IBD2 Encodes a Novel Component of the Bub2p-Dependent Spindle Checkpoint in the Budding Yeast Saccharomyces Cerevisiae

IBD2 Encodes a Novel Component of the Bub2p-Dependent Spindle Checkpoint in the Budding Yeast Saccharomyces cerevisiae

Hyung-Seo Hwang and Kiwon Song1 Department of Biochemistry, College of Science, Yonsei University, Seoul 120-749, Korea Manuscript received November 30, 2001 Accepted for publication March 25, 2002

ABSTRACT During mitosis, genomic integrity is maintained by the proper coordination of mitotic events through the spindle checkpoint. The bifurcated spindle checkpoint blocks cell cycle progression at metaphase by monitoring unattached kinetochores and inhibits mitotic exit in response to the incorrect orientation of the mitotic spindle. Bfa1p is a spindle checkpoint regulator of budding yeast in the Bub2p checkpoint pathway for proper mitotic exit. We have isolated a novel Bfa1p interacting protein named Ibd2p in the budding yeast Saccharomyces cerevisiae. We found that IBD2 (Inhibition of Bud Division 2) is not an essential gene but its deletion mutant proceeded through the cell cycle in the presence of microtubule-destabilizing drugs, thereby inducing a sharp decrease in viability. In addition, overexpression of Mps1p caused partial mitotic arrest in ibd2⌬ as well as in bub2⌬, suggesting that IBD2 encodes a novel component of the spindle checkpoint downstream of MPS1. Overexpression of Ibd2p induced mitotic arrest with increased levels of Clb2p in wild type and mad2⌬, but not in deletion mutants of BUB2 and BFA1. Pds1p was also stabilized by the overexpression of Ibd2p in wild-type cells. The mitotic arrest defects observed in ibd2⌬ in the presence of nocodazole were restored by additional copies of BUB2, BFA1, and CDC5, whereas an extra copy of IBD2 could not rescue the mitotic arrest defects of bub2⌬ and bfa1⌬. The mitotic arrest defects of ibd2⌬ were not recovered by MAD2, or vice versa. Analysis of the double mutant combinations ibd2⌬mad2⌬, ibd2⌬bub2⌬, and ibd2⌬dyn1⌬ showed that IBD2 belongs to the BUB2 epistasis group. Taken together, these data demonstrate that IBD2 encodes a novel component of the BUB2-dependent spindle checkpoint pathway that functions upstream of BUB2 and BFA1.

ELLS ensure genomic integrity in each division dle checkpoint in the absence of any spindle damage C through checkpoints that control cell cycle pro- in wild-type cells but not in other spindle checkpoint gressions by monitoring the successful completion of mutants, placing MPS1 upstream of other spindle check- preceding processes. One mitotic checkpoint, known point genes (Hardwick et al. 1996). The spindle check- as the spindle checkpoint, monitors the assembly and point bifurcates into two separate signaling pathways, orientation of the mitotic spindle for the equal segrega- the MAD/BUB spindle assembly checkpoint for meta- tion of replicated chromosomes during mitosis. By sens- phase arrest and the BUB2-dependent pathway to block ing defects in the microtubule cytoskeleton, the spindle mitotic exit and cytokinesis (Alexandru et al. 1999; Li checkpoint arrests cells at metaphase and prevents exit 1999). from mitosis through the regulation of Cdk activity. Bub1p, Bub3p, Mad1p, Mad2p, and Mad3p form a The spindle checkpoint is vital for maintaining genomic conserved spindle assembly checkpoint that monitors stability during cell division, and deficiency of this the attachment of bipolar microtubules to the kineto- checkpoint can lead to genomic instability associated chores of sister chromatids and delays the metaphase- with cancer (Cahill et al. 1998). Genetic studies in to-anaphase transition in response to spindle assembly budding yeast have identified several components of defects by inhibiting Cdc20p (Fang et al. 1998; Hwang the spindle checkpoint by isolating mutants that could et al. 1998). Cdc20p is a key component of the anaphase- no longer sense spindle depolymerization and died rap- promoting complex (APC) that targets the B-type cyclin idly in the presence of microtubule-depolymerizing Clb5p and the anaphase inhibitor Pds1p for degrada- drugs such as nocodazole or benomyl (Hoyt et al. 1991; tion by ubiquitin-mediated proteolysis to trigger chro- Li and Murray 1991). These components include mosome separation for anaphase onset (Zachariae et MAD1, MAD2, MAD3, BUB1, BUB2, BUB3, and MPS1. al. 1998; Shirayama et al. 1999). Homologs of yeast Overexpression of MPS1 is sufficient to activate the spin- Mad1p, Mad2p, Bub1p, and Bub3p have been identified and localized to unattached kinetochores in higher eukaryotes, including mammalian cells (Chen et al. 1996, 1998; Taylor and McLeon 1997; Taylor et al. 1998; 1Corresponding author: Department of Biochemistry, College of Sci- ence, Yonsei University, Seoul 120-749, Korea. Martinez-Exposito et al. 1999), although the mecha- E-mail: [email protected] nism that senses spindle defects is not yet understood.

Genetics 161: 595–609 ( June 2002) 596 H.-S. Hwang and K. Song

Vertebrate homologs of Cdc20p and Pds1p have also cells treated with 15 ␮g/ml of nocodazole for 0, 3, and 6 hr, been identified, suggesting that spindle assembly check- respectively, was plated on YPD without any nocodazole, and the percentage viability at each time point was calculated by point mechanisms are also conserved in eukaryotes dividing the number of colonies formed at 0, 3, or 6 hr by (Zou et al. 1999). the number at time 0 (Straight and Murray 1997). For Bub2p is present in the spindle pole body, the micro- plate assays, equivalent numbers of cells grown in YPD to an Ϫ tubule-organizing center in yeast, and forms a separate OD600 of 1.0 were serially diluted, spotted onto both YPD ( ) ϩ ␮ branch of the spindle checkpoint pathway that controls benomyl and YPD ( ) benomyl (10 g/ml) plates, and incubated at 25Њ for 3–4 days. To assay cell cycle progression, cells mitotic exit and the timing of cytokinesis (Fesquet et with an extra new bud(s) were counted after cells arrested al. 1999; Fraschini et al. 1999; Li 1999). In the fission with ␣-factor were released in the presence of nocodazole yeast Schizosaccharomyces pombe, the Bub2p homolog (15 ␮g/ml) for 3 hr. Before counting, cells from each time Cdc16p interacts with Byr4p to form a two-component point were briefly fixed in 70% ethanol and sonicated lightly. GTPase activating protein (GAP) that stimulates the Yeast two-hybrid screen: Yeast two-hybrid screening was performed essentially by following Gyuris et al. (1993). The full- GTPase activity of Spg1p to coordinate the onset of length BFA1 subcloned into pLex202 ϩ PL was used as the cytokinesis (Furge et al. 1998; Jwa and Song 1998). bait for the screen. For the interactor hunt, EGY48 with BFA1/ BFA1, a putative byr4 homolog in budding yeast that has pLex202 ϩ PL was transformed with a cDNA library in pJG4-5, also been known as IBD1 and BYR4, has been reported where the expression of each cloned cDNA was under the to function in the BUB2-dependent spindle checkpoint control of a GAL1-inducible promoter. A total of 50,000 colonies were screened. True positive interaction was verified by for mitotic exit and cytokinesis (Alexandru et al. 1999; leucine assay in EGY48, where chromosomal LEU2 is replaced Lee et al. 1999; Li 1999). The simplest model in budding by LexAop6-LEU2. True positives grew on SC-leu dropout yeast would thus be that Bub2p and Bfa1p together form media only in the presence of galactose/raffinose and not a GAP activity that inhibits Tem1p to prevent cells from glucose, since the cDNA was expressed in galactose/raffinose exiting mitosis, when the checkpoint is activated. Re- only. To confirm the interaction between Ibd2p and Bfa1p, the full-length IBD2 open reading frame (ORF) was subcloned cently the Bub2p checkpoint, including Bub2p, Bfa1p, into pJG4-5 and a two-hybrid assay was performed with BFA1. and Tem1p, has been shown to monitor spindle orienta- DNA manipulations and strain constructions: The full BFA1 tion during anaphase and to inhibit mitotic exit when ORF was amplified by PCR from genomic DNA with the 5Ј nuclear migration into the bud is delayed (Bardin et oligonucleotide 5Ј-TTGGATCCCTATGTCAATTAG-3Ј and the Ј Ј al. 2000; Bloecher et al. 2000; Pereira et al. 2000). 3 oligonucleotide 5 -CAATGGATCCGGCTAAAGGGCTAAT CTTTTG-3Ј and subcloned into the BamHI site of pLex202 ϩ Mitotic exit is ultimately repressed by inhibiting Cdh1p/ PL to be used as a bait for two-hybrid screening. To express Hct1p, which targets degradation of the mitotic cyclin hemagglutinin (HA)-tagged BFA1 in a CEN plasmid under its Clb2p through the APC (Schwab et al. 1997; Visintin endogenous promoter, the full promoter and ORF of BFA1 et al. 1997; Zachariae et al. 1998). were amplified with the 5Ј oligonucleotide 5Ј-TGCTCTAGAC GGAGCAAGAGATAGTCTGAG-3Ј containing an XbaI site and In this study, we discuss the function of IBD2, which Ј Ј we isolated on the basis of its interaction with BFA1 in the 3 oligonucleotide 5 -ACAGGATCCATCTTTTGTCGAAT TGATTACCATGTT-3Ј containing a BamHI site and were sub- budding yeast, and present evidence that IBD2 plays a cloned into pTS903CL (a gift from Dr. Toh-e, Tokyo Univer- role in the spindle checkpoint pathway and belongs to sity). The full ORF of IBD2 was amplified by PCR from genomic the BUB2 epistasis group. DNA with the 5Ј oligonucleotide 5Ј-GGGTTTATATGAATC ATAGACTAATATAG-3Ј and the 3Ј oligonucleotide 5Ј-CCTG TTACTATTTAGTCATAATACCGC-3Ј and was subcloned into MATERIALS AND METHODS the SpeI and SacI sites of pRS316 and pRS315 via T-vector (Promega, Madison, WI). The full ORF of IBD2 was also sub- Yeast strains, cultures, cell cycle arrest, and release: The cloned into pJG4-5 by amplifying with the 5Ј oligonucleotide Saccharomyces cerevisiae strains used in this study are listed in 5Ј-CCGGAATTCAAGAAAATGACACCTACAAACC-3Ј containing Table 1. Yeast cells were grown in YPD medium (1% yeast an EcoRI site and the 3Ј oligonucleotide 5Ј-TTCCTCGAGTA extract, 2% bactopeptone, and 2% glucose) or in synthetic ATAATGTTGACTATCTATTC-3Ј containing an XhoI site. For complete (SC) dropout media prepared with yeast nitrogen the overexpression of IBD2 under the GAL10-1 promoter, the base (YNB) and necessary supplements. To induce expressions full ORF of IBD2 amplified with the 5Ј oligonucleotide 5Ј- from the GAL10-1 or GAL1 promoter, cells grown to midlog ATCGAATTCAAAATGACACCTACAAACCAATC-3Ј containing phase in 2% glucose were transferred to SC dropout media an EcoRI site and the 3Ј oligonucleotide 5Ј-TAAGGATCCC with raffinose for 4 hr, 2% galactose was added to this culture, TATCTATTCCTTTTCC-3Ј containing a BamHI site was sub- and then cells were incubated in 2% raffinose/galactose for cloned into pMW20. 12–14 hr at 29Њ. Cell cycles of log phase cells (5 ϫ 106 cells/ To make a YSK1 strain in which the IBD2 ORF tagged with ml) were arrested with a final concentration of 6 ␮m ␣-factor Myc and His at its 3Ј end was integrated into the chromosome (Sigma, St. Louis) or 0.1 m hydroxyurea (HU; Sigma) for 3 of an IBD2 knockout strain (CDLY011), the full-length ORF hr and released from the cell cycle arrest by washing cultures of IBD2 amplified with the 5Ј oligonucleotide 5Ј-TATCTG in fresh medium several times. CAGCATAGACTAATATAGATAG-3Ј and the 3Ј oligonucleo- Assays for sensitivity to microtubule-destabilizing drugs: For tide 5Ј-ACTCTGCAGTTCATCTCTTGGTGGATTC-3Ј was sub- nocodazole treatment, cells were grown to midlog phase (5 ϫ cloned into the PstI site of pTS905IT (a gift from Dr. Toh-e, 106 cells/ml) in YPD at 29Њ and nocodazole was added to a Tokyo University). IBD2-Myc-His/pTS905IT was linearized final concentration of 15 ␮g/ml from a 10 mg/ml stock in with EcoRI, transformed into CDLY012 (ibd2⌬), and selected DMSO. Cells were incubated at 25Њ in the presence of nocoda- on SC-trp plates. YSK2, YSK3 (both ibd2⌬), YSK5 (ibd2⌬bub2⌬), zole, if not specified. To assay viability, the same number of YSK7 (ibd2⌬mad2⌬), YSK9 (ibd2⌬dyn1⌬), and YSK10 (ibd2⌬ IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 597

TABLE 1 Yeast strains used in study

Strain name Genotype Source W303 MATa ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 FY1679C MATa ura3-52 leu2-1 his3/MAT␣ ura3-52 leu2-1 his3 F. Galibert EGY48 MATa LEU2::LexAop6-LEU2 ura3 his3 trp1 GALϩ J. Kim CDLY011 MATa IBD2::KanMX4 ura3-52 leu2-3 112 trp1-289 his3-1 C. Rodriquez CDLY012 MAT␣ IBD2::KanMX4 ura3-52 his 3-200 trp1-63 C. Rodriquez FY1674 MATa BFA1::KanMX4 ura3-52 leu2⌬1 his3 F. Galibert RHC 15.1 MATa MAD2::URA3 ura3-1 leu2,3-112 his3-11 trp1-1 ade2-1 can1-100 R-H. Chen MAY2052 MAT␣ BUB2::URA3 lys2-801 his3-⌬200 leu2-3,112 ura3-52 GALϩ A. Hoyt KT1374 MATa DYN1::HIS3 leu2 ura3-52 his3 K. Tatchell YSK1 MAT␣ IBD2::KanMX4 IBD2-Myc, His TRP ura3-52 his 3-200 trp1-63 This study YSK2 MATa IBD2::URA3 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 This study YSK3 MATa IBD2::HIS3 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 This study YSK4 MAT␣ IBD2::KanMX4 BUB2::URA3 This study YSK5 MATa IBD2::HIS3 BUB2::URA3 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 This study YSK6 MATa IBD2::KanMX4 MAD2::URA3 This study YSK7 MATa IBD2::HIS3 MAD2::URA3 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 This study YSK8 MATa BFA1::HIS3 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 K. Song YSK9 MATa IBD2::HIS3 DYN1::URA3 This study YSK10 MATa IBD2::HIS3 ura3-52 leu2⌬1 his3 BFA1::KanMX4 This study YSK11 MATa BUB2::TRP1 ura3-1 trp1-1 ade2-1 leu2-3,112 his3-11,15 This study

bfa1⌬) were constructed by PCR-based gene deletion (Wach 62.5 mm ␤-mercaptoethanol for 90 min at 30Њ. Microtubules et al. 1994; Longtine et al. 1998) using 5Ј and 3Ј primers that were stained with 1:100 diluted anti-␣-tubulin mouse mono- contained 50 nucleotides spanning the start or stop codons clonal antibody (Sigma) followed by 1:50 diluted Texas red- of the targeted genes, respectively. For YSK2, URA3 from conjugated anti-mouse IgG (Molecular Probes, Eugene, OR) pRS316 was amplified with the 5Ј oligonucleotide 5Ј-CAA and were mounted with DAPI. For microscopy, cells were GAAAATGACACCTACAAACCAATCTAGTGGAACGACTAA observed with a ϫ100 objective on a Zeiss (Thornwood, NY) TGCATCTGTGGAGGTACGTACTGAGAGTGCACCACGC-3Ј Axioskop or on a Leica (Deerfield, IL) fluorescence DMR. and the 3Ј oligonucleotide 5Ј-GACTATCTATTCCTTTTCC Photographs were taken with Tmax 400 film and negatives TACTATCTTGTTCATCTCTTGGTGGATTCGGCATACGC were scanned with a Proimager 8200 (Pixelcraft) for figures, TCCTTACGCATCTGTGCGG-3Ј. For YSK3, HIS3 from pRS303 or alternatively images were taken directly using a Leica DC200 was amplified with 5Ј-GAAGAAAATGACACCTACAAACCAA and a Leica DC viewer. TCTAGTGGAACGACTAATGCATCTGAGCTTGGTGAGCG Fluorescence-activated cell sorter analysis: For flow cytome- CTAGGAGTCAC-3Ј and 5Ј-GACTATCTATTCCTTTTCCTAC try, budding yeast cells were prepared essentially as described TATCTTGTTCATCTCTTGGTGGATTCGGCTCGTTCAGAA by Paulovich and Hartwell (1995). Briefly, cells were fixed TGACACGTATAG-3Ј. PCR products were transformed into in 70% ethanol overnight at 4Њ and washed with 50 mm sodium W303, selected using URA3 and HIS3 markers, and verified citrate (pH 7.5). A total of 4 ϫ 106 cells were resuspended in by genomic PCR and Southern blotting. The same PCR prod- 0.5 ml of 50 mm sodium citrate and incubated with 250 ␮g/ uct used to construct YSK3 was also transformed into MAY2052 ml RNase A followed by 1 mg/ml proteinase K for 1 hr at 50Њ, (bub2⌬), RHC 15.1 (mad2⌬), KT1374 (dyn1⌬), and YSK8 respectively. After adding 0.5 ml of propidium iodide in 50 mm (bfa1⌬) to construct YSK5 (ibd2⌬bub2⌬), YSK7 (ibd2⌬mad2⌬), sodium citrate (final concentration 8 ␮g/ml), samples were YSK9 (ibd2⌬dyn1⌬), and YSK10 (ibd2⌬bfa1⌬), respectively. incubated in the dark for 12–24 hr at 4Њ and were sonicated YSK4 (ibd2⌬bub2⌬) and YSK6 (ibd2⌬mad2⌬) were made essen- briefly just before fluorescence-activated cell sorter (FACS) tially by following Sena et al. (1973). Diploids were constructed analysis. For each sample, 20,000 cells were analyzed with a by mating CDLY011 (ibd2⌬) and MAY2052 (bub2⌬) or CDLY012 Becton Dickinson (San Jose, CA) fluorescence-activated cell (ibd2⌬) and RHC 15.1 (mad2⌬) of opposite mating types on analyzer. For the standard of the DNA content of each FACS the surface of agar plates and were sporulated on sporulation analysis, ␣-factor-treated haploid wild-type (W303) cells [G1 plates at 25Њ for 6–7 days. Tetrads were resuspended in 1 ml (1N)], wild-type cells in log phase [G1 (1N) and G2 (2N)], ddH2O, incubated with 0.25 mg zymolase 20T (Seikagaku, and wild-type diploid (FY1679C) cells in log phase (2N and Rockville, MD) overnight at 30Њ with gentle shaking, sonicated 4N) were used. briefly, and spread on YPD. The genotype of each spore colony Coprecipitation and immunoblot: To detect the coprecipita- was determined by replica plating on selective media. tion of Bfa1p/Ibd1p and Ibd2p, YSK1 cells transformed with Microscopic techniques: To observe nuclei and cell shape, BFA1-HA/pTS903CL were grown to 5 ϫ 106 cells/ml and cells were fixed in 70% ethanol for 5 sec, washed twice with proteins were extracted in H-buffer [25 mm Tris-HCl pH 7.4, ␮ Ј PBS, briefly sonicated, and mounted with 1 g/ml 4 ,6-diami- 15 mm EGTA pH 7.5, 15 mm MgCl2, 0.1% Triton X-100, 10% ϫ dino-2-phenylindole (DAPI). For immunostaining, cells were glycerol, 1 mm NaN3, 0.6 mm sodium vanadate pH 7.0, 1 fixed by incubating in 3.7% formaldehyde for 2 hr, washed protease cocktail in DMSO (Boehringer Mannheim, Indianap- with KPO4 (pH 6.5) twice, and resuspended in KPO4 (pH 6.5) olis), 1 mm dithiothreitol, and 5 mg/ml phenylmethylsulfonyl containing 1.2 m sorbitol. Fixed cells were permeabilized with fluoride] by beadbeating (Mark et al. 1990). The cell lysate a final concentration of 300 ␮g/ml zymolase (Seikagaku) and was incubated with anti-HA antibody (Novagen) for 2 hr fol- 598 H.-S. Hwang and K. Song lowed with Protein A-Sepharose (Sigma) for 1 hr at 4Њ, and the Protein A-Sepharose was washed twice with H-buffer. SDS sample buffer (6ϫ) was added to the resin, the resin was boiled for 5 min, and the proteins were resolved using 10% SDS-PAGE. The resolved proteins were transferred onto nitro- cellulose membrane and then incubated with polyclonal rabbit anti-HA antisera and polyclonal mouse anti-Myc antisera (Upstate Laboratories), respectively. Bound antibodies were detected with anti-rabbit or anti-mouse IgG-HRP (Jackson Im- munochemicals, West Grove, PA) and enhanced chemilumi- nescence (ECL) reagents (Amersham, Arlington Heights, IL). For immunoblots, cell extracts were prepared as described and the protein concentration of each yeast extract was determined by a dye-binding assay (Pierce, Rockford, IL ). A total of 35 ␮g of total protein from each extract was separated by 8% SDS-PAGE, transferred to a membrane, and incubated with polyclonal goat anti-Clb2 antisera (Santa Cruz Biotech- nology), polyclonal rabbit anti-Pds1 antisera (Santa Cruz Bio- technology), or monoclonal rabbit anti-actin antisera (Calbio- chem-Novabiochem, La Jolla, CA) followed by anti-goat or anti-rabbit IgG-HRP and was detected with ECL.

RESULTS IBD2 was isolated by its interaction with BFA1 in budding yeast: Loss of BFA1 results in reduced viability in the presence of microtubule-destabilizing drugs, dem- onstrating its function in the spindle checkpoint of budding yeast (Alexandru et al. 1999; Li 1999). To identify new components of the BFA1-dependent spindle check- Figure 1.— Ibd2p was isolated as a Bfa1p-interacting pro- point, we performed a yeast two-hybrid screen. An open tein in a yeast two-hybrid screen. (A) Ibd2p directly interacts reading frame YNL164C that encodes a potential Bfa1p with Bfa1p in the yeast two-hybrid assay. The specific positive interaction of Ibd2p and Bfa1p was verified by a LEU assay interacting protein was isolated, which we named IBD2 in which true positives should grow on galactose/raffinose (Inhibition of Bud Division 2) on the basis of its overex- SC-ura, his, leu, trp (left) but not on glucose SC-ura, his, leu, pression phenotypes described below. Ibd2p exhibited trp (right), since the expression of IBD2 cDNA was under specific interactions with Bfa1p in the yeast two-hybrid control of the GAL1 promoter. Lanes 1 and 2 are positive LEU assay, in which IBD2 under the GAL1 promoter and negative controls, respectively. Lane 3 shows the specific interaction of Ibd2p with Bfa1p, a bait of the screen, on SC interacted with BFA1 only when its expression was in- gal/raff-ura, his, leu, trp but not on SC glu-ura, his, leu, trp. duced by galactose/raffinose (Figure 1A). To verify the (B) Ibd2p coprecipitates with Bfa1p. Strain YSK1, in which direct interaction of Bfa1p and Ibd2p, we constructed IBD2 tagged with Myc and His was integrated into the chromo- strain YSK1 in which IBD2 tagged with Myc and His at some of ibd2⌬, was transformed with a low copy plasmid car- its C terminus was integrated into the chromosome of rying BFA1-HA (pTS903CL/BFA1-HA), and Myc-tagged Ibd2p ⌬ and HA-tagged Bfa1p were coexpressed from their endoge- ibd2 and was expressed under its endogenous pro- nous promoters (lane 2). Wild-type cells were transformed moter. YSK1 and wild-type cells were transformed with with a low copy plasmid carrying BFA1-HA (pTS903CL/BFA1- a low copy plasmid carrying BFA1-HA under its endoge- HA; lane 1). Strain YSK1 was also transformed with pTS903CL nous promoter. When HA-tagged Bfa1p was purified vector only as a negative control (lane 3). HA-tagged Bfa1p with anti-HA antibody, HA-tagged Bfa1p exclusively co- was purified with anti-HA antibody and Protein A-Sepharose. Lane 2 shows that HA-tagged Bfa1p exclusively coprecipitated precipitated with Myc-tagged Ibd2p expressed in YSK1 with Myc-tagged Ibd2p. Lane 1 shows that Ibd2p in wild type (Figure 1B). was not detected by anti-Myc and lane 3 shows that only Myc- We verified the expression of IBD2 in S. cerevisiae by tagged Ibd2p and pTS903CL vector did not interact. The Northern blot (data not shown). IBD2 encodes a protein top and bottom show purified HA-tagged Bfa1p detected by predicted to contain 352 amino acids. A BLASTP search immunoblotting with anti-HA antibody and Myc-tagged Ibd2p detected with anti-Myc antibody, respectively. (C) The pre- of sequences in GenBank using the full-length Ibd2p dicted protein structure of Ibd2p containing a motif of sequence revealed no meaningful similarity, but a motif CCPHHHYENLS between amino acids 262 and 273 that is search showed that Ibd2p contains a conserved se- frequently found in chitinase families by e-MOTIF database quence between amino acids 263 and 273 (CCPHHHY- search. Boldface letters indicate amino acids conserved be- ENLS) that is found in chitinase families (Figure 1C) tween Ibd2p and other proteins with this motif. (Huang and Brutlag 2001). A similar motif has also been found in BIK1 and DFG10, as shown in Figure 1C (Berlin et al. 1990; Mosch and Fink 1997). IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 599

ml benomyl exhibited a similar degree of hypersensitivity as mad2⌬, bub2⌬, and bfa1⌬ cells. For the experiments described in Figures 2–5, we used spindle checkpoint mutants with isogenic W303 background except bub2⌬. We also made a bub2⌬ in W303 (YSK11) and conﬁrmed that there is no obvious difference in physiological re- sponses between the two bub2⌬ strains of different back- grounds. Another phenotype of spindle checkpoint-defective mutants is repeated budding without mitotic arrest in the presence of microtubule-destabilizing drugs. To investigate whether the hypersensitivity of ibd2⌬ cells to nocodazole was due to their inability to arrest the cell cycle in mitosis, we examined rebudding by counting cells that formed a new bud when mitotic spindle formation was inhibited by nocodazole. ibd2⌬ cells arrested in G1 by ␣-factor were released in the presence of 15 ␮g/ml nocodazole and the number of cells with more than one bud was compared with that of wild-type and other spindle checkpoint mutant cells. The number of cells with a new bud was not much changed in wild-type cells (W303), but was increased in ibd2⌬ as well as in mad2⌬, bub2⌬, and bfa1⌬ cells (Figure 3A). We also compared by microscopy the phenotypes of ibd2⌬ cells with those of wild type every hour for 6 hr, after cells arrested with ␣-factor were released in 15 ␮g/ Figure 2.—The deletion mutant of IBD2 is sensitive to mi- ml nocodazole. Wild-type cells progressed through the crotubule-destabilizing drugs. (A) Viability of the IBD2 dele- cell cycle until mitosis, at which time they arrested with tion mutant cells decreases sharply in the presence of nocoda- a large bud and a condensed nucleus in the bud neck ⌬ ⌬ ⌬ zole. Wild-type (W303), bfa1 (YSK8), ibd2 (YSK2), bub2 (Figure 3B, top right). The ibd2⌬ cells became enlarged (MAY2052), and mad2⌬ (RHC 15.1) cells were grown to midlog phase (5 ϫ 106 cells/ml), incubated with 15 ␮g/ml nocoda- at 2 hr compared with wild type (suggesting a transient zole for 0, 3, and 6 hr, respectively, and plated on YPD without mitotic delay), but produced aberrant extra bud(s) any nocodazole to measure viability. The percentage of viable within 3 hr in the presence of nocodazole (Figure 3B, cells (%) was calculated relative to the number of viable cells bottom). Transient mitotic delay and similar enlarged at time 0. Three independent experiments were performed phenotypes are also observed when deletion mutants of and the average was plotted with standard deviations. (B) ibd2⌬ cells are sensitive to benomyl in plate assays. Actively BUB2 and BFA1 are treated with microtubule-destabiliz- growing wild-type (W303), bfa1⌬ (YSK8), ibd2⌬ (YSK2), bub2⌬ ing drugs (Hoyt et al. 1991; Fesquet et al. 1999; Li 1999; (MAY2052), and mad2⌬ (RHC 15.1) cells were serially diluted data not shown). This transient enlarged phenotype 10-fold and spotted onto either YPD plates (left) or YPD plates observed in ibd2⌬ as well as in bub2⌬ and bfa1⌬ mutants ␮ containing 10 g/ml benomyl (right). following exposure to nocodazole could be explained as temporary mitotic arrest due to the presence of a functional MAD2 spindle assembly checkpoint pathway. IBD2 encodes a component of the spindle checkpoint: In the nocodazole-treated ibd2⌬ cells, the nucleus also The deletion of IBD2 was not lethal and showed no failed to become properly divided between the mother growth defects, as is also the case for the BFA1 deletion and the bud(s) (Figure 3B, bottom). These observations mutant (Duenas et al. 1999; data not shown). To deter- show that ibd2⌬ cells could not ultimately arrest the cell mine whether Ibd2p functions in the spindle check- cycle in mitosis and progressed to the next cell cycle point, we tested the sensitivity of ibd2⌬ cells to a suble- without proper nuclear division and cytokinesis, as re- thal concentration of nocodazole. After incubation with ported in other spindle checkpoint mutants including 15 ␮g/ml nocodazole, the viability of ibd2⌬ cells de- mad2⌬, bub2⌬, and bfa1⌬ (Hoyt et al. 1991; Fesquet et creased as sharply as that of mad2⌬, bub2⌬, and bfa1⌬ al. 1999; Li 1999), although microtubule-destabilizing cells (Figure 2A). As reported, mad2⌬ cells were more drugs inhibited mitotic spindle formation. sensitive to the drug than were bub2⌬ cells (Fesquet et To verify that the ibd2⌬ mutant progressed through al. 1999). To conﬁrm these results, the sensitivity of the cell cycle in the presence of mitotic spindle defects ibd2⌬ cells to benomyl was examined in conventional as other spindle checkpoint mutants, ibd2⌬ cells ar- plating experiments. In the plate assay shown in Figure rested with ␣-factor were released from cell cycle arrest 2B, ibd2⌬ cells serially diluted in the presence of 10 ␮g/ into medium containing nocodazole for 3 hr, and their 600 H.-S. Hwang and K. Song IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 601

DNA contents were analyzed by flow cytometry. Wild- netics as wild type, but Clb2p began to degrade at 100 type, ibd2⌬, bub2⌬, bfa1⌬, and mad2⌬ cells all contained min, was completely degraded at 120 min, and started either a G1 (1N) or a G2 (2N) DNA content in the to reaccumulate at 140 min (Figure 3D). This observed absence of nocodazole (Figure 3C, left). However, a profile of Clb2p in ibd2⌬ cells was consistent with the larger proportion of ibd2⌬, bub2⌬, and bfa1⌬ cells con- above results that ibd2⌬ cells exited mitosis and pro- tained a G2 (2N) DNA content compared to wild type, gressed into the next cell cycle in the presence of noco- suggesting a possible delay in mitosis (Figure 3C, left). dazole. Taken together, these data demonstrate that After incubation with nocodazole for 3 hr, the ibd2⌬, Ibd2p functions in the spindle checkpoint of budding bub2⌬, bfa1⌬, and mad2⌬ cells all displayed a G2 (2N) yeast. or higher DNA content, while most wild-type cells con- IBD2 functions downstream of MPS1: To further ex- tained only a G2 (2N) DNA content (Figure 3C, right). amine the function of IBD2 in the spindle checkpoint The DNA content of ibd2⌬ cells in the presence or pathway, MPS1 overexpression phenotypes in ibd2⌬ mu- absence of nocodazole was very similar to that observed tants were analyzed and compared with those in bub2⌬ for bub2⌬ and bfa1⌬. The distribution in DNA content and mad2⌬ checkpoint mutants by introducing a plas- of ibd2⌬ was consistent with the new bud formation mid that overexpressed Mps1p under the GAL1 pro- phenotypes described previously and demonstrated that moter. Cells transformed with a plasmid vector only the ibd2⌬ cells proceeded to the next cell cycle and were used as negative controls. As shown previously, the replicated their DNA without proper nuclear division overexpression of Mps1p alone was sufficient to cause and cytokinesis despite the loss of a mitotic spindle. a mitotic delay by activating the MAD- and BUB-depen- These characteristics were also reported in other spindle dent spindle checkpoints in the absence of spindle dam- checkpoint mutants including mad2⌬, bub2⌬, and bfa1⌬ age, locating MPS1 upstream of the checkpoint com- (Hoyt et al. 1991; Fesquet et al. 1999; Li 1999). posed of these genes (Hardwick et al. 1996). However, When exposed to microtubule-destabilizing drugs it is arguable whether Mps1p overexpression affects such as nocodazole, wild-type yeast cells arrest in mitosis both bifurcated spindle checkpoint pathways or only through the stabilization of B-type cyclins and the ele- the MAD/BUB pathway and not the BUB2-dependent vated activity of cyclin B-associated Cdc28 kinase. Thus, pathway, since the observed mitotic delay by Mps1p the level of Clb2 protein serves as an excellent marker overexpression was completely eliminated in mad2⌬ but for mitotic arrest. To further assess cell cycle progression not in bub2⌬ mutants (Alexandru et al. 1999; Fesquet in ibd2⌬ cells, we compared Clb2 protein levels in ibd2⌬ et al. 1999; Li 1999). As displayed in Table 2, Mps1p and wild-type cells incubated with nocodazole. Cells syn- overexpression in galactose-containing media for 12 hr chronized at G1 with ␣-factor were released in fresh resulted in mitotic arrest in 76% of wild-type cells, while medium with nocodazole and collected every 20 min only 19% of cells in the negative control were in a for 140 min to investigate the level of Clb2p. The per- mitotic stage. This mitotic delay by Mps1p overexpres- centage of cells with a large bud and the nucleus in the sion was abolished in mad2⌬, when compared with the neck was also counted in each sample as an index for mad2⌬ negative control (Table 2). Overexpression of mitosis (Figure 3D, top). Wild-type cells gradually accu- Mps1p in ibd2⌬ and bub2⌬ also caused a mitotic delay, mulated and maintained Clb2p at high levels in the but the delay in ibd2⌬ and bub2⌬ was less than that in presence of nocodazole, since cells were arrested in wild type and more than that in mad2⌬ (Table 2). A mitosis. ibd2⌬ cells accumulated Clb2p with similar ki- similar percentage of ibd2⌬ and bub2⌬ mutant cells in

Figure 3.—IBD2 encodes a component of the spindle checkpoint. (A) ibd2⌬ cells produce a new bud in the presence of nocodazole. Logarithmically growing wild-type (W303), bfa1⌬ (YSK8), ibd2⌬ (YSK2), bub2⌬ (MAY2052), and mad2⌬ (RHC 15.1) cells were arrested by ␣-factor and released in the presence of 15 ␮g/ml nocodazole. The number of cells with more than one bud was counted every hour for 3 hr after fixation and brief sonication. A total of 500 cells were counted at each time point and the percentage of cells with more than one bud was calculated relative to total counted cells. Three independent experiments were performed and the average was plotted with standard deviations. (B) The phenotypes of ibd2⌬ cells in the presence of nocodazole. Wild-type and ibd2⌬ cells arrested with ␣-factor were released in the presence of 15 ␮g/ml nocodazole for 5 hr. Cells taken every hour were fixed, briefly sonicated, and stained with DAPI. The top shows wild-type cells incubated either without nocodazole (left) or with nocodazole for 5 hr (right). The bottom shows the phenotypes of ibd2⌬ cells treated with nocodazole at each hour as depicted. All panels are at the same scale. Bar, 5 ␮m. (C) ibd2⌬ cells progress to the subsequent cell cycle in the presence of nocodazole. Wild-type (W303), ibd2⌬ (YSK2), bfa1⌬ (YSK8), and bub2⌬ (MAY2052) cells arrested with ␣-factor were released from the cell cycle arrest in the presence of nocodazole for 3 hr and their DNA contents were measured by flow cytometry. Cells are shown either without (left) or after nocodazole treatment (right). (D) ibd2⌬ cells do not accumulate Clb2p when exposed to a microtubule-destabilizing drug. Wild-type (W303) and ibd2⌬ (YSK2) cells were arrested in G1 by ␣-factor and released in the presence of nocodazole at 25Њ. Cells were collected every 20 min for 140 min and the cells with a grown large bud and the nucleus in the neck were counted in each sample, as shown in the top graph. Cell extracts from each sample were immunoblotted with anti-Clb2 and anti-actin antibody (as a loading control). 602 H.-S. Hwang and K. Song

Figure 4.—The overexpression of IBD2 induces mitotic arrest. (A) Cells overexpressing IBD2 are arrested in M phase. Wild- type (W303), bfa1⌬ (YSK8), bub2⌬ (MAY2052), and mad2⌬ (RHC 15.1) cells were transformed with pMW20/IBD2 or pMW20L/ IBD2 and the overexpression of IBD2 under the GAL10-1 promoter was induced for 12 hr. Cells in M phase were counted after fixation and staining with DAPI. The same strains transformed with only pMW20 were used as negative controls. The average of three independent experiments is shown with standard deviation. (B) Cells overexpressing IBD2 show no mitotic spindle defects. The mitotic spindle was visualized by immunostaining with antitubulin in cells overexpressing IBD2. Among cells in M phase by Ibd2p overexpression, each number of cells with a short mitotic spindle or with an elongated spindle was counted after antitubulin staining and displayed in the top. In the bottom section, the top shows a cell in metaphase with a short spindle while the bottom displays a cell with an elongated spindle. DNA (left) and microtubule (right) staining are shown. Bar, 5 ␮m. (C) Clb2p accumulates in cells overexpressing IBD2. Cell extracts were prepared from (1) wild type (W303) transformed with the vector pMW20 only, (2) wild type cells in which IBD2 overexpression was induced, and (3) wild-type cells incubated with nocodazole for 3 hr. Extracts were subjected to immunoblottings using anti-Clb2p (top) and anti-actin (bottom) as a loading control. (D) Clb2p does not accumulate when IBD2 is overexpressed in bfa1⌬ and bub2⌬ mutant cells. IBD2 overexpression was induced in wild-type (W303), bfa1⌬ (YSK8), bub2⌬ (MAY2052), and mad2⌬ (RHC 15.1) cells, and Clb2p in extracts from each sample was analyzed by immunoblotting using anti-Clb2p (top). Actin is shown as a loading control (bottom). Lane 1, wild-type cells transformed with vector only as a control; lanes 2–5, cells overexpressing Ibd2p [(2) wild type, (3) bfa1⌬, (4) bub2⌬, and (5) mad2⌬]. (E) Pds1p is stabilized in wild-type cells overexpressing IBD2. Wild-type cells (W303) were arrested with HU and released in the presence of 2% galactose to induce overexpression of IBD2. Cells were taken every 30 min for 210 min, and Pds1p and Clb2p were examined in each extract by immunoblots. The top shows wild-type cells transformed with vector pMW20 only; the bottom shows wild-type cells in which overexpression of IBD2 was induced. Pds1p and Clb2p are both stabilized in cells overexpressing IBD2, while Pds1p and Clb2p in wild-type cells degrade as cells exit mitosis. As a loading control, an actin blot for each sample is shown. IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 603 mitotic delay in response to Mps1p overexpression im- observed in bub2⌬ cells and only a minor mitotic arrest plies that IBD2 and BUB2 are likely to function in the was detected in bfa1⌬. This could be explained if a same pathway. This incomplete mitotic delay in re- regulator of Bub2p other than Bfa1p interacts with sponse to Mps1p overexpression in ibd2⌬ and bub2⌬ Ibd2p for mitotic arrest. As the spindle checkpoint is also suggests that IBD2 and BUB2 are downstream of bifurcated into Mad/Bub-dependent and Bub2-depen- MPS1 and that MPS1 functions more effectively through dent pathways, the mitotic arrest by Ibd2p overexpres- the MAD/BUB pathway than through the BUB2-depen- sion in mad2⌬ is more likely due to the functional inde- dent pathway. pendence of IBD2 and MAD2 in different pathways and Overexpression of Ibd2p induces mitotic arrest: The supports the hypothesis that IBD2 functions in the BUB2 function of Ibd2p in the spindle checkpoint was further pathway. verified by studying the overexpression of Ibd2p. Over- To gain further insight into the functional pathway expression of Ibd2p under the GAL10-1 promoter in of Ibd2p, we also measured the level of Clb2p in wild- wild-type cells blocked the cell cycle in mitosis, as re- type as well as in mad1⌬, bfa1⌬, and bub2⌬ cells overex- vealed by DAPI staining and nuclear morphology pressing Ibd2p. As described above, the overexpression counts. A total of 78% of wild-type cells overexpressing of IBD2 in wild type resulted in mitotic arrest with in- Ibd2p were arrested either at metaphase or at anaphase creased Clb2p (Figure 4A and Figure 4, C and D). Over- with a large bud, while 29% of wild-type cells with the expression of Ibd2p resulted in an increased level of vector control were in M phase (Figure 4A). These in- Clb2p in mad1⌬ but not in bfa1⌬ and bub2⌬, reinforcing creased mitotic arrest phenotypes by Ibd2p overexpres- the conclusion that Ibd2p is a component of the spindle sion strongly suggest that Ibd2p functions in the spindle checkpoint and that overexpression of Ibd2p induces checkpoint. mitotic arrest through the BUB2 pathway upstream of To confirm that the overexpression of Ibd2p does BFA1 and BUB2. not activate the spindle checkpoint indirectly by causing We analyzed the stability of Pds1p in wild-type cells a spindle defect, we inspected microtubule structures overexpressing Ibd2p to further verify the mitotic arrest in cells overexpressing Ibd2p by antitubulin immuno- caused by Ibd2p overexpression. For this experiment, fluorescence microscopy. As can be seen in Figure 4B, wild-type cells were synchronized in S phase with 0.1 m cells overexpressing Ibd2p did not show any defect in HU and released in the presence of 2% galactose to the orientation of microtubules and displayed the nor- induce the overexpression of IBD2. In control cells ex- mal microtubule patterns of M-phase cells in metaphase pressing vector alone, Pds1p accumulated gradually and or anaphase. When the cells arrested in mitosis by Ibd2p was completely degraded at 210 min after the release overexpression were further analyzed by their spindle when cells exit mitosis. Clb2p, whose degradation is patterns, 67.1% of cells had a short spindle and 32.9% inhibited by Pds1p (Cohen-Fix and Koshland 1999), contained an elongated spindle (Figure 4B, top). These began to decrease at 90 min when Pds1p started to observations demonstrated that the overexpression of diminish (Figure 4E). In contrast, in cells where the Ibd2p does not generate mitotic spindle defects but overexpression of Ibd2p was induced, Pds1p accumu- induces mitotic arrest directly through its role as a com- lated and was maintained at a constant high level. Clb2p ponent of the spindle checkpoint. The mitotic arrest was also maintained stably in these cells (Figure 4E). caused by the overexpression of Ibd2p in wild type was The observed stability of Pds1p in wild-type cells overex- also validated by measuring Clb2p levels. The amount pressing Ibd2p confirms that the overexpression of of Clb2p in wild-type cells overexpressing Ibd2p was Ibd2p induces mitotic arrest and that Ibd2p functions elevated relative to actively growing wild-type cells, al- as a component of the spindle checkpoint. though a similar amount of actin was present, and was IBD2 belongs to the BUB2 epistasis group: The above comparable to that of wild-type cells arrested in mitosis results, including the phenotypes of ibd2⌬ in the pres- as a result of nocodazole treatment (Figure 4, C and D). ence of nocodazole as well as Ibd2p overexpression, To examine in which of the bifurcated spindle path- strongly suggest that IBD2 functions in the BUB2 branch ways and where in the pathway Ibd2p functions, Ibd2p of the spindle checkpoint. The function of IBD2 in the overexpression phenotypes were observed in wild-type BUB2 pathway was further validated by genetic epistasis as well as in mad2⌬, bfa1⌬, and bub2⌬ cells, and these analysis. Blockage of both MAD2 and BUB2 pathways in were compared with negative controls in each strain that the mad2⌬bub2⌬ double mutant appeared to ablate the overexpressed only the vector control. The increased checkpoint completely, so that these cells progressed mitotic arrest caused by Ibd2p overexpression was ob- into the next cell cycle without any mitotic delay and served in mad2⌬ cells but much less in bfa1⌬ and not rebudded more rapidly than either single mutant (mad2⌬ at all in bub2⌬ (Figure 4A). When compared with each or bub2⌬) in the presence of nocodazole (Fesquet et vector control, the lack of mitotic arrest in response to al. 1999). If IBD2 functions in the BUB2 branch, we Ibd2p overexpression in bfa1⌬ and bub2⌬ suggests that would expect that the checkpoint would be blocked Ibd2p functions through Bfa1p and Bub2p in the BUB2 more effectively in the ibd2⌬mad2⌬ mutant than in pathway. No mitotic arrest by Ibd2p overexpression was ibd2⌬bub2⌬. We constructed an ibd2⌬bub2⌬ strain (YSK2) Figure 5.—IBD2 belongs to the BUB2 epistasis group. (A) New bud formation in ibd2⌬bub2⌬ and ibd2⌬mad2⌬ in the presence of nocodazole. Logarithmically growing wild-type (W303), ibd2⌬ (YSK3), bub2⌬ (MAY2052), mad2⌬ (RHC15.1), ibd2⌬bub2⌬ (YSK5), ibd2⌬bfa1⌬ (YSK10), and ibd2⌬mad2⌬ (YSK7) cells were incubated in the presence of 15 ␮g/ml nocodazole, and cells with new buds were counted every 20 min for 160 min after fixation and brief sonication. A total of 300 cells were counted at each time point and the percentage of cells with new buds at each time point was calculated relative to the total number of cells counted. Three independent experiments were performed and the average was plotted with standard deviations. (B) Cell cycle progression of ibd2⌬mad2⌬ and ibd2⌬bub2⌬ in the presence of nocodazole by the analysis of DNA content. (a) ibd2⌬bub2⌬ (YSK5), (b) ibd2⌬mad2⌬ (YSK7), (c) bub2⌬ (MAY2052), and (d) mad2⌬ (RHC15.1) were arrested with ␣-factor and released in the presence of 15 ␮g/ml nocodazole for 110 min. Cells were taken every 10 min and their DNA contents were analyzed by flow cytometry as described in materials and methods. (C) dyn1⌬ibd2⌬ cells proceed through mitosis with a misoriented mitotic spindle. The dyn1⌬ ibd2⌬ double mutant was constructed and its phenotypes compared with that of dyn1⌬ after DAPI and antitubulin immunostaining. The number of cells with each phenotype was counted as shown in the top table. In the images, top, dyn1⌬ single mutant; bottom, dyn1⌬ibd2⌬ double mutant. DAPI staining for DNA (left) and antitubulin staining (right) are shown. The scale is the same in all panels. Bar, 5 ␮m. IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 605

double mutant was especially remarkable during the early stages of incubation with nocodazole (Figure 5A). We also examined the mitotic arrest defect and cell cycle progression of ibd2⌬bub2⌬ and ibd2⌬mad2⌬ by measuring the DNA content. The cell cycle progression of bub2⌬ and mad2⌬ single mutants as well as wild type was also monitored as controls. In this experiment, ibd2⌬- bub2⌬, ibd2⌬mad2⌬, bub2⌬, and mad2⌬ cells in log phase were arrested with ␣-factor and released in the presence of 15 ␮g/ml nocodazole for 110 min, and their DNA content was analyzed every 10 min by ﬂow cytometry. Approximately 80% of both wild-type and mutant cells were arrested at G1 by ␣-factor with 1N DNA content. Wild-type cells were gradually arrested with 2N DNA content in the presence of nocodazole as cells reached mitosis (Figure 3C and data not shown). Similarly, both ibd2⌬bub2⌬ and ibd2⌬mad2⌬ double mutants proceeded through the cell cycle and displayed a 2N DNA content after release. However, as shown in Figure 5B, b, a fraction of the ibd2⌬mad2⌬ cells began to display a 4N DNA content at 80 min after release and this proportion was highly increased at 110 min without noticeable mitotic delay. Conversely, most of the ibd2⌬- bub2⌬ cells retained a 2N DNA content at 80 min and Figure 5.—Continued. only a small portion of cells with a 4N DNA content started to appear at 110 min, suggesting a temporal mitotic delay of this double mutant in the presence of and an ibd2⌬mad2⌬ strain (YSK3) and investigated nocodazole (Figure 5B, a). As ibd2⌬bub2⌬, both bub2⌬ whether increased nocodazole sensitivity was detected and mad2⌬ single mutant cells showed a temporal mi- by an enhanced checkpoint defect in each double mu- totic delay with a 2N DNA content until 90 min and tant. First, we counted the rebudding of these double only a small portion of cells began to have a 4N DNA mutants in the presence of nocodazole, after cells were content at 110 min (Figure 5B, c and d). Therefore, released from the arrest by ␣-factor. As can be seen in the deletion of both IBD2 and MAD2 appeared to ablate Figure 5A, while the proportion of cells with new buds the spindle checkpoint more severely than that of IBD2 in the ibd2⌬bub2⌬ double mutant was similar to that in and BUB2, suggesting that IBD2 and MAD2 function in the bub2⌬ single mutant, the increase occurred a little separate checkpoint pathways and that IBD2 and BUB2 more rapidly in ibd2⌬mad2⌬ in comparison with ibd2⌬, likely belong to the same epistasis group. mad2⌬, and ibd2⌬bub2⌬ mutants. Cell cycle progression The BUB2 checkpoint pathway has been reported to as assayed by new bud formation in the ibd2⌬mad2⌬ monitor anaphase spindle position. BUB2 is required

TABLE 2 MPS1 overexpression in ibd2⌬ cells

Overexpression M arrest (%) Multibud (%) Normal (%) WT ϩ MPS1 75.5 Ϯ 1.5 17.0 Ϯ 1.5 7.5 Ϯ 1.5 WT ϩ pRS316 only 19.0 Ϯ 0.5 2.5 Ϯ 0.5 78.5 Ϯ 0.5 ibd2⌬ϩMPS1 54 Ϯ 0.5 39 Ϯ 0.5 7 Ϯ 0.5 ibd2⌬ϩpRS316 only 22.5 Ϯ 1.5 24.5 Ϯ 1.5 52.0 Ϯ 1.5 bub2⌬ϩMPS1 56 Ϯ 3.5 40 Ϯ 3.5 4 Ϯ 3.5 bub2⌬ϩpRS316 only 17.5 Ϯ 0.5 22.0 Ϯ 0.5 60.5 Ϯ 0.5 mad2⌬ϩMPS1 29.5 Ϯ 1.06 64 Ϯ 1.06 6.5 Ϯ 1.06 mad2⌬ϩpRS316 only 25.5 Ϯ 1.5 27.0 Ϯ 1.5 47.5 Ϯ 1.5 MPS1 was overexpressed in wild-type (W303), ibd2⌬ (YSK3), bub2⌬ (MAY2052), and mad2⌬ (RHC15.1) cells in 2% galactose for 12 hr at 29Њ. Cells were ﬁxed in 70% EtOH, sonicated brieﬂy, and their phenotypes were examined after staining with DAPI. A total of 300 cells were counted for each sample; the average of three independent experiments is presented. 606 H.-S. Hwang and K. Song

TABLE 3 TABLE 4 Rescue of the mitotic arrest defects in ibd2⌬ by other Rescue of mitotic arrest defects of other spindle checkpoint spindle checkpoint genes mutants by IBD2

Rescue M arrest (%) Multibud (%) Rescue M arrest (%) Multibud (%) WT 87.2 Ϯ 2.5 12.8 Ϯ 2.5 bub2⌬ϩBFA1 58 Ϯ 2.5 42 Ϯ 2.5 ibd2⌬ 18.4 Ϯ 1.5 81.6 Ϯ 1.5 bub2⌬ϩIBD2 46.8 Ϯ 2.5 53.2 Ϯ 2.5 ibd2⌬ϩIBD2 74.5 Ϯ 1.06 25.5 Ϯ 1.06 bub2⌬ϩBUB2 83.7 Ϯ 1.5 16.3 Ϯ 1.5 ibd2⌬ϩBFA1 74.9 Ϯ 2.5 25.1 Ϯ 2.5 bub2⌬ϩpRS315 only 17 Ϯ 0.5 83 Ϯ 0.5 ibd2⌬ϩBUB2 73.2 Ϯ 1.06 26.8 Ϯ 1.06 bfa1⌬ϩBFA1 79 Ϯ 0.5 21 Ϯ 0.5 ibd2⌬ϩMAD2 39.5 Ϯ 3.5 60.5 Ϯ 3.5 bfa1⌬ϩIBD2 22 Ϯ 1.5 78 Ϯ 1.5 ibd2⌬ϩCDC5 72.8 Ϯ 2.5 27.2 Ϯ 2.5 bfa1⌬ϩBUB2 73.7 Ϯ 1.06 26.3 Ϯ 1.06 ibd2⌬ϩpRS316 only 19.6 Ϯ 1.5 80.4 Ϯ 1.5 bfa1⌬ϩpRS316 only 19.3 Ϯ 0.5 80.7 Ϯ 0.5 mad2⌬ϩIBD2 39.5 Ϯ 1.5 60.5 Ϯ 1.5 ⌬ ibd2 (YSK3) cells were transformed with pRS316/IBD2, mad2⌬ϩpRS316 only 21.5 Ϯ 2.5 78.5 Ϯ 2.5 BFA1, BUB2, MAD2, and CDC5 under their own endogenous promoters, incubated in the presence of nocodazole for 3 hr, bfa1⌬ (YSK8), bub2⌬ (MAY2052), and mad2⌬ (RHC15.1) and counted according to their phenotypes after fixation in cells were transformed by pRS316/IBD2, incubated in the pres- 70% EtOH and DAPI staining. A total of 300 fixed cells were ence of nocodazole for 3 hr, and counted according to their counted for each sample; the average of three independent phenotypes after fixation in 70% EtOH and staining with experiments is presented. DAPI. A total of 300 fixed cells were counted for each sample; the average of three independent experiments is presented. for the prevention of spindle breakdown and mitotic exit in yeast cells lacking dynein or dynactin, in which suggests that IBD2 functions upstream of BFA1 and both poles of the spindle are in the mother cell BUB2 in the BUB2 pathway. To further address where ,of the bub2⌬- IBD2 functions in the BUB2 spindle checkpoint pathway %25ف ,Bloecher et al. 2000). Therefore) dyn1⌬ double mutant cells with misaligned spindles we investigated whether the loss of mitotic arrest in completed anaphase and initiated new bud formation, ibd2⌬ in the presence of microtubule-destabilizing while 95% of the dyn1⌬ mutant cells with misaligned drugs could be compensated by extra copies of BFA1 spindles were arrested at mitosis (Bloecher et al. 2000). and BUB2 on a CEN plasmid, as summarized in Table If IBD2 functions in the BUB2 pathway, then ibd2⌬dyn1⌬ 3. We also examined whether the presence of IBD2 on cells would also be expected to undergo nuclear division a CEN plasmid could suppress the lack of mitotic arrest within the mother and enter the next cell cycle, as is in bfa1⌬ and bub2⌬ upon exposure to nocodazole (Table observed for bub2⌬dyn1⌬. To confirm that IBD2 func- 4). A total of 82% of negative controls (ibd2⌬ cells trans- tions in the BUB2 branch of the spindle checkpoint formed with the CEN plasmid pRS316 only) failed to pathway, we constructed a ibd2⌬dyn1⌬ double mutant undergo mitotic arrest in the presence of nocodazole, and compared the progression of mitosis in ibd2⌬dyn1⌬ while 75% of positive controls (ibd2⌬ cells transformed with that in dyn1⌬. Consistent with previous reports on with IBD2 on a CEN plasmid) were able to restore mitotic dyn1⌬ (Li et al. 1993; Bloecher et al. 2000), only 9% arrest. When compared with ibd2⌬ and mad2⌬ cells of dyn1⌬ single mutant cells that contained misaligned transformed with pRS316 alone, the mitotic arrest de- anaphase spindles exited mitosis and formed an extra fects of ibd2⌬ were not much improved by the presence bud. On the other hand, 38% of ibd2⌬dyn1⌬ double of MAD2 and vice versa (Tables 3 and 4), supporting mutant cells gave rise to binuclear mother cells and the idea that IBD2 is not in the MAD2 pathway. Extra anucleate cells and often contained an extra bud (Fig- copies of either BUB2 or BFA1 were able to restore -of ibd2⌬ cells, a level compa %75–73ف ure 5C). ibd2⌬dyn1⌬ double mutant cells also showed mitotic arrest in a sharp decrease in viability compared with each single rable to that of IBD2 itself (Table 3). In contrast, while mutant, possibly due to progression of the cell cycle in BFA1 and BUB2 were each able to compensate for the the absence of proper nuclear division, as in the case inability of bfa1⌬ and bub2⌬ cells to undergo mitotic of bub2⌬dyn1⌬ (data not shown). These ibd2⌬dyn1⌬ arrest, extra copies of IBD2 could not (Table 3). These phenotypes are very similar to those reported for bub2⌬- genetic interactions of IBD2 are consistent with the data dyn1⌬ and strongly suggest that IBD2 belongs to the described previously indicating that IBD2 functions up- BUB2 epistasis group and functions in the BUB2-depen- stream of BUB2 and BFA1 in the BUB2-dependent spin- dent spindle checkpoint. dle checkpoint pathway. Interestingly, an extra copy of Mitotic arrest defects of ⌬ibd2 can be rescued by CDC5, which encodes a polo-like kinase functioning in extra copies of BUB2 and BFA1: As described above, mitotic exit and cytokinesis, could rescue the deficiency the lack of mitotic arrest by Ibd2p overexpression in of mitotic arrest in ibd2⌬ (Song and Lee 2001). It is bfa1⌬ and bub2⌬ as well as the similar Mps1p overexpres- hard to define a relationship between IBD2 and CDC5 sion phenotypes observed in ibd2⌬ and bub2⌬ mutants solely on the basis of this result, but at least it suggests IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 607 a possible genetic interaction between these two genes we also observed that Ibd2p overexpression caused that could link the checkpoint function of IBD2 with M-phase arrest with either a short bipolar spindle mitotic exit. (67.1%) or an elongated bipolar anaphase B spindle (32.9%), while overexpression of Bfa1p was reported by Li (1999) to induce a cell cycle arrest mainly with DISCUSSION an elongated anaphase B spindle. It was reported pre- IBD2 is a new component of the BUB2-dependent viously that MPS1 functions upstream of both MAD- spindle checkpoint in budding yeast: Bfa1p, Bub2p, and and BUB-dependent spindle checkpoints and that its Tem1p are associated with the spindle pole body (SPB) overexpression leads to a cell cycle arrest predominantly of budding yeast and together comprise the Bub2p- with short bipolar spindles (Hardwick et al. 1996). dependent spindle checkpoint (Alexandru et al. 1999; Pds1p was shown to control both the initiation of ana- Li 1999). The homologies between Bfa1p and Bub2p phase and mitotic exit and to interact with mitotic exit in budding yeast and Byr4p and Cdc16p in fission yeast network (MEN) proteins by unknown mechanisms suggest that Bfa1p and Bub2p might form a two-compo- (Cohen-Fix and Koshland 1999; Tinker-Kulberg nent GAP at the SPB that inhibits the Tem1p GTPase, and Morgan 1999). Our observation that the overex- thus blocking mitotic exit (Furge et al. 1998). Recent pression of Ibd2p caused M-phase arrest either with reports suggest a new model in which the inhibition of a short bipolar spindle or with an elongated bipolar Tem1p by Bfa1p/Bub2p GAP is a molecular switch that anaphase B spindle suggests the possibility that commu- acts on the Bub2p-dependent spindle checkpoint to nication between Pds1p and Ibd2p may occur upstream prevent spindle breakdown, nuclear division, and cytoki- of Bfa1p and Bub2p when there are defects in spindle nesis in response to a failure of nuclear migration into formation and orientation. the bud, which typically results from spindle orientation The results that the mitotic arrest caused by Ibd2p defects (Bardin et al. 2000; Bloecher et al. 2000; Per- overexpression was not observed in bub2⌬ and bfa1/ eira et al. 2000). In this model, when the divided nucleus ibd1⌬, and that the mitotic arrest defects of ibd2⌬ in and progeny SPB migrate to the new bud, Lte1p, a the presence of nocodazole were restored by additional guanine nucleotide exchange factor (GEF) that is pres- copies of BUB2 and BFA1 while an extra copy of IBD2 ent only in the bud, activates the Tem1p GTPase to could not rescue the mitotic arrest defects of bub2⌬ stimulate mitotic exit and cytokinesis (Bardin et al. and bfa1⌬, are consistent with a model in which IBD2 2000; Pereira et al. 2000). The interactions of Bim1p functions upstream of BUB2 and BFA1. Considering that and Kar9p with cortical sites have been reported to Ibd2p and Bfa1p directly interact and that an extra copy properly orient the mitotic spindle in yeast (Korinek of either BFA1 or BUB2 rescues the mitotic defect of et al. 2000; Lee et al. 2000; Miller et al. 2000). However, ibd2⌬, we could expect that Ibd2p, Bfa1p, and Bub2 it still remains to be answered whether Bfa1p and Bub2p form a complex to transmit the spindle orientation de- together are sufficient to act as a molecular switch and fect to block mitotic exit. We observed that Ibd2p physi- how spindle orientation defects are transmitted to cally interacts with Bfa1p but does not interact directly Bfa1p/Bub2p. with Bub2p (H. Hwang, unpublished data), although We have isolated a novel Bfa1p interacting protein Ibd2p and Bub2p still can communicate through Bfa1p named Ibd2p. We have presented evidence that IBD2 by forming a complex together. The observation that functions as a component of the spindle checkpoint in Ibd2p is localized as a dot near the nuclear periphery the BUB2-dependent branch of this pathway upstream when expressed as a green fluorescent protein (GFP) of Bfa1p and Bub2p. IBD2 deletion mutants proceeded fusion on a multicopy plasmid suggests that endogenous through the cell cycle in the presence of microtubule- Ibd2p, like Bfa1p, is localized to the spindle pole body destabilizing drugs, thereby causing a sharp decrease in and supports the possibility that they form a complex in viability. IBD2 overexpression induced mitotic arrest in the spindle pole body (H. Hwang, unpublished data). wild-type cells, as verified by increased levels of Clb2p We also observed that the mitotic arrest defect of and the stabilization of Pds1p, but the pattern of micro- ibd2⌬ in the presence of nocodazole was restored by tubule structures was normal in these cells. This mitotic additional copies of CDC5. CDC5 encodes a polo-like arrest in response to IBD2 overexpression was not ob- kinase in S. cerevisiae and functions as a component of served in BUB2 and was slightly detected in BFA1 dele- the MEN, but how CDC5 participates in the mitotic exit tion mutant cells. These results strongly suggest that pathway is not known (Kitada et al. 1993; Jaspersen et IBD2 functions as a component of the spindle check- al. 1998). Cdc5p also plays a role in regulating cytokine- point pathway upstream of BUB2 and BFA1. The minor sis and is proposed to coordinate mitotic exit with cytoki- difference of Ibd2p overexpression phenotypes in BUB2 nesis (Song and Lee 2001). A recent report showed and BFA1 deletion mutants could be explained if a regu- that the phosphorylation of Bfa1 by Cdc5p regulates lator of Bub2p other than Bfa1p interacts with Ibd2p the checkpoint function of Bfa1p (Hu et al. 2001). Our for mitotic arrest. Further study of proteins interacting data showing that the mitotic arrest defect of ibd2⌬ is with Ibd2p would answer this possibility. Interestingly, rescued by additional copies of CDC5 suggest that IBD2 608 H.-S. Hwang and K. Song is likely to function upstream of CDC5 in the mitotic University for English editing. This work was supported by a grant exit pathway to regulate the function of Bfa1p. However, from the Korean Ministry of Science and Technology (Critical Tech- nology 21 on “Life Phenomena and Function Research”; 00-J-LF-01- the genetic interaction between IBD2 and CDC5 seems B-60) donated to K. Song and partly by a grant from the Korean to be confined in the control of mitotic exit, since the Science & Engineering Foundation (KOSEF 1999-2-207-003-3). deletion or overexpression of IBD2 does not affect cytokinesis. Possible functions of IBD2 in the BUB2-dependent LITERATURE CITED pathway: Ibd2p is the first component of the Bub2- dependent spindle checkpoint to be identified that acts Alexandru, G., W. Zacharie, A. Schleiffer and K. Nasmyth, 1999 Sister chromatid separation and chromosome re-duplication are directly upstream of Bfa1p and Bub2p. Since the Bub2p- regulated by different mechanisms in response to spindle dam- dependent spindle checkpoint prevents mitotic exit and age. EMBO J. 18: 2707–2721. cytokinesis in response to spindle orientation defects, Bardin, A., J. R. Vistin and A. Amon, 2000 A mechanism for cou- pling exit from mitosis to partitioning of the nucleus. Cell 102: Ibd2p is likely to function in transmitting signals about 21–31. spindle integrity to Bfa1p and Bub2p for regulating Berlin, V., C. A. Styles and G. Fink, 1990 Bik1, a protein required the exit from mitosis. Ibd2p is a novel protein with no for microtubule function during mating and mitosis in Saccharo- myces cerevisiae, colocalizes with tubulin. J. Cell Biol. 111: 2573– homology to proteins of known function, but it contains 2586. a conserved sequence (CCPHHHYENLS) found in chi- Bloecher, A., G. M. Venturi and K. Tatchell, 2000 Anaphase tinase families (Huang and Brutlag 2001). This motif spindle position is monitored by the BUB2 checkpoint. Nat. Cell Biol. 2: 556–558. is also found in Bik1p, which is required for proper Cahill,D.P.,C.Lengauer,J.Yu,G.J.Riggins,J.K.Willson et al., microtubule function during mitosis and which shows 1998 Mutations of mitotic checkpoint genes in human cancers. both genetic and direct physical interactions with Bim1p Nature 392: 300–303. ␣ Chen,R.H.,J.C.Waters,E.D.Salmon and A. W. Murray, 1996 and -tubulin in budding yeast (Berlin et al. 1990; Association of spindle assembly checkpoint component XMAD2 Schwartz et al. 1997). The conservation of this se- with unattached kinetochores. Science 274: 242–246. quence in Ibd2p thus points toward possible functions Chen, R. H., A. Shevchenko, M. Mann and A. W. Murray, 1998 Spindle checkpoint protein xmad1 recruits xmad2 to unattached of Ibd2p in monitoring spindle orientation defects dur- kinetochores. J. Cell Biol. 143: 283–295. ing mitosis. Our unpublished data suggest that the do- Cohen-Fix, O., and D. Koshland, 1999 Pds1p of budding yeast has main of Ibd2p containing this motif is important for dual roles: inhibition of anaphase initiation and regulation of mitotic exit. Genes Dev. 13: 1950–1959. eliciting the mitotic arrest observed upon overexpres- Duenas, E., J. L. Revuelta,F.Del Rey and C. R. Vazquez De Aldana, sion of Ibd2p. Further analysis of genetic and physical 1999 Disruption and basic phenotype analysis of six novel genes interactions between Ibd2p and proteins involved in from the left arm of chromosome XIV of Saccharomyces cerevisiae. Yeast 15: 63–72. proper spindle orientation such as Bim1p, Kar9p, Bik1p, Fang,G.,H.Yu and M. W. Kirschner, 1998 The checkpoint protein and Nud1p is underway and should give clues about MAD2 and the mitotic regulator CDC20 form a ternary complex the precise mechanism by which Ibd2p functions in the with the anaphase-promoting complex to control anaphase transition. Genes Dev. 12: 1871–1883. spindle checkpoint. Fesquet, D., P. J. Fitzpatrick, A. L. Johnson, K. M. Kramer, J. H. Since the overexpression of Ibd2p induced mitotic Toyn et al., 1999 A Bub2p-dependent spindle checkpoint path- arrest upstream of Bfa1p and Bub2p, Ibd2p could act way regulates the Dbf2 kinase in budding yeast. EMBO J. 18: 2424–2434. as a negative regulator of Tem1 GTPase, possibly by Fraschini, R., E. Formenti, G. Lucchini and S. Piatti, 1999 Bud- activating Bfa1 and Bub2 GAP or by inhibiting the GEF ding yeast Bub2 is localized at spindle pole bodies and activates Lte1. We observed that Ibd2p does not physically inter- the mitotic checkpoint via a different pathway from Mad2. J. Cell Biol. 145: 979–991. act with Lte1p but is localized as a dot near the nuclear Furge, K. A., K. Wong, J. Amstrong, M. Balasubramanian and periphery when expressed as a GFP fusion, suggesting C. F. Albright, 1998 Byr4 and Cdc16 form a two-component that it localizes on the spindle pole body, as does Bfa1p GTPase-activating protein for the Spg1 GTPase that controls sep- tation in fission yeast. Curr. Biol. 8: 947–954. (H. Hwang, unpublished data). These observations Gyuris, J., E. Golemis, H. Chertkov and R. Brent, 1993 Cdi1, a strongly suggest that Ibd2p functions negatively on human G1 and S phase protein phosphatase that associates with Tem1 GTPase by direct interaction with Bfa1p. Al- Cdk2. Cell 75: 791–803. though there is no direct interaction between Ibd2p Hardwick, K. G., E. Weiss, F. C. Luca, M. Winey and A. W. Murray, 1996 Activation of the budding yeast spindle assembly check- and Lte1p, a genome-wide two-hybrid analysis reported point without mitotic spindle disruption. Science 273: 953–956. that Ibd2p is connected to Lte1p through YNL091W Hoyt, M. A., L. Totis and B. T. Roberts, 1991 S. cerevisiae genes and Msl1p (Uetz et al. 2000). Therefore, the possibility required for cell cycle arrest in response to loss of microtubule function. Cell 66: 507–517. that Ibd2p acts to negatively influence Lte1p cannot be Hu, F., Y. Wang,D.Liu,Y.Li,J.Qin et al., 2001 Regulation of the excluded. Conceivably, Ibd2p might function indirectly Bub2/Bfa1 GAP complex by Cdc5 and cell cycle checkpoint. Cell to inactivate Tem1p GTPase both by activating Bfa1p 107: 655–665. Huang, J. Y., and D. L. Brutlag, 2001 The eMOTIF database. and by inactivating Lte1p to block mitotic exit when Nucleic Acids Res. 29: 202–204. there are defects in spindle formation and orientation. Hwang, L. H., L. Lau, D. Smith, C. A. Mistrot and K. G. Hardwick, 1998 Budding yeast Cdc20: a target of the spindle checkpoint. We thank Drs. J. Kim, K. Choi, M. Winey, C. Rodriquez, F. Galibert, Science 279: 1041–1044. A. Hoyt, A. Toh-e, M. Lonetine, and F. Rey for providing yeast strains Jaspersen, S. L., J. F. Charles, R. L. Tinker-Kulberg and D. O. and plasmids. We are also indebted to Dr. Kris Gunsalus of New York Morgan, 1998 A late mitotic regulatory network controlling IBD2 Encodes a Novel Spindle Checkpoint Regulator in Budding Yeast 609

cyclin destruction in Saccharomyces cerevisiae. Mol. Biol. Cell 9: Pereira, G., T. Hofken,J.Grindlay,C.Manson and E. Schiebel, 2803–2817. 2000 The Bub2p spindle checkpoint links nuclear migration Jwa, M., and K. Song, 1998 Byr4, a dosage-dependent regulator of with mitotic exit. Mol. Cell 6: 1–10. cytokinesis in S. pombe, interacts with a possible small GTPase Schwab, M., A. S. Lutum and W. Seufert, 1997 Yeast Hct1 is a pathway including Spg1 and Cdc16. Mol. Cell 8: 240–245. regulator of Clb2 cyclin proteolysis. Cell 90: 683–693. Kitada, K., A. L. Johnson, L. H. Johnston and A. Sugino, 1993 Schwartz, K., K. Richards and D. Botstein, 1997 BIM1 encodes A multicopy suppressor gene of the Saccharomyces cerevisiae G1 a microtubule-binding protein in yeast. Mol. Biol. Cell 8: 2677– cell cycle mutant gene dbf4 encodes a protein kinase and is 2691. identified as CDC5. Mol. Cell. Biol. 13: 4445–4457. Sena, P., D. N. Radin and S. Fogel, 1973 Synchronous mating in Korinek, W. S., M. J. Copeland, A. Chaudhuri and J. Chant, 2000 yeast. Proc. Natl. Acad. Sci. USA 70: 1373–1377. Molecular linkage underlying microtubule orientation toward Shirayama, M., A. Toth, M. Galova and K. Nasmyth, 1999 APC cortical sites in yeast. Science 287: 2257–2259. (Cdc20) promotes exit from mitosis by destroying the anaphase Lee, J., H.-S. Hwang, J. Kim and K. Song, 1999 Ibd1p, a possible inhibitor Pds1 and cyclin Clb5. Nature 402: 203–207. spindle pole body associated protein, regulates nuclear division Straight, A. F., and A. W. Murray, 1997 The spindle assembly and bud separation in Saccharomyces cerevisiae. Biochim. Biophys. checkpoint in budding yeast. Methods Enzymol. 283: 425–440. Acta 1449: 239–253. Song, S., and K. S. Lee, 2001 A novel function of Saccharomyces Lee, L., J. S. Tirnauer,J.Li,S.C.Schuyler,J.Y.Liu et al., 2000 cerevisiae CDC5 in cytokinesis. J. Cell Biol. 152: 451–469. Positioning of the mitotic spindle by a cortical-microtubule cap- Taylor, S. S., and F. McLeon, 1997 Kinetochore localization of ture mechanism. Science 287: 2260–2262. murine bub1 is required for normal mitotic timing and check- Li, R., 1999 Bifurcation of the mitotic checkpoint pathway in bud- point response to spindle damage. Cell 89: 727–735. ding yeast. Proc. Natl. Acad. Sci. USA 96: 4989–4994. Taylor, S. S., E. Ha and F. MaKeon, 1998 The human homologue Li, R., and A. W. Murray, 1991 Feedback control of mitosis in of Bub3 is required for kinetochore localization of Bub1 and a budding yeast. Cell 66: 519–531. Mad3/Bub1-related protein kinase. J. Cell Biol. 142: 1–11. Li, Y. Y., E. Yeh, T. Hays and K. Bloom, 1993 Disruption of mitotic Tinker-Kulberg, R. L., and D. O. Morgan, 1999 Pds1 and Esp1 spindle orientation in a yeast dynein mutant. Proc. Natl. Acad. control both anaphase and mitotic exit in normal cells and after Sci. USA 90: 10096–10100. DNA damage. Genes Dev. 13: 1936–1949. Longtine, M. S., A. McKenzie, D. J. Demarini, N. G. Shah, A. Wach Uetz, P., L. Giot, G. Cagney, T. A. Mansfield, R. S. Judson et al., et al., 1998 Additional modules for versatile and economical 2000 A comprehensive analysis of protein-protein interactions PCR-based gene deletion and modification in Saccharomyces cerevis- in Saccharomyces cerevisiae. Nature 10: 623–627. iae. Yeast 14: 953–961. Visintin, R., S. Prinz and A. Amon, 1997 CDC20 and CDH1: a Mark, D. R., W. Fred and H. Philip, 1990 Methods in Yeast Genetics: family of substrate-specific activators of APC-dependent proteoly- A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold sis. Science 278: 460–463. Spring Harbor, NY. Wach, A., A. Brachat,R.Pohlmann and P. Philippsen, 1994 New Martinez-Exposito, M. J., K. B. Kaplan, J. Copeland and P. K. heterologous modules for classical or PCR-based gene disruptions Sorger, 1999 Retention of the BUB3 checkpoint protein on in Saccharomyces cerevisiae. Yeast 10: 1793–1808. lagging chromosomes. Proc. Natl. Acad. Sci. USA 96: 8493–8498. Zachariae, W., M. Schwab, K. Nasmyth and W. Seufert, Miller, R. K., S. C. Cheng and M. D. Rose, 2000 Bim1p/Yeb1p 1998 Control of cyclin ubiquitination by CDK-regulated bind- mediates the Kar9p-dependent cortical attachment of cyto- ing of Hct1 to the anaphase promoting complex. Science 282: plasmic microtubules. Mol. Biol. Cell 11: 2949–2959. 1721–1724. Mosch, H. U., and G. R. Fink, 1997 Dissection of filamentous growth Zou, H., T. J. McGarry, T. Bernal and M. W. Kirschner, 1999 by transposon mutagenesis in Saccharomyces cerevisiae. Genetics Identification of a vertebrate sister chromatid separation inhibi- 145: 671–684. tor involved in transformation and tumorigenesis. Science 285: Paulovich, A. G., and L. H. Hartwell, 1995 A checkpoint regu- 344–345. lates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell 82: 841–847. Communicating editor: M. D. Rose