Formaldehyde Induced DPC Effects in DNA Repairing

Yuhong Shu

A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in Partial fulfillment of the requirement for the degree of Master of Science in Public Health in the Department of Environmental Sciences and Engineering in the Gillings School of Global Public Health.

Chapel Hill 2021

Approved by

ABSTRACT

Yuhong Shu: Formaldehyde Induced DPC Effect in DNA Repairing

(Under the direction of Kun Lu)

DNA-protein crosslinks (DPCs) are bulky DNA lesions formed with the covalently linked DNA- binding proteins and DNA, which can interrupt DNA replication and cause genome instability.

However, our current understanding of the adverse effects of DPCs on the DNA repairing process is still limited, and specifically, whether DPCs affect the repair of other DNA adducts are still unclear. In this study, we investigated the effects of formaldehyde-induced DPCs on the repairing efficiency of BPDE-dG adducts. We first knocked down the expression of SPRTN gene, the key

DPC repairing gene, in K562 cells by RNA interference. Then, we treated wild-type and SPRTN- knock downed cells with benzo(a)pyrene diol epoxide (BPDE) for 20min and transferred cells to clean medium for adduct repair. We quantified the BPDE-DNA adducts by ultra-performance liquid chromatography and high-resolution mass spectrometry (UPLC-MS). Cellular BPDE-dG level is low (lower than 10 adducts per million dG) both in wild-type and SPRTN-knock downed cells. However, in the context of formaldehyde treatment, which is known to induce exogenous

DPCs, we found SPRTN-knock downed cells have a much higher BPDE-dG adduct level than WT cells and have a significantly low BPDE-dG repairing efficiency. In conclusion, our results demonstrate for the first time that SPRTN plays an important role in the repair of formaldehyde- induced DPCs and formaldehyde-induced DPCs block the repair of BPDE-DNA adducts.

iii

ACKNOWLEDGEMENTS

To all the team members in Dr. Kun Lu lab and people I met during my master’s degree, I want to say thank you from bottom of my heart. Thank you for all your support and encouragement in this great journey. Thank you Dr. Kun Lu for giving me the opportunity to join your lab and everything you did to help me to pursue my degree. I would like to thank Dr. Chih-Wei Liu, Yun-

Chung Hsiao, Yifei Yang, and Xia Sheng, Yunjia Lai for helping me to break down and solve all my “rocket science” questions. Thanks Dr. Liang Chi’s helpful discussions and providing critical feedbacks. Thank you Dr. Zhenfa and Dr. Radhika to be my graduation committees and give insightful feedbacks and questions to me. I also want to thank my dear parents, Xiaojun Shu and

Lisha Sun, and my lovely family members. Your love is the best power to drive me moving forward.

Table of Contents

List of Tables ...... 2

List of Figures ...... 3

List of Abbreviation ...... 4

Chapter 1: INTRODUCTION ...... 6

Chapter 2: Methodology...... 10

2.1 Cell Culture ...... 10

2.2 Lentiviral-mediated RNA interference (RNAi) ...... 10

2.3 RT-qPCR analysis ...... 11

2.4 Formaldehyde and BPDE treatment ...... 12

2.5 DNA Digestion and BPDE-dG adduct extraction ...... 12

2.6 BPDE-dG adduct quantification ...... 13

2.7 Data and Statistical Analysis ...... 14

Chapter 3: Results and Discussion ...... 15

3.1 RNA interference (RNAi)-mediated SPRTN knockdown ...... 15

3.2 LC-MS-based BPDE-dG adduct quantification ...... 15

3.3 Formaldehyde-induced DPCs interferent BPDE-dG repair in K562 cells ...... 18

Chapter 4: Conclusion ...... 20

Appendix ...... 21

References ...... 22

List of Tables

Table 1: Calibration Curve ...... 21

List of Figures

Figure 1: The gene expression of SPRTN gene in wild type K562 cells and RNAi-treated cells

(Student’s t test; ****p<0.0001; n=3)...... 15

Figure 2:(A). BPDE-dG adduct fragment ions chart, m/z 257.0961 ion is the most abundant ion

(B). Typical Peak of fragment ion m/z 257.0961 of BPDE-dG and 15N5 BPDE-dG. (C).

Standard curve shows the linearity of the theoretical and experimental ratio of BPDE-dG...... 17

Figure 3:(A). BPDE-dG level in BPDE-treated WT and SPRTN-knock downed K562 cells; (B)

BPDE-dG level in formaldehyde- and BPDE-cotreated WT and SPRTN-knock downed K562 cells (Two-way ANOVA, N.S.: no significant difference; *p<0.05; ***p<0.001; n=3;)...... 19

List of Abbreviation

ACTB Actin Beta

AGC Automatic Gain Control

ANOVA Analysis of Variance

AS Analytical Standard

BPDE Benzo(a)pyrene diol epoxide

CRC Colorectal Cancer ddH2O Double distilled water dG Directing group

DMEM Dulbecco's Modified Eagle Medium

DPCs DNA-protein crosslinks

DSB Double strand break

HR Homologous recombination

Gy Gray (unit)

IS Internal Standard

MgCl2 Magnesium Chloride

NaCNBH3 Sodium Cyanoborohydride

NaPO3 Sodium Hexametaphosphate

NHEJ Non-homologous end joining

OHA Hydroxyadenine

OHC Hydroxycytosine

OHG Hydroxyguanine

PRM Parallel Reaction Monitoring

RPMI Rose Park Memorial Institute

RT-qPCR Real Time quantitative Polymerase Chain Reaction

SD Standard Deviation

UV Ultraviolet

WT Wild Type

Chapter 1: INTRODUCTION

DNA is a long-chain, and double-stranded helix structured molecule that contains the genetic information and is essential for cells’ development, reproduction, and death. Although its integrity and stability are essential to life, DNA is a highly reactive chemical species that can react with numerous of endogenous and exogenous agents. Chemical substances attack and the damage DNA to form DNA adducts will lead to mutation and diseases if not repaired(“Mutation, DNA Repair, and DNA Integrity | Learn Science at Scitable,” n.d.). A study in Institute of Molecular Biology in

UK provided several sources that cause DNA damag(Chakarov, Petkova, Russev, & Zhelev, 2014).

For the sources from exogenous and endogenous, DNA damage may occur under the influence of environmental factors and normal cell metabolism. Endogenous sources typically occur more frequently than exogenous sources. Take nitrogenous bases as an example, eukaryotic cells spontaneous base hydrolysis will cause thousands of nitrogenous bases lost daily from DNA.

Chemical and physical agents are also play important role in DNA damage. Short-wavelength electromagnetic energy like ultraviolet (UV) radiation and DNA protein crosslinks are the great examples. Moreover, DNA damage can ultimately generate certain cancers and diseases in human body. In the study of DNA damage response in human disease by Stephen, Down syndrome,

Alzheimer’s disease, Parkinson’s disease, and Fridreich’s ataxia are due to the unrepaired DNA- damages(Jackson & Bartek, 2009). Specifically, in the previous study of Alzheimer’s disease(“DNA Damage and Repair in Alzheimer’s Disease: Ingenta Connect,” n.d.), the oxidative

DNA damage has been largely found in brain regions, peripheral tissues, and biological fluids in

Alzheimer’s disease patients. Moreover, results in study of DNA damage in mild cognitive impairment showed elevation of 8-hydroxyguanine (8-OHG), 8-hydroxyadenine (8-OHA), 5- hydroxycytosine (5-OHC), and 5-hydroxyuracil in both nuclear and mitochondrial DNA that

isolated from vulnerable regions of Alzheimer’s disease brain(Lovell & Markesbery, 2007).

Several other studies have also shown that the DNA damage may cause but not limited to Breast cancer, Colorectal cancer (CRC), Gynecological cancer, and Cervical cancer(Cooke, Evans,

Dizdaroglu, & Lunec, 2003),(Kastan, 2008),(O’Connor, 2015). For example, previous breast cancer case study indicated that elevated DNA damage is significantly associated with breast cancer risk(Smith, Miller, Lohman, Case, & Hu, 2003). The results showed that the cancer case had significantly higher DNA damage compared with control group, the breast cancers cases and controls were (mean±SD) 10.78±3.63 and 6.86±2.76 (p<0.001) for DNA damage at baseline,

21.24±4.88 and 14.97±4.18 (p<0.001) for DNA damage after exposure to 6 Gy of ionizing radiation. Another study of colon mucosa cell from colorectal cancer patients found that cells obtained from the neoplastic tissue presented DNA damage larger than that of in normal cells(Ribeiro et al., 2008). The mean value DNA damage was 1.056±0.46 for normal tissue and

2.532±0.845 for the colorectal cancer patients.

Small DNA adducts such as Alkylating agents have been discussed a lot in the past few decades(Green, Humphrey, Close, & Patno, 1969; Saffhill, Margison, & O’Connor, 1985); however, bulky DNA adduct gradually become the hot topic and research direction in recent years.

DNA-protein crosslinks (DPC), as an example, are one of the most harmful DNA damages

(adduct), which are the bulky DNA structure that formed when proteins covalently bond to chromosomal DNA and block chromatin-based processes, like DNA unwinding in transcription and DNA synthesis in replication(Stingele, Bellelli, & Boulton, 2017). Based on the previous study,

DPCs can be classified into three formation categories, environmentally-induced DPCs, therapy-

Induced DPCs, and endogenously-induced DPCs(Stingele et al., 2017)-(Klages-Mundt & Li, 2017).

Exposing to ionizing radiation, ultraviolet, other transition metal ions, like Nickel, and carcinogens

will cause environmental-induced DPCs. Therapy-Induced DPCs are caused by ionizing radiation and chemical compounds. Endogenously-Induced DPCs are divided into 3 subgroups, Enzymatic,

Non-enzymatic, and DPC-like trapping. Certain enzymes that form covalent reaction short-lived intermediates with DNA caused to produce enzymatic DPCs, like topoisomerases and DNA methyltransferases. Non-enzymatic DPCs are caused by endogenous reactive metabolites and exogenous agents generated nonspecific crosslinking of proteins in the vicinity of DNA. The last

DPC-like trapping was due to the protein bond tightly to DNA and behave like actual DPCs.

For the specific substance that can generate bulky DPCs and lead to severe damage, Formaldehyde is one of the sources that deserve to investigate due to its hazard characteristics and common existence in both nature environment and human body, especially in occupational exposure environment. Bulky Formaldehyde-induced DPCs will block the way of DNA replication and transcription, which ultimately affect the DNA repair processes and cause several diseases. For example, in the study of Formaldehyde exposure and leukemia, Formaldehyde-induced DPCs have been detected in the nasal mucosa of exposed animal and in human lymphocytes and V79 Chinese hamster lung cell exposed in vitro(Zhang, Steinmaus, Eastmond, Xin, & Smith, 2009). Moreover, in a human only studies by Shaham, anatomy laboratories as one of the occupational settings where the worker s are frequently exposed to high level of Formaldehyde concentration and the elevated

DPCs were detected in the peripheral mononuclear cells of formaldehyde exposed workers(Shaham et al., 1996; Shaham, Bomstein, Gurvich, Rashkovsky, & Kaufman, 2003).

DNA repair helps the cell to identify damage and use series process to correct the DNA molecule.

There are several different ways to repair DNA(Chatterjee & Walker, 2017). First one is the most efficient and accurate DNA repair, direct reversal, which repairs the pyrimidine dimers (UV) and methylated bases with single enzyme and single steps. Second one is mismatch repair, which help

the cell to repair improperly paired nucleotides, insertion loops, and deletions during replication process. Third one is base excision repair, which removes offending nucleotide and replace with correct ones. The next one is nucleotide excision repair. Bulky adducts, intercalated compounds,

DNA interstrand crosslinks are repaired by this repair method. The last one needed to be mentioned is double strand break repair. There are two types of DSB repair, homologous recombination (HR) and Non-homologous end joining (NHEJ). Double strand break repair will be activated if the cell has been affected by ionizing radiation and single strand break. The difference between those two types of repair is that NHEJ is early cell cycle major mechanism and HR will be used when DNA synthesis. Recently, SPRTN was proposed to have a function in translational DNA synthesis and prevention of mutagenesis(Lessel et al., 2014). In an in vitro study, the total DPCs amount was rapidly decreased in S-phase progression in cells with SPRTN-siRNA, however, SPRTN-depleted cells showed a delay kinetics of DPCs removal during S-phase progression(Vaz et al., 2016). Not only for the normal DPCs repair, SPRTN was also play an important role in Formaldehyde-induced

DPC repair. In the previous study, SPRTN efficiently repaired Formaldehyde-induced DPCs in mouse embryonic fibroblasts. However, the inactivation of the SPRTN allele in mouse embryonic fibroblasts lead to an almost complete failure to repair DPCs(Stingele et al., 2016).

In this experiment, we explored whether formaldehyde-Induced DPCs affect other DNA adducts’ repairing processes by comparing BPDE-dG adduct level in WT cells and in SPRTN-knock downed cells. Our study demonstrated that DPCs, as a type of bulky DNA lesions, could also impair the removal of other DNA adducts.

Chapter 2: Methodology

2.1 Cell Culture

The cells were culturing in non-phenol red RPMI 1640 medium with 1% penicillin/streptomycin and 10% heat-inactivated fetal bovine serum at 37℃. Frozen K526 cells tube was put into a 37℃ water bath with 1 – 2 minutes thawing process and then added into a petri dish with 10mL culture medium with puromycin solution. The cells were incubated at 37℃ and 5% CO2 with 95% humidity. The new culturing medium and subculturing was created by adding puromycin into 10% old culture medium solution. 293T cells were grown in DMEM medium supplemented with L- glutamine, 10% fetal bovine serum and 1% penicillin/streptomycin. The cells were incubated at

37°C and 5% CO2with 95% humidity.

2.2 Lentiviral-mediated RNA interference (RNAi)

Short oligonucleotides used for lentiviral plasmids were purchased from Sigma and were inserted into the PLKO.1-puromycin vector following standard protocol. Following primers are used to construct shRNA plasmid against SPRTN:

Forward sequence: 5'-

CCGGGCCGCAGAGAATAAAGATAAACTCGAGTTTATCTTTATTCTCTGCGGCTTTTT

G-3'; Reverse sequence: 5'-

AATTCAAAAAGCCGCAGAGAATAAAGATAAACTCGAGTTTATCTTTATTCTCTGCGG

C-3'.

Lentiviral particles were prepared in 293T cells and K562 cells were infected as previously published(Tian et al., 2016). Briefly, 2μg PLKO.1, 2μg pREV, 2μgpGag/Pol and 1μg pVSVG were transfected with TransIT®-293 transfection reagent into 293T cells in a 6cm dish. Cell

culture medium was changed 24 hours later, and the supernatant containing lentiviral particles was collected after 24-48 hours. K562 cells were infected with lentivirus in the presence of 5 μg/ml polybrene, and after overnight incubation fresh medium with puromycin was replaced. After 2–3 days selection, monoclonal colonies were collected, and knockdown efficiency was evaluated by real-time quantitative polymerase chain reaction (RT-qPCR).

2.3 RT-qPCR analysis

A cell pellet containing of approximate 1 million cells was prepared for RNA extraction using

RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions. RNA concentration and purity of products were measured by Nanodrop 2000 (Thermo Fisher Scientific). Digestion of genomic DNA contaminants was performed using DNA-free™ DNA Removal Kit (Thermo Fisher

Scientific) according to manufacturer’s instructions. Then the DNA-digested RNAs were used to synthesized cDNA using iScript™ Reverse Transcription Supermix (Bio-Rad Laboratories), and the products were diluted fivefold for quantitative gene expression analysis. qPCR experiment was performed with SsoAdvancedTM Universal SYBR Green Supermix (Bio-Rad Laboratories) on

Bio-Rad CFX96 Touch Real-Time PCR Detection System. Each reaction contained total 20 uL volume: 10 μL SYBR Green Supermix, 1 μL 0.5 μM of each primer and 5 μL template DNA. A denaturation step at 95°C was carried for 10 min, followed by 35 PCR cycles including denaturation (95°C for 10 s), annealing (55°C for 30 s), extension step (72°C for 30 s) and a final melting curve analysis of raising the temperature from 65–95°C in 0.5°C increments for 0.05 s each. The following primers were used:

ACTB (β-actin): Forward: 5’-GAGCGGGAAATCGTGCGTGAC-3’;

Reverse: 5’-AGGAAGGAAGGCTGGAAGAGTGC-3’.

SPRTN: Forward: 5’-TTGGCATAGCCCTAACACAG-3’;

Reverse: 5’-TGATCCGGGTGGTAGTTACA-3’.

The expression of the target gene was relative to the expression of ACTB gene, which considered as the housekeeping gene. The expression of target genes was computed with the ⧍⧍CT method.

2.4 Formaldehyde and BPDE treatment

WT and SPRTN-knock downed K562 cells were cultured for 16 hours and cells were washed and collected. For control groups, cells were treated with 200 μM BPDE for 20 minutes in RPMI 1640 medium without fetal bovine serum. For formaldehyde-treated groups, cells were first treated with

250 μM formaldehyde for 2 hours and then followed with 20-minute BPDE treatment. Then, cells were washed and cultured in RPMI 1640 medium with fetal bovine serum to recover. After 3-hour,

8-hour, and 20-hour recovery, cells were collected and frozen in -80°C freezer.

2.5 DNA Digestion and BPDE-dG adduct extraction

DNA treatment was similar to previous study with minor changes(Guo et al., 2019; Hsiao, Liu,

Chi, Yang, & Lu, 2020; Liu, Hsiao, Hoffman, & Lu, 2021). Specifically, by following the manufacturer protocol, NucleoBond DNA Isolation Kit (Thermo Fisher Scientific) was used to isolate the DNA from wild type K562 cells and SPRTN-knock downed cells by adding Nucleobond buffer. For DNA reduction and digestion process was adapted from former studies(Hsiao et al.,

2020; Liu et al., 2021). Briefly, 20 μg DNA was dissolved with 70 μL water and 10 μL 1 M NaPO3 and 20 μL 250mM NaCNBH3 for an overnight reduction at 37℃. After overnight reduction, 200

15 μL NaPO3, 20 mM MgCl2 buffer (7.2), 2.5 fmol internal standard [ N5]-BPDE-dG, and 200 units

DNase (Thermo Fisher Scientific) were added into reduced DNA and react for another 3 hours at

37 ℃. After digestion, the DNA was place into Nanosep 3 kDa (Thermo Fisher Scientific) at 8000 rpm for 30 minutes in order to remove any enzymes.

2.6 BPDE-dG adduct quantification

LC-MS/MS analysis of BPDE-dG adduct was following the previous studies with modification

(Guo et al., 2019; Hsiao et al., 2020; Liu et al., 2021). Briefly, the analytic standard and internal standard were collected from the filtrate using Agilent 1200 series UV HPLC System (Thermo

Fisher Scientific) with C18 reverse-phased column (T3, 3 휇푚, 15 cm ×4.6 mm, Water Atlantis).

The detection wavelength was set to 254 nm and the column temperature was 30 ℃. The mobile phase was 10 mM ammonium acetate (A) and methanol (B) in water. The flow rate was set to 0.8 mL/min and the elution gradient was set to: 0 minute, 5% B; 10 minutes, 15% B; 25 minutes, 25%

B; 30 minutes, 80% B; 40 minutes, 5% B. The DNA adduct fraction was dried by a vacuum concentrator with water before further analysis. To quantify the dG amount, a calibration curve was used to calculation the UV detection peak area, peak ratio between analytic standard and internal standard, under 254 nm wavelength. DNA adduct identification was performed by

Ultimate 300 RSLCnano system coupled to a Q Exactive HF Hybrid Quadrupole-Orbitrap mass spectrometer with a nanoelectrospray ionization (Thermo Fisher Scientific). A PepMap C18 analytical column (2 휇푚 particle, 25 cm ×75 휇푚 i.d., catalog number ES802, Thermo Fisher

Scientific) was used to separate DNA adduct. The analytes were loaded into a C18 trapping column

(5 휇푚 particle, 0.5 cm 휇푔 × 300 휇푚 i.d., catelog number 160454, Thermo Fisher Scientific) with a flow rate at 5 휇퐿/min in 0.1% formic acid in ddH2O for 3 minutes. A binary solvent system that consisted with 0.1% formic acid (A) and acetonitrile (B) with 0.3 휇퐿/푚푖푛 flow rate was used for

LC separation. The elution gradient was set to: 0 to 3 minutes, 5 % B; 20 minutes, 40% B; 21 to

26 minutes, 90% B; 27 minutes to 40 minutes, 5% B. Parallel Reaction Monitoring (PRM) mode

was used to detect BPDE-dG, an inclusion list was consisted of m/z 570.1983 (analytical standard)

15 and m/z 575.1835 (internal standard [ N5]-BPDE-dG). The Orbitrap resolution was set to 60,000 and the Automatic Gain Control (AGC) target was 3 × 106 and maximum fill time was 250 ms.

Precursor ions were isolated with a window of 1.4 m/z and fragmented with Higher-energy collisional dissociation with a normalized collision energy at 25.

2.7 Data and Statistical Analysis

The LC/MS raw data analysis was performed by Xcalibur software (Thermo Fisher Scientific) and the quantification analysis was performed by using Skyline v19.1.0.19(Hsiao et al., 2020; Liu et al., 2018; MacLean et al., 2010). Specifically, the peak area ratio of DNA adduct-internal standard was converted to DNA adduct quantities by using calibration curves generated from Appendix

Table 1.

SPRTN gene expression difference between Wild type cells and RNAi-treated cells was determined by student’s t-test. The two-way analysis of variance (ANOVA) was performed by

Prism 8 Software (GraphPad) to identify the statistical difference of DNA adduct amount between two treatment groups. P-value with less than 0.05 was considered significant.

Chapter 3: Results and Discussion

3.1 RNA interference (RNAi)-mediated SPRTN knockdown

To investigate the effect of DPCs in DNA damage repair, we first generated a SPRTN-knock downed K562 cell line by RNAi. We used RT-qPCR to evaluate the efficiency of RNAi and found that the SPRTN expression in RNAi-treated cells is 5-fold lower than the expression in WT cells as showed in Figure 1. Since the critical role of SPRTN in DPC repair, SPRTN-knockdown cells should have weaker DPC repairing capability.

Figure 1: The gene expression of SPRTN gene in wild type K562 cells and RNAi-treated cells (Student’s t test; ****p<0.0001; n=3).

3.2 LC-MS-based BPDE-dG adduct quantification

We next applied LC-MS to quantify the BPDE-dG, the typical DNA adduct induced by BPDE. As illustrated in Figure 2A, precursor ion, BPDE-dG-H+, with m/z 570.1983 can be fragmented to other smaller ions, including the fragments with m/z 152.0568, 285.0907, 303.1014, and 257.0959.

We detected the BPDE-dG precursor ions with m/z 570.1983 as well as the precursor ion of

15 internal standard [ N5]-BPDE-dG with m/z 275.1835 with retention time 22.90 minutes as shown in Figure 2B. All fragment ions can be detected by the current method (Figure 2A). The ion with m/z 257.0959 which is the typical end-product of BPDE-dG fragmentation in MS, has highest peak intensity in our current method. Therefore, the peak area of ion with m/z 257.0959 was used to determine the abundance of BPDE-dG. The cellular level of BPDE-dG was calculated by the

15 ratio of BPDE-dG and [ N5]-BPDE-dG. As shown in Figure 2C and in Appendix Table 1, the standard curve has good linearity in the AS/IS ratio from 0.25 to 40.

Figure 2:(A). BPDE-dG adduct fragment ions chart, m/z 257.0961 ion is the most abundant ion (B). Typical Peak of fragment ion m/z 257.0961 of BPDE-dG and 15N5 BPDE-dG. (C). Standard curve shows the linearity of the theoretical and experimental ratio of BPDE-dG.

3.3 Formaldehyde-induced DPCs interferent BPDE-dG repair in K562 cells

To test whether DPCs affect the DNA adduct repairing efficiency, we next measured the BPDE- dG level in WT and SPRTN-knock downed K562 cells. We first treated BPDE to two types of cells for 20 minutes and followed with recovery to allow DNA adduct repair. Cellular BPDE-dG level was measured after 3-hour, 8-hour, and 20-hour recovery. As shown in Figure 3A, we found that in the 3-hour time point, BPDE-dG level in SPRTN-knock downed cells was slightly but significantly higher than the level in WT cells. This result suggests that SPRTN knockdown (Figure

1) which damages the cellular DPC repair does delays the BPDE-dG adduct clearance. However, we also found that BPDE-dG level was comparable in these two cells after 8-hour and 20-hour recovery. Many previous studies have demonstrated that endogenous DPC level is very low in cells(De Bont & van Larebeke, 2004; Nair, Shoaib, & Sørensen, 2017; Xia et al., 2019; Yu et al.,

2015). Therefore, the endogenous DPCs could also be largely repaired in the cells with low- expressed SPRTN, which may explain the results that BPDE-dG level in WT cells and SPRTN- knock downed cells is no significant difference after 8-hour and 20-hour recovery.

To further demonstrate the effects of DPCs on DNA adduct repair, we treated cells with formaldehyde to induce exogenous DPCs. As shown in Figure 3B, we found formaldehyde treatment didn’t significantly affect the BPDE-dG repair in WT cells after 3-hour, 8-hour, and 20- hour recovery that the BPDE-dG level was very similar with the cells only treated with BPDE in each time point. However, an extremely higher level of BPDE-dG was detected in SPRTN-knock downed cells after formaldehyde treatment. After 3-hour recovery, SPRTN-knock downed cells have 400 to 500-fold higher BPDE-dG level than WT cells, and the BPDE-dG level is still significantly different between two types of cells after 20-hour recovery (Figure 2B). Taken

together, these results indicate that DPCs could largely interfere the BPDE-dG repair progress which could cause severe adverse effects on genome integrity.

Figure 3:(A). BPDE-dG level in BPDE-treated WT and SPRTN-knock downed K562 cells; (B) BPDE-dG level in formaldehyde- and BPDE-cotreated WT and SPRTN-knock downed K562 cells (Two-way ANOVA, N.S.: no significant difference; *p<0.05; ***p<0.001; n=3;).

Chapter 4: Conclusion

In this study, we knocked down the SPRTN gene expression in K562 cells using RNAi, which impaired the DPC repair. By exposing cells to BPDE, we found SPRTN gene-knock downed cells have a much higher BPDE-dG level and low BPDE repairing efficiency comparing with WT cells.

Our results demonstrate that formaldehyde-induced DPCs block the repair of BPDE-DNA adducts, which promotes the current understanding of the adverse health effects of DPCs. Our study also suggests that SPRTN plays an important role in the repair of formaldehyde-induced DPCs.

Appendix

Table 1: Calibration Curve

Calibration curve of BP peak area of AS peak area of IS Ratio Theoretical ratio experimental ratio 9290860 190495 48.7722 40 48.77219875 1742244 123578 14.09833 10 14.09833466 657881 112085 5.869483 5 5.869482982 360548 132273 2.725787 2.5 2.72578682 116534 98173 1.187027 1 1.187026983 54223 98936 0.548061 0.5 0.548061373 29936 105740 0.28311 0.25 0.283109514

References

Cooke, M. S., Evans, M. D., Dizdaroglu, M., & Lunec, J. (2003). Oxidative DNA damage: mechanisms, mutation, and disease. The FASEB Journal, 17(10), 1195–1214. doi:10.1096/fj.02-0752rev De Bont, R., & van Larebeke, N. (2004). Endogenous DNA damage in humans: a review of quantitative data. Mutagenesis, 19(3), 169–185. doi:10.1093/mutage/geh025 DNA Damage and Repair in Alzheimer’s Disease: Ingenta Connect. (n.d.). Retrieved March 28, 2021, from https://www.ingentaconnect.com/content/ben/car/2009/00000006/00000001/art00005 Green, R. A., Humphrey, E., Close, H., & Patno, M. E. (1969). Alkylating agents in bronchogenic carcinoma. The American Journal of Medicine, 46(4), 516–525. doi:10.1016/0002-9343(69)90071-0 Guo, L., Jiang, X., Tian, H.-Y., Yao, S.-J., Li, B.-Y., Zhang, R.-J., … Sun, X. (2019). Detection of BPDE-DNA adducts in human umbilical cord blood by LC-MS/MS analysis. Journal of food and drug analysis, 27(2), 518–525. doi:10.1016/j.jfda.2019.03.001 Hsiao, Y.-C., Liu, C.-W., Chi, L., Yang, Y., & Lu, K. (2020). Effects of gut microbiome on carcinogenic DNA damage. Chemical Research in Toxicology, 33(8), 2130–2138. doi:10.1021/acs.chemrestox.0c00142 Jackson, S. P., & Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature, 461(7267), 1071–1078. doi:10.1038/nature08467 Kastan, M. B. (2008). DNA Damage Responses: Mechanisms and Roles in Human Disease: 2007 G.H.A. Clowes Memorial Award Lecture. Molecular Cancer Research, 6(4), 517– 524. doi:10.1158/1541-7786.MCR-08-0020 Klages-Mundt, N. L., & Li, L. (2017). Formation and repair of DNA-protein crosslink damage. Science China. Life sciences, 60(10), 1065–1076. doi:10.1007/s11427-017-9183-4 Lessel, D., Vaz, B., Halder, S., Lockhart, P. J., Marinovic-Terzic, I., Lopez-Mosqueda, J., … Kubisch, C. (2014). Mutations in SPRTN cause early onset hepatocellular carcinoma, genomic instability and progeroid features. Nature Genetics, 46(11), 1239–1244. doi:10.1038/ng.3103 Liu, C.-W., Hsiao, Y.-C., Hoffman, G., & Lu, K. (2021). LC-MS/MS Analysis of the Formation and Loss of DNA Adducts in Rats Exposed to Vinyl Acetate Monomer through Inhalation. Chemical Research in Toxicology, 34(3), 793–803. doi:10.1021/acs.chemrestox.0c00404 Liu, C.-W., Tian, X., Hartwell, H. J., Leng, J., Chi, L., Lu, K., & Swenberg, J. A. (2018). Accurate Measurement of Formaldehyde-Induced DNA-Protein Cross-Links by High- Resolution Orbitrap Mass Spectrometry. Chemical Research in Toxicology, 31(5), 350– 357. doi:10.1021/acs.chemrestox.8b00040

Lovell, M. A., & Markesbery, W. R. (2007). Oxidative DNA damage in mild cognitive impairment and late-stage Alzheimer’s disease. Nucleic Acids Research, 35(22), 7497–7504. doi:10.1093/nar/gkm821 MacLean, B., Tomazela, D. M., Shulman, N., Chambers, M., Finney, G. L., Frewen, B., … MacCoss, M. J. (2010). Skyline: an open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics, 26(7), 966–968. doi:10.1093/bioinformatics/btq054 Mutation, DNA Repair, and DNA Integrity | Learn Science at Scitable. (n.d.). Retrieved March 27, 2021, from https://www.nature.com/scitable/topicpage/dna-damage-repair- mechanisms-for-maintaining-dna-344/ Nair, N., Shoaib, M., & Sørensen, C. S. (2017). Chromatin dynamics in genome stability: roles in suppressing endogenous DNA damage and facilitating DNA repair. International Journal of Molecular Sciences, 18(7). doi:10.3390/ijms18071486 O’Connor, M. J. (2015). Targeting the DNA damage response in cancer. Molecular Cell, 60(4), 547–560. doi:10.1016/j.molcel.2015.10.040 Ribeiro, M. L., Priolli, D. G., Miranda, D. D. C., Arçari, D. P., Pedrazzoli, J., & Martinez, C. A. R. (2008). Analysis of oxidative DNA damage in patients with colorectal cancer. Clinical Colorectal Cancer, 7(4), 267–272. doi:10.3816/CCC.2008.n.034 Saffhill, R., Margison, G. P., & O’Connor, P. J. (1985). Mechanisms of carcinogenesis induced by alkylating agents. Biochimica et Biophysica Acta, 823(2), 111–145. doi:10.1016/0304- 419x(85)90009-5 Shaham, J., Bomstein, Y., Gurvich, R., Rashkovsky, M., & Kaufman, Z. (2003). DNA-protein crosslinks and p53 protein expression in relation to occupational exposure to formaldehyde. Occupational and Environmental Medicine, 60(6), 403–409. doi:10.1136/oem.60.6.403 Shaham, J., Bomstein, Y., Meltzer, A., Kaufman, Z., Palma, E., & Ribak, J. (1996). DNA--protein crosslinks, a biomarker of exposure to formaldehyde--in vitro and in vivo studies. Carcinogenesis, 17(1), 121–125. doi:10.1093/carcin/17.1.121 Smith, T. R., Miller, M. S., Lohman, K. K., Case, L. D., & Hu, J. J. (2003). DNA damage and breast cancer risk. Carcinogenesis, 24(5), 883–889. doi:10.1093/carcin/bgg037 Stingele, J., Bellelli, R., Alte, F., Hewitt, G., Sarek, G., Maslen, S. L., … Boulton, S. J. (2016). Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN. Molecular Cell, 64(4), 688–703. doi:10.1016/j.molcel.2016.09.031 Stingele, J., Bellelli, R., & Boulton, S. J. (2017). Mechanisms of DNA-protein crosslink repair. Nature Reviews. Molecular Cell Biology, 18(9), 563–573. doi:10.1038/nrm.2017.56

Tian, X., Patel, K., Ridpath, J. R., Chen, Y., Zhou, Y.-H., Neo, D., … Nakamura, J. (2016). Homologous recombination and translesion DNA synthesis play critical roles on tolerating DNA damage caused by trace levels of hexavalent chromium. Plos One, 11(12), e0167503. doi:10.1371/journal.pone.0167503 Vaz, B., Popovic, M., Newman, J. A., Fielden, J., Aitkenhead, H., Halder, S., … Ramadan, K. (2016). Metalloprotease SPRTN/DVC1 Orchestrates Replication-Coupled DNA-Protein Crosslink Repair. Molecular Cell, 64(4), 704–719. doi:10.1016/j.molcel.2016.09.032 Xia, J., Chiu, L.-Y., Nehring, R. B., Bravo Núñez, M. A., Mei, Q., Perez, M., … Rosenberg, S. M. (2019). Bacteria-to-Human Protein Networks Reveal Origins of Endogenous DNA Damage. Cell, 176(1-2), 127–143.e24. doi:10.1016/j.cell.2018.12.008 Yu, R., Lai, Y., Hartwell, H. J., Moeller, B. C., Doyle-Eisele, M., Kracko, D., … Swenberg, J. A. (2015). Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage. Toxicological Sciences, 146(1), 170–182. doi:10.1093/toxsci/kfv079 Zhang, L., Steinmaus, C., Eastmond, D. A., Xin, X. K., & Smith, M. T. (2009). Formaldehyde exposure and leukemia: a new meta-analysis and potential mechanisms. Mutation Research, 681(2-3), 150–168. doi:10.1016/j.mrrev.2008.07.002 Chakarov, S., Petkova, R., Russev, G., & Zhelev, N. (2014). DNA damage and mutation. Types of DNA damage. BioDiscovery, (11), 1. doi:10.7750/BioDiscovery.2014.11.1 Chatterjee, N., & Walker, G. C. (2017). Mechanisms of DNA damage, repair, and mutagenesis. Environmental and Molecular Mutagenesis, 58(5), 235–263. doi:10.1002/em.22087 Cooke, M. S., Evans, M. D., Dizdaroglu, M., & Lunec, J. (2003). Oxidative DNA damage: mechanisms, mutation, and disease. The FASEB Journal, 17(10), 1195–1214. doi:10.1096/fj.02-0752rev De Bont, R., & van Larebeke, N. (2004). Endogenous DNA damage in humans: a review of quantitative data. Mutagenesis, 19(3), 169–185. doi:10.1093/mutage/geh025 DNA Damage and Repair in Alzheimer’s Disease: Ingenta Connect. (n.d.). Retrieved March 28, 2021, from https://www.ingentaconnect.com/content/ben/car/2009/00000006/00000001/art00005 Green, R. A., Humphrey, E., Close, H., & Patno, M. E. (1969). Alkylating agents in bronchogenic carcinoma. The American Journal of Medicine, 46(4), 516–525. doi:10.1016/0002-9343(69)90071-0 Guo, L., Jiang, X., Tian, H.-Y., Yao, S.-J., Li, B.-Y., Zhang, R.-J., … Sun, X. (2019). Detection of BPDE-DNA adducts in human umbilical cord blood by LC-MS/MS analysis. Journal of food and drug analysis, 27(2), 518–525. doi:10.1016/j.jfda.2019.03.001

Hsiao, Y.-C., Liu, C.-W., Chi, L., Yang, Y., & Lu, K. (2020). Effects of gut microbiome on carcinogenic DNA damage. Chemical Research in Toxicology, 33(8), 2130–2138. doi:10.1021/acs.chemrestox.0c00142 Jackson, S. P., & Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature, 461(7267), 1071–1078. doi:10.1038/nature08467 Kastan, M. B. (2008). DNA Damage Responses: Mechanisms and Roles in Human Disease: 2007 G.H.A. Clowes Memorial Award Lecture. Molecular Cancer Research, 6(4), 517– 524. doi:10.1158/1541-7786.MCR-08-0020 Klages-Mundt, N. L., & Li, L. (2017). Formation and repair of DNA-protein crosslink damage. Science China. Life sciences, 60(10), 1065–1076. doi:10.1007/s11427-017-9183-4 Lessel, D., Vaz, B., Halder, S., Lockhart, P. J., Marinovic-Terzic, I., Lopez-Mosqueda, J., … Kubisch, C. (2014). Mutations in SPRTN cause early onset hepatocellular carcinoma, genomic instability and progeroid features. Nature Genetics, 46(11), 1239–1244. doi:10.1038/ng.3103 Liu, C.-W., Hsiao, Y.-C., Hoffman, G., & Lu, K. (2021). LC-MS/MS Analysis of the Formation and Loss of DNA Adducts in Rats Exposed to Vinyl Acetate Monomer through Inhalation. Chemical Research in Toxicology, 34(3), 793–803. doi:10.1021/acs.chemrestox.0c00404 Liu, C.-W., Tian, X., Hartwell, H. J., Leng, J., Chi, L., Lu, K., & Swenberg, J. A. (2018). Accurate Measurement of Formaldehyde-Induced DNA-Protein Cross-Links by High- Resolution Orbitrap Mass Spectrometry. Chemical Research in Toxicology, 31(5), 350– 357. doi:10.1021/acs.chemrestox.8b00040 Lovell, M. A., & Markesbery, W. R. (2007). Oxidative DNA damage in mild cognitive impairment and late-stage Alzheimer’s disease. Nucleic Acids Research, 35(22), 7497–7504. doi:10.1093/nar/gkm821 MacLean, B., Tomazela, D. M., Shulman, N., Chambers, M., Finney, G. L., Frewen, B., … MacCoss, M. J. (2010). Skyline: an open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics, 26(7), 966–968. doi:10.1093/bioinformatics/btq054 Mutation, DNA Repair, and DNA Integrity | Learn Science at Scitable. (n.d.). Retrieved March 27, 2021, from https://www.nature.com/scitable/topicpage/dna-damage-repair- mechanisms-for-maintaining-dna-344/ Nair, N., Shoaib, M., & Sørensen, C. S. (2017). Chromatin dynamics in genome stability: roles in suppressing endogenous DNA damage and facilitating DNA repair. International Journal of Molecular Sciences, 18(7). doi:10.3390/ijms18071486 O’Connor, M. J. (2015). Targeting the DNA damage response in cancer. Molecular Cell, 60(4), 547–560. doi:10.1016/j.molcel.2015.10.040

Ribeiro, M. L., Priolli, D. G., Miranda, D. D. C., Arçari, D. P., Pedrazzoli, J., & Martinez, C. A. R. (2008). Analysis of oxidative DNA damage in patients with colorectal cancer. Clinical Colorectal Cancer, 7(4), 267–272. doi:10.3816/CCC.2008.n.034 Saffhill, R., Margison, G. P., & O’Connor, P. J. (1985). Mechanisms of carcinogenesis induced by alkylating agents. Biochimica et Biophysica Acta, 823(2), 111–145. doi:10.1016/0304- 419x(85)90009-5 Shaham, J., Bomstein, Y., Gurvich, R., Rashkovsky, M., & Kaufman, Z. (2003). DNA-protein crosslinks and p53 protein expression in relation to occupational exposure to formaldehyde. Occupational and Environmental Medicine, 60(6), 403–409. doi:10.1136/oem.60.6.403 Shaham, J., Bomstein, Y., Meltzer, A., Kaufman, Z., Palma, E., & Ribak, J. (1996). DNA--protein crosslinks, a biomarker of exposure to formaldehyde--in vitro and in vivo studies. Carcinogenesis, 17(1), 121–125. doi:10.1093/carcin/17.1.121 Smith, T. R., Miller, M. S., Lohman, K. K., Case, L. D., & Hu, J. J. (2003). DNA damage and breast cancer risk. Carcinogenesis, 24(5), 883–889. doi:10.1093/carcin/bgg037 Stingele, J., Bellelli, R., Alte, F., Hewitt, G., Sarek, G., Maslen, S. L., … Boulton, S. J. (2016). Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN. Molecular Cell, 64(4), 688–703. doi:10.1016/j.molcel.2016.09.031 Stingele, J., Bellelli, R., & Boulton, S. J. (2017). Mechanisms of DNA-protein crosslink repair. Nature Reviews. Molecular Cell Biology, 18(9), 563–573. doi:10.1038/nrm.2017.56 Tian, X., Patel, K., Ridpath, J. R., Chen, Y., Zhou, Y.-H., Neo, D., … Nakamura, J. (2016). Homologous recombination and translesion DNA synthesis play critical roles on tolerating DNA damage caused by trace levels of hexavalent chromium. Plos One, 11(12), e0167503. doi:10.1371/journal.pone.0167503 Vaz, B., Popovic, M., Newman, J. A., Fielden, J., Aitkenhead, H., Halder, S., … Ramadan, K. (2016). Metalloprotease SPRTN/DVC1 Orchestrates Replication-Coupled DNA-Protein Crosslink Repair. Molecular Cell, 64(4), 704–719. doi:10.1016/j.molcel.2016.09.032 Xia, J., Chiu, L.-Y., Nehring, R. B., Bravo Núñez, M. A., Mei, Q., Perez, M., … Rosenberg, S. M. (2019). Bacteria-to-Human Protein Networks Reveal Origins of Endogenous DNA Damage. Cell, 176(1-2), 127–143.e24. doi:10.1016/j.cell.2018.12.008 Yu, R., Lai, Y., Hartwell, H. J., Moeller, B. C., Doyle-Eisele, M., Kracko, D., … Swenberg, J. A. (2015). Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage. Toxicological Sciences, 146(1), 170–182. doi:10.1093/toxsci/kfv079

Zhang, L., Steinmaus, C., Eastmond, D. A., Xin, X. K., & Smith, M. T. (2009). Formaldehyde exposure and leukemia: a new meta-analysis and potential mechanisms. Mutation Research, 681(2-3), 150–168. doi:10.1016/j.mrrev.2008.07.002