in HCD- and

HCDF-fed mice…………………………………………………………115

Table 6.1. Comparisons of lipid emulsion dose…………………………………….131

xiii LIST OF ABBREVIATIONS

ABCB11: ATP-binding cassette, sub-family B member 11

ACAD1: Acyl-Coenzyme A dehydrogenase, medium-chain

ACC1: Acetyl-CoA carboxylase-1

ACOX1: Peroxisomal acyl-coenzyme A oxidase 1

ACTB: Beta-actin

ALT: Alanine aminotransferase

AMP: Adenosine 5’-monophosphate

APCS: Serum amyloid P-component

AT: Adipose tissue

ATGL: Adipose triglyceride lipase

ATP: Adenosine triphosphate

CCL2: Chemokine (C-C motif) ligand 2

CD36: Cluster of differentiation 36; Fatty acid translocase

CEPT: Cholesteryl ester transfer protein

ChREBP: Carbohydrate-responsive element-binding protein

CLY: ATP-citrate lyase

CPT-1α: Carnitine palmitoyltransferase I

CYP7A1: Cytochrome P450 7A1

CYP8B1: Cytochrome P450 8B1

DGAT2: Diacylglycerol O-Acyltransferase 2

DHA: Docosahexaenoic acid

EFA: Essential fatty acid

xiv ELVOL2: Elongation of very long chain fatty acids protein 2

ELVOL5: Elongation of very long chain fatty acids protein 5

ELVOL6: Elongation of very long chain fatty acids protein 6

EN%: Percent of total energy

EPA: Eicosapentaenoic acid

ER: Endoplasmic reticulum eWAT: Epididymal adipose tissue

FASN: Fatty acid synthesis

FAS: Fatty acid synthase

FDA: Food and Drug Administration

FGF-21: Fibroblast growth factor-21

FXR: Farnesoid X receptor

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase

GC-MS: Gas Chromatography-mass spectrometry

GPC: Glycerophosphocholine

GSSG: Oxidized glutathione

HCD: High carbohydrate diet

HCDF: High carbohydrate diet with 13.5% Omegaven®

HCDO: High carbohydrate diet with 13.5% ClinOleic®

HCDS: High carbohydrate diet with 13.5% Intralipid®

HDL: High-density lipoprotein

H&E STAIN: Hematoxylin and eosin stain

HSL: Hormone-sensitive lipase

xv IDL: Intermediate-density lipoprotein

LDL: Low-density lipoprotein

LEs: Lipid emulsions

MUFA: Monounsaturated fatty acid

NAFLD: Non-alcoholic fatty liver disease

NAG: N-acetyl glycoprotein

NASH: Non-alcoholic steatohepatitis

NHANES III: National Health and Nutrition Examination Survey III

NMR: Nuclear magnetic resonance

NOESYPR1D: NOESY (Nuclear Overhauser effect spectroscopy) pulse sequence

OAA: Oxaloacetate

OPLS-DA: Orthogonal projection to the latent structure with discriminant analysis

PC: Phosphorylcholine

PGC-1α: Peroxisome proliferator-activated receptor gamma coactivator 1-alpha

PN: Parenteral nutrition

PNPLA3: Patatin-like phospholipase domain-containing protein-3

PPAR-α: Peroxisome proliferator-activated receptor alpha

PPAR-γ: Peroxisome proliferator-activated receptor gamma

PUFA: Polyunsaturated fatty acid

SAA: Serum amyloid A

SCD1: Stearoyl-CoA desaturase-1 sdLDL: Small dense low-density lipoprotein

SFA: Saturated fatty acid

xvi SREBPF-1: Sterol regulatory element binding transcription factor-1

TG: Triacylglycerol

TLR5: Toll-like receptor-5

TMAO: Trimethylamine N-oxide

T/T RATIO: Triene to tetraene ratio

UCP-1: Uncoupling protein-1

UFA: Unsaturated fatty acid

VLDL: Very low-density lipoprotein

VLDLR: very low density lipoprotein receptor

VNN1: Vanin 1

xvii ACKNOWLEDGMENT

First of all, I would like to thank my mentor, Dr. A. Catharine Ross, for all of her support and guidance throughout my graduate education. I couldn’t have done it without her help. Dr. Ross is such a great academic role model to me as she is always passionate about learning and sharing knowledge. Most importantly, she is still doing experiments, which makes me feel she is a true scientist. It has been a pleasure working with her, and I really appreciate everything she has done for me.

I would like to thank my dissertation committee members, Drs. Michael H. Green,

Connie J. Rogers, and Andrew D. Patterson, for their invaluable insights and advice on my dissertation. Your support really means a lot to me.

I would like to thank my colleagues in Ross’ lab, Drs. Reza Zolfaghari, Qiuyan Chen,

Nan-Qian Li, Floyd Mattie, Libo Tan, Sarah Owusu and Lei Hao, for their training and help on my laboratory techniques and advice on my research, and to all other labmates for their support, care, and friendship. I’d also like to extend my appreciations to everyone, especially in Nutrition department, who has helped me throughout my journey at Penn

State.

Lastly and most importantly, I would like to express my heart-felt gratitude to my wife,

Yi-Ting, whose love, friendship, and support have helped me reach my goals. She is my rock, my foundation, and her support and encouragement made all my accomplishments possible. To my family, without your love and support, I could not have done this. Thank you all.

xviii CHAPTER 1

REVIEW OF THE LITERATURE

1.1 Non-alcoholic fatty acid disease (NAFLD)

NAFLD is the most common form of chronic liver disease that affects at least one- third of populations in the western countries (1-4). NAFLD is an umbrella term that encompasses hepatic steatosis, steatohepatitis, fibrosis, and cirrhosis (5, 6), and is defined as the accumulation of TG greater than 5% of liver weight, and is positively correlated with several metabolic disorders such as insulin resistance, obesity (7), hypertension, hyperlipidemia (8), and diabetes mellitus (9). On the other hand, non-alcoholic steatohepatitis (NASH) is defined as a combination of steatosis and inflammation with or without liver fibrosis (5, 10). A study (10) also indicated that NASH may also include these characteristics in the histological examination, e.g., perisinusoidal-pericellular fibrosis, mallory hyaline, mega-mitochondria, and glycogenated nuclei.

1.1.1 NAFLD Epidemiology

Over the past two decades, chronic liver disease and cirrhosis have been ranked the

12th leading cause of death in the United States (11). NAFLD has been shown to be the major cause of liver-related mortality (12) and is also associated with several metabolic disorders (7, 9). According to the third National Health and Nutrition Examination survey

(NHANES III) (12), the prevalence of hepatic steatosis and NAFLD were 21.4% and 19%, respectively. However, Williams et al. (13) stated further that the prevalence of NAFLD proposed by previous studies might be underestimated based on the prospective study investigating a middle-aged population. Williams et al. (13) reported the prevalence of

1 NAFLD was 46%, and this statistic indicates that at least 105 million Americans are affected by NAFLD. In addition, studies showed that NAFLD not only affects adults in the

U.S., but also becomes a health problem in the U.S. adolescents. Welsh et al. (14) indicated that the prevalence of NAFLD among the U.S. adolescents rose from 3.9% in 1988-1994 to 10.7% in 2007-2010, which suggests that NAFLD has become a severe public health problem. It is not surprising that obese animal models are widely used to explore the pathogenesis of NAFLD. However, only a few studies have focused on the lean NAFLD, an understudied but a clinically relevant condition. There is growing evidence that overweight, obesity and insulin resistance are independent factors for NAFLD (15, 16) and that cardiovascular disease and diabetes mellitus are highly associated with NAFLD even in the absence of obesity (17, 18). Additionally, the National Health and Nutrition

Examination Survey (NHANES III) indicated that 7.4% of lean adults have hepatic steatosis (12), and 25% of NAFLD patients were not physically but yet metabolically obese

(16). Thus, understanding the etiology of lean NAFLD becomes an urgent need, and strategies for the reversal of this condition would confer an important public health benefit.

1.1.2 Diagnosis of NAFLD

To date, there is no test that provides a reliable and an noninvasive way to diagnose hepatic steatosis and NAFLD, and liver biopsy has been utilized as a gold standard of diagnosing liver histology in patients with NAFLD (19). The accuracy and variability of liver biopsy largely depend on the clinical professionals in the processes of sampling, scoring, and interpretation of the scores (10, 20). Therefore, noninvasive tools are often used to accurately detect hepatic steatosis and NAFLD, and to correctly stage NAFLD. To

2 increase its accuracy, some techniques including serum alanine aminotransferase (ALT) and imaging techniques are utilized with liver biopsy.

Serum ALT is a common biochemical marker for diagnosis of liver damage, and it is widely utilized in clinical and large-scale epidemiological studies for screening NAFLD.

However, its sensitivity to NAFLD is relative low, and in some case, patients who have

NAFLD or fibrosis may present normal levels of ALT (< 40 IU/L) in the serum (21).

Additionally, Burgert et al. (22) report that 72 obese children presented with hepatic steatosis, which is detected by magnetic resonance imaging, but only 50% of them had serum ALT that exceeds the normal range (35 IU/L in this study), suggesting that the normal range of serum ALT might be too high to accurately detect liver damage and that serum ALT can only serve as a reference for the diagnosis of NAFLD.

Another alternative technique to detect NAFLD is ultrasonography. In clinical practice, ultrasonography and serum ALT are usually combined for the diagnosis of hepatic steatosis.

It provides a non-invasive and inexpensive method to increase the accuracy of diagnosis of NAFLD (23, 24). Bohte et al. (25) indicate that ultrasound provided an accuracy rate from 85.7%-91.1% when used to detect moderate or/and severe hepatic steatosis; whereas the accuracy rates are down to 72% in detecting mild steatosis, compared with the results from liver biopsy, suggesting a combination of biochemical analysis and ultrasound is required in the diagnosis of steatosis. Although magnetic resonance imaging is another noninvasive method that can detect mild hepatic steatosis with a high accuracy rate (>95%), the method is not cost-effective method to be utilized in large-scale epidemiological studies.

3 1.1.3 The pathogenesis of NAFLD

It is thought that NAFLD is likely multifactorial that includes increased visceral adiposity, intestine microbiota, genetic variants and diet (26), and all of which can contribute to the progression of NAFLD (Fig. 1.1). Although the pathogenesis of NAFLD and liver injury is not well-understood, it is believed that NAFLD involves multiple pathological processes that start from TG accumulation to steatohepatitis, fibrosis, and eventually liver failure (27). Day and James proposed a two-hit model (Fig. 1.2) to elucidate the development of NAFLD (28). The first hit of NAFLD is hepatic steatosis where de novo lipogenesis, dietary intake and free fatty acid (FFA) influx from adipose tissue increase the level of FFA in the hepatocyte. Most of FFA in the hepatocyte is esterified with glycerol to reform TG, which consequently causes TG accumulation in cytosolic lipid droplets in the hepatocytes, and less of them undergo β-oxidation. Studies have showed that the raised level of FFA is sufficient to increase lipotoxicity and oxidative stress leading to liver damage (29, 30), which may force the progression of NAFLD to the second hit and may mediate the activation of Iκκ-β/ nuclear factor-kappa B (NF-κB) signaling pathway.

The second hit of NAFLD involves chronic inflammation and fibrosis. Accumulation of FFA and TG increases oxidative stress and endoplasmic reticulum (ER) stress in the hepatocyte resulting in an imbalance in the production of reactive oxygen species (ROS) and antioxidants (31), which induces lipid peroxidation, production of pro-inflammatory mediators, and hepatocellular apoptosis. Moreover, in the presence of hepatic steatosis, the Iκκ-β/NF-κB signaling pathway is activated and subsequently up-regulates the levels of pro-inflammatory cytokines, produced by hepatocytes, including tumor necrosis factor-

4 alpha (TNF-α), transforming growth factor-beta (TGF-β), and interleukin-6 (IL-6). Based on the fact that these cytokines can replicate all the features associated with NASH (29), it is believed that hepatocyte cytokine production plays a key role in the progression of hepatic steatosis to NASH and that increased ROS and lipid peroxidation can eventually lead to fibrosis by stimulating hepatic stellate cells to synthesize collagen and to cause irreversible consequence (32).

In addition to several metabolic disorders previously described to be associated with the development of NAFLD, NAFLD was also found in patients who received total parenteral nutrition (TPN) (33, 34). Parenteral nutrition formula (PN) contains dextrose, amino acids, and added vitamins and minerals, and it is also a life-saving option for patients who are unable to consume food orally. However, in the case of long-term TPN, PN is considered as a life-threatening concern, because PN formula can cause metabolic disorders, such as hepatic steatosis, production of oxidative stress and liver injury (35). All of these could lead to an imbalance in the rates of uptake, synthesis, and export of FFA and

TG, which subsequently causes steatosis and eventually develops NASH and fibrosis.

5

Figure 1.1. Multifactorial involved in the progression of NAFLD (26).

6

Figure 1.2. A two-hit hypothesis (36). ER: endoplasmic reticulum; FFA: free fatty acid;

IL-6: interleukin-6; NF-κB: nuclear factor-kappa B; TAG: triacylglycerol; TNF-α: tumor necrosis factor-alpha.

7 1.1.4 The treatment of NALFD

Although there is no specific guideline recommendations for NAFLD treatment, persons with NAFLD are usually treated in a way that is the same as the recommendation for obesity, hyperlipidemia, insulin resistance, and type 2 diabetes (19). To date, there are three therapeutic options for treating NAFLD: lifestyle modification, pharmacological treatments, and surgical interventions. Nevertheless, there are no medications that have been approved by the U.S. Food and Drug Administration (FDA) for the treatment of

NAFLD and surgical interventions are considered only when lifestyle modification does not help patients manage body weight, in this section, we focus on the primary strategy- lifestyle modification.

Lifestyle modification including diet and physical activity has been recommended for the treatment of NAFLD, and it does provide cardiometabolic benefits without any side effects (19, 37). The major recommendation for people with NAFLD is weight management. Some studies (19, 38) suggest that weight loss of 3-5% of total body weight can ameliorate hepatic steatosis; others (37, 39, 40) indicate that losing 7-10% of body weight can help normalize an increase in the serum ALT and liver histology with NAFLD characteristics in both adults and adolescents. However, the dropout rate of lifestyle modification, especially for weight loss which is largely depending on the intensity of exercise and dietary intervention, is usually a concern when a group of researchers recruits subjects to participate a large-scale study (39, 41, 42).

It is well known that both physical activity and dietary intervention play a crucial role in maintaining an ideal body weight. Previous studies (43, 44) determined the effect of

8 physical activity on the hepatic de novo lipogenesis in patients with insulin resistance in skeletal muscle, and the results show that moderate physical activity reversed insulin resistance-induced hepatic steatosis by redirecting carbohydrate metabolic pathways, as well as regulating energy storage pattern, which may contribute to hepatic de novo lipogenesis. Additionally, Eckard et al. (37) further indicate that weight loss might not be the key in the recommendation of treating NAFLD; rather a lifestyle intervention including low fat (20% fat) or moderate fat (30% fat) diet with moderate exercise for six months has indicated a great improvement in both serum ALT, AST, and liver histology in patients with NAFLD.

1.2 Lipid metabolism

1.2.1 Digestion and absorption of lipid

TG is the major form of lipid in the diet, and there is a small portion of phospholipids as well. In order to be absorbed, these molecules need to be hydrolyzed and emulsified by lipases and bile acids, respectively, to form micelles for absorption. The first two lipases are lingual and gastric lipases, which hydrolyze the sn-3 ester bond to form FFA and 1,2- diacylglycerols. Once fatty acids and lipids arrive small intestine, cholecystokinin (CCK) is then released to stimulate the pancreas to secrete pancreatic enzymes, e.g., pancreatic lipase. Pancreatic lipase that is activated by colipase attacks the sn-1 and sn-3 ester bonds to form FFA and 2-monoacylglycerol, as the major end products of luminal TG digestion.

Only a small portion (< 25%) of 2-monoacylglycerol is hydrolyzed by pancreatic esterase to form glycerol for absorption. Other 2-monoacylglycerols are then emulsified by bile

9 acids to form micelles and to be transported through the aqueous environment in the small intestine lumen and then be absorbed by epithelial cells.

Within the epithelial cells, there are two pathways to reform TG. The first pathway is monoacylglycerol pathway, in which FFAs are attached to the 2-monoacylglycerols to reform TG. The second way is called phosphatidic pathway. 1-monoacylglycerols are hydrolyzed by intestinal lipase to form FFA and glycerol, and these products provide essential substrates for TG synthesis in the epithelial cells. These TG are then packed into chylomicrons, called nascent chylomicrons, for secretion via lymphatic system into body.

1.2.2 Lipid transport

Once nascent chylomicrons enter circulation, they need to acquire apolipoprotein C

(Apo C) and Apo E from high-density lipoprotein (HDL) to become chylomicrons, which are then hydrolyzed by lipoprotein lipase (LPL) on the capillary endothelium of many cell types and are catabolized rapidly within an hour by lung, heart, adipose tissues, and muscles. After sufficient delipidation, chylomicron remnants are formed, and Apo C is given back to the HDL before chylomicron remnants are transported back to the liver. It is well-known that liver is the primary organ that uptakes chylomicron remnants via low- density lipoprotein (LDL) receptor and LDL receptor-related protein.

Very low-density lipoprotein (VLDL) is responsible for the endogenous TG secretion, and is thought to play a key role in hepatic steatosis (45). In a normal physiological condition, VLDL synthesis is regulated by many factors including Apo B100, phosphatidylcholine, cholesteryl ester, FA, and TG itself (46). Once being secreted to circulation, VLDL acquires Apo C and Apo E form the HDL and is catabolized by a series

10 of lipolysis and ultimately becomes LDL, which is eventually taken up by the liver via

LDL receptor and LDL receptor-related protein.

1.2.2.1 Transport of lipid emulsion

In some experimental studies using lipid emulsions (LEs) as dietary lipids, the metabolism of artificial chylomicrons is believed as the same as dietary lipids, as described in the previous section. LEs have been widely used in PN to provide energy dense-source of calories and essential fatty acid (EFA), which has been shown to induce EFA-induced hepatic steatosis if deficient (47, 48). LEs include artificial chylomicrons and liposomes, in which artificial chylomicrons contain phospholipids at the surface forming monolayer particles and TG at the core forming a hydrophobic phase, and the diameter of each particle is 200-500 nm. Compared to the size of the artificial chylomicron, the diameter of each liposome, a bilayer particle, is relatively small ranging from 60-80 nm, which also serves as an excess emulsifier containing phospholipids as an aqueous phase and glycerol at the core as a continuous phase.

Once LEs are infused into circulation intravenously, these particles will experience several processes simultaneously: exchange and transfer of lipids, proteins, enzymatic hydrolysis of TG and phospholipids, uptake of hydrolysis products, internalization of certain particles by different tissues (49). First, the artificial chylomicrons obtain Apo C and Apo E from HDL and very low-density lipoprotein (VLDL) to become analogous to endogenous chylomicrons and VLDL (49, 50). These artificial chylomicrons with required apolipoprotein then bind to LPL located at the surface of vascular endothelium of extrahepatic tissues in order for releasing FA into tissues. At this time, the size of the

11 artificial chylomicron becomes smaller, and it has to readjust its external membrane by transferring phospholipids to HDL. This process leads to the formation of chylomicron remnant, which will give the Apo C back to the HDL, and chylomicron remnant will be transported back to the liver for oxidation (49).

1.2.3 NAFLD and lipid metabolism

In the presence of mild steatosis or metabolic syndrome, VLDL synthesis and secretion may be increased in response to an elevation of hepatic TG (51, 52), indicating that the levels of VLDL and LDL in plasma may be concomitantly increased. As VLDL secretion increased, small-dense LDL, the most atherogenic subclass of LDL, develops after TG is transferred from VLDL, in which process there are two enzymes implicated in this process. First, cholesteryl ester transfer protein (CETP) simultaneously facilitates the transfer process of TG from VLDL to LDL and cholesteryl esters from LDL to VLDL (53).

Secondly, hepatic lipase hydrolyzes intermediate-density lipoprotein (IDL) leading to the formation of small-density LDL (54). This process allows CETP remodeling VLDL in circulation, enriching it in cholesterol, and also facilitating the formation of small-dense

LDL. Previous studies indicated that LDL receptor has lower affinity to small-dense LDL

(55) and that CETP activity is increased in hepatic steatosis patients (56), indicating that endogenous lipoprotein metabolism may be impaired in patients with hepatic steatosis due to a longer halftime of clearance of LDL in circulation.

In contrast, Fujita et al. (57) indicated that although the hepatic lipid profiles between patients with hepatic steatosis and with NASH were similar, and VLDL synthesis and secretion were reduced, suggesting that the TG secretion is impaired which elevates the

12 extent of hepatic TG accumulation and makes hepatic steatosis in patients with NASH even worse. The mechanism by which hepatic lipid accumulation in patients with NAFLD still remains unclear. It seems that impaired VLDL synthesis might be a key for the development of NAFLD (57), but some studies indicated that elevated lipolysis in adipose tissue and hepatic de novo lipogenesis are the major contributors resulting in the TG synthesis in the liver (5, 6, 58).

1.3 NAFLD and lipid supplementation

1.3.1 NAFLD and n-6 fatty acids

In clinical studies, the liver injury associated with TPN is most likely found in premature infants (34), patients with home TPN, and patients who receive TPN in intensive care units (59). Moss et al. (60, 61) indicated that parenteral nutrition (PN) formula might play a key role in the development of liver injury due to nutrient deficiencies and toxicities caused by PN. Previous studies (62, 63) indicated that n-6 FAs based LE, Intralpid®, can mediate the rate of high glucose infusion and may prevent hyperglycemia and hepatic steatosis; however, recently studies have indicated a critical concern that Intralpid® may influence immune functions and provide substrate for the synthesis of n-6 PUFA-derived pro-inflammatory eicosanoids, which may affect the progression of hepatic steatosis,

NAFLD and the patient’s prognosis (64, 65). In animal studies, n-6 FAs provide some beneficial effect on the hepatic steatosis. Ito et al. reported that hepatic steatosis and the hepatic inflammatory genes were greatly improve by including 13.5% Intralpid® to a HCD

(66). On the other hand, Hao et al. further indicated that hepatic steatosis is dose- dependently improved by including 4% and 13.5% Intralpid®, suggesting that containing

13 certain amount of n-6 FAs is necessary to maintain hepatic TG metabolism. Additionally, patatin-like phospholipase domain-containing protein 3 (PNPLA3) has been shown to play a crucial role in the development of hepatic steatosis (67). Hao et al. indicated that lipogenic diet is capable to induce hepatic steatosis, as well as the mRNA for Pnpla3, and all of which were ameliorated by introduction of 13.5% Intralpid®, which may provide a clue of how n-6 FAs improve hepatic steatosis.

1.3.2 NAFLD and n-3 fatty acids

Since the major cause of NAFLD is overweight and obesity, it is not surprising that the majority of experimental studies have utilized obese-associated animal model to examine the effect of dietary supplementation. Previous studies indicated that n-3 PUFAs low in the diet may promote steatosis and insulin resistance in rodents (68, 69). In a recent systematic review (70), the hepatic n-3 FAs was significantly decreased, and n-3 supplementation may be recommended to patients with NAFLD since many studies have shown beneficial effects on lipid metabolism and insulin resistance (71, 72). Pachikian et al. (73) showed n-3 FAs depletion increased expression of all enzymes involved in lipogenesis and the activation of SREBP-1. On the contrary, n-3 FAs supplementation prevented or reversed the development of hepatic steatosis in mice, suggesting that n6:n3 ratio plays a crucial in the development of hepatic steatosis (74). Recently, it has been reported that rats fed with a high fat diet combined with n-3 PUFAs supplementation were protected against severe NAFLD development. In fact, significantly increased lipid peroxidation was seen in the group fed with the same diet without n-3 PUFAs supplementation (75). Additionally, n-3 PUFA administration was also found to reverse

14 already established hepatic steatosis in leptin deficient obese mice (76). Moreover, n-3

PUFA supplementation improves hepatic steatosis in obese mice by modifying the genes involved in de novo lipogenesis and lipid transport (77). It is well known that n-3 FAs are the natural ligands of PPAR-α, a crucial regulator of lipid metabolism in hepatocytes (78), and in vivo studies indicated that n-3 FAs may regulate fatty acid binding and export in

VLDL through PPAR-α-dependent mechanism (78,79). In PPAR-α knockout animals, hepatic steatosis was significantly induced after a fasting period, and the mitochondrial β- oxidation in the liver during fasting was also impaired, suggesting that PPAR-α may play a critical role in the development of hepatic steatosis (79).

15 CHAPTER 2

HYPOTHESES AND OBJECTIVES

NAFLD is the most common liver disease, and its prevalence is increasing rapidly worldwide (2, 80). Although NAFLD is positively associated with obesity (80), the

National Health and Nutrition Examination Survey (NHANES) III indicated that 7.4% of lean adults have hepatic steatosis, which were more likely to be younger and female (12,

15). Unlike overweight-obese related NAFLD, in which insulin resistance is a major characteristic, people with lean NAFLD have a different clinical profile (15), and lean

NAFLD was independently associated with insulin resistance (15). Additionally, the extent of hepatic lipid was quantitatively associated with cardiovascular disease (17) and diabetes mellitus (18, 81), indicating that the pathogenesis of lean NAFLD may differ from overweight-obese NAFLD. Thus, understanding the development of hepatic steatosis becomes an urgent need.

To date, many studies have utilized obese model to study diet-induced NAFLD, whereas very few studies have focused on a lean mouse model and on reversal of steatosis in a lean mouse model. As mentioned previously that life style intervention plays an important in improving hepatic steatosis, accumulating evidence suggests that n-3 FAs- based lipid emulsion or fish oil improve steatosis (82-85) and that dietary MUFA supplementation decreases the level of TG in liver and in plasma (86, 87). However, evidence is lacking on the reversal effect of n-3 or n-9 FAs, and there are no systematic investigations for reversal of steatosis. Therefore, this thesis tried to fill this research gap and would focus on exploring the development of steatosis and understanding how to reverse it using dietary lipids supplementation in a lean NAFLD mouse model.

16 2.1 Hypotheses

We hypothesized 1) that HCD is capable to induce hepatic steatosis in a short period of time (8d), which can be prevented by life style intervention including Intralipid® supplementation and/or exercise intervention; 2) that 13.5% Intralipid® added to HCD after the onset of hepatic steatosis can ameliorate the extent of steatosis by regulating de novo lipogenesis and the metabolites associated with glucose and lipid metabolism; 3) that

Omegaven® or ClinOleic® intervention can reverse hepatic lipid accumulation after the onset of steatosis. To test these hypotheses, we propose the following specific aims:

2.2 Specific aims

2.2.1 Specific aim to the hypothesis 1- life style intervention on the early dynamic change of fatty acid in an 8d study

The aim of the 8d study was designed to estimate the early dynamic change of fatty acid in the presence of a HCD and a HCD with 13.5% Intralipid®. We investigated the effects of Intralipid® and exercise (Ex, voluntary running) on the TG accumulation and the gene expression associated with de novo lipogenesis in the early stage of HCD-induced non-obese NAFLD model.

2.2.2 Specific aim to hypothesis 2- the reversal effect of Intralipid® on preexisting steatosis

The aim of the Intralipid® reversal study was to determine whether 13.5% Intralipid® can cease the progression of hepatic steatosis once TG accumulation has begun. We have

17 used a combined targeted biochemical and untargeted metabolomics approach to examine the effects of Intralipid® supplementation on the genes and metabolites associated with lipid and glucose metabolism in a non-obese mouse model.

2.2.3 Specific aim to the hypothesis 3- comparison of three lipid emulsions on reversal of HCD-induced steatosis

The aim of this study was to compare Intralipid®, Omegaven®, and ClinOleic® on their ability to reverse preexisting steatosis in a lean NAFLD mouse. We have used a combination of biological, metabolomic, and transcriptomic platforms to explore the possible mechanism of how these LEs mitigate or even reverse the TG accumulation and inflammation after the onset of steatosis.

18 CHAPTER 3

Lipid Emulsion and Voluntary Exercise Reduce Lipogenesis and Ameliorate Early-

Stage Hepatic Steatosis in High Carbohydrate Diet-Fed Mice

3.1 Materials and Methods

3.1.1 Animal protocol Animal protocols were approved by the Institutional Animal Use and Care Committee of Pennsylvania State University (IACUC # 40881). All mice were housed in plastic cages in an animal room maintained at 22±2°C with 50-70% humidity and a 12-h light-dark cycle.

3.1.2 Diets and Study Design The chow (standard feed pellet; Rodent diet 5001, Lab Diet), liquid high carbohydrate diet (HCD) and HCD with LE (Intralipid® 20%; Baxter Healthcare, Deerfield, IL) were used in the present study. One week after arrival, male C57BL/6 mice, aged 6-wk old

(Taconic, n=8-13/group), were randomized into 5 groups and were fed the following diets for 8 days. Mice were fed chow and given unrestricted access to food and water serving as a reference group, and the rest of groups were provided HCD (with 0.5% of total energy as

LE to provide EFA) (Table 3.1), HCD+13.5%LE, HCD with voluntary running

(HCD+Exe), or HCD+13.5%LE+Exe, respectively. In the experimental period, the HCD

(Clinimix E®; Baxter Healthcare, Deerfield, IL) was the only source of nutrition and

19 hydration for all the HCD groups, in which contained 77% of total energy as carbohydrate in the form of dextrose, 22.5% protein, and electrolytes, supplemented with multiple vitamins (Pediatric Influvite®; Baxter Healthcare, Deerfield, IL), minerals and trace elements (Table S1 in the Appendix). The liquid HCD was freshly prepared and replaced daily to avoid contamination. After 8 days, mice were euthanized by carbon dioxide, and plasma, and liver were excised immediately and were snap-frozen in liquid nitrogen and then stored at -80 °C for further analysis. The food intake, body, and liver weights were also recorded.

20 Table 3.1. Macronutrient composition used in this study

Chow HCD HCD+13.5%LE

Macronutrient, en-%

Carbohydrate 58.0 77.0 67.0

Protein 28.5 22.5 19.5

Fat 13.5 0.5 13.5

Source of carbohydrate Mixed Dextrose Dextrose

Source of fat Mixed Intralipid® Intralipid®

Values are shown as calorie percentage. HCD, high carbohydrate diet; LE, lipid

emulsion.

21 3.1.3 Hepatic TG quantification

Liver total lipid was extracted from 50-100 mg of fresh liver overnight using Folch method (88). After solvent evaporation, the total lipid extract was applied to a column of

5% water-deactivated aluminum, and the TG fraction was eluted with 25% diethyl ether in hexane. The TG content in aliquots of the eluted fraction was then assayed by spectrometer at 415 nm (66).

3.1.4 RNA isolation and quantitative gene expression analysis

Total RNA from liver tissues (100 mg/mouse) was extracted with Trizol reagent (Life

Technologies, Carlsbad, CA) and quantified using a NanoDrop ND-1000 (Thermo

Scientific, Waltham, MA). cDNA was synthesized using Moloney murine leukemia virus

(M-MLV) reverse transcriptase protocol (Promega, Madison, WI), as described previously

(89). qRT-PCR was performed using 2x iQTM SYBR® Green Supermix PCR Master Mix

(Bio-Rad, Hercules, CA) with 400 ng of mouse primers (Table S3 in the Appendix) for each reaction. The ratio of mRNA-to-glyceraldehyde 3-phosphate dehydrogenase (Gapdh) mRNA was calculated, with the average value of the HCD-2.5wk group set to 1.0 prior to conducting statistical analysis.

3.1.5 Oil red O staining

Oil red O staining was used to determine the distribution of lipid droplets in the liver and followed the protocol as described previously (90). Briefly, the frozen liver tissues embedded in Optimal Cutting Temperature (O.C.T.) compound were cut on a Leica

22 CM3050S research cryostat at 8-10 µm. These liver sections were air-dried for 15-20 min before processing for Oil Red O staining. An Oil Red O working solution was prepared by

4 ml of distilled water and 6 ml of a stock solution (Sigma, St. Louis, MO; O0625) consisting of 250 mg of Oil Red O dye, 30 mL of triethyl phosphate, and 20 mL distilled water. Slides were firstly fixed in 3.7% formaldehyde for 1 hour, and were then incubated with Oil Red O working solution at room temperature for 15-30 min. After incubation, the sections were washed by distilled-deionized water (ddH2O) and 60% isopropanol for 3 times, respectively, and were counterstained with hematoxylin (Sigma, St. Louis, MO;

MHS16) for another 10 min. To quantify the sectioning data, image J (National Institute of Health, NIH) was used to calculate the area stained in red.

3.1.6 Western blotting

Frozen liver tissues were homogenized in ice-cold radioimmunoprecipitation assay

(RIPA) buffer containing a protease inhibitor cocktail (Roche Diagnostics, Indianapolis,

IN), and after centrifugation the supernatant was collected and used for western blotting, as described previously (91). Protein concentration (40 µg proteins) were loaded and separated by electrophoresis on a 10% SDS–PAGE gels and were then transferred to

Millipore Immobilon-FL membrane. The blots were blocked with Odyssey® blocking buffer (LI-COR Biosciences, Lincoln, NE) at room temperature for 1 h and then incubated with monoclonal anti-FA synthase (FAS) antibody (1:1000 dilution; Abcam, Cambridge,

MA; ab22759), monoclonal anti-β actin antibody (1:1500; Sigma, St. Louis, MO; A2228) overnight at 4°C. After washing 4 times for 7 min each in PBS-T (0.1%; v/v), the membranes were incubated with goat anti-rabbit immunoglobin G or rabbit anti-mouse IgG

23 (LI-COR Biosciences, Lincoln, NE) at 1:7000 dilutions at room temperature for 1 h. After washing, the protein bands were visualized (Odyssey® Classic Imaging System, LI-COR), and all blots were normalized with immunoblotted β-actin to adjust for protein loading.

3.1.7 FA profiling, n-6 to n-3 FA ratio, and lipogenic and SCD1 activity indices

The ratio of n-6 to n-3 FA was obtained from the ratio of the sum of linoleic acid

(C18:2n6) plus arachidonic acid (C20:4n6) divided by the sum of eicosapentaenoic acid

(C20:5n3) plus docosahexaenoic acid (C22:6n3) in the liver. Two indices, a SCD1 activity index and a lipogenic index, were estimated from the ratios of C18:1n9 to C18:0 and of

C16:0 to C18:2n6 FA, respectively (92, 93). FA composition was determined as the methyl esters of FA by gas chromatography-mass spectrometry (GC-MS), and the procedures of the sample preparation and analysis are described as follows: liver tissues (40-60 mg) were mixed with 1 mL of methanol-chloroform (2:1; v/v) containing 50 µmol/L of C15-acid and

C17-methyl ester as internal standards, and then samples were homogenized using a

Precellys homogenizer (Bertin Technologies, Rockville, MD). After homogenization and centrifugation at 20,000 g (4 °C) for 15 min, the supernatant was collected and mixed with

500 µL of saline (0.9%), and then vortexed for 5 min and centrifuged again (20,000 g, 4

°C) for 15 min. The bottom layer was transferred into a 10 mL scintillation vial and dried down under nitrogen gas. After 1 mL of methanol/hydrogen chloride (41.5 mL/9.7 mL) was added and the mixture was vortexed for 5 min, the solution was then incubated overnight at 60°C. The resultant mixture was combined with 5 mL of hexane and 5 mL of

0.9% saline. Following vortexing for 5 min, the top layer was collected and dried down under nitrogen gas. The resultant residues were redissolved in 400 µL of hexane and then

24 transferred to an autosampler vial for GC−MS analysis. The FA methyl ester composition was measured on an Agilent 7890A-5975C GC−MS system (Agilent Technologies, Santa

Clara, CA). A HP-5MS (Agilent Technologies, Santa Clara, CA) capillary column (30 m,

0.25 mm ID, 0.25 µm film thickness) was employed with helium as a carrier gas at flow rate of 1 mL/min. Sample injection volume was 0.5 µL with a pressure pulsed split (1:10 split, 10 psi). The injection port and detector temperatures were 230°C and 250°C, respectively. The initial column temperature was 80°C where it was held for 1 min and then increased to 205°C at a rate of 20°C/min, and then increased to 220°C at a rate of

2°C/min, and then increased to 310°C at a rate of 15°C/min, where it was held for 2 min.

The concentration of each FA was calculated from the integrated peak areas normalized with the internal standards.

3.1.8 Statistical analysis

Data are shown as mean ± SEM. Student’s t-test was used to compare the chow and

HCD alone groups in order to determine whether HCD has a rapid effect on the induction of hepatic steatosis within an 8-d period; the differences among the 4 groups fed an HCD- based diet without or with additional intervention were analyzed by one-way or two-way

ANOVA followed by Fisher’s exact test, as appropriate (Prism 6, GraphPad, La Jolla, CA).

For correlation analysis, Pearson’s correlation coefficient was calculated. For all tests, P <

0.05 was considered significant.

25 3.2 Results

3.2.1 Body weight, diet consumption status

Mice in each of the 4 groups fed an HCD-based diet tolerated the liquid diet well, with none developing loose stools or diarrhea. Although initial body weights did not differ, as expected due to randomization before treatment, the body weight after 8 d was slightly, but significantly, lower in the HCD group than in the chow group, which may reflect a period of adjustment to consuming a liquid diet (Fig. 3.1). The average daily diet intake of each mouse fed an HCD diet was 14 mL, with no significant difference among the 4 HCD-based groups.

Previous studies have shown that EFA deficiency can lead to hepatic steatosis (48, 94).

Holman (95) reported that the ratio of the triene (Mead acid, C20:3n9) to tetraene

(arachidonic acid, C20:4n6), is useful for identifying the risk of EFA deficiency, and a hepatic ratio greater than 0.4 is considered a biochemical indicator of EFA deficiency (47).

In the present study, we did not observe any clinical signs of EFA deficiency in these mice and the ratio of C20:3 to C20:4 in the liver was 0.26 in the mice in the HCD group; therefore,

EFA deficiency can be ruled out as a cause of hepatic steatosis in the 8-d feeding period used in our model (Fig. 4.4F).

26

Figure 3.1. Initial and final body weight in C57BL/6J mice fed chow or HCD with or without 13.5%LE and/or voluntary exercise for 8 d. Data are shown as mean ± SEM. n=8-

13/group. *, HCD differed from chow, P < 0.05 (t-test). Exe, voluntary exercise; HCD, high carbohydrate diet.

27 3.2.2 Liver weight, TG and histology

Relative liver weight did not differ between chow and HCD groups (Fig. 3.2A).

However, comparison of the 4 groups fed any of the HCD-based diets showed that mice treated with LE, with or without Exe, had slightly reduced liver weight relative to body weight after 8 d (Fig. 3.2A). Liver TG content was markedly higher after 8 d in the HCD group compared to the chow group (Fig. 3.2B). Among the 4 HCD-fed groups, treatment with LE significantly reduced liver TG concentration, regardless of Exe, while Exe alone did not have a significant effect, and the interaction of LE and Exe was also not significant.

We then determined the lipid content in the liver using oil red O staining (Fig. 3.3).

Macrovesicular lipid droplets stained with oil red O were visible in the livers of all mice fed an HCD-based diet (Fig. 3.3A-D), but not in the chow group (Fig. 3.3E), providing further evidence of the rapid change in liver hepatic steatosis in the first wk of HCD feeding.

Visually, lipid accumulation in both HCD (Fig. 3.3A) and HCD+13.5%LE (Fig. 3.3C) groups were all higher than that in the HCD+13.5%LE+Exe group, and the addition of Exe for the mice fed HCD diet (Fig. 3.3B) had no effect on lipid accumulation. Upon quantification of these images for the area-% containing oil red O staining as quantified by

Image J, treatment with LE, with and without Exe, resulted in a significantly lower lipid accumulation as compared with HCD and HCD+Exe (Fig. 3.3F). To assure that both oil red O staining and liver TG concentration were consistent, correlation analysis was performed. The two assays agreed well, R2 = 0.5602 and P<0.0001. Together, the results indicated that administration of LE to mice fed HCD can prevent hepatic lipid accumulation in the early stage of the progression of hepatic steatosis.

28

Figure 3.2. Relative liver weight (A), and hepatic TG (B) in C57BL/6J mice fed chow or

HCD with or without 13.5%LE and/or voluntary exercise for 8 d. Data are shown as mean

± SEM. n=8-13/group. *, HCD differed from chow, P < 0.05 (t-test). Different letters indicate statistical difference among the 4 groups that included HCD formula, P < 0.001.

Exe, voluntary exercise; HCD, high carbohydrate diet; Int: interaction between LE and Exe;

LE, lipid emulsion; TG: triacylglycerol.

29

30 Figure 3.3. Representative images (A-E) and quantification of the Oil Red O stained area

(F) in mouse liver. The image from chow serves as a reference group, and the images from other groups are selected as representative (n=8). Original magnification: 200X. Red: lipid; purple: nuclei. Correlation analysis was also shown in the panel F, and the different letters in the bar graph indicate statistical difference among groups, P < 0.001. *: different from

HCD, P < 0.001 (t-test). Exe: voluntary exercise; HCD: high carbohydrate diet; Int: interaction between LE and Exe; LE: lipid emulsion.

31 3.2.3 The transcript levels for de novo lipogenesis

To better understand whether LE and Exe can alter the expression of genes associated with DNL in the liver, a pathway contributing to lipid accumulation, we measured the transcript levels for the enzymes ATP-citrate lyase (Cly), acetyl-CoA carboxylase-1 (Acc1),

FA synthase (Fasn), and stearoyl-CoA desaturase-1 (Scd1), and the transcription factor sterol regulatory element-binding protein-1 (Srebpf1). The transcript levels for all of these lipogenic genes were elevated by 8 d of HCD (P<0.001; P<0.0001 for Scd-1) in the liver of our nonobese mice (Fig. 3.4A). Relative to HCD alone, provision of 13.5%LE, without and with Exe, reduced the transcript levels of Cly, Acc1, Fasn, and Scd1 (Fig. 3.4A), although not of Srebpf1. Interestingly, the transcript levels of Acc1 and Scd1 in the

HCD+13.5%LE+Exe group were significantly lower than those in the HCD+13.5%LE group, although the interaction was significant for only Scd1 (Fig. 3.4A).

We further explored the level of protein expression of FAS (Fig. 3.4B and Fig. 3.4C).

Consistent with the data for mRNA expression of the Fasn gene, FAS protein levels were lower for mice treated with LE, Exe, and LE+Exe.

The mRNA level for patatin-like phospholipase domain-containing protein 3

(Pnpla3), a regulator of DNL in the liver, was also lower in the liver of mice treated with

LE without and with Exe (Fig. 3.4D). Exe alone resulted in a more modest but still significant reduction in Pnpla-3 mRNA transcripts.

To further assess the relationship between lipid accumulation and the expression of

Acc1, Fasn, Scd1, and Pnpla3 in the liver, the Pearson Correlation Coefficient was calculated for hepatic TG level compared with lipogenic gene expression. Hepatic TG concentration was strongly associated with the mRNA levels for each of these genes: Acc1,

32 Fasn, Scd1, and Pnpla3 (Table 3.2). Interestingly, intergene correlation analysis between individual pairs of genes demonstrated that these transcript levels of lipogenic genes were all highly correlated, with the highest correlation between Acc1 and Scd1 (Table 3.2).

33

34 Figure 3.4. Relative mRNA transcripts for lipogenesis (A, D) and protein expression for

FA synthase (FAS) (B, C) in the liver of mice administered a chow or HCD with or without

13.5%LE and/or voluntary exercise for 8 d. Data are shown as mean ± SEM. n=8-13/group.

*, HCD differed from chow, P < 0.001 (t-test). Different letters indicate statistical difference among the 4 groups that included HCD formula, P < 0.001 (t-test). Exe: voluntary exercise; HCD: high carbohydrate diet; LE: lipid emulsion; MUFA: monounsaturated FA; PUFA: polyunsaturated FA; SFA: saturated FA.

35 Table 3.2. Correlation matrix of TG, Cly, Acc1, Fasn, Scd1, and Pnpla3 gene transcript levels in liver of chow, HCD, and HCD+13.5%LE-fed mice combined

Gene

Lipid or Gene Acc1 Fasn Scd1 Pnpla3

TG R2 = 0.3887 R2 = 0.1274 R2 = 0.1346 R2 = 0.414

P = 0.0005 P < 0.05 P < 0.05 P < 0.0001

Cly R2 = 0.1825 R2 = 0.5608 R2 = 0.5857 R2 = 0.1247

P = 0.0262 P < 0.0001 P < 0.0001 P = 0.0296

Acc1 R2 = 0.4747 R2 = 0.6354 R2 = 0.353

P < 0.0001 P < 0.0001 P = 0.0011

Fasn R2 = 0.5047 R2 = 0.158

P < 0.0001 P = 0.0135

Scd1 R2 = 0.2876

P = 0.0007

36 Data are shown as R2 and P values for the Pearson correlation coefficient from n=27-39 mice, combined from all diet groups. Acc1, acetyl-CoA carboxylase-1; Cly, ATP-citrate lyase; Fasn, FA synthase; HCD, high carbohydrate diet; LE, lipid emulsion; Scd1, stearoyl-

CoA desaturase-1; TG, triacylglycerol.

37 3.2.4 FA concentrations in liver of HCD-fed mice

Based on the observations shown in Fig. 1 and 2, LE intervention had the strongest effect on development of hepatic steatosis and, therefore, we focused on determining whether LE administration would alter the FA composition in the liver of HCD-fed mice.

We thus analyzed the total FA in the liver in the chow, HCD, and HCD+13.5%LE groups using quantitative GC-MS. The results for saturated FA indicated that the concentration of palmitic acid (C16:0) was significantly higher in the HCD group, as compared to the chow group, but not in the HCD+13.5%LE group (Fig. 3.5A) and that the concentration of stearic acid (C18:0) in the HCD was the lowest (Fig. 3.5A). Concomitantly with a higher expression in Scd1, capable of FA desaturation, the concentrations of monounsaturated FA

(MUFA), including C16:1,n7, C18:1,n9, and C18:1,n7 FA, were significantly higher in the

HCD group (Fig. 3.5B), as compared to the chow and HCD+13.5%LE groups. On the contrary, the concentrations of linoleic acid (C18:2,n6) and arachidonic acid (C20:4,n6) were higher in response to LE administration (Fig. 3.5C) but did not differ between chow and LE groups, suggesting that linoleic acid and arachidonic acid were mainly contributed by the diet, including the LE component, in this animal model. HCD and HCD+13.5%LE had lower concentration of docosahexaenoic acid (C22:6n3) (Fig. 3.5C), and LE administration maintained the level of cholesterol in the liver (Fig. 3.5D).

The formation of endogenous MUFA is catalyzed by hepatic SCD1, which is thought to be up-regulated through a SREBP-1c dependent mechanism in the presence of HCD

(96). The SCD1 activity index, which is the ratio of C18:1,n9/C18:0 and which represents the ratio of the product to precursor ratio of the SCD1 reaction, has been shown to be positively correlated with liver fat percentage (92). On the other hand, the ratio of palmitic

38 acid (C16:0) to linoleic acid (C18:2,n6), represents an index of DNL (93), and the ratio of n-6 FA to n-3 FA represents a positive indicator of NAFLD (74). The results showed that

HCD+13.5%LE-fed mice had lower SCD1 activity and lipogenic indices, but had a higher ratio of n-6 FA to n-3 FA (Fig. 3.5E), as compared to the HCD group. The lipogenic and

SCD1 activity indices in the HCD+LE group did not differ from that in the chow group.

39

40 Figure 3.5. The concentrations of saturated FA (A), monounsaturated FA (B), polyunsaturated FA (C), cholesterol (D), and lipogenic, SCD1 activity indices and n-6:n-3 ratio (E) in the liver of mice fed chow or HCD with either 0.5% or 13.5% LE. The indices in the panel E were estimated from 1) the ratio of C16:0:C18:2,n6 FA for the lipogenic index; 2) the ratio of C18:1,n9:C18:0 for the SCD1 activity index; 3) the ratio of [C18:2n6 and C20:4n6] to [C20:5n3 and C22:6n3] for the n6:n3 ratio. Data are shown as mean ±

SEM. n=7/group. *, HCD differed from chow, P < 0.001 (t-test). Different letters indicate statistical difference among the 4 groups that included HCD formula, P < 0.001. HCD: high carbohydrate diet; LE: lipid emulsion; MUFA: monounsaturated FA; PUFA: polyunsaturated FA; SFA: saturated FA.

41 3.3 Discussion and Summary of Study I

Lifestyle modification including diet and physical activity is recommended for the treatment of NAFLD, and has been shown to greatly improve liver histology in patients with NAFLD after a 6-month intervention (37). In the present study, we examined these factors during the very early stage of induction of hepatic steatosis, using a non-obese mouse model of HCD feeding to induce lipid accumulation, and testing specifically whether intervention with lipid in the form of HCD+13.5%LE, and intervention with Exe in the form of voluntary running, and both in combination, can attenuate lipid accumulation and alter the expression of genes associated with NAFLD. Here, we discuss first our HCD diet and the rapid accumulation of lipid in the liver, and then the effects of LE, Exe, and their interactions in this model.

The mouse model used in this study was based on previous work by Javid et al. (13), and by our laboratory (66), in which a HCD based on a liquid PN formula, which is rich in dextrose, has been shown to create a condition of hepatic steatosis, similar in appearance to NALFD observed in PN-fed patients (13). Our current study differed from previous ones in, first, its short duration, and, secondly, in the means we employed to assure that hepatic steatosis in our model was not confounded by EFA deficiency. In the present study, we tested the effects of HCD, ± LE and ± Exe, after just 8 d of HCD feeding, in order to focus on the earliest changes and whether they are preventable. In the original description of this

PN diet in a 19-d study in mice, and in a subsequent study (12), LE was not included in the

PN formula, and it seems that EFA deficiency might have confounded the results, although data regarding this point were not presented (12, 13). In our first use of this PN feeding model, as reported by Ito et al. (16), the group of mice fed HCD received a small daily oral

42 supplement of soybean oil, which we calculated from literature values (25) would provide sufficient EFA to prevent EFA deficiency. In this situation, intervention groups treated with an additional 4% or 13.5% of LE, added to the PN diet in the form of Intralipidâ, had lower concentrations of liver TG and of the transcripts for genes associated with lipogenesis and inflammation (16). We now know, however, that the triene to tetraene FA ratio in liver of the HCD group in Ito et al. may exceed 0.4, although no clinical signs of

EFA deficiency were observed. It therefore seems that, in the context of a HCD, a higher intake of EFA may be necessary than the amount the literature has suggested. In this short- term study, we fed the same HCD diet and the hepatic triene:tetraene FA ratio did not exceed 0.4, and thus we believe that the hepatic steatosis observed in this model was not confounded by EFA deficiency.

A main finding of our present study is that by 8 d of feeding the HCD, liver TG was significantly higher in the mice fed HCD as measured biochemically and as observed as lipid droplets with hepatocytes (Fig. 3.2B and Fig. 3.3). Moreover, the expression of genes related to DNL was also significantly elevated in the HCD group compared to chow-fed mice after 8 d (Fig. 3.4A). In previous studies, mice were fed HCD for longer times, or were fed HCD diets with varied carbohydrate composition. For example, Pierce et al. (97) showed that mice exhibited extensive hepatic steatosis after consuming a sucrose- palmitate-rich diet for 12 wk, as compared to a starch-palmitate-rich diet, and Ito et al. (16) demonstrated that mice fed liquid PN diet rich in dextrose, similar to that used in the present study as described above, developed hepatic steatosis in 5 wk. Since the hepatic TG concentration in this study was highly significant after just 8 d, we performed an exercise in which we questioned whether the effect of HCD might have been observable even earlier

43 than d8. By presuming that values for the HCD group were only half of those actually observed after 8 d, as shown in Fig. 3.2B, and compared these presumed values to those for the chow group shown in Fig. 3.2B, we still found statistically significant differences,

P=0.02, which suggests that HCD could have an even more rapid effect, perhaps in half the time (4 d) if the change is linear. A similar exercise for the 5 genes shown in Fig. 3A indicated that significant changes might have been observed for Fasn and Scd1, although differences for Cly, Acc1 and Srebpf1 would not have reached significance. Thus, a short- term study of 8 d duration is sufficient, and may be longer than sufficient, to detect major changes related to DNL and its outcome in liver of HCD-fed mice.

A second main finding was that intervention with 13.5%LE (Intralipid®), substantially prevented the accumulation of hepatic TG accumulation in the early stage of hepatic steatosis (Fig. 3.2B and Fig. 3.3). At the same time, the transcript levels for genes of DNL

(Fig. 3.4A) were significantly reduced as compared to HCD alone. Fatty acid synthesis in liver is known to be tightly regulated by exogenous and endogenous fats as well as the concentration of carbohydrate, and the enzyme FAS, which catalyzes the biosynthesis of saturated FA, mainly C16:0, from acetyl-CoA and malonyl-CoA, plays a crucial role in this process. Of the lipogenic genes we tested, Cly, Acc, Fasn, and Scd1 were all significantly upregulated by HCD as compared to chow, and for each of these LE was a significant main factor that reduced their expression to levels to near those determined for

chow-fed mice. The changes in Fasn expression were confirmed at the protein level (Fig.

3.4B and Fig. 3.4C). We reported previously that in a 5-wk study (66) the liver TG content and FAS protein level in mice fed HCD+13.5%LE were lower, compared to HCD alone.

In the present study, we also observed lower concentrations of C14:0 (Fig. 3.5A),

44 suggesting that exogenous FA may regulate FA synthesis in mice fed a HCD in both short

(8-d) and relative longer (5-wk) periods of time. Other studies have shown that a surplus of carbohydrate induces hepatic DNL by activating sterol regulatory element binding protein (SREBP) pathway (98, 99), and consequently leads to higher lipid accumulation in the liver. It is interesting that although the transcript level for Srebpf-1, an upstream transcription factor that regulates DNL in the liver, was elevated in HCD-fed mice compared to chow-fed mice, its level was not significantly attenuated by LE (or Exe, below), suggesting that the level of expression per se of this gene may not be rate-limiting for the expression of these other genes of DNL, at least at this early stage. In comparison,

Ito et al. (66) showed that LE lowered Srebpf1 mRNA in the liver of mice fed

HCD+13.5%LE for 5 wk, suggesting that LE may act as a long-term regulator in the presence of an HCD. Although it is presently unclear whether the reduced expression of lipogenic genes in the HCD+13.5%LE group involved the SREBP pathway (66), the n-6

FA-rich LE provides an extra source of PUFA, which may decrease DNL in the liver (100).

SCD1 is the rate-limiting enzyme in the conversion of SFA to MUFA. In this short- term study, the transcript level for Scd1 (Fig. 3.4A), the SCD1 activity (Fig. 3.5E), and lipogenic indices (Fig. 3.5F) were significantly higher in HCD-fed mice, consistent with previous findings from a longer study (99). Consistent with the increases in the Scd1 mRNA and SCD1 activity index in the HCD group (Fig. 3.5E), the concentrations of

C16:1n7, C18:1n7, and C18:1n9 in liver were also concomitantly and significantly higher in the liver of HCD-fed mice. All of these changes were abrogated in mice fed

HCD+13.5%LE. Additionally, the ratio of n-6:n-3 FA, a positively associated with

NAFLD (74), was higher in the HCD+LE group, whereas there was no statistical

45 significance between chow and HCD groups, suggesting that a higher ratio of n-6:n-3 FA was caused by LE supplementation. Together these results suggest that the provision of LE containing exogenous n-6 FA has a beneficial effect in the liver of HCD-fed by suppressing the induction of DNL and the resulting imbalance in FA. It would be of interest in future studies to elucidate the location of these lipid changes in terms of membranes and organelles, as previous studies have shown that the excess of free FA in the liver may induce cell dysfunction and apoptosis and that one of the roles of SCD1 is to protect the liver from injury caused by SFA (101-104). Although we did not observe significant difference in the concentration of SFA or in the hepatic inflammatory genes including serum amyloid P component (gene Apcs) and C-C motif ligand-2 (Ccl2), the concentration of MUFA in HCD-fed mice was significantly higher than that in HCD+13.5%LE group, along with a higher Scd1 transcript level and SCD1 activity index. Furthermore, a surplus of carbohydrate was associated with an increase in endoplasmic reticulum (ER) stress in the liver (105), which may consequently increase the expression of SCD-1 (104, 106, 107).

Flowers et al. (104) further pointed out that, in the absence of sufficient dietary unsaturated

FA, the biosynthesis of MUFA catalyzed by SCD1 plays a critical role in maintaining metabolic homeostasis that links FA availability and composition to the ER stress response.

PNPLA3, on the other hand, has been shown previously to act as a regulator of XBP1 under conditions of ER stress (106); our 8-d study suggested that LE supplementation reduced hepatic Scd1 (Fig. 3.4A) and Pnpla3 (Fig. 3.4D), and our correlation coefficient analysis revealed that Scd1 is positively correlated with Pnpla3 in the liver (Table 3.2). Therefore, further studies are needed to illustrate the causality between PNPLA3 and SCD1.

46 Exercise was also a significant factor for some of the variables we measured, but fewer than for LE. The effect of Exe was apparent for genes of DNL and for Pnpla3, which were among the most highly regulated markers of lipogenic activity in our study. Only for Scd1 transcript level was there a significant interaction between LE and Exe, in the direction of additivity. A limitation of this study is that we did not determine the FA composition for the Exe group, and it would be of interest in future studies to determine how Exe alters the

FA composition in the present of HCD in a longer-term study. Although our short-term study did not demonstrate an effect of Exe on hepatic TG levels (Fig. 3.2B and Fig. 3.3), it still seems promising that in longer-term studies or in the case of a sustained lifestyle intervention, both factors might contribute to preventing HCD-induced steatosis, LE through reduction of excess non-esterified FA by reduced synthesis and Exe by increasing oxidation. As mice fed the liquid HCD used in this study do not become obese (66), prevention of obesity per se increased physical activity is not a contributor to the reduced hepatic steatosis in this model.

In summary, short-term HCD feeding is sufficient to significantly alter hepatic lipid metabolism, with higher TG concentration and lipid accumulation, and elevation in expression of genes of DNL, especially Fasn and Scd1, which appear to be the most sensitive of the genes we have tested. All of these changes were abrogated in mice fed

HCD containing 13.5%LE, indicating the power of an appropriate amount of exogenous unsaturated lipid to attenuate hepatic lipogenesis. In general, fewer and smaller changes were observed in the HCD+Exe group than in the HCD+13%LE group, but Exe was effective in reducing some indicators of DNL. Therefore, the results of this study in mice

47 suggest that lifestyle interventions combining diet modification and physical activity might rapidly influence the hepatic response to a diet high in carbohydrate.

48 Chapter 4

Lipid Emulsion Mitigates Preexisting Hepatic Steatosis

and Improves Energy Homeostasis in High Carbohydrate Diet Fed Mice

4.1 Materials and Methods

4.1.1 Ethical statement

Animal protocols were approved by the Institutional Animal Care and Use Committee of Pennsylvania State University (IACUC # 40881). All mice were housed in plastic cages in an animal room maintained at 22±2°C with 50-70% humidity and a 12-h light-dark cycle.

4.1.2. Animals, diets and study design

A liquid HCD and the same HCD supplemented with 13.5% LE (HCD+LE) (Intralipid®

20%; Baxter Healthcare, Deerfield, IL) were used in this study (Table 4.1). One wk after arrival and adaptation to housing, six-wk-old male C57BL/6 mice were all fed HCD for

2.5 wk (total n = 24); at this time, the mice were randomly assigned into 3 groups based on their body weight. To ensure the initiation of hepatic steatosis by the time that LE was fed, one of the groups was euthanized and served as a reference time point (HCD-2.5wk; n =

8). The other two groups continued to be fed either HCD for an additional 2.5 wk (HCD-

5wk; n = 8) or HCD with 13.5%LE (HCD+LE; n = 8) for the additional 2.5-wk period. In the experimental period, the HCD-based liquid diet (Clinimix E®; Baxter Healthcare,

Deerfield, IL) was the only source of nutrition and hydration for all the groups fed HCD

49 based-diet (66, 108), which contained 77% en-% as carbohydrate in the form of dextrose,

22.5 en-% protein, and electrolytes, plus 0.5 en-% fat as a form of LE (Table 4.1), which we added to supply EFA. The formula was supplemented with multiple vitamins (Pediatric

Influvite®; Baxter Healthcare, Deerfield, IL), minerals and trace elements (Table S1 in the

Appendix). The liquid HCD and HCD+LE diets provided 1 kcal per mL and were freshly prepared and replaced daily to avoid contamination. The mice were fasted in the early morning for 4 hours, and then were euthanized using carbon dioxide inhalation, after which plasma and liver were excised immediately and snap-frozen in storage tubes in liquid nitrogen and then stored at -80°C before further analysis. Daily food intake and body weight, and final liver weights were also recorded.

50 Table 4.1. Macronutrient composition used in this study

HCD HCD+LE Macronutrient, en-% Carbohydrate 77.0 67.0 Protein 22.5 19.5 Fat 0.5 13.5 Source of carbohydrate Dextrose Dextrose Source of fat Intralipid® Intralipid®

Values are shown as calorie percentage. HCD, high carbohydrate

diet; LE, lipid emulsion.

51 4.1.3 Liver TG quantification

The procedure of hepatic TG extraction has been described in detail previously (109).

Brief, 80-100 mg of fresh liver tissues were placed in chloroform overnight to extract total lipids. The supernatants were then transferred to new glass tubes, and total lipids were extracted by using the method of Folch et al. (88). After solvent evaporation, the total lipid extract was applied to a column of 5% water-deactivated alumina, and the TG fraction was eluted with 25% diethyl ether in hexane. The TG content in aliquots of the eluate was then assayed by spectrometer at 415 nm.

4.1.4 RNA isolation and quantitative gene expression analysis

Total RNA from liver tissues (100 mg/mouse) was extracted with Trizol reagent (Life

Technologies, Carlsbad, CA) and quantified using a NanoDrop ND-1000 (Thermo

Scientific, Waltham, MA). cDNA was synthesized using Moloney murine leukemia virus

(M-MLV) reverse transcriptase protocol (Promega, Madison, WI), as described previously

(89). qRT-PCR was performed using 2x iQTM SYBR® Green Supermix PCR Master Mix

(Bio-Rad, Hercules, CA) with 400 ng of mouse primers (Table S3 in the Appendix) for each reaction. The ratio of mRNA-to-glyceraldehyde 3-phosphate dehydrogenase (Gapdh) mRNA was calculated, with the average value of the HCD-2.5wk group set to 1.0 prior to conducting statistical analysis.

4.1.5 Hepatic fatty acids profiling, ratio of n-6 fatty acid to n-3 fatty acid, and lipogenic and SCD1 activity indices

The ratio of n-6 to n-3 fatty acid was obtained from the ratio of the sum of linoleic acid

52 (C18:2-n6) plus arachidonic acid (C20:4-n6) to the sum of eicosapentaenoic acid (C20:5- n3) plus docosahexaenoic acid (C22:6-n3) in the liver (74). Two indices, a SCD1 activity index and a lipogenic index, were estimated from the ratios of C18:1-n9 to C18:0 and of

C16:0 to C18:2-n6 fatty acids, respectively (92, 93). Fatty acid composition was determined as the methyl esters of fatty acids by gas chromatography-mass spectrometry

(GC-MS), and the procedures of the sample preparation and analysis were as follows: liver tissues (40∼60 mg) were mixed with 1 mL of methanol-chloroform (2:1; v/v) containing

50 µmol/L of C15-acid and C17-methyl ester as internal standards, and then samples were homogenized using a Precellys homogenizer (Bertin Technologies, Rockville, MD). After homogenization and centrifugation at 20,000 g (4°C) for 15 min, the supernatant was collected and mixed with 500 µL of saline (0.9%), and then vortexed for 5 min and centrifuged again (20,000 g, 4°C) for 15 min. The bottom layer was transferred into a 10 mL scintillation vial and dried down under nitrogen gas. After 1 mL of methanol/hydrogen chloride (41.5 mL/9.7 mL) was added and the mixture was vortexed for 5 min, the solution was then incubated overnight at 60°C. The resultant mixture was combined with 5 mL of hexane and 5 mL of 0.9% saline. Following vortexing for 5 min, the top layer was collected and dried down under nitrogen gas. The resultant residues were redissolved in 400 µL of hexane and then transferred to an autosampler vial for GC−MS analysis. The fatty acid methyl ester composition was measured on an Agilent 7890A-5975C GC−MS system

(Agilent Technologies, Santa Clara, CA). A HP-5MS (Agilent Technologies, Santa Clara,

CA) capillary column (30 m, 0.25 mm ID, 0.25 µm film thickness) was employed with helium as a carrier gas at flow rate of 1 mL/min. Sample injection volume was 0.5 µL with a pressure pulsed split (1:10 split, 10 psi). The injection port and detector temperatures

53 were 230°C and 250°C, respectively. The initial column temperature was 80 °C where it was held for 1 min and then increased to 205°C at a rate of 20°C/min, and then increased to 220°C at a rate of 2°C/min, and then increased to 310°C at a rate of 15°C/min, where it was held for 2 min. Each fatty acid concentration was calculated from the integrated peak areas normalized with the internal standards.

4.1.6 Nuclear magnetic resonance (NMR) analysis

NMR analysis was performed in order to explore a global picture of how metabolites were changed in response to HCD and HCD+LE diets. NMR analysis was performed and followed the condition as described in the study published by Zhang et al (110). In brief, plasma samples were prepared by mixing 200 µL of serum with 400 µL of saline solution containing 30% D2O; 550 µL of samples was transferred into 5 mm NMR tubes after vortexing and centrifugation (11180 g, 10 min, 4 °C). Liver samples (50-80 mg) were extracted three times with 600 µL of precooled methanol-water mixture (2/1, v/v) using the PreCellys Tissue Homogenizer (Bertin Technologies, Rockville, MD). After centrifugation (4°C, 11180 g for 10 min), the combined supernatants were dried in vacuum.

Each of the aqueous extracts was separately reconstituted into 600 µL phosphate buffer

(K2HPO4/NaH2PO4, 0.1 M, pH 7.4, 50% v/v D2O) containing 0.005% TSP-d4 as chemical shift reference. Following centrifugation, 550 µL of each extract was transferred into 5 mm

NMR tube for NMR analysis.

1H NMR spectra of all the biological samples were recorded at 298 K on a Bruker

Avance III 600 MHz spectrometer (operating at 600.08 MHz for 1H) equipped with a

Bruker inverse cryogenic probe (Bruker Biospin) (111). One-dimensional NMR spectra

54 were procured for each sample employing the first increment of NOESY (Nuclear

Overhauser effect spectroscopy) pulse sequence (NOESYPR1D). To better facilitate NMR signal assignments, two-dimensional (2D) NMR spectra were acquired and processed for each selected sample.

4.1.7 Statistical analysis

Data are shown as mean ± SEM. Differences among groups were analyzed by one-way

ANOVA followed by Fisher’s exact test (Prism 6, GraphPad, La Jolla, CA). To account for any possible outliers in our data, we used the Rout test to detect possible outlier(s), and if any, the outlier(s) were substituted by the 95th percentile value(s). When variances were unequal, data were transformed to log10 values before analysis, as noted in the legends to figures. The Pearson’s correlation coefficient was also calculated for the qRT-PCR and liver TG data. For pos-hoc tests, P < 0.05 was considered significant.

For NMR analysis, the data from each spectrum were corrected using the internal standard and were displayed as relative abundance. The NMR spectra shown in Fig. 4.3 and Fig. 4.6 represent an average chemical shift of each metabolite in each group. The spectra were calibrated to TSP-d4 at δ 0.00. After manual phase- and baseline-corrections, each 1H NMR spectrum (δ 0.5-9.5) was segmented into bins with equal width of 0.004 ppm

(2.4 Hz) using AMIX software package (V3.8, Bruker Biospin, Germany). Multivariate data analysis was then conducted using the SIMCA-P+ package (V13.0, Umetrics, Sweden).

Principal component analysis (PCA) was performed on the mean-centered data to generate an overview and identify outliers. Orthogonal projection to the latent structure with discriminant analysis (OPLS-DA) was subsequently conducted using the unit-variance

55 scaled NMR data as X-matrix and class information as Y-matrix. The quality of OPLS-DA models was ensured with a seven-fold cross-validation method and further assessed with the CV-ANOVA method. After back-transformation, the loadings from the OPLS-DA models were plotted using an in-house developed Matlab script (V7.1, The Mathworks,

MA) with correlation coefficients color-coded to reflect the significance of inter-group differentiations for all metabolites. The red colored variables (or metabolites) were more significant contributors to inter-group differences than cool-colored ones (e.g., blue). A cutoff value of 0.7 for the correlation coefficient was chosen to select metabolites with statistical significance between groups (P < 0.05). Student’s t-test was performed to analyze NMR data for liver and plasma.

4.2 Results

4.2.1 Body weight, diet consumption

The final body weight did not differ among groups (Fig. 4.1A). The average intake of diet of each mouse fed either HCD-based diet was 19.56 mL/d, with no significant difference among the 3 groups (Fig. 4.1B).

56

Figure 4.1. Body weight and energy intake (Kcal/day) in C57BL/6J mice given a high carbohydrate diets with or without 13.5%LE for 5 wk. Data are shown as mean ± SEM. n=8/group. HCD, high carbohydrate diet; LE, lipid emulsion; wk: week.

57 4.2.2 Relative liver weight, liver TG, glycogen, and other metabolites

In the present study, HCD-5wk mice had the highest liver weight relative to body weight after 5 wks, as compared to HCD-2.5wk and HCD+LE groups, while the relative liver weight did not differ between HCD-2.5wk and HCD+LE group (Fig. 4.2A). For the hepatic TG content (Fig. 4.2B), mice with preexisting hepatic steatosis, determined by the value for the HCD-2.5wk group compared to mice never exposed to HCD (chow-fed mice, denoted 0 wk in 8-d study), continued to accumulate hepatic TG when fed a HCD until

5wk, but mice fed HCD+LE for the last 2.5 wk had a significantly lower hepatic TG concentration (P < 0.001). This difference indicates a reversal of hepatic lipid accumulation during the period in which LE was included in the diet.

We then determined the total lipids and other metabolites in the liver using NMR analysis. The NMR spectra were normalized and analyzed as described in section 4.1.7.

Cross-validated scores plots indicated that the quality indicators (R2X and Q2 in Fig. 4.3A and Fig. 4.3B) of the comparatives showed that the metabolite profiles from the two groups were distinctive. Based on the sample size (n=6/group) in this analysis, differences are considered as significant only when the color of each peak is in the orange color range or above (the cut-off value is 0.7 on the color bar); the metabolites with statistical significance were labeled in the corresponding color-coded loadings plots. The scores plots (Fig. 4.3 A and Fig. 4.3B) indicated that there were two clusters in each comparison, and the loadings plots revealed that HCD+LE mice had lowest hepatic lipids, consistent with direct TG measurement in Fig. 4.2B, and decreased levels of unsaturated fatty acid (UFA) (Fig. 4.3A and Fig. 4.3B). The levels of lipid and UFA in the HCD-2.5wk group did not differ from that in the HCD-5wk group (Fig. 4.3C). Additionally, LE supplementation increased

58 hepatic glycogen stores and the levels of adenosine 5’-monophosphate (AMP), fumarate, glutamine, and amino acids at the end of the 5-wk study (Fig. 4.3B and Fig. 4.3C), as compared to HCD-5wk group. The HCD-2.5wk and HCD-5wk groups did not differ in the levels of total lipids, UFA, AMP, fumarate, and glutamine but the glycogen level (Fig.

4.3A and Fig. 4.3B).

59

Figure 4.2. Relative liver weight and hepatic TG in C57BL/6J mice fed a high carbohydrate diets with or without 13.5%LE for 5 wk. The hepatic TG level shown as 0 wk in the panel B represents the value of chow-fed mice used as a baseline. Data are shown as mean ± SEM. n=8/group. Different letters indicate statistical difference among the mice fed HCD-based diets, P < 0.001. HCD, high carbohydrate diet; LE, lipid emulsion; wk: week.

60

61 Figure 4.3. OPLS-DA scores and loadings plots derived from NMR spectra of the liver obtained from mice in the HCD groups in this study. (A) Comparison between HCD-2.5wk and HCD+LE groups; (B) Comparison of HCD-5wk and HCD+LE groups; (C) Relative abundance of each significant metabolite in the liver. The NMR spectra of each group represent an average chemical shift of each metabolite. Data in panel C are shown as mean

± SEM. n=6/group. Different letters indicate statistical difference among groups, P < 0.05

(one-way ANOVA). The color bar corresponds to the coefficient of the variables in the separation between two groups (cutoff value: 0.7). Positive signals correspond to the metabolites present at increased concentrations in HCD+LE; the negative signals correspond to the metabolites present at decreased concentration in the HCD-2.5wk or

HCD-5wk. AMP, adenosine 5’-monophosphate; UFA, unsaturated fatty acid.

62 4.2.3 Hepatic fatty acid composition

Many studies have shown that the types of fatty acids play a crucial role in the development of NAFLD (16, 74, 85), and, therefore, to further explore the fatty acid composition in the liver, we first determined the concentrations of total fatty acid in the liver using quantitative GC/MS, as described in section 2.5. The results showed that feeding a HCD for 5 wk resulted in an increase in the concentrations C14:0 and C16:0 fatty acids, but a decrease in the C18:0; whereas the mice fed HCD+LE exhibited decreased levels of C14:0 and C16:0 fatty acids but an increase in C18:0, compared to the HCD-5wk group (Fig. 4.4A). For the concentrations of MUFA, on the other hand, HCD+LE mice had lowest levels of C16:1-n7, C18:1-n7, and C18:1-n9 fatty acids (Fig. 4.4B), as compared to both HCD-2.5wk and HCD-5wk groups. With an increased feeding period of HCD, HCD- fed mice had highest levels of C18:1-n7 and C18:1-n9 in the liver. Unlike the pattern observed in the MUFA, LE supplementation increased the concentrations of PUFA including C18:2-n6, C20:4-n6, and C22:6-n3 (Fig. 4.4C), while HCD-5wk decreased the hepatic PUFA, compared to the HCD-2.5wk group (Fig. 4.4C). Overall, in the presence of a HCD, a time-dependent effect on the changes of fatty acids was observed in the 5-wk compared to 2.5-wk groups (Fig 4.4A, Fig. 4.4B, and Fig. 4.4C), indicating progression of changes with continued HCD, while switching to the HCD+LE diet after 2.5 wk reversed all of these differences.

The n-6:n-3 fatty acid ratio and indices of lipogenic and SCD1 activity have been reported to be increased in NAFLD (74, 92, 93). These indices were estimated from 1) the ratio of total n-6 to n-3 fatty acids; 2) the ratio of C16:0 to C18:2-n6 fatty acid for lipogenic index; and 3) the ratio of C18:1-n9 to C18:0 fatty acid for SCD1 activity index. The results

63 (Fig. 4.4D) showed that the indices for lipogenic and SCD1 activities were lowest in the

HCD+LE group, lower than in either the HCD2.5 or HCD-5 wk groups, and there was a time-dependent response in the mice fed HCD for 2.5 wk and 5 wk. Moreover, the ratio of n-6:n-3 fatty acids was increased by LE intervention and experimental time period (Fig.

4.4D). Hepatic cholesterol was reduced by LE supplementation, whereas there was no significant difference between the HCD-2.5wk and HCD-5wk groups (Fig. 4.4E).

Previous studies have shown that EFA deficiency is a cause of hepatic steatosis (48,

94). Often, a ratio of the triene (Mead acid, C20:3-n9) to tetraene (arachidonic acid, C20:4- n6) greater than 0.4 is considered as an indicator of EFA deficiency (47, 95). In the present study, the ratio of C20:3 to C20:4 fatty acids in the liver was 0.44 in the HCD-2.5wk mice and 0.67 in the HCD-5wk group (Fig. 4.4F). This may, in part, have contributed to hepatic steatosis in this study, although we did not observe any clinical signs of EFA deficiency in these mice.

64

65 Figure 4.4. Total fatty acids, lipogenic, and SCD1 activity indices in the liver of mice fed

HCD or HCD+LE for 5 wk. (A) Hepatic levels of saturated fatty acid, P < 0.05; (B)

Concentration of monounsaturated fatty acids in liver, P < 0.01; (C) Hepatic levels of polyunsaturated fatty acids, P < 0.01; (D) Lipogenic and SCD1 activity indices, P < 0.01;

(E) Hepatic cholesterol level in the liver, P < 0.01; (F) The triene:tetraene ratio, P < 0.05.

Data are shown as mean ± SEM. n=8/group. Different letters indicate statistical difference among groups. HCD, high carbohydrate diet; LE, lipid emulsion; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid.

66 4.2.4 Transcript levels for genes of de novo lipogenesis

To further explore whether LE can alter the expression of genes in the de novo lipogenesis pathway, a pathway contributing to lipid accumulation, we measured the hepatic transcript levels for the genes encoding enzymes, including ATP-citrate lyase (Cly), acetyl-CoA carboxylase-1 (Acc1), fatty acid synthase (Fasn), stearoyl-CoA desaturase-1

(Scd1), and the transcriptional factors carbohydrate-responsive element-binding protein

(Chrebp) and Srebpf1. The results showed that LE treatment decreased the transcript levels for Cly, Acc1, Fasn, Scd1, and Pnpla3 (Fig. 4.5A and Fig. 4.5B) after TG accumulation has begun (P < 0.01; P < 0.001 for Scd1); whereas, only for Acc1 and Pnpla3, a gene associated with hepatic steatosis, were there significant elevations in the HCD-5wk group

(P < 0.001), as compared to HCD-2.5wk group. Moreover, the transcriptional factors showed a significant increase only in Chrebp in the HCD+LE group, but not in Srebpf1.

Diacylglycerol O-Acyltransferase 2 (Dgat2), a key enzyme in TG synthesis, exhibited an increase in mice that received LE supplementation, but the mRNA level for Dgat2 was not statistically different between the HCD-2.5wk and HCD-5wk groups. The relative expression of Fgf-21, also shown to be associated with hepatic lipogenesis (109), was the highest in the HCD-2.5wk group, but did not differ between the HCD-5wk and HCD+LE groups.

To further assess the relationship between lipid accumulation and the expression of

Cly, Acc1, Fasn, Scd1, and Pnpla3 in the liver, Pearson’s correlation coefficient was calculated for hepatic TG level compared with lipogenic gene expression. TG content was positively correlated with the level of Cly, Fasn, Scd1, Fgf-21, Pnpla3, and Dgat2 (Table

4.2). Interestingly, in the presence of hepatic steatosis, the transcript levels of all of the

67 lipogenic genes were all strongly correlated, with the highest correlation coefficient between Acc1 and Scd1 (R2=0.6613, P < 0.0001). Unlike the correlations for Pnpla3, there were no correlations between Fgf-21 and lipogenic gene expressions.

68

Figure 4.5. Relative mRNA transcripts involved in lipogenesis and lipid metabolism in the liver of C57BL/6J mice fed a HCD without or with 13.5%LE. (A) Cly, Acc1, Fasn, and

Scd1; (B) Pnpla3, Fgf21, Dgat2, Chrebp, and Srebpf1. Data are shown as mean ± SEM. n=7-8/group. The log-transformed data were used for the relative mRNA of Fasn and

Pnpla3 before one-way ANOVA, and the significant letters shown on the graphs for these two genes were marked based on the analysis of the transformed data set. Different letters indicate statistical difference among groups, P < 0.01 (one-way ANOVA). Acc1, acetyl-

CoA carboxylase-1; Cly, ATP-citrate lyase; Chrebp: carbohydrate-responsive element- binding protein; Dgat2, diacylglycerol O-acyltransferase-2; Fasn, fatty acid synthase;

Fgf21, fibroblast growth factor-21; HCD, high carbohydrate diet; LE, lipid emulsion;

Pnpla3, patatin-like phospholipase domain-containing protein 3; Scd1, stearoyl-CoA desaturase; Srebpf1, sterol regulatory element-binding transcription factor 1.

69 Table 4.2. Correlation matrix of TG, Cly, Acc1, Fasn, Scd1, and Pnpla3 in liver of HCD, and HCD+LE mice

Gene Lipid or Cly Acc1 Fasn Scd1 Pnpla3 Gene TG R2 = 0.1911 R2 = 0.1274 R2 = 0.2174 R2 = 0.2309 R2 = 0.2045

P = 0.0327 P = 0.0869 P = 0.0329 P = 0.0175 P = 0.0303

2 2 2 2 Cly R = 0.3249 R = 0.4478 R = 0.3928 R = 0.3614

P = 0.0036 P = 0.0009 P = 0.001 P = 0.0024

R2 = 0.2574 R2 = 0.6613 R2 = 0.3748 Acc1 P = 0.0189 P < 0.0001 P = 0.0019

R2 = 0.269 R2 = 0.2833 Fasn P = 0.016 P = 0.0157

R2 = 0.2314 Scd1 P = 0.0201

Data are shown as R2 and P values for the Pearson correlation coefficient from n=20-24 mice from all diet groups combined. Acc1, acetyl-CoA carboxylase-1; Cly, ATP-citrate lyase; Fasn, fatty acid synthase; HCD, high carbohydrate diet; LE, lipid emulsion; Pnpla3, patatin-like phospholipase domain-containing protein 3; Scd1, stearoyl-CoA desaturase-1;

TG, triacylglycerol.

70 4.2.5 NMR analysis of plasma

NMR analysis was performed to further explore the lipoprotein profiles and metabolites in the plasma. After running cross-validated score plots, the quality indicators

(R2X and Q2 in the Fig. 4.6A, Fig. 4.6B, and Fig. 4.6C) of the comparatives showed that the metabolite profiles from the three groups that received any of the HCD-based diets were distinctive. Considering the sample size (n=6/group) in this analysis, differences are considered as significant only when the cut-off value is 0.7, which is shown in an orange color or above, and the metabolites with statistical significance were labeled in the corresponding color-coded coefficient plots. According to the criterion used, the scores plots (Fig. 4.6 A-C) indicated that there were two clusters in each comparison, and the loadings plots showed that the plasma glucose level was higher in the HCD-2.5wk group and that there was no significant difference between HCD-5wk and HCD+LE groups (Fig.

4.6D). Since hepatic TG accumulation was observed in mice fed HCD for 2.5 wk and 5 wk, we then focused on determining whether LE supplementation altered the levels of lipids and other metabolites in the plasma of mice in this lean steatosis model. The results indicated the level of VLDL/LDL in the HCD-5wk group (Fig. 4.6A) was significantly higher than that in HCD-2.5wk group (color bar: orange), but there was no significant difference in the level of HDL (Fig. 4.6A). In contrast, LE supplementation significantly increased the levels of VLDL and/or LDL, which overlap, and HDL (color bar: orange- red), as compared to HCD-2.5wk (Fig. 4.6B) and HCD-5wk (Fig. 4.6C) groups.

Furthermore, the elevated levels of PUFA and UFA were observed in the plasma of LE- supplemented mice; whereas, in contrast, no statistical differences were observed in PUFA and UFA levels between the HCD-2.5wk and HCD-5wk groups.

71 For other metabolites in the plasma, N-acetyl glycoprotein (NAG), an acute-phase glycoprotein in animals under inflammatory conditions (112), was slightly but significantly increased after LE supplementation (Fig. 4.6B, Fig. 4.6C, and Fig. 4.6D), and there was no statistical significance in the plasma level of NAG in mice fed HCD for 2.5wk and 5wk

(Fig. 4.6A and Fig. 4.6D). NMR spectra also revealed that HCD-5wk mice had the highest level of lactate and that the plasma levels for succinate, alanine, and branched-chain amino acids (BCAA) were elevated in the HCD-5wk mice, as compared to HCD+LE group (Fig.

4.6C and Fig. 4.6E). There were no significant differences in the levels of succinate and amino acids in mice fed HCD for 2.5wk compared to 5wk (Fig. 4.6A and Fig. 4.6E).

72

73 Figure. 4.6. Score plot and OPLS-DA regression coefficient plot derived from NMR spectra of the plasma obtained from a lean NAFLD mice fed a HCD without or with

13.5%LE. (A) the comparison between HCD-2.5wk and HCD-5wk; (B) the comparison of

HCD-2.5wk and HCD+LE; (C) the comparison of HCD-5wk and HCD+LE; (D) the quantified relative abundance of each significant metabolite; (E) the quantified relative abundance of amino acids in the plasma. The NMR spectra of each group represent an average chemical shift of each metabolite. Data in the panel D and E are shown as mean ±

SEM. n=6/group. Different letters indicate statistical difference among groups, P < 0.05

(one-way ANOVA). The color bar corresponds to the coefficient of the variables in the separation between two groups (cutoff value: 0.7). Positive signals correspond to the metabolites present at increased concentrations in HCD-5wk or HCD+LE; the negative signals correspond to the metabolites present at decreased concentration in the HCD-2.5wk or HCD-5wk groups, compared to the HCD+LE group. BCAA, branched-chain amino acid;

GPC, glycerophosphocholine; NAG, N-acetyl glycoprotein; PC, phosphorylcholine;

PUFA, polyunsaturated fatty acid; UFA, unsaturated fatty acid.

74 4.2 Discussion and Summary of Study II

We have previously shown that LE can ameliorate the early stage of hepatic steatosis

(113) and that it attenuated steatosis and the expression of inflammatory markers in the liver of a non-obese mouse model, when introduced at the beginning of the feeding study

(66). In the present study, we determined whether supplementing the HCD with lipid in a form of 13.5%LE can cease the progression, or even reverse, hepatic steatosis in a non- obese mouse model with preexisting steatosis. Here, we discuss first the HCD and the accumulation of lipid in the liver, and then focus on the effect of LE in the model with preexisting steatosis.

One of the main findings in our current study was that the duration of induction of steatosis affected lipid and glucose metabolism, apparently by redirecting the substrates for lipogenesis and glycogenesis, so that the concentrations of various classes of fatty acids changed over time. Previous studies (69, 114) indicated that SFA and MUFA play a crucial role in the development of hepatic steatosis. The present study showed that mice fed HCD-

5wk had higher concentrations of C14:0, C16:0 SFA and C18:1-n7 and C18:1-n9 MUFA

(Fig. 4.4A and Fig. 4.4B), but lower PUFA (Fig. 4.4C). This suggests that consuming a

HCD for an even longer period of time could further imbalance lipid metabolism, and may partially contribute to the development of steatosis (69). Additionally, in the mice fed HCD alone, the n6:n3 fatty acid ratio, and the lipogenic activity and SCD1 activity indices (Fig.

4.4D), positive indicators for NAFLD (74, 92, 93), were all significantly elevated by the duration of steatosis induction, suggesting a progression of steatosis with longer time of exposure to HCD. However, the concentration of TG in liver did not differ between HCD-

2.5wk and HCD-5wk groups (Fig. 4.2B). A plausible explanation for these seemingly

75 discrepant results is that a surplus of carbohydrate, such as increased glucose (Fig. 4.3C), in the liver of the HCD-5wk mice may have induced glycogen synthesis, also observed in

Fig. 4.3C, which may, in part, by redirecting glucose, have reduced the levels of the substrates for de novo lipogenesis in the liver, and altered the levels of transcript for genes involved in the de novo lipogenesis pathway (Fig. 4.5A). Furthermore, our results support the concept that hepatic steatosis represents an imbalance between import of lipid from and export of lipid to the liver. Our NMR analysis showed that the level of VLDL/LDL was elevated in the HCD-5wk group (Fig. 4.6A and Fig. 4.6D), which may suggest a subsequent increase in the export of lipid from the liver. Together, the consumption of

HCD for a longer period of time than in the present study could be anticipated to further alter hepatic fatty acid composition and the extent of development of hepatic steatosis by regulating the levels of the transcripts for genes in the de novo lipogenesis pathway. It would be of interest in future studies to determine the mechanism of how HCD regulates the expression of genes associated with lipid metabolism over a longer period.

The second main finding in the present study was that LE (13.5 en-% Intralipid®) supplementation successfully attenuated hepatic lipid accumulation in mice fed HCD (Fig.

4.2B, Fig. 4.3B, and Fig. 4.3C) and altered the levels of metabolites in the liver and plasma

(Fig. 4.3B, Fig. 4.3C, Fig. 4.6C, Fig. 4.6D, and Fig. 4.6E) after the onset of steatosis. It is well known that fatty acid synthesis in the liver is tightly regulated by both exogenous and endogenous fats. In the present study, the concentration of liver TG (Fig. 4.2B), total lipids

(Fig. 4.3B and Fig. 4.3C), and the transcript levels for Cly, Acc1, Fasn, Scd1, and Pnpla3

(Fig. 4.5A and Fig. 4.5B) were all significantly attenuated by LE supplementation, as compared to their levels in mice fed HCD-5wk, suggesting that in the presence of HCD,

76 exogenous fat may not be a factor contributing to lipid accumulation; rather, endogenous lipids were instead concomitantly decreased in response to exogenous LE supplementation.

Moreover, exogenous PUFA has been shown to suppress lipogenic genes in liver (100).

Our GC-MS analysis revealed that the intervention with 13.5%LE decreased the concentrations of C14:0, C16:0, C16:1-n7, C18:1-n7, and C18:1-n9 fatty acids (Fig. 4.4A and Fig. 4.4B) and increased the level of PUFA (Fig. 4.4C), concomitant with decreased hepatic mRNA for enzymes and transcription factors associated with de novo lipogenesis in mice fed HCD+LE. On the other hand, an enhancement in the export of lipids from the liver could be another explanation for a decrease in hepatic TG content; the mice that received LE supplementation had increased transcript levels for Dgat2 (Fig. 4.5B), a gene encoding an enzyme required for TG synthesis, and, furthermore, their plasma levels of

VLDL and/or LDL, PUFA, and UFA (Fig. 4.6C and 4.6D) were significantly higher, providing evidence that LE intervention, begun after the onset of steatosis in this non-obese model, can regulate TG synthesis and lipid transport. Cellular lipid droplets are known to play a highly dynamic role in cell signaling, cellular energy homeostasis, lipid mobilization, and the development of hepatic steatosis (115-117); however, it is presently unclear what role exogenous PUFA may play in this physiological condition. It would be interesting for future studies to elucidate the mechanism of how HCD and/or PUFA regulate the synthesis and/or maintenance of lipid droplets.

It is well known that EFA deficiency is a cause of hepatic steatosis (94), and the ratio of triene to tetraene fatty acid, in liver, was utilized to determine whether our non-obese mouse model fed HCD developed this biochemical indicator of EFA deficiency. The triene:tetraene ratios shown in the Fig. 4.4F increased time-dependently, reaching 0.44 in

77 the HCD-2.5wk group and 0.67 in the HCD-5wk group, which exceed the commonly used threshold value of 0.4. However, we noted no clinical signs of EFA deficiency, such as dermatitis or changes in fur condition, and the body weight of the HCD group was not affected. Previously, Huang et al. (113) reported that the mice fed HCD for 8 d did not have any signs of EFA deficiency, and the triene:tetraene fatty acid ratio was below the threshold value. Additionally, Meisel et al. (118) reported that the ratio was 0.89 in the liver of mice fed a fat-free HCD for 19 d. Our current study was of longer duration (2.5 wk and 5 wk) than our previous one (8 d), which suggests that, with continuous feeding of

HCD for longer times, a higher intake of EFA may be required, that is, greater than 0.5 en-

% LE in the HCD diet, than previously thought (66, 89). Therefore, the non-obese mouse model in this reversal study may be partially confounded by EFA insufficiency (119), whereas HCD+13.5%LE was able to correct this ratio (0.04). Research from a clinical study in children with pancreatic insufficiency and cystic fibrosis (120) has suggested that the plasma linoleic acid concentration may represent a more clinically relevant biomarker of EFA status than the triene:tetraene ratio. Thus, while we cannot rule out some contribution of EFA deficiency to the results in our HCD groups, the triene:tetraene ratio in our mice was lower than that in the study of Meisel et al. (118), and the clinical relevance of this ratio can be questioned. Nevertheless, we plan in future studies to increase the fraction of EFA in the HCD diet, to maintain the triene:tetraene ratio below 0.4.

Exogenous lipid in a form of LE, rich in n-6 fatty acids, was a beneficial factor in this study with regard to metabolites in the liver and plasma, but whether n-6 fatty acids may have a pro-inflammatory effect in the long term period has been a concern (121). In our studies, the effect of LE intervention was significant for the levels of fumarate and AMP

78 (Fig. 4.3B and Fig. 4.3C), which are the important intermediates in the Krebs cycle, a central pathway that unifies macronutrient metabolism. In order to maintain the pathway’s balance, fumarates and other precursors need to be converted to form oxaloacetate (OAA), which will then combine with and completely oxidize acetyl-CoA for energy production, or will be used for macronutrient metabolism. Since these intermediates, including fumarate and AMP, can facilitate generating adenosine triphosphate (ATP), our findings indicated increases in the levels of these intermediates in the liver of HCD+LE-fed mice, suggesting 1) that the liver of the mice fed HCD+LE may have less demands for OAA to generate citrate for macronutrient metabolism; and 2) the intermediates maintain the Krebs cycle working properly to generate ATP for other pathways such as glycogen synthesis, instead of lipogenesis (Fig. 4.4D). Additionally, an increased level of hepatic glutamine

(Fig. 4.3C), either contributed by the gut or skeletal muscles, can also replenish a- ketoglutarate, an intermediate in the Krebs cycle, which maintains energy production. A limitation of this study is that we did not measure the glutamine level from the gut or the gut microbiota, which has been shown to regulate macronutrient metabolism in animals

(122, 123). Further studies are required to explore the roles of gut and microbiota in the non-obese mouse model with preexisting steatosis.

Plasma NMR analysis, on the other hand, indicated that HCD-fed mice had increased levels of alanine, BCAA, succinate, and lactate (Fig. 4.6C and Fig. 4.6E), as compared to

HCD+LE mice, suggesting that these metabolites, especially alanine and lactate, may be transported back to the liver in order to be converted into the intermediates required for the

Krebs cycle. Due to hepatic lipid accumulation in the HCD mice, it is a possibility that the increased plasma succinate serves as a paracrine signal in response to liver damage through

79 succinate receptor expressed on the hepatic stellate cells (124). Although LE supplementation has been shown to be significant in the metabolic parameters we have tested in the present study, it was unexpected that HCD+LE mice had the highest level of

NAG, an acute phase glycoprotein in animals under inflammatory condition (112).

However, this difference was relatively small. Therefore, further studies are required to determine the pro-inflammatory effect of n-6 PUFA over a longer period of time in the

HCD-fed non-obese mouse model.

In summary, LE intervention increased lipid export and decreased endogenous fatty acid synthesis, and these effects allow hepatocytes to mitigate lipid accumulation in the liver, as well as to maintain a balanced macronutrient metabolism. These observations provide a plausible mechanism on how n-6 PUFA ameliorates hepatic lipogenesis and steatosis in the non-obese mouse model. Future studies are required to determine the effects of n-6 PUFA and gut microbiota on inflammation and lipid metabolism in a mouse model of lean NAFLD.

80 Chapter 5

Lipid emulsions, Rich in n-3 or n-9 Fatty Acids, Reverse the Development of High

Carbohydrate Diet-Induced Hepatic Steatosis in Mice

5.1 Methods and Materials

5.1.1 Ethical statement

Animal protocols were approved by the Institutional Animal Care and Use Committee of Pennsylvania State University (IACUC # 40881). All mice were housed in plastic cages in an animal room maintained at 22±2°C with 50-70% humidity and a 12-h light-dark cycle.

5.1.2 Animals, diets and study design

The standard chow diet, a liquid HCD, and the same HCD supplemented with 13.5%

Omegaven® (HCDF), ClinOleic® (HCDO), or Intralipid® (HCDS) were used in this study

(Table 5.1). One week after arrival and adaptation to housing, six-wk-old male C57BL/6 mice were randomized into six groups, and one group was fed a standard chow diet and given unrestricted access to food and water serving as a reference group. The rest of groups were all fed HCD for 2.5 week (total n = 41); at this time, the mice were randomly assigned into 5 groups based on their body weight. To ensure the initiation of hepatic steatosis by the time that LE was fed, one of the groups was euthanized and served as a reference time point (HCD-2.5wk; n = 8). The other four groups continued to be fed either HCD for an additional 2.5 week (HCD-5wk; n = 9) or HCD with 13.5% Omegaven® (HCDF; n = 8),

ClinOleic® (HCDO; n = 8), or Intralipid® (HCDS; n = 8) for the additional 2.5-wk period.

81 In the experimental period, the HCD-based liquid diet (Clinimix E®; Baxter Healthcare,

Deerfield, IL) was the only source of nutrition and hydration for all the groups fed HCD based-diet (66, 108), which contained 76% en-% as carbohydrate in the form of dextrose,

21.0 en-% protein, and electrolytes, plus 3.0 en-% fat as a form of Intralipid® (Table 5.1), which we added to prevent EFA deficiency. The lipid composition from each LE was measured by GC-MS as shown in the Table 5.2. The liquid diet was supplemented with multiple vitamins (Pediatric Influvite®; Baxter Healthcare, Deerfield, IL), minerals and trace elements (Table S2 in the Appendix). The liquid HCD and HCD with either 3%LE or 13.5%LE provided 1 kcal per mL and were freshly prepared and replaced daily to avoid contamination. The mice were fasted in the early morning for 4 hours, and then were euthanized using carbon dioxide inhalation, after which plasma and liver were excised immediately and snap-frozen in storage tubes in liquid nitrogen and then stored at -80°C before further analysis. Daily food intake and body weight, and final liver and adipose tissue weights were also recorded.

82 Table 5.1. Macronutrient composition used in this study

HCD HCDF HCDO HCDS Macronutrient, en-% Carbohydrate 76.0 66.5 66.5 66.5 Protein 21.0 20.0 20.0 20.0 Fat 3.0 13.5 13.5 13.5 Source of Dextrose Dextrose Dextrose Dextrose carbohydrate Source of fat Intralipid® Omegaven® ClinOleic® Intralipid®

Values are shown as calorie percentage. HCD, high carbohydrate diet; HCDF: high carbohydrate diet with 13.5%

Omegaven®; HCDO: high carbohydrate diet with 13.5% ClinOleic®; HCDS: high carbohydrate diet with 13.5%

Intralipid®; LE, lipid emulsion.

83 Table 5.2. Lipid composition of three lipid emulsions used in the present study

Composition (%, w/v) Intralipid® ClinOleic® Omegaven®

Baxter Healthcare Baxter Healthcare Fresenius Kabi SFAs C14:0 - - 3.4 C16:0 13.2 13.8 14.4 C18:0 5.1 5.4 5.0 MUFAs C16:1n7 - - 7.3 C18:1n9 29.6 61.1 15.9 PUFAs C16:3n4 - - 1.0 C16:4n1 - - 1.6 C18:2n6 51.3 19 4.0 C18:3n3 - - 4.9 C20:3n9 - - 1.2 C20:4n6 0.7 0.7 1.8 C20:5n3 - - 19.2 C22:5n3 - - 1.6 C22:6n3 - - 18.8

The value shown in the table was calculated from GC-MS data.

84 5.1.3 Liver TG quantification

The procedure of hepatic TG extraction has been described in detail previously (90).

Brief, 80-100 mg of fresh liver tissues were placed in chloroform overnight to extract total lipids. The supernatants were then transferred to new glass tubes, and total lipids were extracted by using the method of Folch et al. (88). After solvent evaporation, the total lipid extract was applied to a column of 5% water-deactivated alumina, and the TG fraction was eluted with 25% diethyl ether in hexane. The TG content in aliquots of the eluate was then assayed by spectrometer at 415 nm.

5.1.4 Liver hematoxylin and eosin (H&E) staining

After dissection, liver tissue was fixed in 3.7% formaldehyde immediately and embedded in paraffin. 5-µm sections were used to processed hematoxylin-eosin H&E staining (66).

5.1.5 RNA isolation and quantitative gene expression analysis

Total RNA from liver tissues (100 mg/mouse) was extracted with Trizol reagent (Life

Technologies, Carlsbad, CA) and quantified using a NanoDrop ND-1000 (Thermo

Scientific, Waltham, MA). cDNA was synthesized using Moloney murine leukemia virus

(M-MLV) reverse transcriptase protocol (Promega, Madison, WI), as described previously

(89). qRT-PCR was performed using 2x iQTM SYBR® Green Supermix PCR Master Mix

(Bio-Rad, Hercules, CA) with 400 ng of mouse primers (Table S3 in the Appendix) for each reaction. The ratio of mRNA-to-the average of three housekeeping genes, including beta-actin (Actb), glyceraldehyde 3-phosphate dehydrogenase (Gapdh), and hypoxanthine-

85 guanine phosphoribosyl transferase (Hprt) mRNA, was calculated, with the average value of the HCD-2.5wk group set to 1.0 prior to conducting statistical analysis.

5.1.6 Liver RNA sequencing analysis

Total RNA from liver tissues (30 mg/mouse) was extracted with Trizol reagent (Life

Technologies, Carlsbad, CA), as described previously (125) and quantified its purity and concentration using a NanoDrop ND-1000 (Thermo Scientific, Waltham, MA). RNA quality as measured by RNA Integrity Number (RIN) will be determined by Bioanalyzer

(Agilent Technologies). Well-prepared RNA samples, including its sufficient purity, concentration, and quality, will be used to construct libraries for RNA-Seq. The Penn State

Genomics Core Facility (GCF) will use the TruSeq Stranded mRNA Library Prep kit to make barcoded libraries according to the manufacturer’s protocol (Illumina Inc.). Libraries will be sequenced on an Illumina HiSeq 2500 in Rapid Run mode using 150 nt single read sequencing. Approximately 40 million reads will be acquired for each library.

5.1.7 Biological process and Pathway analysis

Gene expression clustering was assigned to biological process using the web tool, the

Database for Annotation, Visualization and Integrated Discovery (DAVID) (126, 127).

Pathway analysis was determined using an online database, Kyoto Encyclopedia of Genes and Genomes (KEGG) (128).

86 5.1.8 Hepatic fatty acids profiling, ratio of n-6 fatty acid to n-3 fatty acid, and lipogenic and SCD1 activity indices

The ratio of n-6 to n-3 fatty acid was obtained from the ratio of the sum of linoleic acid (C18:2-n6) plus arachidonic acid (C20:4-n6) to the sum of eicosapentaenoic acid

(C20:5-n3) plus docosahexaenoic acid (C22:6-n3) in the liver (74). Two indices, a SCD1 activity index and a lipogenic index, were estimated from the ratios of C18:1-n9 to C18:0 and of C16:0 to C18:2-n6 fatty acids, respectively (92, 93). Fatty acid composition was determined as the methyl esters of fatty acids by gas chromatography-mass spectrometry

(GC-MS), and the procedures of the sample preparation and analysis were as follows: liver tissues (4060 mg) were mixed with 1 mL of methanol-chloroform (2:1; v/v) containing

50 µmol/L of C15-acid and C17-methyl ester as internal standards, and then samples were homogenized using a Precellys homogenizer (Bertin Technologies, Rockville, MD). After homogenization and centrifugation at 20,000 g (4°C) for 15 min, the supernatant was collected and mixed with 500 µL of saline (0.9%), and then vortexed for 5 min and centrifuged again (20,000 g, 4°C) for 15 min. The bottom layer was transferred into a 10 mL scintillation vial and dried down under nitrogen gas. After 1 mL of methanol/hydrogen chloride (41.5 mL/9.7 mL) was added and the mixture was vortexed for 5 min, the solution was then incubated overnight at 60°C. The resultant mixture was combined with 5 mL of hexane and 5 mL of 0.9% saline. Following vortexing for 5 min, the top layer was collected and dried down under nitrogen gas. The resultant residues were redissolved in 400 µL of hexane and then transferred to an autosampler vial for GC−MS analysis. The fatty acid methyl ester composition was measured on an Agilent 7890A-5975C GC−MS system

(Agilent Technologies, Santa Clara, CA). A HP-5MS (Agilent Technologies, Santa Clara,

87 CA) capillary column (30 m, 0.25 mm ID, 0.25 µm film thickness) was employed with helium as a carrier gas at flow rate of 1 mL/min. Sample injection volume was 0.5 µL with a pressure pulsed split (1:10 split, 10 psi). The injection port and detector temperatures were 230°C and 250°C, respectively. The initial column temperature was 80 °C where it was held for 1 min and then increased to 205°C at a rate of 20°C/min, and then increased to 220°C at a rate of 2°C/min, and then increased to 310°C at a rate of 15°C/min, where it was held for 2 min. Each fatty acid concentration was calculated from the integrated peak areas normalized with C17-methyl ester, the internal standard.

5.1.9 Nuclear magnetic resonance (NMR) analysis

NMR analysis was performed in order to explore a global picture of how metabolites were changed in response to HCD and HCD+LE diets. NMR analysis was performed and followed the condition as described in the study published by Zhang et al. (110). In brief, liver samples (50-80 mg) were extracted three times with 600 µL of precooled methanol- water mixture (2/1, v/v) using the PreCellys Tissue Homogenizer (Bertin Technologies,

Rockville, MD). After centrifugation (4°C, 11180 g for 10 min), the combined supernatants were dried in vacuum. Each of the aqueous extracts was separately reconstituted into 600

µL phosphate buffer (K2HPO4/NaH2PO4, 0.1 M, pH 7.4, 50% v/v D2O) containing 0.005%

TSP-d4 as chemical shift reference. Following centrifugation, 550 µL of each extract was transferred into 5 mm NMR tube for NMR analysis.

1H NMR spectra of all the biological samples were recorded at 298 K on a Bruker

Avance III 600 MHz spectrometer (operating at 600.08 MHz for 1H) equipped with a

Bruker inverse cryogenic probe (Bruker Biospin) (111). One-dimensional NMR spectra

88 were procured for each sample employing the first increment of NOESY (Nuclear

Overhauser effect spectroscopy) pulse sequence (NOESYPR1D). To better facilitate NMR signal assignments, two-dimensional (2D) NMR spectra were acquired and processed for each selected sample.

5.1.10 Statistical analysis

Data are shown as mean ± SEM. Differences among groups were analyzed by one- way ANOVA followed by Fisher’s exact test (Prism 6, GraphPad, La Jolla, CA). To account for any possible outliers in our data, we used the Rout test to detect possible outlier(s), and if any, the outlier(s) were substituted by the 95th percentile value(s). When variances were unequal, data were transformed to log10 values before analysis, as noted in the legends to figures. The Pearson’s correlation coefficient was also calculated for the qRT-PCR and liver TG data. For pos-hoc tests, P < 0.05 was considered significant.

For NMR analysis, the data from each spectrum were corrected using the internal standard and were displayed as relative abundance. The NMR spectra shown in Fig. 5.6 represent an average chemical shift of each metabolite in each group. The spectra were calibrated to TSP-d4 at δ 0.00. After manual phase- and baseline-corrections, each 1H

NMR spectrum (δ 0.5-9.5) was segmented into bins with equal width of 0.004 ppm (2.4

Hz) using AMIX software package (V3.8, Bruker Biospin, Germany). Multivariate data analysis was then conducted using the SIMCA-P+ package (V13.0, Umetrics, Sweden).

Principal component analysis (PCA) was performed on the mean-centered data to generate an overview and identify outliers. Orthogonal projection to the latent structure with discriminant analysis (OPLS-DA) was subsequently conducted using the unit-variance

89 scaled NMR data as X-matrix and class information as Y-matrix. The quality of OPLS-DA models was ensured with a seven-fold cross-validation method and further assessed with the CV-ANOVA method. After back-transformation, the loadings from the OPLS-DA models were plotted using an in-house developed Matlab script (V7.1, The Mathworks,

MA) with correlation coefficients color-coded to reflect the significance of inter-group differentiations for all metabolites. The red colored variables (or metabolites) were more significant contributors to inter-group differences than cool-colored ones (e.g., blue). A cutoff value of 0.7 for the correlation coefficient was chosen to select metabolites with statistical significance between groups (P < 0.05). Student’s t-test was performed to analyze NMR data for liver and plasma.

5.2 Results

5.2.1 Body weight and dietary intake

The body weighs of the HCD groups at the first two weeks were significantly lower than that in the chow-fed mice, and the mice fed-HCDF had a decrease in the body weight, as compared to chow group, but did not differ among the groups fed high carbohydrate- based diets (Fig. 5.1). The average intake of each group fed a high carbohydrate-based diet was 15.6 mL/d, with no significant difference among the 5 groups.

90

Figure 5.1. Body weight in C57BL/6J mice given a high carbohydrate diets with

3%Intralipid® (HCD), 13.5% Omegaven® (HCDF), ClinOleic® (HCDO), or Intralipid®

(HCDS) for 5 wk. Data are shown as mean ± SEM. n=8/group. *, P < 0.01; +, P < 0.05.

HCD, high carbohydrate diet.

91 5.2.2 Relative liver weight, liver TG, and H&E staining

In the present study, HCD-5wk mice had the highest liver weight relative to body weight after 5 weeks, as compared to HCD-2.5wk and HCD+13.5%LE groups, while

HCDF-fed mice had the lowest relative liver weight (Fig. 5.2A). For the hepatic TG content

(Fig. 5.2B), mice with preexisting steatosis, determined by the value from the HCD-2.5wk group compared to mice never exposed to HCD (chow-fed mice, denoted 0 week), continued to accumulate hepatic TG when fed a HCD until 5wk, but mice fed HCD supplemented with 13.5% LE for the last 2.5 week had a significantly lower hepatic TG concentration (P < 0.01), as compared to HCD-5wk (Fig. 5.2B). Additionally, the extent of TG accumulation was greatly improved by either Omegaven® or ClinOleic® supplementation (Fig. 5.2B), which were significantly lower than that in the HCD-2.5wk group. The mice fed a HCD with Omegaven® supplementation had the lowest hepatic TG, which did not differ from the chow-fed mice. This difference indicates a reversal of hepatic lipid accumulation during the period in which Omegaven® or ClinOleic® was included in the diet.

We then determined the morphology in the liver using H&E staining (Fig. 5.3).

Macrovascular steatosis was visible in the livers of the mice fed HCD for 2.5wk (Fig. 5.3B) and 5wk (Fig. 5.3C), but not in the chow-fed mice (Fig. 5.3A). Visually, lipid accumulation in HCDF, HCDO, and HCDS (Fig. 5.3D-F) were all decreased, as compared to HCD-5wk

(Fig. 5.3C), which were consistent with hepatic TG level (Fig. 5.2B). These results indicated that administration of Omegaven®, ClinOleic®, or Intralipid® to mice fed HCD can cease or ameliorate the development of hepatic steatosis.

92

Figure 5.2. Relative liver weight and hepatic TG in C57BL/6J mice given a high carbohydrate diets with 3%Intralipid® (HCD), 13.5% Omegaven® (HCDF), ClinOleic®

(HCDO), or Intralipid® (HCDS) for 5 wk. The hepatic TG level shown as 0 wk in the panel B represents the value of chow-fed mice used as a baseline. Data are shown as mean ± SEM. n=8-9/group. Different letters within a panel indicate statistical difference among the mice fed HCD-based diets, P < 0.01. HCD, high carbohydrate diet; TG: triacylglycerol.

93

Figure 5.3. Representative photomicrographs of liver sections. The image from chow-fed group serves as a reference group, and the images from other groups are selected as representative (n=4/group). Original magnification: 200X. Purple: nuclei. HCD: high carbohydrate diet; HCDF: high carbohydrate diet with 13.5%Omegaven®; HCDO: high carbohydrate diet with 13.5% ClinOleic®; HCDS: high carbohydrate diet with 13.5%

Intralipid®; LE: lipid emulsion.

94 5.2.3 Transcript levels for genes of de novo lipogenesis

To further explore whether LEs can alter the expression of genes in the de novo lipogenesis pathway, a pathway contributing to lipid accumulation, we firstly measured the hepatic transcriptional factors that are involved in lipid metabolism, and the results showed that, in the presence of HCD, a longer period of time apparently elevated the level for peroxisome proliferator-activated receptor-alpha (Ppar-α) but did not alter the mRNA expression for Ppar-γ, and Srebpf1 (Fig. 5.4A), the two transcriptional factors involved in the de novo lipogenesis. Omegaven® supplementation, on the other hand, suppressed the mRNA levels for Ppar-α, Ppar-γ, and Srebpf1 (Fig. 5.4A), which were consistent with the transcript levels for the genes encoding enzymes, including ATP-citrate lyase (Cly), acetyl-

CoA carboxylase-1 (Acc1), fatty acid synthase (Fasn), stearoyl-CoA desaturase-1 (Scd1)

(Fig. 5.4B). Additionally, the mRNA for Fasn and Scd1 in the HCDS-fed mice were significantly higher than that in the HCDF group but were significantly decreased, as compared to HCD-5wk and HCDO groups. With dietary PUFA supplementation, including

HCDF and HCDS in this study, it seemed that Fasn and Scd1 mRNA were suppressed depending on the extent of unsaturation (Fig. 5.4B).

Next, we then determined the mRNA levels for lipid oxidation to confirm whether

HCD or LE supplementation would alter lipid oxidation in the liver. The results indicated that the expression of acyl-CoA oxidase-1 (Acox1) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Pgc-1α) were decreased in the HCDF and HCDS groups, as compared to the mice fed a HCD for 5 weeks; whereas, only for Acox1 was there significant reduction in the HCDO group (Fig. 5.4C), as compared to HCD-5wk group.

95 Due to the fact that bile acid plays a crucial role in lipid absorption and that the mice were provided dietary lipid supplementation through enteral access route, we assessed genes related to bile acid synthesis and export. The analysis indicated that Omegaven® supplementation lowered expression of cytochrome P450 (Cyp) 7a1, Cyp8b1, and the bile salt export pump (Abcb11) (Fig. 5.4D). Moreover, the relative expression of patatin-like phospholipase domain-containing protein 3 (Pnpla3) and fibroblast growth factor (Fgf)-21 are shown to be associated with hepatic lipogenesis (89, 90). With an increase in the duration of feeding a HCD, it seems that Pnpla3 and Fgf-21 play an opposite role in the mouse liver (Fig. 5.4E). The present study indicated that HCD-5wk had a higher Pnpla3 but had a lower Fgf-21, as compared to HCD-2.5wk group; whereas only for the mice fed a HCD with Omegaven® supplementation had the lowest levels for both genes (Fig. 5.4E).

Additionally, metabolic dysregulation and inflammation have been shown to contribute to the progression of NAFLD (129). Therefore, we measured the transcript level for serum amyloid A (Apcs) and nuclear factor (NF)-κB-induced macrophage chemoattractant protein-1 (Mcp-1/Ccl-2), which signal inflammation and recruitment of inflammatory cells, respectively. Fig. 5.4E showed that, after Omegaven®, ClinOleic®, or

Intralipid® supplementation, the level for Ccl2 was greatly improved, which were not different from chow-fed mice. For Apcs expression, HCDF- and HCDS-fed mice had the lowest mRNA level (Fig. 5.4E).

96

97 Figure 5.4. Relative mRNA transcripts involved in lipogenesis and lipid metabolism in the liver of C57BL/6J mice fed a HCD with 3%Intralipid®, 13.5%Omegaven®,

13.5%ClinOleic®, or 13.5%Intralipid®. (A) Ppar-α, Ppar-γ, and Srebpf1, the transcriptional factors involved in lipid metabolism; (B) Cly, Acc1, Fasn, and Scd1; (C)

Acox1, Cpt-1α, Acad1, and Pgc-1α; (D) Cyp7a1, Cyp8b1, and ABCb11; (E) Pnpla3, Fgf-

21, Ccl2, and Apcs. Data are shown as mean ± SEM. n=8-9/group. The log-transformed data were used for the relative mRNA of Scd1, Pnpla3, and Fgf-21 before one-way

ANOVA, and the significant letters shown on the graphs for these three genes were marked based on the analysis of the transformed data set. Different letters indicate statistical difference among groups, P < 0.01 (one-way ANOVA). ABCb11: ATP-binding cassette, sub-family B member 11; Acad1: acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain; Acc1, acetyl-CoA carboxylase-1; Acox1: acyl-CoA oxidase; Apcs: Amyloid P

Component, Serum; Ccl2: Chemokine (C-C Motif) Ligand 2; Cly, ATP-citrate lyase; Cpt-

1α: Carnitine palmitoyltransferase I; Cyp7a1: cytochrome P450 7a1; Cyp8b1: cytochrome

P450 8b1; Fasn, fatty acid synthase; Fgf21, fibroblast growth factor-21; HCD, high carbohydrate diet; Pgc-1α: peroxisome proliferator-activated receptor gamma coactivator-

1 alpha; Pnpla3, patatin-like phospholipase domain-containing protein 3; Ppar-α: peroxisome proliferator-activated receptor alpha; Ppar-γ: peroxisome proliferator- activated receptor gamma; Scd1, stearoyl-CoA desaturase; Srebpf1, sterol regulatory element-binding transcription factor 1.

98 5.2.4 Hepatic fatty acid composition

In order to confirm the mRNA data, we continued to examine the concentrations of hepatic total FA using quantitative GC-MS. As shown in Fig. 5.5, feeding a HCD for additional 2.5 week elevated the concentration of C16:0 fatty acids, as compared to HCD supplemented with 13.5%LE groups; whereas the mice fed HCDF had the lowest levels of

C14:0 and C16:0 fatty acids but a higher concentration of C18:0 (Fig. 5.5A). In the presence of HCD alone, both HCD-2.5wk and HCD-5wk groups had highest levels of

MUFA in the liver (Fig. 5.5B); whereas, the mice fed a HCD supplemented with 13.5%

Omegaven®, 13.5%ClinOleic®, or 13.5% Intralipid® had a decrease in the concentrations of C16:1n7 and C18:1n7, and an even stronger reduction in the levels of C18:1n7 and

C18:1n9 was found in the HCDF-fed mice (Fig. 5.5B), which were not different from that in the chow-fed mice. Additionally, the hepatic levels of C20:4n6 and C22:6n3 in the HCD-

5wk were lower than that in the HCD-2.5wk group (Fig. 5.5C). HCD supplemented with

Omegaven® or Intralipid® elevated the concentrations of C22:6n3 and C18:2-n6, respectively (Fig. 5.5C), suggesting that hepatic FA compositions were partially regulated by the exogenous lipid. Overall, the gene and metabolic signals are consistent and support regulation of de novo lipogenesis as important for further study.

The n-6:n-3 fatty acid ratio and indices of lipogenic and SCD1 activity have been reported to be increased in NAFLD (74, 92, 93). These indices were estimated from 1) the ratio of total n-6 to n-3 fatty acids; 2) the ratio of C16:0 to C18:2-n6 fatty acid for lipogenic index; and 3) the ratio of C18:1-n9 to C18:0 fatty acid for SCD1 activity index. The results

(Fig. 5.5D) showed that the ratio of n-6:n-3 fatty acids was increased by ClinOleic® and

Intralipid® intervention and experimental time period (Fig. 5.5D), whereas HCDF-fed mice

99 had the lowest n-6:n-3 ratio. An opposite pattern was found in the lipogenic index:

ClinOleic® or Intralipid® supplementation reduced lipogenesis, and HCDF group exhibited the highest one, as compared to HCD-2.5wk or HCD-5wk group. For the SCD1 activity index, HCDF- and HCDS-fed mice had lower SCD1 activity index, as compared to HCD-

5wk and HCDO, especially the index that did not differ between chow- and HCDF-fed mice. There was a time-dependent response in the hepatic cholesterol in the mice fed a

HCD for 2.5 weeks and 5 weeks (Fig. 5.5E), and hepatic cholesterol in the HCDF and

HCDS groups were significantly higher as compared to HCD-5wk group.

Previous studies have shown that EFA deficiency is a cause of steatosis (48), and a ratio of the triene (C20:3-n9) to tetraene (C20:4-n6) is used to identify EFA deficiency (47).

In the present study, the ratio of C20:3 to C20:4 fatty acids in the liver was less than 0.2 in both HCD-2.5wk and HCD-5wk groups (Fig. 5.5F). Therefore, EFA deficiency can be ruled out as a confounding factor in the development of hepatic steatosis in mice fed a

HCD.

100

101 Figure 5.5. Total fatty acids, lipogenic, and SCD1 activity indices in the liver of mice fed

HCD or HCD+LE for 5 wk. (A) Hepatic levels of saturated fatty acid, P < 0.05; (B)

Concentration of monounsaturated fatty acids in liver, P < 0.01; (C) Hepatic levels of polyunsaturated fatty acids, P < 0.05; (D) n6:n3 fatty acid ratio and indices of lipogenic and SCD1 activity, P < 0.01; (E) Hepatic cholesterol level in the liver, P < 0.01; (F) The triene:tetraene ratio, P < 0.01. The indices in the panel D were estimated from 1) the ratio of [C18:2-n6 and C20:4-n6] to [C20:5-n3 and C22:6-n3]; 2) the ratio of C16:0 to C18:2- n6 fatty acid for the lipogenic index; 3) the ratio of C18:1-n9 to C18:0 fatty acid for the

SCD1 activity index. Data are shown as mean ± SEM. n=8-9/group. Different letters indicate statistical difference among groups. HCD, high carbohydrate diet; LE, lipid emulsion; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid; T/T ratio: triene/tetraene ratio.

102 5.2.5 Liver NMR analysis

To better understand the metabolic change caused by HCD and HCD+13.5%LEs, we then determined the total lipids and other metabolites in the liver using NMR analysis.

Cross-validated scores plots indicated the quality indicators (R2X and Q2 in Fig. 5.6A-E) of the comparatives from the two groups were distinctive, and the relative abundance in all groups were quantified in the Table 5.3. Based on the sample size (n=8/group) in this analysis, differences are considered as significant only when the color of each peak is in the yellow color range or above (the cut-off value is 0.6 on the color bar); the metabolites with statistical significance were labeled in the corresponding color-coded loading plots.

The scores plots (Fig. 5.6A-E) indicated that there were two clusters in each comparison, and the loadings plots revealed that HCD supplemented with 13.5% ClinOleic® decreased the level of total lipids, as compared to HCD-5wk group (Table 5.3), and LEs supplementation did not change hepatic glucose level. In contrast, the levels of choline and its derivatives, phosphocholine, in mice fed HCD+13.5%LEs were significantly higher than that in the HCD-fed mice. Additionally, Omegaven® supplementation (HCDF) increased the metabolites in the liver including oxidized glutathione, succinate, glutamine, phenylanine, and branched-chain amino acids (Fig. 5.6C-E and Table 5.3), as compared to HCD-5wk group. The HCD-2.5wk and HCD-5wk groups did not differ in the hepatic metabolites, except the levels of glucose and glycine (Table 5.3).

103

104 Figure 5.6. OPLS-DA score plots and loading plots derived from NMR spectra of the liver obtained from mice in the HCD groups in this study. (A) Comparison between HCD-5wk and chow groups; (B) Comparison of HCDF and chow groups; (C) Comparison of HCDF and HCD-5wk groups; (D) Comparison of HCDO and CHDF groups; (E) Comparison of

HCDS and HCDF groups. The NMR spectra of each group represent an average chemical shift of each metabolite. Data in panel C are shown as mean ± SEM. n=8/group. Different letters indicate statistical difference among groups, P < 0.05 (one-way ANOVA). The color bar corresponds to the coefficient of the variables in the separation between two groups

(cutoff value: 0.6). Positive signals correspond to the metabolites present at increased concentrations in the mice fed HCD-5wk, HCDF, HCDO, or HCDS; the negative signals correspond to the metabolites present at decreased concentration in the chow, HCD-5wk or HCDF group. AMP, adenosine 5’-monophosphate; GPC: glycerophosphocholine;

GSSG: oxidized glutathione; PC: phosphocholine; TMAO: trimethylamine N-oxide.

105

Table 5.3. Relative abundance for the hepatic metabolites analyzed by NMR analysis

Chow HCD-2.5wk HCD-5wk HCDF HCDO HCDS Amino Acids Relative abundance BCAA 27.0±1.04a 16.7±0.38c 16.1±0.39c 21.8±0.89b 16.2±0.38c 16.7±1.02c Glutamine 12.5±0.58c 14.1±0.81b,c 14.3±0.72b,c 16.5±0.54a 15.6±0.77a,b 16.0±0.62a,b Alanine 21.4±0.7a,b 22.9±1.77a,b 24.2±0.86a 19.1±0.57c 23.8±0.98a 20.0±0.71b,c Glycine 16.9±0.29b 16.3±0.38b 19.2±0.29a 17.1±0.26b 17.2±0.36b 17.2±0.42b Taurine 119±1.17c 137±3.64a,b 132±3.59a,b 128±1.73b,c 142±3.02a 137±4.94a,b Phenylanine 2.97±0.05a 1.89±0.12b 2.10±0.21b 2.61±0.21a 1.86±0.16b 1.98±0.14b Tyrosine 1.55±0.03a 1.10±0.07c 1.13±0.09c 1.31±0.08b 1.02±0.08c 1.03±0.05c

Other Metabolites Total lipids 37.4±1.36a 29.2±3.78b 27.3±2.43b 25.0±1.78b 20.8±1.51c 23.0±2.01b,c GSSG 16.5±0.79c 17.3±1.54b,c 20.1±1.27b 22.8±1.05a 18.8±0.98b 17.8±0.85b Choline 7.70±0.22a 3.53±0.19c 3.27±0.31c,d 7.21±0.53a 4.29±0.19b,c 4.98±0.21b PC/GPC 14.4±0.65a 5.88±0.31c 6.08±0.74c 9.02±0.46b 12.0±1.63a 10.7±1.33a,b TMAO 65.2±1.28a 57.9±2.11b 57.9±2.23b 55.5±1.83b,c 62.5±1.16a,b 58.8±1.74b AMP/ADP 2.66±0.15b 3.36±0.27a,b 4.13±0.36a 3.05±0.23a,b 3.98±0.26a 3.62±0.33a,b Succinate 4.22±0.14a 3.16±0.20b 3.42±0.22b 4.56±0.11a 3.32±0.24b 3.26±0.19b Glucose 3.92±0.06c 4.61±0.11a 4.36±0.04b 4.27±0.04b 4.40±0.11a,b 4.36±0.10b

Data are means ± SEM. n=6/group. Different letters indicate differences between the treatment groups, P < 0.05. AMP: adenosine monophosphate; ADP: adenosine diphosphate; BCAA: branched-chain amino acid; HCD: high carbohydrate diet; HCDF: high carbohydrate diet with 13.5% Omegaven®; HCDO: high carbohydrate diet with 13.5% ClinOleic®; HCDS: high carbohydrate diet with

13.5% Intralipid®; GPC: glycerophosphocholine; GSSG: oxidized glutathione; PC: phosphocholine; TMAO: trimethylamine N-oxide.

106 5.2.6 Transcript levels for genes of lipolysis in adipose tissue

In the presence of HCD, the adipose tissue weight relative to body in the chow-fed mice was significantly lower than that in the mice fed a HCD-based diets (Fig. 5.7A), and

Omegaven® supplementation significantly decreased relative adipose tissue weight, as compared to the mice-fed HCDO or HCDS.

To further assess the effect of HCD in the adipose tissue, we determined the transcript levels involved in lipid metabolism in adipose tissue. The results showed that the mRNA for adipose triglyceride lipase (Atgl) and hormone-sensitive lipase (Hsl) were elevated in the HCD-5wk, HCDO, and HCDS groups; whereas there was no significant difference in the levels of Atgl and Hsl between chow- and HCDF-fed mice (Fig. 5.7B). On the other hand, HCD-based diets increased the mRNA for fatty acid translocase (Fat/Cd36), especially HCDO- and HCDS-fed mice, which had the highest expression for Cd36.

Additionally, peroxisome proliferator-activated receptor-gamma (Ppar-γ) has been shown to regulate adipogenesis in adipose tissue (130) and a potential modulator of whole body lipid metabolism (131, 132). Mice fed HCD with either ClinOleic® or Intralipid® had the highest mRNA level for Ppar-γ (Fig. 5.7C), and the expression in the HCD-5wk group did not differ from that in the chow and HCDF groups (Fig. 5.7C). With Omegaven® supplementation, HCDF group had an elevation in the mRNA level for peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Pgc-1α), but exhibited a reduction of Fgf-21 in adipose tissue, as compared to HCD-2.5wk and HCD-5wk groups

(Fig. 5.7C).

107

108 Figure 5.7. Relative adipose tissue weight and the transcripts involved in lipogenesis and lipid metabolism in the adipose tissue of C57BL/6J mice fed chow or a HCD with 3%

Intralipid®, 13.5% Omegaven®, 13.5%ClinOleic®, or 13.5% Intralipid®. (A) adipose tissue weight relative to body weight; (B) Atgl, Hsl, and Cd36; (C) Ppar-γ, Pgc-1α, and Fgf-21.

Data are shown as mean ± SEM. n=6/group. Different letters indicate statistical difference among groups, P < 0.05 (one-way ANOVA). Atgl, adipose triglyceride lipase; Cd36, cluster of differentiation 36 or fatty acid translocase; Fgf21, fibroblast growth factor-21;

HCD, high carbohydrate diet; Hsl, hormone-sensitive lipase; Pgc-1α: peroxisome proliferator-activated receptor gamma coactivator-1 alpha; Ppar-γ: peroxisome proliferator-activated receptor gamma;

109 5.2.7 Plasma glucose, insulin, FGF-21, and alanine aminotransferase

There was no significant difference among groups in the level of plasma glucose (Fig.

5.8A). The mice fed a HCD for 5 weeks exhibited a reduction in the concentration of plasma insulin, but LEs supplementation including Omegaven®, ClinOleic®, and

Intralipid® did not alter plasma insulin level (Fig. 5.8B). Additionally, LEs supplementation improved hepatic inflammation, as compared to HCD-2.5wk, but ALT activity in the HCD-5wk did not differ from the mice fed a HCD supplemented with LEs

(Fig. 5.8C). Plasma FGF21 protein, on the other hand, was decreased by Omegaven® supplementation (Fig. 5.8D).

110

Figure 5.8. Plasma glucose (A), plasma insulin level (B), alanine aminotransferase activity

(C), and plasma FGF21 protein (D) in mice fed chow or a HCD with 3% Intralipid®, 13.5%

Omegaven®, 13.5% ClinOleic®, or 13.5% Intralipid®. Values are means ± SEMs, n = 4-

5/group. One-way ANOVA was used to compare the treatments. Different letters indicate differences between the treatment groups, P < 0.05. ALT, alanine aminotransferase;

FGF21, fibroblast growth factor 21; HCD, high- carbohydrate diet.

111 5.2.8 Liver RNA sequencing pathway analysis

To better understand the reversal effect of Omegaven® supplementation on the gene expression in the liver of the mice with HCD-induced steatosis, hepatic transcriptomics was determined by RNA-Seq analysis for mice fed a HCD or a HCDF. Among the 12,773 gene sets that were detected, 600 genes were differentially expressed with adjust P value

< 0.01, and about 500 hepatic genes were altered in response to a HCD or a HCDF (Table

S4 in the Appendix), which were classified in the Table 5.4 using the DAVID web tool.

The table showed that the major changes of the transcriptomics were the genes associated with lipid metabolism, glucose metabolism, and acute inflammatory response. There were sixty-eight genes enriched in the process of oxidation-reduction, and over a hundred genes were involved in the lipid and glucose metabolic processes, indicating high demands of oxidation-reduction reaction in the HCD group (Table 5.4). However, inflammatory response-associated genes were altered by HCDF, in which the mice fed HCDF had higher levels for serum amyloid A1 (Saa1), Saa3, and cluster of differentiation 163 (Cd163), but had reductions in the levels for nuclear protein-1 (Nupr1), vanin 1 (Vnn1), and toll-like receptor-5 (Tlr-5), the genes associated with inflammatory response (Table 5.5).

Furthermore, as suggested in the previous studies that the extent of liver TG accumulation can predict the risk of cardiovascular disease in patients with lean NALFD without insulin resistance (15, 133). To confirm this, the genes involved in the insulin signaling pathway (Fig. 5.9) were mapped using web databases, DAVID and KEGG. The results indicated that the upstream of signaling pathways were not altered by any of the diets, but the downstream pathways including glycolysis, gluconeogenesis, lipid synthesis, and protein synthesis were upregulated by HCD. Additionally, plasma insulin level

112 between HCD and HCDF (Fig. 5.8B) was not significant difference, suggesting that the

HCD used in the present study did not dysregulate insulin signaling pathway.

We further visualized the selected transcriptomic data using MultiExperiment Viewer for the heat map (Fig. 5.10). The differential expression analysis indicated that lipid metabolism including lipogenesis, unsaturated fatty acid synthesis, lipid transport, lipid droplet, and arachidonic acid metabolism was significantly elevated in the mice fed a HCD, and that glucose metabolism, especially in the pyruvate metabolic pathway that serves as a central role of the metabolic crosstalk between glucose and lipid, was also increased in the HCD group (Fig. 5.10). Moreover, the gene expression associated with glutathione metabolism was significantly elevated by a HCD, indicating the turnover rate of glutathione might also be increased. In contrast, HCDF-fed mice had reductions on the genes associated with lipid and glucose metabolism, except the genes involved in energy homeostasis (Enho) and glutathione S-transferase P (Gstp1) in the glutathione pathway

(Fig. 5.10).

113 Table 5.4. The related biological processes of the genes altered by HCD and HCDF

Biological processes Genes P value Oxidation reduction 68 1.2E-19 Steroid metabolic process 27 7.5E-13 Lipid biosynthetic process 33 4.1E-11 Lipid localization 20 4.2E-9 Coenzyme metabolic process 20 2.7E-8 Cofactor metabolic process 22 6.2E-8 Acute inflammatory response 14 4.8E-7 Chemical homeostasis 30 7.6E-7 Hexose metabolic process 18 7.6E-6 Monosaccharide metabolic process 19 1.0E-5 Cellular amino acid derivative metabolic process 16 1.3E-5 Homeostatic process 37 1.4E-5 Carboxylic acid biosynthetic process 15 5.5E-5 Organic acid biosynthetic process 15 5.5E-5 Glucose metabolic process 14 2.0E-4 Response to wounding 23 4.6E-4 Inflammatory response 17 8.1E-4 Response to endogenous stimulus 15 8.9e-4 Response to hormone stimulus 14 9.7E-4 Cellular homeostasis 21 2.2E-3 Generation of precursor metabolites and energy 16 8.6E-3 Triglyceride metabolic process 6 3.5E-3 Glutathione metabolic process 5 4.5E-3

The biological processes listed here were selected based on the Gene Ontology from the DAVID and were arranged by the P value.

114 Table 5.5. The gene expression involved in acute inflammatory response in HCD- and

HCDF-fed mice

Gene ID Log2 fold change P value Adjust P value Vnn1 1.23 2.83E-12 5.83E-10 C9 -1.02 1.15E-11 2.10E-09 Saa4 -1.10 8.73E-11 1.37E-08 C2 -0.65 5.28E-07 3.37E-05 C8b -0.75 9.24E-07 5.47E-05 Nupr1 1.37 6.67E-06 0.000309 Serpinf2 -0.49 1.95E-05 0.000771 Hc -0.45 2.59E-05 0.000972 Ahsg -0.56 6.18E-05 0.001939 Cd163 -0.95 9.62E-05 0.002790 Saa1 -0.86 0.000113 0.003127 Saa3 -1.10 0.000116 0.003183 Tlr5 1.06 0.000120 0.003286 Cfb -0.40 0.000387 0.008633 The P values and adjust P values were generated by DESeq software in which

Benjamini-Hochberg (BH) method was used to calculate adjusted P value, and the

fold change was estimated by the ration of HCD to HCDF.

115 116 Figure 5.9. An overview of genes involved in the insulin signaling pathway

(figure from DAVID/KEGG). C57BL/6J mice were fed either a HCD or a

HCDF. Each node represents a gene in the insulin signaling pathway. n = 3-

4/group. Red nodes indicated upregulated genes in the mice fed HCD, and black nodes showed no significant difference between groups. ACC: acetyl-CoA carboxylase; ERK1/2: extracellular signal-regulated protein kinases 1 and 2;

HCD: high carbohydrate diet; HCDF: high carbohydrate diet with 13.5%

Omegaven®; FAS: fatty acid synthase; FBP: fructose biphosphatase 1; Flot1: flotillin-1; GYS: glycogen synthase; MNK: MAP kinase-interacting serine/ threonine-protein kinase 2 ; PGC-1α: peroxisome profilferative activated receptor-1 alpha; PP1: protein phosphatase-1; PYK: pyruvate kinase; SREBP-

1C: sterol regulatory element binding transcriptional factor-1; TSC1: tuberous sclerosis-1

117

118 Figure 5.10. Differential expression analysis in the liver of C57BL/6J mice fed a HCD with 3% Intralipid® and HCD with 13.5% Omegaven® (HCDF). Fold change was shown as log2, and red and green colors indicate up- and down-regulation of the gene, respectively. n = 3-4/group. HCD: high carbohydrate diet; HCDF: high carbohydrate diet with 13.5%

Omegaven®.

119 5.3 Discussion and Summary of Study III

We have previously shown that 13.5% Intralipid® can ameliorate the early stage of steatosis and the preexisting steatosis in mice fed a HCD (Fig. 3.2 in the Chapter 3 and Fig.

4.2 in the chapter 4), and it also attenuated steatosis and the inflammatory genetic markers in the liver of a non-obese mouse model (66). In the present study, we compared three LEs, including Intralipid®, Omegaven®, and ClinOleic®, for their ability to reverse hepatic TG accumulation after the onset of steatosis. Here, we discuss first the HCD with 3%

Intralipid® and the accumulation of lipid in the liver, and then focus on the reversal effect of Omegaven® in the model with preexisting steatosis.

One of the main findings in this study was that the duration of induction of hepatic steatosis affected lipid metabolism, by decreasing the mRNA levels for lipid oxidation and

Scd1 and by elevating liver glucose and glycine level. A previous study (114) indicated that SFA and MUFA play a crucial role in the development of steatosis. The present study showed that mice fed HCD-5wk had almost no changes in the concentrations of C14:0,

C16:1-n7, C18:1-n7, C18:1-n9, and C18:2-n6 (Fig. 5.5A, Fig. 5.5B, and Fig. 5.5C), suggesting that consuming a HCD with 3% Intralipid® for a longer period of time might not alter the hepatic levels of SFA and MUFA due to the fact that the transcripts for Ppar-

γ, Srebpf-1, Acc1, and Fasn remain unchanged (Fig. 5.4A and Fig. 5.4B). In contrast, in the mice fed HCD for 5 weeks, the n6:n3 fatty acid ratio (Fig. 5.5D), a positive indicator for NAFLD (74), was significantly elevated by the duration of steatosis induction, and the concentration of TG in the liver of mice fed a HCD for 5 weeks was also significantly increased, as compared to the HCD-2.5wk group (Fig. 5.2B), which was confirmed by

120 H&E staining (Fig. 5.3). Lipid oxidation associated genes, on the other hand, were reduced by the duration of steatosis induction (Fig. 5.4C), suggesting that with a longer time of exposure to HCD, endogenous lipogenesis might not play a crucial role in the development of steatosis; instead, a reduction in the lipid oxidation might partially contribute to the TG accumulation in the mice fed a HCD. Another plausible explanation for the hepatic TG accumulation in the HCD-5wk group is that a surplus of glucose and glycine, a substrate for pyruvate metabolism, (Table 5.4) in the liver of the HCD-5wk mice may induce glycolysis and/or gluconeogenesis to generate glycerol backbone for TG synthesis.

Furthermore, adipose tissue mRNA (Fig. 5.7 B) revealed that the transcripts for lipolysis including Atgl and Hsl were elevated in response to a longer duration of steatosis induction, indicating an elevation in lipid turnover rate in the adipose tissues and a possibility of an elevation in the concentrations of free FA and non-esterified FA in plasma (134), which

FAs may be further transported back to the liver and be repacked to synthesize TG. Lastly, differential expression analysis demonstrated that the upstream of insulin signaling pathway did not alter by either introduction of HCD or HCD with LEs supplementation

(Fig. 5.9); rather, the downstream pathways including de novo lipogenesis and glucose metabolism (Table 5.4) were significantly elevated by the exposure to a HCD. Together, the consumption of HCD for a longer period of time than 5 weeks could be anticipated to further alter the levels of the transcripts and metabolites in plasma and adipose tissues, in terms of lipid and glucose metabolism. It would be of interest in future studies to determine how HCD regulates the levels of transcripts and metabolites in both the liver and plasma.

The second main finding in the present study was that 13.5% LEs supplementation successfully ameliorated lipid accumulation (Fig. 5.2B and Fig. 5.3), partially by

121 regulating the levels of total FAs (Fig. 5.5A-C) and hepatic metabolites (Table 5.3) after the onset of steatosis, especially 13.5% Omegaven® enriched in n-3 FA. We have previously shown that 13.5% Intralipid® prevents the development of steatosis and improves inflammation-associated genes (66, 89, 90). The present study indicated that the concentration of liver TG (Fig. 5.2B) was significantly attenuated by the three LEs supplementation, in which level was even reversed by Omegaven® and ClinOleic® intervention, as compared to the HCD-2.5wk group. Additionally, endogenous lipids, contributed by lipogenic genes, remain unchanged in HCD with ClinOleic® group but decreased significantly in HCD with Omegaven® (Fig. 5.4B), suggesting that in the presence of HCD, the extent of desaturation of the exogenous fat may be a factor regulating lipid accumulation and that n-3 FA may suppress de novo lipogenesis through Srebpf1- dependent mechanism (135). Moreover, exogenous PUFA has been shown to suppress lipogenic genes in liver (100). Our GC-MS analysis revealed that the intervention with

13.5%LE decreased the concentrations of C14:0, C16:0, C16:1-n7, C18:1-n7, and C18:1- n9 fatty acids (Fig. 5.5A and Fig. 5.5B) and increased the levels of C20:4-n6 and C22:6- n3 (Fig. 5.5C), concomitant with decreased hepatic mRNA for enzymes and transcription factors associated with de novo lipogenesis in mice fed HCDF or HCDS. On the other hand, maintaining the Krebs cycle working properly could be another explanation for a decrease in hepatic TG content. The mice that received 13.5% LEs supplementation had higher glutamine in the liver (Table 5.3), a substrate for α-ketoglutarate, but had lower alanine and glycine, amino acids that can be converted to pyruvate, (Table 5.3), indicating lipogenesis might be increased (Fig. 5.5D). Although HCDF-fed mice had the highest ratio for lipogenesis, it does not necessarily mean HCDF-fed mice had higher endogenous lipids;

122 rather, the ratio for which was estimated by the ratio of C16:0:C18:2-n6, and the concentration of C18:2-n6 was too low. Together, including 13.5%LEs into a HCD can further suppress endogenous lipogenesis and improve substrates for energy homeostasis.

Exogenous lipid in a form of Omegaven®, rich in n-3 fatty acids, was a beneficial factor in the present study with regard to transcriptomics and metabolites in the liver, but also raised a concern of acute inflammatory effect in this animal model (Table 5.5). In our studies, the effect of the three LEs intervention was significant for reversal of hepatic steatosis (Fig. 5.2B and Fig. 5.3), whereas 13.5% Omegaven® supplementation brought the liver TG back to the level that was not significantly different from that in the chow-fed mice (Fig. 5.2B), indicating that n-3 FA might be able to reverse TG accumulation after the onset of steatosis, which was consistent with Marsman et al. in which they used 1H- magnetic resonance spectroscopy to confirm the reversal of hepatic steatosis (136).

Additionally, the transcriptomic analysis (Table 5.3 and Fig. 5.10) revealed that the genes involved in lipid transport, de novo lipogenesis, unsaturated FA synthesis, and arachidonic acid pathway were all significantly increased. It is a possibility that lipid and glucose metabolism were dysregulated based on the evidence 1) that the lipolysis in the adipose tissue of the HCD-fed mice was increased (Fig. 5.7B), and mRNA levels for lipid transport in the liver were upregulated, suggesting that the import of free FA and/or non-esterified

FA to the liver might be increased; 2) that the genes associated with lipid oxidation (Fig.

5.10 and Table 5.3) did not catabolize the accumulated lipid; instead, they were upregulated in order to generate unsaturated FAs including arachidonic acids and/or n-3

FAs for the high demands of PUFA in the mice-fed HCD for cellular signaling and/or maintaining physiological functions of PUFA-derivatives; 3) that the genes involved in

123 glucose metabolism (Fig. 5.10) were elevated and the levels of glutamine and succinate, the intermediates in the Krebs cycle (Table 5.3), in the HCD-fed mice were reduced, indicating that these acetyl-CoA might not be able to be metabolized completely through the Krebs cycle to generate energy; rather, the liver in the HCD-fed mice required more substrates including alanine, glycine (Table 5.3) for de novo lipogenesis and PUFA synthesis.

Previous studies indicated that beige adipose tissue, a uncoupling protein-1(UCP1)- positive adipocyte, has been identified within white adipose tissue, especially in inguinal adipose tissue (137), and that fish oil induces UCP-1 upregulation (138) and mitochondria biogenesis in white adipose tissue (139). In the present study, although we did not observe an increase in Ucp-1 mRNA in the epididymal adipose tissue (eWAT), the transcript for

Pgc-1α in the eWAT of HCDF-fed mice was significantly elevated, as compared to HCD- fed mice (Fig. 5.7C), suggesting that mitochondria biogenesis might be increased by the

Omegaven® intervention. However, based on the data on adipose tissue, it remains unclear whether fish oil intervention will promote the development of beige adipocyte in eWAT.

It would be of interest in the future study to further explore the mechanism of how beige adipocytes develop after the intervention of n-3 FA in a lean NAFLD mouse model. A limitation of this study is that we did not measure the lipid composition and other metabolites in plasma and adipose tissue. Further studies are required to elucidate the crosstalk between liver and adipose tissue and gut in the non-obese mouse model with preexisting steatosis.

Studies indicated that cellular lipid droplets play a crucial role in cell signaling, cellular energy homeostasis, lipid mobilization, and the development of hepatic steatosis

124 (115, 117). Differential expression analysis revealed (Fig. 5.10) that the mRNA for perilipin 2 (Plin 2), Plin3, and Plin4, the genes encoding lipid droplet-associated proteins, were elevated, suggesting that lipid droplets in HCDF-fed mice might be reduced, as compared to HCD-5wk group. However, it is presently unclear what role exogenous n-3

FA plays in this physiological condition. It would be interesting for future studies to elucidate the mechanism of how HCD and/or PUFA regulate the synthesis and/or maintenance of lipid droplets.

In the present study, the inflammatory genes, Ccl2 and Apcs, were significantly decreased by 13.5% Omegaven® supplementation (Fig. 5.4E), as compared to HCD-5wk group; whereas the mRNAs for inflammatory response, including Saa1, Saa3, Cd163, and complements, were upregulated (Table 5.5), suggesting the innate immunity in HCDF mice was activated. It is possible that gut microbiota play a role in regulating pro- inflammatory factors, such as lipopolysaccharide which may activate serum amyloid A protein and complement system (140, 141). Therefore, further studies are required to determine whether HCDF is capable to alter gut microbiota.

EFA deficiency has been shown to be associated with hepatic steatosis (94), and the hepatic ratio of triene to tetraene fatty acid was utilized to investigate whether the non- obese mouse model fed HCD used in the present study developed this biochemical indicator of EFA deficiency. The triene:tetraene ratios shown in the Fig. 5.5F indicated that the duration of steatosis induction did not alter the triene:tetraene rations in HCD-

2.5wk and HCD-5wk groups, and the ratios in all groups were less than 0.2, suggesting that, by including 3% Intralipid® in the HCD, EFA deficiency can be fully ruled out in this non-obese NAFLD model.

125 In conclusion, Omegaven® supplementation has a stronger reversal effect on the preexisting steatosis than that of Intralipid® and ClinOleic®, in which Omegaven® increased the levels of substrates for TCA cycle, maintained the balance of glucose and lipid metabolism, and decreased endogenous fatty acid synthesis. These effects allow hepatocytes to mitigate or even reverse the preexisting TG accumulation in the liver, as well as to maintain a balanced macronutrient metabolism. These observations provide a plausible mechanism on how n-3 PUFA reverses hepatic lipogenesis and steatosis in the non-obese mouse model. Future studies are required to determine the effects of single n-3

PUFA and gut microbiota on inflammation and lipid metabolism in a mouse model of lean

NAFLD.

126 CHAPTER 6

DISSCUSSION AND FUTURE DIRECTIONS

The results from this dissertation, research improvements for future studies, and future directions are discussed in this chapter. By adjusting a HCD used in the mouse model published by Javid et al. (108), the lean NAFLD model without EFA deficiency serves as a convenient platform to examine the progression of hepatic steatosis and to determine whether treatments would work under conditions of lean NAFLD. In this dissertation, I examined how efficaciously the HCD-induced steatosis developed in the Chapter 3, which provided evidence-based results to estimate the experimental period for the Intralipid® reversal study in the Chapter 4, and lastly, I compared three LEs on their ability to reverse the progression of hepatic steatosis in the lean NAFLD mouse (Chapter 5). Here, I discuss

1) the dose of LEs added to HCD-based diets; 2) the effects of HCD-based diets on the development of steatosis; 3) the effect of exogenous lipids on glucose and lipid metabolism.

6.1 The dose of lipid emulsion added to a HCD

In the present studies, three Intralipid® doses were used to determine its ability on the prevention and reversal of steatosis in a lean NAFLD model. In order to compare the doses properly, the doses of lipid emulsion used in the previous studies (108, 118, 142) as well as ours (66, 89, 90) were converted to percent of total calorie per day (en-% per day), as shown in the Table 6.1. Intralipid® is known to provide EFA to patients receiving total parenteral nutrition and is important in preventing EFA deficiency-induced steatosis (47,

48), and a biochemical marker, the ratio of triene:tetraene, is utilized to determine EFA

127 deficiency (95). Javid et al. and Meisel et al. reported that the mice fed a HCD with 5.3 % and 2.1 % Intralipid®, respectively, did not develop EFA deficiency. In the present studies, on the contrary, the mice fed a HCD with 0.5% Intralipid® for 5 weeks (Fig. 4.4F in the

Chapter 4) had an increase in the triene: tetraene ratio at 0.67, which exceeded its threshold,

0.4. This study (discussed in the Chapter 4) was of longer duration than our 8-d study

(Chapter 3) and the 19-d study in the Meisel et al. (118), suggesting that, with continuous feeding of HCD for a longer period of time, a higher intake of EFA may be needed. Meisel et al. also pointed out that 2.1% Intralipid® given intravenously should be sufficient to ensure EFA adequacy.

The Intralipid® reversal study (Chapter 4) indicated that insufficient EFA added into the HCD may deplete substrates in the Krebs cycle in order to generate PUFA, e.g., linoleic acid or arachidonic acids, for physiological functions. In the current study in the chapter 5, we then increased the amount of Intralipid® to 3 en-% as a basal HCD diet, which not only significantly reduced the triene:tetraene ratio under 0.2, but also successfully induced hepatic steatosis in a lean mouse model (Fig. 5.2B and Fig. 5.3 in the Chapter 5). To further understand whether 3% Intralipid® was capable to alter the lipid metabolism in the mice with preexisting steatosis, I compared the concentrations of total fatty acids and total lipids in the liver between the two reversal studies, in which we started with adding 0.5%

Intralipid® to HCD as a basal liquid lipogenic diet, which was the Intralipid® reversal study in the chapter 4, and we observed that hepatic total fatty acids were elevated significantly, as compared to the ClinOleic®-Omegaven® reversal study (Fig. 4.4A-C and Fig. 5.5A-C).

Additionally, the overall lipids and unsaturated FA were also concomitantly elevated in the

Intralipid® reversal study (Fig. 4.3C and Table 5.3), suggesting a plausible mechanism to

128 the EFA deficiency-induced steatosis. Overall, by including 3% Intralipid® to the HCD, it can completely remove the confounding factor, the insufficient EFA in the diet, to the steatosis and can also serve as a lean NAFLD model in the absence of nutritional deficiencies and obesity.

6.2 Lean NAFLD mouse model

Given that lean NAFLD was independently associated with insulin resistance (8), and the extent of hepatic lipid was quantitatively associated with cardiovascular disease (17) and diabetes (18), which refers to as metabolically obese normal weight (MONW).

Previous studies indicated that MONW are more likely found in Asian population (15, 143), and the prevalence of lean NAFLD is being reported in different countries: 20 % in India

(144), 15.2 % in Japan (145), 15 % in China (146), 12 % in Greece (147), 12.6 % in South

Korea (148), Iceland (149), and the US (8). Thus, Therefore, understanding the etiology of lean NAFLD in the early stage of the development of steatosis becomes an urgent need.

The lean NAFLD mouse model was first estimated previously by Javid et al. (108), in which the extent of hepatic TG accumulation, detected by magnetic resonance spectroscopy, was improved dose-dependently by including 1.75 en-% and 5.3 en-%

Intralipid® to the PN diet in 19 days. Meisel et al. (118) also reported a moderate steatosis in the liver of the mouse fed a HCD with 2.1% Intralipid® given intravenously.

Additionally, Ito et al. (66) demonstrated that the mice fed a HCD supplemented with 4% and 13.5% Intralipid® had a dose-dependent improvement in the hepatic Srebpf1, suggesting that our previous work (90) and the result in the Fig. 5.2B were consistent with

Javid et al. and Meisel et al. and that the amount of omega-6-based LE plays a crucial role

129 in TG metabolism in this model. Together, the inclusion of 3% Intralipid® in HCD should be sufficient to prevent EFA deficiency and is capable to serve as a basal diet in exploring the development of hepatic steatosis in a lean NAFLD model.

130 Table 6.1. Comparisons of lipid emulsion dose

Lipid Emulsion (en%/ day)

Author, Year Ref. Mouse Strains Diet Given route Intralipid® ClinOleic® Omegaven®

Javid et al., 2005 (108) C57BL/6J PN I.V* and Oral 0; 1.75; 5.3 - -

Meisel et al., 2011 (118) C57BL/6J PN I.V* 0; 2.1 2.1 2.1

Kalish et al., 2013 (142, 150) C57BL/6J PN I.V* 0; 2.1 - 2.1

Ito et al., 2013 (66) C57BL/6J PN I.V+ and Oral 0.5; 4.0; 13.5 - -

Hao et al., 2014 (89) C57BL/6J PN Oral 0.5; 4.0; 13.5 - -

Hao et al., 2016 (90) C57BL/6J PN Oral 0.5; 13.5 - -

Huang et al. Table 3.1 and 4.1 C57BL/6J PN Oral 0.5; 13.5 - -

Huang et al. Table 5.1 C57BL/6J PN Oral 3.0; 13.5 13.5 13.5

EN%, percent of total calorie; I.V, Intravenous injection; PN, Parenteral nutrition formula. *, lipid emulsion was given from tail vein injection. +, lipid emulsion was given from retro-orbital sinus.

131 6.3 The effects of liquid HCD-based diets on the development of steatosis

The majority of experimental studies of NAFLD have utilized obese models, while little is known about the development of lean NAFLD or even its early stage of the development of hepatic steatosis. The present studies demonstrated a convenient and an affordable lean NAFLD model that can be utilized to determine transcriptional and metabolomic changes in the development of steatosis in mice with preexisting TG accumulation. Furthermore, Fig. 5.8B and Fig. 5.9 showed that the upstream of the insulin signaling pathway was not altered by the introduction of HCD, and the genes that were upregulated by a HCD were situated at the downstream pathways, e.g., lipid homeostasis and glucose metabolism, indicating that the model is capable to imitate at least the most important characteristics, the absence of insulin resistance and obesity (15, 143).

In the present studies, the induction of steatosis for 2.5 weeks elevated the genes and the metabolites related to lipogenesis and decreased the levels of the substrates involved in the Krebs cycle, suggesting that the metabolic pathways tended to proceed lipid biosynthesis in the liver. A previous study (114) indicated that SFA and MUFA play a crucial role in the development of steatosis. The present studies showed that mice fed HCD-

2.5wk had elevations in the concentrations of C14:0, C16:0, C16:1-n7, C18:1-n7, and

C18:1-n9 (Fig. 5.5A and Fig. 5.5B), suggesting that consuming a HCD with 3% Intralipid® for 2.5 weeks was sufficient to alter the hepatic levels of SFA and MUFA. qRT-PCR also confirmed that the increase in the liver MUFA in the HCD-2.5wk group is due to the fact that the mRNA for Scd1 was significantly elevated (Fig. 5.4B). In order to produce PUFA for other physiological purposes, the genes involved in the β-oxidation were concomitantly elevated (Fig. 5.4A and Fig. 5.4C) in the mice fed a HCD for 2.5 weeks. On the other hand,

132 the levels of succinate and BCAA, the intermediates in the Krebs cycle, in the liver were significantly reduced by the intervention of HCD, suggesting that lipid biosynthesis is predominately activated (Fig. 6.1). Additionally, although the adipose tissue weight relative to body weight in the HCD-fed mice for 2.5 weeks was significantly higher than that in the chow-fed mice (Fig. 5.7A), the genes involved in the lipolysis in the adipose tissues did not differ from that in the chow-fed mice (Fig. 5.7B), indicating that adipose tissue may not get involved in the early stage of the development of hepatic steatosis in a lean NAFLD model. The indices of n6:n3 ratio and lipogenesis (Fig. 5.5D), positive indicators for NAFLD (74), were significantly elevated by the HCD intervention, and the liver TG in mice fed a HCD for 2.5 weeks was also significantly increased (Fig. 5.2B), which was confirmed by H&E staining (Fig. 5.3).

With TG accumulation in the liver, it seems that Fgf21 was the gene that responded to the early stage of steatosis. The Fgf21 in both liver and adipose tissue, as well as FGF-21 protein in the plasma were significantly elevated, but the transcript for Fgf21 in the liver and adipose tissue went down by a longer duration of feeding a HCD, e.g., HCD-5wk group

(Fig. 4.5B, Fig. 5.4E and Fig. 5.7C). Although it is presently unclear how Fgf21 is regulated in the lean NAFLD model, previous studies (151, 152) have indicated that hepatic

PPAR-α can not only be activated by NEFA released from adipose tissue for lipid β- oxidation, but also upregulates the transcript for Fgf21 in the liver. The present studies showed a consistency with previous studies that HCD-2.5wk group had the highest genes involved in lipid β-oxidation, including Ppar-α, Cpt-1α, Acad1, and Pgc-1α (Fig. 5.4A-B), suggesting a plausible mechanism of how FGF-21 is regulated. Thus, additional studies are required to explore the role of FGF-21 in the lean NAFLD mouse model.

133 In a longer duration of induction of steatosis, 5 weeks, adipose tissues seemed to participate in the regulation of lipid metabolism, in which FFA and NEFA released from adipose tissue may provide substrates for TG synthesis. The Fig. 6.1 summarized the metabolic changes in the mice fed a HCD for 5 weeks, as compared to the mice fed a HCD for 2.5 weeks. Differential expression analysis revealed that the genes involved in the FA biosynthesis were all significantly elevated in response to the HCD (Table 5.3 and Fig.

5.10), and metabolomics analysis confirmed these observations in which the metabolites were also concomitantly increased in the liver of mice fed a HCD for 5 weeks, suggesting that with a longer duration of induction of steatosis, it is possible that the liver tried to get rid of a surplus of carbohydrate which were eventually converted to lipids for export.

Additionally, the intermediates in the Krebs cycle, e.g., succinate and fumarate, were significantly decreased, providing a direct evidence that acetyl-CoA was not completely oxidized for energy production; rather, citrates were transported out of mitochondria for

FA biosynthesis (Fig. 6.1). In order to proceed FA biosynthesis, the genes, 6- phosphogluconate dehydrogenase (Pgd) and transketolase (Tkt) (Fig. 5.10), in the pentose phosphate pathway went up to generate NAPDH for FA biosynthesis. On the other hand, the genes involved in glycolysis (Fig. 5.10) were also predominantly activated by high carbohydrate to further provide glycerol backbone for TG synthesis. All of which makes the energy homeostasis even worse. Besides, lipolysis in the adipose tissue was increased

(Fig. 5.7B) in the lean NAFLD mice at the week 5, we speculated that the levels of FFA and NEFA might also be increased in the plasma and be transported back to the liver.

Although we did not have enough sample volumes to determine FAs composition in plasma,

134 an increase in the hepatic genes for FA transport provided an indirect evidence showing

FAs exchange between liver and plasma (153).

135

136 Figure 6.1. Summary of the significant changes in the mouse fed a HCD for 5 weeks. The metabolic changes including genes and metabolites were compared with the mice fed a

HCD for 2.5 weeks. The red and blue indicate up- and down-regulation, respectively, in the liver, plasma, and adipose tissue. *: Pgc-1α was measured to represent mitochondria biogenesis. +: Atgl and Hsl were determined to represent lipolysis in the adipose tissue. Acc: acetyl-CoA carboxylase; Ala: alanine; Aldob: aldolase B; ALT: alanine aminotransferase;

Apcs: serum amyloid P Component; Atgl: adipose triglyceride lipase; α-KG: alpha- ketoglutarate; BA: bile acid; BCAA: branched-chain amino acids; Ccl2: C-C Motif

Chemokine Ligand 2; Cly: citrate lyase; Cyp: cytochrome P 450; Elovl: elongase; Fasn: fatty acid synthse; Fbp1: fructose biphosphatase-1; Fgf21: fibroblast growth factor-21;

FFA: free fatty acid; Gly: glycine; HCD: high carbohydrate diet; Gys: glycogen synthase;

Hsl: hormone-sensitive lipase; Ldha: lactate dehydrogenase A; MUFA: monounsaturated fatty acid; NEFA: non-esterified fatty acid; OAA: oxaloacetate; Pdh: pyruvate dehydrogenase complex; Pgd: 6-phosphogluconate dehydrogenase; Pnpla3: patatin-like phospholipase domain-containing protein 3; PUFA: polyunsaturated fatty acid; Tkt: transketolase.

137 6.4 The effects of exogenous lipids on glucose and lipid metabolism

Our systematic analyses showed a significant improvement in the metabolic homeostasis in the liver of mice fed a HCD after 13.5% LEs supplementation, especially

Omegaven®. The Fig. 6.3 summarized the metabolic changes in the mice fed a HCDF, compared to the mice fed a HCD for 5 weeks. In which figure we emphasized the improvement of lipolysis and mitochondria biogenesis in adipose tissue, as well as energy generation in the liver.

As discussed in the 6.2 that the duration of induction of steatosis dysregulated energy homeostasis and increased FA biosynthesis in the liver, exogenous lipids in a form of lipid emulsion reversed liver TG accumulation (Fig. 4.2, Fig. 5.2 and Fig. 5.3) (136) and reduced hepatic de novo lipogenesis (154, 155) (Fig. 4.4, Fig. 4.5, Fig. 5.4, and Fig. 5.5), as well as replenishing the intermediates in the Krebs cycle (Fig. 4.3 and Table 5.3), indicating that exogenous lipids ameliorated the preexisting hepatic steatosis by partially replenishing citrate cycle and reducing de novo lipogenesis. Additionally, differential expression analysis revealed that the genes involved in the glycolysis and pentose phosphate pathway were all significantly reduced by Omegaven® supplementation, indicating that exogenous PUFA is required to maintain glucose metabolic pathways working properly. Specially, the beneficial effect from Omegaven® was most stronger than that in the Intralipid® and ClinOleic®. All of these beneficial effects contributed by

Omegaven® tended to balance glucose homeostasis (72).

Another plausible contributor to the reversed hepatic TG content in HCDF-fed mice was farnesoid X receptor (FXR). PUFA and bile acids have been shown to be the ligands

138 of FXR, which plays an important physiological role in regulating hepatic lipid and glucose metabolism through SREBP-1C pathway (156-158), and its activation not only leads to increases in the expression of the genes that promote plasma TG clearance (159) and FFA catabolism via increasing PPAR-α (160), but also reduce the genes associated with de novo lipogenesis (161) in a high fat diet-induced obese mouse model. In the present study, we observed from the transcriptomic data that although the HCD-fed mice had higher transcripts for Srebpf-1, Ppar-α, Cd36, Fabp2, Fabp5 (Fig. 5.4A and Table S4) and plasma

TG clearance, e.g., very low density lipoprotein receptor (Vldlr) and low-density lipoprotein receptor (Ldlr) (Fig. 5.10), lipogenic genes in HCD group were conversely increased in response to high carbohydrate intake, suggesting that lipogenesis in the liver of HCD-fed mice may be induced by other mechanism that is independently associated with FXR pathway.

Previous studies (162-164) suggested that Apoa4 and Apoa5 are important regulators of TG secretion and mobilization. With 13.5% Omegaven® supplementation, FA biosynthesis was greatly improved as discussed previously, transcriptional profiling also showed that the genes for apolipoprotein A IV (Apoa4) and Apoa5 were concomitantly decreased in response to the improvement of hepatic steatosis; the gene for Ldlr, on the other hand, was also reduced, suggesting that the VLDL synthesis might be normalized by the n3-based LE intervention after the onset of hepatic stetosis.

Although 13.5% Intralipid® and Omegaven® supplementation in the chapter 4 and 5 respectively have been shown to be significant in the metabolic parameters we have tested in the present studies, it was unexpected that HCDS or HCDF supplementation elevated the levels for plasma N-acetyl-glycoprotein (Fig. 4.6) and acute inflammatory response-

139 associated genes, especially the complement system (Table 5.5). Although it is presently unknown how n6- and n3-based LEs increased inflammatory response, it would be a plausible explanation that its downstream metabolites, e.g., certain FFAs, ceramides and eicosanoids, and oxidative stress were increased (165, 166) in response to the preexisting steatosis. Moreover, it still seems promising that 13.5% Intralipid® or Omegaven® supplementation may contribute to ameliorating steatosis-induced inflammation (Fig. 4.6,

Fig. 5.4E and Table 5.5). Therefore, further studies are required to determine what factors trigger the acute inflammatory response in the use of Intralipid® and Omegaven® in the mice with preexisting steatosis.

140

141 Figure 6.2. Summary of the significant changes in the mouse fed a HCD supplemented with 13.5% Omegaven (HCDF). The metabolic changes including genes and metabolites were compared with HCD-5wk group. The red and blue indicated up- and down-regulation in the liver plasma, and adipose tissue. *: Pgc-1α was measured to represent mitochondria biogenesis. +: Atgl and Hsl were determined to represent lipolysis in the adipose tissue. Acc: acetyl-CoA carboxylase; Ala: alanine; Aldob: aldolase B; ALT: alanine aminotransferase;

Apcs: serum amyloid P Component; Atgl: adipose triglyceride lipase; α-KG: alpha- ketoglutarate; BA: bile acid; BCAA: branched-chain amino acids; Ccl2: C-C Motif

Chemokine Ligand 2; Cly: citrate lyase; Cyp: cytochrome P 450; Elovl: elongase; Fasn: fatty acid synthse; Fbp1: fructose biphosphatase-1; Fgf21: fibroblast growth factor-21;

FFA: free fatty acid; Gly: glycine; HCD: high carbohydrate diet; Gys: glycogen synthase;

Hsl: hormone-sensitive lipase; Ldha: lactate dehydrogenase A; MUFA: monounsaturated fatty acid; NEFA: non-esterified fatty acid; OAA: oxaloacetate; Pdh: pyruvate dehydrogenase complex; Pgd: 6-phosphogluconate dehydrogenase; Pnpla3: patatin-like phospholipase domain-containing protein 3; PUFA: polyunsaturated fatty acid; Tkt: transketolase.

142 6.5 Limitations and future directions

The present studies were conducted to explore the underlying mechanisms of HCD- induced steatosis. Although we have shown that LEs supplementation can ameliorate the extent of hepatic steatosis in the lean NAFLD model, a couple of questions still need to be answered. First, the present studies indicated that the genes and the metabolites involved in lipid and glucose metabolism were altered by the exposure to HCD, which were further prevented or improved by including 13.5% LE to a HCD. Additionally, LEs supplementation improved inflammatory genes in the liver after the onset of steatosis.

Considering the transport of exogenous lipids, however, the effects of LEs intervention were not determined directly on both extrahepatic tissues and plasma due to the small amount of tissue and plasma, and we do not exactly know whether these beneficial effects were contributed directly by LEs supplementation per se, or these exogenous lipids regulated hepatic genes and metabolites through the signals/metabolites from extrahepatic tissues, which could further mitigate steatosis. To address this concern, we will increase sample size for each group or use pooled samples for other analyses. A systemic investigation including transcriptomics and/or metabolomics can also be utilized in the future studies to determine a global change in the genes and lipid derivatives in the plasma or from the extrahepatic tissues, as well as kinetic modeling for TG metabolism.

The second limitation of the present studies is that we have been focusing on the roles of the liver in the mice with HCD-induced steatosis. However, these investigations did not allow us to explore the role of dietary lipid on the gut microbiota in the lean NAFLD model.

Previous studies have shown that gut microbiota play a crucial role in regulating host metabolism (123, 167), especially, the metabolites produced by microbiota. To overcome

143 this limitation, metagenomics can be employed, in which method not only provides the species and strain of composition of the microbiota, but also genetic information for metabolism within the microbiota and the microecosystem in the gut. Therefore, in future studies, we will take metagenomics into account in order to have a better understanding of how dietary lipids improve hepatic steatosis through microbiota-dependent or independent pathway.

Lastly, the present studies have shown an improvement on the inflammation- associated genes in the liver of the mouse with preexisting steatosis. However, it remains unclear whether Omegaven®, the most effective LE in the present studies, is still capable to reverse hepatic steatosis after additional inflammatory insult, e.g., lipopolysaccharide and cholesterol, and which n-3 FAs, e.g., α-linolenic acid, eicosapentaenoic acid, and docosahexaenoic acid, is more effective in regulating lipid metabolism and inflammation in this model. Therefore, additional studies are required to determine which n-3 FA is more effective in reversing hepatic steatosis and improving inflammation after the introduction of second insult, inflammation, in a lean NAFLD model.

6.5 Conclusions

This dissertation successfully estimated a lean NAFLD mouse model in the absence of insulin resistance and obesity, and it also demonstrates that, in the presence of HCD, a short-term HCD intervention is sufficient to alter hepatic lipid metabolism, in which lipogenic genes and TG accumulation were elevated rapidly. These changes were abrogated by additional 13.5% Intralipid® and a combination of voluntary exercise and

13.5% Intralipid® supplementation. Additionally, 13.5% Intralipid® could also ameliorate

144 liver TG accumulation, de novo lipogenesis, as well as energy homeostasis after the onset of hepatic steatosis. However, a systematic investigation demonstrated that the reversal effect contributed by Omegaven® supplementation was the strongest, and the hepatic TG accumulation was even disappeared, which was confirmed by transcriptional and metabolomics analyses. Overall, these effects allow hepatocytes to mitigate the preexisting hepatic steatosis, as well as to maintain a balanced macronutrient metabolism.

145 References

1. Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M. Global

epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of

prevalence, incidence, and outcomes. Hepatology 2016;64(1):73-84.

2. Rinella ME. Nonalcoholic fatty liver disease: a systematic review. Jama

2015;313(22):2263-73.

3. Loomba R, Sanyal AJ. The global NAFLD epidemic. Nat Rev Gastroenterol

Hepatol 2013;10(11):686-90.

4. Bedogni G, Miglioli L, Masutti F, Tiribelli C, Marchesini G, Bellentani S.

Prevalence of and risk factors for nonalcoholic fatty liver disease: the Dionysos

nutrition and liver study. Hepatology 2005;42(1):44-52.

5. Woo Baidal JA, Lavine JE. The intersection of nonalcoholic fatty liver disease and

obesity. Sci Transl Med 2016;8(323):323rv1.

6. Sharma M, Mitnala S, Vishnubhotla RK, Mukherjee R, Reddy DN, Rao PN. The

Riddle of Nonalcoholic Fatty Liver Disease: Progression From Nonalcoholic Fatty

Liver to Nonalcoholic Steatohepatitis. J Clin Exp Hepatol 2015;5(2):147-58.

7. Ahima RS, Lazar MA. Physiology. The health risk of obesity--better metrics

imperative. Science 2013;341(6148):856-8.

8. Younossi ZM, Stepanova M, Afendy M, Fang Y, Younossi Y, Mir H, Srishord M.

Changes in the prevalence of the most common causes of chronic liver diseases in

the United States from 1988 to 2008. Clin Gastroenterol Hepatol 2011;9(6):524-

30.e1; quiz e60.

146 9. Marchesini G, Brizi M, Bianchi G, Tomassetti S, Bugianesi E, Lenzi M,

McCullough AJ, Natale S, Forlani G, Melchionda N. Nonalcoholic fatty liver

disease: a feature of the metabolic syndrome. Diabetes 2001;50(8):1844-50.

10. Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW,

Ferrell LD, Liu YC, Torbenson MS, Unalp-Arida A, et al. Design and validation of

a histological scoring system for nonalcoholic fatty liver disease. Hepatology

2005;41(6):1313-21.

11. Xu J, Murphy SL, Kochanek KD, Bastian BA. Deaths: Final Data for 2013.

National Center for Health Statistics 2016;National Vital Statistics reports; vol 64

no 2. Hyattsville, MD.

12. Lazo M, Hernaez R, Eberhardt MS, Bonekamp S, Kamel I, Guallar E, Koteish A,

Brancati FL, Clark JM. Prevalence of nonalcoholic fatty liver disease in the United

States: the Third National Health and Nutrition Examination Survey, 1988-1994.

Am J Epidemiol 2013;178(1):38-45.

13. Williams CD, Stengel J, Asike MI, Torres DM, Shaw J, Contreras M, Landt CL,

Harrison SA. Prevalence of nonalcoholic fatty liver disease and nonalcoholic

steatohepatitis among a largely middle-aged population utilizing ultrasound and

liver biopsy: a prospective study. Gastroenterology 2011;140(1):124-31.

14. Welsh JA, Karpen S, Vos MB. Increasing prevalence of nonalcoholic fatty liver

disease among United States adolescents, 1988-1994 to 2007-2010. J Pediatr

2013;162(3):496-500.e1.

147 15. Younossi ZM, Stepanova M, Negro F, Hallaji S, Younossi Y, Lam B, Srishord M.

Nonalcoholic fatty liver disease in lean individuals in the United States. Medicine

(Baltimore) 2012;91(6):319-27.

16. Pagadala MR, McCullough AJ. Non-alcoholic fatty liver disease and obesity: not

all about body mass index. Am J Gastroenterol 2012;107(12):1859-61.

17. Arulanandan A, Ang B, Bettencourt R, Hooker J, Behling C, Lin GY, Valasek MA,

Ix JH, Schnabl B, Sirlin CB, et al. Association Between Quantity of Liver Fat and

Cardiovascular Risk in Patients With Nonalcoholic Fatty Liver Disease

Independent of Nonalcoholic Steatohepatitis. Clin Gastroenterol Hepatol

2015;13(8):1513-20 e1.

18. Birkenfeld AL, Shulman GI. Nonalcoholic fatty liver disease, hepatic insulin

resistance, and type 2 diabetes. Hepatology 2014;59(2):713-23.

19. Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, Charlton M,

Sanyal AJ. The diagnosis and management of non-alcoholic fatty liver disease:

practice Guideline by the American Association for the Study of Liver Diseases,

American College of Gastroenterology, and the American Gastroenterological

Association. Hepatology 2012;55(6):2005-23.

20. Ratziu V, Bugianesi E, Dixon J, Fassio E, Ekstedt M, Charlotte F, Kechagias S,

Poynard T, Olsson R. Histological progression of non-alcoholic fatty liver disease:

a critical reassessment based on liver sampling variability. Aliment Pharmacol Ther

2007;26(6):821-30.

21. Mofrad P, Contos MJ, Haque M, Sargeant C, Fisher RA, Luketic VA, Sterling RK,

Shiffman ML, Stravitz RT, Sanyal AJ. Clinical and histologic spectrum of

148 nonalcoholic fatty liver disease associated with normal ALT values. Hepatology

2003;37(6):1286-92.

22. Burgert TS, Taksali SE, Dziura J, Goodman TR, Yeckel CW, Papademetris X,

Constable RT, Weiss R, Tamborlane WV, Savoye M, et al. Alanine

aminotransferase levels and fatty liver in childhood obesity: associations with

insulin resistance, adiponectin, and visceral fat. J Clin Endocrinol Metab

2006;91(11):4287-94.

23. Shannon A, Alkhouri N, Carter-Kent C, Monti L, Devito R, Lopez R, Feldstein AE,

Nobili V. Ultrasonographic quantitative estimation of hepatic steatosis in children

With NAFLD. J Pediatr Gastroenterol Nutr 2011;53(2):190-5.

24. Dasarathy S, Dasarathy J, Khiyami A, Joseph R, Lopez R, McCullough AJ.

Validity of real time ultrasound in the diagnosis of hepatic steatosis: a prospective

study. J Hepatol 2009;51(6):1061-7.

25. Bohte AE, van Werven JR, Bipat S, Stoker J. The diagnostic accuracy of US, CT,

MRI and 1H-MRS for the evaluation of hepatic steatosis compared with liver

biopsy: a meta-analysis. Eur Radiol 2011;21(1):87-97.

26. Kanuri G, Bergheim I. In vitro and in vivo models of non-alcoholic fatty liver

disease (NAFLD). Int J Mol Sci 2013;14(6):11963-80.

27. Angulo P. Nonalcoholic fatty liver disease. N Engl J Med 2002;346(16):1221-31.

28. Day CP, James OF. Steatohepatitis: a tale of two "hits"? Gastroenterology

1998;114(4):842-5.

29. Day CP. From fat to inflammation. Gastroenterology 2006;130(1):207-10.

149 30. Feldstein AE, Werneburg NW, Canbay A, Guicciardi ME, Bronk SF, Rydzewski

R, Burgart LJ, Gores GJ. Free fatty acids promote hepatic lipotoxicity by

stimulating TNF-alpha expression via a lysosomal pathway. Hepatology

2004;40(1):185-94.

31. Yamaguchi K, Yang L, McCall S, Huang J, Yu XX, Pandey SK, Bhanot S, Monia

BP, Li YX, Diehl AM. Inhibiting triglyceride synthesis improves hepatic steatosis

but exacerbates liver damage and fibrosis in obese mice with nonalcoholic

steatohepatitis. Hepatology 2007;45(6):1366-74.

32. Browning JD, Horton JD. Molecular mediators of hepatic steatosis and liver injury.

J Clin Invest 2004;114(2):147-52.

33. Baker AL, Rosenberg IH. Hepatic complications of total parenteral nutrition. Am J

Med 1987;82(3):489-97.

34. Mullick FG, Moran CA, Ishak KG. Total parenteral nutrition: a histopathologic

analysis of the liver changes in 20 children. Mod Pathol 1994;7(2):190-4.

35. Cai W, Wu J, Hong L, Xu Y, Tang Q, Shi C. Oxidative injury and hepatocyte

apoptosis in total parenteral nutrition-associated liver dysfunction. J Pediatr Surg

2006;41(10):1663-8.

36. Dowman JK, Tomlinson JW, Newsome PN. Pathogenesis of non-alcoholic fatty

liver disease. Qjm 2010;103(2):71-83.

37. Eckard C, Cole R, Lockwood J, Torres DM, Williams CD, Shaw JC, Harrison SA.

Prospective histopathologic evaluation of lifestyle modification in nonalcoholic

fatty liver disease: a randomized trial. Therap Adv Gastroenterol 2013;6(4):249-59.

150 38. Vilar-Gomez E, Martinez-Perez Y, Calzadilla-Bertot L, Torres-Gonzalez A, Gra-

Oramas B, Gonzalez-Fabian L, Friedman SL, Diago M, Romero-Gomez M. Weight

Loss Through Lifestyle Modification Significantly Reduces Features of

Nonalcoholic Steatohepatitis. Gastroenterology 2015;149(2):367-78.e5; quiz e14-

5.

39. Reinehr T, Schmidt C, Toschke AM, Andler W. Lifestyle intervention in obese

children with non-alcoholic fatty liver disease: 2-year follow-up study. Arch Dis

Child 2009;94(6):437-42.

40. Promrat K, Kleiner DE, Niemeier HM, Jackvony E, Kearns M, Wands JR, Fava JL,

Wing RR. Randomized controlled trial testing the effects of weight loss on

nonalcoholic steatohepatitis. Hepatology 2010;51(1):121-9.

41. Nobili V, Manco M, Devito R, Di Ciommo V, Comparcola D, Sartorelli MR,

Piemonte F, Marcellini M, Angulo P. Lifestyle intervention and antioxidant therapy

in children with nonalcoholic fatty liver disease: a randomized, controlled trial.

Hepatology 2008;48(1):119-28.

42. Gronbaek H, Lange A, Birkebaek NH, Holland-Fischer P, Solvig J, Horlyck A,

Kristensen K, Rittig S, Vilstrup H. Effect of a 10-week weight loss camp on fatty

liver disease and insulin sensitivity in obese Danish children. J Pediatr

Gastroenterol Nutr 2012;54(2):223-8.

43. Rabol R, Petersen KF, Dufour S, Flannery C, Shulman GI. Reversal of muscle

insulin resistance with exercise reduces postprandial hepatic de novo lipogenesis in

insulin resistant individuals. Proc Natl Acad Sci U S A 2011;108(33):13705-9.

151 44. Perseghin G, Price TB, Petersen KF, Roden M, Cline GW, Gerow K, Rothman DL,

Shulman GI. Increased glucose transport-phosphorylation and muscle glycogen

synthesis after exercise training in insulin-resistant subjects. N Engl J Med

1996;335(18):1357-62.

45. Fon Tacer K, Rozman D. Nonalcoholic Fatty liver disease: focus on lipoprotein and

lipid deregulation. J Lipids 2011;2011:783976.

46. Mason TM. The role of factors that regulate the synthesis and secretion of very-

low-density lipoprotein by hepatocytes. Crit Rev Clin Lab Sci 1998;35(6):461-87.

47. Keim NL, Mares-Perlman JA. Development of hepatic steatosis and essential fatty

acid deficiency in rats with hypercaloric, fat-free parenteral nutrition. J Nutr

1984;114(10):1807-15.

48. Reif S, Tano M, Oliverio R, Young C, Rossi T. Total parenteral nutrition-induced

steatosis: reversal by parenteral lipid infusion. JPEN J Parenter Enteral Nutr

1991;15(1):102-4.

49. Ferezou J, Bach AC. Structure and metabolic fate of triacylglycerol- and

phospholipid-rich particles of commercial parenteral fat emulsions. Nutrition

1999;15(1):44-50.

50. Robinson SF, Quarfordt SH. Apoproteins in association with Intralipid incubations

in rat and human plasma. Lipids 1979;14(4):343-9.

51. Adiels M, Olofsson SO, Taskinen MR, Boren J. Overproduction of very low-

density lipoproteins is the hallmark of the dyslipidemia in the metabolic syndrome.

Arterioscler Thromb Vasc Biol 2008;28(7):1225-36.

152 52. Toledo FG, Sniderman AD, Kelley DE. Influence of hepatic steatosis (fatty liver)

on severity and composition of dyslipidemia in type 2 diabetes. Diabetes Care

2006;29(8):1845-50.

53. Packard CJ, Shepherd J. Lipoprotein heterogeneity and apolipoprotein B

metabolism. Arterioscler Thromb Vasc Biol 1997;17(12):3542-56.

54. Verges B. New insight into the pathophysiology of lipid abnormalities in type 2

diabetes. Diabetes Metab 2005;31(5):429-39.

55. Toyota Y, Yamamura T, Miyake Y, Yamamoto A. Low density lipoprotein (LDL)

binding affinity for the LDL receptor in hyperlipoproteinemia. Atherosclerosis

1999;147(1):77-86.

56. Lucero D, Zago V, Lopez GI, Graffigna M, Lopez GH, Fainboim H, Miksztowicz

V, Gomez Rosso L, Belli S, Levalle O, et al. Does non-alcoholic fatty liver impair

alterations of plasma lipoproteins and associated factors in metabolic syndrome?

Clin Chim Acta 2011;412(7-8):587-92.

57. Fujita K, Nozaki Y, Wada K, Yoneda M, Fujimoto Y, Fujitake M, Endo H,

Takahashi H, Inamori M, Kobayashi N, et al. Dysfunctional very-low-density

lipoprotein synthesis and release is a key factor in nonalcoholic steatohepatitis

pathogenesis. Hepatology 2009;50(3):772-80.

58. Postic C, Girard J. Contribution of de novo fatty acid synthesis to hepatic steatosis

and insulin resistance: lessons from genetically engineered mice. J Clin Invest

2008;118(3):829-38.

153 59. Benjamin DR. Hepatobiliary dysfunction in infants and children associated with

long-term total parenteral nutrition. A clinico-pathologic study. Am J Clin Pathol

1981;76(3):276-83.

60. Moss RL, Haynes AL, Pastuszyn A, Glew RH. Methionine infusion reproduces

liver injury of parenteral nutrition cholestasis. Pediatr Res 1999;45(5 Pt 1):664-8.

61. Moss RL, Das JB, Raffensperger JG. Total parenteral nutrition-associated

cholestasis: clinical and histopathologic correlation. J Pediatr Surg

1993;28(10):1270-4; discussion 4-5.

62. DeFronzo RA, Jacot E, Jequier E, Maeder E, Wahren J, Felber JP. The effect of

insulin on the disposal of intravenous glucose. Results from indirect calorimetry

and hepatic and femoral venous catheterization. Diabetes 1981;30(12):1000-7.

63. Gil KM, Askanazi J, Elwyn DH, Gump FE, Kinney JM. Energy expenditure after

infusion of glucose-based total parenteral nutrition. Am J Physiol 1987;253(2 Pt

1):E135-41.

64. Furukawa K, Yamamori H, Takagi K, Hayashi N, Suzuki R, Nakajima N, Tashiro

T. Influences of soybean oil emulsion on stress response and cell-mediated immune

function in moderately or severely stressed patients. Nutrition 2002;18(3):235-40.

65. Waitzberg DL, Lotierzo PH, Logullo AF, Torrinhas RS, Pereira CC, Meier R.

Parenteral lipid emulsions and phagocytic systems. Br J Nutr 2002;87 Suppl 1:S49-

57.

66. Ito K, Hao L, Wray AE, Ross AC. Lipid emulsion administered intravenously or

orally attenuates triglyceride accumulation and expression of inflammatory

154 markers in the liver of nonobese mice fed parenteral nutrition formula. J Nutr

2013;143(3):253-9.

67. Kawaguchi T, Sumida Y, Umemura A, Matsuo K, Takahashi M, Takamura T,

Yasui K, Saibara T, Hashimoto E, Kawanaka M, et al. Genetic polymorphisms of

the human PNPLA3 gene are strongly associated with severity of non-alcoholic

fatty liver disease in Japanese. PLoS One 2012;7(6):e38322.

68. Pachikian BD, Neyrinck AM, Cani PD, Portois L, Deldicque L, De Backer FC,

Bindels LB, Sohet FM, Malaisse WJ, Francaux M, et al. Hepatic steatosis in n-3

fatty acid depleted mice: focus on metabolic alterations related to tissue fatty acid

composition. BMC Physiol 2008;8:21.

69. Ferramosca A, Zara V. Modulation of hepatic steatosis by dietary fatty acids. World

J Gastroenterol 2014;20(7):1746-55.

70. Parker HM, Johnson NA, Burdon CA, Cohn JS, O'Connor HT, George J. Omega-

3 supplementation and non-alcoholic fatty liver disease: a systematic review and

meta-analysis. J Hepatol 2012;56(4):944-51.

71. Flachs P, Rossmeisl M, Kopecky J. The effect of n-3 fatty acids on glucose

homeostasis and insulin sensitivity. Physiol Res 2014;63 Suppl 1:S93-118.

72. Lombardo YB, Chicco AG. Effects of dietary polyunsaturated n-3 fatty acids on

dyslipidemia and insulin resistance in rodents and humans. A review. J Nutr

Biochem 2006;17(1):1-13.

73. Pachikian BD, Essaghir A, Demoulin JB, Neyrinck AM, Catry E, De Backer FC,

Dejeans N, Dewulf EM, Sohet FM, Portois L, et al. Hepatic n-3 polyunsaturated

155 fatty acid depletion promotes steatosis and insulin resistance in mice: genomic

analysis of cellular targets. PLoS One 2011;6(8):e23365.

74. Puri P, Baillie RA, Wiest MM, Mirshahi F, Choudhury J, Cheung O, Sargeant C,

Contos MJ, Sanyal AJ. A lipidomic analysis of nonalcoholic fatty liver disease.

Hepatology 2007;46(4):1081-90.

75. Oliveira CP, Coelho AM, Barbeiro HV, Lima VM, Soriano F, Ribeiro C, Molan

NA, Alves VA, Souza HP, Machado MC, et al. Liver mitochondrial dysfunction

and oxidative stress in the pathogenesis of experimental nonalcoholic fatty liver

disease. Braz J Med Biol Res 2006;39(2):189-94.

76. Alwayn IP, Andersson C, Zauscher B, Gura K, Nose V, Puder M. Omega-3 fatty

acids improve hepatic steatosis in a murine model: potential implications for the

marginal steatotic liver donor. Transplantation 2005;79(5):606-8.

77. Kim HJ, Lee KT, Park YB, Jeon SM, Choi MS. Dietary docosahexaenoic acid-rich

diacylglycerols ameliorate hepatic steatosis and alter hepatic gene expressions in

C57BL/6J-Lep(ob/ob) mice. Mol Nutr Food Res 2008;52(8):965-73.

78. Pettinelli P, Obregon AM, Videla LA. Molecular mechanisms of steatosis in

nonalcoholic fatty liver disease. Nutr Hosp 2011;26(3):441-50.

79. Yeon JE, Choi KM, Baik SH, Kim KO, Lim HJ, Park KH, Kim JY, Park JJ, Kim

JS, Bak YT, et al. Reduced expression of peroxisome proliferator-activated

receptor-alpha may have an important role in the development of non-alcoholic

fatty liver disease. J Gastroenterol Hepatol 2004;19(7):799-804.

80. Satapathy SK, Sanyal AJ. Epidemiology and Natural History of Nonalcoholic Fatty

Liver Disease. Semin Liver Dis 2015;35(03):221-35.

156 81. Chang Y, Jung HS, Yun KE, Cho J, Cho YK, Ryu S. Cohort study of non-alcoholic

fatty liver disease, NAFLD fibrosis score, and the risk of incident diabetes in a

Korean population. Am J Gastroenterol 2013;108(12):1861-8.

82. Nandivada P, Cowan E, Carlson SJ, Chang M, Gura KM, Puder M. Mechanisms

for the effects of fish oil lipid emulsions in the management of parenteral nutrition-

associated liver disease. Prostaglandins Leukot Essent Fatty Acids 2013;89(4):153-

8.

83. Fell GL, Nandivada P, Gura KM, Puder M. Intravenous Lipid Emulsions in

Parenteral Nutrition. Adv Nutr 2015;6(5):600-10.

84. Kalish BT, Fell GL, Nandivada P, Puder M. Clinically Relevant Mechanisms of

Lipid Synthesis, Transport, and Storage. JPEN J Parenter Enteral Nutr 2015;39(1

Suppl):8s-17s.

85. Scorletti E, Byrne CD. Omega-3 fatty acids, hepatic lipid metabolism, and

nonalcoholic fatty liver disease. Annu Rev Nutr 2013;33:231-48.

86. Hussein O, Grosovski M, Lasri E, Svalb S, Ravid U, Assy N. Monounsaturated fat

decreases hepatic lipid content in non-alcoholic fatty liver disease in rats. World J

Gastroenterol 2007;13(3):361-8.

87. Williams CM. Beneficial nutritional properties of olive oil: implications for

postprandial lipoproteins and factor VII. Nutr Metab Cardiovasc Dis 2001;11(4

Suppl):51-6.

88. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and

purification of total lipides from animal tissues. J Biol Chem 1957;226(1):497-509.

157 89. Hao L, Ito K, Huang K-H, Sae-tan S, Lambert JD, Ross AC. Shifts in dietary

carbohydrate-lipid exposure regulate expression of the non-alcoholic fatty liver

disease-associated gene PNPLA3/adiponutrin in mouse liver and HepG2 human

liver cells. Metabolism 2014;63(10):1352-62.

90. Hao L, Huang K-H, Ito K, Sae-tan S, Lambert JD, Ross AC. Fibroblast Growth

Factor 21 (Fgf21) Gene Expression Is Elevated in the Liver of Mice Fed a High-

Carbohydrate Liquid Diet and Attenuated by a Lipid Emulsion but Is Not

Upregulated in the Liver of Mice Fed a High-Fat Obesogenic Diet. The Journal of

Nutrition 2016;146(2):184-90.

91. Huang K-H, Pai M-H, Wu C-H, Liu J-J, Yeh S-L. Supplemental dietary arginine

reduces renal RAGE expression and oxidative damage in rats with streptozotocin-

induced type 2 diabetes. e-SPEN, the European e-Journal of Clinical Nutrition and

Metabolism 2010;5(2):e77-e84.

92. Kotronen A, Seppanen-Laakso T, Westerbacka J, Kiviluoto T, Arola J, Ruskeepaa

AL, Oresic M, Yki-Jarvinen H. Hepatic stearoyl-CoA desaturase (SCD)-1 activity

and diacylglycerol but not ceramide concentrations are increased in the

nonalcoholic human fatty liver. Diabetes 2009;58(1):203-8.

93. Tang Y, Wallace M, Sanchez-Gurmaches J, Hsiao WY, Li H, Lee PL, Vernia S,

Metallo CM, Guertin DA. Adipose tissue mTORC2 regulates ChREBP-driven de

novo lipogenesis and hepatic glucose metabolism. Nat Commun 2016;7:11365.

94. Cohen C, Olsen MM. Pediatric total parenteral nutrition. Liver histopathology.

Arch Pathol Lab Med 1981;105(3):152-6.

158 95. Holman RT. The ratio of trienoic: tetraenoic acids in tissue lipids as a measure of

essential fatty acid requirement. J Nutr 1960;70:405-10.

96. Flowers MT, Groen AK, Oler AT, Keller MP, Choi Y, Schueler KL, Richards OC,

Lan H, Miyazaki M, Kuipers F, et al. Cholestasis and hypercholesterolemia in

SCD1-deficient mice fed a low-fat, high-carbohydrate diet. J Lipid Res

2006;47(12):2668-80.

97. Pierce AA, Duwaerts CC, Soon RK, Siao K, Grenert JP, Fitch M, Hellerstein MK,

Beysen C, Turner SM, Maher JJ. Isocaloric manipulation of macronutrients within

a high-carbohydrate/moderate-fat diet induces unique effects on hepatic lipogenesis,

steatosis and liver injury. J Nutr Biochem 2016;29:12-20.

98. Horton JD, Bashmakov Y, Shimomura I, Shimano H. Regulation of sterol

regulatory element binding proteins in livers of fasted and refed mice. Proc Natl

Acad Sci U S A 1998;95(11):5987-92.

99. Miyazaki M, Dobrzyn A, Man WC, Chu K, Sampath H, Kim HJ, Ntambi JM.

Stearoyl-CoA desaturase 1 gene expression is necessary for fructose-mediated

induction of lipogenic gene expression by sterol regulatory element-binding

protein-1c-dependent and -independent mechanisms. J Biol Chem

2004;279(24):25164-71.

100. Dentin R, Benhamed F, Pegorier JP, Foufelle F, Viollet B, Vaulont S, Girard J,

Postic C. Polyunsaturated fatty acids suppress glycolytic and lipogenic genes

through the inhibition of ChREBP nuclear protein translocation. J Clin Invest

2005;115(10):2843-54.

159 101. Li ZZ, Berk M, McIntyre TM, Feldstein AE. Hepatic lipid partitioning and liver

damage in nonalcoholic fatty liver disease: role of stearoyl-CoA desaturase. J Biol

Chem 2009;284(9):5637-44.

102. Alkhouri N, Dixon LJ, Feldstein AE. Lipotoxicity in nonalcoholic fatty liver

disease: not all lipids are created equal. Expert Rev Gastroenterol Hepatol

2009;3(4):445-51.

103. Unger RH. Lipotoxic diseases. Annu Rev Med 2002;53:319-36.

104. Flowers MT, Keller MP, Choi Y, Lan H, Kendziorski C, Ntambi JM, Attie AD.

Liver gene expression analysis reveals endoplasmic reticulum stress and metabolic

dysfunction in SCD1-deficient mice fed a very low-fat diet. Physiol Genomics

2008;33(3):361-72.

105. Burrin DG, Ng K, Stoll B, Saenz De Pipaon M. Impact of new-generation lipid

emulsions on cellular mechanisms of parenteral nutrition-associated liver disease.

Adv Nutr 2014;5(1):82-91.

106. Ochi T, Munekage K, Ono M, Higuchi T, Tsuda M, Hayashi Y, Okamoto N, Toda

K, Sakamoto S, Oben JA, et al. Patatin-like phospholipase domain-containing

protein 3 is involved in hepatic fatty acid and triglyceride metabolism through X-

box binding protein 1 and modulation of endoplasmic reticulum stress in mice.

Hepatol Res 2016;46(6):584-92.

107. Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipogenesis by

the transcription factor XBP1. Science 2008;320(5882):1492-6.

108. Javid PJ, Greene AK, Garza J, Gura K, Alwayn IP, Voss S, Nose V, Satchi-Fainaro

R, Zausche B, Mulkern RV, et al. The route of lipid administration affects

160 parenteral nutrition-induced hepatic steatosis in a mouse model. J Pediatr Surg

2005;40(9):1446-53.

109. Hao L, Huang K-H, Ito K, Sae-tan S, Lambert JD, Ross AC. Fibroblast growth

factor 21 (Fgf21) gene expression is elevated in the liver of mice fed a high-

carbohydrate liquid diet and attenuated by a lipid emulsion but is not upregulated

in the liver of mice fed a high-fat obesogenic diet. J Nutr 2016;146(2):184-90.

110. Zhang L, Hatzakis E, Nichols RG, Hao R, Correll J, Smith PB, Chiaro CR, Perdew

GH, Patterson AD. Metabolomics Reveals that Aryl Hydrocarbon Receptor

Activation by Environmental Chemicals Induces Systemic Metabolic Dysfunction

in Mice. Environ Sci Technol 2015;49(13):8067-77.

111. Zhang L, Nichols RG, Correll J, Murray IA, Tanaka N, Smith PB, Hubbard TD,

Sebastian A, Albert I, Hatzakis E, et al. Persistent Organic Pollutants Modify Gut

Microbiota-Host Metabolic Homeostasis in Mice Through Aryl Hydrocarbon

Receptor Activation. Environ Health Perspect 2015;123(7):679-88.

112. Grootveld M, Claxson AW, Chander CL, Haycock P, Blake DR, Hawkes GE. High

resolution proton NMR investigations of rat blood plasma. Assignment of

resonances for the molecularly mobile carbohydrate side-chains of 'acute-phase'

glycoproteins. FEBS Lett 1993;322(3):266-76.

113. Huang K-H, Hao L, Ross A. Lipid emulsion and exercise reduce the development

of hepatic steatosis in mice fed high-dextrose parenteral nutrition formula (642.9).

The FASEB Journal 2014;28(1 Supplement):642.9.

161 114. Leamy AK, Egnatchik RA, Young JD. Molecular mechanisms and the role of

saturated fatty acids in the progression of non-alcoholic fatty liver disease. Prog

Lipid Res 2013;52(1):165-74.

115. Beller M, Thiel K, Thul PJ, Jackle H. Lipid droplets: a dynamic organelle moves

into focus. FEBS Lett 2010;584(11):2176-82.

116. Khaliullina H, Panakova D, Eugster C, Riedel F, Carvalho M, Eaton S. Patched

regulates Smoothened trafficking using lipoprotein-derived lipids. Development

2009;136(24):4111-21.

117. Mashek DG, Khan SA, Sathyanarayan A, Ploeger JM, Franklin MP. Hepatic lipid

droplet biology: Getting to the root of fatty liver. Hepatology 2015;62(3):964-7.

118. Meisel JA, Le HD, de Meijer VE, Nose V, Gura KM, Mulkern RV, Akhavan Sharif

MR, Puder M. Comparison of 5 intravenous lipid emulsions and their effects on

hepatic steatosis in a murine model. J Pediatr Surg 2011;46(4):666-73.

119. Siguel EN, Lerman RH. Altered fatty acid metabolism in patients with

angiographically documented coronary artery disease. Metabolism

1994;43(8):982-93.

120. Maqbool A, Schall JI, Garcia-Espana JF, Zemel BS, Strandvik B, Stallings VA.

Serum linoleic acid status as a clinical indicator of essential fatty acid status in

children with cystic fibrosis. J Pediatr Gastroenterol Nutr 2008;47(5):635-44.

121. Patterson E, Wall R, Fitzgerald GF, Ross RP, Stanton C. Health implications of

high dietary omega-6 polyunsaturated Fatty acids. J Nutr Metab 2012;2012:539426.

162 122. Mardinoglu A, Shoaie S, Bergentall M, Ghaffari P, Zhang C, Larsson E, Backhed

F, Nielsen J. The gut microbiota modulates host amino acid and glutathione

metabolism in mice. Mol Syst Biol 2015;11(10):834.

123. Everard A, Lazarevic V, Derrien M, Girard M, Muccioli GG, Neyrinck AM,

Possemiers S, Van Holle A, Francois P, de Vos WM, et al. Responses of gut

microbiota and glucose and lipid metabolism to prebiotics in genetic obese and diet-

induced leptin-resistant mice. Diabetes 2011;60(11):2775-86.

124. Correa PR, Kruglov EA, Thompson M, Leite MF, Dranoff JA, Nathanson MH.

Succinate is a paracrine signal for liver damage. J Hepatol 2007;47(2):262-9.

125. Ross AC, Cifelli CJ, Zolfaghari R, Li NQ. Multiple cytochrome P-450 genes are

concomitantly regulated by vitamin A under steady-state conditions and by retinoic

acid during hepatic first-pass metabolism. Physiol Genomics 2011;43(1):57-67.

126. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of

large gene lists using DAVID bioinformatics resources. Nat Protoc 2009;4(1):44-

57.

127. Dennis G, Jr., Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA.

DAVID: Database for Annotation, Visualization, and Integrated Discovery.

Genome Biol 2003;4(5):P3.

128. Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S,

Katayama T, Araki M, Hirakawa M. From genomics to chemical genomics: new

developments in KEGG. Nucleic Acids Res 2006;34(Database issue):D354-7.

163 129. Lade A, Noon LA, Friedman SL. Contributions of metabolic dysregulation and

inflammation to nonalcoholic steatohepatitis, hepatic fibrosis, and cancer. Curr

Opin Oncol 2014;26(1):100-7.

130. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARgamma.

Annu Rev Biochem 2008;77:289-312.

131. Ahmadian M, Suh JM, Hah N, Liddle C, Atkins AR, Downes M, Evans RM.

PPARgamma signaling and metabolism: the good, the bad and the future. Nat Med

2013;19(5):557-66.

132. Evans RM, Barish GD, Wang YX. PPARs and the complex journey to obesity. Nat

Med 2004;10(4):355-61.

133. Jin R, Le NA, Cleeton R, Sun X, Cruz Munos J, Otvos J, Vos MB. Amount of

hepatic fat predicts cardiovascular risk independent of insulin resistance among

Hispanic-American adolescents. Lipids Health Dis 2015;14:39.

134. Duncan RE, Ahmadian M, Jaworski K, Sarkadi-Nagy E, Sul HS. Regulation of

lipolysis in adipocytes. Annu Rev Nutr 2007;27:79-101.

135. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program

of cholesterol and fatty acid synthesis in the liver. J Clin Invest 2002;109(9):1125-

31.

136. Marsman HA, Heger M, Kloek JJ, Nienhuis SL, van Werven JR, Nederveen AJ,

Ten Kate FJ, Stoker J, van Gulik TM. Reversal of hepatic steatosis by omega-3

fatty acids measured non-invasively by (1) H-magnetic resonance spectroscopy in

a rat model. J Gastroenterol Hepatol 2011;26(2):356-63.

164 137. Wu J, Bostrom P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M, Virtanen

KA, Nuutila P, Schaart G, et al. Beige adipocytes are a distinct type of thermogenic

fat cell in mouse and human. Cell 2012;150(2):366-76.

138. Kim M, Goto T, Yu R, Uchida K, Tominaga M, Kano Y, Takahashi N, Kawada T.

Fish oil intake induces UCP1 upregulation in brown and white adipose tissue via

the sympathetic nervous system. Sci Rep 2015;5:18013.

139. Chen Y, Kuo W, Chang Y, Liu H, Cheng Y, Mersmann H, Ding S.

Docosahexaenoic Acid Inhibits White Adipogenesis and Enhances Mitochondrial

Biogenesis through SIRT1 and Hh Signaling. The FASEB Journal 2015;29(1

Supplement).

140. Zhang N, Ahsan MH, Purchio AF, West DB. Serum amyloid A-luciferase

transgenic mice: response to sepsis, acute arthritis, and contact hypersensitivity and

the effects of proteasome inhibition. J Immunol 2005;174(12):8125-34.

141. Shah C, Hari-Dass R, Raynes JG. Serum amyloid A is an innate immune opsonin

for Gram-negative bacteria. Blood 2006;108(5):1751-7.

142. Kalish BT, Le HD, Gura KM, Bistrian BR, Puder M. A metabolomic analysis of

two intravenous lipid emulsions in a murine model. PLoS One 2013;8(4):e59653.

143. Wattacheril J, Sanyal AJ. Lean NAFLD: an Underrecognized Outlier. Current

Hepatology Reports 2016;15(2):134-9.

144. Bhat G, Baba CS, Pandey A, Kumari N, Choudhuri G. Insulin resistance and

metabolic syndrome in nonobese Indian patients with non-alcoholic fatty liver

disease. Trop Gastroenterol 2013;34(1):18-24.

165 145. Nishioji K, Sumida Y, Kamaguchi M, Mochizuki N, Kobayashi M, Nishimura T,

Yamaguchi K, Itoh Y. Prevalence of and risk factors for non-alcoholic fatty liver

disease in a non-obese Japanese population, 2011-2012. J Gastroenterol

2015;50(1):95-108.

146. Feng RN, Du SS, Wang C, Li YC, Liu LY, Guo FC, Sun CH. Lean-non-alcoholic

fatty liver disease increases risk for metabolic disorders in a normal weight Chinese

population. World J Gastroenterol 2014;20(47):17932-40.

147. Margariti E, Deutsch M, Manolakopoulos S, Papatheodoridis GV. Non-alcoholic

fatty liver disease may develop in individuals with normal body mass index. Ann

Gastroenterol 2012;25(1):45-51.

148. Kim HJ, Kim HJ, Lee KE, Kim DJ, Kim SK, Ahn CW, Lim SK, Kim KR, Lee HC,

Huh KB, et al. Metabolic significance of nonalcoholic fatty liver disease in

nonobese, nondiabetic adults. Arch Intern Med 2004;164(19):2169-75.

149. Kim LJ, Nalls MA, Eiriksdottir G, Sigurdsson S, Launer LJ, Koster A, Chaves PH,

Jonsdottir B, Garcia M, Gudnason V, et al. Associations of visceral and liver fat

with the metabolic syndrome across the spectrum of obesity: the AGES-Reykjavik

study. Obesity (Silver Spring) 2011;19(6):1265-71.

150. Kalish BT, Le HD, Fitzgerald JM, Wang S, Seamon K, Gura KM, Gronert K, Puder

M. Intravenous fish oil lipid emulsion promotes a shift toward anti-inflammatory

proresolving lipid mediators. Am J Physiol Gastrointest Liver Physiol

2013;305(11):G818-28.

151. Kuro-o M. Endocrine FGFs and Klothos: emerging concepts. Trends Endocrinol

Metab 2008;19(7):239-45.

166 152. Moore DD. Physiology. Sister act. Science 2007;316(5830):1436-8.

153. Rui L. Energy metabolism in the liver. Compr Physiol 2014;4(1):177-97.

154. Jelenik T, Rossmeisl M, Kuda O, Jilkova ZM, Medrikova D, Kus V, Hensler M,

Janovska P, Miksik I, Baranowski M, et al. AMP-activated protein kinase alpha2

subunit is required for the preservation of hepatic insulin sensitivity by n-3

polyunsaturated fatty acids. Diabetes 2010;59(11):2737-46.

155. Rossmeisl M, Medrikova D, van Schothorst EM, Pavlisova J, Kuda O, Hensler M,

Bardova K, Flachs P, Stankova B, Vecka M, et al. Omega-3 phospholipids from

fish suppress hepatic steatosis by integrated inhibition of biosynthetic pathways in

dietary obese mice. Biochim Biophys Acta 2014;1841(2):267-78.

156. Kalaany NY, Mangelsdorf DJ. LXRS and FXR: the yin and yang of cholesterol and

fat metabolism. Annu Rev Physiol 2006;68:159-91.

157. Cariou B, van Harmelen K, Duran-Sandoval D, van Dijk TH, Grefhorst A,

Abdelkarim M, Caron S, Torpier G, Fruchart JC, Gonzalez FJ, et al. The farnesoid

X receptor modulates adiposity and peripheral insulin sensitivity in mice. J Biol

Chem 2006;281(16):11039-49.

158. Zhao A, Yu J, Lew JL, Huang L, Wright SD, Cui J. Polyunsaturated fatty acids are

FXR ligands and differentially regulate expression of FXR targets. DNA Cell Biol

2004;23(8):519-26.

159. Kast HR, Nguyen CM, Sinal CJ, Jones SA, Laffitte BA, Reue K, Gonzalez FJ,

Willson TM, Edwards PA. Farnesoid X-activated receptor induces apolipoprotein

C-II transcription: a molecular mechanism linking plasma triglyceride levels to bile

acids. Mol Endocrinol 2001;15(10):1720-8.

167 160. Pineda Torra I, Claudel T, Duval C, Kosykh V, Fruchart JC, Staels B. Bile acids

induce the expression of the human peroxisome proliferator-activated receptor

alpha gene via activation of the farnesoid X receptor. Mol Endocrinol

2003;17(2):259-72.

161. Zhang Y, Castellani LW, Sinal CJ, Gonzalez FJ, Edwards PA. Peroxisome

proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha) regulates

triglyceride metabolism by activation of the nuclear receptor FXR. Genes Dev

2004;18(2):157-69.

162. VerHague MA, Cheng D, Weinberg RB, Shelness GS. Apolipoprotein A-IV

expression in mouse liver enhances triglyceride secretion and reduces hepatic lipid

content by promoting very low density lipoprotein particle expansion. Arterioscler

Thromb Vasc Biol 2013;33(11):2501-8.

163. Blade AM, Fabritius MA, Hou L, Weinberg RB, Shelness GS. Biogenesis of

apolipoprotein A-V and its impact on VLDL triglyceride secretion. J Lipid Res

2011;52(2):237-44.

164. Forte TM, Shu X, Ryan RO. The ins (cell) and outs (plasma) of apolipoprotein A-

V. J Lipid Res 2009;50 Suppl:S150-5.

165. Neuschwander-Tetri BA. Hepatic lipotoxicity and the pathogenesis of nonalcoholic

steatohepatitis: the central role of nontriglyceride fatty acid metabolites.

Hepatology 2010;52(2):774-88.

166. Pedersen H, Petersen M, Major-Pedersen A, Jensen T, Nielsen NS, Lauridsen ST,

Marckmann P. Influence of fish oil supplementation on in vivo and in vitro

168 oxidation resistance of low-density lipoprotein in type 2 diabetes. Eur J Clin Nutr

2003;57(5):713-20.

167. Hooper LV, Wong MH, Thelin A, Hansson L, Falk PG, Gordon JI. Molecular

analysis of commensal host-microbial relationships in the intestine. Science

2001;291(5505):881-4.

169 APPENDIX. SUPPLEMENTAL TABLES

Table S1. Ingredients of diets fed in the 8-d and Intralipid® reversal study

HCD1 HCD+13.5%LE Ingredients (g/100 mL) Dextrose 20 20 Amino acids 5 5 Lipid emulsion2 0.5 13.5

Electrolytes (mg/100 mL) Sodium acetate trihydrate 340 340 Potassium phosphate dibasic 261 261 Sodium chloride 59 59

Magnesium chloride MgCl2.6H2O 51 51 Calcium chloride dihydrate 33 33 Vitamin mix3 0.5 0.5 Mineral mix4 0.2 0.2 1HCD mice received soybean oil-based LE as a source of EFA.

2Lipid emulsion (Intralipid® 20%, Baxter) is expressed as percentage of total energy. The volumes of the emulsion added per 100 mL of liquid diet were 0.22 and 6.10 mL, respectively.

3Vitamin mix (Infuvite® Pediatric, Baxter). Final amounts per 100 mL of liquid diet were: vitamin A palmitate, 230 IU; vitamin D3, 40 IU; folic acid, 14 µg; biotin, 2 µg; niacinamide,

1.7 mg; dexpanthenol, 0.5 mg; pyridoxine-HCl, 0.1 mg; riboflavin, 0.14 mg; thiamin-HCl,

0.12 mg; ascorbic acid, 8 mg; vitamin K1, 0.02 mg, and vitamin B12, 0.1 µg when added to 100 mL of liquid diet.

170 4Final amounts per 100 mL of liquid diet were: 0.8 µg zinc chloride, 0.64 µg cupric sulfate, 0.12 µg manganous sulfate, 8 µg chromium chloride, 17.6 µg sodium selenite, and 0.113 g ferrous sulfate.

171 Table S2. Ingredients of diets fed in the Omegaven®, Clinoleic®, and Intralipid® reversal study

HCD1 HCD+13.5%LE Ingredients (g/100 mL) Dextrose 20 20 Amino acids 5 5 Lipid emulsion2 3.0 13.5

Electrolytes (mg/100 mL) Sodium acetate trihydrate 340 340 Potassium phosphate dibasic 261 261 Sodium chloride 59 59

Magnesium chloride MgCl2.6H2O 51 51 Calcium chloride dihydrate 33 33 Vitamin mix3 0.5 0.5 Mineral mix4 0.2 0.2 1HCD mice received soybean oil-based LE as a source of EFA.

2Lipid emulsion (Intralipid® 20%, Baxter; Omegaven® 10%, Fresenius Kabi; Clinoleic®

20%, Baxter) is expressed as percentage of total energy. The volumes of the emulsion added per 100 mL of liquid diet were 1.32 and 6.10 mL, respectively.

3Vitamin mix (Infuvite® Pediatric, Baxter). Final amounts per 100 mL of liquid diet were: vitamin A palmitate, 230 IU; vitamin D3, 40 IU; folic acid, 14 µg; biotin, 2 µg; niacinamide,

1.7 mg; dexpanthenol, 0.5 mg; pyridoxine-HCl, 0.1 mg; riboflavin, 0.14 mg; thiamin-HCl,

0.12 mg; ascorbic acid, 8 mg; vitamin K1, 0.02 mg, and vitamin B12, 0.1 µg when added to 100 mL of liquid diet.

4Final amounts per 100 mL of liquid diet were: 0.8 µg zinc chloride, 0.64 µg cupric sulfate, 0.12 µg manganous sulfate, 8 µg chromium chloride, 17.6 µg sodium selenite, and 0.113 g ferrous sulfate.

172 Table S3. Primer sequences used in this study

Gene F, Forward primer Gene Name Symbol R, Reverse primer

Abcb11 ATP-binding cassette, sub-family B F: 5'- GTTCCTCCGTTCAAACATTGG -3'

member 11 R: 5'- TCCCCATACTTGATGTTGTCCAT -3'

Acad1 Acyl-CoA dehydrogenase, medium-chain F: 5'-GCTGGAGACATTGCCAATCA-3' fatty acid R: 5'-TCTTGGCGTCCCTCATCAG-3'

Acc1 Acetyl-CoA carboxylase-1 F: 5'- ACCTGCCACAGAAACCATTC-3'

R: 5'-CGTGCTGTAGCAAAAGTGGA-3'

Actb Beta-actin F: 5'-ACCCACACTGTGCCCATCTA-3'

R: 5'-GCCACAGGATTCCATACCCA-3'

Acox1 Acetyl-CoA oxidase-1 F: 5'-CCGCCACCTTCAATCCAG-3'

R: 5'-ACTCTTGGGTCTTGGGGTCA-3'

Apcs amyloid P component, serum F: 5'- CACACTTTTGTTCCACACCCAAG-3'

R: 5'-TCTGAAAGAAGGCTGGTGAAGAC-3'

Atgl Adipose triglyceride lipase F: 5'-TGTGGCCTCATTCCTCCTAC-3'

R: 5'-TCGTGGATGTTGGTGGAGCT-3'

Ccl2 chemokine (C-C motif) ligand 2 F: 5'- AGGTCCCTGTCATGCTTCTG-3'

R: 5'- TCTGGACCCATTCCTTCTTG -3' Cd36 Cluster of differentiation 36 F: 5'-CAGTGTGAGACTGAAGGCAAA-3'

R: 5'-CATCGTTTCCCACACTCCTT-3'

Chrebp Carbohydrate-responsive element- F: 5'-CCAGCCTCAAGGTGAGCAAA-3'

binding protein R: 5'-CATGTCCCGCATCTGGTCA-3'

Cly ATP-citrate lyase F: 5'-AGGTCTCTCTGCAGCCATGT-3'

R: 5'-AAGCTTTCCTCGACGTTTGA-3'

Cpt-1α Carnitine palmitoyltransferase I F: 5'-CCAACGGGCTCATCTTCTAA-3'

R: 5'-CCCCACCCTCACTTCTGTTA-3'

Cyp7a1 Cytochrome P450 7A1 F: 5'- TCTGTCATGAGACCTCCGGG -3'

R: 5'- CCCTCATGTACAGGTTCTTGTGC -3'

173 Cyp8b1 Cytochrome P450 8B1 F: 5'- ATCCATGCAGGACAAATTTAACTTT -3'

R: 5'- ACAGGTGGGTCCCGTGTTC -3'

Fasn Fatty acid synthase F: 5'-CCAGAGCCCAGACAGAGAAG-3'

R: 5'-GACGCCAGTGTTCGTTCC-3'

Fgf-21 Fibroblast growth factor-21 F: 5'- ACACAATTCCAGCTGCCTTG-3'

R: 5'-TAGAGGCTTTGACACCCAGG-3'

Gapdh Glyceraldehyde 3-phosphate F: 5'-TGTCAGCAATGCATCCTGCA-3'

dehydrogenase R: 5'-GGAYACATTGGGGGTAGGAACAC-3'

Hprt Hypoxanthine-guanine F: 5'-AGGACCTCTCGAAGTGTTGG-3'

phosphoribosyltransferase R: 5'-AGCGCAAGTTGAATCTGCAA-3'

Hsl Hormone-sensitive lipase F: 5'- GCTGGGCTGTCAAGCACTGT -3'

R: 5'- GTAACTGGGTAGGCTGCCAT -3'

Pgc-1α Peroxisome proliferator-activated F: 5'- AGGAGGGTCATCGTTTGTGG -3'

receptor gamma coactivator 1-alpha R: 5'-GGAGGCAGAAGAGCCGTC-3'

Ppar-α Peroxisome proliferator-activated F: 5'- TCGAATATGTGGGGACAAGG -3'

receptor-alpha R: 5'- GACAGGCACTTGTGAAAACG -3' Ppar-γ Peroxisome proliferator-activated F: 5'- CCACCAACTTCGGAATCAGCT -3'

receptor-gamma R: 5'- TTTGTGGATCCGGCAGTTAAGA -3'

Pnpla3 Patatin-like phospholipase domain F: 5'-GGATCACAGGATCTGGGCTA-3'

containing protein 3 R: 5'- TGCACTCCCTGGTGTGTTTA-3'

Scd1 Stearoyl-CoA desaturase-1 F: 5'-GGAAATGAACGAGAGAAGGTG-3'

R: 5'-CCGAAGAGGCAGGTGTAGAG-3'

Srebpf1 Sterol regulatory element binding F: 5'-GTGAGCCTGACAAGCAATCA-3'

transcription factor-1 R: 5'-ACCAAGCCAGCAAATACACC-3'

174 Table. S4. Differential expression analysis of the hepatic genes

Gene ID Log2 Fold Change P value Adjust P value Elovl5 2.744711786 5.24E-70 6.70E-66 Ppp1r3g 4.308119791 2.30E-63 1.47E-59 2010003K11Rik 2.773744156 5.35E-50 2.28E-46 Dntt 3.965855179 1.33E-48 4.26E-45 Serpina1e -2.605877728 1.67E-46 4.26E-43 Enho -3.177608141 1.05E-44 2.23E-41 Pltp 2.831885131 1.59E-40 2.89E-37 Fabp2 1.824013559 2.18E-37 3.48E-34 Gal3st1 2.960708844 3.89E-34 5.52E-31 Raet1d 2.024564948 1.72E-32 2.19E-29 Lgals1 2.566323519 2.20E-31 2.55E-28 Raet1c 2.187870362 8.32E-31 8.85E-28 Raet1a 1.999312803 1.93E-29 1.90E-26 Raet1b 2.004737393 3.58E-29 3.26E-26 Raet1e 2.051447608 1.33E-28 1.14E-25 Plin4 2.898613701 1.51E-28 1.20E-25 Cyp17a1 2.359789798 3.59E-28 2.69E-25 Mup2 -3.352168548 7.95E-28 5.64E-25 Cyp46a1 2.774682528 1.06E-27 7.09E-25 Apoa4 2.516368415 9.43E-27 6.02E-24 Slc16a5 2.858662834 4.03E-25 2.45E-22 Cyp4a14 1.68374424 6.92E-25 4.02E-22 Sdr9c7 -1.368768518 6.58E-23 3.66E-20 1810008I18Rik 1.319012052 3.41E-22 1.81E-19 Tuba8 2.490085194 5.09E-22 2.60E-19 Fads1 1.487070219 9.11E-21 4.48E-18 Uap1l1 2.149863026 1.08E-20 5.13E-18 Osgin1 -2.108859873 4.40E-20 2.01E-17 Nr4a1 2.752613467 9.66E-20 4.25E-17 Crat 1.388137533 1.28E-19 5.44E-17 Oat 1.647832144 1.98E-19 8.16E-17 Gpx6 2.35221249 7.42E-19 2.96E-16 1810055G02Rik 1.705493149 9.20E-18 3.56E-15 Mup9 -2.613603832 1.09E-17 4.09E-15

175 Gstp1 -1.409725536 2.89E-17 1.05E-14 Cd36 1.821092449 1.35E-16 4.78E-14 Slc39a5 2.175604388 3.77E-16 1.30E-13 Ces4a -2.344133733 7.49E-16 2.52E-13 Serpina12 -1.289290927 1.60E-15 5.24E-13 Cyp2f2 -1.189830493 1.98E-15 6.33E-13 Ces2a -0.964938844 2.33E-15 7.25E-13 Gpc1 1.680695725 4.73E-15 1.44E-12 Aox3 -1.610994676 4.99E-15 1.48E-12 Scd1 2.308371582 7.75E-15 2.25E-12 Sult5a1 -1.747689406 9.92E-15 2.82E-12 Hcar2 2.301974692 1.14E-14 3.17E-12 Frmd4b 1.543217819 1.27E-14 3.45E-12 Gtdc1 1.575325579 1.47E-14 3.90E-12 Prss8 1.833526276 2.19E-14 5.72E-12 Aqp4 1.37766396 2.35E-14 6.01E-12 Clstn3 1.495566891 3.30E-14 8.25E-12 Pnldc1 1.779117132 6.14E-14 1.51E-11 Acaa1b 1.211344293 1.09E-13 2.63E-11 Osbpl3 2.045837995 2.97E-13 7.02E-11 Vegfb 1.494352021 8.04E-13 1.87E-10 Elovl2 1.222166938 8.45E-13 1.93E-10 Unc119 1.512015177 9.86E-13 2.21E-10 Atf5 0.902177159 1.12E-12 2.46E-10 Lhpp 1.575077896 1.18E-12 2.56E-10 Slc3a1 -1.230990129 1.28E-12 2.72E-10 Efna1 1.443553108 2.74E-12 5.74E-10 Vnn1 1.234449699 2.83E-12 5.83E-10 Got1 1.170988138 3.59E-12 7.27E-10 Pter 0.78795144 3.78E-12 7.54E-10 Gprc5b 2.094723185 4.16E-12 8.17E-10 Wfdc2 1.723319455 5.81E-12 1.12E-09 Moxd1 -2.10208756 6.32E-12 1.20E-09 Chrna4 2.077217398 6.90E-12 1.30E-09 Ly6d 2.045458091 8.94E-12 1.66E-09 C9 -1.020557629 1.15E-11 2.10E-09 Acsl5 0.906280264 1.64E-11 2.96E-09

176 Npr2 -1.037774214 1.80E-11 3.19E-09 Cln6 1.522758103 2.24E-11 3.91E-09 Hspb1 1.221757678 2.48E-11 4.28E-09 Mfsd2a 2.020909434 2.78E-11 4.73E-09 Spry4 -1.455577217 3.28E-11 5.51E-09 Cyp4a10 1.323577314 3.81E-11 6.33E-09 Gch1 -0.720283636 5.19E-11 8.50E-09 Gngt1 1.804486386 5.67E-11 9.16E-09 Sort1 -1.594331531 6.64E-11 1.06E-08 Cyp2c50 -0.977371445 8.80E-11 1.37E-08 Saa4 -1.099123207 8.73E-11 1.37E-08 Hbb-bs -1.420374838 9.81E-11 1.49E-08 Hbb-b1 -1.420374838 9.81E-11 1.49E-08 Sik1 1.661909218 1.06E-10 1.60E-08 Stap1 1.876139577 1.17E-10 1.74E-08 Cgref1 1.833084353 1.33E-10 1.95E-08 Olig1 1.181983731 1.64E-10 2.37E-08 Anxa2 1.120027196 2.44E-10 3.50E-08 Pparg 1.191658739 2.94E-10 4.17E-08 Apcs 1.241783575 3.02E-10 4.24E-08 Cela1 -1.334420829 3.18E-10 4.41E-08 Lipa 0.889327915 3.54E-10 4.86E-08 Pgrmc2 0.863712465 3.81E-10 5.18E-08 Arsa 1.064634969 4.00E-10 5.37E-08 Grpel2 0.761743783 4.54E-10 6.03E-08 Bche 0.915726253 4.70E-10 6.14E-08 Irf5 -1.08721864 4.71E-10 6.14E-08 Rdh11 1.293085134 5.35E-10 6.91E-08 Slc25a45 -1.467500765 6.36E-10 8.12E-08 Vnn3 0.953851972 6.91E-10 8.74E-08 Mknk2 1.132279774 9.22E-10 1.15E-07 Zfp395 1.082713657 9.79E-10 1.21E-07 Pdzk1ip1 1.371997327 1.04E-09 1.28E-07 Rdh16 1.138851553 1.09E-09 1.33E-07 Lrrc39 1.777750941 1.17E-09 1.41E-07 Il1r1 -1.385335093 1.21E-09 1.44E-07 Cdh1 -1.307646527 1.24E-09 1.46E-07

177 Aldh3a2 0.889671316 1.39E-09 1.63E-07 Tsc22d1 -1.378347107 1.46E-09 1.70E-07 Egln3 0.939937392 1.70E-09 1.95E-07 Galk1 0.892611217 1.72E-09 1.96E-07 Ftl1 0.917116268 1.95E-09 2.21E-07 Acaca 1.28914539 2.01E-09 2.25E-07 Fam25c -1.494043774 3.09E-09 3.44E-07 Acnat1 -0.794455126 3.17E-09 3.48E-07 Hr 1.764340875 3.20E-09 3.50E-07 Susd1 1.206120896 3.39E-09 3.67E-07 Vldlr 1.375279319 3.55E-09 3.81E-07 Gas6 0.849236291 3.67E-09 3.91E-07 Fasn 1.671339291 4.07E-09 4.30E-07 Acot3 1.799309634 4.48E-09 4.65E-07 Cyp2a12 -1.006714642 4.46E-09 4.65E-07 Slc16a7 1.085388042 5.00E-09 5.15E-07 Ido2 -0.870765086 5.77E-09 5.90E-07 Insig1 1.300515315 6.28E-09 6.30E-07 Hbb-bt -1.325959036 6.32E-09 6.30E-07 Hbb-b2 -1.325959036 6.32E-09 6.30E-07 Ildr2 0.906676508 6.53E-09 6.46E-07 Fam213a 0.812042448 6.70E-09 6.58E-07 Abca2 -1.079154547 7.35E-09 7.16E-07 Sigmar1 0.632659071 7.51E-09 7.27E-07 Tmem184b 1.048606409 9.16E-09 8.80E-07 Apoc2 0.940722921 9.65E-09 9.20E-07 Fmo1 0.713006835 1.14E-08 1.08E-06 Ndrg2 -0.673167016 1.54E-08 1.45E-06 2310034O05Rik 1.712677374 1.62E-08 1.51E-06 Trim80 1.685021776 1.72E-08 1.59E-06 Cyp4a12b 0.92183578 1.75E-08 1.61E-06 Tlcd1 0.972808918 1.88E-08 1.71E-06 Ugt2b38 -1.377046804 2.12E-08 1.92E-06 Tspan33 -0.862570729 2.53E-08 2.28E-06 Zkscan3 -0.832203969 2.90E-08 2.59E-06 Adgrv1 -1.38639905 3.11E-08 2.76E-06 Acacb 1.642015281 3.30E-08 2.90E-06

178 D230025D16Rik -0.92969497 3.32E-08 2.90E-06 Fst 1.45164405 3.38E-08 2.93E-06 Idh2 0.758618059 3.41E-08 2.94E-06 Tmem86a 1.202765885 3.73E-08 3.19E-06 Lama3 -1.465161479 4.30E-08 3.66E-06 Baat -0.657151239 4.72E-08 4.00E-06 Cyp4v3 -0.645448821 5.56E-08 4.67E-06 Cyp2c70 -1.230914246 5.65E-08 4.71E-06 Hba-a1 -1.108998864 5.94E-08 4.88E-06 Hba-a2 -1.108998864 5.94E-08 4.88E-06 Atp9a 0.75782164 5.96E-08 4.88E-06 Lifr -1.124619676 6.34E-08 5.16E-06 D130043K22Rik 1.533854042 6.86E-08 5.55E-06 9030619P08Rik -1.650426857 7.50E-08 6.02E-06 Irf2bpl -0.859811166 7.95E-08 6.34E-06 Ces3b -0.867609617 8.08E-08 6.41E-06 Slco1a4 1.288885856 8.81E-08 6.95E-06 Mmd -0.752355615 9.05E-08 7.04E-06 Mup16 -1.531297712 9.03E-08 7.04E-06 Pigp 1.050289347 9.69E-08 7.50E-06 Sdc4 -0.72150509 1.04E-07 8.01E-06 Nudt7 -1.139392861 1.06E-07 8.13E-06 Aqp8 0.917408486 1.09E-07 8.27E-06 Cyp2a5 -1.025296217 1.20E-07 9.04E-06 Selenbp2 -1.53906893 1.41E-07 1.06E-05 Amacr -0.563061641 1.42E-07 1.06E-05 Dpyd 0.549005517 1.45E-07 1.07E-05 Cyp2u1 -1.123252529 1.50E-07 1.11E-05 Ifi27l2b 1.288372978 1.52E-07 1.11E-05 Actg1 1.020143609 1.56E-07 1.14E-05 Mvp 0.790687624 1.62E-07 1.18E-05 Ces1c -0.670668144 1.63E-07 1.18E-05 Il17rb 1.04624219 1.72E-07 1.23E-05 Tceal8 0.806452422 1.78E-07 1.27E-05 Anxa5 0.883276732 2.06E-07 1.46E-05 Cpn1 0.540161727 2.10E-07 1.48E-05 Btg2 1.23620016 2.51E-07 1.76E-05

179 Abhd6 -0.774377783 2.56E-07 1.78E-05 Pdk4 1.186459821 2.63E-07 1.82E-05 Ulk2 -0.79124918 2.65E-07 1.83E-05 Gm19619 1.441409959 2.67E-07 1.83E-05 Flot1 0.766384965 2.75E-07 1.88E-05 Smad7 1.092073902 3.21E-07 2.18E-05 Mup12 -1.442577016 3.39E-07 2.29E-05 Slc20a1 1.298675087 3.65E-07 2.46E-05 Bdh1 0.505137103 3.68E-07 2.46E-05 Gsap -0.88919666 3.72E-07 2.47E-05 Obp2a -1.50619901 3.79E-07 2.51E-05 Cd9 0.81646041 3.95E-07 2.60E-05 Lpcat3 0.621534441 4.01E-07 2.63E-05 Id1 1.308045303 4.20E-07 2.74E-05 Serpina7 1.479973062 4.58E-07 2.97E-05 Lpl 1.16377131 4.73E-07 3.05E-05 Serpinb8 1.195809195 5.01E-07 3.22E-05 C2 -0.651096011 5.28E-07 3.37E-05 Fgf21 1.450216603 5.43E-07 3.45E-05 Sult2a8 -0.771343024 5.73E-07 3.62E-05 Slc27a1 0.979342891 5.90E-07 3.71E-05 Ctsb 0.593306368 5.96E-07 3.73E-05 Cyp2d9 -0.570341732 6.30E-07 3.92E-05 Ttc3 0.926682697 6.38E-07 3.96E-05 Dlat 0.86828473 6.57E-07 4.05E-05 Gstm2 1.144057272 7.65E-07 4.70E-05 Ccnd1 1.001555366 7.73E-07 4.72E-05 Fdps 1.138801686 7.84E-07 4.77E-05 Acot1 1.009000671 7.95E-07 4.81E-05 Ajuba -1.049850781 8.24E-07 4.95E-05 Cdc42ep5 1.419927618 8.26E-07 4.95E-05 Avpr1a -1.055719643 8.55E-07 5.10E-05 Arid5b -1.381166458 8.86E-07 5.27E-05 C8b -0.753566329 9.24E-07 5.47E-05 Mat1a 0.66060829 9.57E-07 5.63E-05 Rnf144b -0.830984018 9.67E-07 5.66E-05 Pdilt -1.026770875 9.75E-07 5.68E-05

180 Proca1 1.188143605 9.85E-07 5.72E-05 Ermp1 0.901314159 1.01E-06 5.83E-05 Hip1r 0.890687136 1.01E-06 5.83E-05 Gnat1 1.319710498 1.04E-06 5.96E-05 Supt3 0.947883884 1.06E-06 6.05E-05 Uox 0.665248968 1.07E-06 6.06E-05 Hopx -0.720346863 1.07E-06 6.06E-05 Robo1 1.057371602 1.14E-06 6.39E-05 Tmem97 0.602501204 1.20E-06 6.67E-05 Stom 0.653844512 1.20E-06 6.67E-05 Dusp6 0.907488921 1.24E-06 6.86E-05 Hspa2 1.312351816 1.25E-06 6.88E-05 Krt18 0.710397253 1.25E-06 6.88E-05 Atf3 1.448593569 1.33E-06 7.30E-05 Enpep 0.700282111 1.45E-06 7.92E-05 Lamb3 1.079953133 1.51E-06 8.19E-05 Pcyt2 0.531262343 1.63E-06 8.80E-05 Fbp1 0.613161982 1.73E-06 9.31E-05 Mug1 -0.573612876 1.91E-06 0.000102603 Mgst3 0.986570068 1.93E-06 0.000103018 Pgd 0.891015964 1.95E-06 0.000103827 Acox1 0.661186029 2.06E-06 0.000108758 Acot4 0.966496432 2.06E-06 0.000108758 Ggt6 0.794391576 2.13E-06 0.000112143 Slc17a3 -0.590361805 2.18E-06 0.000113918 C6 -0.633230833 2.19E-06 0.000114049 Mtmr11 1.436188025 2.25E-06 0.000116797 Slc22a7 -1.446504251 2.28E-06 0.000117469 Ctsa 0.612576772 2.28E-06 0.000117469 Rnf145 0.948351592 2.38E-06 0.000121812 Cpsf4l -1.093080233 2.50E-06 0.000127878 Tm6sf2 0.772531994 2.90E-06 0.00014759 Dio1 -1.300702016 3.00E-06 0.000152133 Hexa 0.829081173 3.08E-06 0.000155606 Adora1 1.033203049 3.22E-06 0.000161815 Aadat -0.56436513 3.23E-06 0.000161918 Acss2 0.971668483 3.38E-06 0.000168563

181 Pcp4l1 -1.119955651 3.80E-06 0.000188898 4931408D14Rik 0.955845759 3.85E-06 0.000190329 Stat5a -1.053734071 3.90E-06 0.000192396 Abhd2 1.181580658 3.93E-06 0.000193016 Morc4 1.325470121 4.03E-06 0.000197042 Ppp1r3c 0.996813318 4.11E-06 0.00020026 Trim14 -0.657674482 4.23E-06 0.000205344 Gnpda1 0.695740231 4.66E-06 0.000225248 Kctd2 0.72492678 4.96E-06 0.00023909 Nipal1 1.365005942 5.14E-06 0.000246745 Mt2 1.365259857 5.22E-06 0.000249698 Ctsc -0.865502038 5.58E-06 0.000265768 Tlcd2 -0.765009009 5.62E-06 0.000266716 Dirc2 -0.635772236 5.91E-06 0.000279439 Rassf6 1.020849632 6.18E-06 0.00029114 Plin2 0.615949668 6.24E-06 0.000291813 Ccni 0.552571501 6.26E-06 0.000291813 Klk1b4 1.252647605 6.22E-06 0.000291813 Chd3 -0.684825552 6.31E-06 0.000293112 Aldob 0.627078118 6.70E-06 0.000308723 Nupr1 1.369776051 6.67E-06 0.000308723 Hsd17b12 0.554862308 6.72E-06 0.000308774 Krt8 0.490667433 6.88E-06 0.000315138 Snap29 0.616426175 7.22E-06 0.000329464 Apoa5 0.739884562 7.26E-06 0.00032985 Stx6 -0.806876301 7.93E-06 0.000359037 Rad51b 1.333899697 8.07E-06 0.000364228 Dynll1 -0.970110043 8.31E-06 0.00037361 Ralgds 1.241573196 8.45E-06 0.000378729 Copz2 0.809249492 8.83E-06 0.000394311 Akr1c14 -0.659245111 8.88E-06 0.000395022 Hspb8 0.52835104 9.24E-06 0.000409572 Dpp7 0.587710728 9.37E-06 0.000414052 Tdo2 -0.572763467 9.96E-06 0.000438745 Tmem135 0.682693636 1.00E-05 0.00043906 Acadl 0.465129822 1.09E-05 0.000478509 Nfix -0.707581772 1.11E-05 0.000482068

182 Apom -0.571691355 1.12E-05 0.000485977 Serpina4-ps1 -1.343524943 1.19E-05 0.000515423 H2-Q10 0.524320737 1.22E-05 0.000525686 Depdc7 -0.712504182 1.24E-05 0.000531152 Pctp 0.570872981 1.25E-05 0.000533117 Camk1d 0.727513062 1.25E-05 0.000533117 Qpct -0.892577364 1.25E-05 0.000533355 Cdk4 0.531008327 1.26E-05 0.000535268 Myo1d 0.860042661 1.29E-05 0.000543571 Trp53inp2 -0.848315413 1.29E-05 0.000543571 Dennd2d 0.848080587 1.39E-05 0.000583549 Gstt3 0.796711058 1.45E-05 0.000608723 Car1 -0.951173832 1.46E-05 0.000610677 Slc25a42 -0.664313204 1.50E-05 0.000625912 Hdhd3 -0.802950061 1.51E-05 0.000626443 Slc41a2 -1.051281009 1.54E-05 0.000636276 Pqbp1 0.701072313 1.56E-05 0.000640624 Lpin2 0.82157507 1.67E-05 0.000687622 Gstm4 0.648211528 1.69E-05 0.000691837 Gpx4 0.733661123 1.72E-05 0.000700937 Iigp1 -0.608469237 1.76E-05 0.000715043 Bcl3 -0.758521572 1.80E-05 0.000729389 Cyp2d40 -0.573895375 1.82E-05 0.000735915 Pdk1 0.731599422 1.87E-05 0.000750455 Mup14 -1.14858616 1.87E-05 0.000750455 Rhou 0.558225453 1.87E-05 0.000750455 Atp6v0d2 1.124700821 1.90E-05 0.000756815 Fgf1 -0.531632342 1.90E-05 0.000756892 Lrig1 -0.739375495 1.94E-05 0.000769436 Serpinf2 -0.489976915 1.95E-05 0.000771417 Tsku -1.308626464 1.98E-05 0.000778744 Fabp5 1.290332315 1.99E-05 0.000780845 Cyp2c38 0.950014307 2.02E-05 0.000793279 Srebf1 0.770085812 2.15E-05 0.00083776 Tspan31 0.659281318 2.16E-05 0.000840859 Acy3 -0.538177036 2.30E-05 0.00089121 Npc2 0.485593189 2.33E-05 0.000897879

183 Hykk 0.605512322 2.32E-05 0.000897879 Ptpn9 0.649816282 2.34E-05 0.000900464 Rtn4 0.721954349 2.35E-05 0.000900484 Cyp4a12a 0.572123484 2.37E-05 0.000904363 Ston2 -0.947369258 2.41E-05 0.000918575 Ttc39c -0.795647741 2.44E-05 0.000924889 Pklr 0.893635451 2.43E-05 0.000924889 Gata4 -0.586840983 2.52E-05 0.000950847 Fam83f 1.262541739 2.52E-05 0.000950847 Hc -0.452611142 2.59E-05 0.000972234 Pgm3 0.819712229 2.60E-05 0.000973249 Rras 0.639950208 2.62E-05 0.000977376 Inhbe 0.933972568 2.73E-05 0.001016538 Ugt2b35 -0.702964613 2.74E-05 0.001016538 Tkt 0.604016319 2.75E-05 0.001016756 Gramd1c -0.624439001 2.77E-05 0.001022804 Rai14 -0.577488221 2.79E-05 0.001025586 Abhd17a 0.600945196 2.82E-05 0.001033289 1500017E21Rik 0.980795281 2.82E-05 0.001033289 Slc44a3 0.945999343 2.85E-05 0.00104008 Col1a1 1.085379402 2.88E-05 0.001048388 Angptl3 0.676625358 2.90E-05 0.001053041 Gcnt4 -1.044551303 2.92E-05 0.001057765 5830473C10Rik 0.671598139 2.94E-05 0.001058133 Ces3a -0.505816001 2.94E-05 0.001058133 Ctps2 0.798577128 3.00E-05 0.001074744 F11 -0.473725748 3.07E-05 0.001097863 Emilin1 0.603484821 3.10E-05 0.001107145 Akr1c6 -0.584403805 3.30E-05 0.001173159 Lonp2 -0.42951108 3.32E-05 0.001177102 Elovl6 1.245277369 3.42E-05 0.001210874 Spg21 0.560958034 3.46E-05 0.001220623 Wfdc21 -0.576389684 3.56E-05 0.001250883 Mab21l3 1.203626034 3.58E-05 0.001255454 Adcy6 0.791994361 3.60E-05 0.001258832 Foxa1 -1.047143358 3.65E-05 0.001275127 2010111I01Rik -0.770614566 3.73E-05 0.001299024

184 Dexi -0.862161603 3.74E-05 0.001299443 Prodh -0.556823727 3.83E-05 0.001324083 Mafk 0.80621918 3.86E-05 0.001331808 Cyb5r3 0.561165806 3.88E-05 0.001335437 Amigo2 0.780880545 4.05E-05 0.001389208 Nfkb2 0.76684763 4.20E-05 0.001438732 Jmjd4 -0.78475428 4.23E-05 0.001440945 Ocstamp 1.2429246 4.23E-05 0.001440945 Tcn2 0.603768845 4.33E-05 0.001468485 Syne3 1.141128681 4.33E-05 0.001468485 Cyp7b1 -1.224302645 4.39E-05 0.001484035 Tmem18 -0.81453665 4.46E-05 0.001501787 Hmox1 0.577010661 4.49E-05 0.001509919 Fads2 1.218775645 4.64E-05 0.00155571 Sgk1 0.833012644 4.68E-05 0.001566092 Cxx1c 1.070295991 4.73E-05 0.001575764 2810474O19Rik -1.075775732 4.76E-05 0.001584483 Ak2 0.51026038 4.78E-05 0.001586273 Mt1 1.209949207 4.81E-05 0.001591642 Stat5b -0.654464817 4.88E-05 0.001604955 Fitm1 0.757727224 4.87E-05 0.001604955 Plin3 0.616897085 4.90E-05 0.001610255 Fpgs -0.70453249 4.96E-05 0.001623836 Bpgm -0.626133857 5.05E-05 0.001649144 Tsc1 0.542641111 5.27E-05 0.001715827 Fam171a1 0.958664728 5.33E-05 0.001732356 Dhcr24 0.830754752 5.36E-05 0.001737343 Zfpm1 0.567591272 5.48E-05 0.001771442 Igfbp5 1.072808757 5.51E-05 0.001774068 Hsd17b2 -0.627349631 5.51E-05 0.001774068 Arrdc4 0.737234444 5.57E-05 0.001786296 Ap5s1 0.589839165 5.65E-05 0.001808211 Mapk15 0.82263779 5.67E-05 0.001810821 Ptpre -1.187989066 5.69E-05 0.001812872 AI182371 -0.490016139 5.77E-05 0.001834426 Ctsz 0.576595266 5.98E-05 0.001895136 Col1a2 0.842731732 6.09E-05 0.001925447

185 Kng2 0.588405012 6.11E-05 0.001926685 Agpat9 0.968660298 6.13E-05 0.001929406 Ahsg -0.561570346 6.18E-05 0.001938889 Grn 0.532422423 6.47E-05 0.002024617 Fam102a 0.922685774 6.57E-05 0.002041416 Gcn1l1 -0.536480521 6.57E-05 0.002041416 Renbp 1.020285366 6.55E-05 0.002041416 2810459M11Rik -0.482337977 6.67E-05 0.002066593 Bhlhe40 0.963040731 6.71E-05 0.002075621 Amd1 -0.812258638 6.94E-05 0.002130515 Amd2 -0.812258638 6.94E-05 0.002130515 Lgr4 -0.683302883 6.92E-05 0.002130515 Abhd17b -0.753589739 7.00E-05 0.002142974 Cpne2 -0.848881547 7.23E-05 0.002208455 Etnppl 0.597466485 7.28E-05 0.002220283 Slc25a1 0.481942333 7.33E-05 0.002229163 Slc25a17 -0.581600115 7.45E-05 0.002260981 Aldh1a7 0.589095826 7.49E-05 0.002267724 Sparc 0.486759766 7.68E-05 0.002319976 Cyr61 0.882785357 7.80E-05 0.002347893 Aar2 -0.538063562 7.85E-05 0.002360381 Mapk3 0.487476704 8.08E-05 0.002423023 Nrg4 1.098293409 8.11E-05 0.0024243 Zfp84 -0.822429267 8.16E-05 0.00243531 Agpat6 0.625663542 8.29E-05 0.00246724 Abcc3 0.772405648 8.36E-05 0.002484014 Mir8093 -0.980611069 8.39E-05 0.00248741 Fth1 0.677266566 8.49E-05 0.002509666 Ctcflos 1.01137653 8.77E-05 0.002586176 Wnk4 -1.119562367 8.86E-05 0.002602024 Sdr42e1 -0.598625213 8.86E-05 0.002602024 Glipr2 1.050195884 8.95E-05 0.002621493 Cidec 1.17054786 9.11E-05 0.002661949 Pfkfb3 -1.074952337 9.18E-05 0.002675823 Nagk 0.643966147 9.21E-05 0.002679051 Fhl3 1.1889451 9.66E-05 0.002790029 Stim2 -0.772408809 9.64E-05 0.002790029

186 Cd163 -0.948077483 9.62E-05 0.002790029 Serpina3k -0.571656515 9.75E-05 0.002810582 Rusc1 0.70657335 9.92E-05 0.002853928 Abca3 -0.721091524 9.97E-05 0.002862561 Cldn2 0.730297241 0.000100628 0.002881432 Ralb 0.630248045 0.000101481 0.002886455 Mief2 -0.651794384 0.000101432 0.002886455 Cela2a -1.1047867 0.000101318 0.002886455 Nmral1 -0.838364805 0.000102776 0.002916783 Snap47 -0.531122631 0.000103495 0.00292808 Tmem184a 0.69033806 0.000103633 0.00292808 Slc35f2 1.067216877 0.000105721 0.002980482 Gstm6 0.598817336 0.000108209 0.003043919 Gys2 0.66864773 0.000110398 0.003098669 Cyb5b 0.496404872 0.000110911 0.003106227 Slc38a2 -0.480665628 0.000111367 0.003106662 Phospho2 -0.664520723 0.000111413 0.003106662 Slc38a4 0.470864014 0.000111815 0.003111087 Saa1 -0.859826494 0.000112629 0.003126922 Nt5c2 0.647322571 0.000113272 0.003137954 Tmem171 1.136313505 0.000113909 0.003148776 Zap70 0.783122905 0.000114427 0.003156249 Saa3 -1.10484356 0.000115881 0.003182618 Ldha 0.411867724 0.000115672 0.003182618 Acat2 0.684212164 0.000116613 0.003195849 Tlr5 1.055754065 0.000120174 0.003286395 Slc46a3 -0.7666232 0.000120756 0.003295238 Kif1a 1.113488485 0.000121703 0.003314015 Sdc1 0.482597529 0.000125874 0.003420304 Nelfe 0.488705707 0.00012661 0.003432976 Eif4ebp3 -0.876382247 0.00012862 0.003480105 Prkce 0.654532251 0.000129115 0.003486099 Pros1 0.506080176 0.000132288 0.00356425 Nup35 -0.984313262 0.000133208 0.003581475 Chpt1 0.467740662 0.0001352 0.003627402 Mettl7b 0.594827763 0.000136875 0.003656969 Baz1a -0.88597816 0.000136619 0.003656969

187 Klf16 0.959295123 0.000137258 0.003659541 Mapkapk2 0.412754022 0.000138147 0.003675567 2310001H17Rik -0.919718954 0.000139523 0.003704468 Arl5a 0.437669725 0.000143564 0.003803838 Grhpr -0.441193256 0.00014684 0.003882601 Mterf3 -0.535765436 0.000149847 0.003945754 Dnaic1 -1.035498475 0.000149705 0.003945754 Nrp1 -0.841854508 0.000155079 0.00407513 Tax1bp3 0.632025187 0.000158016 0.004143787 Palm 1.036035046 0.000160182 0.00419197 Letm1 -0.500093195 0.000162997 0.004256916 Rhpn2 0.749305138 0.000164618 0.004290482 Slc17a4 0.534547383 0.000165774 0.004305222 Gpcpd1 -0.794302869 0.000165858 0.004305222 Hhipl2 1.15214684 0.000168302 0.004349276 Lacc1 0.933590402 0.000168372 0.004349276 Mup3 -0.748251969 0.000168577 0.004349276 Hgd 0.4672457 0.00016984 0.004367988 S100a10 0.71096172 0.000170328 0.004367988 Tox 0.916338271 0.000170186 0.004367988 Susd4 -0.780256899 0.000178298 0.004535954 BC029214 -0.833680771 0.000178167 0.004535954 Gm10319 -0.624937614 0.000177401 0.004535954 Paox 0.474043632 0.000178192 0.004535954 Loxl2 1.029608593 0.000179133 0.004548138 Vat1 0.565891573 0.000180175 0.00455995 Nars2 -0.544944736 0.00018042 0.00455995 Ctsd 0.495104148 0.00018067 0.00455995 Ugt2a3 -0.482821521 0.000183673 0.0046266 Fam83a 1.146769783 0.00018452 0.004638782 Tmem51 0.717081626 0.000185376 0.004651158 Foxa3 -0.59043822 0.000186423 0.004668262 Tmem219 -0.532089416 0.000192185 0.004803131 Brap 0.410683419 0.000192623 0.00480466 Gba2 -0.663201817 0.000195411 0.004864703 Clmp 0.987912997 0.000211254 0.005248879 Selenbp1 0.556641389 0.000216683 0.005373312

188 Osbpl7 1.002380943 0.0002195 0.005432635 Xrcc3 0.880386526 0.000220055 0.005434759 Lpar6 -0.576365564 0.000220863 0.005434759 Fam13a 0.880199048 0.000220543 0.005434759 Dnajb2 0.510185232 0.000224083 0.005492834 Dact2 0.682355492 0.000223688 0.005492834 Slc2a4 1.121090965 0.000226066 0.005523081 S100a11 0.779750974 0.000226182 0.005523081 Rbbp4 -0.513275011 0.000226901 0.005530058 Wbp2 0.39805278 0.000228305 0.005553677 Kmo -0.40213479 0.000231006 0.005608712 Ugt2b5 -0.471129 0.000232221 0.005627501 Scpep1 0.555791379 0.000237039 0.005733372 Gstt2 0.757904123 0.000240406 0.005803831 Mfap4 1.083367237 0.000247015 0.005929757 Gramd4 0.826205338 0.000246715 0.005929757 Lims2 -0.628871566 0.000246445 0.005929757 Slc22a15 0.70550452 0.000247911 0.005939803 Ldlr 0.820966774 0.000248364 0.005939803 Ank3 0.834184183 0.000250943 0.005985075 Irgm2 -0.632786811 0.00025162 0.005985075 Anxa8 1.047784165 0.000251663 0.005985075 3110082I17Rik -0.98967188 0.000254309 0.006036766 Nfe2l2 0.494973714 0.000255333 0.006049825 Cyp1a2 -0.676652764 0.000262045 0.006197373 Tmem53 0.628472761 0.000262991 0.006208251 H2-K1 0.421724173 0.000274506 0.006456195 Nadk 0.444747547 0.000274298 0.006456195 Asap2 -0.856915944 0.000295833 0.006944995 Rnpepl1 0.411797296 0.000296669 0.006951845 Tnfrsf19 0.887535199 0.000299134 0.006996777 Crnkl1 -0.602103667 0.00030348 0.007085462 Hnmt 0.699886485 0.000304109 0.007087192 Pigr -0.464724986 0.000309218 0.007193113 Ppargc1a 0.723076982 0.00031141 0.007230936 Slc36a1 -0.615360789 0.000313157 0.007258309 Tat 0.691192177 0.00031427 0.007270907

189 Plcxd2 -0.771052198 0.00031839 0.007352916 Xbp1 -0.596766288 0.000319994 0.007376617 Fam53a -0.500306975 0.00032366 0.007447684 Hsd17b10 0.67326856 0.000325756 0.007482432 Hsd3b3 -0.465612495 0.000328723 0.007537011 Plxnb2 -0.414677486 0.000332768 0.007597524 Dnase2b 0.535915004 0.000333146 0.007597524 Atg4d -0.504776611 0.000332961 0.007597524 Nr4a2 1.071266854 0.000340054 0.007741237 Sh3pxd2a -0.576437996 0.000343547 0.007796638 Nup210 -0.547849205 0.000343709 0.007796638 Gpr108 -0.550098317 0.000352725 0.007986971 Fam81a -1.085300015 0.000359955 0.008136254 Tpst1 -0.587389865 0.00036538 0.008200814 Mfge8 0.544409633 0.000364599 0.008200814 Aplp2 0.499244711 0.000364129 0.008200814 C2cd2l 0.724876248 0.000365009 0.008200814 Sult1a1 0.590128322 0.000366126 0.00820314 Fam126a 0.923381932 0.000369954 0.008274405 Mfsd6 -0.728131779 0.000379708 0.008477722 Cfb -0.395386431 0.000387327 0.008632739 Vps41 0.474475864 0.000390722 0.008685578 Sec23ip -0.565495226 0.000391058 0.008685578 Impg2 0.988324588 0.000392247 0.008696847 Col14a1 0.566394513 0.000394601 0.008703708 Mup13 -0.888694927 0.00039435 0.008703708 Rnf169 -0.47085645 0.000394411 0.008703708 Lrriq3 1.074613267 0.000396083 0.008721342 Slc22a30 -0.533787687 0.000408622 0.008981952 Capn8 -1.047755209 0.000410519 0.009008142 Gga2 0.621918906 0.000413289 0.009053363 Anxa7 0.446223975 0.000417995 0.009140773 Themis 1.082060761 0.000420717 0.009184577 Cep85 -0.611835094 0.000423922 0.009238751 Lyz2 -0.596751146 0.000425525 0.009242148 Chic1 -1.022832324 0.000425231 0.009242148 Rnase4 -0.637506355 0.000430185 0.009327496

190 Serpina6 0.566320943 0.000435041 0.009416791 Dynlt3 0.402953667 0.000445666 0.009630454 Maff 0.862683994 0.000447286 0.009649134 Tmem106b 0.496445865 0.000457838 0.009860109 Grk5 -0.921713557 0.000458725 0.009862578 Srxn1 0.602476363 0.000461729 0.009910496 Akr1b8 0.851009175 0.000462922 0.009919434 Cyp2d11 -0.984811409 0.000464808 0.009943163 Shmt2 -0.408115019 0.000466461 0.009961822 Prlr 0.723267349 0.000468145 0.009975551 Btc 1.019277408 0.000468666 0.009975551

The P values and adjust P values were generated by DESeq software in

which Benjamini-Hochberg (BH) method was used to calculate

adjusted P value, and the fold change was estimated by the ration of

HCD to HCDF.

191 VITA Kuan-Hsun Huang

Education 2016 Ph.D. in Nutritional Sciences. The Pennsylvania State University, U.S.A. 2009 M.S. in Nutrition and Health Science. Taipei Medical University, Taiwan. 2006 B.S. in Nutrition and Health Science. Fooyin University, Taiwan.

Research Experience • Graduate Research Assistant (2012-2016). The Pennsylvania State University. • Graduate Research Assistant (2007-2009). Taipei Medical University. • Undergraduate Research Assistant (2004-2006). Fooyin University. Teaching Experience • Instructor (Fall 2016). The Pennsylvania State University. • Nutr 100 (Contemporary Nutrition Concerns) • Graduate Teaching Assistant (Fall 2013, Fall 2014). The Pennsylvania State University. • Nutr 445 (Macronutrient Metabolism) Selected Publications • Hao L*, Huang KH*, Ito K, Sae-Tan S, Lambert JD, and Ross AC. (2016) Fibroblast growth factor (Fgf)-21 gene expression is elevated in the liver of mice fed a high-carbohydrate liquid diet and attenuated by lipid emulsion, but is not upregulated in liver of mice fed a high-fat obesogenic diet. J Nutr. 146:184-90. *The authors contributed equally. • Huang KH, Hao L, Smith PB, Rogers CJ, Patterson AD, and Ross AC. Lipid Emulsion and Voluntary Exercise Reduce Lipogenesis and Ameliorate Early-Stage Hepatic Steatosis in High Carbohydrate Diet-Fed Mice. (Submitted to Journal of Nutrition) • Huang KH, Zhang L, Hao L, Smith PB, Patterson AD, and Ross AC. Lipid Emulsion Mitigates Preexisting Hepatic Steatosis and Improves Energy Homeostasis in High Carbohydrate Diet Fed Mice. (Submitted to Molecular Nutrition & Food Research) Awards • Young Investigator Award, Society for Experimental Biology and Medicine, 2016. • 2nd Place, Emerging Leaders in Nutrition Science Poster Competition, ASN, 2016. • 2nd Tier Young Investigator Award, Baxter Healthcare Co., 2015.