DOCSLIB.ORG

Supplementary Table 6: Transcripts with a Significant Difference in Expression Between Insulin- and X10- Treated Animal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Table 6: Transcripts with a significant difference in expression between insulin- and X10- treated animal. Fold change X10 relative Illumina ID Gene Symbol Entrez Gene Name to insulin ACOT1 ACOT1 acyl-CoA thioesterase 1 -1.171 1300017J02RIK 1.093 1700057G04RIK 1.132 2210008F06RIK 1.094 2610016F04RIK 1.100 2610301B20RIK -1.090 2900054C01RIK 1.090 4833412N02RIK -1.159 4930544G11RIK 1.109 4933412E12RIK -1.216 5430400L16RIK 1.098 5430417C01RIK -1.079 5730406F04RIK -1.110 5832418A03 1.131 6030458P06RIK -1.153 6430550H21RIK 1.095 9530066K23RIK -1.112 9930023K05RIK -1.074 A130019A16RIK -1.077 A330043C08RIK 1.087 A630054D14 1.129 A830042C15RIK -1.135 AA409316 FAM83H family with sequence similarity 83, member H 1.230 Lipo1 (includes AI747699 others) lipase, member O2 -1.099 ALDH18A1 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 1.399 ARHGAP26 ARHGAP26 Rho GTPase activating protein 26 -1.073 ARID3A ARID3A AT rich interactive domain 3A (BRIGHT-like) -1.139 ARL5A ARL5A ADP-ribosylation factor-like 5A -1.155 ARRDC4 ARRDC4 arrestin domain containing 4 -1.220 ATF4 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1.346 BANF2 BANF2 barrier to autointegration factor 2 -1.072 BATF BATF basic leucine zipper transcription factor, ATF-like -1.100 BC018242 LPPR2 lipid phosphate phosphatase-related protein type 2 1.155 BC039210 PIEZO1 piezo-type mechanosensitive ion channel component 1 1.230 BDKRB1 BDKRB1 bradykinin receptor B1 -1.107 BNC1 BNC1 basonuclin 1 1.247 C130023A14RIK -1.080 C130032M10RIK 1.114 C130037I06RIK 1.098 C130080K17RIK -1.126 C3 NAD+ -1.530 C630032P22RIK 1.110 C730027P07RIK -1.093 C730036N12RIK 1.102 CCL9 -1.343 CD2 CD2 CD2 molecule -1.168 CD274 CD274 CD274 molecule -1.338 CD52 CD52 CD52 molecule -1.238 CD6 CD6 CD6 molecule -1.139 CD79B CD79B CD79b molecule, immunoglobulin-associated beta 1.076 CD97 CD97 CD97 molecule 1.197 CDR2L CDR2L cerebellar degeneration-related protein 2-like 1.333 CFP CFP complement factor properdin -1.285 CHAC1 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 2.243 CHCHD10 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 -1.415 CHMP4B CHMP4B charged multivesicular body protein 4B -1.432 CLDN15 CLDN15 claudin 15 1.098 CNR2 CNR2 cannabinoid receptor 2 (macrophage) -1.105 CPT1B CPT1B carnitine palmitoyltransferase 1B (muscle) -1.074 CRELD1 CRELD1 cysteine-rich with EGF-like domains 1 -1.193 CYP51 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1.193 CYTIP CYTIP cytohesin 1 interacting protein -1.214 D130007C19RIK -1.094 D130043K22RIK -1.071 D130054H18RIK 1.072 D430004H20RIK -1.129 D430006A07RIK -1.100 D630048A15RIK -1.111 D7BWG0611E -1.087 D930002C22RIK -1.072 D930046M13RIK 1.217 DDIT3 DDIT3 DNA-damage-inducible transcript 3 1.452 DENND4B DENND4B DENN/MADD domain containing 4B 1.137 DHX58 DHX58 DEXH (Asp-Glu-X-His) box polypeptide 58 -1.202 DIRAS2 DIRAS2 DIRAS family, GTP-binding RAS-like 2 -1.142 E030010A14RIK -1.139 E030030K01RIK 1.182 E430031D18RIK 1.235 EBI3 EBI3 Epstein-Barr virus induced 3 -1.203 EDC4 EDC4 enhancer of mRNA decapping 4 1.200 EG328314 SORL1 sortilin-related receptor, L(DLR class) A repeats containing 1.072 EG383436 -1.131 EG434077 -1.084 EG667378 1.091 EGFL8 EGFL8 EGF-like-domain, multiple 8 1.086 EHHADH EHHADH enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase -1.107 EN1 EN1 engrailed homeobox 1 -1.172 FAM109A FAM109A family with sequence similarity 109, member A -1.226 FGF21 FGF21 fibroblast growth factor 21 1.233 FKBP1A FKBP1A FK506 binding protein 1A, 12kDa -1.264 FOXJ1 FOXJ1 forkhead box J1 1.112 GBP3 GBP3 guanylate binding protein 3 -1.242 GBP6 GBP6 guanylate binding protein family, member 6 -1.178 GCK GCK glucokinase (hexokinase 4) 1.112 GFOD2 GFOD2 glucose-fructose oxidoreductase domain containing 2 1.155 GIP GIP gastric inhibitory polypeptide -1.129 GMDS GMDS GDP-mannose 4,6-dehydratase -1.213 GPR120 O3FAR1 omega-3 fatty acid receptor 1 -1.117 H2-AB1 -1.278 H2-KE6 -1.220 H2-TW3 -1.128 HBEGF HBEGF heparin-binding EGF-like growth factor 1.268 homocysteine-inducible, endoplasmic reticulum stress-inducible, HERPUD1 HERPUD1 ubiquitin-like domain member 1 1.272 HIF3A HIF3A hypoxia inducible factor 3, alpha subunit 1.068 HIST1H1B HIST1H1B histone cluster 1, H1b -1.107 HIST1H1C HIST1H1C histone cluster 1, H1c -1.379 HIST2H2BE HIST1H2BF (includes others) histone cluster 2, H2be -1.276 HIST1H2BH/HI HIST1H2BH ST1H2BO histone cluster 1, H2bh -1.397 HOXA4 HOXA4 homeobox A4 1.177 HOXA5 HOXA5 homeobox A5 -1.182 HOXA9 HOXA9 homeobox A9 -1.125 HS6ST1 HS6ST1 heparan sulfate 6-O-sulfotransferase 1 1.250 IFT88 IFT88 intraflagellar transport 88 homolog (Chlamydomonas) -1.113 IGLC2_J00595_IG_L AMBDA_CONSTAN 1.104 T_2_14 IGTP -1.390 IIGP2 -1.412 KRT222 KRT222 keratin 222 1.110 LHFPL2 LHFPL2 lipoma HMGIC fusion partner-like 2 1.212 LMBR1L LMBR1L limb region 1 homolog (mouse)-like -1.218 LOC100041796 1.079 LOC100044298 -1.225 LOC100044430 -1.395 LOC100044698 1.074 LOC100045708 1.160 LOC100046586 1.150 LOC100046891 1.219 LOC100047260 1.207 LOC100047480 1.197 LOC100048076 -1.269 LOC100048554 -1.774 LOC216963 1.189 LOC232745 1.098 LOC240672 1.357 LOC277313 -1.078 LOC329506 -1.111 LOC331336 -1.113 LOC380626 1.085 LOC380854 1.124 LOC381607 1.099 LOC382994 1.104 LOC383836 1.096 LOC384890 1.102 LOC386553 1.184 LOC626150 -1.096 LOC672946 1.094 LOC674706 -1.420 LRFN2 LRFN2 leucine rich repeat and fibronectin type III domain containing 2 -1.101 LTB4R1 -1.420 LTC4S LTC4S leukotriene C4 synthase -1.301 LYCAT LCLAT1 lysocardiolipin acyltransferase 1 1.130 LYVE1 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 -1.125 MAML1 MAML1 mastermind-like 1 (Drosophila) 1.215 MAT1A MAT1A methionine adenosyltransferase I, alpha -1.076 MEF2C MEF2C myocyte enhancer factor 2C -1.082 MEPCE MEPCE methylphosphate capping enzyme 1.149 MOD1 1.111 MS4A6D -1.308 MSLN MSLN mesothelin 1.203 MYD116 1.544 MYO1G MYO1G myosin IG -1.260 MYOHD1 MYO19 myosin XIX 1.136 NAPSA NAPSA napsin A aspartic peptidase -1.316 NCF4 NCF4 neutrophil cytosolic factor 4, 40kDa -1.337 NIT2 NIT2 nitrilase family, member 2 -1.120 NOD1 NOD1 nucleotide-binding oligomerization domain containing 1 -1.180 NOL1 NOP2 NOP2 nucleolar protein homolog (yeast) 1.217 OASL2 -1.170 OLFR1390 1.145 OLFR66 1.104 PDCL3 PDCL3 phosducin-like 3 1.122 PDE2A PDE2A phosphodiesterase 2A, cGMP-stimulated 1.074 PEG10 PEG10 paternally expressed 10 -1.080 PHLDB1 PHLDB1 pleckstrin homology-like domain, family B, member 1 1.144 PIK3IP1 PIK3IP1 phosphoinositide-3-kinase interacting protein 1 -1.161 PLK2 PLK2 polo-like kinase 2 1.310 PODXL PODXL podocalyxin-like 1.127 POU2F2 POU2F2 POU class 2 homeobox 2 1.240 PRDX6-RS2 1.102 PTCRA PTCRA pre T-cell antigen receptor alpha 1.115 PTRH1 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) -1.133 PWWP2B PWWP2B PWWP domain containing 2B 1.136 RAB4A RAB4A RAB4A, member RAS oncogene family 1.202 RAB7L1 RAB7L1 RAB7, member RAS oncogene family-like 1 -1.172 RCOR2 RCOR2 REST corepressor 2 1.153 RHBDD1 RHBDD1 rhomboid domain containing 1 1.280 RIL-PENDING 1.128 RIN1 RIN1 Ras and Rab interactor 1 1.208 RNF130 RNF130 ring finger protein 130 -1.245 RNPEP RNPEP arginyl aminopeptidase (aminopeptidase B) -1.236 SC4MOL MSMO1 methylsterol monooxygenase 1 1.304 SCL0002130.1_20 -1.173 SCL000648.1_30 -1.086 SECTM1A -1.111 sema domain, immunoglobulin domain (Ig), transmembrane domain SEMA4A SEMA4A (TM) and short cytoplasmic domain, (semaphorin) 4A -1.406 SESN2 SESN2 sestrin 2 1.297 SHISA4 SHISA4 shisa homolog 4 (Xenopus laevis) -1.102 SIPA1L2 SIPA1L2 signal-induced proliferation-associated 1 like 2 1.118 SLC12A4 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1.220 solute carrier family 1 (glutamate/neutral amino acid transporter), SLC1A4 SLC1A4 member 4 1.375 solute carrier family 25 (mitochondrial carrier; phosphate carrier), SLC25A25 SLC25A25 member 25 1.220 SLC25A30 SLC25A30 solute carrier family 25, member 30 1.116 SMCR7 SMCR7 Smith-Magenis syndrome chromosome region, candidate 7 1.130 SNAI2 SNAI2 snail homolog 2 (Drosophila) 1.187 SNAP29 SNAP29 synaptosomal-associated protein, 29kDa -1.188 SNX20 SNX20 sorting nexin 20 -1.193 STARD5 STARD5 StAR-related lipid transfer (START) domain containing 5 1.181 STAT1 STAT1 signal transducer and activator of transcription 1, 91kDa -1.291 TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)- TAF5L TAF5L associated factor, 65kDa 1.226 Target ID TCF21 TCF21 transcription factor 21 1.163 TCFE2A 1.188 TFRC TFRC transferrin receptor (p90, CD71) 1.475 TMEM184C TMEM184C transmembrane protein 184C 1.103 TMEM97 TMEM97 transmembrane protein 97 1.243 TNFRSF18 TNFRSF18 tumor necrosis factor receptor superfamily, member 18 -1.218 TNKS1BP1 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1.141 TPRKB TPRKB TP53RK binding protein 1.185 TPSAB1 TPSAB1/TPSB2 tryptase alpha/beta 1 -1.116 TRBV13- 1_M15618_T_CELL_ RECEPTOR_BETA_ VARIABLE_13- 1_213 1.158 TRFR2 -1.078 TRIB3 TRIB3 tribbles homolog 3 (Drosophila) 1.546 TRIM30 -1.113 TTC37 TTC37 tetratricopeptide repeat domain 37 1.138 UNG UNG uracil-DNA glycosylase -1.152 WDR25 WDR25 WD repeat domain 25 1.105 WIF1 WIF1 WNT inhibitory factor 1 1.125 ZFP496 1.349 ZFP598 1.210 .
Recommended publications
  • Supplementary Data

    Supplementary Data

    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
  • Comprehensive Molecular Characterization of Gastric Adenocarcinoma

    Comprehensive Molecular Characterization of Gastric Adenocarcinoma

    Comprehensive molecular characterization of gastric adenocarcinoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Bass, A. J., V. Thorsson, I. Shmulevich, S. M. Reynolds, M. Miller, B. Bernard, T. Hinoue, et al. 2014. “Comprehensive molecular characterization of gastric adenocarcinoma.” Nature 513 (7517): 202-209. doi:10.1038/nature13480. http://dx.doi.org/10.1038/ nature13480. Published Version doi:10.1038/nature13480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12987344 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2014 September 22. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2014 September 11; 513(7517): 202–209. doi:10.1038/nature13480. Comprehensive molecular characterization of gastric adenocarcinoma A full list of authors and affiliations appears at the end of the article. Abstract Gastric cancer is a leading cause of cancer deaths, but analysis of its molecular and clinical characteristics has been complicated by histological and aetiological heterogeneity. Here we describe a comprehensive molecular evaluation of 295 primary gastric adenocarcinomas as part of The Cancer
  • Isyte: Integrated Systems Tool for Eye Gene Discovery

    Isyte: Integrated Systems Tool for Eye Gene Discovery

    Lens iSyTE: Integrated Systems Tool for Eye Gene Discovery Salil A. Lachke,1,2,3,4 Joshua W. K. Ho,1,4,5 Gregory V. Kryukov,1,4,6 Daniel J. O’Connell,1 Anton Aboukhalil,1,7 Martha L. Bulyk,1,8,9 Peter J. Park,1,5,10 and Richard L. Maas1 PURPOSE. To facilitate the identification of genes associated ther investigation. Extension of this approach to other ocular with cataract and other ocular defects, the authors developed tissue components will facilitate eye disease gene discovery. and validated a computational tool termed iSyTE (integrated (Invest Ophthalmol Vis Sci. 2012;53:1617–1627) DOI: Systems Tool for Eye gene discovery; http://bioinformatics. 10.1167/iovs.11-8839 udel.edu/Research/iSyTE). iSyTE uses a mouse embryonic lens gene expression data set as a bioinformatics filter to select candidate genes from human or mouse genomic regions impli- ven with the advent of high-throughput sequencing, the cated in disease and to prioritize them for further mutational Ediscovery of genes associated with congenital birth defects and functional analyses. such as eye defects remains a challenge. We sought to develop METHODS. Microarray gene expression profiles were obtained a straightforward experimental approach that could facilitate for microdissected embryonic mouse lens at three key devel- the identification of candidate genes for developmental disor- opmental time points in the transition from the embryonic day ders, and, as proof-of-principle, we chose defects involving the (E)10.5 stage of lens placode invagination to E12.5 lens primary ocular lens. Opacification of the lens results in cataract, a leading cause of blindness that affects 77 million persons and fiber cell differentiation.
  • Oxidative Stress-Induced Chromosome Breaks Within

    Oxidative Stress-Induced Chromosome Breaks Within

    Tan et al. Human Genomics (2018) 12:29 https://doi.org/10.1186/s40246-018-0160-8 PRIMARY RESEARCH Open Access Oxidative stress-induced chromosome breaks within the ABL gene: a model for chromosome rearrangement in nasopharyngeal carcinoma Sang-Nee Tan1, Sai-Peng Sim1* and Alan Soo-Beng Khoo2 Abstract Background: The mechanism underlying chromosome rearrangement in nasopharyngeal carcinoma (NPC) remains elusive. It is known that most of the aetiological factors of NPC trigger oxidative stress. Oxidative stress is a potent apoptotic inducer. During apoptosis, chromatin cleavage and DNA fragmentation occur. However, cells may undergo DNA repair and survive apoptosis. Non-homologous end joining (NHEJ) pathway has been known as the primary DNA repair system in human cells. The NHEJ process may repair DNA ends without any homology, although region of microhomology (a few nucleotides) is usually utilised by this DNA repair system. Cells that evade apoptosis via erroneous DNA repair may carry chromosomal aberration. Apoptotic nuclease was found to be associated with nuclear matrix during apoptosis. Matrix association region/scaffold attachment region (MAR/SAR) is the binding site of the chromosomal DNA loop structure to the nuclear matrix. When apoptotic nuclease is associated with nuclear matrix during apoptosis, it potentially cleaves at MAR/SAR. Cells that survive apoptosis via compromised DNA repair may carry chromosome rearrangement contributing to NPC tumourigenesis. The Abelson murine leukaemia (ABL) gene at 9q34 was targeted in this study as 9q34 is a common region of loss in NPC. This study aimed to identify the chromosome breakages and/or rearrangements in the ABL gene in cells undergoing oxidative stress-induced apoptosis.
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
  • University of Copenhagen, Copenhagen, Denmark, Citation: Pereira J, Johnson WE, O’Brien SJ, 8

    University of Copenhagen, Copenhagen, Denmark, Citation: Pereira J, Johnson WE, O’Brien SJ, 8

    Evolutionary genomics and adaptive evolution of the hedgehog gene family (Shh, Ihh and Dhh) in vertebrates Pereira, Joana; Johnson, Warren E.; O'Brien, Stephen J.; Jarvis, Erich D; Zhang, Guojie; Gilbert, M. Thomas P.; Vasconcelos, Vitor; Antunes, Agostinho Published in: PloS one DOI: 10.1371/journal.pone.0074132 Publication date: 2014 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Pereira, J., Johnson, W. E., O'Brien, S. J., Jarvis, E. D., Zhang, G., Gilbert, M. T. P., Vasconcelos, V., & Antunes, A. (2014). Evolutionary genomics and adaptive evolution of the hedgehog gene family (Shh, Ihh and Dhh) in vertebrates. PloS one, 9(12), [e74132]. https://doi.org/10.1371/journal.pone.0074132 Download date: 24. sep.. 2021 RESEARCH ARTICLE Evolutionary Genomics and Adaptive Evolution of the Hedgehog Gene Family (Shh, Ihh and Dhh) in Vertebrates Joana Pereira1¤, Warren E. Johnson2, Stephen J. O’Brien3,4, Erich D. Jarvis5, Guojie Zhang6, M. Thomas P. Gilbert7, Vitor Vasconcelos1,8, Agostinho Antunes1,8* 1. CIIMAR/CIMAR, Interdisciplinary Centre of Marine and Environmental Research, University of Porto, Porto, Portugal, 2. Smithsonian Conservation Biology Institute, National Zoological Park, Front Royal, Virginia, United States of America, 3. Theodosius Dobzhansky Center for Genome Bioinformatics, St. Petersburg State University, St. Petersburg, Russia, 4. Oceanographic Center, N. Ocean Drive, Nova Southeastern University, Ft. Lauderdale, Florida, United States of America, 5. Howard Hughes Medical Institute, Department of Neurobiology, Duke University Medical Center, Durham, North Carolina, United States of America, 6. BGI-Shenzhen, Beishan Industrial Zoon, Yantian District, Shenzhen, China, 7.
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene

    Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
  • The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D

    The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D

    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail.
  • Coordinate Regulation of Long Non-Coding Rnas and Protein-Coding Genes in Germ- Free Mice Joseph Dempsey, Angela Zhang and Julia Yue Cui*

    Coordinate Regulation of Long Non-Coding Rnas and Protein-Coding Genes in Germ- Free Mice Joseph Dempsey, Angela Zhang and Julia Yue Cui*

    Dempsey et al. BMC Genomics (2018) 19:834 https://doi.org/10.1186/s12864-018-5235-3 RESEARCHARTICLE Open Access Coordinate regulation of long non-coding RNAs and protein-coding genes in germ- free mice Joseph Dempsey, Angela Zhang and Julia Yue Cui* Abstract Background: Long non-coding RNAs (lncRNAs) are increasingly recognized as regulators of tissue-specific cellular functions and have been shown to regulate transcriptional and translational processes, acting as signals, decoys, guides, and scaffolds. It has been suggested that some lncRNAs act in cis to regulate the expression of neighboring protein-coding genes (PCGs) in a mechanism that fine-tunes gene expression. Gut microbiome is increasingly recognized as a regulator of development, inflammation, host metabolic processes, and xenobiotic metabolism. However, there is little known regarding whether the gut microbiome modulates lncRNA gene expression in various host metabolic organs. The goals of this study were to 1) characterize the tissue-specific expression of lncRNAs and 2) identify and annotate lncRNAs differentially regulated in the absence of gut microbiome. Results: Total RNA was isolated from various tissues (liver, duodenum, jejunum, ileum, colon, brown adipose tissue, white adipose tissue, and skeletal muscle) from adult male conventional and germ-free mice (n = 3 per group). RNA-Seq was conducted and reads were mapped to the mouse reference genome (mm10) using HISAT. Transcript abundance and differential expression was determined with Cufflinks using the reference databases NONCODE 2016 for lncRNAs and UCSC mm10 for PCGs. Although the constitutive expression of lncRNAs was ubiquitous within the enterohepatic (liver and intestine) and the peripheral metabolic tissues (fat and muscle) in conventional mice, differential expression of lncRNAs by lack of gut microbiota was highly tissue specific.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name basonuclin 1 Gene Symbol BNC1 Organism Human Gene Summary The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. This gene seems to have multiple alternatively spliced transcript variants but their full-length nature is not known yet. There seems to be evidence of multiple polyadenylation sites for this gene. Gene Aliases BNC, BSN1, HsT19447 RefSeq Accession No. NC_000015.9, NT_077661.3 UniGene ID Hs.459153 Ensembl Gene ID ENSG00000169594 Entrez Gene ID 646 Assay Information Unique Assay ID qHsaCID0017223 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000345382, ENST00000541809 Amplicon Context Sequence CCATAGAGCATGAGGCTGCTAATATCAAACACTACATTGGACTGGACAATCTCCA CCTGGCTTGTTGGATACATGGGGGGGATCCTTAGCTTACTTAGAGCGTGGGCCA CCCATCCATGCTTGCATTGGTCACACTGACGGTGGTTTATTTTCCCGGGTTTGAA ACTTTGG Amplicon Length (bp) 141 Chromosome Location 15:83935724-83936955 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9997 cDNA Cq 26.81 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 84.5 gDNA Cq 39.42 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report BNC1, Human Amplification
  • Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: a Role for Histone Deacetylase 4

    Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: a Role for Histone Deacetylase 4

    The Journal of Neuroscience, November 12, 2014 • 34(46):15327–15339 • 15327 Cellular/Molecular Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: A Role for Histone Deacetylase 4 Yelin Chen,1 Yuanyuan Wang,1 Zora Modrusan,3 Morgan Sheng,1 and Joshua S. Kaminker1,2 Departments of 1Neuroscience, 2Bioinformatics and Computational Biology, and 3Molecular Biology, Genentech Inc., South San Francisco, California 94080 Neuronal gene expression is modulated by activity via calcium-permeable receptors such as NMDA receptors (NMDARs). While gene expression changes downstream of evoked NMDAR activity have been well studied, much less is known about gene expression changes that occur under conditions of basal neuronal activity. In mouse dissociated hippocampal neuronal cultures, we found that a broad NMDAR antagonist, AP5, induced robust gene expression changes under basal activity, but subtype-specific antagonists did not. While some of the gene expression changes are also known to be downstream of stimulated NMDAR activity, others appear specific to basal NMDARactivity.ThegenesalteredbyAP5treatmentofbasalcultureswereenrichedforpathwaysrelatedtoclassIIahistonedeacetylases (HDACs), apoptosis, and synapse-related signaling. Specifically, AP5 altered the expression of all three class IIa HDACs that are highly expressed in the brain, HDAC4, HDAC5, and HDAC9, and also induced nuclear accumulation of HDAC4. HDAC4 knockdown abolished a subset of the gene expression changes induced by AP5, and led to neuronal death under