Remodeling of the Chlamydia Psittaci Inclusion by the Type III Secreted, BAR Domain- Containing Inclusion Membrane Protein Inca

Home , Chlamydia felis, Chlamydia psittaci

Remodeling of the Chlamydia psittaci inclusion by the type III secreted, BAR domain- containing inclusion membrane protein IncA

Item Type dissertation

Authors Phillips, Daniel Austin

Publication Date 2016

Abstract Chlamydia species cause infections in humans that range from prevalent, often asymptomatic genital infections caused by Chlamydia trachomatis to relatively rare, potentially life- threatening zoonotic infections caused by avian Chlamydia psittaci. All...

Keywords BAR domain; Chlamydia psittaci; contact-dependent; IncA; inclusion membrane; Chlamydophila psittaci; Type III Secretion Systems

Download date 29/09/2021 16:37:42

Link to Item http://hdl.handle.net/10713/5445 Curriculum Vitae

Name: Daniel Austin Phillips Contact Information: [email protected] Degree and Date to be Confirmed: Ph.D., April 25, 2016.

EDUCATION

2005-2010 B.S. in Biology, East Tennessee State University, Johnson City, TN, Cum Laude 2005-2010 B.S. in Physics, East Tennessee State University, Johnson City, TN, Cum Laude 2010-2016 Ph.D. in Molecular Microbiology and Immunology, University of Maryland, Baltimore, Baltimore, MD

WORK EXPERIENCE

2010-2016 Ph.D. candidate. Department of Microbial Pathogenesis University of Maryland, Baltimore Baltimore, MD Mentor: Patrik M. Bavoil, Ph.D.

2007-2010 Undergraduate Technician Department of Microbiology East Tennessee State University Johnson City, TN Mentor: Priscilla Wyrick, Ph.D.

RESEARCH SKILLS

 Bacterial and cell culture  Algorithm development  Bioinformatics software proficiency o Phylogenetics: PhyML, RAxML, FigTree, ClustalO, Geneious, Mesquite o Coding languages: Perl, Python, C++  Growing polarized genital epithelial cells on membranes  Protein-protein interaction techniques  In vitro Tubule Formation from liposomes  Mathematical modeling of biological systems  Bioinformatics analysis of microbiota diversity  DNA extraction and sequence analysis from patient samples  Immunofluorescence microscopy  Confocal microscopy  Transmission electron microscopy (including sample processing)  Molecular cloning, expression, and purification of recombinant polypeptides  Certification in BSL-3 usage

HONORS AND AWARDS

2008-2010 Kappa Mu Epsilon Mathematics Honor Society 2006-2010 Golden Key Honor Society

EDUCATIONAL ACTIVITIES

2012-2015 Active in qualifying exam preparation of 2nd year graduate students 2011-2015 Student host for incoming student recruitment 2008-2010 Physics tutor 2005-2010 General chemistry tutor

PUBLICATIONS

In preparation Daniel Phillips, Heather Huot-Creasy, Jacques Ravel, Joana C Silva, Ru-ching Hsia, and Patrik M. Bavoil Remodeling of the Chlamydia psittaci parasitophorous vacuole by a type III secreted, BAR domain-containing inclusion membrane protein.

ABSTRACTS AND PRESENTATIONS

April 2016 Daniel Phillips, Heather Huot-Creasy, Jacques Ravel, Joana C. Silva, Ru-ching Hsia, and Patrik M. Bavoil Remodeling of the Chlamydia psittaci parasitophorous vacuole by a type III secreted, BAR domain-containing inclusion membrane protein. Type III Secretion Systems 2016, Tübingen, Germany

February 2016 Daniel Phillips, Sergio Mojica, Kelley Hovis, Patricia Marques, Rebecca Brotman, Heather Huot Creasy, Jacques Ravel, Ru-ching Hsia, Joanna C. Silva, Kathy Wilson, Patrik M. Bavoil The Yin Yang of chlamydial biology 11th Annual Amsterdam Chlamydia Meeting

March 2015 Daniel Phillips, Ru-ching Hsia, Heather Huot-Creasy, Jacques Ravel, Joana Carneiro da Silva, and Patrik M. Bavoil Stepwise convergent evolution of a membrane remodeling BAR domain inclusion membrane protein of Chlamydia psittaci Chlamydia Basic Research Society conference, New Orleans, LA Poster presentation

December 2014 Daniel Phillips, Ru-ching Hsia, Heather Huot-Creasy, Joana Carneiro da Silva, Jacques Ravel, and Patrik M. Bavoil

Chlamydia psittaci encodes a functional BAR domain Inc protein that targets inverted and everted inclusion membrane extensions and associates with gap junction proteins American Society for Cell Biology conference, Philadelphia, PA Poster presentation

March 2013 Daniel Phillips, Andrew Craig, Roger Rank, Ru-ching Hsia, David Wilson Jacques Ravel and Patrik Bavoil IncA BAR domain-mediated transluminal folds of the inclusion membrane support contact-dependent development of Chlamydia psittaci Chlamydia Basic Research Society conference, San Antonio, TX Oral presentation, invited speaker

October 2012 Daniel Phillips, Ru-ching Hsia, Andrew Craig, David Wilson, and Patrik Bavoil Reconciliation of the Chlamydia psittaci inclusion with the contact-dependent hypothesis SAC meeting of CRC, Baltimore, MD Poster presentation

Spring 2010 Daniel Phillips, Cheryl Moore, Maria Schell, Judy Whittimore, Priscilla Wyrick Acidic Mucosal pH Decreases Chlamydia trachomatis Serovar E Attachment and Entry in HEC-1B Cells in vitro. ETSU Undergraduate Student Research Symposium, Johnson City, TN Oral presentation, invited speaker – 2nd place overall best presentation Poster presentation

Abstract

Remodeling of the Chlamydia psittaci inclusion by the type III secreted, BAR domain- containing inclusion membrane protein IncA.

Daniel Phillips, Doctor of Philosophy, 2016

Dissertation Directed by: Patrik Bavoil, Ph.D., Department of Microbial Pathogenesis

Chlamydia species cause infections in humans that range from prevalent, often asymptomatic genital infections caused by Chlamydia trachomatis to relatively rare, potentially life-threatening zoonotic infections caused by avian Chlamydia psittaci. All

Chlamydia spp. encode integral membrane proteins (Incs) that are type III-secreted (T3S) through the molecular syringe injectisome from the bacteria into the host-derived inclusion membrane where they interact with host proteins. These include Incs of C. trachomatis that interact with membrane curvature-inducing BAR-domain sorting-nexin

(SNX) proteins, potentially disrupting retromer-mediated endosome-to-Golgi trafficking to benefit the pathogen. Eukaryotic BAR domain protein interaction with bacterial proteins have been reported, but BAR domain proteins have yet to be confirmed in prokaryotes. I propose that IncA/Cps, the first BAR protein described in a prokaryote, specifically contributes to the remodeling of the C. psittaci inclusion membrane to form a) IncA-laden retromer-like tubules extending outward into the cytosol, and b) folds and tubular extensions extending inward into the inclusion lumen. IncA of C. psittaci

(IncA/Cps) contains a predicted SNX-BAR-like domain that is absent in the C. trachomatis ortholog. Comparative sequence analysis of IncA orthologs across

Chlamydia spp. suggests that the SNX-BAR-like domain of IncA/Cps was acquired by

convergent evolution. IncA/Cps BAR-mediated in vitro tubulation of liposomes and filamentous/tubular structures observed in HEK293 cells expressing IncA/Cps suggest that IncA/Cps has membrane remodeling activity. During C. psittaci infection, IncA/Cps localized to the inclusion membrane and to nocodazole-sensitive retromer-like tubules extending from the inclusion membrane into the host cytosol. IncA-specific immunofluorescence staining of the C. psittaci inclusion displayed a characteristic irregular configuration with concave pits and folds extending into the inclusion lumen, sharply contrasting the characteristic ovoid shape of the C. trachomatis inclusion. In addition, abundant luminal IncA/Cps staining did not colocalize with growing chlamydiae and was sensitive to host sphingolipid biosynthesis inhibition. This suggests that luminal IncA/Cps is structurally continuous with the inclusion membrane. Inward extensions may enhance contact-dependent growth of C. psittaci and eventually infectious progeny per infected cell. The higher infectious load may contribute to C. psittaci-induced severe pathologies and high transmission rates between birds and to humans.

Remodeling of the Chlamydia psittaci Inclusion by the Type III Secreted, BAR Domain- containing Inclusion Membrane Protein IncA.

by Daniel Phillips

Dissertation submitted to the Faculty of the Graduate School of the University of Maryland, Baltimore in partial fulfillment of the requirements for the degree of Doctor of Philosophy 2016

Dedication

To Debbie, Tony, Sam, Brandi, Brody, and Sarah Phillips, Dr. Priscilla Wyrick, and my dog, Zaphod.

iii

Acknowledgements

First, I would like to express my sincerest gratitude to my thesis mentor, Dr. Patrik Bavoil. Patrik, with his seemingly infinite patience, gave me creative freedom to investigate new and promising leads that helped foster my independence as a researcher. When I had ideas for experiments and projects that I thought were interesting and novel, but were tangential to progress within my main project, Patrik would say, “You’re going to do THAT, are you?” not necessarily telling me not to do it, but reminding me to consider the bigger picture of my investigative research. Looking back, the lesson was to maintain my scientific curiosity, always be thinking about the experiment, and that the thrill of discovery goes hand-in-hand with discipline, dedication, and perseverance. I am eternally grateful for the training and wisdom received while under his mentorship.

Special thanks are due to all past and present members of the Bavoil lab with whom I’ve worked. Huizhong Shou has been an incredible friend and an invaluable source of support, kindness, and incalculable assistance throughout my Ph.D. training. Dr. Sergio Mojica, who was the first (and only) person to ask (repeatedly), “What do you think of science?”, remains a friend despite his current post-doc position across the globe in Sweden. Dr. Kelley Hovis, for giving me grounded advice and mentoring. Dr. Patricia Marques, for her expertise and experimental help and ability to tune out my incessant singing while working. To Kim Filcek, for the banter, quarrels, and jump-starting my car on numerous occasions. Dr. Jose Carrasco, for helping me pick up the Spanish language by arguing with Sergio in both Spanish and English with seamless transitions between the two. Andrea Kennard, Dr. Valerie Grinblat-Huse, and Nisha George, who overlapped my time in the Bavoil lab briefly, but were helpful and pleasant to work with. Thanks are due to all of them for providing a fun, supportive work environment.

My gratitude also belongs to my fellow members of the Department of Microbial Pathogenesis. Dr. Bob Ernst and his lab, especially Dr. Alison Scott, Kelsey Gregg, and Francesca Gardner, have been instrumental in assistance ranging from sharing reagents, assistance with equipment, and friendly conversations over lunch. Dr. Bryan Krantz and his lab members, including Nate Hardenbrook, Dr. Debasis Das, and Dr. Koyel Ghosal. Dr. Mark Shirtliff and his lab members, both past and present. They made the 9th floor an incredible place to work.

Judy Pennington and Yulvonnda Brown, without whom I wouldn’t have the slightest idea how to properly submit forms and handle paperwork, have made my life much easier, and have always been very helpful.

My appreciation extends to the graduate program in Molecular Microbiology and Immunology’s administrative guru, June Green. She kept me on track, up-to-date, and always smiling. Further thanks are due to Dr. James Kaper and Nick Carbonetti for their support in my academic progress.

To Dr. Bret Hassel, thanks for the fishing / hunting trips, conversations over good beer, and tremendous help throughout the process of receiving my degree.

I would also like my committee members for their insight, thoughtful comments, and investment in my professional development. Dr. Bob Ernst (reader), Dr. Vincent Bruno (reader), Dr. Michael Donnenberg, Dr. Isabelle Coppens, and Dr. David Wilson. Special thanks to Dr. David Wilson, for many insightful conversations in front of the dry erase board reviewing equations, friendly conversations at conferences and meetings, and honest investment in my academic progress/development. To Dr. Michael Donnenberg, for the rotation in his lab that taught me the fundamental techniques in molecular biology research, with the aid of a close friend, Dr. Joshua Lieberman. Dr. Vincent Bruno, for spontaneous meetings in his office, thought-provoking discussion, direction in several experiments, and career advice to help me become an independent researcher. Dr. Bob Ernst, for his critical analysis of my experiments, unwavering jovial nature, and top-shelf bourbon. All of you have enriched my scientific training immensely.

Further thanks are due to Zhiming Chen and Dr. Ted Baumgart at the University of Pennsylvania, for their willingness and readily available guidance for the in vitro tubule formation experiments.

I cannot overstate the impact of Dr. Ru-ching Hsia on my thesis work. She has been the driving force behind the transmission electron microscopy and in vitro tubule formation experiments. Without her tireless help, including nights and weekends spent processing and visualizing samples with me, most of my thesis research would not be possible. John Strong and Johanna Sotiris, thanks for the camaraderie and technical help/expertise.

To Dr. Jacques Ravel, thanks for igniting my interest in pursuing bioinformatics research by showing how my enjoyment of coding/programming can be useful to my career as a scientist, and helping to secure funding for our projects. Dr. Joana Silva was essential in the development and analysis that led to the convergent evolution conclusions. Without her valuable expertise, my thesis research would have taken a vastly different shape. Dr. Garry Myers and Heather Huot-Creasy were pivotal in the development of the HMM analysis on the IncA orthologs.

The following people have made my time in Baltimore enriched not only academically, but through the fostering of remarkable personal relationships. First and foremost, Jason Karimy, my closest friend, #1 bro, roommate, and confidant. Kyle Tretina, for helping me wade through learning BioPerl. Mark Guillote, Jessica Pouder, Dr. Jason Bailey, Dr. Elena Artimovich, and Philippe Azimzadeh, thanks for the weekly gags, stories, and getting excited about dice rolls with me.

To Dr. Priscilla Wyrick, my undergraduate mentor, friend, and steadfast motivator, thanks for opening the doors allowing me to pursue my scientific career. I’m thankful for washing all those dishes in her lab, but all the lab upkeep I’d be able to do in a lifetime would never repay the impact she’s had in my life.

Finally, to my mom and dad, Debbie and Tony Phillips, my brother, Sam Phillips, my sister-in-law Brandi Phillips and nephew Brody, and little sister Sarah Phillips, without whom none of this would be possible. Your unwavering love and support not only helped shape me into who I am today, but continue to inspire me to bigger and better things. Thank you all.

Table of Contents

Dedication ...... iii

Acknowledgements ...... iv

Table of Contents ...... vii

List of Tables ...... ix

List of Figures ...... x

List of Abbreviations ...... xiii

Chapter 1. Introduction ...... 1 The genus Chlamydia ...... 1 Hypothesis: Matsumoto’s projections represent type III secretion injectisomes that control contact-dependent development ...... 10 Inc proteins are integral inclusion membrane proteins ...... 17 Inc proteins are type III secretion substrates ...... 20 IncA mediates inclusion fusogenicity ...... 21 IncA orthologs include SNARE-like motifs ...... 23

Chapter 2. Materials and Methods...... 32 Cell and Chlamydia culture ...... 32 Generation of α-IncA polyclonal antiserum ...... 32 Recombinant IncA protein expression and purification ...... 33 Liposome preparation ...... 34 In vitro tubule formation ...... 35 IncA ortholog prediction ...... 35 Transfection ...... 36 Purification of biotinylated proteins for mass spectrometry ...... 37 Immunofluorescence ...... 38 Transmission electron microscopy contour analysis ...... 39 Infectivity time course ...... 39

Chapter 3. Chlamydia psittaci inclusion morphology supports contact-dependent development ...... 43 Introduction ...... 43 vii

Results ...... 44 The Chlamydia psittaci CAL10 inclusion membrane is irregularly shaped and uniquely extends into the inclusion lumen...... 44 Inhibition of host sphingolipid biosynthesis changes the C. psittaci inclusion configuration ...... 48 Inclusion fusion is dependent on host sphingolipid ...... 53 Method of fixation affects luminal IncA/Cps signal...... 57 Discussion...... 59

Chapter 4. The inclusion membrane protein IncA of Chlamydia psittaci contains a functional prokaryotic BAR domain acquired by convergent evolution ...... 63 Introduction ...... 63 Results ...... 65 The inclusion membrane protein IncA of C. psittaci contains a predicted, uniquely evolved BAR-like domain ...... 65 IncA/Cps BAR-like domain was acquired by convergent evolution ...... 70 The IncA/Cps predicted tertiary structure consists of coiled-coils ...... 79 The IncA/Cps BAR-like domain induces membrane tubulation with low frequency...... 79 IncA/Cps is expressed as tubules/fibers in HEK293 cells ...... 91 IncA/Cps inclusion membrane structures are differentially sensitive to inhibitors ...... 93 IncA/Cps interacts with retromer cargo proteins ...... 95 Discussion...... 101

Chapter 5. General discussion and future directions ...... 104 C. psittaci has evolved a functional prokaryotic BAR domain by convergent evolution ...... 104 IncA retromer-like tubules extend from the inclusion membrane into the host cytosol ...... 111 The inclusion configuration of C. psittaci supports contact-dependent growth ...... 119

Bibliography ...... 127

viii

List of Tables

Table 1 – The Chlamydiaceae...... 2

Table 2 – Primer list ...... 42

Table 3 – Hidden Markov Model analysis of IncA orthologs for BAR domain prediction

...... 72

Table 4 – Frequency of tubule formation of liposomes in vitro ...... 90

Table 5 – IncA/Cps-proximal proteins identified with “high confidence” by BioID ...... 99

List of Figures

Figure 1 – Parrot fever strikes the United States ...... 4

Figure 2 – The developmental cycle of Chlamydia ...... 8

Figure 3 – Matsumoto’s projections ...... 9

Figure 4 – Type III secretion injectisome ...... 11

Figure 5 – The Type III secretion-mediated contact-dependent hypothesis for the developmental cycle of Chlamydia ...... 12

Figure 6 – Schematic of Inc protein secondary structure ...... 16

Figure 7 – The hydrophobic bilobe is conserved in Inc proteins ...... 18

Figure 8 – Model for IncA SNARE complex structure formation during membrane fusion

...... 25

Figure 9 – Detection of IncA/Cps in the ...... 46

Figure 10 – Immunogold labeling of IncA/Cps ...... 47

Figure 11 – The growing C. psittaci inclusion is irregularly shaped ...... 50

Figure 12A – Myriocin induces inclusion roundness in a dose-dependent manner ...... 51

Figure 12B – Myriocin induces inclusion roundness in a dose-dependent manner ...... 52

Figure 13A – Myriocin exposed C. psittaci inclusions are rounded, non-fusogenic, and lyse early ...... 54

Figure 13B – Myriocin exposed C. psittaci inclusions are rounded, non-fusogenic, and lyse early ...... 55

Figure 14 – The shape of C. trachomatis inclusions is unaffected by exposure to myriocin

...... 56

Figure 15 – Methanol fixation diminishes luminal IncA/Cps signal ...... 58

Figure 17 – The C. psittaci IncA ortholog contains a predicted BAR doman ...... 67

Figure 18 – ClustalO alignment of the IncA/Cps SNX-BAR-like domain with the SNX-

BAR consensus sequence ...... 68

Figure 19 - MAFFT alignment of the IncA/Cps SNX-BAR-like domain with the SNX-

BAR consensus sequence ...... 69

Figure 20 – Alignment of IncA orthologs reveals overlap between SNARE-like domains and the IncA/Cps SNX-BAR-like domain residues ...... 73

Figure 21 – Alignment of IncA orthologs with the SNX-BAR consensus sequence ...... 74

Figure 22 – BAR domain amino acids are most conserved in the IncA from C. psittaci strain Cal10 ...... 75

Figure 23 – Dendrogram of IncA alignment supports convergent evolution of the IncA

BAR domain ...... 77

Figure 24 – Evolutionary phylogeny of MOMP within the Chlamydiaceae ...... 78

Figure 25 – The coiled-coil IncA/Cps predicted structure exhibits SNX-BAR domain similarity ...... 82

Figure 26 – Purified recombinant proteins used for in vitro tubule formation ...... 83

Figure 27 – IncA/Cps induces tubule formation of liposomes in vitro ...... 84

Figure 28 – In vitro tubule formation replicate one ...... 85

Figure 29 – In vitro tubule formation replicate two ...... 86

Figure 30 – In vitro tubule formation replicate three ...... 87

Figure 31 – In vitro tubule formation blinded replicate four ...... 88

Figure 32 – In vitro tubule formation with endophilin ...... 89

Figure 33 – Cells transfected with IncA/Cps-GFP and IncA/Ctr-GFP display contrasting localizations ...... 92

Figure 34 – Nocodazole disrupts everted, retromer-like tubules ...... 94

Figure 35 – Schematic of the BioID technique ...... 97

Figure 36 – IncA/Cps::myc::BirA colocalizes with Streptavidin-568 in transfected

HEK293 cells ...... 98

Figure 37 – Intracellular localizations and structures of known BAR domain proteins and their association with bacterial virulence factors ...... 110

Figure 38 – A proposed pathway for SNX-BAR-retromer-like tubule assembly of

IncA/Cps ...... 115

Figure 39 – Schematic representation of IncA/Cps-mediated IM remodeling ...... 118

xii

List of Abbreviations

EB Elementary Body

RB Reticulate Body

Inc Inclusion membrane protein

SNX Sorting Nexin

BAR Bin-Amphiphysin-Rvs

Cps Chlamydia psittaci

Ctr Chlamydia trachomatis

EM Electron Microscopy

LGV Lymphogranuloma Venereum

T3S Type III Secretion kDa Kilodalton

TarP Translocated Actin Recruitment Protein

SinC Secreted Inner Nuclear Chlamydia protein

GPIC Guinea Pig Inclusion Conjunctivitis

IF Immunofluorescence

MOI Multiplicity of Infection

ER Endoplasmic Reticulum

IFU Inclusion Forming Unit

SNARE Soluble NSF Attachment Protein Receptor

MTOC Microtubule Organizing Center

GFP Green Fluorescent Protein

Hpi Hours Post Infection

xiii pN Piconewtons

LC-MS/MS Liquid Chromatography Tandem Mass Spectrometry

FBS Fetal Bovine Serum

DMEM Dulbecco’s Modified Eagles Medium

SPG Sucrose-Phosphate-Glutamate

OD600 Optical Density at a wavelength of 600 nm

DNA Deoxyribonucleic Acid

MOMP Major Outer Membrane Protein

PBS Phosphate Buffered Saline

PBS-T PBS + 0.1% Tween 20

PCR Polymerase Chain Reaction

DOPS 1,2-Dioleoyl-sn-glycero-3-phosphoserine

DOPE 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine

DOPC 1,2-Dioleoyl-sn-glycero-3-phosphocholine

PIP2 Phosphatidylinositol (4,5)-bisphosphate

HMM Hidden Markov Model

LC-MS Liquid Chromatography Mass Spectrometry

DMSO Dimethyl Sulfoxide

EF-Tu Elongation Factor-Tu

DAPI 4',6-diamidino-2-phenylindole

BSA Bovine Serum Albumin

TEM Transmission Electron Microscopy

PFA Paraformaldehyde

xiv pI Isoelectric Point

PDB Protein Data Bank

SCV Salmonella-containing Vacuole

DSG2 Desmoglein-2

IRS4 Insulin Receptor Substrate 4

CXADR Coxsackievirus and Adenovirus Receptor

SNAP23 Synaptosomal-associated Protein 23

SCRIB Protein Scribble Homolog

CI-MPR Cation-Independent Mannose-6-Phosphate Receptor

TGN Trans-Golgi Network

SNX-BAR Sorting Nexin BAR

I-BAR Inverse BAR

WASPs Wiskott-Aldrich Syndrome Proteins

Tir Translocated Intimin Receptor

VAMP Vesicle-Associated Membrane Protein

1 Chapter 1. Introduction

3 The genus Chlamydia

4 Members of the genus Chlamydia are obligate intracellular bacteria capable of

5 causing a wide range of pathology in humans and animals (Table 1). The most notorious

6 pathogen of the family Chlamydiaceae is Chlamydia trachomatis, the leading cause of

7 bacterial sexually transmitted infections with over 1.4 million cases reported per year in

8 the United States (1). Infections can be asymptomatic, so this number does not

9 accurately represent the total annual infection rate. Total reported and unreported cases

10 are suspected to surpass three million (2). Ocular C. trachomatis infections lead to a

11 serious disease, trachoma, and can progress to preventable blindness. Trachoma-induced

12 sequelae are most prevalent in underdeveloped nations (3) and are reduced with improved

13 sanitation. For this reason, C. trachomatis is of great concern to global public health.

14 Chlamydia pneumoniae and Chlamydia psittaci infections develop as atypical pneumonia

15 after exposure to aerosols containing the bacteria. In the case of C. pneumoniae, the

16 infection is considered one of the three major causes of “community acquired”

17 pneumonia, together with Streptococcus pneumoniae and Mycoplasma pneumoniae (4).

18 C. psittaci, and the ovine/bovine pathogen, Chlamydia abortus, are zoonotic pathogens

19 with human infections occurring as a result of exposure to respiratory/fecal aerosols and

20 fluids from infected animals (5-8). Both C. pneumoniae and C. psittaci infections can

21 progress into more serious disease with dissemination resulting in septicemia,

22 endocarditis, and meningitis (9, 10). After C. psittaci infections become systemic, they

23 can be fatal. C. psittaci infections within the United States are

24 Table 1 – The Chlamydiaceae

Species Host Disease Sexually-transmitted infections, trachoma, Chlamydia trachomatis Humans conjunctivitis, cervicitis, salpingitis, proctitis, epididymitis, lymphogranuloma venereum Community-acquired pneumonia (humans), respiratory Humans, amphibians, infections (humans, amphibians, reptiles, marsupials, Chlamydia pneumoniae reptilians, equines, equines), conjunctivitis (marsupials), urogenital marsupials infections (marsupials) Humans, birds, ovines, bovines, Psittacosis (humans), ornithosis (birds), pneumonia, Chlamydia psittaci swine, equines, dogs, gastrointestinal infections cats Ovines, bovines, Chlamydia abortus Spontaneous abortion humans (rarely) Chlamydia felis Cats Conjunctivitis, rhinitis, respiratory infections Chlamydia caviae Guinea pigs Conjunctivitis, genital infections Pigeons, psittacine Chlamydia avium Respiratory and gastrointestinal infections birds Chickens, guinea Chlamydia gallinacea Respiratory and gastrointestinal infections fowl, turkeys Marsupials, ovines, Chlamydia pecorum Reproductive disease, abortion, conjunctivitis, enteritis bovines, swine Candidatus Chlamydia African Sacred Ibises Gastrointestinal infections ibidis Chlamydia suis Swine Conjunctivitis, enteritis, pneumonia Pharyngitis, bronchitis, pneumonitis, genital tract Chlamydia muridarum Rodents infections Table 1. The Chlamydiaceae. Chlamydia species infect a wide range of hosts and cause disease ranging from sexually transmitted infections (C. trachomatis) to systemic, septicemic infections (C. psittaci).

25 relatively rare by comparison to C. trachomatis and C. pneumoniae, with fewer than 50

26 cases per year (6). However, C. psittaci presents a substantial threat to the poultry

27 industry, not only economically, but also through the at-risk population of poultry

28 farming workers (11).

29 The first recorded case of psittacosis, or “parrot fever”, occurred in 1879 and was

30 reported in an article titled, “Contribution to the Question of Pneumotyphus” (12, 13). In

31 this report, the Swiss physician Jacob Ritter investigated a minor epidemic of atypical

32 pneumonia that afflicted his family. He detailed the progressive decline in health of the

33 patients and their eventual autopsy. Within his brother’s house, all seven residents

34 became infected, as well as several visitors. Five of the seven initial patients died from

35 the disease. He speculated that the contagion was spread by exposure to either the 12 pet

36 birds in the house or their cages. Thirteen years later in Paris, an outbreak led to a

37 conclusive association between exposure to infected birds and disease in humans (14).

38 Figure 1 – Parrot fever strikes the United States

A. B.

Figure 1. Parrot fever strikes the United States. Psittacosis outbreaks were reported in the news in the late 1920s-1930s. A) Sarasota Times Newspaper. Jan 8th, 1930. B) Lawrence Journal-World. Jan 11, 1930.

39 The celebrated psittacosis ‘pandemic’ of 1929 (Figure 1) occurred after the export

40 of infected parrots from Brazil led to serious illness in unsuspecting purchasers

41 throughout Argentina, Europe, North America, North Africa, and western Pacific

42 countries (15, 16). As recently reported by Jill Lepore in an article in The New Yorker

43 (17), these infected birds were sold from a pet store in Baltimore, Maryland. After the

44 family of the secretary of the Chamber of Commerce of Maryland became ill with a

45 mysterious pneumonia, word quickly reached the U.S. Public Health Service in the

46 nation’s capital. The National Hygienic Laboratory became involved and tracked down

47 the parrots sold at this store. Not only did the individuals who purchased the infected

48 parrots become sick, but so did the researchers studying the disease. Among the infected

49 was Dr. Charles Armstrong, the lead investigator of the psittacosis outbreak, who was

50 treated with serum from a patient who had recovered from the disease. He survived, and

51 the laboratory in which the research was taking place was fumigated with cyanide to

52 prevent others from developing the illness. A few weeks after these drastic steps were

53 taken to prevent the spread of psittacosis, congress expanded the Hygienic Laboratory

54 and increased its funding to create the National Institute of Health (17).

55 At the time, it was assumed that the causative agent of psittacosis was a virus (18-

56 21). It was not until electron microscopy (EM) was used to visualize the organism that

57 Chlamydia was shown to be a bacterium (22). Observations of the similarities between

58 the agent of psittacosis, the microbe responsible for the sexually transmitted infection

59 known as lymphogranuloma venereum (LGV), and a trachoma-causing microorganism

60 eventually led to all three being assigned to the genus Chlamydia within the order

61 Rickettsiales (23). Similarities to the latter included the obligate intracellular life style,

62 resistance to sulfonamides, antibiotic susceptibility, and a common cell envelope antigen.

63 Several species of Chlamydia are of vital veterinary and agricultural importance. C.

64 abortus, the nearest phylogenetic relative to C. psittaci, causes spontaneous abortion in

65 ruminants, such as cattle, sheep, and yaks (24, 25). Exposure to C. abortus infected

66 livestock during pregnancy can result in gestational septicemia and abortion in humans

67 (7, 8). Such cases of zoonotic C. abortus infections of humans are often difficult to

68 diagnose. Conversely, veterinary chlamydiosis involving C. abortus is widespread

69 among wild ruminant populations, infecting up to 18% of Chinese yaks (26). A unifying

70 characteristic of all Chlamydia spp. is their obligate intracellular growth and a biphasic

71 developmental cycle (27-30) (Figure 2). The infectious elementary body (EB) binds to

72 the surface of the host cell and induces its own endocytosis (31-35), whereupon after

73 entry it differentiates into the replicative, non-infectious reticulate body (RB). The RBs

74 replicate inside a membrane-bound vacuole within the cell known as the chlamydial

75 inclusion. The inclusion is comprised of a phospholipid bilayer derived from lipids

76 scavenged and hijacked from the host (36). Inside the inclusion, chlamydiae replicate

77 protected from complement proteins and exogenous antibodies (37). Between 36 to 72

78 hours depending upon the species and strain of Chlamydia, bacteria grow exponentially.

79 Differentiation from RBs into infectious EBs is asynchronous, and the signal that triggers

80 late differentiation remains unclear.

81 Structural characterization of C. psittaci, the causative agent of psittacosis, by

82 immunofluorescence (IF) first revealed the presence of the two distinct developmental

83 forms (38). Using gradient-purification to separate the two developmental forms, RBs

84 were found to be noninfectious, irregular in shape, and moderately electron dense (39).

85 Conversely, purified EBs were infectious, smaller than RBs, often ovoid, and had a

86 highly electron dense nucleoid (40). On the surface of EBs, rosette projections with 3-

87 fold symmetry comprised of 9 “leaflets” extended from the surface as observed by

88 freeze-deep-etching EM (41). In 1981, Akira Matsumoto was able to purify C. psittaci

89 inclusions for EM (42). Freeze-replica EM images showed the projections penetrating

90 the inclusion membrane into the cytosol in both Chlamydia caviae GPIC and C. psittaci

91 Cal10 (28, 42). Matsumoto noted a “direct connection between the reticulate bodies and

92 the inclusion membrane” through projections on the surface of RBs (Figure 3).

93 Figure 2 – The developmental cycle of Chlamydia

Figure 2. The developmental cycle of Chlamydia. Clockwise from top: the infectious EB (dark green) attaches to the surface of the host cell and secrete proteins into the cytosol (orange) to induce endocytosis into the eukaryotic host (nucleus = purple). Upon entry into the host cell, the EB differentiates into the non-infectious RB (green) that replicates inside a membrane- bound vacuole termed the chlamydial inclusion. The RBs multiply in close contact with the inclusion membrane (brown). Upon a signal late in the developmental cycle, the RBs differentiate back into EBs (small arrows). The nascent EBs are internalized by neighboring cells after lysis of the cell/inclusion or after whole inclusion extrusion (not shown).

94 Figure 3 – Matsumoto’s projections

Figure 3. Matsumoto’s projections. HeLa 229 cells infected with C. caviae GPIC (A, B) or C. psittaci Cal10 (C, D) were examined by (A, C) scanning and (B, D) transmission electron microscopy. Matsumoto’s projections (red arrows) are viewed from the cytosolic side of the infected cell extending across the inclusion membrane from underlying RBs (A, C), or in cross-section of an RB bound to the inclusion membrane (B, D) with needle-like structures. In (B, D), the patch of projections delineates the area of contact between the RB and the luminal face of the inclusion membrane. Adapted from Peters et al, 2007 and Matsumoto, 1981.

96 Hypothesis: Matsumoto’s projections represent type III secretion injectisomes that

97 control contact-dependent development

98 In order to establish an infection within a host cell, the chlamydiae use virulence

99 factors to aid in attachment, entry, cytoskeletal remodeling, and nutrient acquisition. To

100 achieve this goal, Chlamydia has evolved a type III secretion (T3S) system (43, 44). The

101 T3S system is a macromolecular syringe found in many Gram-negative bacteria. The

102 T3S injectisome is comprised of multiple proteins that form a complex spanning the inner

103 and outer membranes, as well as the host plasma and/or –in the case of Chlamydia– the

104 inclusion membrane (Figure 4). Based on structural similarity, the T3S complex was

105 proposed (45) to correspond to the projections emanating from the surface of purified

106 EBs previously observed by Matsumoto (Figure 3) (41, 46). Although still not formally

107 demonstrated, this proposal is currently widely accepted (47-50). The 3-fold symmetry

108 of these surface projections is consistent with the ultrastructure of T3S machines in other

109 prokaryotes (51-53). The injectisome complex,composed of ~20-25 individual proteins,

110 is encoded by all Chlamydia genomes (28). The individual proteins that make up the

111 chlamydial T3S were identified based upon homology to T3S components in other

112 bacterial species (43, 54, 55), (56). However, in other prokaryotes the T3S genes are

113 frequently observed clustered together in pathogenicity islands that are readily

114 identifiable due to a substantially different G+C content profile, often indicative of

115 acquisition within the genome by horizontal gene transfer events (57). Chlamydia is

116 unique in that clusters of T3S genes appear dispersed within the genome and have a G+C

117 content similar to the rest of the genome (~40%) (28).

118 Figure 4 – Type III secretion injectisome

Figure 4. Type III secretion injectisome. The protein names in the figure correspond to proteins from Salmonella typhimurium, while their predicted Chlamydia sp. homologs are in parenthesis (Peters et al, 2007, Betts-Hampikian and Fields, 2011). The precise arrangement of chlamydial T3S protein components are presently unknown (designated with a question mark), but investigations into the structural assembly are emerging. The chlamydial T3S spans the inner and outer chlamydial cell membranes, through the host membrane. The host membrane may either be the plasma membrane or the plasma membrane-derived inclusion membrane. Effector proteins are delivered to the T3S machine by chaperone proteins for secretion into the host cell cytosol. Secretion of effectors into the host cell is contact-dependent (Costa et al, 2015). Adapted from Costa et al, 2015.

119 Figure 5 – The Type III secretion-mediated contact-dependent hypothesis for the

120 developmental cycle of Chlamydia

Figure 5. The Type III secretion-mediated contact-dependent hypothesis for the developmental cycle of Chlamydia. Clockwise from top left: Infectious EBs (dark blue) attach to the surface of the host cell and secrete proteins into the cytosol (grey) to induce endocytosis into the host. Upon entry into the eukaryotic host, the EB differentiate into non-infectious RBs (light blue) for replication inside a membrane-bound vacuole termed the chlamydial inclusion. The RBs multiply in close contact with the inclusion membrane. After a signal late in the developmental cycle, the RBs will differentiate back into EBs. The nascent EBs spread to neighboring cells after lysis of the cell/inclusion or after whole inclusion extrusion. At each developmental stage, chlamydiae secrete different subsets of effectors (e.g. TarP and CT694/early, IncA/mid, CopN and SinC/late). Adapted from Wilson et al 2006.

121 The T3S injectisome serves to deliver proteins across the inner and outer bacterial

122 cell wall membranes, through the host plasma membrane, and into the cytosol of the

123 eukaryotic host cell (57). These proteinaceous toxins, termed T3S effectors, accomplish

124 varied and multitudinous tasks, and can vary greatly between species. Given the

125 relatively small size of the chlamydial genome, it is interesting to note that predicted T3S

126 effectors may correspond to ~10-15% of the genome (58).

127 The ubiquitous presence of a T3S in Chlamydia spp. along with Matsumoto’s

128 early observations on the inclusion ultrastructure led to the development of the “T3S-

129 mediated contact-dependent hypothesis” for the intracellular development of Chlamydia

130 (Figure 5) (59). The updated hypothesis (Bavoil, personal communication) illustrates the

131 central role of T3S in chlamydial biology from the early step of internalization to the late

132 differentiation step:

133 1. EB internalization and early intracellular survival requires attachment of T3S

134 injectisomes to cell surface receptor(s) and ‘unloading’ of late-

135 expressed/preloaded and early neosynthesized effectors.

136 2. RB replication requires T3S-mediated contact with the inclusion membrane and

137 delivery of mid-cycle effectors.

138 3. Loss of T3S-mediated contact and/or (coupled) disruption of T3S activity is

139 associated with the signal for commitment to late differentiation.

140 Effector proteins that aid in entry into host cells are transcribed late in

141 development (29), retained within the EBs (60), and are secreted upon attachment of the

142 EBs to the host plasma membrane (60-62). Effectors that assist in invasion disrupt and

143 subvert host processes to allow EBs to gain entry into non-phagocytic cells (63). The

144 translocated actin recruitment protein (TarP) is secreted early in development upon

145 attachment to the host cell membrane (63). In the cytosol, TarP interacts with vinculin to

146 recruit actin to the site of EB attachment (64). TarP vinculin-binding domains appear

147 conserved in C. caviae (65), and may have similar functionality in other Chlamydia spp.

148 During growth, chlamydiae are limited by spatial and geometric constraints

149 within the cell, such as inclusion membrane surface area and inclusion volume (59, 66).

150 RBs replicate in intimate contact with the inclusion membrane through T3S projections

151 (28, 49, 67). The inclusion swells to eventually encompass the majority of the host cell

152 interior. EM images show RBs in contact with the inclusion membrane throughout the

153 developmental cycle. Toward the end of the developmental cycle, RBs detach from the

154 inclusion membrane and accumulate in the inclusion lumen. Asynchronous late

155 differentiation is a common trait among all Chlamydia spp. (28, 29, 68). RB

156 differentiation appears associated with physical detachment from the inclusion membrane

157 (69). Detachment of RBs from the inclusion membrane is coincident with the onset of

158 late differentiation genes (68, 70). An unknown signal, subsequent to physical

159 detachment from the inclusion membrane, triggers detached RBs to differentiate into EBs

160 (70). Sigma factors involved in transcription of late differentiation-associated genes are

161 associated with T3S chaperone proteins (71), suggesting T3S disruption and late

162 differentiation could be linked by the dual roles of chaperone activity and transcription

163 inhibition. Upon lysis of the inclusion, the contents rupture into the extracellular milieu

164 and the infectious EBs go on to infect surrounding cells. Conversely, the whole inclusion

165 can be extruded from the infected cell into the extracellular milieu (72, 73). These

166 extruded, double-membrane inclusions can travel larger distances, such as ascending the

167 urogenital tract or passing through the gastrointestinal system, while disguised from local

168 inflammatory mediators, potentially disseminating to sites distant from that of the initial

169 infection (72, 73).

170 While specific effectors can be conserved between species of Chlamydia,

171 variation among T3S effectors is prevalent. In C. trachomatis, CT694 is an early

172 developmental cycle-associated effector protein that interacts with AHNAK and could be

173 involved with host cell invasion (61). At the same locus in C. psittaci, a gene encodes the

174 T3S effector protein SinC that is produced late in the developmental cycle and targets the

175 host cell inner nuclear envelope (74). Interestingly, both proteins have membrane

176 localization domains, but have different membrane targets within the cell (75). Effector

177 proteins at the inclusion membrane are some of the first and best studied in Chlamydia.

178 These proteins, called Incs, are integral inclusion membrane proteins consisting of an

179 amino-proximal bilobed hydrophobic domain and a carboxy-proximal effector domain

180 extending into the cytosol (Figure 6) (76-78). The C. psittaci ortholog of IncA, first

181 characterized in C. caviae and C. trachomatis (76), will be further investigated in this

182 thesis. The history of research on IncA highlights the progression from a previously

183 genetically intractable pathogen towards fulfillment of the molecular Koch’s postulates

184 (79) for virulence factor confirmation (80, 81). In addition, primary sequence variation

185 of IncA between species hinted at possible different functions of this effector,

186 underscoring the degree of variation among effectors of the Chlamydiaceae.

187

188 Figure 6 – Schematic of Inc protein secondary structure

Figure 6. Schematic of Inc protein secondary structure. The amino terminal portion of Inc proteins contains the putative secretion signal. Immediately following the T3S signal is the bilobed hydrophobic domain unique to all Inc proteins. The bilobed hydrophobic domain anchors the effector protein in the inclusion membrane. The carboxy-terminal effector region of Inc proteins can be varied, facilitating interaction with a variety of protein / lipid substrates within the cytosol of the host cell.

189 Inc proteins are integral inclusion membrane proteins

190 Before the advent of chlamydial genomics in 1998 (44), Ted Hackstadt’s group

191 identified an immunogenic 39 kDa gene product that was reactive with antisera from C.

192 caviae-infected guinea pigs (76). At the time, C. caviae was named C. psittaci strain

193 Guinea Pig Inclusion Conjunctivitis (GPIC) before genomic analysis established it as

194 distinctly separate species from C. psittaci (82). Immunoblots confirmed production of

195 IncA (IncA/Cca) in addition to suggesting post-translational modification of IncA during

196 infection (76, 83). Hydrophobicity analysis detected a bilobed hydrophobic domain

197 toward the amino terminal region of the protein (Figure 7), and immunofluorescence (IF)

198 of C. caviae GPIC inclusions with anti-IncA antibodies localized IncA at the inclusion

199 membrane. IF also showed multiple inclusions (approximately 40 per cell) with IncA-

200 containing fibers extending from the inclusion membrane into the cytosol (76). C. caviae

201 inclusions were noted to be multiple and lobed, as reported the following year by the

202 same authors (84). As IncA is an integral inclusion membrane protein, fluorescent NBD-

203 ceramide was used to track the growing inclusions. It was observed that the lobed

204 morphology is independent of the multiplicity of infection (MOI) with multiple or lobed

205 inclusions observed at very low MOI (0.1 EBs per cell). These authors speculated that

206 multiple inclusions are formed when RBs divide as a result of division of the RB itself.

207 The lipid NBD-ceramide is trafficked to the inclusion, indicating functional connections

208 between the inclusion and ER-Golgi (84-86). The authors propose inclusion interaction

209 with the exocytic pathway based on the NBD-ceramide inclusion localization. Once

210 again, many inclusions with long fibers extending into the cytosol were prevalent (84).

211 Figure 7 – The hydrophobic bilobe is conserved in Inc proteins

Figure 7. The hydrophobic bilobe is conserved in Inc proteins. A characteristic of all Inc proteins is the presence of a bilobed hydrophobic domain. The domain, spanning at least 50 amino acids, is unique in that it lacks a conserved primary amino acid sequence, and is dependent upon the hydrophobic character of the amino acids within the domain. The mechanism of insertion of the Inc proteins directly into the inclusion membrane is unknown. Adapted from Bannantine et al, 2000.

212 Rockey et al then showed that a minimum of two IncA amino acid residues are

213 phosphorylated at unknown positions within the protein, and that IncA appears on the

214 cytosolic face of the inclusion membrane as determined by IF using microinjected anti-

215 IncA antibodies (83). The presence of the hydrophobic bilobe within Inc proteins has

216 become the identifying characteristic of this group of inclusion membrane proteins. After

217 IncA was characterized, genes downstream of incA were observed to be transcribed as an

218 operon and encoding a similar bilobed hydrophobic domain. The encoded gene products

219 were named IncB and IncC, resulting in establishment of chlamydial proteins containing

220 this motif as “Incs” (78). These seminal papers established IncA as a viable marker of

221 the inclusion membrane and provided the initial stimulus for research that continues

222 today.

223 The initial characterization of IncA continued from C. caviae over to C.

224 trachomatis, where an antigenic ortholog (IncA/Ctr) was identified (89). IncA/Ctr also

225 localized to the inclusion membrane and as fibrous extensions of the inclusion membrane

226 into the cytosol. Such IncA fibers in C. trachomatis extend into uninfected neighbor cells

227 as well (89). IncA fibers in C. trachomatis infections colocalize with other Inc proteins

228 during infection, namely IncD, E, F, and G (77). Like in C. caviae-infected cultured

229 cells, IncA fibers of C. trachomatis inclusions were observed extending through and

230 traversing uninfected neighbor cells (89). Shared features, such as inclusion membrane

231 localization and cytosolic inclusion membrane extensions, are apparent between the

232 IncAs of C. trachomatis and C. caviae. Sequence analysis revealed that clinical isolates

233 of C. trachomatis from serovars J, I, D, E, and F carry a mutation in incA that would

234 yield a truncated gene product (90). The isolates appeared to lack the fusogenic inclusion

235 phenotype that was apparent in most other C. trachomatis strains. Inclusions were

236 smaller and multiple, similar to those observed in C. caviae GPIC infections. Hackstadt et

237 al also noted that inclusion fusion occurs soon after IncA/Ctr production and discovered

238 that if anti-IncA/Ctr antibodies were introduced into the host cell during infection by

239 microinjection, C. trachomatis adopts an inclusion configuration similar to that of C.

240 caviae. This finding, coupled with yeast two-hybrid data showing IncA self-association,

241 provided support for IncA mediating inclusion fusion (91).

242

243 Inc proteins are type III secretion substrates

244 As the functional aspects of IncA were beginning to be understood, the question

245 remained as to how IncA was transported into the inclusion membrane. Genetic

246 manipulation of Chlamydia was unavailable; therefore, heterologous T3S assays were

247 employed to answer this question. The eventual answer was gleaned not for C. caviae or

248 C. trachomatis, but for C. pneumoniae with the aid of a heterologous T3S assay based on

249 the T3S machinery of Shigella flexneri and candidate effector fusions with the reporter

250 calmodulin-dependent adenylate cyclase from Bordetella pertussis (92). Using this assay,

251 IncB and IncC were shown to be T3S substrates by detection of the reporter fusions in the

252 supernatant of S. flexneri cultures expressing the chimeric protein fusions. However,

253 initial negative results for IncA led to the construction of chimeric proteins of the amino-

254 terminal region upstream of the bilobed hydrophobic domain fused to the adenylate

255 cyclase reporter. Positive results obtained from the chimeric proteins led to speculation

256 that the Inc proteins might require the aid of T3S chaperones prior to secretion (92).

257 Surrogate systems for T3S effector substrate confirmation used in this study led to the

258 discovery of many characterized chlamydial effector proteins (61, 74, 93-95).

259 Subsequent heterologous T3S assays were refined using genus-optimized effector

260 candidate prediction software and reporter fusions with the first 25 amino acid residues of

261 a candidate T3S effector (96).

262 The initial characterization of IncA containing an amino-proximal bilobed

263 hydrophobic domain and the absence of such a domain within proteins in other

264 prokaryotes (97, 98) led to speculation that this domain could be used as a predictor of

265 inclusion membrane localization. Several additional putative Incs were predicted, based

266 on a bilobed hydrophobic domain spanning at least 50 amino acids (97). Predictions

267 were made not only of C. trachomatis, but of C. caviae and C. pneumoniae as well.

268 Genome analyses predicted 40 Incs in C. trachomatis and 90 in C. pneumoniae.

269 Localization of several putative Incs has been verified by IF of infected cultured cells

270 (97, 99).

271

272 IncA mediates inclusion fusogenicity

273 In most C. trachomatis serovars and strains, cells infected with more than one EB

274 form multiple nascent inclusions that coalesce into a single, fusogenic inclusion during

275 mid-development. Irregular, non-fusogenic inclusions produced by C. trachomatis

276 clinical isolates were observed lacking IncA at the inclusion membrane (102). In many

277 cases, these strains had mutations within incA resulting in truncations.

278 IncA/Cca and IncA/Ctr were transfected into Hela cells (99, 106). Infection of

279 cells simultaneously transfected with the homologous incA genes resulted in aberrant

280 inclusion morphology. Untransfected and incA/Ctr transfected cells were reportedly

281 equally susceptible to C. trachomatis or C. caviae infection (106). This finding

282 contrasted that of a different investigating group that demonstrated that transfected

283 IncA/Ctr disrupts the developmental cycle of C. trachomatis infections (99). Attachment

284 and internalization of EBs was not altered, but developmental arrest at 3 hours post-

285 infection (hpi) was noted. Transfected incA/Ctr lacking the hydrophobic domain

286 localized to the cell cytoplasm and was sufficient to inhibit inclusion growth.

287 Inclusion fusogenicity, while the most readily noticeable phenotype associated

288 with IncA, may only represent one of this protein’s functions. IncA is both localized to

289 the inclusion membrane and to fibers extending out from the inclusion membrane into the

290 cytosol. In C. caviae-infected cells, the cytosolic fibers were shown to be associated with

291 chlamydial lipopolysaccharide (103). C. trachomatis IncA did not display this

292 association. C. caviae and C. trachomatis fibers were even observed extending into or in

293 contact with neighboring uninfected cells. It is speculated that these fibers could provide

294 a mechanism of antigen delivery into proximal host cells. Giles et al examined these

295 IncA-laden everted fibers by EM. These authors discovered that the everted fibers were

296 vesicular, and confirmed the presence of chlamydial antigens within these vesicular

297 structures (104). Later findings by Suchland et al (105) also led to the hypothesis that

298 these fibers could participate in the development of secondary inclusions within the cell.

299 When IncA-specific polyclonal antibodies were subjected to epithelial cells grown on

300 transwell filters to establish polarity, FcRn-mediated transport of the antibodies decreased

301 infection (100). The inclusions appeared non-fusogenic, as was seen previously with

302 microinjection experiments (91). IncA intranasal immunization of mice elicited the most

303 substantial decrease in testicular burden upon urogenital challenge. This protection was

304 completely absent in mice deficient in beta-2 migroglobulin, a known component of

305 FcRn (100). It was observed that non-fusogenic strains had a higher propensity for

306 subclinical disease presentation than fusion-competent chlamydia (101). Variation

307 among strains of C. trachomatis at the incA locus provides interesting insight and

308 speculation into the greater role of this protein during infection of a host. It is likely that

309 mutations in incA, albeit detrimental to infectious progeny (inclusion forming unit; IFU)

310 yield, were propagated within the studied population observed due to their lack of clinical

311 presentation (101). Individuals infected with these subclinical strains would be unaware

312 of infection. This presents an interesting balance in the fate of a chlamydial infection.

313 Indeed a cost in replicative potential and consequent lessened immunopathology in favor

314 of multiple, subclinical rounds of infection may prove advantageous to the organism’s

315 survival in the long term.

316

317 IncA orthologs include SNARE-like motifs

318 Overall, there exists strong evidence for the role of IncA/Ctr in inclusion

319 fusogenicity. IncA is predicted to contain SNARE-like motifs within the predicted coiled

320 coil tertiary structure (99). Eukaryotic SNARE proteins contain motifs that interact with

321 other SNARE proteins to promote vesicle fusion. The SNARE fusion complex is

322 composed of alpha helical coiled coils that run parallel to each other and “zipper” the two

323 membranes into close proximity (114). In a zipper-like motion, SNARE motifs fuse

324 vesicles together (Figure 8). The unzipping of the SNARE complex is dependent upon

325 mechanical force, which is accomplished by a sliding action of the multimeric complex

326 (117). As SNARE proteins generate force, they aid in overcoming that aforementioned

327 energetic barrier to vesicle fusion. This force has been measured using magnetic tweezer

328 experiments and found to be ~34 pN (118). From here, the IncA orthologs containing

329 SNARE-like domains have direct mechanical capabilities for modification of membranes.

330 There exists evidence of a SNARE protein having both membrane fusion activity and

331 membrane curvature induction (119), assisting vesicle fusion by minimizing the area of

332 force distribution. The SNARE protein synaptotagmin bends membranes in a Ca2+

333 dependent manner, and fusion activity is promoted with the addition of N-BAR proteins

334 that directly induce membrane curvature through electrostatic interaction. Membrane

335 bending activity is more prevalent in liposomes of higher diameter, suggesting flat

336 membranes are preferentially bent.

337

338 Figure 8 – Model for IncA SNARE complex structure formation during membrane fusion

Figure 8. Model for IncA SNARE complex structure formation during membrane fusion. (A) v-SNAREs (VAMPs) and t-SNAREs (IncA) are separate. (B) Complex formation begins via association of the N-terminal regions of the individual SNARE proteins forming the half-zippered state {Gao:2012gu, Min:2013kr}. This association includes the ionic (0) layer. (C) A second intermediate state has been postulated {Gao:2012gu}, here called the partially unzipped state. (D) SNARE complex assembly and fusion complete. Here, the SNARE complex is drawn to reflect the conformation as observed in the crystal structure of the neuronal SNAREs {Sutton:1998cw}. Adapted from Bombardier and Munson, 2015.

339 Formation of the SNARE fusion complex requires SNARE-SNARE interactions.

340 When coincubated with a crosslinker, IncA was found to form complexes in both C.

341 trachomatis and C. caviae-infected cells. IncA displayed homomultimerization activity

342 in these experiments. This led to utilization of tertiary and quaternary structure

343 predictions. Modeled IncA tetramers resemble eukaryotic SNARE complexes. These

344 coiled coil residues have predicted SNARE motifs within them that are present in all

345 IncA orthologs except that of C. pneumoniae, an organism that produces non-fusogenic

346 inclusions (107). The predicted coiled coil motifs within IncA/Ctr do not resemble the

347 SNARE protein synaptotagmin, which contains predominantly beta sheets and alpha

348 helices (111), but appear more like the functionally similar VAMPs. The alpha helical

349 nature of the protein was confirmed by circular dichroism. Edman degradation revealed a

350 consistent IncA fragment of ~17kDa that was protected from cleavage. This same

351 fragment when ectopically expressed during infection prevented fusion of inclusions.

352 The IncA core fragment forms a stable dimer, and this core region was able to

353 recapitulate the fusogenic inclusion phenotype in addition to facilitating liposome fusion

354 interaction with VAMP8 (112). Proteins containing an R-SNARE motif, namely Vamp4,

355 7, and 8, were also recruited to the C. trachomatis inclusion (108). Not all R-SNAREs

356 were recruited, however. Interaction was shown between IncA/Ctr and a subset of

357 Vamps by in vitro pulldown assays (108), suggesting a mechanism for eukaryotic vesicle

358 fusion in addition to inclusion fusion activity of IncA. However, SNARE activity relies

359 on formation of stable lipid microdomains replete with cholesterol and sphingolipids. It

360 has been shown previously that IncA plays a role in NBD-ceramide acquisition in the

361 inclusion membrane, and is known to co-fractionate with lipid droplets within the

362 inclusion (115). Further, exposure of C. trachomatis infected cells to 25 μM myriocin

363 ablates the fusogenic inclusion phenotype (116).

364 Recent advances in the genetic manipulation of Chlamydia have allowed targeted

365 mutagenesis of incA. Since incA is non-essential for chlamydial growth, and since incA

366 mutations are associated with a distinct visual phenotype, incA became an ideal candidate

367 for genetic analysis. IncA was inactivated by site-specific introns and the resultant incA-

368 deficient Chlamydia displayed non-fusogenic inclusions (80). The non-fusogenic

369 phenotype was ablated upon complementation with the plasmid shuttle vector containing

370 the incA gene (112). SNARE-like activity of IncA/Ctr has been well documented and

371 mapped back to a 17kDa region within the IncA core (112).

372 While inclusion fusion is a known phenotype associated with IncA/Ctr, inhibitory

373 SNARE activity was also observed for IncA/Ctr. Paumet et al (109) observed that

374 IncA/Ctr encodes one fusogenic and one inhibitory SNARE domain each. Liposome

375 fusion assays were performed with donor and acceptor liposomes containing SNARE

376 proteins (VAMPs) or IncA. Fusion inhibition was observed when VAMP liposomes

377 were combined with IncA. Following up on these findings, liposomes were reconstituted

378 with IncA, t-SNARE, or v-SNARE and subjected to additional fusion assays. Fusion, as

379 was observed in previous experiments by Paumet et al (109), was measured by a decrease

380 in fluorescence. When t-SNARE and v-SNARE liposomes were incubated in the

381 presence of a third liposome containing IncA, no inhibition of fusion was observed. A

382 slight decrease in fusion was detected when IncA was reconstituted on liposomes with t-

383 SNARE proteins. Much higher inhibition occurred when IncA liposomes were co-

384 incubated with the v-SNARE liposomes. Ronzone and Paumet also sought to determine

385 which domains of IncA contribute to fusion inhibition (110). The first 34 amino acids

386 did not prevent inhibition of fusion. A truncated IncA/Ctr recombinant protein consisting

387 of the first 34 amino acid tail region, the transmembrane domain, and the amino terminal

388 SNARE-like motif was tested for fusion inhibition. This construct still elicited a slight

389 decrease in fusion that was ablated after mutagenesis of key residues. A full length IncA

390 with the same residues mutated elicited a fusion inhibition rate similar to that of wild type

391 IncA shown earlier (110). Paumet et al speculated that inhibitory SNARE-like domains

392 could play a role in prevention of fusion with lysosomes (109). The presence of

393 inhibitory SNARE activity may also support other functions within the cell. The

394 inhibitory nature of SNARE-like activity could be related to avoidance of endolysosomal

395 fusion. As endosomes traffic along microtubules toward the MTOC, decoration of the

396 inclusion membrane with IncA could serve to prevent lysosomal-specific SNAREs from

397 overcoming the necessary energetic barrier for the fusion of two membranes.

398 When multiple C. trachomatis inclusions occupy a single cell, the inclusions migrate

399 toward and cluster around the microtubule organizing center (MTOC) (113). Video

400 recordings of C. trachomatis infections with EB1-GFP transfected beforehand show

401 multiple inclusions fusing to form a single fusogenic inclusion at around 11.5 hpi.

402 Nocodazole was used to disrupt microtubules and inhibit trafficking, but inclusion fusion

403 was not completely abolished. This suggests that fusion is not solely dependent on

404 microtubules, but they may play a role in collecting nascent inclusions in close proximity.

405 As expected, the motor protein dynein plays a role in inclusion fusion. Microinjection of

406 anti-dynein into infected cells inhibited inclusion fusion, possibly through the same

407 mechanism as nocodazole treatment. Interestingly, neuroblastoma cells have multiple

408 centrosomes, and infection of these cells by C. trachomatis results in delayed

409 fusogenicity of inclusions (113). Richards et al speculated that for inclusion fusion by

410 IncA to occur, the inclusions must be brought into very close proximity, and this is

411 facilitated by microtubule trafficking of vesicles to the MTOC (113). The presence of two

412 SNARE-like motifs that provide inhibitory SNARE activity by themselves raises

413 questions as to how IncA utilizes both domains for inclusion fusion. Ronzone et al

414 speculated that a conformational change within IncA and the existence of stable

415 homodimers could result in differential activity (112). To answer this question in more

416 exacting detail, a solved structure of IncA will be necessary. Given the stability of the

417 IncA-core, this could be achieved in the near future.

418 Joanne Engel and her collaborators characterized the global Inc protein

419 interactome in humans with the aid of large-scale affinity purification mass spectrometry

420 (AP-MS) (122). AP-MS involves separation of affinity captured interacting proteins

421 from the infected cell lysate for purification and identification by mass spectrometry.

422 Interacting partners are purified from the lysate by coimmunoprecipitation or pulldown

423 methods. Multiple proteins within the host cell were found associated with specific Inc

424 proteins. Included among these processes are actin cytoskeleton rearrangement, vesicle

425 transport, organelle interaction (lysosome, mitochondria, ER, and Golgi), cell cycle /

426 division, antigen processing, immune responses, and apoptosis. Interaction between IncA

427 and VAMPs was not observed as previously reported (108), which the authors speculated

428 may be due to the propensity of this assay for false negatives. The observed Inc-laden

429 everted fibers extending from the inclusion membrane into the cytosol described

430 previously were IncE-dependent. A major finding from this study was the reported

431 interaction with IncE and sorting nexin retromer complexes. The authors speculate that

432 the retromers could contribute to recognition and clearance of the intracellular pathogen

433 or promote Golgi fragmentation for lipid acquisition.

434 The role of retromers during C. trachomatis infection is further bolstered by

435 complimentary data from Dagmar Heuer and colleagues (123). They purified whole

436 intact inclusions for proteomics analysis by liquid chromatography-tandem mass

437 spectrometry (LC-MS/MS). C. trachomatis inclusions are enriched with sorting nexin

438 retromer components. Sorting nexins 1, 2, 5, and 6 colocalize with IncA by IF,

439 confirming their recruitment to the inclusion membrane during infection (123). These

440 data, along with the Inc interactome data, provide strong support for the inclusion

441 membrane acting as a matrix for hijacking intracellular vesicular trafficking.

442 From the perspective of the host, IncA is highly immunoreactive (120). While

443 not protective in and of themselves, IncA-specific IgG antibodies have been shown to

444 reduce infectious burden in vitro and in vivo (100). IncA localization on the cell surface

445 has not been documented in the literature, so antibodies must either enter the infected cell

446 or interact with extracellular extruded inclusions (121) in order to encounter this

447 inclusion membrane protein. FcRn-mediated transcytosis could overcome and

448 accomplish this feat, as was shown by Armitage et al (100). Pinocytosis of antibodies

449 would allow for acidic conditions necessary for binding to FcRn, but without more

450 information as to how chlamydiae subvert and redirect endosomal trafficking, only

451 speculation can be made at this point on if / how IncA antibodies encounter the inclusion.

452 Molecular characterization of the endocytic pathway leading to α-IncA internalization

453 could be accomplished by genetic knockdown or knockout of protein mediators of

454 pinocytosis.

455 This dissertation will examine the C. psittaci inclusion configuration within the

456 context of IncA. Contrasts between inclusion morphologies of C. trachomatis and C.

457 psittaci are investigated in Chapter 3 using a combination of transmission electron

458 microscopy and fluorescence microscopy techniques, with IncA marking the inclusion

459 membrane. After highlighting the apparent contrast in inclusion geometries, Chapter 4

460 will examine a C. psittaci-specific Inc protein with membrane sculpting activity that

461 could contribute to the lobed, invaginated inclusion membrane morphology associated

462 with C. psittaci inclusions. Taken together, I will attempt to show that the inclusion

463 configuration itself is a virulence factor of Chlamydia, highlighting the importance of the

464 contact-dependent hypothesis of chlamydial development.

465 Chapter 2. Materials and Methods

466

467 Cell and Chlamydia culture

468 C. psittaci strain Cal10 and C. trachomatis serovar E strain E/11023 seeds were

2 469 grown in HeLa 229 cells in 150 mm culture-treated dishes at 37°C with 5% CO2 in 10

470 mL Dulbecco’s modified Eagles medium (DMEM, Mediatech, Herndon, VA)

471 supplemented with 10 % heat-inactivated fetal bovine serum (FBS) (Atlanta Biologicals,

472 Lawrenceville, GA). Cells were infected with an inoculum comprised of the respective

473 species diluted to an MOI of 1 in 1 mL SPG (0.25 M sucrose, 10 mM sodium phosphate,

474 5 mM L-glutamic acid). The inoculum was added to confluent monolayers of cells for 2

475 h at 25°C with rocking before removal and replacement with fresh growth media

476 (DMEM/FBS/glutamate).

477

478 Generation of α-IncA polyclonal antiserum

479 The incA ortholog from C. psittaci strain Cal10 was amplified from genomic

480 DNA using primers with engineered restriction enzyme sites for NdeI and BamHI

481 (CpsIncA_BamHI_f and CpsIncA_EcoRI_R; Table 2) for insertion into the pET30a

482 cloning vector. Full-length recombinant IncA/Cps with a poly-His tag was generated

483 after expression in BL21 E. coli. At an OD600 of 0.8 - 1.0, expression was induced with 1

484 mM IPTG for 7 hours at 37°C. French press was used to lyse the cells, and IncA/Cps

485 was purified from the resulting cell lysate on Ni-NTA agarose resin in a buffer of 50 mM

486 NaH2PO4, 300 mM NaCl, pH 8.0. IncA/Cps-specific polyclonal antiserum was generated

487 in guinea pigs. The guinea pigs were immunized and subsequently boosted with purified

488 full length IncA/Cps. Antisera was harvested as previously described (96) and was

489 shown to react specifically with a protein band at ~42 kDa, corresponding to the

490 predicted molecular weight of IncA/Cps by Western blot. C. psittaci-infected cell lysates

491 collected throughout the developmental cycle were harvested in

492 radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitor

493 cocktails (Complete Mini, Roche, Indianapolis, IN). SDS-PAGE was performed using

494 12.5% gels (Bio-Rad, Hercules, CA) and transferred to polyvinylidene difluoride (PVDF)

495 membranes (GE Healthcare Life Sciences, Little Chalfont, UK). Membranes were

496 blocked overnight with 3% milk in PBS with 0.1% Tween 20 (PBS-T) before exposure to

497 the α-IncA polyclonal antisera or rabbit α-MOMP primary antibodies for 1 hour at room

498 temperature (1:500 dilution). Membranes were washed 5x with PBS-T before addition of

499 goat α-guinea pig or goat α-rabbit secondary IgG antibodies with a conjugated reporter

500 (horseradish peroxidase, 1:300,000 dilution) in PBS-T with 3% milk. Blots were

501 visualized directly by fluorescence or using Supersignal West Femto substrate (Thermo

502 Scientific, Waltham, MA) on the Typhoon 9400 imager (Amersham Biosciences, Little

503 Chalfont, UK) or exposure to film (Hyblot CL; Denville Scientific Inc, South Plainfield,

504 NJ). The resulting α-IncA/Cps-specific signal corresponded to both the predicted

505 molecular weight and the molecular weight from the recombinant IncA/Cps alone.

506

507 Recombinant IncA protein expression and purification

508 Orthologs of incA were amplified by PCR of the gene fragment encoding the

509 carboxy-terminal effector region past the bilobed hydrophobic domain from C. psittaci

510 Cal10 and C. trachomatis for cloning into the pET-19b expression vector with primers

511 engineered with for NdeI and BamHI (primers Cps_incA2_pET19b_f /

512 Cps_incA_pET19b_r and CtE_incA_Cterm_f/r, respectively; Table 2). Point mutagenesis

513 of the incA/Cps sequence for the R155G mutation was performed by two PCR reactions

514 (primers Cps_incA2_pET19b_f / Cps_incA_pET19b_r and IncA_Mid_f/r). The

515 amplified products were cloned into the multiple cloning sites to generate the pET19b-

516 IncACps_cterm-His, pET19b-IncACtr_cterm-His, and pET19b-IncACps_cterm_R155G-

517 His expression vectors. Recombinant IncA orthologs were expressed in BL21 E. coli

518 with an amino-terminal poly-His tag in LB media at 37°C. The cultures were induced

519 with 300 mM IPTG at an OD600 of 0.8-1.0 for 7 hours. Lysates were buffered with 50

520 mM NaH2PO4, 300 mM NaCl, pH 8.0 and were purified on Ni-NTA agarose columns.

521 Fractions containing purified recombinant IncA proteins were concentrated by spin

522 concentrators (Millipore, Billerica, MA) and stored at -80°C. Concentrations were

523 determined by Bradford assay. Purified endophilin was kindly provided by Ted

524 Baumgart and Zhiming Chen (University of Pennsylvania, Pennsylvania, PA).

525

526 Liposome preparation

527 Synthetic lipids were used for all liposome preparations (Avanti, Alabaster, AL).

528 For IncA, liposomes were prepared from 75% 1,2-dioleoyl-sn-glycero-3-phosphoserine

529 (DOPS) and 25% 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) in

530 chloroform. 5% w/v cholesterol was added to the phospholipid solution, and the mixture

531 was dried under nitrogen gas. For endophilin, liposomes were prepared from a lipid

532 mixture of 30% DOPS, 30% DOPE, 35% 1,2-dioleoyl-sn-glycero-3-phosphocholine

533 (DOPC), and 5% phosphatidylinositol (4,5)-bisphosphate (PIP2). After drying, both lipid

534 films were frozen at -80°C then lyophilized overnight. The lipid films were rehydrated

535 using a buffer of 50 mM NaH2PO4, 300 mM NaCl, pH 8.0. At this step, two different

536 methods for unilamellar vesicle production were used: 1) after vortexing vigorously, the

537 liposome mixture composed of DOPS, DOPE, and cholesterol was sonicated for 10

538 minutes to produce unilamellar vesicles (124), or 2) DOPS, DOPE, DOPC, and PIP2

539 liposomes were produced by extrusion through polycarbonate membranes with a pore

540 size of 400 nm (Avanti, Alabaster, AL) (125).

541

542 In vitro tubule formation

543 Proteins and liposome suspensions were equilibrated to room temperature before

544 reactions. The in vitro tubulation experiments were performed with liposomes at a

545 concentration of 0.25 mg/ml incubated with purified proteins at 0.25 mg/ml (1:1 ratio) for

546 30 minutes at room temperature. The reactions were screened with 1% uranyl acetate

547 negative staining. The samples were viewed in a FEI Tecnai T12 electron microscope

548 (FEI, Hillsboro, OR) at an operating voltage of 80 kV. Digital images were acquired

549 using an AMT bottom mount CCD camera and AMT600 software (Advanced

550 Microscopy Techniques, Woburn, MA).

551

552 IncA ortholog prediction

553 IncA orthologs were aligned by clustalO (126-128) or MAFFT (129) using the

554 BLOSUM62 matrix. Hydrophobicity plots were generated using the Kyte and Doolittle

555 algorithm (130) in ExPASy ProtScale (131). Hidden Markov Model analysis was

556 performed by HMMER2.0 [v2.3.2] (132). Manual curation of alignments along the

557 conserved predicted SNARE-like motifs and midpoint rooting of the resultant

558 dendrogram was performed in Mesquite (133). The curated alignments from Mesquite

559 were used to determine convergent and divergent amino acid positions within the IncA

560 orthologs. Alignments generated were subjected to RAxML (134) for protein sequences

561 with maximum likelihood search. The resulting trees were visualized by FigTree (135).

562 The solved structures of full length and the SNX-BAR domain of human sorting nexin 9

563 (PDB ID: 3DYU)(136) were visualized in C3nD. Protein structure predictions of the full

564 length and SNX-BAR-like domain of C. psittaci IncA were generated using I-TASSER

565 (137-139).

566

567 Transfection

568 PCR products of full length IncA orthologs from C. psittaci Cal10, C.

569 trachomatis, and C. abortus were amplified from genomic DNA with engineered

570 restriction sites corresponding to EcoRI and XmaI at the ends (pCAGGS_incA/Cps_f/r,

571 pCAGGS_incA/Ctr_f/r, and pCAGGS_incA/Cab_f/r; Table 2). The PCR products were

572 cloned into the pCAGGS-GFP mammalian transfection vector to generate pCAGGS-

573 incA/Cps-GFP, pCAGGS-incA/Ctr-GFP, and pCAGGS-incA/Cab-GFP plasmids. For

574 localization experiments, HEK293 cells were grown on glass coverslips in 24-well tissue

575 culture plates and transfected 24 hours post seeding with 500 ng of either pCAGGS-incA

576 constructs in 200 µL OPTI-MEM and 2 µL Lipofectamine LTX reagent (Life

577 Technologies), incubated for 24 hours at 37°C, and fixed with 4% paraformaldehyde.

578 Stably transfected HEK293 cells for use in the BioID analysis (for BioID, see below)

579 were transfected as before, but with the HEK293 cells growing in culture dishes (150

580 mm2) and with the Lipofectamine LTX reagent reaction proportionally scaled to

581 accommodate the increased culture dish volume. After a 48 hour incubation at 37°C, the

582 transfected cells were placed under 500 µg/mL G418 selection for a minimum of two

583 weeks while refreshing the growth medium every two days. Stable IncA::myc::BirA

584 construct expression was monitored by indirect immunofluorescence as indicated (74).

585

586 Purification of biotinylated proteins for mass spectrometry

587 A PCR product of full length incA/Cps was amplified from C. psittaci Cal10

588 genomic DNA with engineered terminal KpnI and AflII restriction sites (primer set

589 BirAIncAFusion_F_Kpn1 and BirAIncAFusion_R_AflII; Table 2) and cloned into the

590 multiple cloning site of plasmid pcDNA3.1 mycBioID as previously described (74). The

591 plasmid was kindly provided by Kyle Roux (Sanford Research Center, Sioux Falls, SD).

592 The resultant plasmid encoded IncA/Cps amino-terminally fused to myc and the biotin

593 ligase BirA (IncA/Cps::myc::BirA). HEK293 cells stably expressing

594 IncA/Cps::myc::BirA or myc::BirA were incubated in complete medium supplemented

595 with 50 µM exogenous biotin. Cells from five dishes per transfection reaction were

596 washed three times with PBS, lysed in 5 mL lysis buffer [50 mM Tris, 500 mM NaCl,

597 0.4% SDS, 5mM EDTA, 1 mM DTT, pH 7.4, and 1x complete protease inhibitor cocktail

598 (Roche, Basel, Switzerland)], and sonicated to disrupt the cells until homogenous. A

599 final concentration of 2% Triton X-100 was added to the homogenates before additional

600 sonication for 10 seconds. Equal volumes of 50 mM Tris, pH 7.4 at 4°C were added to

601 the lysates, resonicated for 10 additional seconds, and were centrifuged for 20 min at

602 16,000 x g. The supernatants were incubated overnight with rocking at room temperature

603 with 500 µL Dynabeads (MyOne Streptavidin C1, Life Technologies, Carlsbad, CA).

604 Beads were collected, washed, and prepared for mass spectrometry analysis as described

605 previously (74). Nano-LC-MS analysis of proteins bound to beads was performed as

606 described previously (74).

607

608 Immunofluorescence

609 HeLa cell monolayers infected at an MOI of 1-2 with either C. psittaci Cal10 or

610 C. trachomatis serovar E grown on 10 mm diameter glass coverslips (Ted Pella Inc,

611 Redding, CA) in 48-well plates (Cellstar; Sigma-Aldrich, St. Louis, MO) were washed

612 with PBS and fixed with 4% paraformaldehyde or methanol as indicated. For myriocin

613 (LKT Laboratories Inc, St. Paul, MN) experiments, specific concentrations of the

614 inhibitor (or DMSO vehicle control) were added to infected cells in growth media at 1

615 hour post infection. For nocodazole (Cell Signaling Technology, Danvers, MA)

616 experiments, the inhibitor was added 4 hours prior to fixation of the infected cells. Fixed

617 cells were washed and permeablized with PBS containing 1 mg/mL bovine serum

618 albumin (BSA) and 0.1% Triton X-100. Infections were labeled with guinea pig α-

619 IncA/Cps (as above), rabbit α-IncA/Ctr (Dan Rockey), monoclonal mouse α-EF-Tu (Y.-

620 X. Zhang, Boston University), and visualized with α-mouse Alexa fluor 488, or α-guinea

621 pig Alexa fluor 488 (Life Technologies, Carlsbad, CA). Infections were counterstained

622 with DAPI to visualize DNA. For inclusion fluorescence densitometry experiments,

623 inclusions from C. psittaci and C. trachomatis-infected HeLa cells with and without 25

624 uM myriocin were labeled with monoclonal anti-EF-Tu and Alexa 488-conjugated goat

625 anti-mouse IgG antibodies as above at 16 hpi.

626

627 Transmission electron microscopy contour analysis

628 For ultrastructural analysis, infected cells were washed with PBS, fixed with 4%

629 paraformaldehyde, 2.5% glutaraldehyde, in 0.1 M phosphate buffer (pH 7.2) at 16 hpi for

630 one hour. After fixation, cells were washed, scraped off the plate, pelleted and

631 subsequently enrobed in 2.5% low melting agarose. Agarose blocks containing cells were

632 trimmed into 1mm3 size, post-fixed with 1% osmium tetroxide, and en-bloc stained with

633 1% uranyl acetate. Specimens were then washed and dehydrated using 30%, 50%, 70%,

634 90%, and 100% ethanol in series, 10 minutes each. This was followed by two more 100%

635 ethanol washes and infiltration with increasing concentration of Spurr resin (Electron

636 Microscopy Sciences, Hatfield, PA). After two exchanges of pure resin, specimens were

637 embedded in Spurr resin and polymerized at 60°C overnight. Silver colored (~70nm)

638 ultrathin sections were cut and collected using a Leica UC6 ultramicrotome (Leica

639 Microsystems, Inc., Bannockburn, IL), counterstained with uranyl acetate and lead, and

640 examined in a transmission electron microscope (Tecnai T12, FEI, Hillsboro, OR)

641 operated at 80 kV. Digital images were acquired using an AMT bottom mount CCD

642 camera and AMT600 software (Advanced Microscopy Techniques, Woburn, MA).

643 Inclusions observed in electron micrographs were traced and analyzed for circularity

퐴푟𝑒푎 644 (Circularity = 4휋 ) and angularity in ImageJ. 푃𝑒푟푖푚𝑒푡𝑒푟2

645

646 Infectivity time course

647 Cell culture dishes (150 mm2) with confluent monolayers of HeLa cells were

648 infected at an MOI of 1 with C. psittaci strain Cal10 as above. Myriocin (25 μM) was

649 added at 1 hpi. Infected cells were harvested at designated times post infection as

650 described previously. Infectious progeny were stored in 2SP buffer at -80°C. To

651 determine resulting infectivity of the resultant EBs harvested, confluent monolayers

652 grown on 10 mm diameter glass coverslips in 48-well plates were infected with serial

653 dilutions of recovered EBs grown with or without 25 μM myriocin from each time point

654 tested. Inclusions were labeled with rabbit α-MOMP and visualized with Alexa fluor

655 594-conjugated goat α-rabbit IgG secondary antibody. The cells were photographed and

656 counted on a Zeiss Axio Imager Z.1 fluorescence microscope. The experiment was

657 performed in triplicate.

658

659 Pre-embedding immunogold labeling

660 Cells grown on coverslips were fixed in 4% paraformaldehyde in phosphate

661 buffer for 1 hour. After fixation, cells were permeabilized with 0.1% triton X-100,

662 quenched with 100 mM glycine in phosphate buffer, and blocked in phosphate buffer

663 containing 1% BSA and 1% fish gelatin for 30 min. Cells were incubated with specific

664 antibody at optimum dilution at 37°C for 1 hour, washed three times with phosphate

665 buffer containing 0.1% BSA and 1% fish gelatin, and incubated with corresponding

666 secondary antibodies conjugated with 1.4 nm gold for 1 hour. After washing, cells were

667 fixed again with a fixative containing 2% glutaraldehyde for 30 min, quenched with 100

668 mM glycine, washed three times with deionized water, and incubated with a gold

669 enhancement solution to enlarge the gold size to ~ 10-15 nm. Cells were washed again

670 and post stained with 1% osmium reduced with 1.5% potassium ferrocyanide, followed

671 by en bloc staining with 1% uranyl acetate. After serial dehydration in ethanol,

672 specimens were embedded in Spur’s resin. Silver colored (~70 nm) ultrathin sections

673 were cut and collected using a Leica UC6 ultramicrotome (Leica Microsystems, Inc.,

674 Bannockburn, IL), counterstained with uranyl acetate and lead, and examined in a

675 transmission electron microscope (Tecnai T12, FEI) operated at 80 kV. Digital images

676 were acquired using an AMT bottom mount CCD camera and AMT600 software

677 (Advanced Microscopy Techniques, MA).

678

679

680 Table 2 – Primer list

GGGATCTTGC

GTTTGCAGATAC

ATGACATCACCAGTAGAATCTGCTACAAG

CTGTTCATATATTGGGAAGCCTTGATCATC

CTTTATCTACAGAAAACCGCTAATCTACATCTAT

AAACAACAACTTCATCAATTTAGCCAAG

ACATCACCAGTAGAATCTGCTACAAG

ATGACATCACCAGTAGAATCTGCTACAAG

GGAGCTTTTTGTAGAGGGTGATGC

CTAGGAGCTTTTTGTAGAGGGTGATGC

TTACTGTTCATATATTGGGAAGCCTTGATC

ATGACATCACCAGTAGAATCTGGTAC

TTACTGTTCATATATTGGGAAGCCTTGATCAT

ATGACAACGCCTACTCTAATCGTG

acc

TTACTGTTCATATATTGGGAAGCCTTGATC

cccggg

cttaag

ggtacc

cccggg

gaattc

ggatcc

catATG

ggatcc

catATG

gaattc

ggatcc

cgat

atcg

cgat

atcg

cTTA

atcg

gcat

cgat

GCAAGATCCC

GTATCTGCAAAC

atgc

gcat

atgc

gtac

Primer Sequence 5' 3' -> *,** Sequence Primer

Afl

Kpn

I_F

/Ctr_r

/Ctr_f

/Cps_r

/Cps_f

I_R

incA

2_pET19b_F

_pET19b_r

_pET19b_f

_Cterm_r

_Cterm_f

EcoR

BamH

incA

BirAIncAFusion_R_

BirAIncAFusion_F_

pCAGGS_

CtE_

IncA_Mid_r

IncA_Mid_f

Cps_

CpsIncA_

Primer name Primer

Mutations underlined Mutations

Engineered restriction sites in bold sites in restriction Engineered

** = = **

* = = *

lowercasenucleotides Added =

pCDNA3.1-BirA-IncACps

pCAGGS-IncACtr-GFP

pCAGGS-IncACps-GFP

pET19b-IncACtr_cterm-His

pET19b-IncACps_cterm_R155G-His

pET19b-IncACps_cterm-His

pET19b-IncACps_full-His

pET30a-IncACps_full-His

Construct Table 2. Primers. 2. Table

681 Chapter 3. Chlamydia psittaci inclusion morphology supports contact-dependent

682 development

683

684 Introduction

685 Upon attachment and entry into the eukaryotic host cell, chlamydiae differentiate

686 from the infectious elementary body (EB) into the metabolically active, non-infectious

687 reticulate body (RB). At this phase in the developmental cycle, the RB begins replication

688 and the number of type III secretion (T3S) injectisomes protruding from the chlamydial

689 cell wall into the inclusion membrane increases (60). According to the contact-dependent,

690 T3S-mediated hypothesis of chlamydial development, the developmental status of a

691 chlamydia is dependent on its injectisome-mediated contact with the inclusion

692 membrane, such that RBs that are attached to the inclusion membrane are replicating

693 while those that are detached --and therefore non-type III secreting-- are committed to

694 late differentiation into infectious EBs. Although this model was derived in part from

695 ultrastructural observations of C. psittaci CAL10 (59), it is most consistent with

696 observations of growing C. trachomatis inclusions (140, 141). Surprisingly however, the

697 model appears inconsistent with the C. psittaci (Cps) inclusion configuration, where

698 apparently actively replicating RBs are observed in the lumen of the inclusion, i.e.

699 apparently out of contact with the inclusion membrane (142). In this chapter, I test the

700 hypothesis that these luminally replicating RBs are actually in contact with luminal folds

701 or invaginations of the inclusion membrane.

702

703 Results

704

705 The Chlamydia psittaci CAL10 inclusion membrane is irregularly shaped and

706 uniquely extends into the inclusion lumen

707 To investigate whether replicating C. psittaci RBs could remain in close

708 proximity to the inclusion membrane via membrane invaginations extending into the

709 inclusion lumen, we compared growing C. psittaci and C. trachomatis inclusions by

710 three-dimensional reconstruction of indirect immunofluorescence (IF) confocal images,

711 using polyclonal antibodies specific for the well-characterized inclusion protein IncA of

712 C. trachomatis (IncA/Ctr, CT119, NCBI accession no. NP_219622) or for the ORF573-

713 encoded IncA ortholog of C. psittaci CAL10 (IncA/Cps, ORF G5Q_0573 of C. psittaci

714 reference genome; (143)). Confocal IF images of C. trachomatis inclusions showed

715 discontinuous, patchy IncA/Ctr staining of the rounded inclusion membrane and no

716 detectable staining of the chlamydiae within the inclusion (Figure 9A, Supplemental

717 video 1), consistent with previous observations (89) and suggesting that IncA/Ctr is

718 rapidly translocated from the chlamydial cytoplasm to the inclusion membrane. In

719 contrast, IncA/Cps-specific staining localized not only to similar patchy segments of the

720 inclusion membrane, but also to the lumen of the inclusion as multiple similar short

721 patches (Figure 9B, Supplemental video 2). Progression through the z-stack images also

722 suggested that luminal IncA/Cps staining was continuous with the inclusion membrane as

723 the observed patches were often contiguous to or aligned with the inclusion membrane

724 (Figure 9C). IncA/Cps-specific luminal staining did not colocalize with EF-Tu of C.

725 psittaci (Figure 9C) indicating that although IncA/Cps is made in chlamydiae, at 24 hpi

726 most of the protein is rapidly concentrated in the inclusion membrane and to multiple

727 discrete inclusion membrane-like locations within the inclusion lumen that are distinct

728 from the replicating chlamydiae. Everted IncA tubules or fibers were observed extending

729 from the inclusion membrane into the host cytosol (Figure 9C), similar to previous

730 observations in C. trachomatis (89) and C. caviae (83). These results are consistent with

731 the hypothesis that the C. psittaci inclusion membrane is remodeled into folds and/or

732 fibers/tubules that extend both into the inclusion lumen host cytosol, and the transluminal

733 IncA/Cps signal is potentially proximal to or contacting RBs that appear to be replicating

734 in the lumen of the inclusion. To confirm that luminal IncA signal is separate from RBs,

735 I examined C. psittaci inclusions at 24 hpi with immunogold labeling of IncA/Cps. With

736 pre-embedding immunogold labeling, the nanogold-conjugated secondary antibodies

737 undergo a gold enhancement reaction to increase the size of the antigen-specific signal.

738 The gold enhancement reaction can nucleate background antigens, resulting in small,

739 nonspecific electron-dense particles. While these nonspecific, electron-dense particles

740 are observed throughout the inclusion and host cell, well-defined larger IncA/Cps-

741 specific nanogold particles were observed at the inclusion membrane and between

742 luminal RBs (Figure 10). Moreover, IncA/Cps-specific staining was observed to

743 colocalize with ultrastructure resembling stacked membrane bilayers (Figure 10, inset).

744

745 Figure 9 – Detection of IncA/Cps in the inclusion lumen

Figure 9. Detection of IncA/Cps in the inclusion lumen Confocal images (A, B, and C) (Zeiss LSM 510 Meta Confocal Microscope) of the inclusion membrane staining of α-IncA for both (A) C. trachomatis serovar E and (B) C. psittaci strain Cal10 illustrate the differences in inclusion configurations. C. trachomatis inclusions are rounded with an absence of luminal IncA staining, whereas C. psittaci inclusions display a lobed, irregular inclusion morphology with frequent luminal IncA staining. Scale = 5 μm. Luminal IncA/Cps staining does not colocalize with the chlamydial marker EF-Tu (C), showing α-IncA/Cps labels discrete structures in the C. psittaci inclusion lumen separate from the replicating chlamydiae. α- IncA/Cps also labeled everted inclusion membrane tubules (white arrows), consistent with previous observations in C. trachomatis {Bannantine:1998wy} and C. caviae {Rockey:1997ve}. Scale = 10 μm.

746 Figure 10 – Immunogold labeling of IncA/Cps

Figure 10. Immunogold labeling of IncA/Cps. α-IncA/Cps immunogold labeling localizes between luminally replicating RBs. Nanogold particles (white arrows) can be observed both between RBs and at the inclusion membrane (black arrowheads). Scale = 500 nm, with 300 nm inset.

747 Inhibition of host sphingolipid biosynthesis changes the C. psittaci inclusion

748 configuration

749 We reasoned that if the observed inclusion membrane folds and candidate

750 inclusion membrane tubules indeed represent ‘overgrowth’ of the inclusion membrane

751 into the inclusion lumen rather than IncA-positive lipid vesicles, then blocking the

752 growth of the inclusion membrane might reduce or ablate their production. For this we

753 used myriocin, an inhibitor of the biosynthesis of sphingolipids previously shown to be

754 required for inclusion and chlamydial growth. Robertson et al (116) previously

755 demonstrated that myriocin caused the production of small inclusions in C. trachomatis-

756 infected cells that were associated with a shortened developmental cycle and concomitant

757 decrease in infectious progeny yield. C. trachomatis-infected (24hpi) and C. psittaci-

758 infected HeLa cells (18 hpi) with or without continuous exposure to myriocin were

759 observed by antibody-independent transmission electron microscopy (TEM) and by

760 indirect IF using IncA/Cps-specific antibodies.

761 While TEM confirmed the irregular, invaginated inclusion membrane

762 configuration of growing C. psittaci inclusions already observed by indirect IF (Figure

763 11A), exposure to myriocin caused the C. psittaci inclusions to become rounded with a

764 simultaneous loss of all the inclusion membrane invaginations (Figure 11B). The

765 inclusion configuration adopted by C. psittaci inclusions at 18 hpi was similar to those of

766 C. trachomatis inclusions at 24 hpi (Figure 11C). Analysis of inclusion angularity and

767 circularity in ImageJ confirmed the resemblance of C. trachomatis inclusions to those of

768 C. psittaci exposed to myriocin (Figure 11D). The impact of myriocin on C. psittaci

769 inclusion configuration occurred in a dose-dependent manner with the maximum impact

770 on inclusion shape and inclusion membrane luminal extensions observed at 25 μM

771 myriocin (Figures 12A and 12B). This myriocin concentration was previously used by

772 Beatty et al (116) for C. trachomatis and is used in all subsequent C. psittaci experiments

773 in this study. Transluminal IncA/Cps signal also decreased with increasing

774 concentrations of myriocin (Figure 12B), supporting the hypothesis that the transluminal

775 IncA/Cps structures are continuous with the inclusion membrane. Overall, TEM and IF

776 results strongly support that the IncA/Cps-specific luminal staining observed by IF

777 corresponds to contiguous extensions of the inclusion membrane into the inclusion

778 lumen.

779 Figure 11 – The growing C. psittaci inclusion is irregularly shaped

Figure 11. The growing C. psittaci inclusion is irregularly shaped. Mid-cycle (18 hpi) C. psittaci inclusions in HeLa cells under (A) normal culture conditions or (B) the presence of myriocin were compared with (C) growing C. trachomatis inclusions (24 hpi) by TEM. The IM and putative luminal IM- contiguous extensions of reduced opacity similar to that of the cytoplasm are marked with solid and dashed yellow lines respectively; scale = 500nm. (D) Inclusion angularity and circularity were computed in ImageJ from IM solid line tracings in 10 whole inclusion images of C. psittaci (blue), C. psittaci + myriocin (orange), and C. trachomatis (gray). Angularity represents a measurement of IM fold degrees with 180 degrees representing the maximal tangential deviation from 퐴푟𝑒푎 a perfect circle, while circularity of an inclusion is equal to 4휋 with a 푃𝑒푟푖푚𝑒푡𝑒푟2 value of one denoting a perfect circle.

780 Figure 12A – Myriocin induces inclusion roundness in a dose-dependent manner

DMSO

0.1 µM myriocin

1.0 µM myriocin

10 µM myriocin

25 µM myriocin

Figure 12A. Myriocin induces inclusion roundness in a dose-dependent manner. IF of C. psittaci inclusions at 24 hpi. Top to bottom: without myriocin exposure, DMSO control, 0.1 μM, 1.0 μM, 10 μM, and 25 μM myriocin. Inclusions were labeled with α- MOMP (red – left column) and α-IncA (green – middle column). Epifluorescence images (Zeiss Axio Imager Z.1 with Apotome.2 module) indicate inclusion roundness and loss of luminal staining increases with increasing concentrations of myriocin. Scale = 20 μm.

781 Figure 12B – Myriocin induces inclusion roundness in a dose-dependent manner

Figure 12B. Myriocin induces inclusion roundness in a dose- dependent manner. Frequencies of rounded inclusions with minimal luminal IncA signal were calculated as a proportion of the total number of inclusions observed in the Epifluorescence IF images from Figure 12A. p < .001, Student’s t-test.

782 Inclusion fusion is dependent on host sphingolipid

783 For most Chlamydia spp., multiple nascent inclusions that are formed in one cell

784 upon internalization of multiple EBs may fuse at mid-cycle to form a single large

785 inclusion that occupies most of the host cell cytoplasm late in development. In view of

786 the impact of myriocin biosynthesis inhibition on C. psittaci inclusion configuration at

787 mid cycle, we next investigated whether inclusions exposed to myriocin would still fuse

788 late in development. At the early developmental times of 4 and 8 hpi, newly internalized

789 EBs and nascent inclusions were observed evenly distributed across the monolayer

790 irrespective of exposure to myriocin (Figure 13A). In C. psittaci cultures without

791 myriocin, clusters of relatively small fusogenic inclusions began to appear at 12 hpi in

792 each infected cell and grew to form single, large inclusions at the later times of 18, 24,

793 and 30 hpi (Figure 13A). In C. psittaci cultures exposed to myriocin, small non-fusogenic

794 rounded inclusions began to appear at 12 hpi, and although these grew in size with time,

795 they remained as clusters of non-coalescent inclusions at the later developmental times of

796 18 and 24 hpi. At 30 hpi, these inclusions appeared to lyse within infected cells.

797 Measurements of recovered infectious progeny along developmental time reveal a 2-3 log

798 decrease in IFUs at the late times of 30, 36, and 48 hpi (Figure 13B). In C. trachomatis,

799 inclusions in both the presence and absence of 25 μM myriocin maintained the same

800 rounded inclusion morphology throughout the developmental cycle (Figure 14).

801 Notwithstanding the differential impact of myriocin on C. psittaci and C. trachomatis

802 inclusion configuration, these results are consistent with the observed impact of myriocin

803 on C. trachomatis development (116).

804 Figure 13A – Myriocin exposed C. psittaci inclusions are rounded, non-fusogenic, and

805 lyse early

test, test,

s t s

’

3 were were 3

forming units from the representative units from representative the forming

fusogenic, and fusogenic, early. lyse

ncrease in IFU under normal culture in under normal culture ncrease IFU

M myriocin infected 2 MOI an at infected of myriocin M

opment, the onset of late differentiation, and toward the end of the the of the end toward and differentiation, opment,late of onset the

inclusions are rounded, non rounded, are inclusions

M myriocin sharply increase in IFU but plateau at 24 hpi. 24 increase in plateau but at Student IFU sharply myriocin M

M myriocin show a continual i continual show a myriocin M

devel

. Scale = 10µm. (B) Recoverable inclusion Recoverable 10µm. (B) = Scale .

C.psittaci

Tu and imaged by epifluorescence (Zeiss Axio Imager Z.1). Respective times post infection were times post were Respective Axioinfection Z.1). Imager by (Zeiss epifluorescence and imaged Tu

infected cells exposure without and with 25 to Hela infected

+myriocin

Brightfield

C.psittaci

Figure 13A. Myriocin exposed Figure (A) with labeled early mid represent to infection, chosen for cycle developmental time and with over without 25 intervals exposed 25 to conditions, infections while 0.001. < p

806 Figure 13B – Myriocin exposed C. psittaci inclusions are rounded, non-fusogenic, and 807 lyse early

B *** *** *** ***

Figure 13B. Myriocin exposed C. psittaci inclusions are rounded, non- fusogenic, and lyse early. (A) C. psittaci-infected Hela cells with and without exposure to 25 μM myriocin infected at an MOI of 2-3 were labeled with α-EF-Tu and imaged by epifluorescence (Zeiss Axio Imager Z.1). Respective times post infection were chosen to represent early infection, mid-development, the onset of late differentiation, and toward the end of the developmental cycle for C. psittaci. Scale = 10µm. (B) Recoverable inclusion-forming units from the representative intervals over time with and without 25 μM myriocin show a continual increase in IFU under normal culture conditions, while infections exposed to 25 μM myriocin sharply increase in IFU but plateau at 24 hpi. Student’s t-test, p < 0.001.

808 Figure 14 – The shape of C. trachomatis inclusions is unaffected by exposure to myriocin

(Zeiss Axio Imager Z.1) AxioImager (Zeiss

, inclusions observed by epifluorencence by inclusions , observed

inclusions is unaffected by exposure to to myriocin. by exposure is unaffected inclusions

C.trachomatis

C. trachomatis C.trachomatis

inclusion shape is consistent with previously observations (Robertson et al, 2009). Scale = 10µm. Scale = 2009). al, et observations consistent is (Robertson previously with inclusionshape

d without 25 µM myriocin displayed a similar rounded inclusion morphology. The impact of myriocin on on impact myriocin of The inclusion morphology. displayed similar rounded a myriocin without d µM 25

+myriocin

Brightfield

Figure 14. Theshape of 14. Figure developmental of the cycle Throughout an with trachomatis

809 Method of fixation affects luminal IncA/Cps signal

810 Since it was observed that the luminal IncA/Cps signal was sensitive to myriocin

811 and therefore continuous with the inclusion membrane, we hypothesized that the method

812 of fixation (methanol vs. 4% paraformaldehyde) would impact luminal IncA/Cps

813 staining. Methanol is known to disrupt protein-lipid interactions and protein tertiary

814 structure. Fixation of inclusions at 24 hpi with methanol resulted in diminished, but still

815 present signal within the inclusion lumen in the absence of myriocin (Figure 15A).

816 Inclusions fixed with 4% paraformaldehyde displayed the IncA/Cps luminal staining

817 (Figure 15B) pattern consistent with earlier observations (e.g., Figures 9C and 11).

818 Everted IncA/Cps tubules were not observed with methanol fixation (Figure 15A). In the

819 4% paraformaldehyde-fixed infections, everted tubules were observed extending from the

820 inclusion membrane into the host cytosol (Figure 15B).

821 Figure 15 – Methanol fixation diminishes luminal IncA/Cps signal

Methanol

4% PFA

Figure 15. Methanol fixation diminishes luminal IncA/Cps signal. Inclusions at 24 hpi were fixed with either (A) methanol or (B) 4% PFA under normal culture conditions. Inclusions were labeled with α-IncA/Cps and visualized by epifluorescence (Zeiss Axio Imager Z.1 and Apotome.2 module). In methanol fixed inclusions (A), α-IncA/Cps staining appeared more punctate within the inclusion lumen and everted IncA/Cps-laden tubule extensions were disrupted. In the 4% PFA fixed inclusions (B), α-IncA/Cps signal is prevalent throughout the inclusion lumen. IncA signal can be seen as apparent tubule extensions of the IM (white arrows). Scale = 10 µm.

822 Discussion

823 The chlamydial inclusion is a complex intracellular niche comprised of

824 chlamydial proteins, host proteins, and lipids (86, 122, 123). Upon endocytosis into the

825 eukaryotic host cell, the inclusion serves as shelter preventing detection of pathogen

826 associated molecular patterns (e.g. lipopolysaccharide and peptidoglycan) from pattern

827 recognition receptors (e.g. toll-like receptors)and provides a platform for host-pathogen

828 interaction (144, 145). Chlamydia modify the inclusion membrane through T3S effectors

829 that aid in lipid acquisition (36, 115, 116), organelle interaction (85, 87), vesicle

830 trafficking to the inclusion (110, 113, 146), and retromer association (122, 123). RBs

831 form a host-pathogen synapse through T3S-mediated interaction with the inclusion

832 membrane (49). The C. psittaci inclusion configuration, replete with membrane folds

833 and/or tubules, provides a mechanism for luminally replicating RBs to maintain T3S-

834 mediated contact with the inclusion membrane.

835 IncA is frequently used as a marker of the chlamydial inclusion membrane (89,

836 147). IncA/Cps-specific signal was observed in the lumen of C. psittaci inclusions by

837 both IF and immunogold labeling and did not colocalize with Elongation Factor Tu (EF-

838 Tu), a marker of the replicating chlamydial RB. Independently, the luminal IF IncA/Cps

839 signal could be interpreted as either IncA-positive lipid vesicles within the inclusion or as

840 lipid structures continuous with the inclusion membrane. By IF, IncA/Cps fluorescent

841 signal appears punctate in cross-sections of inclusions. Conversely, 3D reconstructions

842 of inclusions show the IncA/Cps signal as apparent folds and putative tubules within the

843 inclusion that can be seen traversing the luminal space. Similar IncA/Ctr staining of C.

844 trachomatis inclusions was absent. Further, transmission electron microscopy images

845 revealed transluminal inclusion membrane folds in C. psittaci inclusions that are absent

846 in inclusions of C. trachomatis. The rounded inclusion phenotype of C. trachomatis was

847 recapitulated during C. psittaci infection of HeLa cells by inhibition of de novo host

848 sphingolipid biosynthesis with myriocin. Reduced lipid acquisition by the inclusion

849 membrane from the host cell resulted in smaller, rounded inclusions devoid of luminal

850 folds and transluminal IncA/Cps localization. Together, these data support the assertion

851 that transluminal signal of IncA/Cps is continuous with the inclusion membrane.

852 However, membranes are dynamic fluid structures, and the IF images and electron

853 micrographs only allow a snapshot of the inclusion at one time. The IncA-laden folds

854 and/or tubules of the C. psittaci inclusion membrane could be dynamic structures,

855 extending and retracting in response to unidentified stimuli. Similar membrane

856 perturbations have been observed in conjunction with eukaryotic, endosomal curvature-

857 inducing BAR domain proteins (148, 149). The observed differences in inclusion

858 configuration between C. trachomatis and C. psittaci suggest the presence of a species-

859 specific mechanism that influences the C. psittaci inclusion architecture. In the following

860 chapter, I will investigate a potential means for C. psittaci to directly alter its inclusion

861 membrane through membrane sculpting capabilities.

862 I propose that the putative IncA/Cps-laden inclusion membrane structures provide

863 a means of connecting luminally replicating RBs with the inclusion membrane, such that

864 T3S effectors may still be discharged from the luminally replicating RBs into the host

865 cell cytosol. If C. psittaci does exhibit contact-dependent growth via luminal extensions

866 of the inclusion membrane, then the available inclusion membrane surface area

867 occupiable by replicating RBs would increase accordingly. Thus, within a single

868 developmental cycle (approximately 48 hours), the C. psittaci inclusion configuration

869 may allow for higher recoverable IFU yield per inclusion compared to that of C.

870 trachomatis which produces well rounded inclusions. Myriocin was shown to ablate

871 transluminal inclusion membrane structures, and by extension, limited available inclusion

872 membrane surface area. The developmental cycle of C. psittaci was shortened from 48 to

873 approximately 30 hpi in the presence of myriocin, and a consequent 2-3 log decrease in

874 recoverable IFU yield from a single developmental cycle was observed. The impact of

875 available inclusion membrane surface area on EB yield in conjunction with demonstrated

876 transluminal inclusion membrane structures supports contact-dependent growth of C.

877 psittaci. In the context of an infection, i.e. multiple cells at multiple sites over 7-14 days,

878 the higher yield of infectious EBs would be greatly amplified for C. psittaci relative to C.

879 trachomatis. The relatively elevated recoverable infectious progeny from a single

880 primary infection could contribute to the differences in disease pathology and severity

881 observed in C. trachomatis and C. psittaci. Unlike C. trachomatis, C. psittaci infection

882 can disseminate systemically and can be fatal in humans. While higher infectious

883 progeny generation can be advantageous to C. psittaci over the course of infection within

884 a single host, fatal systemic psittacosis could preempt human-to-human transmission.

885 Although C. psittaci is highly infectious from infected birds to humans, person-to-person

886 transmission of C. psittaci has rarely been observed (6, 150, 151). Conversely, 50-70%

887 of women infected with C. trachomatis are asymptomatic and can unknowingly spread

888 the infection to others (152). While the different inclusion configurations of C. psittaci

889 and C. trachomatis do not completely explain the discrepancies in transmissibility and

890 infectivity, the inclusion morphologies highlight different evolutionary strategies for

891 propagation within the Chlamydiaceae.

892 Chapter 4. The inclusion membrane protein IncA of Chlamydia psittaci contains a

893 functional prokaryotic BAR domain acquired by convergent evolution

894

895 Introduction

896 Despite comprising 7-10% of the chlamydial genome (153), Inc proteins are

897 species-specific and are often similar only in the secondary structure of the bilobed

898 hydrophobic domain (97, 153). Chlamydia spp. encode up to 107 Incs that are type III-

899 secreted into the host-derived inclusion membrane where they interact with host proteins

900 (153). IncA/Ctr has orthologs with a conserved sequence in all Chlamydia spp. and was

901 reported to significantly contribute to inclusion membrane modification through SNARE-

902 like motifs by facilitating coalescence of multiple, smaller inclusions into a single,

903 fusogenic inclusion (81, 108). In the previous chapter, I demonstrated that the C. psittaci

904 inclusion membrane contains both everted tubules and inverted folds and/or

905 tubular/vesicular structures. This finding contrasts the inclusion configuration of C.

906 trachomatis, where only everted inclusion membrane structures are present. In C.

907 trachomatis, everted tubules are associated with sorting nexin Bin/Amphiphysin/Rvs

908 (BAR) domain proteins (122, 123). BAR domains sense/induce membrane curvature in

909 eukaryotic cells through electrostatic interactions between positively charged amino acids

910 and negatively charged lipids. Sorting nexin BAR (SNX-BAR) proteins facilitate

911 formation of retromer complexes that mediate transmembrane protein recycling and

912 endosomal targeting to the lysosome or trans-Golgi (148). The BAR proteins directly

913 form protrusions, invaginations, and tubules of phospholipid membranes independent of

914 other factors (182). The unexpected impact of sphingolipid biosynthesis inhibition on

915 inclusion shape and fusogenicity, as well as ablation of transluminal inclusion membrane

916 structures hinted at a possible role of inclusion membrane proteins in inclusion

917 remodeling. Therefore, I hypothesize that (an) Inc protein(s) specific to C. psittaci

918 contribute to the differences observed between the inclusion membrane architectures of

919 C. psittaci and C. trachomatis.

920

921

922 Results

923

924 The inclusion membrane protein IncA of C. psittaci contains a predicted, uniquely

925 evolved BAR-like domain

926 Although several relatively weak paralogs of incA exist within the C. psittaci

927 CAL10 genome, the IncA/Cps ortholog previously used as a marker of the C. psittaci

928 inclusion membrane in IF experiments from Chapter 3 is encoded by a segment of the C.

929 psittaci CAL10 genome with local genomic similarity to the locus of the C. trachomatis

930 genome that encodes IncA/Ctr (Figure 17A). Similar to IncA/Ctr, IncA/Cps was

931 confirmed to include an amino-proximal prototypic Inc family hydrophobic bilobe, as

932 well as predicted SNARE-like motifs (Figure 17B). However, IncA/Cps and IncA/Ctr

933 were also structurally different with primary sequences only 12.5% identical and

934 respective predicted molecular weights of 41.7 and 30.3 kDa. IncA/Cps is 382 amino

935 acids in length with a 49 residue bilobed hydrophobic domain spanning amino acids 68-

936 117. IncA/Ctr is 282 amino acids in length with a 49 amino acid bilobed hydrophobic

937 domain spanning amino acids 35-84. The amino-terminal region before the bilobed

938 hydrophobic domain in IncA/Cps is nearly double the length of the corresponding region

939 in IncA/Ctr, but the length of the bilobed hydrophobic domain is conserved. The two

940 proteins also diverge in theoretical pI. ExPASy ProtParam predicts IncA/Cps has a pI of

941 5.26 and IncA/Ctr is at 7.70. Moreover, a tertiary structure domain search revealed the

942 presence of a predicted membrane remodeling BAR-like domain (E-value: 8.15e-06)

943 overlapping the SNARE motifs in IncA/Cps that was not detected in IncA/Ctr (Figure

944 17B) and was most closely related to SNX-BAR of eukaryotic sorting nexins by

945 sequence homology. The predicted SNX-BAR region starts at the methionine at amino

946 acid 129 and is predicted to continue past 283 with an estimated endpoint beyond the

947 amino acid at position 283. The 200 amino acid incA family protein region, consisting of

948 the bilobed hydrophobic domain and putative SNARE-like motifs, overlaps the predicted

949 SNX-BAR-like domain region from the serine at position 60 up to the leucine at position

950 260 (E-value = 1.71e-25). ClustalO alignment of IncA/Cps with the SNX-BAR

951 consensus sequence detailed 42 fully conserved amino acid positions and an overall

952 homology of 21.1% (Figure 18). MAFFT alignment yielded 22.8% homology and 49

953 conserved amino acid positions (Figure 19), but gaps were more prevalent within the

954 alignment to maximize the number of homologous amino acids. In either case, overall

955 homology between IncA/Cps and the SNX-BAR consensus sequence was greater than

956 the homology between IncA/Cps and IncA/Ctr (21.1-22.8% vs. 12.5%, respectively).

957

958 Figure 17 – The C. psittaci IncA ortholog contains a predicted BAR doman

Figure 17. The C. psittaci IncA ortholog contains a predicted BAR domain. The genetic locus containing incA from C. trachomatis (IncA/Ctr, CT119, NCBI accession no. NP_219622) and the ORF573-encoded IncA ortholog of C. psittaci Cal10 (IncA/Cps, ORF G5Q_0573 of C. psittaci reference genome; {Grinblat:2011wm}) have 12.5% homology between them (A) despite their locus of genomic similarity. The locus corresponding to the two proteins have open reading frames immediately upstream with comparatively higher homology (>70%). The hyydrophobicity plots of IncA/Ctr and IncA/Cps (B) show the bilobed hydrophobic domain with the predicted IncA (blue) and BAR superfamily (red) conserved domains below each. Orange dashes within the IncA domain represent SNARE-like domain residues, with the red dash as the zero ionic layer.

959 Figure 18 – ClustalO alignment of the IncA/Cps SNX-BAR-like domain with the SNX- 960 BAR consensus sequence

Figure 18. ClustalO alignment of the IncA/Cps SNX-BAR-like domain with the SNX-BAR domain consensus sequence. Full length IncA/Cps was aligned with the SNX-BAR domain consensus sequence (cd07596) by Clustal O(1.2.1). The aligned sequences were 21.1% homologous, with 42 fully conserved amino acid positions spanning the 382 amino acid IncA/Cps protein (. = weakly similar, : = strongly similar, * = fully conserved).

961 Figure 19 - MAFFT alignment of the IncA/Cps SNX-BAR-like domain with the SNX- 962 BAR consensus sequence

Figure 19. MAFFT alignment of the IncA/Cps SNX-BAR-like domain with the SNX-BAR domain consensus sequence Full length IncA/Cps was aligned with the SNX-BAR domain consensus sequence (cd07596) by MAFFT (v7.215). The aligned sequences were 22.8% homologous, with 49 fully conserved amino acid positions spanning the 382 amino acid IncA/Cps protein (. = weakly similar, : = strongly similar, * = fully conserved).

963 IncA/Cps BAR-like domain was acquired by convergent evolution

964 Proteins such as the chlamydial histones (154) have acquired eukaryotic-like

965 function and structure by convergent evolution. The presence of a predicted BAR domain

966 in a Chlamydia species immediately raised the question of its origin. The likely answer to

967 this question was gleaned upon further examination of the IncA orthologs from

968 representative genomes of available Chlamydia spp. Hidden Markov Model analysis of

969 the IncA polypeptide predicted the SNX-BAR-like domain in C. psittaci with the highest

970 confidence (Table 3). IncA orthologs from representative species and strains were

971 aligned by MAFFT, then manually curated to align the predicted SNARE-like motifs

972 present within most of the orthologs (Figure 20). The SNX-BAR consensus sequence

973 was then mapped to IncA/Cps based on the alignment generated by RPS-BLAST. The

974 amino acids within the IncA orthologs that aligned to the SNX-BAR consensus sequence

975 were determined relative to their position within the IncA alignment (Figure 21).

976 Comparative amino acid sequence analysis across the Chlamydia genus revealed a

977 patchwork of conserved and divergent positions among the 151 consensus residues

978 distributed along the 204 residue SNX-BAR sequence in different species when aligned

979 relative to the putative SNARE-like domains (Figure 21). IncA/Cps contained the

980 highest number of conserved SNX-BAR amino acids, so the divergent and convergent

981 SNX-BAR amino acids were mapped relative to the IncA/Cps BAR domain sequence

982 (Figure 22). In support of the results of the HMM (Table 3), the close phylogenetic

983 relatives C. trachomatis, C. suis, and C. muridarum contained the lowest number of

984 conserved SNX-BAR residues (5, 6, and 6, respectively) while C. psittaci Cal10

985 demonstrated the most (30) within this alignment. All other species had subsets of

986 conserved SNX-BAR residues that differed between species.

987

988 Table 3 – Hidden Markov Model analysis of IncA orthologs for BAR domain prediction 989

Table 3. HMM analysis of IncA orthologs for BAR domain prediction. An HMM for the BAR domain predicted in IncA/Cps was generated to predict the prevalence of a similar predicted SNX-BAR-like domains within the IncA orthologs of other species of Chlamydiacea. The strains / serovars chosen were representative strains of each sequenced Chlamydia spp., and the identifier column is used to map each Chlamydia spp. to the location on the phylogenetic tree in Figure 21.

990 Figure 20 – Alignment of IncA orthologs reveals overlap between SNARE-like domains

991 and the IncA/Cps SNX-BAR-like domain residues

like domains domains like

the IncA/CpsSNX the

like domains are like are domains

ut was was ut the in included

like domains and likedomains

like domains are detailed while are domains like red, in

ual curation aligning the SNARE predicted curation aligning ual

erlap between SNARE between erlap

layer amino acid residues of the SNARE the of acid layerresidues amino

terminal bilobed hydrophobic domain is not shown above, b bilobed is domain shown not terminal above, hydrophobic

. Amino acids corresponding to overlap in both in SNARE and overlap to corresponding BAR acids Amino .

e. The zero The e.

like domain amino acid residues were conserved in most in conserved residues like exception the with were species, acid amino domain of

C.pecorum

and and

like domain residues. likedomain

(dark blue) in Mesquite revealed specific key amino acids homologous to the BAR consensus sequence (green) were were (green) sequence consensus the to BAR homologous amino key acids specific revealed Mesquite in blue) (dark Figure 20. Alignment of IncA orthologs reveals o reveals orthologs Alignmentof IncA 20. Figure BAR subsequent man and MAFFT by orthologs of IncA Alignment amino The in present IncA/Cps. SNARE alignment. pneumoniae blu light in annotated are the with consensus acids amino in shown BAR overlap yellow.

992 Figure 21 – Alignment of IncA orthologs with the SNX-BAR consensus sequence

Figure 21. Alignment of IncA orthologs with the SNX-BAR consensus sequence. Alignment of IncA/Cps with the SNX-BAR consensus sequence from RPS-BLAST (SNXBAR_consensus) was combined with the IncA ortholog alignment generated by MAFFT after manual curation in Mesquite. The resultant alignment was visualized by BOXSHADE (3.3.1) to show degree of conservation of SNX-BAR residues within the IncA orthologs.

993 Figure 22 – BAR domain amino acids are most conserved in the IncA from C. psittaci 994 strain Cal10

Figure 22. BAR domain amino acids are most conserved in the IncA from C. psittaci strain Cal10. Convergent BAR domain amino acid positions were mapped to the alignment of IncA orthologs by MAFFT. Sequence variation was present between strains of C. psittaci, while greater variance occurred between species. Cal10 (psittaci-1) contained 30 BAR consensus amino acids. NJ1 (psittaci-2) exhibited variation at position 282 consistent with M56 (psittaci-3), but M56 also lacked diverged from the BAR consensus amino acids at 163 and 171. C. psittaci strain 842334 (psittaci-4) also lacked the 163 and 171 conservation, as well as the valine at 159, but retained the alanine at 282. C. suis, C. muridarum, and C. trachomatis displayed minimal BAR consensus conservation, and have the overall lowest homology to C. psittaci Cal10 IncA.

995 The alignment of IncA orthologs (Figure 20) was used to generate a phylogeny.

996 Midpoint rooting of the phylogenetic tree generated from the alignment in RAxML

997 shows distinctly separate evolutionary lineages of IncA/Ctr and IncA/Cps (Figure 23)

998 that are consistent with results obtained from 16S rRNA phylogenetic trees (155) and the

999 midpoint rooted MOMP phylogeny (Figure 24). In the C. psittaci IncA clade, IncA/Cps

1000 is closest to a consensus SNX-BAR domain with 30 of the SNX-BAR consensus residues

1001 being conserved. IncA/Cps of three other strains, C. psittaci NJ1, M56, and 84-2334, and

1002 C. abortus S26/3 differ from C. psittaci Cal10 IncA by 1, 3, 2, and 3 residues,

1003 respectively. As phylogenetic distance increases, more divergence from the SNX-BAR

1004 consensus is observed. It is noticeable however that the larger subsets of SNX-BAR

1005 consensus residues that are lost with phylogenetic distance differ between each species

1006 (Figure 23). IncA/Ctr, along with its orthologs in C. suis and C. muridarum, clusters

1007 furthest away from the SNX-BAR-like domain-containing IncA/Cps. C. pecorum, cand.

1008 C. ibidis, and C. pneumoniae formed distinctly separate lineages. C. pneumoniae IncA,

1009 which is not predicted to contain the SNARE-like motifs (Figure 20) has minimal

1010 accumulation of SNX-BAR-specific residues. Likewise, C. pecorum IncA is missing the

1011 zero ionic layer residue central to SNARE domain function in the region corresponding

1012 to the amino-proximal SNARE-like motif (Figure 20) and is also relatively deficient in

1013 BAR-specific residues. Frequency of IncA from other Chlamydia spp. containing SNX-

1014 BAR domain amino acids increases considerably within the former “Chlamydophila”

1015 clade (82). From this, we tentatively conclude that the SNX-BAR-like domain of

1016 IncA/Cps, as well as IncA of closely related species, has evolved from an incA ancestral

1017 gene to mimic SNX-BAR structure by a process of convergent evolution.

1018 Figure 23 – Dendrogram of IncA alignment supports convergent evolution of the IncA 1019 BAR domain

Figure 23. Dendrogram of IncA alignment supports convergent evolution of the IncA BAR domain. After alignment by MAFFT and midpoint rooting in Mesquite, RAxML was used to generate a dendrogram of the phylogenetic relationship between IncA proteins. BAR domain consensus amino acids are mapped to branches of the dendrogram corresponding to their estimated emergence (green dashes). Tip labels correspond to the HMM labels in Table 3. The bootstrap support values are labeled at each node. IncA proteins cluster into five specific groups. C. trachomatis, C. muridarum, and C. suis form a clade comprised of a minimal amount of BAR domain amino acids, while the former ‘Chlamydophila’ group show a gradual accumulation of homologous SNX-BAR domain amino acid residues. C. ibidis forms its own clade, and has slightly higher SNX-BAR domain consensus homology than the C. trachomatis clade while predicted to contain both SNARE-like domains. C. pneumoniae strains do not have conserved predicted SNARE-like domains and form their own clade, and the clade of C. pecorum strains are predicted to contain only the C-terminal SNARE-like domain (Figure 20). Scale represents mean number of nucleotide substitutions per site on each respective branch.

1020 Figure 24 – Evolutionary phylogeny of MOMP within the Chlamydiaceae

Figure 24. Evolutionary phylogeny of MOMP within the Chlamydiaceae. After alignment by MAFFT, RAxML was used to generate a midpoint rooted phylogeny of the evolutionary relationship between MOMP proteins. The resulting dendrogram is consistent with the 16S rRNA phylogenetic tree (Sachse et al, 2015). The bootstrap support values are labeled at each node. Scale represents mean number of nucleotide substitutions per site on each respective branch.

1021 The IncA/Cps predicted tertiary structure consists of coiled-coils

1022 To strengthen the sequence-based similarity data, two independent tertiary

1023 structure prediction analyses were performed on the full length and carboxy-terminal

1024 SNX-BAR-like domain containing sequences of IncA/Cps. The IncA/Cps predicted

1025 structures were compared to the previously solved structure of human sorting nexin 9

1026 (SNX9) (PDB ID: 3DYU) of both the full length (Figure 25A) and BAR domain-only

1027 (Figure 25B). The full length SNX9 structure contains an amino-terminal PX domain

1028 (Figure 25A), a domain implicated in phosphoinositide binding (156). IncA/Cps has an

1029 amino-terminal hydrophobic bilobe for anchoring the effector protein into the inclusion

1030 membrane (Figures 17B). The I-TASSER platform was used to predict the structure of

1031 full-length IncA/Cps, including the amino-terminal secretion signal and bilobed

1032 hydrophobic domain (Figure 22C), and the BAR-like domain-containing region alone

1033 (Figure 22D). The bilobed hydrophobic domain was revealed as antiparallel alpha

1034 helices, while the effector domain containing the putative SNX-BAR-like domain and

1035 predicted SNARE-like motifs were coiled-coils, consistent with solved structures of

1036 several BAR proteins (157). The prediction analysis performed verified that the coiled-

1037 coil tertiary structure was conserved in the absence of the bilobed hydrophobic domain.

1038

1039 The IncA/Cps BAR-like domain induces membrane tubulation with low frequency

1040 BAR domains are dynamic instruments of membrane curvature induction through

1041 electrostatic interactions between positively charged amino acids and negatively charged

1042 phospholipid membranes. The canonical test for BAR domain activity is the in vitro

1043 tubule formation assay (IVTF). In this assay, purified BAR domain proteins are

1044 incubated with liposomes of a specific composition and visualized by negative staining

1045 transmission electron microscopy. A His-tagged recombinant form of IncA/Cps lacking

1046 the bilobed hydrophobic domain (amino acids 1 to 128) was generated and purified

1047 (Figure 26A). The C-terminal fragment of IncA/Ctr also bereft of the bilobed

1048 hydrophobic domain was purified for tubule formation analysis in this assay (Figure

1049 26B). In addition, specific point mutagenesis of IncA/Cps at arginine 155 to glycine

1050 (R155G) (Figure 26C) was predicted to likely negatively affect tubule formation activity

1051 due to its positive charge and presence within the predicted dimerization interface. The

1052 Arg155 position was conserved in the alignment of IncA/Cps with the SNX-BAR

1053 consensus sequence (alignment position 163R) (Figures 18, 19, and 20) and shares

1054 sequence similarity with a region containing Arg337 in SNX1 that affects dimerization

1055 capabilities (158). Reactions were performed with purified recombinant IncA/Cps alone

1056 (Figure 27A) and liposomes alone (Figure 27B) as negative controls, and the eukaryotic

1057 BAR domain endophilin as a positive control (Figure 27C). When endophilin, IncA/Cps,

1058 IncA/Cps with trypsin, IncA/Ctr, and IncA/Cps R155G were incubated with liposomes

1059 (Figure 27C-G, respectively), only endophilin and IncA/Cps formed tubules (IncA/Cps in

1060 3 replicates, endophilin in 1) (Figures 28-32). IncA/Cps-induced tubules were of a

1061 diameter of 37nm ± 4, consistent with the diameter of retromer-associated SNX-BAR

1062 domain-induced tubules (158). Tubules were often seen connecting individual liposomes

1063 or extending from a single liposome as previously reported for BAR proteins from

1064 eukaryotes (125, 158-160). As predicted, IncA/Ctr did not display tubule formation

1065 activity (p = 6.0*E-11)(Figure 27F), nor did IncA/Cps after incubation with liposomes

1066 and trypsin (Figure 27E). Representative images from each replicate in vitro tubule

1067 formation experiment are shown (Figures 28-32). Tubule formation was sensitive to the

1068 addition of trypsin, indicating that IncA/Cps was specifically responsible for the liposome

1069 rearrangement into tubules (1 replicate, Figure 29). The IncA/Cps R155G mutant elicited

1070 no tubule formation activity (Figure 27G), confirming the predicted impact of Arg155 on

1071 tubule formation activity and suggesting an effect on IncA/Cps homodimerization.

1072 Endophilin induced tubulation in liposomes composed of DOPS, DOPE, DOPC, and PIP2

1073 as seen previously (125), while IncA/Cps did not (Figure 32). Endophilin, when

1074 incubated in optimized conditions and lipid compositions published previously (125),

1075 tubulates liposomes with a frequency of 43.2% (Table 4). Although IncA/Cps tubulation

1076 frequency was relatively rare at 5.4% (Table 4), these results suggest the SNX-BAR

1077 domain of IncA/Cps is functional and capable of sculpting/remodeling membranes and

1078 hints at a larger function within the inclusion.

1079

1080 Figure 25 – The coiled-coil IncA/Cps predicted structure exhibits SNX-BAR domain 1081 similarity

A B

C D

Figure 25. The coiled-coil IncA/Cps predicted structure exhibits SNX- BAR domain similarity. Using I-TASSER protein structure prediction webserver resources, two independent predictions show IncA/Cps with coiled-coil structures similar to eukaryotic SNX-BAR domains (SNX9_Human, PDB ID: 3DYU). Full length SNX9 contains an amino-terminal PX domain (red arrow) (A). SNX-BAR- only structures (B and D) are multicolored to show protein directionality (violet/dark blue, N-terminal; red, C-terminal). In (C), the full length IncA/Cps predicted structure shows the bilobed hydrophobic domain (white arrow) as alpha helixes. The predicted structure of IncA/Cps in (D) is the carboxy- terminal effector domain alone.

1082 Figure 26 – Purified recombinant proteins used for in vitro tubule formation

Figure 26. Purified recombinant proteins used for in vitro tubule formation. Poly-His tagged recombinant IncA proteins were generated lacking the amino-terminal 2+ bilobed hydrophobic domain and purified by Ni affinity purification. IncA/Cps (A), IncA/Ctr (B), and IncA/Cps R155G (C) purified proteins were detected at the corresponding molecular weights and concentrated to equivalent concentrations before use in the in vitro tubule formation assay. Elution fractions 3-7 (A, B) and 2-5 (C) were pooled and concentrated for in vitro tubule formation.

1083 Figure 27 – IncA/Cps induces tubule formation of liposomes in vitro

Figure 27. IncA/Cps induces tubule formation of liposomes in vitro. In vitro tubule formation of liposomes was perfomed to determine the predicted membrane sculpting capabilities of the putative IncA/Cps SNX- BAR-like domain. Reactions consisted of (A) IncA/Cps alone, (B) liposomes alone, (C) endophilin and liposomes, (D) IncA/Cps and liposomes, (E) IncA/Cps, liposomes, and trypsin, (F) IncA/Ctr and liposomes, and (G) IncA/Cps R155G and liposomes. The IncA/Cps R155G mutant corresponds to the amino acid at position 163R from Figure 19. IncA/Cps-induced tubules had a diameter of 37±4 nm. Scale = 100 nm.

1084 Figure 28 – In vitro tubule formation replicate one

Figure 28. In vitro tubule formation replicate one. Purified recombinant IncA/Cps (A) was incubated with liposomes (75% DOPS, 25% DOPE, and 5% dry w/v cholesterol; B) and formed tubules (C, D, and E). Tubules were observed extending from a single liposome (C) or between two liposomes (D, E). The tubule in (D; yellow box) is enlarged to show detail. Scale = 100 nm.

1085 Figure 29 – In vitro tubule formation replicate two

Figure 29. In vitro tubule formation replicate two. Purified recombinant IncA/Cps was incubated with liposomes (75% DOPS, 25% DOPE, and 5% dry w/v cholesterol; A) and formed tubules (B). Tubules were observed extending from a single liposome and connecting to a smaller liposome (B). IncA/Cps exposed to trypsin digestion prior to coincubation with liposomes did not form tubules (C). Scale = 100 nm.

1086 Figure 30 – In vitro tubule formation replicate three

ached tubules (B). IncA/Ctr (B). tubules ached IncA/Ctr

IncA/Cps was incubated with liposomes (75% DOPS, 25% DOPE, and 5% dry w/v dry 5% with and DOPE, DOPS, incubated 25% IncA/Cpsliposomes (75% was

tubule formation replicate three. replicate tubuleformation

In vitro

Figure 30. 30. Figure recombinant Purified single extending observed from were Tubules G). and C, E, D, F, (B, formed A)tubules and cholesterol; liposomes two C, and and F), det connecting and (B, E, D, as G), liposomes(B, nm. 100 Scale = liposomes formation tubule from (H). not did induce

1087 Figure 31 – In vitro tubule formation blinded replicate four

Figure 31. In vitro tubule formation blinded replicate four. Purified recombinant IncA/Cps was incubated with liposomes (75% DOPS, 25% DOPE, and 5% dry w/v cholesterol; A). IncA/Cps grids did not contain clearly defined tubules as seen previously. Elongated structures were present but were not counted toward the total IncA/Cps liposome tubulation frequency. IncA/Cps R155G did not induce tubule formation from liposomes as predicted (B). Liposomes alone (C) were without tubules. Scale = 100 nm.

1088 Figure 32 – In vitro tubule formation with endophilin

A B

C D

Figure 32. In vitro tubule formation with endophilin. Purified recombinant endophilin was incubated with liposomes (30%

DOPS, 30% DOPE, 35% DOPC, and 5% PIP2; A). BSA was incubated with liposomes to determine if liposome deformation could be attributed to addition of a protein not predicted to have membrane curvature-inducing capabilities (B). Endophilin produced tubules that extended from a single liposome (C and D), connected two liposomes (D), or were detached (D). IncA/Cps did not produce tubules from these liposomes (not shown). Scale = 100 nm.

1089 Table 4 – Frequency of tubule formation of liposomes in vitro

Table 4. Frequency of tubule formation of liposomes in vitro. The frequency of tubules formed by recombinant proteins tested in the in vitro tubule formation assay. These data represent the combined totals for each experimental replicate.

1090 IncA/Cps is expressed as tubules/fibers in HEK293 cells

1091 IncA/Cps has membrane remodeling activity in vitro, so I sought to determine if

1092 IncA/Cps tubule formation activity could be observed by transfection of eukaryotic cells.

1093 Transfected HEK293 cells expressing GFP-tagged IncA orthologs from C. psittaci and C.

1094 trachomatis for 24 hours were fixed with 4% paraformaldehyde and counterstained with

1095 DAPI. GFP-tagged IncA/Cps and IncA/Ctr localiztion was examined by epifluorescence

1096 (Figures 33A,B) or confocal (Figures 33 C,D) microscopy. Cells transfected with

1097 IncA/Cps-GFP (Figure 33A,C) displayed a GFP-positive branched tubular-like network

1098 in the cytosol. Z-stack progressions show IncA/Cps tubule-like GFP signal extending

1099 throughout the transfected cell (Supplimental video 3), while IncA/Ctr appears as

1100 rounded, punctate vesicle-like structures (Supplimental video 4). The fluoresence signal

1101 observed is similar to reported observations of BAR domain fibers (161-163), and is

1102 distinctly different from those generated upon expression of IncA/Ctr-GFP (Figure

1103 33B,D). Punctate staining of membrane compartments by IncA/Ctr was confirmed

1104 (Figure 33B,D) consistent with previous observations (99). These results support the

1105 functionality of the SNX-BAR-like domain of IncA/Cps in membrane remodeling

1106 activity.

1107 Figure 33 – Cells transfected with IncA/Cps-GFP and IncA/Ctr-GFP display contrasting

1108 localizations.

GFP exhibited GFP

aining Confocal (B). aining

of of IncA/Cps

display contrasting

GFP (C) and punctate signal and (C) of GFP

GFP GFP

GFP displayed punctate st displayed GFP

andIncA/Ctr

like signal of signal like IncA/Cps

GFP GFP

tagged (green) IncA/Cps (A, C) and IncA/Cps (B, C) (A, D). (B, tagged and(green) IncA/Cps IncA/Cps

/Cps

(Zeiss Axio Imager Z.1 and Apotome.2 module) module) Apotome.2 and AxioZ.1 Imager (Zeiss

were transfected GFP with were

GFP (D) with higher resolution. Scale = µm. 5 Scale resolution. (D) higher with GFP

like signal in transfected cells (A), (A), in and transfected cells IncA/Ctr signal like

Figure 33. 33. transfected with Cells IncA Figure localizations cells HEK293 images Epifluorescence tubule tubule the 510 reveal Meta) (Zeiss LSM images IncA/Ctr

1109 IncA/Cps inclusion membrane structures are differentially sensitive to inhibitors

1110 In Chapter 3, IncA/Cps signal was localized to proposed inverted folds/tubules

1111 extending into the inclusion lumen and everted tubules spreading out into the host cell

1112 cytosol (Figure 9). Inverted IncA/Cps signal was myriocin-sensitive, resulting in

1113 rounded inclusions, while myriocin left everted inclusion membrane extensions intact

1114 (Figure 12A). The Salmonella-containing vacuole (SCV) demonstrates similar everted

1115 tubule structures extending throughout the host cytosol (164). The SCV tubules are

1116 mediated through BAR domain interactions with the vacuole and are trafficked along

1117 microtubules (164, 165). To determine if the proposed inverted and everted IncA/Cps

1118 tubules were microtubule-associated, HeLa cells were infected with C. psittaci Cal10 for

1119 24 hours before fixation with 4% paraformaldehyde. Infected cultures were exposed to

1120 either 25 µM myriocin at 1 hpi as before or the microtubule polymerization inhibitor

1121 nocodazole 4 hours prior to fixation where indicated. The fixed cells were stained for α-

1122 IncA/Cps and counterstained with DAPI, labeling the chlamydiae within the inclusion

1123 and host cell nuclei. Luminal IncA/Cps signal (proposed inverted tubules or vesicles)

1124 was again myriocin-sensitive (Figure 34A) but was unaffected by exposure to nocodazole

1125 (Figure 34B). Conversely, everted inclusion membrane extensions were unaffected by

1126 myriocin (Figure 25A) but were disrupted by nocodazole (Figure 34B), showing an

1127 association between everted IncA/Cps tubules and trafficking along microtubules.

1128

1129 Figure 34 – Nocodazole disrupts everted, retromer-like tubules

A + myriocin B + nocodozole

DAPI

IncA

merged

Figure 34. Nocodazole disrupts everted, retromer-like tubules. C. psittaci Cal10 inclusions examined by epifluorescence microscopy (Zeiss Axio Imager Z.1 and Apotome.2 module) at 24 hpi were exposed to (a) myriocin or (b) nocodazole. In inclusions unexposed to either myriocin or nocodazole, everted tubules were seen extending from the inclusion membrane into the cytosol. The inverted, transluminal inclusion membrane structures that were myricoin-sensitive were not affected by nocodazole. Conversely, the everted IM tubules were disrupted by nocodazole and unaffected by myriocin. Scale = 10 µm.

1130 IncA/Cps interacts with retromer cargo proteins

1131 In recent publications on the Inc human interactome and the inclusion membrane

1132 proteome of C. trachomatis, the authors observed that specific Inc proteins interact with

1133 retromer complexes (122, 123). To date, the Inc interactome of C. psittaci is unknown.

1134 As SNX-BAR proteins are key players in retromer function, I predicted there could be

1135 interaction between IncA/Cps and components of retromers. Candidate interacting

1136 partners with IncA/Cps were determined by BioID (Figure 35). This method identifies

1137 proximal proteins through transfection of eukaryotic cells with the protein of interest

1138 fused to a promiscuous biotin ligase (166). The biotin ligase fusion biotinylates

1139 interacting proteins within a specific distance of 10-20 nm (166, 167). Interacting

1140 proteins, either as direct interacting partners or through protein complexes, become

1141 biotinylated after addition of exogenous biotin to the transfected culture (166). By this

1142 method, the biotinylated interacting partners of the BirA-tagged protein can be separated

1143 from the cell lysate for tandem mass spectrometry analysis for identification. HEK293

1144 cells transiently transfected with either myc::BirA or IncA/Cps::myc::BirA fusions were

1145 grown in the presence and absence of exogenous 50 µM biotin for 24 h. By

1146 immunofluorescence using antibodies targeting IncA/Cps and fluorophore-conjugated

1147 Streptavidin-568, the streptavidin signal was shown to colocalize with IncA/Cps (Figure

1148 36). Transfected cells without the addition of 50 µM biotin did not yield the same

1149 fluorescent signal. The IncA::myc::BirA fusion construct and a myc::BirA control

1150 construct were stably transfected into HEK293 cells as previously described (74). After

1151 the transfected cells were grown for 24 h in medium containing 50 µM biotin, cell lysates

1152 were subjected to affinity purification on streptavidin beads. The streptavidin-bound

1153 interacting partners of the transfected proteins were digested with trypsin, and the

1154 peptides were analyzed by mass spectrometry.

1155 In this screen, I found the highest confidence candidate interacting proteins were

1156 those involved in retromer trafficking and function (Table 5). The majority of interacting

1157 proteins were cargo proteins, comprised of transmembrane cell surface receptors,

1158 extracellular matrix interacting proteins and their scaffolding components, as well as tight

1159 junction proteins. The highest confidence plasma membrane associated proteins were

1160 either tight junction / cell-to-cell adherence proteins, transmembrane surface receptors,

1161 and endocytic trafficking components. Among the tight junction-associated proteins,

1162 desmoglein-2 (DSG2), Band 4.1-like protein 5 (EPB41L5), and leucine-rigch repeat

1163 transmembrane protein FLRT2 (FLRT2) were identified with the highest confidence.

1164 Transmembrane surface receptors including insulin receptor substrate 4 (IRS4), solute

1165 carrier family 12 member 2 (NKCC1), and coxsackievirus and adenovirus receptor

1166 (CXADR), and several amino acid transporters were among the proteins with the highest

1167 spectral counts. Proteins involved in vesicle transport and fusion were identified,

1168 including the SNARE protein synaptosomal-associated protien 23 (SNAP23). Small rho

1169 GTPase-interacting proteins and interacting partners, including Rho GDP-dissociation

1170 inhibitor 1, PAK4, USP6 and Rab-like protein 6 were also among the IncA/Cps proximal

1171 proteins.

1172

1173

1174 Figure 35 – Schematic of the BioID technique

Figure 35. Schematic of the BioID technique. (A) The promiscuous biotin-ligase fused to the protein of interest is expressed in live cells leading to selective biotinylation of proximal proteins. Biotinylated proteins are affinity purified after cell lysis and protein denaturation, and can be detected by mass spectrometry. (B) HEK293 cells stably express IncA::myc::BirA and proximal protein biotinylation was induced with the addition of 50 µM biotin. After cell lysis, biotinylated IncA/Cps-proximal proteins were collected on streptavidin-conjugated beads for analysis and identification by mass spectrometry. Adapted from Roux et al, 2012.

1175 Figure 36 – IncA/Cps::myc::BirA colocalizes with Streptavidin-568 in transfected 1176 HEK293 cells

- +

IncA

Streptavidin

568

Merged

Figure 36. IncA/Cps::myc::BirA colocalizes with Streptavidin-568 in transfected HEK293 cells. HEK293 cells transfected with IncA/Cps::myc::BirA were cultured in the presence (+) or absence (-) of 50 µM biotin. Confocal images (Zeiss LSM 510 Meta) revealed colocalization of α-IncA/Cps (green), and the fluorophore-conjugated streptavidin-568 (red) used to detect biotinylated proteins. Scale = 5 µm.

1177 Table 5 - IncA/Cps-proximal proteins identified with “high confidence” by BioID

Table 5. IncA/Cps-proximal proteins identified with “high confidence” by BioID. Proteins that appeared in only the IncA::myc::BirA experiment (IncA::myc::BirA proteins minus myc::BirA alone) were ranked by annotation and spectral counts.

1178

Table 5 continued. IncA/Cps-proximal proteins identified with “high confidence” by BioID. Proteins that appeared in only the IncA::myc::BirA experiment (IncA::myc::BirA proteins minus myc::BirA alone) were ranked by annotation and spectral counts.

100

1179

1180 Discussion

1181 Intracellular pathogens, including S. enterica (168), Shigella flexneri (169), and

1182 C. trachomatis (122, 123) have demonstrated interactions with host BAR domain

1183 proteins. Until now, functional BAR domains have yet to be confirmed within

1184 prokaryotes, although another BAR domain was predicted in Helicobacter pylori based

1185 on sequence homology (170). Surprisingly, incA of C. psittaci itself encodes a predicted

1186 SNX-like BAR domain that is absent in the C. trachomatis IncA ortholog. Although

1187 most SNX-BAR residues were not conserved in IncA/Ctr, IncA/Ctr was likewise

1188 predicted to be composed of C-terminal coiled-coils (108). IncA/Cps and IncA/Ctr

1189 appear conserved in this respect, despite only 12.5% homology. Comparison of the

1190 IncA/Cps protein sequence with orthologs in the Chlamydiaceae strongly suggests that

1191 the IncA/Cps SNX-BAR-like domain was acquired by convergent evolution. Predictive

1192 structures of both full length IncA/Cps and the SNX-BAR-like domain-containing C-

1193 terminal region only display the coiled-coil structures consistent with eukaryotic BAR

1194 domain proteins (157). IncA/Cps BAR membrane remodeling activity was confirmed by

1195 in vitro tubulation of liposomes, albeit at a low frequency. The low tubulation frequency

1196 could be due in part to the utilization of an assay optimized for eukaryotic N-BAR

1197 proteins. The IncA/Cps SNX-BAR may require different buffer conditions or liposome

1198 lipid compositions for optimal membrane sculpting activities. In further support for BAR

1199 domain functionality of IncA/Cps, HEK293 cells transfected with IncA/Cps-GFP

1200 displayed tubule-like structures within the cytosol.

101

1201 During C. psittaci infection, IncA/Cps localized to the inclusion membrane, to

1202 proposed “inverted” myriocin-sensitive inclusion membrane folds/tubules, and to

1203 nocodazole-sensitive retromer-like tubules extending from the inclusion membrane into

1204 the host cytosol. While colocalization of a BAR domain-containing Inc protein with the

1205 observed everted and inverted inclusion membrane structures does not determine

1206 causality, it demonstrates the association and supports the possible involvement of

1207 IncA/Cps in incidences of high inclusion membrane curvature. Future experimentation

1208 will be required to strengthen the suggested membrane remodeling activity of IncA/Cps.

1209 Notwithstanding, IncA/Cps is to date the first BAR domain protein with demonstrated

1210 functionality in prokaryotes that is closely associated with/needed for membrane

1211 sculpting activity.

1212 To further strengthen the possible role of the IncA/Cps SNX-BAR-like domain in

1213 retromer function, I attempted to identify targets of this protein in incA/Cps-expressing

1214 transfected cultured cells. SNX-BAR proteins are key mediators of endosomal

1215 trafficking within the eukaryotic cell, specifically within the context of recycling

1216 endosomes and retromers (171). Several proteins identified in the BioID interaction

1217 screen are reported cargo or mediators of sorting nexin retromers. IRS4 interacts with

1218 sorting nexin 5, a known retromer component (172). CXADR follows Rab5 to Rab7

1219 retrograde trafficking after endocytosis (173). Protein scribble homolog (SCRIB) is

1220 directly involved with retromer-dependent endocytic trafficking (171, 174) and epithelial

1221 cell polarization (175). Tracking cation-independent mannose-6-phosphate receptor (CI-

1222 MPR) trafficking by immunofluorescence is a standard method of determining retromer

1223 function (176), and CI-MPR was identified with high confidence in this assay. Other

102

1224 proteins identified rely on sorting nexin proteins for retrieval from degredation in

1225 lysosomes, such as integrin β-1, but are not retromer-associated (177, 178). High

1226 confidence proteins associated with recycling / early endosomes identified by BioID also

1227 included DSG2. DSG2 is recycled from the plasma membrane in a Rab11-dependent

1228 manner (179), which is Snx4-dependent (180). We propose that IncA/Cps serves as a

1229 resident inclusion membrane sorting nexin-like protein for C. psittaci. In addition it may

1230 be indirectly involved in generating inverted inclusion membrane transluminal

1231 folds/tubules by priming concave pits or folds of the inclusion membrane between

1232 everted retromers that are further extended in the inclusion lumen into fold/tubules by an

1233 unknown mechanism.

1234

1235

103

1236 Chapter 5. General discussion and future directions

1237

1238 C. psittaci has evolved a functional prokaryotic BAR domain by convergent

1239 evolution

1240 Lipid membranes are dynamic, elastic structures that possess the innate ability to

1241 self-assemble with respect to their polar heads and hydrophobic tails, forming structures

1242 ranging from unilamellar vesicles to lipid bilayer sheets (181). Eukaryotic cells use such

1243 lipid structures to compartmentalize functions or to serve as barriers. Due to the fluid

1244 nature of lipid structures, in order to form higher ordered structures, such as folds, bends,

1245 stacks, and tubules, eukaryotic cells evolved proteins that shape and sculpt membranes

1246 into the aforementioned shapes (182). Bin/Amphiphysin/Rvs (BAR) domains have been

1247 discovered to directly modify the conformation of lipid bilayers. BAR proteins have

1248 been directly implicated in the processes of endocytosis, vesicular transport, filipodia

1249 formation, actin anchoring at specific membrane sites, and in curvature generation in

1250 organelles (183). BAR proteins achieve membrane-sculpting capabilities by electrostatic

1251 interactions between accumulations of positively charged amino acids within the

1252 crescent-shaped protein domain and negatively-charged lipid membranes.

1253 The first BAR domain structure was solved in 2004 (159). The BAR domain-

1254 containing protein amphiphysin was shown to dimerize to form a crescent or banana-like

1255 shape. This finding was pivotal to understanding the nature of BAR domains, as it was

1256 revealed that a concentration of positively charged amino acids were located on the

1257 concave surface of the dimer (160). The dimers displayed a distinct radius of curvature

1258 that was believed to contribute directly to membrane curvature sensing / induction (184).

104

1259 BAR proteins became established as members of a BAR superfamily after other BAR

1260 structures were solved. The unique antiparallel dimer of coiled coils became the defining

1261 characteristic of the BAR domain superfamily.

1262 Within the superfamily there exist several subsets of BAR domains, including

1263 classical BAR, N-BAR, BAR-PH, PX-BAR (SNX-BAR), F-BAR, and I-BAR proteins.

1264 Classical BAR proteins, such as arfaptins, frequently contain SH3 domains that bind to

1265 proline-rich repeats (185). These proteins bind GTPases to promote intracellular

1266 signaling (186), but are not dependent upon GTPase binding for their membrane

1267 sculpting capabilities. These BAR proteins bind well to phosphatidyl inositol phosphates

1268 and have a localization and distribution within the trans-Golgi network (TGN). Mutation

1269 of the positive charges within the concave surface of these proteins ablates liposome

1270 tubulation and disrupts TGN localization (159).

1271 N-BAR proteins are named for the presence of an N-terminal amphipathic helix

1272 (H0 loop). This amphipathic helix inserts into a single leaflet of a lipid bilayer, inducing

1273 localized bending at that site (187, 188). Following insertion of the helix, the

1274 electrostatic interactions between the positive charges within the concave surface of the

1275 N-BAR dimer and the negatively charged phospholipids sculpt the membranes into

1276 distinct tubule structures. The best characterized N-BAR proteins are amphiphysins,

1277 BINs, and endophilins. These proteins are frequently involved in eisosome formation,

1278 stabilization of the T-tubule network (189), and intracellular transport of endocytic

1279 vesicles (190).

1280 BAR-PH proteins are unique due to the presence of a pleckstrin homology

1281 domain (PH) within the proteins that facilitates additional lipid interaction. These BAR

105

1282 proteins are capable of liposome tubulation, similar to their classical and N-BAR

1283 counterparts. The BAR domain of BAR-PH proteins is capable of binding liposomes by

1284 itself, but the interaction is substantially weaker without the PH domain (159). It seems

1285 as though the PH domain could be necessary for anchoring the BAR-PH proteins on the

1286 membranes for subsequent interaction and membrane sculpting capabilities of the BAR

1287 domain.

1288 Not all BAR proteins have the positive charge accumulation at the concave

1289 surface. Inverse BAR (I-BAR) proteins are unique in that the positive charges are

1290 predominantly on the convex surface of the protein dimer while appearing structurally

1291 similar to F-BAR domains (191). These proteins sense and induce negative membrane

1292 curvature, rather than the positive curvature detected by other BAR proteins. IRSp53 is

1293 among the best studied I-BAR proteins (192, 193). In conjunction with its binding

1294 partners, IRSp53 induces filopodia formation. This function of membrane protrusion is

1295 achieved through binding of IRSp53 to the inner leaflet of the plasma membrane and

1296 recruitment of proteins involved in actin polymerization through its SH3 domain.

1297 Without IRSp53, filopodia formation is impaired (194), and when overexpressed it leads

1298 to punctate clustering at the plasma membrane (192).

1299 Not all BAR proteins induce tubule formation of liposomes. Pinkbar is a small

1300 subset within I-BAR proteins. These proteins do not induce either positive or negative

1301 membrane curvature, but instead act to promote formation of planar membrane sheets

1302 (195). Upon exposure of purified Pinkbar to liposomes, rather than inducing tubule

1303 formation, Pinkbar flattens out curved regions on the liposomes. These proteins are

1304 expressed in intestinal epithelial cells and are localized at intracellular junctions (195).

106

1305 Cells rely on a variety of signals from their environment to accordingly adapt to

1306 stimuli. Cell membrane geometry is converted to biochemical signals that can alter the

1307 transcriptional profile of eukaryotic cells through the aid of curvature-sensing BAR

1308 domains and their interaction with small Rho GTPases (159, 194). Shear forces and

1309 pressure result in changes in growth factor expression in eukaryotic cells (196). Cell

1310 proliferation is affected by contact status to other eukaryotic cells (197). BAR domains

1311 are known to be involved in mechanotransduction (198). In spermathecal cells of

1312 Caenorhabditis elegans, the F-BAR and RhoGAP domain containing protein SPV-1

1313 senses membrane curvature (199). When the membrane is relaxed and curvature is high,

1314 the F-BAR is localized to the membrane and RhoA signaling is inhibited. When the

1315 membrane is stretched and taut, the F-BAR inner membrane localization is disrupted, and

1316 signaling through RhoA is permitted. RhoA is decisive in the G1 cell cycle progression

1317 and affects cyclins and cyclin-dependent kinases (198). When active, the Rho GTPase

1318 activates Arp2/3 resulting in actin polymerization and cytoskeletal modification (199). A

1319 hypothesis we have yet to consider is the potential role of the IncA/Cps SNX-BAR-like

1320 domain in mechanotransduction. The growing inclusion requires cytosolic space within a

1321 cell, and the force exerted by inclusion expansion would be sensed by contact-mediated

1322 signaling and/or shear/stretch sensing mechanisms unless mitigated by the chlamydiae

1323 through secreted virulence factors targeting cell-cell adherence proteins themselves or

1324 their corresponding GTPases.

1325 The ability of BAR domains to sculpt liposomes into tubules is a staple function

1326 of most BAR domains. As such, the canonical test for BAR domain activity is in vitro

1327 tubule formation. In this assay, liposomes are incubated with purified proteins and

107

1328 examined on the electron microscope. Upon interaction between the unilamellar vesicles

1329 and the positively-charged regions of the BAR domains, the BAR dimers multimerize to

1330 form a scaffold around the lipid, and curvature is generated producing elongated tubules

1331 of a consistent diameter (200). The diameter of these tubules is determined by the BAR

1332 protein inducing their formation. For example, amphiphysin and endophilin induce

1333 tubules of 20-100 nm in diameter. Sorting nexin BAR (SNX-BAR) domain protein

1334 tubules range within 20-50 nm (201).

1335 Curvature generation by BAR domains is a highly regulated event, as curvature

1336 sensing can lead to downstream signaling. BAR proteins are known to interact with

1337 small Rho GTPases. Rho GTPases are active in their GTP form and inactive when bound

1338 to GDP (202). Interactions with GTPases can occur through multiple ways. Tuba is a

1339 BAR protein with a guanine exchange factor domain (RhoGEF) and directly activates

1340 Rho GTPases (203). Conversely, other BAR proteins can contain RhoGAP domains,

1341 leading to inactivation of the GTPases (204). BAR proteins can also have binding

1342 domains that target the Rho GTPases themselves. Downstream effects of GTPase

1343 activity in conjunction with BAR domain proteins can include targeted sites of actin

1344 polymerization. This actin polymerization activity is accomplished by actin nucleation

1345 promoting factors such as Wiskott-Aldrich syndrome proteins (WASPs) (205). Upon

1346 interaction with actin, these BAR proteins can form protrusions in the plasma membrane.

1347 At least one bacterial pathogen is already known to coopt the BAR-actin interaction. E.

1348 coli O157:H7 is known for attaching and effacing lesions on epithelial cells. During

1349 infection and after initial attachment to surface receptors, the type III secreted effector

1350 protein EspFu interacts through its SH3 domain with the I-BAR protein insulin receptor

108

1351 tyrosine kinase substrate (IRTKS) (206, 207). EspFu also forms a complex with N-

1352 WASP, bridging interaction with this IRSp53 family protein and an actin nucleator. The

1353 interaction between IRTKS, EspFu, and N-WASP in conjunction with the activities of the

1354 translocated intimin receptor (Tir) promotes localized actin polymerization and pedestal

1355 formation, leading to attaching and effacing lesions (208). This finding highlights the

1356 crucial role of BAR-mediated membrane remodeling during E. coli infection. It stands to

1357 reason that other bacteria may have evolved similar mechanisms of host membrane

1358 sculpting capabilities, especially those with demonstrated propensity for contact-

1359 dependent infection.

1360

109

1361 Figure 37 – Intracellular localizations and structures of known BAR domain proteins and 1362 their association with bacterial virulence factors

Figure 37. Intracellular localizations and structures of known BAR domain proteins and their association with bacterial virulence factors. Shown is a cartoon of a cell (not to scale) with a non-comprehensive list of BAR proteins found in various curvature-related phenomena. Counter-clockwise from top left: IRSp53 and other I-BAR

proteins colocalize with filopodia. The E. coli T3S effector protein EspFu has been shown to interact with IRSp53 for attaching and effacing {Groot:2011bf}. Fluorescence image shows an enrichment of fluorescently labeled (green) I-BAR domain on filopodia, scale bar: 5 μm. MIM (I-BAR) is found enriched on the edges of transcellular tunnels formed by bacterial toxins, namely Bacillus anthracis edema toxin (ET) and Staphylococcus aureus EDIN toxin {Maddugoda:2011iu}. Image shows a tunnel with fluorescently labeled MIM, scale bar: 5 μm. Amphiphysin 2 (N-BAR) is crucial for the formation of T-tubules (tubular invaginations in the membrane of skeletal and cardiac muscles). Amphiphysin II is associated with the C. pneumoniae inclusion inside macrophages {Gold:2004dx}. Image shows the localization of fluorescently labeled endogenous amphiphysin 2 on differentiated myotubes, scale bar: 10 μm. Endophilin B1 (N-BAR) is key for the formation of reticular membrane morphology of the mitochondrion. Endophilin is functionally associated with structures of early internalization of Shiga and cholera toxins {Renard:2014ks}. Shown is a mitochondrial network stained with anti-endophilin B1 antibody. A variety of BAR proteins colocalize with endocytosis, for example, FCHo2, Syp1, and Bzz1 (F-BARs) are found at early stages of endocytosis, syndapin (F- BAR), various amphiphysins, endophilins (N-BARs), and sorting nexin 9 (N-BAR-like protein) were found at later stages of endocytosis. Electron microscopy image shows an ultrastructure of a membrane invagination in the course of clathrin-mediated endocytosis in yeast. Scale bar: 100 nm. Many sorting nexins (N-BARs) are found on endosomes. C. trachomatis IncE interacts with sorting nexin BAR proteins for IM everted tubules {Aeberhard:2015du, Mirrashidi:2015vu}. Shown are structures of sorting nexins 1 (top) and 9 (bottom). Image shows a membrane tubule budding from an endosome coated by fluorescently labeled sorting nexin 1. Scale bar: 10 μm. Adapted from Simunovic et al, 2015.

110

1363 IncA retromer-like tubules extend from the inclusion membrane into the host

1364 cytosol

1365 Retromers are vesicle structures involved in internalizing protein from the surface

1366 of the cell, most often transmembrane surface receptors, to be trafficked to the trans-golgi

1367 or back to the plasma membrane (148). SNX-BAR domain proteins, also known as PX-

1368 BAR domain proteins, are key players in endosome maturation and inducers of

1369 membrane curvature in retromer formation. PX-BAR proteins are named for the

1370 presence of a phosphoinositide-binding PX domain within the BAR protein. The PX

1371 domain acts to target the sorting nexin BAR proteins to specific membrane sites for

1372 vesicle transport within the eukaryotic cell. The SNX-BAR and PX domains are recruited

1373 to phosphoinositide-enriched membranes with a substantial membrane curvature (159).

1374 In addition to cargo trafficking, PX-BAR proteins have been identified to play a role in

1375 autophagosome formation from recycling endosomes (209). The cargo recognition

1376 subcomplex forms at the target site through recruitment of scaffolding proteins (158).

1377 Localized membrane curvature is further induced through multimerization of the SNX-

1378 BAR proteins, resulting in nascent BAR tubules (180). The process of shuttling the

1379 vesicular cargo throughout the cell is dependent on motor proteins such as dynein for

1380 trafficking along microtubules (210). Rab proteins assist in in the endosomal sorting,

1381 resulting in either recycling back to the plasma membrane, shuttling toward the trans-

1382 Golgi network (TGN), or endolysosomal fusion (211).

1383 Interaction with SNX- BAR proteins is common among intracellular pathogens.

1384 Shiga toxin is trafficked to the TGN through SNX1-mediated retrograde transport (212,

1385 213). Salmonella enterica serovar Typhimurium utilizes the effector proteins SigD and

111

1386 SopB to target SNX1 to the Salmonella-containing vacuole (SCV) (168) and forms

1387 extensive, long-range fibers throughout the host cell cytosol (164). The SNX1 interaction

1388 with the SCV directly remodels the membrane, and SNX1 depletion delays replication of

1389 S. enterica (165). Interaction between the chlamydial inclusion membrane and retromers

1390 are observed during infection of tissue culture cells (122, 123), but the reasons for this

1391 interaction have yet to be elucidated. Purified whole C. trachomatis inclusions are

1392 enriched with sorting nexin BAR proteins (123), and sorting nexin interactions are

1393 mediated by the inclusion membrane protein IncE (122). It would be interesting to see if

1394 a similar association between the C. psittaci inclusion and sorting nexin BAR proteins

1395 exists. One can speculate that if C. psittaci creates its own inclusion membrane-resident

1396 SNX-BAR-like domain that interacts with retromer components and cargo, the C. psittaci

1397 inclusion might be devoid of sorting nexin association.

1398 C. trachomatis secretes the effector protein IncE that interacts with retromer

1399 sorting nexins (122). Two different evolutionary strategies could achieve a similar goal

1400 within the cell, where one organism secretes SNX-BAR recruitment proteins and the

1401 other utilizes its own SNX-BAR-like protein for retromer interaction. IncA/Ctr cytosolic

1402 tubules from C. trachomatis inclusions are partially generated by IncE interaction with

1403 SNX proteins (122). Previous forays into whole inclusion purification and mass

1404 spectrometry have shown an accumulation of SNX proteins at the C. trachomatis

1405 inclusion membrane (123). CI-M6P was an identified candidate interacting partner of

1406 IncA/Cps by BioID, and is commonly used as a marker of retromer function.

1407 Examination of the C. psittaci inclusion membrane proteome by the same method

1408 employed by Aeberhard et al (123) would yield insight into if eukaryotic sorting nexins

112

1409 also decorate the C. psittaci inclusion membrane. Since C. psittaci constructs its own

1410 SNX-BAR, I hypothesize sorting nexin proteins at the inclusion membrane would be

1411 greatly diminished in comparison, or absent altogether. As other bacteria have evolved

1412 effector proteins to directly recruit sorting nexin proteins to the site of infection for

1413 membrane remodeling (164, 165, 206, 207), I propose that C. psittaci evolved its own

1414 prokaryotic BAR domain for a similar purpose.

1415 An alternative, but not mutually exclusive hypothesis, can be formed by

1416 considering a nascent inclusion as an endosome from the eukaryotic host perspective.

1417 Chlamydiae induce their own endocytosis into the host cell (32). During retromer-

1418 mediated sorting, the endosomes have cargo adapters that recruit the retromer assembly

1419 complex for tubule formation by sorting nexins (148). IncE of C. trachomatis recruits

1420 and interacts with sorting nexins, and the Inc-laden retromer fibers extend out from the

1421 endocytosed inclusion (122). Endosomes have specific fates within the cell, be it a)

1422 fusion with lysosomes, b) trafficking to the trans-Golgi, or c) recycling back to the

1423 plasma membrane (171, 214). The chlamydial inclusion avoids endolysosomal fusion,

1424 allowing the parasitophorous vacuole to remain in the host cytosol (145). Trafficking to

1425 the trans-Golgi has been observed through direct associations with the inclusion and

1426 Golgi stacks, and golgin-84 proteolytic cleavage contributes toward the Golgi

1427 redistribution around the inclusion (146, 215). Of the proteins identified in the IncA/Cps

1428 BioID interaction screen, golgin subfamily B member 1 was identified, a protein that

1429 contributes to Golgi organization (216). The third fate of the endosome cargo is

1430 recycling. Retromer complexes, in concert with the corresponding Rab proteins, assist in

1431 budding off tubules and directing the endosome back to the plasma membrane (217).

113

1432 Retromer-like extensions of the inclusion membrane may facilitate delivery of effector

1433 proteins to the plasma membrane or into neighboring uninfected cells, as is observed with

1434 the T3S effector SinC (74).

1435

114

1436 Figure 38 – A proposed pathway for SNX-BAR-retromer-like tubule assembly of 1437 IncA/Cps

Figure 38. A proposed pathway for SNX-BAR-retromer-like tubule assembly of IncA/Cps. Everted retromer-like tubules that extend from the inclusion membrane may be generated in a similar manner to endosomal retromer tubules. Cargo proteins could either be trafficked to (DSG2?) or away from (SinC?) the inclusion, traveling along microtubules to the target membrane site. The pathway shown above provides potential targets of investigation for confirmation of IncA/Cps sorting nexin-like activity. Adapted from Cullen and Korswagen, 2012.

115

1438 Here we have demonstrated the presence and function of the first characterized

1439 prokaryotic BAR domain. There exist several possible implications for the formation of

1440 a functional BAR domain within IncA/Cps. First, inclusion membrane surface area to

1441 inclusion volume ratios are direct predictors of infectious progeny yield. C. psittaci, by

1442 evolving a means of inclusion membrane curvature induction, can increase the surface

1443 area component while inclusion volume is limited by the size of the cell it occupies,

1444 resulting in increased EB yield. A second, noncompeting hypothesis is that IncA BAR

1445 domain mimicry of sorting nexins could confer the inclusion a means of direct subversion

1446 of vesicular transport during infection.

1447 Functional overlap could exist between IncA/Ctr and IncA/Cps due to the

1448 predicted SNARE-like motifs being present in both; however, functional characterization

1449 of IncA/Cps SNARE-like activity has yet to be performed. IncA homodimerization

1450 between inclusions may bring nascent inclusion membranes into close enough proximity

1451 to facilitate vesicle fusion. IncA/Cps SNX-BAR-like domain could play multiple roles in

1452 the geometry of the growing C. psittaci inclusion. In addition to predicted SNARE-like

1453 activity from the two SNARE-like domains of IncA/Cps, the IncA SNX-BAR-like

1454 domain could directly alter the C. psittaci inclusion membrane through the formation of

1455 transluminal membrane structures observed in Chapter 3. A consequence of inclusion

1456 membrane remodeling, in the instance of transluminal extensions of the inclusion

1457 membrane, would provide increased contact sites for RB attachment. As shown in

1458 Chapter 3, transluminal extensions and increased inclusion membrane curvature results in

1459 increased infectious progeny. IncA/Cps was discovered to be associated with the

116

1460 transluminal inclusion membrane extensions, and the IncA/Cps SNX-BAR-like domain

1461 could directly induce these invaginations (Figure 39).

1462 The everted IncA/Cps tubules, similar to Salmonella-induced filaments (164), can

1463 extend from one side of the cell to the other. These tubules are sensitive to nocodazole,

1464 showing that they traffic along microtubules, in a manner consistent with retromer vesicle

1465 trafficking (217). A previous yeast 2-hybrid experiment found an interaction between

1466 IncA/Cps and G3BP1, a Ras GTPase binding protein (218). BAR domain-containing

1467 proteins can also have GTPase binding activity. G3BP1 was not detected in the BioID

1468 results. However, several retromer and recycling endosomal peptides were affinity

1469 purified by BioID, including regulators of small GTPases such as Rho GDP-dissociation

1470 inhibitor 1 and USP6. The BioID data merely suggests a possible role of IncA/Cps in

1471 retromer function, and further confirmation of the results from chapter 4 are needed.

1472 Putative interacting partners need to be verified by coimmunoprecipitation or affinity

1473 pulldown experiments to confirm the interactions. The assertion is supported however,

1474 by ablation of everted retromer-like IncA/Cps tubules with nocodazole, as retromers are

1475 trafficked along microtubules (219).

1476

117

1477 Figure 39 – Schematic representation of IncA/Cps-mediated IM remodeling

Figure 39. Schematic representation of IncA/Cps-mediated IM remodeling. The C. psittaci IM (orange), as shown in chapter 3, is irregular, invaginated, and contains transluminal structures continuous with the IM that provide a means of contact to luminally replicating RBs (light green). After detaching from the IM, these RBs become committed to late differentiation back into EBs (dark green). The IncA/Cps BAR domain localized to transluminal IM structures, the IM periphery, and to retromer-like everted tubules extending into the host cytosol. The SNX-BAR domain of IncA/Cps could form the lattice structure on the everted fibers by multimerization as depicted in the bottom right inset. The inset in the top left depicts a mechanism for the IncA/Cps SNX-BAR induction of transluminal inclusion membrane extensions from the host cytosol side of the IM.

118

1478 The inclusion configuration of C. psittaci supports contact-dependent growth

1479 RBs are typically observed replicating in close contact or proximity to the

1480 inclusion membrane. This observation led to the formation of the contact-dependent

1481 model of chlamydial development, where:

1482 1. EB internalization and early intracellular survival requires attachment of T3S

1483 injectisomes to cell surface receptor(s) and ‘unloading’ of late-

1484 expressed/preloaded and early neosynthesized effectors.

1485 2. RB replication requires T3S-mediated contact with the inclusion membrane and

1486 delivery of mid-cycle effectors.

1487 3. Loss of T3S-mediated contact and/or (coupled) disruption of T3S activity is

1488 associated with the signal for commitment to late differentiation.

1489 Intracellular growth is dependent upon physical constraints within the developing

1490 inclusion. Variables such as inclusion size, inclusion volume, total cytosolic

1491 encompassing space, number of RBs and EBs per inclusion over time, number and

1492 spacing of T3S injectisomes present at the chlamydial surface, and distance separating

1493 respective chlamydiae to the inclusion membrane have been previously measured. These

1494 parameters were used in developing partial differential equations to describe chlamydial

1495 growth and development during infection (59, 70). The equations yield predictors of

1496 available surface area for binding and maintaining T3S-mediated contact with the

1497 inclusion membrane, total volume of the developing inclusion, and the total number of

1498 chlamydiae within the inclusion. These data were then used to predict the optimal

1499 conditions for maximal chlamydial growth. The partial differential equations provide a

1500 powerful tool for generating hypothesis-driven research in answering essential questions

119

1501 about the role and impact of the inclusion membrane in the infectious process. This

1502 model, based upon observations made of C. trachomatis and C. psittaci inclusions is

1503 applicable to most Chlamydia species. The application of the model to C. psittaci has

1504 however received criticism, despite C. psittaci having been used predominately to derive

1505 it, due to the presence of apparently replicating RBs observed in the inclusion lumen in

1506 electron micrographs (220). The disparity between C. psittaci and the other

1507 Chlamydiaceae with regard to contact-dependent development is however difficult

1508 conceptually, as all other key aspects of chlamydial development such as the time of

1509 onset and the asynchronous nature of late differentiation (142, 221) are relatively well

1510 conserved.

1511 Fusogenicity was affected by exposure to myriocin over time, causing C. psittaci

1512 inclusions to adopt the non-fusogenic, multi-inclusion per cell appearance observed

1513 during C. pneumoniae and C. caviae infections. The inclusion configuration of multiple

1514 smaller, non-fusogenic inclusions is mathematically predicted to maintain high surface

1515 area but minimal inclusion volume as mentioned previously (66). Further, this highlights

1516 the C. psittaci inclusion fusion phenotype as not solely dependent on IncA, suggesting

1517 that other factors may be required. One possibility is that SNARE-like activity requires

1518 sphingolipids for formation of stable lipid microdomains. SNARE activity, including

1519 VAMPs and SNAP23 in eukaryotic cells, is known to be regulated by and linked to lipid

1520 rafts (222). Vesicle fusion is also known to be enhanced when sphingolipids are present

1521 in liposomes used for in vitro fusion assays of SNARE proteins (223).

1522 As evidenced earlier with measurements of recoverable IFUs in the presence and

1523 absence of myriocin, inclusion size and shape play a direct role in the size of infectious

120

1524 progeny per inclusion. The physical constraints of replicating within a host cell place

1525 upward limits on maximum inclusion size and volume, and as observed previously in C.

1526 trachomatis, replication within this inclusion configuration is a function of surface area to

1527 volume ratio. Inclusion configurations across the Chlamydiaceae range from the single,

1528 large ovoid vacuole replete with luminal space of C. trachomatis to multiple smaller

1529 inclusions of C. caviae and C. pneumoniae. The former is characterized by relatively

1530 lower available inclusion membrane surface area for replicating RBs, but ample luminal

1531 space for late-differentiating RBs/differentiated EBs, while the reverse is true for the

1532 latter. Therefore, the probability of observing contact between a C. trachomatis RB and

1533 the inclusion membrane relative to the surface area to volume ratio is low. Inclusion

1534 configurations with high surface area and low luminal volume, such as C. caviae and C.

1535 pneumoniae, are associated with higher probabilities (infinite, in the theoretical case of

1536 one RB per inclusion) of observing contact between RBs and the inclusion membrane

1537 (66). C. psittaci has inclusions that intermediary to these two extremes, with distinct

1538 structures continuous with the inclusion membrane extending into the inclusion lumen,

1539 increasing available surface area with occupiable luminal space for detached RBs to

1540 differentiate into EBs.

1541 Using mathematical modeling, we can integrate the inclusion configuration into

1542 the differential equations for contact-dependent development (Wilson, personal

1543 communication). Rate of replication is directly associated with inclusion membrane

1544 surface area, as represented by the equation

ⅆ푅 푅 1545 = 훼푅 (1 − ) ⅆ푡 푅푚푎푥

121

ⅆ푅 1546 where R is the number of RBs that change over time ( ). The rate of replication for ⅆ푡

1547 RBs is designated α, which was measured by radiolabeled uridine incorporation into C.

1548 psittaci as 2 hours (226), but more recent experiments on C. trachomatis by PCR return

1549 rates between 1.45 – 3 hours (68, 227-229). In C. trachomatis, α varies depending upon

1550 the serovar, and endemic trachoma strains grow slower than genital strains (228). 푅푚푎푥

1551 represents an inclusion membrane fully saturated with bound RBs. Therefore, the rate of

1552 EB production can be represented:

ⅆ퐸 0, 푅 < 푅 1553 = { 푚푎푥 ⅆ푡 훿푅, 푅 = 푅푚푎푥

1554 Under these conditions, if the surface area within the inclusion is occupiable, the RBs

1555 will continue replication until 푅 = 푅푚푎푥. After this condition is met, replicating RBs

1556 will force other RBs out of contact with the inclusion membrane into the inclusion lumen,

1557 committing them to late differentiation through loss of T3S-mediated contact. The

1558 number of IFUs at a given time can thus be modeled by the integral:

푡 1559 퐼퐹푈 = ∫ 퐸(푡) ⅆ푡 0

1560 Assuming the C. trachomatis inclusion resembles a sphere, the surface area of the

1561 inclusion is represented by the equation 퐴 = 휋푟2. The growing inclusion will increase in

1562 both surface area and the radius of the inclusion. With this theoretical developing

1563 inclusion, contact-dependent growth would predict infectious progeny would increase in

1564 proportion to the surface area as the radius increases, assuming a constant rate of

ⅆ퐴 1565 replication, represented by the rate of change of spherical surface area equation = ⅆ푡

ⅆ푟 1566 8휋푟 . However, the C. psittaci inclusion, as demonstrated in Chapter 3 of this thesis, is ⅆ푡

122

1567 lobed, invaginated, and overall irregularly shaped. If the C. psittaci inclusion

1568 encompasses the same volume within the cell, and transluminal membrane folds allow

1569 for increased contact sites for RBs, the total overall infectious progeny would not follow

1570 the same linear EB production trajectory. Instead, the C. psittaci inclusion configuration

1571 would theoretically shift the infectious progeny production from a linear relationship to

1572 an upward trend earlier in the developmental cycle, as invaginations of the inclusion

1573 membrane would quickly satisfy 푅 = 푅푚푎푥. This configuration would result in higher

1574 EB yield from C. psittaci inclusions compared to C. trachomatis inclusions, albeit within

1575 one log of each other, during a single generation. Subsequent infections of the

1576 surrounding cells would amplify this difference after multiple reinfections. As shown

1577 previously, severity in pathology is directly correlated with infectious burden (101, 224,

1578 225). C. psittaci constructed its own BAR domain through convergent evolution, and as

1579 the IncA/Cps BAR is associated with the transluminal membrane folds that facilitate

1580 inclusion membrane contact with luminally replicating RBs (Figure 39), one can surmise

1581 how this previously eukaryotic-specific protein domain became fixed in the C. psittaci

1582 genome. Assuming the transluminal folds of the C. psittaci inclusion membrane are in

1583 fact IncA/Cps BAR mediated, maintaining BAR functionality would provide a selective

1584 advantage for the developing chlamydiae. With a BAR domain protein sculpting the

1585 inclusion membrane to increase surface area, and by association IFU titer, the inclusion

1586 configuration itself is a virulence factor of Chlamydia spp. The results obtained by this

1587 study yield multifaceted insights into chlamydial biology. The equations derived

1588 previously from observations of inclusions can be finely tuned to allow for membrane

123

1589 folds, invaginations, and other transluminal structures, further increasing the ability of

1590 such equations to make meaningful predictions and testable hypotheses.

1591 Sphingolipid-limiting conditions investigated over developmental time in this

1592 study aid in testing our initial hypothesis as well as provide avenues for further research

1593 into the mechanism of late differentiation. Upon exposure to myriocin, the occupiable

1594 surface area at the inclusion membrane for RB attachment is approaching its maximum at

1595 18 hpi given that sphingolipids are not available to grow the inclusion further. As such,

1596 RBs may detach and begin their transition to EBs sooner, resulting in higher IFU titers

1597 earlier in development in the presence of myriocin than without the drug. This

1598 phenomenon could be due to the lack of membrane surface area to continue RB

1599 replication, which would force detached RBs into the inclusion lumen preventing

1600 potential reattachment to the inclusion membrane. Late differentiation simultaneously

1601 creates occupiable space within the inclusion lumen, as EBs are considerably smaller

1602 than RBs.

1603 In order to overcome this surface area to volume ratio constraint, I propose that C.

1604 psittaci has evolved the IncA/Cps SNX-BAR-like domain as a mechanism for

1605 modulating inclusion membrane surface area while the total volume of the inclusion

1606 increases. This configuration allows for higher infectious progeny recovered per

1607 developmental cycle, resulting in log scale increases in EB production over multiple

1608 generations in an actual infection. Such a mechanism for modulation of inclusion shape

1609 would be evolutionarily advantageous if the end goal is to replicate as much as possible.

1610 The hypothesis that clinical outcome is correlated with infectious burden is well

1611 documented in other Chlamydia species (101, 224). For example, ocular pathology is

124

1612 more severe in guinea pigs infected with C. caviae GPIC at higher infectious burdens

1613 (225). However, for subclinical presentations as is frequently the case with C.

1614 trachomatis, decreased progeny yield per inclusion could also have advantages, leading

1615 to decreased acute pathology and delayed diagnosis / treatment. The idea that the

1616 inclusion configuration itself directly impacts pathogenesis opens up more avenues for

1617 investigation into potential inclusion membrane-modifying virulence factors produced by

1618 Chlamydia. Finally, we see that the lobed, invaginated C. psittaci inclusion

1619 configuration fits with the contact-dependent hypothesis of chlamydial growth and

1620 development, providing a unified model for defining parameters of intracellular growth

1621 of this diverse array of microorganisms.

1622

1623

125

1624

126

1625 Bibliography

1626

1627 1. F. D. C. A. P. CDC, CDC Grand Rounds: Chlamydia prevention: challenges and 1628 strategies for reducing disease burden and sequelae. MMWR Morbidity and … 1629 (2011).

1630 2. A. J. Phillips, N. S. Skolnik, Fast Facts. … Transmitted Diseases: A Practical 1631 Guide for … (2013).

1632 3. R. Bourne, G. A. Stevens, R. A. White, J. L. Smith, Causes of vision loss 1633 worldwide, 1990–2010: a systematic analysis. The Lancet Global … (2013).

1634 4. T. File, Treatment of community-acquired pneumonia in adults in the outpatient 1635 setting. UpToDate Oct (2013).

1636 5. D. Vanrompay, T. Harkinezhad, Chlamydophila psittaci transmission from pet 1637 birds to humans. Emerging infectious … (2007).

1638 6. D. S. A. Beeckman, D. C. G. Vanrompay, Zoonotic Chlamydophila psittaci 1639 infections from a clinical perspective. Clinical Microbiology and Infection. 15, 1640 11–17 (2009).

1641 7. A. Pospischil, R. Thoma, M. Hilbe, P. Grest, Abortion in woman caused by 1642 caprine Chlamydophila abortus (Chlamydia psittacci serovar 1). Swiss medical 1643 weekly (2002).

1644 8. A. Meijer, A. Brandenburg, J. De Vries, J. Beentjes, Chlamydophila abortus 1645 infection in a pregnant woman associated with indirect contact with infected 1646 goats. … and Infectious Diseases (2004).

1647 9. R. Gdoura et al., Culture-negative endocarditis due to Chlamydia pneumoniae. 1648 Journal of Clinical Microbiology. 40, 718–720 (2002).

1649 10. A. West, A brief review of Chlamydophila psittaci in birds and humans. Journal 1650 of Exotic Pet Medicine (2011).

1651 11. M. R. Knittler, K. Sachse, Chlamydia psittaci: update on an underestimated 1652 zoonotic agent. Pathog Dis. 73, 1–15 (2015).

1653 12. J. Ritter, Beitrag zur Frage des Pneumotyphus. Eine Hausepidemie in Uster 1654 (Schweiz) betreffend (Deutsches Archiv für Klinische Medizin, 1880).

1655 13. R. L. Harris, T. W. Williams, “Contribution to the Question of Pneumotyphus”: 1656 A Discussion of the Original Article by J. Ritter in 1880. Review of Infectious 1657 Diseases (1985).

127

1658 14. A. Morange, De la psittacose ou infection spéciale déterminée par les perruches 1659 (1895).

1660 15. E. C. Ramsay, The psittacosis outbreak of 1929-1930. Journal of Avian Medicine 1661 and Surgery (2003).

1662 16. C. Armstrong, Psittacosis: epidemiological considerations with reference to the 1663 1929-30 outbreak in the United States. Public Health Reports (1896-1970) 1664 (1930).

1665 17. J. Lepore, “It’s Spreading: Outbreaks, media scares, and the parrot panic of 1666 1930” | Jill Lepore. The New Yorker (2009).

1667 18. S. P. Bedson, J. Bland, A morphological study of psittacosis virus, with the 1668 description of a developmental cycle. British journal of experimental pathology 1669 (1932).

1670 19. M. D. Eaton, M. D. Beck, H. E. Pearson, A VIRUS FROM CASES OF 1671 ATYPICAL PNEUMONIA RELATION TO THE VIRUSES OF 1672 MENINGOPNEUMONITIS AND PSITTACOSIS. The Journal of experimental 1673 … (1941).

1674 20. Y. TANAMI, M. POLLARD, T. J. STARR, Replication pattern of psittacosis 1675 virus in a tissue culture system. Virology. 15, 22–29 (1961).

1676 21. M. POLLARD, N. SHARON, W. R. KLEMM, Transient sensitivity of 1677 intracellular psittacosis virus to x-rays. Nature. 198, 313–314 (1963).

1678 22. J. W. MOULDER, The Relation of the Psittacosis Group (Chlamydiae) to 1679 Bacteria and Viruses. Annu. Rev. Microbiol. 20, 107–130 (1966).

1680 23. L. A. PAGE, Revision of the family Chlamydiaceae Rake (Rickettsiales): 1681 unification of the psittacosis-lymphogranuloma venereum-trachoma group of 1682 organisms in the genus …. International Journal of Systematic and … (1966).

1683 24. J. Salinas et al., Abortion associated with Chlamydia abortus in extensively 1684 reared Iberian sows. Vet. J. 194, 133–134 (2012).

1685 25. G. Entrican, N. Wheelhouse, S. R. Wattegedera, D. Longbottom, New challenges 1686 for vaccination to prevent chlamydial abortion in sheep. Comp. Immunol. 1687 Microbiol. Infect. Dis. 35, 271–276 (2012).

1688 26. Q. Chen, X. Gong, F. Zheng, X. Cao, Z. Li, Seroprevalence of Chlamydophila 1689 abortus infection in yaks (Bos grunniens) in Qinghai, China. Tropical animal 1690 health and … (2014).

1691 27. P. B. Wyrick, Cell biology of chlamydial infection: a journey through the host 1692 epithelial cell by the ultimate cellular microbiologist (Chlamydial Infections

128

1693 (Stephens, 1998).

1694 28. J. Peters, D. P. Wilson, G. Myers, P. Timms, P. M. Bavoil, Type III secretion à la 1695 Chlamydia. Trends Microbiol. 15, 241–251 (2007).

1696 29. R. J. Belland et al., Genomic transcriptional profiling of the developmental cycle 1697 of Chlamydia trachomatis. Proc. Natl. Acad. Sci. U.S.A. 100, 8478–8483 (2003).

1698 30. Y. M. AbdelRahman, R. J. Belland, The chlamydial developmental cycle. FEMS 1699 Microbiology Reviews (2005).

1700 31. P. B. Wyrick et al., Entry of genital Chlamydia trachomatis into polarized human 1701 epithelial cells. Infection and Immunity. 57, 2378–2389 (1989).

1702 32. B. J. Lane, C. Mutchler, S. Al Khodor, S. S. Grieshaber, Chlamydial entry 1703 involves TARP binding of guanine nucleotide exchange factors. PLoS … (2008).

1704 33. K. Mölleken, E. Becker, J. H. Hegemann, The Chlamydia pneumoniae invasin 1705 protein Pmp21 recruits the EGF receptor for host cell entry. PLoS Pathog. 9, 1706 e1003325 (2013).

1707 34. S. Stallmann, J. H. Hegemann, The Chlamydia trachomatis Ctad1 invasin 1708 exploits the human integrin β1 receptor for host cell entry. Cellular Microbiology 1709 (2015), doi:10.1111/cmi.12549.

1710 35. P. Subbarayal, K. Karunakaran, A. C. Winkler, EphrinA2 receptor (EphA2) is an 1711 invasion and intracellular signaling receptor for Chlamydia trachomatis. PLoS … 1712 (2015).

1713 36. T. HACKSTADT, M. A. Scidmore, (1995).

1714 37. P. Lydyard et al., Case Studies in Infectious Disease: Chlamydia Trachomatis 1715 (Garland Science, 2009).

1716 38. S. M. Buckley, E. Whitney, F. Rapp, (1955).

1717 39. A. Tamura, A. Matsumoto, N. Higashi, Purification and chemical composition of 1718 reticulate bodies of the meningopneumonitis organisms. Journal of Bacteriology 1719 (1967).

1720 40. J. W. Costerton, L. Poffenroth, J. C. Wilt, Ultrastructural studies of the nucleoids 1721 of the pleomorphic forms of Chlamydia psittaci 6BC: a comparison with 1722 bacteria. Canadian journal of … (1976).

1723 41. A. Matsumoto, Surface projections of Chlamydia psittaci elementary bodies as 1724 revealed by freeze-deep-etching. Journal of Bacteriology. 151, 1040–1042 1725 (1982).

129

1726 42. A. Matsumoto, Isolation and electron microscopic observations of 1727 intracytoplasmic inclusions containing Chlamydia psittaci. Journal of 1728 Bacteriology. 145, 605–612 (1981).

1729 43. R. C. Hsia, Y. Pannekoek, E. Ingerowski, P. M. Bavoil, Type III secretion genes 1730 identify a putative virulence locus of Chlamydia. Mol. Microbiol. 25, 351–359 1731 (1997).

1732 44. R. S. Stephens et al., Genome sequence of an obligate intracellular pathogen of 1733 humans: Chlamydia trachomatis. Science. 282, 754–759 (1998).

1734 45. P. M. Bavoil, R. C. Hsia, Type III secretion in Chlamydia: a case of déjà vu? 1735 Mol. Microbiol. 28, 860–862 (1998).

1736 46. A. Matsumoto, E. Fujiwara, N. Higashi, Observations of the surface projections 1737 of infectious small cell of Chlamydia psittaci in thin sections. J Electron Microsc 1738 (Tokyo). 25, 169–170 (1976).

1739 47. M. Wilkat, E. Herdoiza, V. Forsbach-Birk, P. Walther, A. Essig, Electron 1740 tomography and cryo-SEM characterization reveals novel ultrastructural features 1741 of host-parasite interaction during Chlamydia abortus infection. Histochem. Cell 1742 Biol. 142, 171–184 (2014).

1743 48. K. A. Fields, D. J. Mead, C. A. Dooley, Chlamydia trachomatis type III 1744 secretion: evidence for a functional apparatus during early‐cycle development. 1745 Molecular … (2003).

1746 49. M. Dumoux, A. Nans, H. R. Saibil, R. D. Hayward, Making connections: 1747 snapshots of chlamydial type III secretion systems in contact with host 1748 membranes. Current Opinion in Microbiology. 23, 1–7 (2015).

1749 50. M. Dumoux, D. K. Clare, H. R. Saibil, R. D. Hayward, Chlamydiae assemble a 1750 pathogen synapse to hijack the host endoplasmic reticulum. Traffic. 13, 1612– 1751 1627 (2012).

1752 51. J. L. Hodgkinson et al., Three-dimensional reconstruction of the Shigella T3SS 1753 transmembrane regions reveals 12-fold symmetry and novel features throughout. 1754 Nature Publishing Group. 16, 477–485 (2009).

1755 52. O. Schraidt, T. C. Marlovits, Three-dimensional model of Salmonella's needle 1756 complex at subnanometer resolution. Science. 331, 1192–1195 (2011).

1757 53. P. Roblin, F. Dewitte, V. Villeret, E. G. Biondi, A Salmonella type three 1758 secretion effector/chaperone complex adopts a hexameric ring-like structure. 1759 Journal of … (2015).

1760 54. P. Ghosh, Process of Protein Transport by the Type III Secretion System. 1761 Microbiology and Molecular Biology Reviews. 68, 771–795 (2004).

130

1762 55. P. Burghout et al., Structure and Electrophysiological Properties of the YscC 1763 Secretin from the Type III Secretion System of Yersinia enterocolitica. Journal 1764 of Bacteriology. 186, 4645–4654 (2004).

1765 56. R. S. Stephens et al., Genome sequence of an obligate intracellular pathogen of 1766 humans: Chlamydia trachomatis. Science. 282, 754–759 (1998).

1767 57. J. J. Mecsas, E. J. Strauss, Molecular mechanisms of bacterial virulence: type III 1768 secretion and pathogenicity islands. Emerging Infect. Dis. 2, 270–288 (1996).

1769 58. H. J. Betts-Hampikian, K. A. Fields, The chlamydial type III secretion 1770 mechanism: revealing cracks in a tough nut. The obligate intracellular lifestyle 1771 (2010).

1772 59. D. P. Wilson, P. Timms, D. L. S. Mcelwain, P. M. Bavoil, Type III Secretion, 1773 Contact-dependent Model for the Intracellular Development of Chlamydia. Bltn. 1774 Mathcal. Biology. 68, 161–178 (2006).

1775 60. H. A. Saka et al., Quantitative proteomics reveals metabolic and pathogenic 1776 properties of Chlamydia trachomatis developmental forms. Mol. Microbiol. 82, 1777 1185–1203 (2011).

1778 61. S. Hower, K. Wolf, K. A. Fields, Evidence that CT694 is a novel Chlamydia 1779 trachomatis T3S substrate capable of functioning during invasion or early cycle 1780 development. Mol. Microbiol. 72, 1423–1437 (2009).

1781 62. T. J. Jewett, N. J. Miller, C. A. Dooley, T. Hackstadt, The conserved Tarp actin 1782 binding domain is important for chlamydial invasion. PLoS Pathog. 6, e1000997 1783 (2010).

1784 63. D. R. Clifton, K. A. Fields, S. S. Grieshaber, (2004).

1785 64. T. R. Thwaites, A. T. Pedrosa, T. P. Peacock, R. A. Carabeo, Vinculin Interacts 1786 with the Chlamydia Effector TarP Via a Tripartite Vinculin Binding Domain to 1787 Mediate Actin Recruitment and Assembly at the Plasma Membrane. Front Cell 1788 Infect Microbiol. 5, 88 (2015).

1789 65. T. Thwaites, A. T. Nogueira, I. Campeotto, A. P. Silva, The Chlamydia effector 1790 TarP mimics the mammalian leucine-aspartic acid motif of paxillin to subvert the 1791 focal adhesion kinase during invasion. Journal of Biological … (2014).

1792 66. A. Hoare, P. Timms, P. M. Bavoil, D. P. Wilson, Spatial constraints within the 1793 chlamydial host cell inclusion predict interrupted development and persistence. 1794 BMC Microbiol. 8, 5 (2008).

1795 67. A. Nans, C. Ford, R. D. Hayward, Host-pathogen reorganisation during host cell 1796 entry by Chlamydia trachomatis. Microbes Infect. 17, 727–731 (2015).

131

1797 68. E. I. Shaw et al., Three temporal classes of gene expression during the 1798 Chlamydia trachomatis developmental cycle. Mol. Microbiol. 37, 913–925 1799 (2000).

1800 69. J. W. MOULDER, Interaction of chlamydiae and host cells in vitro. 1801 Microbiological Reviews. 55, 143 (1991).

1802 70. D. P. Wilson, J. A. Whittum-Hudson, P. Timms, P. M. Bavoil, Kinematics of 1803 Intracellular Chlamydiae Provide Evidence for Contact-Dependent Development. 1804 Journal of Bacteriology. 191, 5734–5742 (2009).

1805 71. B. R. Hanson, A. Slepenkin, E. M. Peterson, M. Tan, Chlamydia trachomatis 1806 Type III Secretion Proteins Regulate Transcription. Journal of Bacteriology. 197, 1807 3238–3244 (2015).

1808 72. E. I. Lutter, A. C. Barger, V. Nair, T. HACKSTADT, Chlamydia trachomatis 1809 Inclusion Membrane Protein CT228 Recruits Elements of the Myosin 1810 Phosphatase Pathway to Regulate Release Mechanisms. Cell Reports. 3, 1921 1811 (2013).

1812 73. K. Hybiske, R. S. Stephens, Mechanisms of host cell exit by the intracellular 1813 bacterium Chlamydia. Proceedings of the National \ldots (2007).

1814 74. S. A. Mojica, K. M. Hovis, M. B. Frieman, B. Tran, SINC, a type III secreted 1815 protein of Chlamydia psittaci, targets the inner nuclear membrane of infected 1816 cells and uninfected neighbors. Molecular biology of … (2015).

1817 75. H. D. Bullock, S. Hower, K. A. Fields, Domain analyses reveal that Chlamydia 1818 trachomatis CT694 protein belongs to the membrane-localized family of type III 1819 effector proteins. Journal of Biological Chemistry. 287, 28078–28086 (2012).

1820 76. D. D. Rockey, R. A. Heinzen, T. HACKSTADT, Cloning and characterization of 1821 a Chlamydia psittaci gene coding for a protein localized in the inclusion 1822 membrane of infected cells. Mol. Microbiol. 15, 617–626 (1995).

1823 77. M. A. Scidmore-Carlson, E. I. Shaw, C. A. Dooley, E. R. Fischer, T. 1824 HACKSTADT, Identification and characterization of a Chlamydia trachomatis 1825 early operon encoding four novel inclusion membrane proteins. Mol. Microbiol. 1826 33, 753–765 (1999).

1827 78. J. P. Bannantine, D. D. Rockey, Tandem genes of Chlamydia psittaci that encode 1828 proteins localized to the inclusion membrane. Microbiology (1998).

1829 79. S. Falkow, Molecular Koch's postulates applied to microbial pathogenicity. Rev. 1830 Infect. Dis. 10 Suppl 2, S274–6 (1988).

1831 80. C. M. Johnson, D. J. Fisher, Site-specific, insertional inactivation of incA in 1832 Chlamydia trachomatis using a group II intron. PLoS ONE (2013).

132

1833 81. M. M. Weber et al., A functional core of IncA is required for Chlamydia 1834 trachomatis inclusion fusion. Journal of Bacteriology (2016), 1835 doi:10.1128/JB.00933-15.

1836 82. D. R. Boone, R. W. Castenholz, G. M. Garrity, N. R. Krieg, Bergey's Manual of 1837 Systematic Bacteriology: Volume 4: The Bacteroidetes, Spirochaetes, 1838 Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, … (2011).

1839 83. D. D. Rockey, D. Grosenbach, D. E. Hruby, Chlamydia psittaci IncA is 1840 phosphorylated by the host cell and is exposed on the cytoplasmic face of the 1841 developing inclusion. Molecular … (1997).

1842 84. D. D. Rockey, E. R. Fischer, T. HACKSTADT, Temporal analysis of the 1843 developing Chlamydia psittaci inclusion by use of fluorescence and electron 1844 microscopy. Infection and Immunity. 64, 4269–4278 (1996).

1845 85. I. Derré, Chlamydiae interaction with the endoplasmic reticulum: contact, 1846 function and consequences. Cellular Microbiology. 17, 959–966 (2015).

1847 86. C. A. Elwell, J. N. Engel, Lipid acquisition by intracellular Chlamydiae - Elwell 1848 - 2012 - Cellular Microbiology - Wiley Online Library. Cellular Microbiology 1849 (2012).

1850 87. H. Agaisse, I. Derré, Expression of the effector protein IncD in Chlamydia 1851 trachomatis mediates recruitment of the lipid transfer protein CERT and the 1852 endoplasmic reticulum-resident …. Infection and Immunity (2014).

1853 88. C. Van Ooij, L. Kalman, S. Van Ijzendoorn, Host cell‐derived sphingolipids are 1854 required for the intracellular growth of Chlamydia trachomatis. Cellular … 1855 (2000).

1856 89. J. P. Bannantine, W. E. Stamm, R. J. Suchland, D. D. Rockey, Chlamydia 1857 trachomatis IncA is localized to the inclusion membrane and is recognized by 1858 antisera from infected humans and primates. Infection and Immunity. 66, 6017– 1859 6021 (1998).

1860 90. R. J. Suchland, D. D. Rockey, J. P. Bannantine, W. E. Stamm, Isolates of 1861 Chlamydia trachomatis that occupy nonfusogenic inclusions lack IncA, a protein 1862 localized to the inclusion membrane. Infection and Immunity. 68, 360–367 1863 (2000).

1864 91. T. HACKSTADT, M. A. Scidmore-Carlson, E. I. Shaw, E. R. Fischer, The 1865 Chlamydia trachomatis IncA protein is required for homotypic vesicle fusion. 1866 Cellular Microbiology. 1, 119–130 (1999).

1867 92. A. Subtil, C. Parsot, A. Dautry-Varsat, Secretion of predicted Inc proteins of 1868 Chlamydia pneumoniae by a heterologous type III machinery. Mol. Microbiol. 1869 39, 792–800 (2001).

133

1870 93. S. V. Pais, C. Milho, F. Almeida, L. J. Mota, Identification of novel type III 1871 secretion chaperone-substrate complexes of Chlamydia trachomatis. PLoS ONE. 1872 8, e56292 (2013).

1873 94. D. R. Clifton et al., A chlamydial type III translocated protein is tyrosine- 1874 phosphorylated at the site of entry and associated with recruitment of actin. Proc. 1875 Natl. Acad. Sci. U.S.A. 101, 10166–10171 (2004).

1876 95. K. A. Fields, T. HACKSTADT, Evidence for the secretion of Chlamydia 1877 trachomatis CopN by a type III secretion mechanism. Mol. Microbiol. 38, 1048– 1878 1060 (2000).

1879 96. K. M. Hovis et al., Genus-optimized strategy for the identification of chlamydial 1880 type III secretion substrates. Pathog Dis. 69, 213–222 (2013).

1881 97. J. P. Bannantine, R. S. Griffiths, W. Viratyosin, W. J. Brown, D. D. Rockey, A 1882 secondary structure motif predictive of protein localization to the chlamydial 1883 inclusion membrane. Cellular Microbiology. 2, 35–47 (2000).

1884 98. S. T. Cole et al., Deciphering the biology of Mycobacterium tuberculosis from 1885 the complete genome sequence. Nature. 393, 537–544 (1998).

1886 99. C. Delevoye, M. Nilges, A. Dautry-Varsat, Conservation of the Biochemical 1887 Properties of IncA from Chlamydia trachomatis and Chlamydia caviae 1888 OLIGOMERIZATION OF IncA MEDIATES …. Journal of Biological … 1889 (2004).

1890 100. C. W. Armitage et al., Divergent outcomes following transcytosis of IgG 1891 targeting intracellular and extracellular chlamydial antigens. Immunol. Cell Biol. 1892 92, 417–426 (2014).

1893 101. W. M. Geisler, R. J. Suchland, D. D. Rockey, W. E. Stamm, Epidemiology and 1894 clinical manifestations of unique Chlamydia trachomatis isolates that occupy 1895 nonfusogenic inclusions. J. Infect. Dis. 184, 879–884 (2001).

1896 102. D. D. Rockey, W. Viratyosin, J. P. Bannantine, R. J. Suchland, W. E. Stamm, 1897 Diversity within inc genes of clinical Chlamydia trachomatis variant isolates that 1898 occupy non-fusogenic inclusions. Microbiology (Reading, Engl.). 148, 2497– 1899 2505 (2002).

1900 103. W. J. Brown, Y. A. W. Skeiky, P. Probst, D. D. Rockey, Chlamydial Antigens 1901 Colocalize within IncA-Laden Fibers Extending from the Inclusion Membrane 1902 into the Host Cytosol. Infection and Immunity. 70, 5860–5864 (2002).

1903 104. D. K. Giles, J. D. Whittimore, R. W. LaRue, J. E. Raulston, P. B. Wyrick, 1904 Ultrastructural analysis of chlamydial antigen-containing vesicles everting from 1905 the Chlamydia trachomatis inclusion. Microbes Infect. 8, 1579–1591 (2006).

134

1906 105. R. J. Suchland, D. D. Rockey, S. K. Weeks, Development of secondary 1907 inclusions in cells infected by Chlamydia trachomatis. Infection and … (2005).

1908 106. D. Alzhanov, J. Barnes, D. E. Hruby, D. D. Rockey, Chlamydial development is 1909 blocked in host cells transfected with Chlamydophila caviae incA. BMC 1910 Microbiol. 4, 24 (2004).

1911 107. K. Wolf, E. Fischer, T. HACKSTADT, Ultrastructural analysis of developmental 1912 events in Chlamydia pneumoniae-infected cells. Infection and Immunity. 68, 1913 2379–2385 (2000).

1914 108. C. Delevoye et al., SNARE Protein Mimicry by an Intracellular Bacterium. PLoS 1915 Pathog. 4, e1000022 (2008).

1916 109. F. Paumet et al., Intracellular Bacteria Encode Inhibitory SNARE-Like Proteins. 1917 PLoS ONE. 4, e7375 (2009).

1918 110. E. Ronzone, F. Paumet, Two coiled-coil domains of Chlamydia trachomatis IncA 1919 affect membrane fusion events during infection. PLoS ONE. 8, e69769 (2013).

1920 111. C. M. Schauder et al., Structure of a lipid-bound extended synaptotagmin 1921 indicates a role in lipid transfer. Nature. 510, 552–555 (2014).

1922 112. E. Ronzone et al., An α-helical core encodes the dual functions of the chlamydial 1923 protein IncA. Journal of Biological Chemistry. 289, 33469–33480 (2014).

1924 113. T. S. Richards, A. E. Knowlton, S. S. Grieshaber, Chlamydia trachomatis 1925 homotypic inclusion fusion is promoted by host microtubule trafficking. BMC 1926 Microbiol. 13, 185 (2013).

1927 114. M. A. Poirier et al., The synaptic SNARE complex is a parallel four-stranded 1928 helical bundle. Nat. Struct. Biol. 5, 765–769 (1998).

1929 115. J. L. Cocchiaro, Y. Kumar, E. R. Fischer, T. Hackstadt, R. H. Valdivia, 1930 Cytoplasmic lipid droplets are translocated into the lumen of the Chlamydia 1931 trachomatis parasitophorous vacuole. Proc. Natl. Acad. Sci. U.S.A. 105, 9379– 1932 9384 (2008).

1933 116. D. K. Robertson, L. Gu, R. K. Rowe, W. L. Beatty, Inclusion Biogenesis and 1934 Reactivation of Persistent Chlamydia trachomatis Requires Host Cell 1935 Sphingolipid Biosynthesis. PLoS Pathog. 5, e1000664 (2009).

1936 117. J. P. Bombardier, M. Munson, Three steps forward, two steps back: mechanistic 1937 insights into the assembly and disassembly of the SNARE complex. Curr Opin 1938 Chem Biol. 29, 66–71 (2015).

1939 118. D. Min et al., Mechanical unzipping and rezipping of a single SNARE complex 1940 reveals hysteresis as a force-generating mechanism. Nat Commun. 4, 1705

135

1941 (2013).

1942 119. E. Hui, C. P. Johnson, J. Yao, F. M. Dunning, E. R. Chapman, Synaptotagmin- 1943 Mediated Bending of the Target Membrane Is a Critical Step in Ca2+-Regulated 1944 Fusion. Cell. 138, 709–721 (2009).

1945 120. K. S. Rahman et al., Defining species-specific immunodominant B cell epitopes 1946 for molecular serology of Chlamydia species. Clin. Vaccine Immunol. 22, 539– 1947 552 (2015).

1948 121. L. Volceanov et al., Septins arrange F-actin-containing fibers on the Chlamydia 1949 trachomatis inclusion and are required for normal release of the inclusion by 1950 extrusion. MBio. 5, e01802–14 (2014).

1951 122. K. M. Mirrashidi, C. A. Elwell, E. Verschueren, J. R. Johnson, Global mapping 1952 of the inc-human interactome reveals that retromer restricts Chlamydia infection. 1953 Cell host & … (2015).

1954 123. L. Aeberhard et al., The Proteome of the Isolated Chlamydia trachomatis 1955 Containing Vacuole Reveals a Complex Trafficking Platform Enriched for 1956 Retromer Components. PLoS Pathog. 11, e1004883 (2015).

1957 124. C. Mim, H. Cui, J. Gawronski-Salerno, A. Frost, E. al, Structural Basis of 1958 Membrane Bending by the N-BAR Protein Endophilin. Cell (2012).

1959 125. B. R. Capraro et al., Kinetics of endophilin N-BAR domain dimerization and 1960 membrane interactions. Journal of Biological Chemistry. 288, 12533–12543 1961 (2013).

1962 126. W. Li et al., The EMBL-EBI bioinformatics web and programmatic tools 1963 framework. Nucleic Acids Research. 43, W580–4 (2015).

1964 127. F. Sievers et al., Fast, scalable generation of high-quality protein multiple 1965 sequence alignments using Clustal Omega. Molecular Systems Biology. 7, 539 1966 (2011).

1967 128. H. McWilliam et al., Analysis Tool Web Services from the EMBL-EBI. Nucleic 1968 Acids Research. 41, W597–600 (2013).

1969 129. K. Katoh, D. M. Standley, MAFFT multiple sequence alignment software 1970 version 7: improvements in performance and usability. Molecular Biology and 1971 Evolution. 30, 772–780 (2013).

1972 130. J. Kyte, R. F. Doolittle, A simple method for displaying the hydropathic 1973 character of a protein. Journal of molecular biology. 157, 105–132 (1982).

1974 131. M. R. Wilkins et al., Protein identification and analysis tools in the ExPASy 1975 server. Methods in molecular biology (Clifton, N.J.). 112, 531–552 (1999).

136

1976 132. S. R. Eddy, A new generation of homology search tools based on probabilistic 1977 inference (2009).

1978 133. W. P. Maddison, D. R. Maddison, Mesquite: a modular system for evolutionary 1979 analysis. v3. 02 (2015).

1980 134. A. Stamatakis, P. Hoover, A rapid bootstrap algorithm for the RAxML web 1981 servers. Systematic \ldots (2008).

1982 135. A. Rambaut, A. Drummond, FigTree: Tree figure drawing tool, version 1.2. 2 1983 (2008).

1984 136. Q. Wang, H. Y. K. Kaan, R. N. Hooda, S. L. Goh, H. Sondermann, Structure and 1985 plasticity of Endophilin and Sorting Nexin 9. Structure. 16, 1574–1587 (2008).

1986 137. A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated 1987 protein structure and function prediction. Nat Protoc. 5, 725–738 (2010).

1988 138. Y. Zhang, I-TASSER server for protein 3D structure prediction. BMC 1989 bioinformatics (2008).

1990 139. J. Yang et al., The I-TASSER Suite: protein structure and function prediction. 1991 Nature methods (2015).

1992 140. T. HACKSTADT, E. R. Fischer, M. A. Scidmore, D. D. Rockey, Origins and 1993 functions of the chlamydial inclusion. Trends Microbiol. 5, 288 (1997).

1994 141. P. M. Bavoil, R. C. Hsia, Type III secretion in Chlamydia: a case of de\'ja\` vu? 1995 Mol. Microbiol. 28, 860–862 (1998).

1996 142. D. Beeckman, J. P. Timmermans, P. Van Oostveldt, Identification and 1997 characterization of a type III secretion system in Chlamydophila psittaci. 1998 Veterinary … (2008).

1999 143. V. Grinblat, Genome sequences of the zoonotic pathogens Chlamydia psittaci 2000 6BC and Cal10. Journal of \ldots (2011).

2001 144. R. J. Bastidas, C. A. Elwell, J. N. Engel, R. H. Valdivia, Chlamydial Intracellular 2002 Survival Strategies. Cold Spring Harbor Perspectives in Medicine. 3, a010256 2003 (2013).

2004 145. T. HACKSTADT, Redirection of host vesicle trafficking pathways by 2005 intracellular parasites. Traffic. 1, 93–99 (2001).

2006 146. A. R. Lipinski et al., Rab6 and Rab11 regulate Chlamydia trachomatis 2007 development and golgin-84-dependent Golgi fragmentation. PLoS Pathog. 5, 2008 e1000615 (2009).

137

2009 147. E. R. Moore, S. P. Ouellette, Reconceptualizing the chlamydial inclusion as a 2010 pathogen-specified parasitic organelle: an expanded role for Inc proteins. Front 2011 Cell Infect Microbiol. 4, 157 (2014).

2012 148. M. Gallon, P. J. Cullen, Retromer and sorting nexins in endosomal sorting. 2013 Biochem. Soc. Trans. 43, 33–47 (2015).

2014 149. K. A. Christensen, B. A. Krantz, R. J. Collier, Assembly and disassembly 2015 kinetics of anthrax toxin complexes. Biochemistry. 45, 2380–2386 (2006).

2016 150. C. Hughes, P. Maharg, P. Rosario, Possible nosocomial transmission of 2017 psittacosis. Infection Control and Hospital Epidemiology. 18, 165 (1997).

2018 151. I. Ito, T. Ishida, M. Mishima, M. Osawa, M. Arita, Familial cases of psittacosis: 2019 possible person-to-person transmission. Internal Medicine. 41, 580 (2002).

2020 152. A. J. Carey, K. W. Beagley, REVIEW ARTICLE: Chlamydia trachomatis, a 2021 Hidden Epidemic: Effects on Female Reproduction and Options for Treatment. 2022 American journal of reproductive \ldots (2010).

2023 153. P. Dehoux, R. Flores, C. Dauga, Multi-genome identification and 2024 characterization of chlamydiae-specific type III secretion substrates: the Inc 2025 proteins. BMC \ldots (2011).

2026 154. M. E. Pennini, S. Perrinet, A. Dautry-Varsat, A. Subtil, Histone Methylation by 2027 NUE, a Novel Nuclear Effector of the Intracellular Pathogen Chlamydia 2028 trachomatis. PLoS Pathog. 6, e1000995 (2010).

2029 155. K. Sachse, P. M. Bavoil, B. Kaltenboeck, Emendation of the family 2030 Chlamydiaceae: proposal of a single genus, Chlamydia, to include all currently 2031 recognized species. Systematic and applied \ldots (2015).

2032 156. D. Yarar, M. C. Surka, M. C. Leonard, S. L. Schmid, SNX9 activities are 2033 regulated by multiple phosphoinositides through both PX and BAR domains. 2034 Traffic. 9, 133–146 (2008).

2035 157. M. Simunovic, G. A. Voth, A. Callan-Jones, P. Bassereau, When Physics Takes 2036 Over: BAR Proteins and Membrane Curvature. Trends Cell Biol. 25, 780–792 2037 (2015).

2038 158. J. R. T. van Weering et al., Molecular basis for SNX-BAR-mediated assembly of 2039 distinct endosomal sorting tubules. The EMBO Journal. 31, 4466–4480 (2012).

2040 159. B. J. Peter et al., BAR domains as sensors of membrane curvature: the 2041 amphiphysin BAR structure. Science. 303, 495–499 (2004).

2042 160. M. Masuda et al., Endophilin BAR domain drives membrane curvature by two 2043 newly identified structure-based mechanisms. The EMBO Journal. 25, 2889–

138

2044 2897 (2006).

2045 161. J. Park, H. Zhao, S. Chang, The Unique Mechanism of SNX9 BAR Domain for 2046 Inducing Membrane Tubulation. Molecules and cells (2014).

2047 162. X. Zhao, D. Wang, X. Liu, L. Liu, Z. Song, Phosphorylation of the Bin, 2048 Amphiphysin, and RSV161/167 (BAR) domain of ACAP4 regulates membrane 2049 tubulation. Proceedings of the National Academy of Sciences. 110, 11023 (2013).

2050 163. J. Coutinho, The F-BAR domains from srGAP1, srGAP2 and srGAP3 regulate 2051 membrane deformation differently. Journal of cell \ldots (2012).

2052 164. V. Braun, A. Wong, M. Landekic, W. J. Hong, Sorting nexin 3 (SNX3) is a 2053 component of a tubular endosomal network induced by Salmonella and involved 2054 in maturation of the Salmonella‐containing vacuole. Cellular Microbiology. 12, 2055 1352 (2010).

2056 165. M. V. Bujny, P. A. Ewels, S. Humphrey, N. Attar, Sorting nexin-1 defines an 2057 early phase of Salmonella-containing vacuole-remodeling during Salmonella 2058 infection. Journal of cell \ldots (2008).

2059 166. K. J. Roux, D. I. Kim, M. Raida, B. Burke, A promiscuous biotin ligase fusion 2060 protein identifies proximal and interacting proteins in mammalian cells. The 2061 Journal of Cell Biology (2012).

2062 167. K. J. Roux, D. I. Kim, B. Burke, BioID: A Screen for Protein‐Protein 2063 Interactions. Current Protocols in Protein \ldots (2013).

2064 168. S. L. Marcus, L. A. Knodler, B. B. Finlay, Salmonella enterica serovar 2065 Typhimurium effector SigD/SopB is membrane‐associated and ubiquitinated 2066 inside host cells. Cellular Microbiology (2002).

2067 169. Y. Leung, S. Ally, M. B. Goldberg, Bacterial actin assembly requires toca-1 to 2068 relieve N-wasp autoinhibition. Cell Host & Microbe (2008).

2069 170. A. Roujeinikova, Phospholipid binding residues of eukaryotic membrane- 2070 remodelling F-BAR domain proteins are conserved in Helicobacter pylori CagA. 2071 BMC research notes (2014).

2072 171. C. Burd, P. J. Cullen, Retromer: a master conductor of endosome sorting. Cold 2073 Spring Harbor Perspectives in \ldots (2014).

2074 172. F. Li et al., Sorting nexin 5 and dopamine d1 receptor regulate the expression of 2075 the insulin receptor in human renal proximal tubule cells. Endocrinology. 156, 2076 2211–2221 (2015).

2077 173. D. Henaff, S. Salinas, An endocytic CARriage tale: Adenoviruses internalization 2078 and trafficking in neurons. Virulence (2010).

139

2079 174. G. de Vreede, J. D. Schoenfeld, S. L. Windler, The Scribble module regulates 2080 retromer-dependent endocytic trafficking during epithelial polarization (2014).

2081 175. B. Zhou, The Role of Retromer in Regulating the Apical-Basal Polarity and the 2082 Immune Response during Drosophila Development (2012).

2083 176. C. N. Arighi, L. M. Hartnell, R. C. Aguilar, C. R. Haft, Role of the mammalian 2084 retromer in sorting of the cation-independent mannose 6-phosphate receptor. The 2085 Journal of cell \ldots (2004).

2086 177. R. T. Böttcher, C. Stremmel, A. Meves, H. Meyer, Sorting nexin 17 prevents 2087 lysosomal degradation of [beta] 1 integrins by binding to the [beta] 1-integrin tail 2088 (2012) (available at 2089 http://www.nature.com/ncb/journal/v14/n6/abs/ncb2501.html).

2090 178. F. Steinberg, K. J. Heesom, M. D. Bass, P. J. Cullen, SNX17 protects integrins 2091 from degradation by sorting between lysosomal and recycling pathways. The 2092 Journal of Cell Biology. 197, 219 (2012).

2093 179. M. G. Chavez et al., Differential Downregulation of E-Cadherin and Desmoglein 2094 by Epidermal Growth Factor. Dermatology Research and Practice. 2012, 1 2095 (2012).

2096 180. J. R. T. van Weering, P. Verkade, P. J. Cullen, SNX-BAR-Mediated Endosome 2097 Tubulation is Co-ordinated with Endosome Maturation. Traffic. 13, 94 (2011).

2098 181. S. J. Singer, G. L. Nicolson, The fluid mosaic model of the structure of cell 2099 membranes. Science. 175, 720–731 (1972).

2100 182. Z. Shi, T. Baumgart, Dynamics and instabilities of lipid bilayer membrane 2101 shapes. Adv Colloid Interface Sci. 208, 76–88 (2014).

2102 183. Y. Shibata, J. Hu, M. M. Kozlov, T. A. Rapoport, Mechanisms shaping the 2103 membranes of cellular organelles. Annu. Rev. Cell Dev. Biol. 25, 329–354 2104 (2009).

2105 184. J. Zimmerberg, S. McLaughlin, Membrane curvature: how BAR domains bend 2106 bilayers. Curr. Biol. 14, R250–2 (2004).

2107 185. A. H. Y. Tong et al., A combined experimental and computational strategy to 2108 define protein interaction networks for peptide recognition modules. Science. 2109 295, 321–324 (2002).

2110 186. C. Tarricone et al., The structural basis of Arfaptin-mediated cross-talk between 2111 Rac and Arf signalling pathways. Nature. 411, 215–219 (2001).

2112 187. K. Farsad et al., Generation of high curvature membranes mediated by direct 2113 endophilin bilayer interactions. The Journal of Cell Biology. 155, 193–200

140

2114 (2001).

2115 188. J. L. Gallop et al., Mechanism of endophilin N-BAR domain-mediated 2116 membrane curvature. The EMBO Journal. 25, 2898–2910 (2006).

2117 189. A. Razzaq et al., Amphiphysin is necessary for organization of the excitation- 2118 contraction coupling machinery of muscles, but not for synaptic vesicle 2119 endocytosis in Drosophila. Genes Dev. 15, 2967–2979 (2001).

2120 190. K. Takei, V. I. Slepnev, V. Haucke, P. De Camilli, Functional partnership 2121 between amphiphysin and dynamin in clathrin-mediated endocytosis. Nat. Cell 2122 Biol. 1, 33–39 (1999).

2123 191. T. H. Millard et al., Structural basis of filopodia formation induced by the 2124 IRSp53/MIM homology domain of human IRSp53. The EMBO Journal. 24, 2125 240–250 (2005).

2126 192. P. K. Mattila et al., Missing-in-metastasis and IRSp53 deform PI(4,5)P2-rich 2127 membranes by an inverse BAR domain-like mechanism. The Journal of Cell 2128 Biology. 176, 953–964 (2007).

2129 193. S. Suetsugu et al., The RAC binding domain/IRSp53-MIM homology domain of 2130 IRSp53 induces RAC-dependent membrane deformation. J. Biol. Chem. 281, 2131 35347–35358 (2006).

2132 194. A. Disanza et al., CDC42 switches IRSp53 from inhibition of actin growth to 2133 elongation by clustering of VASP. The EMBO Journal. 32, 2735–2750 (2013).

2134 195. A. Pykäläinen et al., Pinkbar is an epithelial-specific BAR domain protein that 2135 generates planar membrane structures. Nature Publishing Group. 18, 902–907 2136 (2011).

2137 196. K. Yamamoto, J. Ando, Vascular endothelial cell membranes differentiate 2138 between stretch and shear stress through transitions in their lipid phases. 2139 American Journal of Physiology - Heart and Circulatory Physiology. 309, 2140 H1178 (2015).

2141 197. C. Gérard, A. Goldbeter, Dynamics of the mammalian cell cycle in physiological 2142 and pathological conditions. 8, 140–156 (2015).

2143 198. V. Vogel, M. Sheetz, Local force and geometry sensing regulate cell functions. 2144 Nat. Rev. Mol. Cell Biol. 7, 265 (2006).

2145 199. P. Y. Tan, R. Zaidel-Bar, Transient membrane localization of SPV-1 drives 2146 cyclical actomyosin contractions in the C. elegans spermatheca. Current Biology. 2147 25, 141–151 (2014).

2148 200. B. Habermann, The BAR-domain family of proteins: a case of bending and

141

2149 binding? EMBO Rep. 5, 250–255 (2004).

2150 201. M. Masuda, N. Mochizuki, Structural characteristics of BAR domain 2151 superfamily to sculpt the membrane. Semin. Cell Dev. Biol. 21, 391–398 (2010).

2152 202. A. B. Jaffe, A. Hall, Rho GTPases: biochemistry and biology. Annu. Rev. Cell 2153 Dev. Biol. 21, 247–269 (2005).

2154 203. M. A. Salazar et al., Tuba, a novel protein containing bin/amphiphysin/Rvs and 2155 Dbl homology domains, links dynamin to regulation of the actin cytoskeleton. J. 2156 Biol. Chem. 278, 49031–49043 (2003).

2157 204. N. Richnau, P. Aspenström, Rich, a rho GTPase-activating protein domain- 2158 containing protein involved in signaling by Cdc42 and Rac1. J. Biol. Chem. 276, 2159 35060–35070 (2001).

2160 205. J. D. Rotty, C. Wu, J. E. Bear, New insights into the regulation and cellular 2161 functions of the ARP2/3 complex. Nat. Rev. Mol. Cell Biol. 14, 7–12 (2013).

2162 206. J. C. de Groot et al., Structural basis for complex formation between human 2163 IRSp53 and the translocated intimin receptor Tir of enterohemorrhagic E. coli. 2164 Structure. 19, 1294–1306 (2011).

2165 207. C.-R. Yi, M. B. Goldberg, Enterohemorrhagic Escherichia coli raises the I-BAR. 2166 Proc. Natl. Acad. Sci. U.S.A. 106, 6431–6432 (2009).

2167 208. K. G. Campellone et al., Repetitive N-WASP-binding elements of the 2168 enterohemorrhagic Escherichia coli effector EspF(U) synergistically activate 2169 actin assembly. PLoS Pathog. 4, e1000191 (2008).

2170 209. H. Knævelsrud et al., Membrane remodeling by the PX-BAR protein SNX18 2171 promotes autophagosome formation. The Journal of Cell Biology. 202, 331–349 2172 (2013).

2173 210. T. Wassmer, N. Attar, M. Harterink, J. van Weering, The retromer coat complex 2174 coordinates endosomal sorting and dynein-mediated transport, with carrier 2175 recognition by the trans-Golgi network. Developmental Cell (2009).

2176 211. H. Stenmark, Rab GTPases as coordinatorsof vesicle traffic. Nat. Rev. Mol. Cell 2177 Biol. 10, 513–525 (2009).

2178 212. M. V. Bujny, V. Popoff, L. Johannes, The retromer component sorting nexin-1 is 2179 required for efficient retrograde transport of Shiga toxin from early endosome to 2180 the trans Golgi network. Journal of cell \ldots (2007).

2181 213. A. Utskarpen, H. H. Slagsvold, A. B. Dyve, SNX1 and SNX2 mediate retrograde 2182 transport of Shiga toxin. Biochemical and \ldots (2007).

142

2183 214. I. Mellman, Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 2184 (1996).

2185 215. D. Heuer et al., Chlamydia causes fragmentation of the Golgi compartment to 2186 ensure reproduction. Nature. 457, 731–735 (2008).

2187 216. A. K. Gillingham, S. Munro, Finding the Golgi: Golgin Coiled-Coil Proteins 2188 Show the Way. Trends Cell Biol. (2016), doi:10.1016/j.tcb.2016.02.005.

2189 217. S. C. Klinger, P. Siupka, M. S. Nielsen, Retromer-Mediated Trafficking of 2190 Transmembrane Receptors and Transporters. Membranes. 5, 288–306 (2015).

2191 218. N. Borth et al., Functional interaction between type III-secreted protein IncA of 2192 Chlamydophila psittaci and human G3BP1. PLoS ONE. 6, e16692 (2011).

2193 219. P. Temkin et al., SNX27 mediates retromer tubule entry and endosome-to- 2194 plasma membrane trafficking of signalling receptors. Nat. Cell Biol. 13, 715–721 2195 (2011).

2196 220. T. Taraska et al., The late chlamydial inclusion membrane is not derived from 2197 the endocytic pathway and is relatively deficient in host proteins. Infection and 2198 Immunity. 64, 3713–3727 (1996).

2199 221. S. Böcker et al., Chlamydia psittaci inclusion membrane protein IncB associates 2200 with host protein Snapin. 304, 542–553 (2014).

2201 222. R. Regazzi, Molecular Mechanisms of Exocytosis (Springer Science & Business 2202 Media, 2008).

2203 223. B. Pallavi, R. Nagaraj, Palmitoylated peptides from the cysteine-rich domain of 2204 SNAP-23 cause membrane fusion depending on peptide length, position of 2205 cysteines, and extent of palmitoylation. J. Biol. Chem. 278, 12737–12744 (2003).

2206 224. W. M. Geisler, R. J. Suchland, W. L. Whittington, W. E. Stamm, Quantitative 2207 culture of Chlamydia trachomatis: relationship of inclusion-forming units 2208 produced in culture to clinical manifestations and acute inflammation in 2209 urogenital disease. 184, 1350–1354 (2001).

2210 225. D. P. Wilson, A. K. Bowlin, P. M. Bavoil, R. G. Rank, Ocular pathologic 2211 response elicited by Chlamydia organisms and the predictive value of 2212 quantitative modeling. J. Infect. Dis. 199, 1780–1789 (2009).

2213 226. J. J. Alexander, Effect of infection with the meningopneumonitis agent on 2214 deoxyribonucleic acid and protein synthesis by its L-cell host. Journal of 2215 Bacteriology. 97, 653–657 (1969).

2216 227. S. A. Mathews, K. M. Volp, P. Timms, Development of a quantitative gene 2217 expression assay for Chlamydia trachomatis identified temporal expression of

143

2218 sigma factors. FEBS Letters. 458, 354–358 (1999).

2219 228. I. Miyairi, O. S. Mahdi, S. P. Ouellette, R. J. Belland, G. I. Byrne, Different 2220 growth rates of Chlamydia trachomatis biovars reflect pathotype. J. Infect. Dis. 2221 194, 350–357 (2006).

2222 229. D. P. Wilson, S. Mathews, C. Wan, A. N. Pettitt, D. L. S. Mcelwain, Use of a 2223 quantitative gene expression assay based on micro-array techniques and a 2224 mathematical model for the investigation of chlamydial generation time. Bltn. 2225 Mathcal. Biology. 66, 523–537 (2004).

2226

144