GENOME-WIDE ANALYSES of GENES AFFECTING GROWTH, MUSCLE ACCRETION and FILLET QUALITY TRAITS in RAINBOW TROUT by Ali Reda Eid

Total Page:16

File Type:pdf, Size:1020Kb

GENOME-WIDE ANALYSES of GENES AFFECTING GROWTH, MUSCLE ACCRETION and FILLET QUALITY TRAITS in RAINBOW TROUT by Ali Reda Eid GENOME-WIDE ANALYSES OF GENES AFFECTING GROWTH, MUSCLE ACCRETION AND FILLET QUALITY TRAITS IN RAINBOW TROUT by Ali Reda Eid Ali A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Molecular Biosciences Middle Tennessee State University August 2019 Dissertation committee: Dr. Mohamed (Moh) Salem, Chair Dr. Anthony L. Farone Dr. Jason Jessen Dr. Mary Farone Dr. Elliot Altman I dedicate this research to my parents, my wife and kids for their unwavering love and endless support throughout this long trip. Without their great selflessness, sacrifices, and prayers, I would not have been able to fulfill and achieve this dream of mine ii ACKNOWLEDGMENTS First of all, I would like to express my deepest respect and indebtedness to my PhD dissertation advisor Dr. Mohamed Salem for his continuous guidance, endless support and encouragement throughout my PhD research work. I was fortunate to have him as my primary advisor who gave me this opportunity to grow as a professional research scholar. He was never wavering in his support, and was always patient and supportive during the more grueling portions of this investigation. My deepest appreciation and respect also go to my PhD dissertation committee members Dr. Anthony Farone, Dr. Elliot Altman, Dr. Jason Jessen, and Dr. Mary Farone for guiding me with their expertise to accomplish this project. I would like to thank Dr. Rafet Al-Tobasei for working together in several projects and sharing scientific ideas. I also want to acknowledge my collaborators Dr. Yniv Palti, and Dr. Timothy D. Leeds from National Center for Cool and Cold Water Aquaculture (NCCCWA)/USDA. I would also like to extend my sincere thanks to my collaborator Dr. Brett Kenney from West Virginia University (WVU). Finally, I would like to express my sincere gratitude to the entire MTSU Molecular Biosciences (MOBI) program and MTSU Biology department for their support and encouragement during my stay as a doctoral student at MTSU. iii ABSTRACT Growth performance is one of the most economic important traits for the aquaculture industry. In addition, fillet quality attributes are among the primary determinants of consumer acceptability. To study the genetic architecture of these traits, phenotypic characterization of whole body weight (WBW), muscle yield, fat content, shear force, moisture, protein content, and whiteness were measured in ~500 fish representing 98 families from a growth-selected line. RNA-Seq was used to sequence the muscle transcriptome of different families exhibiting divergent phenotypes for each trait. In total, 240 and 1,280 differentially expressed (DE) protein-coding genes and long noncoding RNAs (lncRNAs), respectively, were identified in fish families exhibiting contrasting phenotypes. Expression of many DE lncRNAs (n = 229) was positively correlated with overlapping, neighboring or distantly located protein-coding genes (n = 1,030), resulting in 3,392 interactions. Three DE antisense lncRNAs were co-expressed with sense genes known to impact muscle quality traits. A 50K SNP chip has been developed and used across four genome-wide association (GWA) studies to identify quantitative trait loci (QTL) explaining variations in fish growth and fillet quality attributes. In the first study, QTL explaining up to 28.40% of the additive genetic variance for muscle yield were identified; particularly on chromosomes 14 and 16. In the second study, 247 QTL associated with bodyweight gain were identified. Most SNPs affecting muscle yield and bodyweight gain exist in genes that act as major regulators of developmental processes. In the third study, the additive genetic variance for fillet firmness and protein content was investigated where RYR3 harbored most SNPs affecting the two iv traits. In the fourth study, sixty-one common SNPs on chromosomes 19 and 29 affecting the muscle fat and moisture content were identified. SNP-harboring genes, in the common QTL, were mainly involved in lipid metabolic process and cytoskeleton remodeling. Presence of common QTL associated with multiple phenotypes suggests common mechanisms underlying those phenotypes in fish. The present work identified DE genes and genetic markers explaining variations in growth and fillet quality phenotypes in selectively bred trout populations. Such markers could be used for marker-assisted and genomic selection in breeding programs of rainbow trout. v TABLE OF CONTENTS CONTENTS.......................................................................................................... …PAGE LIST OF TABLES ........................................................................................................... ix LIST OF FIGURES ........................................................................................................ xii LIST OF APPENDICES .................................................................................................xv INTRODUCTION..............................................................................................................1 OBJECTIVES ....................................................................................................................9 CHAPTER I: INTEGRATED ANALYSIS OF LNCRNA AND MRNA EXPRESSION IN RAINBOW TROUT FAMILIES SHOWING VARIATION IN MUSCLE GROWTH AND FILLET QUALITY TRAITS ..........................................10 INTRODUCTION .............................................................................................................11 MATERIALS AND METHODS .......................................................................................14 RESULTS AND DISCUSSION ........................................................................................22 CONCLUSIONS................................................................................................................46 REFERENCES ..................................................................................................................48 APPENDICES ...................................................................................................................60 CHAPTER II: GENOME-WIDE ASSOCIATION ANALYSIS WITH A 50K TRANSCRIBED GENE SNP-CHIP IDENTIFIES QTL AFFECTING MUSCLE YIELD IN RAINBOW TROUT .....................................................................................65 INTRODUCTION .............................................................................................................66 MATERIALS AND METHODS .......................................................................................69 RESULTS AND DISCUSSION ........................................................................................76 CONCLUSIONS................................................................................................................92 vi REFERENCES ..................................................................................................................93 APPENDICES .................................................................................................................100 CHAPTER III: GENOME-WIDE ASSOCIATION STUDY IDENTIFIES GENOMIC LOCI AFFECTING FILLET FIRMNESS AND PROTEIN CONTENT IN RAINBOW TROUT .................................................................................................101 INTRODUCTION ...........................................................................................................102 MATERIALS AND METHODS .....................................................................................106 RESULTS AND DISCUSSION ......................................................................................112 CONCLUSIONS..............................................................................................................133 REFERENCES ................................................................................................................134 APPENDICES .................................................................................................................146 CHAPTER IV: IDENTIFICATION OF GENOMIC LOCI ASSOCIATED WITH GROWTH IN RAINBOW TROUT .............................................................................150 INTRODUCTION ...........................................................................................................151 MATERIALS AND METHODS .....................................................................................154 RESULTS AND DISCUSSION ......................................................................................159 CONCLUSIONS..............................................................................................................179 REFERENCES ................................................................................................................180 APPENDICES .................................................................................................................191 CHAPTER V: GENOME-WIDE ASSOCIATION STUDY IDENTIFIES COMMON GENOMIC LOCI ASSOCIATED WITH MUSCLE FAT AND MOISTURE CONTENT IN RAINBOW TROUT ............................................................................193 INTRODUCTION ...........................................................................................................194 vii MATERIALS AND METHODS .....................................................................................198 RESULTS AND DISCUSSION ......................................................................................203 CONCLUSIONS..............................................................................................................224
Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name katanin p80 (WD repeat containing) subunit B 1 Gene Symbol KATNB1 Organism Human Gene Summary Microtubules polymers of alpha and beta tubulin subunits form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. Gene Aliases KAT RefSeq Accession No. NC_000016.9, NT_010498.15 UniGene ID Hs.275675 Ensembl Gene ID ENSG00000140854 Entrez Gene ID 10300 Assay Information Unique Assay ID qHsaCIP0026589 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379661 Amplicon Context Sequence CACCAAGACAGCCTGGAAGTTGCAAGAGATCGTCGCGCATGCCAGCAACGTGT CCTCACTGGTGCTGGGCAAAGCCTCCGGGCGGCTGCTGGCTACAGGCGGGGAT GACTGCCGCGTCAACCTGTGGTCCATCAACAAGCCCAACTGCATCATGAGCCTG ACG Amplicon Length (bp) 132 Chromosome Location 16:57771173-57778314 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.47 cDNA Tm (Celsius) 89 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.43 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report KATNB1, Human Amplification
    [Show full text]
  • Dynamics of Gene Silencing During X Inactivation Using Allele-Specific RNA-Seq Hendrik Marks1*, Hindrik H
    Marks et al. Genome Biology (2015) 16:149 DOI 10.1186/s13059-015-0698-x RESEARCH Open Access Dynamics of gene silencing during X inactivation using allele-specific RNA-seq Hendrik Marks1*, Hindrik H. D. Kerstens1, Tahsin Stefan Barakat3, Erik Splinter4, René A. M. Dirks1, Guido van Mierlo1, Onkar Joshi1, Shuang-Yin Wang1, Tomas Babak5, Cornelis A. Albers2, Tüzer Kalkan6, Austin Smith6, Alice Jouneau7, Wouter de Laat4, Joost Gribnau3 and Hendrik G. Stunnenberg1* Abstract Background: During early embryonic development, one of the two X chromosomes in mammalian female cells is inactivated to compensate for a potential imbalance in transcript levels with male cells, which contain a single X chromosome. Here, we use mouse female embryonic stem cells (ESCs) with non-random X chromosome inactivation (XCI) and polymorphic X chromosomes to study the dynamics of gene silencing over the inactive X chromosome by high-resolution allele-specific RNA-seq. Results: Induction of XCI by differentiation of female ESCs shows that genes proximal to the X-inactivation center are silenced earlier than distal genes, while lowly expressed genes show faster XCI dynamics than highly expressed genes. The active X chromosome shows a minor but significant increase in gene activity during differentiation, resulting in complete dosage compensation in differentiated cell types. Genes escaping XCI show little or no silencing during early propagation of XCI. Allele-specific RNA-seq of neural progenitor cells generated from the female ESCs identifies three regions distal to the X-inactivation center that escape XCI. These regions, which stably escape during propagation and maintenance of XCI, coincide with topologically associating domains (TADs) as present in the female ESCs.
    [Show full text]
  • FBXW8 (NM 153348) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP761689 FBXW8 (NM_153348) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Purified recombinant protein of Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1, full length, with N-terminal HIS tag, expressed in E. coli, 50ug Species: Human Expression Host: E. coli Tag: N-His Predicted MW: 67.2 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 50mM Tris, pH8.0,8M Urea. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_699179 Locus ID: 26259 UniProt ID: Q8N3Y1 RefSeq Size: 4871 Cytogenetics: 12q24.22 RefSeq ORF: 1794 Synonyms: FBW6; FBW8; FBX29; FBXO29; FBXW6 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 FBXW8 (NM_153348) Human Recombinant Protein – TP761689 Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1- cullin-F-box), which function in phosphorylation-dependent ubiquitination.
    [Show full text]
  • KIAA0556 Is a Novel Ciliary Basal Body Component Mutated in Joubert Syndrome Anna A
    Sanders et al. Genome Biology (2015) 16:293 DOI 10.1186/s13059-015-0858-z RESEARCH Open Access KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome Anna A. W. M. Sanders1†, Erik de Vrieze2,3†, Anas M. Alazami4†, Fatema Alzahrani4, Erik B. Malarkey5, Nasrin Sorusch6, Lars Tebbe6, Stefanie Kuhns1, Teunis J. P. van Dam7, Amal Alhashem8, Brahim Tabarki8, Qianhao Lu9,10, Nils J. Lambacher1, Julie E. Kennedy1, Rachel V. Bowie1, Lisette Hetterschijt2,3, Sylvia van Beersum3,11, Jeroen van Reeuwijk3,11, Karsten Boldt12, Hannie Kremer2,3,11, Robert A. Kesterson13, Dorota Monies4, Mohamed Abouelhoda4, Ronald Roepman3,11, Martijn H. Huynen7, Marius Ueffing12, Rob B. Russell9,10, Uwe Wolfrum6, Bradley K. Yoder5, Erwin van Wijk2,3*, Fowzan S. Alkuraya4,14* and Oliver E. Blacque1* Abstract Background: Joubert syndrome (JBTS) and related disorders are defined by cerebellar malformation (molar tooth sign), together with neurological symptoms of variable expressivity. The ciliary basis of Joubert syndrome related disorders frequently extends the phenotype to tissues such as the eye, kidney, skeleton and craniofacial structures. Results: Using autozygome and exome analyses, we identified a null mutation in KIAA0556 in a multiplex consanguineous family with hallmark features of mild Joubert syndrome. Patient-derived fibroblasts displayed reduced ciliogenesis potential and abnormally elongated cilia. Investigation of disease pathophysiology revealed that Kiaa0556-/- null mice possess a Joubert syndrome-associated brain-restricted phenotype. Functional studies in Caenorhabditis elegans nematodes and cultured human cells support a conserved ciliary role for KIAA0556 linked to microtubule regulation. First, nematode KIAA0556 is expressed almost exclusively in ciliated cells, and the worm and human KIAA0556 proteins are enriched at the ciliary base.
    [Show full text]
  • The Molecular Karyotype of 25 Clinical-Grade Human Embryonic Stem Cell Lines Received: 07 August 2015 1 1 2 3,4 Accepted: 27 October 2015 Maurice A
    www.nature.com/scientificreports OPEN The Molecular Karyotype of 25 Clinical-Grade Human Embryonic Stem Cell Lines Received: 07 August 2015 1 1 2 3,4 Accepted: 27 October 2015 Maurice A. Canham , Amy Van Deusen , Daniel R. Brison , Paul A. De Sousa , 3 5 6 5 7 Published: 26 November 2015 Janet Downie , Liani Devito , Zoe A. Hewitt , Dusko Ilic , Susan J. Kimber , Harry D. Moore6, Helen Murray3 & Tilo Kunath1 The application of human embryonic stem cell (hESC) derivatives to regenerative medicine is now becoming a reality. Although the vast majority of hESC lines have been derived for research purposes only, about 50 lines have been established under Good Manufacturing Practice (GMP) conditions. Cell types differentiated from these designated lines may be used as a cell therapy to treat macular degeneration, Parkinson’s, Huntington’s, diabetes, osteoarthritis and other degenerative conditions. It is essential to know the genetic stability of the hESC lines before progressing to clinical trials. We evaluated the molecular karyotype of 25 clinical-grade hESC lines by whole-genome single nucleotide polymorphism (SNP) array analysis. A total of 15 unique copy number variations (CNVs) greater than 100 kb were detected, most of which were found to be naturally occurring in the human population and none were associated with culture adaptation. In addition, three copy-neutral loss of heterozygosity (CN-LOH) regions greater than 1 Mb were observed and all were relatively small and interstitial suggesting they did not arise in culture. The large number of available clinical-grade hESC lines with defined molecular karyotypes provides a substantial starting platform from which the development of pre-clinical and clinical trials in regenerative medicine can be realised.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Cyclin K Interacts with Β-Catenin to Induce Cyclin D1 Expression And
    Theranostics 2020, Vol. 10, Issue 24 11144 Ivyspring International Publisher Theranostics 2020; 10(24): 11144-11158. doi: 10.7150/thno.42578 Research Paper Cyclin K interacts with β-catenin to induce Cyclin D1 expression and facilitates tumorigenesis and radioresistance in lung cancer Guojun Yao*, Jing Tang*, Xijie Yang, Ye Zhao, Rui Zhou, Rui Meng, Sheng Zhang, Xiaorong Dong, Tao Zhang, Kunyu Yang, Gang Wu and Shuangbing Xu Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. *These authors contributed equally to this work. Corresponding author: Shuangbing Xu or Gang Wu, Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.11.29; Accepted: 2020.08.24; Published: 2020.09.11 Abstract Rationale: Radioresistance remains the major cause of local relapse and distant metastasis in lung cancer. However, the underlying molecular mechanisms remain poorly defined. This study aimed to investigate the role and regulatory mechanism of Cyclin K in lung cancer radioresistance. Methods: Expression levels of Cyclin K were measured by immunohistochemistry in human lung cancer tissues and adjacent normal lung tissues. Cell growth and proliferation, neutral comet and foci formation assays, G2/M checkpoint and a xenograft mouse model were used for functional analyses. Gene expression was examined by RNA sequencing and quantitative real-time PCR.
    [Show full text]
  • Regulation of Xenobiotic and Bile Acid Metabolism by the Anti-Aging Intervention Calorie Restriction in Mice
    REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE By Zidong Fu Submitted to the Graduate Degree Program in Pharmacology, Toxicology, and Therapeutics and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Dissertation Committee ________________________________ Chairperson: Curtis Klaassen, Ph.D. ________________________________ Udayan Apte, Ph.D. ________________________________ Wen-Xing Ding, Ph.D. ________________________________ Thomas Pazdernik, Ph.D. ________________________________ Hao Zhu, Ph.D. Date Defended: 04-11-2013 The Dissertation Committee for Zidong Fu certifies that this is the approved version of the following dissertation: REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE ________________________________ Chairperson: Curtis Klaassen, Ph.D. Date approved: 04-11-2013 ii ABSTRACT Calorie restriction (CR), defined as reduced calorie intake without causing malnutrition, is the best-known intervention to increase life span and slow aging-related diseases in various species. However, current knowledge on the exact mechanisms of aging and how CR exerts its anti-aging effects is still inadequate. The detoxification theory of aging proposes that the up-regulation of xenobiotic processing genes (XPGs) involved in phase-I and phase-II xenobiotic metabolism as well as transport, which renders a wide spectrum of detoxification, is a longevity mechanism. Interestingly, bile acids (BAs), the metabolites of cholesterol, have recently been connected with longevity. Thus, this dissertation aimed to determine the regulation of xenobiotic and BA metabolism by the well-known anti-aging intervention CR. First, the mRNA expression of XPGs in liver during aging was investigated.
    [Show full text]
  • Are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway Is Associated with a More Favorable Phenotype
    Cancers 2019, 11 S1 of S19 Supplementary Material Functional Toll-Like Receptors (TLRs) are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway is Associated with a More Favorable Phenotype Annette K. Brenner and Øystein Bruserud Table S1. Median concentration increase in the secretion of 19 (16 patients with G-CSF, 67 patients with GM-CSF) soluble mediators as a result of targeting with four different TLR agonists. More than 5-fold increase is highlighted. LPS (TLR4) Flagellin (TLR5) R848 (TLR7/8) Pam3CSK4 (TLR1/2) IL-6 301.0 45.9 10.2 5.3 TNFα 188.7 10.6 5.0 1.5 IL-1β 89.7 9.2 1.1 1.5 CCL3 56.4 6.0 2.4 1.5 CCL2 52.6 9.4 4.3 2.8 G-CSF 51.9 2.7 1.0 1.0 CXCL1 38.0 5.8 1.4 1.5 CCL4 17.2 3.3 2.0 1.3 CCL5 14.5 2.1 1.3 1.1 MMP-1 11.1 3.4 1.4 1.1 CXCL5 8.3 4.3 1.3 1.4 CXCL8 6.0 4.3 1.7 1.3 GM-CSF 5.2 1.5 1.4 1.0 MMP-2 4.0 1.5 1.2 1.1 CXCL10 3.9 1.6 2.2 1.1 HGF 2.0 1.1 1.0 1.0 MMP-9 1.9 2.5 1.3 1.7 IL-1RA 1.8 1.3 1.3 1.0 Serpin E1 1.3 1.3 1.1 1.1 Cystatin C 1.1 1.1 1.0 1.0 Cancers 2019, 11 S2 of S19 Table S2.
    [Show full text]
  • Lncrna Jpx Induces Xist Expression in Mice Using Both Trans and Cis Mechanisms
    RESEARCH ARTICLE LncRNA Jpx induces Xist expression in mice using both trans and cis mechanisms Sarah Carmona, Benjamin Lin, Tristan Chou, Katti Arroyo, Sha Sun* Department of Developmental and Cell Biology, Ayala School of Biological Sciences, University of California, Irvine, Irvine, CA, United States of America * [email protected] a1111111111 a1111111111 Abstract a1111111111 a1111111111 Mammalian X chromosome dosage compensation balances X-linked gene products a1111111111 between sexes and is coordinated by the long noncoding RNA (lncRNA) Xist. Multiple cis and trans-acting factors modulate Xist expression; however, the primary competence factor responsible for activating Xist remains a subject of dispute. The lncRNA Jpx is a proposed competence factor, yet it remains unknown if Jpx is sufficient to activate Xist expression in OPEN ACCESS mice. Here, we utilize a novel transgenic mouse system to demonstrate a dose-dependent relationship between Jpx copy number and ensuing Jpx and Xist expression. By localizing Citation: Carmona S, Lin B, Chou T, Arroyo K, Sun S (2018) LncRNA Jpx induces Xist expression in transcripts of Jpx and Xist using RNA Fluorescence in situ Hybridization (FISH) in mouse mice using both trans and cis mechanisms. PLoS embryonic cells, we provide evidence of Jpx acting in both trans and cis to activate Xist. Our Genet 14(5): e1007378. https://doi.org/10.1371/ data contribute functional and mechanistic insight for lncRNA activity in mice, and argue that journal.pgen.1007378 Jpx is a competence factor for Xist activation in vivo. Editor: Gregory S. Barsh, Stanford University School of Medicine, UNITED STATES Received: November 20, 2017 Accepted: April 24, 2018 Author summary Published: May 7, 2018 Long noncoding RNA (lncRNA) have been identified in all eukaryotes but mechanisms Copyright: © 2018 Carmona et al.
    [Show full text]
  • Salty Taste Deficits in CALHM1 Knockout Mice M
    Donald and Barbara Zucker School of Medicine Journal Articles Academic Works 2014 Salty Taste Deficits in CALHM1 Knockout Mice M. G. Tordoff H. T. Ellis T. R. Aleman A. Downing P. Marambaud Northwell Health See next page for additional authors Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Medical Molecular Biology Commons Recommended Citation Tordoff M, Ellis H, Aleman T, Downing A, Marambaud P, Foskett ,J Dana R, McCaughey S. Salty Taste Deficits in CALHM1 Knockout Mice. 2014 Jan 01; 39(6):Article 2870 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/articles/2870. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. For more information, please contact [email protected]. Authors M. G. Tordoff, H. T. Ellis, T. R. Aleman, A. Downing, P. Marambaud, J. K. Foskett, R. M. Dana, and S. A. McCaughey This article is available at Donald and Barbara Zucker School of Medicine Academic Works: https://academicworks.medicine.hofstra.edu/articles/2870 Chem. Senses 39: 515–528, 2014 doi:10.1093/chemse/bju020 Advance Access publication May 20, 2014 Salty Taste Deficits in CALHM1 Knockout Mice Michael G. Tordoff1, Hillary T. Ellis1, Tiffany R. Aleman1, Arnelle Downing1, Philippe Marambaud2, J. Kevin Foskett3, Rachel M. Dana4 and Stuart
    [Show full text]
  • Toxicogenomics Applications of New Functional Genomics Technologies in Toxicology
    \-\w j Toxicogenomics Applications of new functional genomics technologies in toxicology Wilbert H.M. Heijne Proefschrift ter verkrijging vand egraa dva n doctor opgeza gva nd e rector magnificus vanWageninge n Universiteit, Prof.dr.ir. L. Speelman, in netopenbaa r te verdedigen op maandag6 decembe r200 4 des namiddagst e half twee ind eAul a - Table of contents Abstract Chapter I. page 1 General introduction [1] Chapter II page 21 Toxicogenomics of bromobenzene hepatotoxicity: a combined transcriptomics and proteomics approach[2] Chapter III page 48 Bromobenzene-induced hepatotoxicity atth etranscriptom e level PI Chapter IV page 67 Profiles of metabolites and gene expression in rats with chemically induced hepatic necrosis[4] Chapter V page 88 Liver gene expression profiles in relation to subacute toxicity in rats exposed to benzene[5] Chapter VI page 115 Toxicogenomics analysis of liver gene expression in relation to subacute toxicity in rats exposed totrichloroethylen e [6] Chapter VII page 135 Toxicogenomics analysis ofjoin t effects of benzene and trichloroethylene mixtures in rats m Chapter VII page 159 Discussion and conclusions References page 171 Appendices page 187 Samenvatting page 199 Dankwoord About the author Glossary Abbreviations List of genes Chapter I General introduction Parts of this introduction were publishedin : Molecular Biology in Medicinal Chemistry, Heijne etal., 2003 m NATO Advanced Research Workshop proceedings, Heijne eral., 2003 81 Chapter I 1. General introduction 1.1 Background /.1.1 Toxicologicalrisk
    [Show full text]