Evolution and DíversiEy of 55 rRNA Gene Family Organizatíon ln PyEhium and OLher Stramenopiles
by
,lames Edward LTohn Bedard
A thesis submitted to the Facufty of Graduat.e Studies in part.ial. fulfiLlment of the requirement for the degree of Doctor of philosophy
DeparLment of Microbiology University of Manitoba
Winnipeg , Mani t.oba
Canada
JuIy, 2002 National.ub'ary Bibliothèque nationale t*I du Canada Acouisitions and Acquisitions et Bibiiographic Services services bibliographiques
395 Well¡ngrton St.eet 395, .ue Well¡ngton OtlÂwa ON KIA 0l\¡4 Onawa ON K1A 0N4 Canacta Canada You 6lo Votlo téléñãæ
Our øe ¡lolte télëtâræ
The author has granted a non- L'auteur a accordé u¡re ficence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distibute or sell reproduire, prêter, distribuer ou copies of this thesis in mioroform, vend¡e des copies de cette thèse sous paper or electronic formats. la forme de microfiche/fiI¡n, de reproduction sur papier ou sur format électronique.
The author retains ownership ofthe L'auteur conserye la propriété du copyright in this thesis. Neither the droit d'auteu¡ qui protege cette thèse. thesis nor substantial extracts from it Ni la thèse ni des extaits substantiels may be printed or otherwise de celle-ci ne doivent êüe imprimés reproduced v/ithout the author's ou autrement reproduits sâns son permission. autorisation.
0-612-79832-1
Canad'ä TIIT'. IJNTVERSITY OF MÀNITOBÄ
FACIJLTY OF GRÄDUATE STI]DMS ***** COPYRIGHT PERMISSION PAGE
EVOLUTION AND DTVERSITY OF 55 rRNA GENE FAMILY ORGANIZATION IN P YTHI UM AI.{D OTHER STRAMENOPILES
BY
JAMES EDWARD JOHN BEDARD
A Thesis/Practicum submitted to the Faculty of Graduate Studies ofThe University
of Manitoba in partial fulfillment of the requirements of the degree
of
Doctor of Philosophy
JAMES EDWARD JOHN BEDARD @ 2OO2
Permission has been granted to the Library ofThe University of Manitoba to lend or sell copies ofthis thesis/practicum, to the National Library ofCanada to microfìlm this thesis and to lend or sell copies of the film, and to University Microfìlm Inc, to publish an abstract of this thesis/practicum.
The author reserves other publication rights, and neither this thesis/practicum nor extensive extracts from it may be printed or otherwise reproduced without the authorrs written permission, ÀBSTR.ÈCT
The 55 ribosomal RNA (rRNA) gene family organization among 90 species of Pythium was invest.j_gated to see whether a patt.ern coufd be discerned that might be related to evolutionary or ecological factors. The genus has at least
three main fines of evolut.ion, and a domínant pattern of 55 gene organizatíon was found in each group¿ with a few notabfe exceptions. Specíes with filamentous sporangia and their relatives (croup 1A) had 55 genesl linked to the ribosomal DNA (rDNA) repeat that were predomì.nat.ely coded
for on the opposite DNA strand ('ínverted' orientation) . A smal1 group of species with a variety of sporangial forms
(Group 1B) was related to croup 1A but had unlinked 55 genes. The maín group of species with spherícal zoosporangia (Group 2) generally had unlinked 55 genes in tandem arrays. The six species in Group 3, although they have sphericaf sporangia, had linked genes on t.he same strand as the other rRNA genes ( 'non-inverted, ) and 4 of t.he 6 species each had pairs of tandem 55 genes. fn croup 2, afthough most species had unlinked 5S genes, one major group, believed t.o be a clade on the basis of rTS sequences¿ and two other unrelat.ed species, had finked 5S genes. In three species, (P. anandrum, p. tracheiphiJum and
P. osEracodes) both finked and unlinked genes have been det.ected. 55 rRNA genes undergo translocation in the course
of evol-ution and so they alternate between the finked and the unlinked states, and the inverted and non-invert.ed. orientations, but a nonrandom pattern could be díscerned. Over 50 species of Phytophthora and HaLophytophthora
were surveyed for theír 55 rRNA gene organization. The predomínant pattern found was that Lhe 55 gene is linked and non-inverted in orientation with respect to t.he other rRNA genes of the rDNA repeat. A few species of Phytophthora and HaTophytophthora have their 55 genes unlinked to Ehe rDNA repeat and located in 55 tandem arrays. This confirms earfier findings with t.he genus Pythium which índicated that. 55 genes are readíly rearranged buE. that 55 famíIy organization ís stable in large groups of related species.
The organizaLion of the 55 rRNA gene family in
Rhizidionyces apophysaLus and Hyphochytrium catenoides was investigated to deLermine whether 5S genes are finked or unlinked wit.h respect to other rRNA genes, and to see whether the result.ing patt.ern was consistent with Lhe evolution of 55 gene organization of other sLramenopilous
I ¡qg: The expression'5S genes" will be used throughout as a sho¡t form for,,5S IRNA genes,, iii
fungí. Both organisms were found to have 55 genes linked to
the rDNA repeat and to be coded on the same DNA strand as the ot.her rRNA genes. H, catenojdes also had arrays of tandem repeaLs of 55 sequences unfinked t.o the rDNA repeat, These results support the idea that Lhe linked arïangement ís ancest.ral for stramenopílous fungi but that unlinking of genes was afso occurring. In addition it was found that the
intergenic spacer (IGS) of t.he rDNA repeaL was
heterogenous, like1y due to varying numbers of DNA
subrepeats in differenL versions of the IGS.
Preliminary work using DNA-DNA hybridizat.ion found
evidence of a region cont.aining a put.ative 5S rRNA gene- like sequence within t.he intergenic spacer (IcS) of pythium irreguTare. A region of the IGS consist.ing of the 55 rRNA gene-1ike sequence was cLoned and further characterized, It was previously unknown that. p. irreguLare contained any 55 or Ss-like gene sequences within the IcS region. The cl-oned insert. containing the putative 5S sequence \¡¡as sequenced and analysed. The insert was comprised of 639 base pairs and contained a 55 pseudogene focated almost directly within the middle of the insert. The insert was aligned with the known 55 rRNA gene sequence of. pythiun irreguTare 8R486 and an overall homology of 52.5% was found; 62 basepairs were identical (out of 118). The pseudogene shov/ed 8i-.4% homology to the cent.ral 59 nucleotides of the functional 55 gene. To ampfify the IGS region between the large subunit rRNA (LSïRNA) and the 55 pseudogene, primers were designed based on the r,lell conserved portion of sequence shared between the 55 gene and the pseudogene. The PCR results produced a 1,6 kb amplicon, showing that. the pseudogene v,¡as locat.ed 1.3S kb downstream from the 3'-end of the LSTRNA gene and t.hat it. occurs in the inverted orientation. ThaL is, it was coded. on the opposíte DNA strand with respect to the other rRNA genes. A number of other specíes of pythium may have similar 5S pseudogenes locat.ed. within their IGS regions. ACKNOVILEDGEMENTS
I \.{ou l-d f ike to Lhank my supervisor Dr. clen R.
Klassen for his support and help in overseeing t.he
compfetion of t.his project, whose patience, kindness, and friendship have made my experience in t.he 1ab a joy.
Thanks to our collaborator, Dr. Arthur W.A.M de Cock,
for provision of genomic DNA from most of the ísolates used in this study and t.he opportunity to work wíth him at his 1ab in the Netherfands, and also to his family for a1f
theír kindness and generosity that helped t.o make my st.ay t.here a pleasant one.
I also wish t.o thank my committ.ee members, Dr. Deborah
Court and Dr. David Punter for their suggestions and helpful advice, all Microbiology faculty members, and graduate students, especially my labmate Andrew Schurko and my good friend Chris Rathgeber. Special thanks t.o Dr.
André L,ésvesque for his collaboration and to or. Weidong Chen for his involvement as externaf examiner for this thesis.
The completion of this thesis was in paït. due E.o the support of my beloved wife Angela, my family, and especially my 1aL.e grandfather, .fohn Kouæak. Financial support. from a University of Manitoba
Fellowship and a Natural Sciences and Engíneerj-ng Research Council of Canada grant t.o Ðr. G. R. Kfassen is gratefully acknowl edged . TABIJE OF CONTENTS
page
ABSTRåCT...... i ACKNOWLEDGEMENTS. .. .v TABLE OF CONTENTS .. ..vii LIST OF TABLES ... .x I,IST OF FTGURES ...... xi L]ST OF ABBREVTATIONS...... xiv INTRODUCTION...... ,...1 LITERÀTURE REVIEW...... 4 Early studies of the 5S rRNA gene...... 5
Structure and expression of 55 rRNA genes ...... , . . . . g 55 rRNA gene organizat.ion ín bacteria ...... 13 55 rRNA gene organization in eukaryotes...... L4
Mitochondria...... 1_4 Chloroplast.s ...... 16 Linkage of 55 rRNA genes to rDNA and other multigene families ...... 1_1
Unlinkage of 55 rRNA genes in direct tandem arrays ...... 19 55 pseudogenes...... 19 Dispersal of 55 IRNA genes...... 2L
Syst.ematics of the Kingdom Straminipila...... 24
Systemat.ics of the Genus p¡zthium...... - -25 vlll
Systematics of t.he cenus .P.hytophthora...... 29 MATERTALS ÄND METHODS ...,....32 Growt.h of cult.ures ,.....33
ÐNA extraction and purification of genomic DNA. ..,..45 Amplification of DNA...... 46
Isofation of PCR products ... . .,49 DNA digestion and electrophoresis. . .,...... 50 Hybridization...... 51 Purification of PCR and rest.riction digest.
products ... .52 Cloníng of purified restriction digested fragments ...... 53
i. Políshing of restriction fragmenLs ...... 53
ii. Vect.or-insert ligation...... 54 iii. Trans format.ion ...... 54 DNA sequencing.., .....,.55
CHAPTER 1. EVOLUTTON AND DIVERSITY oF 55 TRNA GENE
ORGANTZATION IN pytåjum...... 56
CHAPTER 2. 55 rRNA GENE ORGANTZATION IN phyEophthora,
Hafophytophtåora, AND OTHER OOMYCETES...... 96
CHAPTER 3. 55 rRNA GENE ORGANIZATTON IN HYPHOCHYTRTOMYCETES .,....133
CHAPTER 4. CIIARå,CTERIZATToN oF A 55 TRNA PSEUDoGENE FOUNÐ
fN THE INTERGENIC SPACER oF Pylhiun IX
irreguTare...... , L4g coNcLUsIoNS . . .181 APPENDTCES ....L84 Appendix l-...... 185 Appendix 2. The ribosomal RNA gene spacer as a source of information for species assignment in Phytophthora...... 2I4
REFERENCES . . ..229 T,TST OF TÀBIES
Page
MATERTALS ÂND METHODS TABLE 1. A list of ísolates used in this study...... 34 TABLE 2. Primers used in amplifications and,/or sequencing rDNA...... ,,47
CHAPTER 1
TABLE 1. Presence and absence of 55 rRNA sequences in
IDNA repeat of pythium species . . ,...... 64
CHAPTER 2
TABLE 1. presence and absence of 55 rRNA sequences in
rDNA repeat. of phytophthora, HaTophytophthora anð.
other oomyceL.e species . . .106
APPENDICES
APPENDIX ].
TABLE 1. Eukaryotic organisms in which the 55 rRNA genes are linked to the rDNA repeac unic...... , . . . .1-g6
TABLE 2. Organisms in which the 55 rRNA genes are tandemly arranged and unlinked to rDNA. ...L92
APPENÐIX 2
TABLE 1. A list of isol-ates used in t.his sLudy...... 2L9 xl
I,IST OF FIGI'RES
Page
CHAPTER 1
Figure 1. Hybridization of the 55 rRNA gene probe to the IGS of the rDNA repeat. to det.ect linkage of
the 55 gene to the other rRNA genes . . . .60
Figure 2. Schematic representat.ion of the pytj?iu¡n 5S
gene showing primers used for amplífication and conserved restrictíon sites...... 10 Figure 3. N2-y and SL-SR pCR amplificat.ion prod.ucts of genomic DNA from a smal1 set of pythiun species ....j3 Figure 4. N2-Y amplification product.s, using purified Q-P2 PCR product as a template, from a set of
croup l-A pythium species ...... 16 Figure 5. SL-SR amplification products, using purifíed Q-P2 PCR product. as a template, from a set of Group 3 pythiun species .,..j9 Figure 6. PCR amplification products of the type
culture of the genus, p. monospermum CBS 15g.73. using genomic DNA as a templat.e...... g2 Figure 7. Comparative 55 rRNA gene arrangement in the P. oedochiTum group...... g5
Figure 8. Schematic phylogeny of the stramenopiles and xll
summary of 55 gene family arrangement...... gg
CHAPTER 2
Fj-gure 1. The presence of 55 sequences in the IGS as detect.ed by hybridization of the 55 probe to the Q-P2 amplicon...... 100
Figure 2, Amplif icat.ions t.o det.ermine E.he location and orient.ation of 55 rRNA sequences in the IcS...1j.0 Figure 3, Amplificat.ions to det.ermine whether there is gene-to-gene amplification due to the presence of tandem arrays in the IGS...... 11g
Figure 4. Schematic phylogeny of st.ramenopiles and
summary of 55 gene family arrangement ...... 13 0
CIiAPTER 3
Figure 1. Primer sites ín the rDNA unit.. ...!3.7 Figure 2. Hybridizat.ion of the 55 rRNA gene probe to the fcs of the rÐNA repeat to detect. linkage of the 55 gene to the other rRNA genes ....139
Figure 3. Amplifications to find arrays of tandem repeats of 55 rRNA genes...... L42
CHAPTER 4.
Figure 1. Amplification of intergenic spacer of
Pythium irreguTare using e and p2 primers. . . . .153 Figure 2. Restriction endonuclease digestions of the
Q-P2 amplicon from pythiun jrregru_Zare (CBS xlll
250.28) . i.55 Figure 3. Purifed ?agI restrict.ion digest fragments
from the Q-P2 amplicon of .P. irregu7are...,.,.159
Figure 4. DNA sequence of the pI2A insert, which is a ?agI fragment. of the intergenic spacer of pythium irreguTare (CBS 250.28)...... 1-61 Figure 5. DNA sequence alignment and comparison of p. irreguJare (CBS 250.28) and p. uTtimum (8R471) DNA sequences; beginning at the e primer ín the
LSTRNA gene, and continuing ínt.o TGS - 1 ...... 16 6 Figure 6. QN-5 and e-N5C pCR amplification of genomic DNA from a set of pythiun species ...... 1-69
Figure 7. Top: Secondary structure model for Lhe 55
rRNA of p. irregulare showing loops a, b, c, d,
and e, and helices A, B, C, D, and E...... IjA
APPENDIX 2
Figure 1. Restriction digestions of phyEophthora IcS spacers (Q-P2 amplicon) ...... 222 x1v
LIST OF .ABBREVIÀTTONS
A adenine
bp base pairs
C cytos ine
CTAB hexadecyltrimethyl ammonium bromide cm centimetre
DIG digoxigenin
DNA deoxyribonuc leic acid
ÐMSO dimet.hyl sul-f oxide dNTP 2' -deoxyribonucleoside 5' -t.riphosphate dUTP 2' -deoxyuridine 5' -t.riphosphate EDTA ethylenediamine-tetra-acetic acid ETS ext.ernal transcribed spacer
Fis (s) t r-gure (s)
G guani dì.ne g gram (s)
ICR internal control- regíon fGR intergenic region IGS intergenic spacer
-L.Lò internal transcribed spacer kb kilobase pairs L litre (s)
LSTRNA large subunit ríbosomaL RNA mg mífligram (s) min minute (s)
ML millifitre (s)
tÌtm millimetre (s)
MM mil-limo1ar
nm nanome tre nt nucfeotide
NTS nontranscribed spacer
PCR polymerase chaín reaction
RAPD random amplifíed polymorphic DNA RFLP restriction fragment fength polymorphism
rDNA ribosomal DNA RÏP repeat. induced point
RNA ribonucleic acid rRNA ribosomaf RNA rpm revoluLions per minute
SDS sodium dodecyl suffate
55U sodium saline cit.rate
SSTRNA smaLl subunit. ribosomal RNA T t.hymine
TF transcription f act.or TSL trans-spliced leader U uraciL l,¿s mícrogram (s) xvl
I,tL mícrolit.re (s ) t¿M micromolar UV uftraviofet V volts v/v vofume / volume w/v weight / volume INTRODUCTION
Ribosomal RNA genes are part of a multigene family. These genes are universal and their products are funct.ionalfy homologous amongst all organisms. Generally, in eukaryotes, the nuclear rRNA gene family is comprised of tandem arrays of the 18S, 5.85 and 28S rRNA genes, interspersed by transcribed and non-transcribed spacers, and is referred to col-lect.ively as the rDNA repeat unit.
The 55 rRNA gene may or may not be linked to t.he rÐNA repeat unit. In higher eukaryotes, such as plants and animals, the 55 gene ís generally found unlinked to the rDNA repeat unit. (Brown and Sugimoto, 1,9j3; Gerlach and Dyer, 198L), whereas in many Lower eukaryotes the 55 gene may or may not be part. of t.he rDNA repeat unit (Gerbi,
1985) . fn many cases where 55 genes are unlinked from t.he rDNA, they are found Lo occur in 55 gene tandem arrays.
There are cases, however, where 55 rRNA genes have been found to be dispersed as single units t.hroughout the genome, as in the fungus Neurospora crassa (SeLker et aL., l-981) . The organizat.ion of 55 rRNA genes has been extensively invest.igat.ed ín the Oomycetes and especially within t.he cenus pythiun (Belkhiri eE aj., 1,992; Belkhiri and Klassen, 1,996; Belkhiri et a] ., 1gg7), and t.o a fesser degree in genera such as Achfya t phytophthora, and SaproTegnia (Rozek and Timberlake, !9j9; Howlett. et af,,
L992) . Afthough much is known, the organization of 55 rRNA genes has yet to be fu1ly surveyed ín pythium and other Oomycetes.
fn Lerms of morphology and physiology the Oomycetes
most closefy resemble fungi. However, 18S rRNA gene
sequences have been used Lo show that the Oomycetes are related to brown algae and diatoms, and more distantly relat.ed to fungi (cunderson et af., Igg't; Förster et al ., 1990) . These groups, though díverse, are combined to form the Kingdom Straminipila, informally ca11ed stramenopiles (Patterson, 1989; I_,eipe et af . , L994) . PyEhiun, wíth over 120 described specíes, is the largest genus wíthj.n the Oomycetes, and. is notoríous for causing serious damage to economically important pfant crops (Van der pfaats -Ni terink, L9g1). pythiun ís a cosmopolitan genus, wit.h isolates colfected worldwide. Pythiun is interesting because species with eit.heï linked or unfinked 55 rRNA gene arrangemenL.s, with respect to the rDNA repeat, have both been found t.o occur within t.he genus (Belkhiri et af., L992). The aim of this study is to provide an extensive survey of 55 gene organization in Pythiun, L.o uncover novel- 55 gene arrangement.s, and to at.E.empt t.o broaden our understanding of the evolutíon of this multigene fami 1y. I,ITERÀTI'RE REVIEW Early studies of the 5S rRNA gene The ribosome was studied by ul tracentri fugation t.hroughout the 1950s. The RNA composit.ion of the ribosome
was found to consist of a 16-l-g5 molecule and a 23_2gS mo1ecu1e, found in t.he small and large subunits, respect.ivefy. Transfer DNA had afso been discovered during that time. 55 rRNA was first. observed in 1959 by Hamilton and Petterman during their investigation of rat fiver microsomes, ín which t.hey observed a fow molecular weight particfe, and based on its size, termed it. "55". Efson (1961¡ L964) discovered a sj.mifar particle in the E. coLi 50S subuniL. and hypothesized that this was a species of ribosome-bound L.RNA. The 55 rRNA in the eukaryotes
BLastocfadieffa emersonjj, KB cells, and HeLa cells (Comb and Katz, 1-964; Gal-ibert eL aj., !965\ was also thought to be a species of LRNA, or a precursor, but. in fact. this molecule did not share simil-ar properties wiLh LRNA.
Hybridizatíon st.udies and further characteri zat.ion of t.he
55 molecufe 1ed to the concl-usion that 55 and IRNA were unrelat.ed t.o each other (Rosset eË a_2., 1_964¡ Zehani_
Willner and Comb, 1,966') . Short.Ly thereafter 55 rRNA in Xenopus faewis was seen to be expressed in a synchronized. manner with t.he other rRNA species (Brown and Litt.na, L966). Brownlee et al,. (l-967) were the first to determine the sequence of 55 rRNA in E, cofi, and Forget et af. (1967) from L¡uman carcinoma (KB) ce1fs. The two sequences shared relatively 1j.tt1e homology, 1ikely due to the early
divergence of bacteria and ani.mals, but. both molecufes were
approximately 720 bp long and showed some homology between their 5'and 3' ends (Bror^rnlee, L9]-21 . The 55 sequence of
HeLa ce1ls was determined in 1969, and ln L972 a 55 sequence was determined ín the fungus Saccharomyces
carTsbergensjs (Hatfen et a7., 1_969¡ Hindley and page,
L972). 55 genes were first observed in 55 rRNA hybrídization st.udies with x. Jaevis (Bro\4¡n and Dawid, 1968) . A number of cfasses of 55 genes were found during examination of oocytes and somatic ce11s, and in addition, sequence het.erogeneity was observed in t.he oocyte genes
(Mairy and Denis, 1971; Wegnez and Monier, 1-912\. Ford and Southern (1973) observed a similar situation when comparing kidney and ovary ce1fs. Hybridization and el_ectron microscopy studies showed that t.here \¡rere approximately
24,000 copies of 55 genes in t.he xenopus genome, t.hat t.hey are arranged in tandem arrays on different chromosomes, and. that the 55 spacer was about. five times larger than the 55 gene, and that there was some sequence het.erogeneity (Brown eE a7., L91L; pardue et al ., L973) . Aloní et aL. (Lgj1,) al-so f ound a comparable arrangement in HeLa cel"l-s. fn t.he DrosophiTa meJ-anogasEer genome, 5S genes were found. in only a single array, buL stil1 in tandem (wimber and Steffenson, 1-910) . With respect. t.o size, the 55 gene family differs
greatly betv/een closely relat.ed species of the same genus. In studies of Xenopus species, it was found that X, laevis
had a 55 gene family size of 24,OOO and repeat. size of 840 bp, whereas in X. mufferj, family size was 9000 and repeat
size 1700 bp (Brown and Sugimoto, j-973 ) . pardue et af.
(1973) discovered that. the majoríty of 55 genes in X. Taevis were locaEed on or near the tefomeric regions in the
chromosomes. This observat.ion fed to the idea that these 55 genes h¡ere cfustered together to facilit.ate recombination between t.he 5S arrays on different chromosomes during t.he crossing over process (pardue eE af., tg73). The 710 bp 55 gene-spacer repeat unit in X. Taevis was comprised of the following structure: a L2L bp 55 gene, a short linker, a pseudogene that shared the first. L01 bp of the gene with approximately 9 substit.utions, and a 400 bp A-T rich spacer consisting of 15 bp imperfect repeats (Bror,vnlee et a7.,
!974; ,Jacq eE af., L977 ) . These shorL. repeats were the source of variat.ion of length heterogeneity found within the spacers of an individual organism, as observed by restriction analysis studies (CarroL and Brown, 1976a; 1976b). Símilar studíes were cond.ucLed in Drosophila mefanogaster and revealed a much shorter repeat unit of 3g0 bp, only 165 copies and less heterogeneity (Hershey et af.,
1977\ . Saccharomyces cerevisiae r^¡as shown to have
approxímately 150 copies of t.he rDNA repeat., with each
repeat conE.aining a single linked 5S gene (Rubin and
Su1st.on, 1973) . The 55 gene and its ffanking regions in S. cerevisiae were the first. DNA segments to be sequenced by
the Maxam and Gilbert method ln 1-9'7't (Valenzuela et al-. ,
L9'7 7 a; 1"917b) .
Structure and, expression of 55 rRNÀ ger¡es
The majority of rRNA genes, wj-th the exception of the
55, are transcríbed by t.he enz)rme RNA pol]¡merase I. The 55 gene is inst.ead t.ranscribed by RNA polymerase III (Weinmann and Roeder, 1,974). In prokaryot.es, the 5S gene is part. of the rDNA operon, but in eukaryotes 55 genes can be unlinked to the rDNA repeat unit, This implies that. there is some mechanísm present t.o ensure equal molar expression of the
55 gene and other ribosomaf RNA genes. Ân obvious \.day to coordinate this is to have the same number of 55 genes as the other rRN.A, genes. This appears to be demonstrated in D. melanogaster, an organism with approximately 160 55 rRNA genes and approximately 160 rDNA repeat units per haploid genome (Rit.ossa and Spiegelman, 1965; Vermeulen and Atwood, 1965; Tartof and Perry, 7970¡ euíncy, L9'tIl . DrosophiJia hydei, on the other hand, has 320 5S genes per haploid genome (Renkawitz-pohl, 1978), but only 250 rDNA repeat units (Henníng and Meer, 1971; Schafer and Kunz, 1976). In many more cases, however, the num.ber of 55 genes differs drastically from the number of ïDNA repeat units. Theïe are
approximately 2000 copies of the 55 rRNA genes in humans
(Hatfen and Attardi , L91L\, but only 200 copies of rDNA per hapJ-oid genome (Schmickel, 1973; Gaubatz and Cut.ler. 1975;
Henderson et af ., 1976; young eL aj., 1,91 6l . There are tv,¡o possible explanations for this excess of 55 genes. First., it may be due to the fact that not aff 55 genes are act.ively transcribed, and second, the 55 rRNA may be rapidly degraded and so an excess of 55 rRNA is produced to ensure equimolar amounts of 55 rRNA and rRNA in the celf (Gerbi, 1985). Mil-1er (1913; 1,9741 , using X. faewis embryos, demonst.rated that control of 55 rRNA transcript.ion can be independent of rDNÀ transcription.
It has been estimat.ed that in Xenopus Laevis there are 24,000 55 rRNA gene copies per haploid genome (pardue et af , , 1-973; Bro\a¡n and Sugimoto, L973; peterson et af . ,
1980), a smalL fraction of t.hese being the somatic_t]æe 55 genes (400) which are found only on one chromosome per haploid genome (peterson et aj., 1990) . The oocyte-t)æe 55 10
genes are locat.ed at t.he tefomeres of afl chromosomes
(Harper et af., 1_983 ) . Even though bot.h t)T)es of 55 genes are synthesized in oocytes, the oocyte 55 genes are not
expressed in the somatic ce1ls (Gerbí, 1985). Thís is due to the fact that after development of the embryo, the oocyte-tlt)e 55 genes are repressed, but the somat.ic_t]æe genes remaín actíve (WoLffe and Brown, 1988) . Schfissel and Brown (1984) found t.haL in X. Taevis somat.ic ce1l chromatin histone H1 is necessary to maintain the
repressíon of oocyte 55 genes in somatic cel1s. This work was furt.her confirmed by observing that histone H1 prot.ein
from somatic ce1ls is not found in X. faevis oocyt.es (Dimitrov et af., 1993\. BouveL. et al-. (1994) and Kandoff (1994) found t.hat efiminating somat.ic H1 protein from embryos that normally have these genes turned off, resul-ts in the cont.inued expression of oocyte tl¡tr)e 55 genes. From observations on oocyte t]æe 55 genes protected fïom nuclease digestion by incorporation into a nucLeosome, it was fater discovered that. AT-rich flanking regions act as a signal for hist.one H1 mediated chromatin recognition in oocyt.e t]æe 55 gtenes, This further supports the idea that. AT-rich repeats that surround E.he oocyte t]æe 55 genes are invol-ved in H1 mediated chromatin recognition, and thus wif l- result in the observed transcriptional repression l1
(Chipev and Wolffe. 1992; Tomaszewski and ,Jerzmanowski, 1997; Tomaszewski eE af ., j-998).
Deletion analysis showed that there Ìdas a control region located in the center of the 55 gene ln X. Laevis,
(residues 50-55 to 80-83) and Chat Lhis region was necessary to initiat.e transcription (Bogenhagen eL a_Z., 1980; Sakonju et aJ., 1980; 1991). ol igonuc leot.ide direct.ed mutagenesis studies done by pieler et af. (1985a; 19g5b; 1987) showed thaL this internal controf regíon (rCR) promoter extends int.ermitLently from residues 5O to 97 of the 55 gene, from which t.hree separate promoter ef ement.s were identified: boxes A, B, and C. Box A is invofved ín binding of transcript.ion factoï (TF) ffIA, whereas box B and box C have an affinity for TFIIfA. TF]IIA is involved in the initiation of transcription by binding to the ICR (Sankonju and Brown, L982l . In X. Jaevis, Wormington et al . (1981) demonstraLed that somatic-tn)e 5S genes bind about four times more strongly to TFIIIA than do t.he oocyte-t]T)e
By means of deletion analysis of the S. cererzisjae 55 gene it' was demonstrated that the ICR ís contained within the region bounded by residues 57 and 99 (Taylor and
Segal-f , 1985; t-,ee et af , , 1_995) . In Jveurospora crassa t.here is a TATA box at. resid.ue 29 anð, removaf of it by defetion caused a 2-30 fofd reduction in the rat.e of t.ranscription of the 55 gene, indicating that this site is needed for
transcription initiat.ion (Tyfer, 1997). As with ,9. cerevisiae, t.he 55 gene ICR in IV. crassa is divided into
t.hree distinct regions; D (residues 19-30), A (residues 44- 57), and C (residues 73-103); aff three are necessary for transcription (Tyler, L987l . Regions A and C are
homologous to the ICR region in X. faevis, but there is no D region homologue ín Xenopus. In X. faevis box A pfays the key role as the inítíation point of transcription for the 55 gene (Ha1l et af ., 1-982; Cifiberto et af ., 1993), a ro]e
played by the TATA box in N. crassa (Tyler, l-987) . The exact funct.ion of box D is not known; it. may act t.o bind
t.ranscription factors or other eLements (Tyler, L9g1 l . A secondary structure for eukaryotic 55 rRNA was first proposed by Nishikawa and Takemura (1974) and for bacterial
(prokaryot.ic) 55 rRNA by Fox and Woese (1975). Fox and Woese's struct.ure consisted of four helices, cal1ed the mofecular sta1k, the prokaryotíc loop, the tuned hefix, and the common arm base, respectively. Nj_shikawa and Takemura,s modeL postulated five helices (designated A to E) and adjacent loops (designated a to e) . rn addition to t.he Fox and Woese (1975) proposal and other 55 rRNA secorÌdary structure modefs (SL.udnicka et. al ., IggI; Mackay et af., 13
1982; Delíhas and Andersen, L982; KunEzeI eE aj., 19g3) a
revised modef that consisted of an additional he1íx was
proposed by Wolters and Erdmann (1988) as the common
secondary structure model- for bacterial 5S rRNA.
5S rRNA gene organization in bacteria
The ribosomal RNA genes in prokaryotes are organized as operons. In E. co] j seven rDNA operons were ídentified (Kiss et af., L977\. The rDNA repeat in E'. coJj, as in ot.her eubacteria, has a rDNA repeat structure of 3,-23S-55_
1-65-5' . In -8. co1 j t.here are two upstream promoters whích
regulate the transcription of the entire rÐNA operon (30S RNA precursor), including the 55 gene. The rRNA gene arrangement. in archaebactería is simifar
to that in eubact.eria. The archaebacterium HaJoba cterium haTobium was found to contain a simifar arrangement t.o that found in E. co7i, except. that. only one unit was observed
(Hofman et af, 7919\ . On the other hand, four rDNA operons as welf as a single unfinked 55 gene were observed in the methanogen, Methanococcus vannieLij (.Iarsch et al-., l-9S3). What is likely t.o have happened ín M. vannie_Zii is that. t.here was a 55 gene unlinking event. and. t.hat this unlinked gene t.hen obtained it.s own promoter. I4
5S rRNÀ gene organization in eukaryoLes
Within t.he eukaryotes, the rDNA unit is generally
organízed ínt.o repeat uniCs ín a head-to-tai1 fashion. The
structure of the rDNA repeat unit consists of three main
genes separated by spacers in the following order; 5,_ETS_ 18S-ITS1-5.85-ITS2-28S-IGS-3'. The spaceïs separating the genes are t.he external transcríbed spacer (ETS), the internal transcribed spacers (ITS1, and ITS2), and the int.ergenic spacer (fGS). The ETS contains the promot.er t.hat
initiates t.ranscription of the 45S rRNA precursor (Long and Dawid, l-980). 55 genes may be organized in a number of different. ways: 1) linked to other rÐNA genes, 2) linked to repeat units of ot.her multigene families, 3) unlinked from other muftigene families as tand.em arrays, or 4) dispersed as single copies. The fac! remains that. since 55 genes aïe transcribed by a separat.e pofl¡meïase from that used by the other rRNA genes, the occurrence of unlinked 55 genes should not be unexpected. Why the 55 genes remain linked to the rDNA repeat. is more difficult t.o expJ.ain.
MiLochondria
fn the majority of fungi and animaf species, the 55 gene does not exist in t.he mitochondrial genome (BorsL. and 15
Grive11, 1971,; O'Brien and Matthews, 1976; Butow and Wood, 1978) . This raises the question of the significance of the
55 gene in ribosome construction. For the IJSTRNA gene of yeast mitochondria, Thurlow et af. (1984) hypothesized that
an insert.ion in domaín V may be substit.uted for the 55 rRNA
gene. In human mitochondrial DNA it was found t.hat a 23 nL relic within the LSTRNA region may function as a 55 gene (Nierl-ich, I9e2, . In bovine, rabbit, and chicken mitochondria it was discovered that nucfear encoded 5S RNA mofecules exist in the organelfe, yet. there is no 55 rRNA gene encoded within the mitochondrial genome (yoshionari et a7,, 1994). Furthermore, evidence has been present.ed, based on highly purified mítochondrial fractions of human cefls, t.hat 55 rRNA lranscripts are imported into mammafian mitochondria by an unspecified transport system (Magalhaes et af ., 1998) .
The 55 gene has been found ín the mit.ochondriaf genome of some flowering pl-ants (Lever and Harmey, 1976; Cunningham and Gray, 1-9711 . fL v¡as in close proximity to the SSTRNA gene in both maize and wheat. (Bonen and Gray, 1-980, Bonen et aJ-., 1980; Stern et at. L9g2). Mitochondrial
55 genes have also been found in the chlorophyte a1ga,
Prototheca wjckerhamii (Wolff and Kueck, 1,996) , and the het.erotrophic f1age11aEe, Reclinomonas americana (IJang et 16
a7., L996¡ L997). A 55 rRNA gene was befieved t.o exist. in the mitochondrion of the rhodophyte al.ga Chondrus crispus
(I-,ebf anc et af ., 1995), but daE.a from l_,ang et af . (1996) do
not support the exi.stence of 55 rRNA genes in E.he mit.ochondrial genomes of red algae.
Chloroplasts
In general ribosomal RNA genes are found as farge inverted repeat regions (t.ypically 22-26 kb in size) in chloroplast. genomes as characterized in a number of higher plants (Palmer and Thompson, 1981¡ 1992; Kossel et af.,
1983; Bobrova et a-2., L995¡ Goremykín et af., 1_996¡ Ogihara et af ., 2000). 55 genes are found in chloroplasts in the , order 5' -165-23S-5S-3 . Direct. repeats have been found as in the case of t.he photoautotrophic Eugfena gracilis chloroplast genome, \.dhere three direct. tandem repeats were identified within the rDNA operon preceded by an additionat
165 rRNA gene (cray and Hallick 19Tg; .Ienni and Stutz 1979; Rawson et. af., 1918). A simil-ar situat.ion has been observed in the plast.id DNA (ptDNA) of Ehe colourless heterotrophic flagellate, Astasia 7onga, a close relative to E, gracifis (Gockel and Hachtel, 2000). The genome of the unicelLular green alga Chforeffa vulgaris also contains no inverted repeat. and has a single copy of each of the rRNA genes 17
(165, 265, and 55) (Wakasugi et aj., t99j). 55 rRNA genes in chloroplasts have also been ínvest.ígated in the red afgae (Van den Eynde et af ., l-9gg), spinach (Rombay et al ., 1988; 1991), and in the brown algae (Sommervilfe et aL.,
1992). 55 rRNA is not found in the chloropfast rRNA
precursor, probably due to the presence of its own
promoter, unfike the rDNA operon in prokaryot.ic genomic DNA
(Hart.f ey 1979; Kossel et af., L9g2) .
Linkage of 5S rRNA genes to rDNÀ and other mul!ígene fami lies
So far 55 genes have been shown to be linked to the rDNA repeat ín some fungi and protozoa (Gerbi, 19g5) and in a number of other eukaryotic species, including nematodes and arthropods (Drouin and. Moniz de Sá, j-995), as wef l- as some pfants (Sone et al ,, L999l. 55 genes can be linked to the IDNA repeat. in one of two ways. They may be linked in Lhe non-inverted orientation, which means that they are coded on the same strand as the other ribosomal genes. Examples of this linkage patt.ern have been observed in Coprinus cinereus (Cassidy & pukkila, 19g7) and in
Dic,yosteTium discoideum (Maizels, 1976¡ Hoffmann et aJ-., 1,993) . Al-ternatively, the 55 gene may be linked in the inverted orientat.ion, meaning t.hat it is coded on the t8
opposite DNA strand from the other ribosomaf genes, an example being .9acch aromyces cerevisiae (Maxam et af., L9j7;
Kramer et a7., 1918'). 55 genes have also been shown to be linked to the trans-spliced leader (TSL) in some protj.sts and nematodes, and in a crustacean, where iC is linked to hist.one multigene famil-ies (Drouin and Moniz de Sá, 1995). Drouin et aL, (1987) observed several- crustacean species
t.hat have 55 genes finked to the rDNA repea!, and this was believed to represent an ancestraf condition. Later, Drouin et af. (1992) presented further evid.ence indicating that. not all refated crustacean species shared L.he linked arrangement. Similar findings can be found within the peronosporomycetes, part.icularly wíthin the Genus pythiun, Befkhiri et af. (1992) found that in most specíes of
Pythium \l¡ith fílamentous sporangia that had been surveyed., the 55 genes were found to be linked E.o the rÐNA and in the invert.ed orientation, but finkage was not obseïved for a number of species of pythium wit.h globose sporangia or hyphal swellings. A survey of the linked 55 gene arrangement ís presented in Appendix 1. , Table 1.
Unlinkage of 55 rRNA genes in direcÈ tandem arrays
For plants and animals, the general pattern of 55 gene family organization consists of tandem arrays unfinked to T9
the rDNA repeat (Brown and Sugimoto, L9'13; Hemleben and
Gríerson, 1978; Gerlach and Dyer, 1980; Benes and Cave, 1-985; Singer and Berg; 1991; Saserr et aj., L992). A survey of organisms in which the 55 rRNA genes are tand.emly
arranged and unlinked to rÐNA is present.ed in Appendix 1. , Table 2. In pIant.s, the most surveyed group of organisms, 55 rDNA repeat.s can vary in size from around. 0.2 kb, as in Vigna radiata (Hemleben and Werts, 19gg) , Gymnocfadus dioicus cottlob-McHugh eL a_2. (1990), picea gTauca
(Carfson, L991 | , arrd Hordeum gJaucum (Baum and Baily,
1999), xo t.'l kb in ?riËjcum aestivum (Zhou et af., 2OO1). In humans, repeats of 1.6 and 2.3 kb have been found
(Sorensen and Frederiksen, 1991). In other mammals, such as rodent.s, 55 rDNA repeat size varies from 1,6-2.2 kb (Hart and Fofk, 1984; Suzukí et aL., 1,994¡ Frederiksen et aJ-.,
1-997 1 , except in the macaque monkey, Macaca fascjcufaris, where larger repeat.s of 3.0 and 4.3 kb were found.; t.hese are also unusual because t.he 55 rDNA ïepeat units are organized as alternating 3.0 and 4.3 kb 55 rDNA ïepeats (.Tensen and Fredrikson, 2000 ) .
5S rRNÀ pseud,ogenes
55 rRNA pseudogenes, which are generally non_ functional variants of 55 genes, have been shown to occur ¿0
in t.he genomes of a numbeï of different organisms. 55
pseudogenes are also sometimes pïesent ín 55 rDNA repeaE.s. In rats there are six 55 pseudogenes in tandem that are
separaLed by 2.5 kb (Frederiksen et af., L991 ) and in Xenopus laevis, t.here are 55 pseudogenes occurring adjacent to each functionaf 55 gene in a tand.em array (,facq et aJ.,
L977; Korn and Brown, 1978) . 55 pseudogenes have also been described in Notophtha]mus (Kay and Ga11, 1981), CaJJiphora (Rubacha et af. , 1984) and ín pythiun (Belkhiri eE af. , 1996; Belkhiri et al . 1-99't) . pythiun pachycauJe was found
to cont.ain a linked 55 pseudogene located directly upstream
of the funct.ionaf 55 gene withín the IGS region of each rDNA repeat unit (Belkhiri. eË aJ., L996). In pythium irreguTare a pseudogene was discovered during the charac teri zaL ion of a tandem array of 55 genes. The pseudogene occurred at. the end of t.he tandem array of nine 55 genes and spacer regions. 55 gene variants are not always non-functional . Selker et af. (l-9g1a; 1981b; 1985) found that in IVeurospo ra crassa there were several tl¡pes of
55 rRNÀ genes and that the coding region of each t]æe was different. Although not all of the dífferent variants were found in N. crassâ ribosomes, more than one tlæe vnas observed, which indicates that. 5S rRNA heterogeneit.y can arise even in funct.ional genes (Selker eE af,, L995; Sefker 21
and Stevens, l-985). 55 gene variant.s have also been shown
Eo occur in AspergiTJus (Bartnik et a_Z ,, 19g6; Gníadkowski
et a7. , 1-99tì| .
Dispersal of, 5S rRNÀ genes
For the majority of ascomycetes, such as
Neurospora, Schizosaccharomyces, and .Aspergrj _1_Z us, the 5S rRNA genes are dispersed throughout the genome as single copies (Gerbi, 1985) . The dispersal of 55 genes in
Neurospora crassa has been most intensively examined (Selker et a7., L98La; l-981b; 1985) . Free et a_2. (L97g)
first showed that the 55 gene was unlinked to the rDNA repeat unit. Selker et aJ-. (1991a) revealed. through partíal
and compfete DNA sequencíng that N, crassa had at. l-east 5 different types of 53 rRNA species (a, þ, þ', y, õ), although t.he o-type was found to be the predominant form. Predicted seccndary structures of the dífferent species of 55 RNA showed that afl forms maintained overall structural_ and functional integrity, since the majority of subst.itutions present were compensatory (Selker et aL.,
1981a) .
Tandem familíes will become homogeneous due to the effects of unequal crossing over, but. divergence withín dispersed multigene famifies wilf occur unl-ess there is 22
some other correction mechanism present, hence the large number of compensating subst.itutions in N. crassa. Selker et af, (1981a) speculated that perhaps a defective
díspersed 5S gene needs to und.ergo addit.íonaf compensating
mutations in order to restore correcL function. Selker and
Stevens (1985) discovered the presence of two unusual 5S
rRNA regions that were tightly linked together; these two
55 pseudogenes (( and ¡) had resulted from a 794 bp tandem duplication followed by an extensive accumulatíon of non- random mutatíons. Tt was determined thaL in the (_4 region 1) there was heavy met.hylation, 2) transition mutations are almost always C to T, and 3) no transversion mutations were found (Selker and Stevens, 1995) . Other straíns of JV. crassa with the (-4 duplication were always methylat.ed, but strains with only a single copy of the sequence were not met.hyÌat.ed, and any DNA sequence longer than 500 bp was susceptible to inactivation when duplicat.ed (Selker and
SL.evens, 1987). These findings led to the discovery that JV. crassa has a mechanism for detect.ing repeat.ed. sequences, which can t.hen be methylated and síl_enced. This phenomenon is termed RIP (repeat induced point) mutation (Sefker, 1991). The RIP mechanism involves multiple G:C to A:T transition mutat.ions caused by the deaminat.ion of 5-Met.hy1_ Cytosine, which is irreversible, and always occurs in pairs \3
of 55 genes, that is, single copy 55 genes are not affected. It has been suggested by Margolin et af. (1999) that the cost of maintaining the Rfp system ín JV. crassa to prevent duplication (tandemizatíon) of 5S genes ís less than the potential cost of genomic destabifization by other
genet.ic inffuences. This can explain why IV, crassa, and
possibly other true fungi, maintain only single copy 5S
rRNA genes dispersed t.hroughout t.he genome. Dispersed 5S genes have also been detecLed in
Schi zosaccharomyces pombe (Mao et af ,, 1992) and
AspergiTlus nidufans (Bartnik et aJ-., 199L, 7984, L986;
Bartosze\¡¡skí et a7., 1,98jt. Dispersed 55 pseudogenes have al-so been found in A. niduTans. However, the 55 pseudogene
studied is highly conserved at the 5, end and there is a 200 bp insertion near the 3, end (eartnik et af., j,986;
Borsuk et af ., 1988) . In IV. crassa a heavily melhylated 55 pseudogene, $63¡ was found to contain a 1.9 kb transposable element insertion inactivated by repeat-induced point mutation (Margolin et af ., l-999) . As in ,A. njdu_Zans, the 5'-end of qJ63 was very well conserved. and the first 75 bp of the 55 pseudogene were nearly identical to those in the most common 5S gene type (q) in JV. crassa (Sefker et af,, 198L; Margofis et af., L99B). Systematics of t'he Kingdom Strarnínipila
This assorted group of organisms was ínformally named the stramenopiles by patterson (1989) from cyLological dat.a. Leipe et af. (1994) followed up by providing molecuLar evidence, based on 16S-like rRNA sequences, of the evofutionary refationship between some of these
organisms. An expanded molecufar phylogeny of t.he stramenopiles was esLablished using sequences of the small subunit rRNA (Van de peer, l-996) . Molecufar phylogenies of the smaff subunit rRNA gene have afso been constructed foï a nunìlcer of groups within the kingdom, including the labyrinthulids and t.hraus tochytrids (Honda et aj-., 1999¡ Leander and Porter, 2001), hyphochytrid.s (Hausner et aj., 2000), and some picoplankton (Van der Moon et af., 200I¡
Díez et af,, 200!). StïamenopiLes are charact.erized by having mitochondria with tubuLar cristae and flage11a with mastígonomes or fine hairs, but phenot]t)ica11y, they are a diverse group. The Kingdom Straminipila incfudes t.he Oomycetes, Chrysophytes, phaeophytes, Synurophytes, diat.oms, Xanthophytes, bicosoecíds and slime nets (Sogin and Silberman, 1998 ) . 25
Sygtematics of pythíurn
Nees was first. to refer to pythium in 1g23 (Van der
Plaats -Ni t.erink, l-981) For a period of 35 years the genus
had been treated sys t.emat.ical1y numerous times, but it was not untif 1858 that. pringsheim fínal1y established the cenus PyLåj um (príngsheim, 1858). It was based on the
det.ailed descriptions of tu/o species, p. monospermum and p enEophytum. Zoph (1890) moved the latter species to the Genus -Lagen idiun, leaving p. monospermum as the lectot]¡pe
species for the genus. Thís genus had originally been
placed by Pringsheim into t.he Famify Saprolegniaceae, and
was eventually transferred to the peronosporaceae by de Bary (1-881) due to the many simij.arities with other genera of the latter family. pythiun is the t]T)e genus of the Pythiaceae, placed t.here by Schröter in 1g97, within the Order Peronosporales.
The Genus pythium consist.s mainly of p1ant. pat.hogens.
Many economically important. crops are affected and damage caused by pythiun can be in the millions of dollars
annually. Pythiun is particularily well known as the cause of 'damping-off diseases, of seedlings (Alexopoulos et aL., L996) . A few species are pathogenic to animals, particularly fish and crustaceans. pyLåjum jnsidjosum is 26
the most notorious animal pathogen of the genus (De Cock et
a7,, 1981 ). P. insidiosum infections wífl result in deat.h
of mammals, including humans, when feft untreat.ed.. Some species predominantly ínhabit. aquatic environments, while
oLhers are more amphibious in nature, and some have evoLved to be strictly t.errestríal , using the wind for their dispersal and propaga:íon. pythium requires water for the development of sporangia and for zoospore production. With molecular data now avaifable it is generally agreed t.hat Pytåjum, and all other Oomycetes, are not true
fungi, contrary to what. was previousfy thought. They produce biflagellate reniform or kidney-shaped. zoospores,
and possess one anterior whiplash f1agellum and. one posterior f J-age1lum (Co1t and Endo, !9.12; Kobayashi and Aka!, 1974a, 1974b\. Unlike the celf wafLs of fungi, which are composed primarily of chitin, the cel1 walfs of pythiun consist predominantfy of p-1,3 and B-1,6 linked glucans and cellufose (Hunsfey 1973; Sietsma et a-2., j_9751 . T]ne pythium life-cycle is primarily diploid. with a haploid phase only during meiosis until karyogamy (Alexopoulos et aJ., L996). The vast majority of species are homothalLic or self fertilizing. Campbell and Hendríx (1967) were the first to show heterothaLlism within the genus. Ribosomal RNA gene sequences show t.hat E.he Oomycetes are refated to heterokont ,.7
algae and are unrefated t.o the t.rue fungi (Gunderson et af., 198'l; Först.er et af ., 1990) Barr (1992) provided
bíochemical- and cytological evidence thaL showed that
Oomycetes are aligned with t.he het.erokont. a1gae. Phylogenetic analysis of the p-tubulin gene also supports t.he hypothesis that. the Oomycetes aïe more closefy related Eo the al.gae and protists than to the true fungí (Weerakoon
et af ., 1998). According to Caval ier-Smi th, s classification system both the Oomycetes and a sister taxon, the H]æhochytridiomyceLes, were placed in the
Subphylun Pseudomycotina, phylum Het.erokonta, and t.he Kingdom Chromista, while true fungi were to l:e found in the Eumycota (Cavalier-Smith, l_989) . Dick (2001) ptaced pythiun
in the Kingdom Straminipila, phylum Het.erokonta, Class Peronosporomycetes (synonymous with Oomycetes), Order
Pythiaceae, and Family pythiales. Under this new classification strucLure, the hyphochytrids are grouped into the class Hyphochyt.riomycetes (Dick, 2001).
Sparrow's (1976) cfassificat.ion system divided t.he Oomycetes into six orders, of which only the peronosporafes were considered especially important, due to the economic importance and dest.ruct.ive nature of many of the plant pathogens wíthin this group. The key charact.eris t.ic uniting the Peronosporales was the nature of the sporangium, 28 particularly it.s shape. In 1981 Van d.er pfaats-Niterink published a monograph of the cenus pyLåium that incfuded the descriptions of more than 120 species. Oíck (1_990) published a key of the genus for more than 130 species that depended heavily on biometric dat.a. Two other descriptions of t.he genus have included t.axonomic accounts and keys by MiddÌeton (1943) and Wat.erhouse (I961 , L968). The description and comparison of reproductive structures are basic in pythiun systematics. These characters incfude oogonium size, location, size, and shape; source of antheridia with respect to hyphal stafk; presence,/absence of sporangium, shape, and size (Van der Plaats -Ní Cerink, 1981) . Species can also be differentiat.ed quant.i tatively, i.e. using biomet.ric measurements (Dick,
1969, 1990¡ Ho, 1975) . These measurements, however, may be problematic in defining species boundaries, since many morphologicaL characL.ers change depending upon environmentaL conditions. particular morphologíca1 structures may not be formed in some species, and identifying these species can be difficult (Hendrix and
Papa, L91 41 . Those isolates whích cannot. be assigned to a single species are grouped according to t.he tlpe of zoosporangia or hyphal swellings produced: F tl4>e, strictly filamentous sporangia; T tlæe, toruloid sporangia; G tlæe, ¿9
spherical or ellipsoid (non-prol i ferous ) sporangia; p tg)e, sphericaf or etlipsoid and proliferous,. and HS type, hyphal (Van pfaats swellings der -Ni terink, 19g1; Dick, l-990) .
Systematics of the Gel¡us phyëophthora
The genus name phytophthora was first used in 1g76 by de Bary to describe the fungus causing late bJ.ight of pot.ato, Phytophthora infestans, which became the t]¡pe
species of this new genus (Alexopulous eE af., l_996). The same organism had been previously described by Montagne in 1845 under the name BoETytis infestans (Afexopufous et af, , 1996) . PhyEophthora infestans is infamous as a plant pathogen, causing widespread destruct.ion of the economically important. pot.ato. A decade after the first. descript.ion of PhyEophthora a species was described, p. cactorum, followed by t.he description of p, phaseo_Z j, and P. nicotianae. Since 1900 more than 50 new species of PhyEophthora have been described, and this number continues t.o grow. Species of phytopthora cause a wide range of diseases in plants, especially those that are economically important .
Phytophthora belongs to the Family pythiaceae and is most cl-osefy refated Lo pyEhium within this family. Two major morphoJ.ogical characteriscics are used to separate 30
the two genera: sporangial form, and maturat.ion of
zoospores in the sporangia. phyEophthora prod.uces a specialized structure, cafled a sporangiophore, which is readily distinguishable from somatic h]T)hae. In
Phytophthora, zoospores mature wit.hin a sporangium and can either be released directly or, in some cases, will pass into a vesicle for release. ln pythium, the undi f ferentiated protoplast. is t.ransferred. from the sporangia into a vesicle in which it matures int.o zoospores and from which it. is then refeased,
Rosenbaum (1911) produced the first key of the Genus Phytoph|hora which included descriptíons of the 11 species known at that t.ime. Species discrimination was prímarily on the basis of size and shape of sporangia, chlamydospore size, oogonial- síze, and origin of antheridia. Several more species were described in the next monograph of the genus, with the addition of cardinal t.emperatures, growth on different media, and host source as criteria (Tucker, l-931) . Waterhouse (1963) produced an extensive key describing 43 different. species separated into six main groups, but t.he key was judged not to be useful in resolving species complexes or questions arising from intraspecific variability, an updated key was drawn t.oget.her in the form of tables in the expectat.ion thaE. it would be of greater use to both the plant pathologists and taxonomists (Newhook eE af., L91.g]l. Newhook et af. (l_97g) st.i11 retains Waterhouse,s (1963) six main groupings of species based on a number of morphological dissimilarities. MÀTERTAIJS ÀND MEÎHODS 33 crowth of, cultures fsolates of Pythiun ot phytophthora were first subcuftured onto cornmeal agar (sometimes on Vg or Vg-sea water agar), until sufficíent mycelial grrowth had occurred on the media. Approximately five to six 1 cm2 pieces of agar and mycelium were transferred onto a st.erile petri dish (Fisher Scientific, Nepean, Ont.. ) containing fresh pea broth media. The pea broth media was comprised of 200 g frozert peas boiled in 1 litre distílled water, filtered, and autocLaved, with approximately 5 g of glucose added thereafter. The mycelium was allowed to grow on the pea broth media for a few days to a week, untif a thick mycelial mat had formed. The mycelium was t.hen harvested by washing the materiaf at feast t.hree times, on Whatman No. 1 (lrùhat.man filter paper Laboratory products, Cfinton, N..I . ) by vacuum filtration, using dist.illed water, The washed mycelium was then peeled off the filter paper and t.ransf erred to a sterife petri dish. The mycelium was placed into a -20"C f.reezer for at least 20 min, and then into a freeze drier overnight. The lyophílized material t.hat was not used immediat.ely for nucleic acid extraction of genomic DNA was frozen at -20"C, until needed. All isofates t.hat were used Ín this investigatíon, including sources and accession numbers, are l-isted in Table 1. 34
Table 1. A fist of isolat.es used in this st.udy
Species Accession Original Origin Statusb Numbero Substrate
Achlya aquatica cBS 103.ó7 Water in pool hdia T
Achlya sparrowíi cBS 102.49 -T
Albugo candída
Aphanonryces iridis cBS 524.87 -T
Alpanes androgynes cBS 579.69
Alpanopsis spinosa cBS 112.61
Brevile gnia macrospora cBS 132.37 Viola tricolor Netherlands T
C a lyp t ral e g nia achly o i de s cBs 314.81 Pond Netherlands
Dictyuchus sterílis cBS 550.67 UK
Halophytophthora cBS 188.85 Avicennia marina Australia NT avícerutiae
Halophytophthora cBS 586.85 -T bahamensis
Halophytophthora cBs 679.84 Avícennia sp. Austlalia T batemanensis
Halophytophthora cBs 590.85 -T epistomiunt
Halophytophthora kandelii CBS 1 I 1.91 Kandelia candeli Taiwan NT
Halophytophthora CBS 680.84 -T polymorphica
Halophytophthora CBS 241.83 Avicennia ntarina Australia T operculata 35
Table 1. Continued
Species Accession Original Origin Number Substrate
H a I op hy to p htho r a sp ino s a var. lobata cBS 588.85 Rhizophora sp. Vietnam T
H alophytophtho ra ve s ic ula cBs 393.81 Prunus lauroceras¿¡s Canada T
Hyphochytrium catenoides 8R217"
Lagenidium caudatu,n cBS 584.85 Xiphinema riversi USA
Lagenidium giganteunt cBS 580.84 Mosquito larva USA
P ac hymet ra chaunorhiza cBS 960.87 Saccharunt officínarum
P e ronophytho ra litchii cBS 100.81 Litchi chinensis Taiwan
P e r ono sp o ra p ar a s íti c ad Capsella bursa- pastoris
Phytophthora arecae cBs 305.62 Areca catechu India NT
P hy t o phtho r a b o ehtne r iae cBS 291.29 Boehmeria nivea Japan T
Phytophthora botryosa cBS 581.69 Heveabrasiliensis Malaysia T
P hytophthora cdcto,'unx cBS 108.09 Cactus sp. NT
Phytophthora cambivora cBs 248.60 Castanea sativa France T
Ph),tophthora capsici cBS 128.23 Capsícumannum - T
P hy t op htho ra c innamo mi cBS 144.22 Citntantomum I¡donesia T burmarutii P hytophthora citt icola cBs 221.88 Cítrus sinensis T
P hy t o p hth o ra c it r o p htlto r n cBs 950.87 Citrus sp. USA NT
P hytophthora colocasiae cBS 955.87 Colocasia esculenta India NT Tab1e 1. Contínued
Species Accession Original Origin Number Substrate
Phytophthoraclandestina C8S347.86 Trifolíunt Australia T subterraneunt
P hyto phtho ra c rypto ge a cBs 113.19 Lycopersicon h'ish Republic T esculentum ot Petunia sp.
Phytophthora crypto gea JMlOE
Phytophthora cryptogea cBS 468.81 Begonia eliator Gelmany T \at. begoniae
P hy to p htho r a dt' e clt s Ie ri cBs 291.35 Beta vulgaris var. USA AU allissitna
Phytophthora erythroseptica CBS 129.23 Solanum tuberosunt hÌsh Republic T
Phytophthora fragariae CBS 209.46 Fragaría sp. UK AU var. fragariae
Phytophthora heveae cBS 296.29 Hevea brasiliensis India T
Phytophthora humicola cBs 200.81 Soil Taiwan T
Phytophthora idaei cBS 971.95 Rubus idaeus UK T
Phytophthora ilicis cBS 255.93 NT
P hytophtho ra ùtfestans cBS 366.51 Solanum tuberosunt Netherlands NT
Phytophthora ùnolita cBs 691.79 Soil Taiwan T
Phytophthora iranica cBS 374.72 Solan,unz melongena lran T
P h¡,to p hth o r a k at s u ra e cBS 587.8s Soil Taiwan T 5t
Table 1. Continued
Species Accession Original Origin Status Number Substrate
P hy t o p htho r a lat e rali s cBS 168.42 Chamaecyparis lawsoniana
Phytophthora meadii cBS 219.88 Hevea brasiliensis India NT
P hytophtho ra me g akarya cBS 238.83 Theobroma cacao Cameloon T
P hyto phtho ra me gas p e rma cBS 402.72 Althaea rosea USA T vaf. megasperma
Phytophthora melonis cBs 582.69 Cucunùs sativus Japan T
P hyto phtho ra nzexic ana cBs 554,88 NT
P hy to p htho r a mir a b ili s cBs 678,85 Mit'abilis jalapa Mexico T
P hy to p htho r a nic o t ian a e cBs 305.29 NT
P hyto phtho ra p alnùvo ra cBS 298.23 Theobroma cacao Trinidad & Tobago
P hy t op ht ho r a p almiv o ra cBs 236.30 Cocos nucifera India
P hy t op htho r a p alntív o ra cBS 358.39 Hevea brasiliensis Sri Lanka
Phytophthora phaseoli cBs 556.88
Phytophthora pini cBS i81.25 Pinus resínosa -T
Phytophthora porri A cBS 567.86 Alliunt porrum Netherlands T
Phytophthora poni B cBs 178.87
Phytophthora poni A cBS 179.87
Phytophthora primulae cBS 2'75.74 Malus sylvestris Netherlands NT Tab1e 1. Continued
Species Accession Original Oligin Status Number Substrate
Phytophthora pseudotsugae CBS 444.84 Pseudotsuga USA tnenziesii
Phytophthora quininea cBS 407.48 Cinchona olîicùmlis Peru T
P hyto phtho ra r ichardiae cBS 240.30 Zantedeschia USA T aethiopica
Phytophthora sinensis cBs 557.88 Cucumis sativus China
Phytophthora spec. marine. cBS 215.84
Phytophîhora syringae cBs 367.79 Forsythia sp. Netherlands
Phytophthora syringae cBS 132.23 UK
P hy t op htho ra t ent ac ultû a cBS 552.96 Chrysanthemunt Gelmany T Ieucanthemunt P hy to p htho ra t r op í c ali s cBS 434.91 T
Phytophthora vígnae cBS 241.73 Vigna sinensis Australia AU
Plectospira myrianda cBs 523.87
Pythium acanthicunt cBS 294.31 Cih'ullus vulgaris USA T
P yt hi unt ac antho p ho ron cBS 337.29 Ananas sativus USA AU
Pythium acrogynunt cBS 549.88 Soil China AU
Pythium adhaerens cBS 520.74 Soil Netherlands R
P ), thi u m atn a s c ulitzunt cBs 552.88 Soil China AU
Pythiunt anandrum cBs 2s8.31 Rheurn rhaponticunt USA T
Pythiunt angustatuffi cBS 522.14 Soil Netherlands R Tab1e 1. Continued
Species Accession Original Origin Number Substrate
P y t hi um ap hatxid e r mat u m cBS 216.46 Cucutttis satívus UK PN
Pythium apleroticum cBS 772.81 Nymphoídes peltata Netherlands R
Pythiunt aquatile cBs 215.80 -UKNT
Pythium aristosporunt cBS 263.38 Trilicunz aestívum Canada T
Pythium arrhenomanes cBS 324.62 Zea mays USA pN
Pythium boreale cBS 551.88 Soil China R
Pythium buismaniae cBs 288.31 Linunt usitatissi¡,r¿¡.¿¡n Netherlands T
Pythium capillosunt cBS 222.94 Soil France AU
Pythium catenulatutn cBS 842.68 Turf glasses USA pN
Pythiunt chamaehyphon cBS 259.30 Carica papaya Hawaii T
Pythium chondricola cBs 203.85 Chondrus críspus Nethe¡lands T
Pythium coloratunt cBS i54.64 Soil Australia T
ythi P um c oni dio p h o r unt cBS 223.88 Soil UK R
yt P hi urn c uc u r b it a c e arutn cBS 748.96 - Australia
P yt híum c y lin d r o s p o r unt cBS 2i8.94 Soil Ger.many T
Pythium debaryanum cBS 752.96 Tulipa sp. UK
Pythium deliense cBS 314.33 Nicotiona tab.tcum Sumatra NT
Pythium diclinunt cBS 664.79 Betavulgaris Netherlands NT
Pythiunt dimorphunt cBS 406j12 Pinus taeda USA T Table 1. Contínued
Species Accession Original Origin Number Substrate
Pythium dissimile cBS 155.64 Pinus radiata Australia T
P ), t lti unt di s s o t o cunt cBS 166.68 Triticuttt aestivum USA PN
P y t h i utn e c hit'tulat unt cBS 281.64 Soil Australia PN
Pythium erinaceus cBS 505.80 Soil New Zealand T
Pythium flevoense cBS 234.72 Soil Netherlands T
Pythium folliculosum cBS 220.94 Soil Switzelland T
Pythium graminicola cBS 321.62 Saccharum Jamaica NT officinarunt
P yt hiu m g ran di sp o r an g ium cBS 286.79 Decaying leaf USA T
Pythium helicandrutn cBs 393.54 Rumex acetosella USA AU
Pythium helicoides cBS 286.31 Phaseolus vulgaris USA AU
P y t h i unt he t e r o thalli c um cBs 450.67 Soil Canada T
Pythium hydnosporwn cBS 253.60 Solanunt luberosunt Germany PN
Pythium hypogynunt cBS 262.79 Medicago sativa Canada R
Pythiurn indigoferae cBS 261.30 Cucunùs sativus India PN
Pythiunt inflatunt cBS 168.68 Saccharunt USA PN officinarunt
Pythiunz insidiosunt. cBS 574.85 Holse Costa Rica T
Pythium intermedium cBS 266.38 Agrostis stolonifera Netherlands PN
Pythiunt irregulare cBS 250.28 Phaseolus vulgaris Netherlands NT Tab1e 1. Continued
Species Accession Original Origin Status Number Substrate
Pythium iwayamai cBs 156.64 Soil Australia PN
Pythium kunmingense cBS 550.88 Soil China T
Pythiunt lutariunt cBs 222.88 Soil UK T
Pythium macrosporum cBS 574.80 Flowel bulb Nether.lands T
Pythiunt manillatunt cBS 251.28 Beta vulgaris Netherlands pN
Pythium marinum cBS 312.93 Porphyra nereoc¡,s/ls USA R
Pythiunt marsipiunt cBS 773.81 Nymphoides peltata Netherlands
Pythium mastophorunt cBS 375.72 Apium graveolens UK pN
Pythiunt middletottii cBS 528.74 Soil Netherlands pN
Pythium minus cBS 226.88 Soil UK T
Pythiurn monospermun cBS 158.73 -UKNT
Pythíum multisporum cBS 407,50 SoiI USA T
Pythium ntyriotylunt cBS 254.70 Arachis hypogae¿ Israel pN
Pythiunt oedochilunt cBS 292.37 Dahlia sp. USA AU
Pythium okanoganense cBS 315.81 Triticunt aestivunt USA T
Pythíum oligandrum cBS 382.34 Viola sp. UK pN Pythium ostracodes cBS 768.73 Soil Spain PN
Pythiunt pachycaule cBs 227.88 Soil UK T
Pythium paddicunt cBS 698.83 Triticun sp. and Japan R Hordeun sp. 42
Table 1. Continued
Species Accession Original Origin Status Number Substrate
Pythium paroecandrum cBS 157.64 Soil Australia pN
Pythium periilum cBS 169.68 Soil USA pN
Pythiunt periplocunt cBS 289.31 Citrullus vulgaris USA T
Pythium plerotícum cBs 776.81 Nymphoides peltata Nethe¡lands R
Pythium polymastum cBs 810.70 Lactuca sativa Netherlands PN
Pythium polymorphon cBs 751.96 Lepídunt sativunt UK
Pythiunt porphyrae cBS 369.79 Porphyrayezoensis Japan PN
Pythiu,n prolatunl cBS 845.68 Soil USA T
Pyrhium pyrilobum cBs 1s8.64 Pinus radiata Australia T
Pythium radiosum cBS 217.94 Soil France T
Pythium rostratunx cBs 533.74 Soil Nethe¡lands NT
Pythium salpingophorum cBS 471.50 Lupi n u s an g u s t ifoliøs Germany PN
P y t hi um s c I e ro t e ichunr cBS 294.37 Ipomoea batatas USA AU
Pythiwn spittosunt cBS 275.67 Compost Netherlands PN
Pythiunt splerùens cBS 462.48 - USA PN
Pytltium sulcatum cBS 603.73 Daucus carota USA T
Pythíum sylvaticum cBS 452.67 Soil USA T
Pythium torulosum cBS 316.33 Grass root Netherlands PN
P ythi unt t r ache ip hilum cBs 323.65 Lactuca sativa Italy T 43
Table 1. Continued
Species Accession Original Origin Status Number Substlate
Pythium ultimum cBs 398.51 Lepidíum sativurtt Netherlands NT var. ultimunt
Pythium ultitnum cBS 219.65 Chenopodíuttt albunt USA T var. sporangiiferum
Pythiunt uncinulatunt cBs 518.77 Lactuca sativa Netherlands T
Pythium undulatum cBS 157.69 Soil USA NT
Pythium vanterpoolii cBs 295.37 Triticum .testivum UK T
Pythium vexans cBs 339.29 Spinacia oleracea Hawaii T
Pythium violae cBs 159.64 Soil Australia pN
Pythium volutum cBs 669.83 Tritícum sp. and Japan R Hordeum sp.
Pythiunt zingiberis cBS 216.82 Zingiber míoga Japan R
Rhizidiomyc es ap ophy satus 8R296
Saprole gnía parasitica cBs 540.67 Watel in fish UK hatchery
Saprole gnia polyntorpln cBs 618.97 Cyprinus carpio UK T
Saprolegnia utzispora cBS 213.35 -UK
Thraustotheca clavata cBS 343.33 Soil Nethellands
* cBS = accession numbers of strains obtained from centraalbureau voor Schimmelcuf tures ULrecht., b , NetherLands, T = strain from which the tlæe material was derived; AU authent.ic sL.rain, = identified by author of the species; pN = strain used by van der plaats-Niterink for t.he description of 44
the species of the genus pytåj um,. NT = strain designat.ed as neoe)T)e because all type material is missing; R = representative straín, no T, NT, AU, or pN availabfe. 'BR isofates u/ere obtained from the Biosystematics Research Centre, Ottawa, Canada d Peronospora parasiEica material was scraped from plant of CapseTTa bursa-pastorjs. Obligate parasite of which no culture is avai fable . ',fMl-0 was obtained from the Aquatic phycomycete Cult.ure Collection, Readíng, England. 45
DNÀ extraction and purification of genomÍc DNA Ext.raction of DNA was based on a method described by MöLler eE af. (1992) . Approximat.ely 20-30 mg of lyophilized mycelium was placed into a L.5 mL microt.ube (Eppendorf Scientific, Westbury, Ny) . The mycelium was then gent.ly broken into smaffer pieces using a pipet.te tip and 3g ¡tL of a 2-4 t¿M stock solut.ion of proteinase K (Sigma, St. Louis,
Mo.) and 71,0 ¡.tL of TES (100 mM Tris, pH 8.0, 10 mM EDTA, 2%
sodium dodecyl suffate) were add.ed. The microtube was mixed. by inversion and placed in a 55-60"C waterbath for l- hour; the microtube was shaken eveïy 5 min during incubat.ion. 210 pL of 5M NaCl and 98 ¡zL hexadecyl trimethyl ammonium bromíde (CTAB; Sigma) / NaCf (tOZ/0.7M) was added, mixed, and aLlowed to incubate for 10 min at 65"C. The mixt.ure was then centrifuged aL L4,00O rpm, at 4.C, for 10 min E.o peLlet cellul-ar debris. The supernatant was transferred to a new 1.5 mL microtube and an equal volume of chloro form: isoamyl alcohoT, 24:1, (Fisher Scientific) was added. The cont.ents of the tube were t.hen mixed, by inversion, and placed on ice for 30 min and cent.rifuged at l-4,000 rpm, at 4"C, for 10 min. The supernatant was transferred into a new 1.5 mL microtube (maximum 1000 ø1,) . 550 ,¿L isopropanol (0.55 vol) (Fisher Scientific) was then added to the tube with the maximum amount of supernatant. The contents were mixed by inversion, five times, and incubated for a few minutes to overnight aL room temperature. This was followed by +6
centrifugation at 14,000 rpm at ïoom Cemperature for l-0 min. The supernatant. was díscarded and t.he remaining pellet.
was washed with 900 ¡,tL 70* ethanof (Fisher Scientific), at. room temperat.ure for at. least 10 min. The contents of t.he tube were then centrifuged at 14,OOO ïpm at. room temperature for 1 min. The pel1et. was dried for 5_30 min at room Lemperature by opening and carefufly inverting the
microtube. 50 tLL., TE (10 mM Tris, 1 mM EDTA, pH 7.6) \,,¡as then added and left at room temperature, or eventually warmed t.o 55'C, to dissolve the peflet. This met.hod yields approximately 30-50 ¡,rg of crude genomic DNA extract.
Amplification of DNÀ Amplification of DNA was performed by the polymerase chain reaction (pCR) in vofumes of 50 ¡tL. The following reagents were added: 5.0 tLL of 10X ?aq DNA polymerase
reaction buffer (promega, Madison, !VI), 3 t¿L of 25 ÍM MgC12 (final concentratíon 1.5 mM) , 4 pL of dNTp mixture (final concentrat.ion each of nucleotide 2OO ltVl) , O .5 ¡.tL ( 16 pmol ) of each of the ref evant oligonucleotide primer s, O ,25 ¡.tL of
?ag pofl¡merase (1.25 uníts) (promega) , I l.¿L template DNA (approximately 200 ng of crude nucleic acid extract per ¡,tL) , and 35.15 ¡tL ultra pure water. All oligonucf eotide primers used for pCR are listed in Tabte 2. Amplifications were performed in a prograflìrnable thermaÌ control-ler (pTC_ l-00, MJ 47
Table 2. Primers used in amplifications and/or sequencing rDNA
Primer Location of the Sequence o l igonuc 1eo t ide (5' to 3')
N 3 4-52c ATCCCGTTCGCTCTGCGA
N2 2-L9" TAGACGGCCATCTTAGGC
N5 IGS of Pythium GÄAGTT.AAGCAGCCT irreguTare
N5C rcs of Pythiun AGGCTGCTTA.A,CTTC i rreguTare
N6 IGS of Pythium GCAAATGCGA.AAGTGATC irreguTare
N6C IGS of Pythiun GATCACTTTCGCATTTGC irregulare
P 7 01-7204 GGCTCCCTCTCCGGÄå,TC
P2 80-984 ATACTTAGACATGCATGGC
0 3110-3128b ACGCCTCTAAGTCAGAATC
Q3 IGS of Pythiun AGTTGACTTCTGCGCÄÀG irreguTare
Q3C IGS of Pythiun CTTGCGCAGAAGTCA.A,CT irregu Tare
òL 1-2 0c AGCCTA.A,GATGGCCGTCGAC
SR 99-l-18' GÀÃGCCCGGGTGCTGTCTAC
T3 Bl-uescript pML3 ATTAÀCCCTCACTAA.AG
T1 Bluescript pM13 AATACGACTCACTATAG
Y 3 4-52c TCGCAGAGCGAÀCGGGAT 99-118" GTAGACAGCACCCGGACTTC
'Based on the SSïRNA sequences of. S. cerevisiae (Rubstov et al . 1980) b Based on the LSïRNA sequences of S. cerevisjae (Gutefl and Fox i-988 ) 'Based on 55 rRNA sequences of PyEhiun hydnosporum (Wolt.ers and Erdmann 1988 ) +9
Research, Watertown, MA) , using the st.ep cycle program, including denaturation at 93'C for 1 min, annealing at 50.C for 1 min, and polymerization at 72"C for 1 min with primers y3, N2 and Y, N2 and or SL and SR, 2 min with O and N, e and N2, Q and N5, e and N5C, or e and y3. The pCR cycle was repeated 30 times. For primers N2 and p2, or p2 and y, polymerization was carried out at 12"C for 3 min, and the PCR cycle repeaL.ed 24 times. For primers e and p2, polymerization was carried out at 65.C for 10 min, and the PCR cycfe repeated 20 t.imes.
Isolêtíon of pCR prod,ucts When amplífied DNA was need.ed for the const.ruction of a probe or for use as a template for further amplification, t.he freeze squeeze method was used t.o purify DNA from gefs (Tautz and Renz 1983). Bands \^reïe first excised from et.hidium bromide stained agarose gefs and f.rozen at _60.C for at least 30 min. The frozen gel plug was placed between two layers of parafilm (American Natíonal Can. cïeenwich, Conn. ) and t.hawed using constant finger pressure. The
resulting liquid cont.aining DNA was colfected and 2M
NaCl/2B CTAB was added to a fína1 concentration of l_M/t %. The mixture was incubat.ed at 55"C for 10 min and extracted.
twice with chloroform/ ísoamyl afcohol (24:L, v/v). DNA was precipitated by the addit.ion of two volumes of 95% ethanol . Alternatively, purificat.ion of the pCR amplified products was performed by the 1ow melt.ing point agarose gel 50
exL.raction method. Samples were first electrophoresed on a 1.53 agarose ge1 made with l_ow melting point agarose (Roche) . Af t.er electrophoresís the band of agarose geI containing t.he desired DNA was excised and dissolved at. 65.C in TE buffer (20 mM Tris, 1mM EDTA, pH g.0). The mixture was then extracted twice, first with an equaf volume of
phenol, folfcwed by an equal volume of phenol : chloroform (25:24, v:v) . DNA was precipitat.ed in 95* ethanof, followed
by one washing with 709 ethanol. The remaining pellet was dried and resuspended in wat.er.
DNÀ digestion and, electrophoresis
Endonucfease dígest.ions \^rere performed. using enzymes obtained from Gibco BRL (Burlington, Ont.) according to t.he manufact.urer,s recommendations . 5x foading buffer (0.25% bromophenol bl-ue, 40?, w/v sucrose, and 1mM EDTA, pH 7.6) was added to DNA restriction reactions following the incubation period recommend.ed by the manufacturer. El ec t.rophores is of DNA was carried out. in TBE buffer (89 mM Tris, 89 mM boric ac!d,, 2.5 mM EDTA, pH 7.6) on 0.7 to 1.5% agarose (Roche) horizontal submarine gels at 2 to
10 V/cm. Band lengths were estimated by means of DNA fragmenL size stand.ards, using the 1 kb Ladder, 1 kb+ Ladder (Gibco BRL) or the DNA molecular weight. marker Vr DIc-labefed (Roche) . Agaïose gels were stained by the additíon of a final concenLration of 0.5 ¡tg /mT_, of et.hidium bromide (Sigma) t.o the agarose ge1 and were visual_ized 51
under ultraviofet (UV) light (310 nm) on a trans i f fuminator (Fot.odyne Incorporated, Mississauga, Ont..). The gels were photographed under UV light using polaroid 667 f i1m.
Hybridi zaÈ ion The 55 gene probe was made from the pooled N2_y3 product.s of 55 gene amplification of pythium irreguJare (CBS 2SO.2g) and Pythium torufosum (CBS 316.33), first eluted from agarose gel by the freeze squeeze method (Mö11er et af. L992) and then label1ed with dioxigenin- 11_dUTp by the random primed meLhod. The e and p2 ol igonuc leot ides were fabelfed with dioxigenin- j_ 1-dUTp by Lhe 3,_end labelling method according t.o the supplier,s instructions (Roche). Southern blots were prepared. by the capillary blott.ing technique described by Southern (l-975) for t.he transfer of amplified DNA from agarose gels to Hybond_N membrane (Amersham Corp., Arlington Heights, IL) . DNA was fixed to t.he membrane by cross-linking wiE.h uLtraviolet light on a trans i l luminator for 4 min (3 min on DNA side, 1 min on opposite side). Membranes were incubat.ed at 55"C or 42"C for t h in 15 mL of hybridization sofution (18 SDS, 1 M NaCl) and hybridized wieh constant agitation overnight. at 55.C wích the 55 gene probe or at- 42.C with the e and p2 probes added t.o the hybridization solution, probe concent.ratíons ranged from 5 to 10 nglmI-. After hybridization, membranes were washed twice, 5 min per wash, in 2x SSC (1x SSC is 0.15 M NaCl- pfus 0.015 M sodium citrate, pH 7.0) and 0.1t 52
SDS at room temperaLure, then twice in 0.19 SSC and 0.19 SDS at 55'C for the 55 gene probe, or 42.C for the oligonucleotide probes, Chemi fuminescent. detection was performed with anti_ dioxigenin (DIG) antibody and CDp-Star subst.rate (Boehringer) according to t.he manufacturer's instruct.ions as foffows. After pos t. -hybridi zation washes, membranes were washed briefly in buffer 1 (100 mM maleic acid, 150 mM NaCl , pH 7.5) and incubated in buffer 2 (1% blocking reagent in buffer 1) for j. h wit.h gent.le agitation. Anti_
DfG-alkaline phosphat.ase was added to fresh buffer 2 Eo achieve a dilut.ion of 1:10,000, followed by gentle agitation for 30 min. Membranes were washed twice for 15 min in buffer l- and incubat.ed ín buffer 3 (100 mM Tris HC1, pH 9.5, 100 mM NaC1, 50 mM MgCl2) for 3 min. Membranes were placed on transparent plastic sheeE.s and l-00 ¡,tI of a 1:2OO difution of CDP-Star was spread over each 15 cm2 of membrane. Membranes were sealed in the plastic sheets and exposed t.o Kodak X-Omat X-ray film (Eastman Kodak Co.,
Rochester, NY) for L to 20 min to record chemi l-uminescence .
Purifícation of pCR and restriction digeEt proilucts DNA isolation of pCR products and restriction digest.ed fragments, used in cloning, was done using Geneclean If (8io101, Vista, CA) , according to manufacturer,s recorûnendations , Digested pCR fragments were first efectrophoresed on a 1B agarose gel. After ef ectrophores i s , 53
the desired bands were excised from the ge1 , 4.5 volumes of Nar and 0.5 volumes of TBE modifier (Biol-Ol) were added to 1 vofume of agarose ge1 and this mixture was dissofved at 55 'C for l-0 min. To t.his, 10 - 15 pL of glassmilk was added, folfowed by a 15 min íncubat.ion period at room temperature. After incubat.ion, Lhe mixture was washed t.hree times with 500 ¡tL of New Wash (Bio101). The result.ing
pellet was then cenLrifuged for 30 seconds in ord.er t.o
eLute the DNA f rom the glassmi Ik. 2 ¡.tL of the elut.ed DNA was electrophoresed on a 1? agarose gel stained with ethidium bromide, then viewed under try 1ight.
Cloning of purified restriction digested fragrmenls The purified DNA was cloned into t.he .SrfI site of the pPcR-Script ÃmpSK(+) plasmid (Stratagene, La ,folfa, CA) , as detailed below.
i. Políshíng of, reEtriction fragrments
For successful ligation, alf îaq DNA polymerase generated PCR products had to have theír ends polished. The polishing react.ion, according t.o the pCR-script Amp Cloning Kit (Stratagene, La .Iolla, CA) , was prepared by adding each of the following: IO pL of the purified pCR producl, 1 ¡tL of 10 ÍìM dNTPs (2.5 mM each) , L.3 ptL of 10X polishing buffer and 1 7:t of pfu DNA poll¡merase (0.5 units). The reaction v/as covered v,¡ith 20 ¡zL mineral oi1 overlay and incubated for 30 min in a i2"C rdater bath. 54
ii. Vector-insert ligatíon
the ligacion protocol was t.aken fïom pcR-Script Ãmp Cloning Kit. (Stratagene, La ,JoIIa, CA) . Ligation of insert required a 40:1 to 100:1 insert - to -vec tor rat.io. The polished PCR product was then added to t.he ligat.ion mixture . L0 ¡tL of ligation mixture \^,as prepared as follows: 1" ¡.ù of PCR-Script. LOX reaction buffer (Stratagene) , 0.5 tù
of 10 mM dATP (Strat.agene) , 4 þL blunt_ended pCR product, 1
tLL SrfI restriction enz)¡me (St.ratagene) anð. L ¡,tL of T4 DNA 1ígase (St.ratagene) , Ligation míxture was then incubated
for t h at room t.emperature. The reaction t¡/as stopped by a 10 min incubation period at 65"C.
iii. rransformation Transformation of vector_ligated insert into Epicurian
Cofi xL l-0-Go1d Kan ultracompetent Escherichia co_Z j cel_ls was carried out using t.he prot.ocol outlined in pCR-Scïipt Amp Cloning KiC (SEratagene) according to manufacturer,s
instructions. 40 ¡.tL of thawed Epicurian Colí XL 10_go1d Kan ultracompet.ent j -8, coJ cel1s (Strat.agene ) and 1 . 6 l.¿L of XL 10-go1d B-mercaptoethanof were mixed and íncubated on ice
f or 10 min. To thj.s mixt.ur e 2 ¡,tT. of vector_f igat.ed inserL. were added, followed by a 30 min incubation in íce. After completion of incubation period, the reaction mixture was heat pulsed for 30 second.s aL 42"C and then incubated on ice for 2 min. 0.45 mL of preheated (42.C) NZy+ vras added and 55
the mixture was incubated for t h at 37"C with shaking. the
reaction mixture was then spread plat.ed onto LB + ampícj.11in (100 ¡tg/¡¡¡ plates already coated with a 2% w/v Xgal - 10 mM IPTG míxture and incubated overnight at 3?.C. Result.ing white (transformant) colonies were picked and replated onto LB + ampicif l-in plat.es. Onto t.hese
cof onies a 10 nìM IF.IG / 2Z Xgal (10:75, v:v) mixture was spotted. The result.ing white cofonies were screened for the presence of the recombinant plasmid. Subsequent digestion wíth an appropriate restriction endonuclease followed by efectrophoresis on a 1.0* agarose geÌ was used to confirm presence of t.he insert. For further confirmation, the
agarose gel containing the plasmid DNA was bfotted onto a nylon membrane and hybridized with the 55 gene probe.
DNA sequencing Plasmid DNA containing inserts was sequenced ín both direct.ions with primers developed from the vecLor (T3 and T7) . Sequencing was carried out using a 31.lxL sequenceï with deoxyrhodamine terminators (University Core DNA Services, University of Calgary, Cal-gary, AB). 56
CIIAPTER 1 Evolution and diversity of 55 rRNA gene organizat,ion ín PyEhíum 5'l
INTRODUCTION
Family organization of 55 rRNA genes is variable within major and minor taxa (Drouin and de Sá 1995), but
dominant. patt.erns exist in most groups, and variations can be seen as refativefy rare departures from the norm. This is t.rue for pfants and metazoa, where the dominant pattern is a 55 rRNA gene family in tandem arrays, unfinked to the
other rRNA genes. Exceptions include some nemat.odes and
some arthropods (mostly crustacea) , whose 55 genes may be
linked t.o the rDNA repeat, the trans-spliced leader (TSL) repeat family, or, in one case, to the histone gene family
(reviewed by Drouin and de Sá L995). Varíation is also seen among profozoans/ where within one genus (Trpanosoma) , the 55 gene family may be linked to the TSL or unlinked (Aksoy
et af. L992; Lerardo et aJ. l-985). Among true fungi, two
major pat.Cerns appear: Basidiomycetes and some ascomycetous
yeasts have Lheir 55 genes linked to t.he rDNA repeat, and some filamentous ascomycetes have dispersed 55 genes that are not linked to other gene families and that are not found in tandem arrays (revíewed in Belkhiri et af. 1gg2). zygomycetes have not been adequat.ely surveyed but they
appear t.o be similar to Basidiomycetes wit.h respect to 55 gene organization (Cíhlar and Sypherd 1980) . t8
Stramenopiles (Chromist.a) have been wídeIy surveyed for 55 gene famíly organization. Most. famífies of
stramenopilous algae ( s tramenochromes ) have been found t.o have 55 genes linked t.o the rDNA repeat, except for the
Baci l lariophyceae and the Synurophyceae, which have unlinked, tandem repeats (Kawai et aJ. tggl\. Stramenopilous fungi (Oomycet.es and Hyphochytriomycetes)
al-so show a dominant pattern of 5S genes linked t.o the ïDNA
repeat, but. the genus pytåium, which has been most intensively surveyed, contains a large group of species with unlinked, tandem 55 genes (Belkhiri et af. 1_992;
HowleE.t eE aL. l_992; Bedard and Klassen 199g). We present here a nearly complete picLure of 55 gene family variability within t.he genus pythium, using type cuftures or authentic st.rains of afl but a few of t.he approximately 100 species avail_abLe. These studies af l-ow us to assess the stability of 55 gene family organizatj.on in the course of evolution and may lead t.o ecological / evolutíonary explanations for persisL.ent pat.terns. 59
RESUIJTS
DeÈectíon of 5S genes in the rGS by hybridizatíon
Initial- screening for presence or absence of 5S gene (s) in different species was accomplished by amplifying t.he intergenic spacer (IGS) of the rDNA repeat wi_th primers
Q and P2, followed by hybridization of this pCR product t.o
the 55 gene probe. The products were between 4 and 7 kb (Figure 1) . The 55 gene hybridized to the e_p2 pCR product.
of 54 species out of 91 (Table 1) . Act.ua1ly, only 90 species were studied, but two variet.ies of .P. uLtimum (var. uTtimum and var. sporangiiferum) are included, and for the
sake of simplicity they were counted as two species. The labfe shows resufts only for tl4)e or represent.atíve cultures, but many ot.her isolates t.han the tlpe were also
surveyed, and only two anomalies were uncovered. These were
for alternat.e cul-tures of p. niddfetonii and p. rexans. and. both cases could be at.tributed to taxonomic uncert.ainties.
The remaining 37 species (Tabfe 1B) showed no
hybridization, suggesting t.he absence of 55 genes or 5S_
like sequences from the fcs. Of these, 36 specíes have
globose sporangia or hyphal swellings. The exception was p. peripTocum, which has filamentous (toruloid) sporangia.
Those species showing presence of 5S sequences(s) in t.he IGS include t.he ones with filamentous sporangia, 60
Fígure 1. Hybridízation of the 5S rRNA gene probe to the IGS of the rÐNA repeat to det.ect linkage of the 55 gene to the ot.her rRNA genes. A) pCR prod.ucts of e_p2 amplification of genomic DNA of (CBS accessíon numbers follow species names): Lane t, p. monospermum 159,73; Iane 2, p. conidiophorum 223.88; lane 3, p. scLeroEeichum 294.3j; lane 4, P. grandisporangium 286.79; lane 5, p. hpogynun 262.19;
J.ane 6, e. pyriTobum 158.64 lane 7, p. saTpingophorum 471-.50; l-ane 8, p. acanthophoron 337.29¡ lane 9, p.
heterothaTTicum 450.67; fane !0, p. parvum 225,gg; lane 11, P. pTeroticun 776.81; lane 1,2, p. marsipium 773.gL; lane 13, P. middfeEonii 528.74; lane 1-4, p. muTtisporum 407.50; lane 15, P. boreale 551.88; lane 16, p. chamaehphon 259.30; Lane 17, p. heLicoides 286.31; lane 1g, p. oedichifum 292.31; lane L9, p. vexans 33g.2g; lane 20, p. peripTocun 289.3!¡ fane 21, p. hydnosporum 253.60¡ Iane 22, P. acanthicunt 281,.31; lane 23, p. intermed.ium 266.38; fane 24, P. radiosum 21-7.94¡ lane 25, p. spinosum 2.15.67; lane 26, P. spJendens 462.48; IarLe 27, p. syTvaticum 452.6.1 ; lane 28, P. uTtinum var. ufEimum 39g.51 1ane 29, p. viofae
L59.64¡ lane 30, p. acrogynum 549.88; fane 31, p. anandlum 258.3L; lane 32. p. debaryanun .752.96; fane 33, p. echinuLatum 28L.64¡ lane 34, p. hel_icandrum 393.54; lane 35, P. irregulare 2EO.2B; lane 36, p. iwayamai L56.64; lane 61
37, P. macrosporum 51 4.80¡ l-ane 3g, p. masEophorum 3j5.j2¡ lane 39, P. okanoganense 315.81; lane 40, p. paddicum
698 . 83; lane 4L, p. pofgastum 8L0 .70 ¡ lane 42 , p. Tostratum 533,74¡ l-ane 43, p, uLtimum var. sporangiiferum 2L9.65¡ lane 44, p. undulatum L57.69; lane 45, p. tracheiphiTum 323.65; lane 46, p. ostracodes .1 68.j3; lane 47, P. mamifTatum 25L.2B; lane 48, p. myriotyTun 254.70¡
lane 49, P. ofigandrum 382.34; lane 50, .P. toruLosum 316.33; lane 5L, p. aquatiTe 2l-5.90; lane 52, p. coforatum L54.64¡ fane 53, p. adhaerens 520.74; fane 54, p. periifum 169.68; lane 55, p. angustatun 522.74; fane 56, p. dicJ-inun 664.'79 ; f ane 5'7, p. dimorphum 406 .72; lane 5g, p. dissimiLe L55.64; lane 59, p. erinaceus 505.80; lane 60, p. futarium 222.88¡ lane 61, p. minus 226.88; fane 62, p. zingiberis 276.82; lane 63, p. suLcatum 603.73; lane 64, p. vofutum 669.83; lane 65, p. vanterpoolii 295.37; lane 66, p. kunmingense 550 . 88; l-ane 61 , p. proLatum g45 . 6g; lane 68,
P. insidiosum 574.84; l-ane 69, p. dejiense 314.33; fane 70, P. paroecandrun I5'7.64; Ìane 7L, p. apJeroEicum l72.gI; Tane 72, P. aphanidermatum 216.46; fane 73, p. capillosum 222.94; Iane 74, p. cyLindrosporum 2!8.94; fane 75, p. drechsTeri 22!.94¡ lane 76, p. foLLicujosum 220.94; l-ane
71 , P. catenuTatum 842.68; lane 7g, p. ffevoense 234.72; lane 79, P. inffatum 168.68; lane g0, p. chondricofa 62
230.85, fane 81, p. marinum 31"2.93, lane 92, p. uncinufatum 51,8.7'7; lane 83 , p. porphyrae 369.?9; fane g4, p. aristosporun 263.38; fane 95, p. dissotocum l-66.6g; Ìane
86, P. graminicoJa 32j.62; lane 81 , p. buismaniae 28g.3L¡ fane 88, P. pachycaufe 227.88; lane 99, p. amascufinum 552.88¡ lane 90, p. pofgorphon 751.96; lane 9L, p. indigoferae 261-.30. Lanes L = BRL L kb+ fadder. The arrow indicates 2,0 kb, the bands above it. increase in 1kb increments. B) Chemi luminescent exposure of gels shown in
A) after blott.ing and hybrídization to Dfc-label1ed 5S rRNA gene probe. Lanes L-46 were exposed t.o X_ray fifm for 5 min, lanes 47-91- for 8 min. i.itiË. ¿äÊ,â t: íìiö'r'.iî¡'iiri;
ùi7iz6z, æ Ð Ð &, tz3¡ 34 3¡ 36 3i Ja 39 ao dr ¿r ¿r ¿¿ ¿s ¿s tb
i,lffiiíll iltïl{ 64
TÀ3IrE 1. Presence and Absence of 55 rRNA Sequences in rDNA Repeat of Pythium Spec i es
55 probe Pytlüutt hybridizes Q-N2 Q-Y3 N2-Y SL-SR 55 gene Isolate" Statusb tO IGS PCR PCR PCR PCR o¡ientation"
GROUP 1A
Filamentous Spo¡angia adheerens CBS 520.74 REp + + aústospot'uDt CBS 263.38 TYPE + + arrhenontanes CBS 324.62 TypE capíllosum CBS 222.94 AU + + chondricola CBS 230.85 TypE + + dissinile CBS 155.64 TypE + + flevoense CBS 234.72 TypE + + folliculosun CBS 220.94 TypE + + gramiricola CBS 327 .62 TypE + + ittsìdiosun CBS 574.84 TypE + + nari¡uutt CBS 312.93 REp + ntyriorylunt CBS 254.70 pN + + periiltutt CBS 169.68 pN + + porphyrae CBS 369.19 pN + + st¿lcqtunt CBS 603.73 TypE + + toruloswtt CBS 376.33 PN + + vanterpoolii CBS 295.37 TypE + volutun CBS 669 .83 REp + + zitryiberís CBS 216.82 REp + + pN angustatun CBS 522.'14 + + + aplønidennatum CBS 216.46 REp + + aquat¡le CBS 215.80 NEOTYPE + + + catetutlatum CBS 842.68 PN + + + color.ttum CBS 154.64 TypE + + + deliense CBS 374.33 NEOTYPE + + + diclinun CBS 664.79 NEOTYPE + + + dissotocwn CBS 766.68 PN + + + pN irtJlatum CBS 168.68 + + luteriwn CBS 222.88 TypE + + pacltycaule CBS 227 .88 TypE + + apleroticun CBS 772.87 REp + ntonospernum CBS 158.73 NEOTYPE +
Hvphal Swellines conidiopltorun CBS 223.88 REp + + drechsleri CBS 221.94 TypE + + scleroteiclum CBS 294.3'1 AU + +
Globose Sooranpia grandisporangium CBS 286.79 TypE + + Ìt¡,pog¡vrnrn CBS 262.79 REp + plu ilobunt CBS 158.64 TypE + + salpirrgophorun CBS 471.50 pN + + 65
t racheip hilun CBS 323.65 TYPE +d
GROUP 18
Filamentous Soorangia periplocuu CBS 289.31 TYPE
Hvohal Swellinss a nß s c u I í tt u nt CBS 5 52.88 AU hyduosporun CBS 253.60 PN
Clobose Spo¡ansia qca.túh¡cum CBS 281.31 TYPE olígandrun CBS 382.34 PN
GROUP 2
H),ohal Swellinss buisnaniae CBS 288.37 TypE + + pN internediun CBS 266.38 + + kunnùngense CBS 55O.88 TypE + + radiosum CBS 217 .94 TypE + + spirtosun pN CBS 275.67 + + splendens pN CBS 462.48 + + sylvaticun CBS 452.67 TypE + + ultinwn var. ¡rl¿ CBS 398.51 NEOTYPE + + violae pN CBS 159.64 + + acatttltophoron CBS 337.29 AU + + heterothallicum CBS 450.67 TypE + + ntit,as CBS 226.88 TypE + + panun CBS 225.88 TypE + + pleroticun CBS 776.81 REp + +
Globose Sooranpia acrog¡,twn cBS 549.88 REP + cylitdrosporun CBS 218.94 TypE + debar¡,anun CBS 752.96 dirnorphunt CBS 406.72 TypE + echittulatum pN CBS 281.64 + erinaceus CBS 505.8O TypE + lrclícandrum CBS 393.54 AU + írregulare CBS 250.28 NEOTYPE + iwa¡,anai pN CBS 156.64 + nncrosporum CBS 574.80 TypE + nantillatunt pN CBS 251.28 + nastophorunt CBS 375.72PN + okanoganense CBS 315.81 TypE + pøddicun CBS 698.83 REp + paroecard.runt pN CBS 157.64 + polynastun pN CBS 81O.70 + polynorphon CBS 7 51.96 + prolatwn CBS 845.68 TypE + rostratun CBS 533.74 NEOTYPE + tuhinwn var. spor CBS 219.6 TypE + tutcitwlannt CBS 406.72 TypE + uldulqtun CBS 157.69 NEOTYPE + 66
nwrsipiun CBS 773.81 + + _l tn¡ddletonii CBS 528.7 4 PN + I nult¡sporun CBS 407 .50 TYPE + + I qtnndrum CBS 258.31 TYPE + ++
GROUP 3
Globose Sooranpia boreele CBS 551.88 REp + +++N chanueh¡,phon CBS 259.3O TypE + +++N helicoides CBS 286.31 PN + +++N oedochilun CBS 292.37 AU + +++N ostracodes CBS 768.73 PN + ++d+dN índigoferue CBS 261.3O PN + +--N vexansCBS339.29 TypE + +--N
- CIJS = accession nuIrìbers of strains obt.ained from Centraalbureau voor Schimmefcu] tures , Baarn, Netherfands. b TYPE = strain from which the t)æe materiaf was derived; AU = authentic strain, identified by the author of the species; PN = strain used by van der pfaats_Niterink for description of the species of the genus pytåium; NEOTYPE = strain designat.ed as neot]æe because al-I tlæe materiaf is missing; REP = representative strain, no TypE, NEOTYPE, AU, or PN availabfe. " I = inverted with respect to other rRNA genes; N = non_ inverted with respect dThese to other rRNA genes. results were obtained. when ge;omic DNA was used as the t.empfate, but when the amplified IGS (e-p2) was used, aff results were negat.ive. 'Linkage of 55 gene-1ike sequence detected by DNA_ DNA hybridization only. pCR analysis did not yield positíve results, therefore orientation has not. been d.etermined. 67
except for P. peripTocumt as weLl as a number of species globose with sporangia or hlæhaÌ sweflings (Table 1À, 1C) .
In some cases, amplification with e_p2 yíe1ded. more
than one amplicon in the 4-j kb range (see p. sp.j.endens and P, uftimum in Figure 1) . This was due t.o IDNA heterogeneity
as reported earfier (Buchko and Klassen 1990). In many isolates, additíonaf amplicons appear in the 1 kb range ín
Figure 1. This is Iike1y due to second.ary annealì.ng of one of the primers to a site in the IcS. The only isolate in t.hj-s group with finked 55 genes and with extra amplicons was P. tracheiphiTum, and when probed wit.h the 55 probe,
the extra amplicons were recognized with the main IGS
amplicon, indicatíng that extra amplicons arise from t.he IGS and are noL from some other source (daL.a not shown) . These results extend. previous findings (Belkhíri et a7 . 1-992) and conf irm all- but three of Chem. .P. rzioJ.ae was earlier report.ed to have linked 55 genes, but it is now found to be without t.hem. The two isolat.es used earlier, however (M42160 and MA2O24, from the Aquatic phycomycete
Culture Co]lection tApCCl ), have genet.íc fingerprints (RFLPs of the amplified IcS) almost identical t.o those of P. heterothafficum. Thus, t.hey are probably not closely related to isolate CBS l-59.64, which was used in t.his study, and was the basis of Van der pLaats _Ni terink, s 68
(1992) description of the species. The genetic fingerprints are RFIJPS of the amplified IGS (unpublished) . If these
isofates are rea1ly p. heterothaf j icum, their linked 5S genes would be consistent with our present findings for that species.
The seccnd anomaly has t.o do vrit.h p. acanthophoron. The isolate used earlier (ApCC 4000a) did not have a linked 55 gene, but isolate CBS 337,29 does. Here again, t.he fcs fingerprínts show that the two isolat.es are not closely relat.ed, so it is difficult to say which of the two is the best represent.ative of p. acanthophoron. The t.hird anomaly is more difficult to explaín. Two isofates of p. parvum, one obt.ained from APCC, one of them the t]æe species was earlier reported not to have linked 5S genes. The tl¡pe culture from CBS (225.89) however, now shows finked 55 genes. .A,s will be explained in the discussion, the fatt.er findings are more consist.enL with phylogenetic considerations and are supporL.ed by more evidence presented in this thesis, and shoufd be taken as rel-iabfe. The previous negative result may have been due to a failed pCR reaction. 69
PCR amplifícation and restriction mappingr t'o confírm presence and, orientation of 5S gene(s)
To confirm the presence of 55 genes in the IGS, amplifications were at.tempted using primer e paired with SS-specific primers N2 and y3 (Figure 2). A1l of the isolates for whích hybridization experiments showed the presence of 55 genes coufd be successfufLy amplified with
either one of these primer pairs: e-y3 when t.he 55 gene was on the same strand as the other rRNA genes (non_invert.ed) ,
and Q-N2 when the 55 gene \.das on the opposite DNA st.rand (inverted) . e-N2 pCR amplification products of 1.3 t.o 1.6 kb were obtained from 45 species of pyEhiun, none of which amplified with the e-y3 primer pair. e_y3 amplicons of 1.1 to L.3 kb were obtained from 9 different species, none of which amplified when using t.he e-N2 primer pair, indicating a non-inverted orientation. Thus t.he inverted oríentation is dominant among pytåjum species with línked 55 genes. In some inst.ances multiple prod.uct.s were observed in a ladder formatíon, likely due t.o multiple 55 genes or gene_like efements within t.he rDNA repeat.
All species r.dhose IcS failed to hybridize to the 55 probe were also negative with respect to atcempt.ed e_N2 and
Q-Y3 amplification. These findings confirmed lhat the 5S genes of these species were unfinked to the rDNA repeat. As 70
Figure 2. a) Schematic represent.ation of t.he pyEhium 53 gene showing primers used for amplification and conserved. restrict.ion sites. A = AvaI t B = BstEII. B) The three ways in which 55 rRNA gene may be arranged in various pythium species. IGS = intergenic spacer. e and p2 are t.he primers used to amplify the IcS. LSTRNA = farge subunit gene, SSTRNA = smalf subunit rRNA gene. 55 genes \^/ith circular shading are extra copies of the gene oï pseudogenes, A
5S 100 bp
B Linked & Non-inverted O N2Y3
LSfRNÀ 72
sho\.vn previously (Klassen eË af , L996 ¡ Belkhiri et aj. 1997) , such species always have t.andem arrays at another genomic f ocat.ion.
The presence of tand.em arrays of 53 genes was
investigated by gene to gene amplification within the 55
arrays using primer pairs SL and SR, and N2 and y. The
predict.ion was that all specíes v,¡ith unfinked 55 genes shoufd amplify with these primers, and indeed, all
predict.ed N2-Y and sL-sR amprifications were successfur and in agreement wit.h each other, wit.h products ranging from
0.4 to 0.8 kb (Table 18) (Figure 3). Unexpecr.edly, 17 species wíth linked 55 genes coufd afso be amplif j.ed with
the N2-Y prímer paír, although only 6 of Lhem were amplified by SL-SR (Table 1A, 1C) , índicatingf the presence of tandem arrays in these species. In addition to the hybridization and pCR evidence for the presence, posítion, and oríentation of 55 genes in the IGS, rest.riction mapping of t.he IGS was a third approach
used occasionally to confirm results. The functionaf 5S gene in Pythiun has ,ArzaI and BstEII sit.es that can be used diagnostically (walker and Doolittr.e i.982; Belkhiri eE af. 1992) (Figure 2). Several instances of this approach will be demonslraE.ed below. t5
Figure 3. N2-Y and SL-SR pCR amplification products of genomic DNA from a smafl seL. of pythiun species. L = Gibco BRL 1 kb fadder. Lane 1, N2-y product of -P. ostracodes
C8S768.73; lane 2, SI_,-SR product of p. ostracodes
C8S768.73; lane 3, N2-y product of p. kunmi¡grense CBS
550.88; lane 4, SL-SR product. of p. kunmingense CBS 550.gg; fane 5, N2-Y producL of p. amascuLinum CBS 552.gg; lane 6, SL-SR product. of p. amascuLinum CBS 552.88. 23456 75
DeÈermining the presence of multj.ple 55 genes or ss_Like elementÉ ineide the fGS The possible presence of tandem arrays of 55 genes in species vrith Linked 55 genes was invest.j_gat.ed by using the pCR purifíed Q-P2 product as a template for N2-y and SL_SR
amplification. All 54 species with finked 55 genes were tested. Result.s for the N2-y primer pair showed amplicons
ranging from 0.3 to 0,6 kb for 15 different species, Efeven of t.hese (P. angustaEum, p. aphanidermatum, p, aquatiLe, p. catenulatum, p. coforatum, p. deliense, p. dicjinun, p. dissotocum, p. inffatum, p. Jutarium, p. pachycau|e\ are in croup 14. fncluded in t.his group ís p, pachycauje, a species for which the 55 gene region of the IGS has been fully characterized (Belkhiri and Klassen tgg6\ . The t.andem array that gives rise to the N2-y amplification consists of a pseudogene and a functional gene. The SR primer site is degraded in the pseudogene, preventing SL_SR amplification of the array. The same situation is likeIy the cause of SL_ SR amplificat.ion failure in the other 10 species of this group. All of them have L.he unusually short N2_y amplicons report.ed for .P. pachycauJe (0.3 kb as compared to 0.6 kb in oLher species) (Figure 4) .
P, boreale, p. chamaehyphon, p. heLicoides, and p. oedochiTum are Group 3 species whose e_p2 products can afso 76
Figure 4. N2-Y amplification products, usíng purified e-p2 PCR product as a templat.e, from a set of croup 1A pythiun species. L = Gibco BRL 1kb fadder. Lane 1, p. dissotocum
CBS 166.68; fane 2, p. aquatj-Ze CBS 2j-5.90; fane 3, .P. coforaEum CBS 154.64; ]ane 4, p. angusËätum CBS 522.74; fane 5, P. dicLinum CBS 654.29; lane 6, p. fuEarjum CBS 222.88; lane '1 , p. defiense CBS 3l-4.33; fane g, p. aphanidermatum CBS 2L6.46; lane 9, p. infl_aEun CBS 16g.6g; fane 10, P. pachycauJ e CBS 227.98 2345678910 1 kb
1.0 0.5 t8
be used for successfuf N2-y and SL-SR amplifications, confírming that they also have tandem arrays of 55 genes ín
the IGS, producing products ranging from 0.35 to 0.55 kb
(Figure 5) .
These results are fike those obt.ained when genomic DNA
was used as the template (Tabfe l_) except for p. anandrum, P. ostracodes and p. tracheiphil.um, whose e_p2 products did
not amplify with eit.her N2-y or SL_SR. When genomic DNA was used as the templaE.e, however, these species did amplify (Tabfe 1), indicating that tandem arrays of 55 genes exist in the genome at another focat.ion. Successful_ hybridization
of the 55 probe v¡ith t.hese e-p2 products then must mean
t.hat either a single 55 gene is present, or that t.he hybridizing elements are 55 pseudogenes with degenerated
primer sites. The failure of N2-y and SL_SR ampJ.ification
from P. vexans (Table 1A, croup 3) on both genomic DNA and on Q-P2 templates means that it 1ike1y has a single linked 55 gene.
For P. osEracodes the IGS appears to have a single 55 efement which can be amplifíed with primers specific for both of it.s ends (N2, y3) and which has the ,qyaI and BstEII sites found in aLl functional pythiun 5S genes. ït is likely a functional 55 gene. If true, this would be t.he only example of an organism having 55 genes both linked and 79
Figure 5. SL-SR amplification producL.s, using purified e_p2 PCR product as a template, from a set of Group 3 pythiun species. L = Gibco BRL 1kb fadder. Lane 1, p. oedochifum CBS 292.37; lane 2, p. hejicojdes CBS 286.3J_; lane 3, p. boreale CBS 551.88; lane 4, p. chamaehphon CBS 259.30. L 1234 L
1.0 -
0.5 - 81
unlinked Lo the rDNA. The possibílity that the p. osEracodes culture was contaminated with a second,
unreLated species is ruled out. by the fact t.hat the same
sample of DNA was used by ot.hers to sequence t.he ITS
regions and no overlapping sequence was det.ected (C. A.
Lévesque, personal communícat.ion) . For p, anandrum and p. tracheiphiTum, the 5S-like element.(s) in the IcS that
hybrídízes to the 55 probe does not amplify with 55_ specific primers and does not have the Lwo diagnostic rest.riction sit.es, and is thus 1ike1y to be a degenerated copy similar t.o the pseud.ogenes found in p. pachycaufe
(Belkhiri and Kl-assen L996). The p. tracheiphiLum DNA sample was also found to be uncontaminated.
Non-inverled 55 genes
Pythium 55 genes that are l-inked to the rDNA repeat are not usuafly coded for on t.he same strand. as the other rRNA genes. We refer to this as the 'invert.ed, orient.ation.
For species \"¡ith filamentous sporangia fisted in Tab1e 1A, the onl-y ones wit.h non-inverted 55 genes are p. monospermum (the tlæe species of the genus, Figure 6) and p. apJeroticum. Each has a single linked 55 gene. Thus, gene orientat.ion in this group is not absofutely uniform, but óz
Fíg.ure 5. PCR amplification products of the type cult.ure of the genus, P. monospermum CBS 159.73, using genomic ÐNA as a templaLe. L = Gibco BRL 1kb ladder. Lane 1, O_p2 amplification product; fane 2, N2-p amplíficat.ion product.; fane 3, Q-y3 amplification product.
84
presence of the gene on the same strand as the other rRNA genes is fairly rare. The hallmarks of 55 gene family organizatíon withín Group 3 are non-inverted 55 genes j.n t.he IGS and the Lypical presence of a pair of genes in tandem (Figure 7). The restrictíon site maps are consistent with all
hybrídization and amplificat.ion data derived from the IGS. The two-gene patteïn ís observed ln p. oedochifum, p. heficoides, P, boreafe, and p. chamaehyphon, but not for p. vexans and .P. ostracodes, species for which a single gene has been detected. As noted earlier, however, p. ostracodes also has tandem arrays of 5S genes unlinked to Lhe rDNA. Fignrre 7. Comparative 55 rRNA gene arrangement in the .P. oedochiTum group. For s]¡mbols see Figure 2 legend. - ¡l k P.oêdoch,um LSTRNA 55 5S SSTRNA
P. hallcöldes
P, chamaehyphon
E¡E P. oatracodes 65 5S 55 lkb - 8'7
DISCUSSION
The work report.ed here gives a virtually compLete picture of 55 rRNA gene family organizat.ion in one genus of Oomycetes. The use of type culLures, or autherlt.ic cultures where t]æes were not. available, makes it. possible for us to address phylogenet.ic quest.ions when they arise. It. is wefl known that f.or pythium, assignment of isofates to species
on t.he basis of morphological characters is of t.en
difficulL., especially when characters overlap or when sexual strucL.ures or sporangia are absent. The major lines of evolution wit.hin t.he genus pythium
have been t.entatively est.ablished on the basis of sequence comparisons in Lhe D2 domaín of the 2gS rRNA gene (Briard
et af. 1995), the ITS regions (wang and white l_997; de cock
et a7. 1998; Matsumoto et af, L999, L,évesque et af. 19991 and the mi tochochondrial ly encoded. cytochrome oxidase II
gene (Martin 2000). At least three major branches have been discerned which we will- refer to as Groups 1, 2, and 3 (Figure 8) . Group 1is divided inLo 2 subgroups. Members of Group 1.A', which incl-udes p. monospermum, the tlæe species of the genus¿ are characterized by theír fiLamentous sporangia, although some species are incfuded which do not produce spores and a few produce spherical sporangia. Group 88
Figure 8. Schematic phyJ.ogeny of st.ramenopiles and summary of 55 gene family arrangement. The tree represents topology on1y. The Pythium groups are discussed in the t.ext. Broken
lines in the t.ree indicate predominance of the unlinked 55
gene family arrangemenE. Letter posiLions in rDNA map: L_N
= number of species (or families for s Lramenochromes ) wit.h finked 55 genes in the noninvert.ed. orientation; L_J = number of species (families) with finked 55 genes in the inverted oríentation; U = num_ber of species (famifies) with unlinked 55 genes in t.andem arrays. The asterisk indicates
that the single species \,,¡ith unlinked 55 genes also has linked 5S genes. The solid boxes represent t.he dominant form, the shaded boxes indicate rare forms, and the open boxes indicate absence of the form. Data from 1) Bel-khiri eE af ., L992, 2) Ho\¡¡lett et aL., 1_992, 3) Chapter 3, 4) Kawai eË af ., L997. Pythiun
tçl tç¡ tæ 1- Ororn f,l -{= oroup le T T T5 I -{F I eroun z I I r32 -{-
I Grouol --E+----.r tH t5 rFI 1- Phytophthoral '2 ¡ n n0 Lagenidiuml -_r- Saprotegnialesl,' t11, t ¡nno
Hyphochytridss --|å----.I n n |]1- J.;;;=;;;..;;;.=- - ¡;;il- I I I: =- -{H---- r r ru 90
18 consists of p. acanthicum, p. peripTocum, p.
amascuLinum, p, hydnosporum, and. p. oJigandrum, species
wíth a contiguous (intermediate between globose and filamentous) form of sporangia (A.W.A.M. de Cock, personal communication) . Members of Group 2 and 3 have spherical sporangia or hyphal swellings, and t.heir separation into two fines depends more on interpret.ation of sequence data
than on morphological analysis. Group 2 has a large number
of species íncluding the ubiquitous paLhogen p, ufEimum. Group 3 is a sma11 cluster including p. oedochifum, p. boreale, P. osEracodes, p, indigoferae, p. vexans, p.
chamaehyphon, and p- heficoides. The erection of new genera
to reffect the major branching with pythium has been
suggest.ed/ but has not yet become a reality (Belkhiri and
Dick 1988; eriard et aL. j.995). This phylogeneL.ic scheme, although incomplete, can now be compared v,/ith the pattern
of 55 rRNA gene family organization to see how sLable 55 gene family organizat.ion is, and to see whether the linked arrangement might be an ancestral or derived characteï. The most rel-iabl_e generalizat.ion about 5S gene arrangement in pythium is that species in Group 1A have linked 55 genes and that they are usually in t.he ,inverted, orientation (on the DNA strand opposite t.o t.he one carrying the other rRNA genes). Only 1 of the 40 species in thj-s 9l
group is known to have the ,non-invert.ed, orientat.ion (p. monospermum) . The orient.ation of the 55_1ike sequences for
P. apferoticum and p. EracheiphiTum have yet to be
determined if they are indeed non-inverted, since pCR
yielded no amplicons wit.h a1l_ available 5S primers test.ed.. There is no reason to attribut.e t.his possible shared character to a cfose refationship between t.he three
species, so it must be concfuded that 'inversion, of t.he 55 gene is an event t.hat occurs from time Lo time but that. there is a strong bias toward the 'inverted, orientation in Group l-4. This bias could be refated Lo some constraint in the mechanics of t.he system that. is responsible for 55 gene t.ranslocation, or it. could be t.he result of selection. The fact that t.he bias seems to work in the opposíte direction in Group 3 (p. oedochil_un et aJ.) suggests that gene ,frozen orient.ation may be a accident, wíth a 1ow probability of change. The apparent uniformity of the .non_ inverted, orientation in the stramenochromes afso support.s the st.abif ity of this character (Kawai et aL. 1997). ït is rare to find both orient.atíons in the same genus. The only cases so far are pythium (this report.) and Coprjnus
(Cassidy and pukkila l-987) .
Eight of Lhe species in Tables 1A and 1C are befieved to be close]y related t.o t.he pythiun species wit.h 92
f il-amentous sporangia even t.hough they have been described as having spherical sporangia or hyphal swellings (p. conidiophorum, p. drechsferii, p. scleroteichum, p. grandisporangium, and p. tracheiphiJum (Lévesque et af.
1999; A.W.A.M, de Cock, personal communication) . The phylogenetíc affinities of each of these species must stiff
be resofved, but if they are placed in Group 1A, their 55
gene family organízation (linked and most.ly inverted) would
be consístent with what is found in that group. The most interest.ing p. case is tracheiphj _Z u¡n. This species has both linked and unlinked 55 genes (Table 1C) . This would be the only case of a member of croup 1A having unlinked genes in t.andem. Thus, gene linkage in this major line of divergence is not completely uniform, but nearly so. The generalization Lhat pyLåjum species with globose sporangía t.end to have unlinked 55 genes is refiabfe (Table 1B) with severaf import.ant. qual.ifications. First., Group 3 should not be included in the generalization because this
group constitutes a separate phylogenetic branch as discussed above. Second, the group consisting of p. minus, p. P. pLeroticum, parvum,, p, niddfetonii, and .P, multisporum also unexpectedly has linked 55 genes. RFLP studies (de Cock, unpublished) and ITS sequences (de Cock et af. 1998; Lévesque et al . 1999) clearly indicate that 93
these species form a clade which does not include any oL.her species. Thus, the reversion to t.he linked 55 gene arrangement ín the ancestor of t.his group indicat.es t.hat such reversions occur in the course of evolution and that t.he new arrangement can be maintained in subsequent
divergence. The same event seems Lo have occurred for .P. acanthophoron, p. heterothajLicum, p. hypogynum, p. marsipium, P, perpf exum, and p. rostratun.
The schematic phylogeny of stramenopiles (Figure g) may be useful- in t.racing the evolut.ion of 55 gene family organization in this group. croups basal t.o pythium nave the linked arrangemenE with the exception of 2 out of 7 families of stramenochromes. The linked arrangement thus appears to be ancest.ral, but more extensive surveys of Oomycetes other than pythium shoufd be done to confirm this, It is also important t.o survey the remaining stramenopilous groups, the Hyphochytriomycetes (See Chapter 3), tne Labyrinthulids, the Thraus t ochytríds , and the bicosoecids.
The two major events involving 55 gene family organizat.ion may have occurred during the evolution of
PyEhium. One was the divergence of Group 2 from croup 3, when the 55 genes lost their linkage to the other rRNA 94
genes. The other major event. was the reversion t.o 1ínkage in Group 1A as i.t diverged from Group 18 and Group 2. There
were also three isolat.ed reversions within Group 2 involving 8 species out of 40 and there was one species in Group LA (P. tracheiphiLum), in which some of the 55 genes had become unlinked.
This study sought to fol1ow 55 IRNA gene family changes during the course of evoLution in a síng1e genus of
the stramenopiles. As expected, ít was found that the 55 famíly had undergone changes in gene linkage and in gene orientation in the course of speciation, but that dominant patterns within taxa could be easíly discerned, and these paL.terns could be mapped Eo a phylogenetic scheme wit.h
relatively few anomalies. Some of the anomalies may be relat.ed L.o the many Laxonomic problems st.ill out.standing in lhe genus. Our results are consistent with those obtained
f rom a survey of the s t.ramenochromes (Karn/ai j et a . , lggj l , which emphasized the stability of 55 gene family organization and which supported the idea that the linked arrangement is ancestral at. least for the stramenopíles, if not for all eukaryotes.
We can only speculate about the factors af fect.ing linking or unlínking of 55 genes. pure chance may be operat.j-ng, but ít is also possibLe t.hat predominant. 95
paE.terns are selected. Tn the case of pythium there is a rough association between sporangial form and gene linkage. The linked arrangement ís most predominantly found in species \,¡iLh filamentous sporangia, and the unlinked state is found in those wit.h spherical sporangia. Species with fifamentous sporangía also tend to live in an aquatic environment whife those with spherj.cal sporangía are found in more t.errestriaf environments in close association wit.h planL hosts. The former way of life may benefit from cfose linkage of al-1 its genes 'RNA while the latter ís more like íts plant hosts, where the 5s gene families are unlinked to the rDNA repeat. The two afternatives may affect the regulaLion of gror.dth differently at the leve1 of transcrípt.ion or that of ribosome assembly. Furt.her genet.ic / ecological ties need t.o be explored, especially among croup 1 pythiun species, where a major genetic and morphological divergence has apparenlly taken place. 96
Chapter 2 55 rRNA gene organization íí phyto¡.hëålora,
EaTopbytophthoîe I and other Oomycetes 97
TNTRODUCTION
55 rRNA gene organization has been welf documented within the Genus pythium (Belkhiri et af., L992, Chapter 1), but there have been few dat.a for phytophthora and other Oomycet.es (Rozek & Timberlake, 1,979; Howlett et af., L992;
BeLkhiri eE af. , 1-9921 . In generaf 55 genes are arranged in two ways, either t.hey are finked t.o t.he other rRNA genes (smal1 subunit, 5.8S, and large subunit) tfrat foïm the rDNA repeat unit, or they are found in 55 t.andem arrays dissociated from the rDNA repeat.
Î.n Pythium, over 90 different species have been examined so far and approximately 40% of t.hese were found to have línked 55 genes, whereas t.he others have unlinked 55 genes (Belkhirí et aJ., L992, ChapLer 1) . These unlinked 55 genes were shown to occur in 55 tandem arïays (Klassen
et af., 1996, Chapter 1) . Linkage of 55 genes has been detected in phytophthora, namely p. cinnamomi, p.
megasperma r p. vignae (HowfetL et af,, 1_992) and p. cr,r)tÕgea (Belkhiri et af. rg92l . Linkage of 55 genes with
rDNA \^¡as afso observed in ot.her Oomycetes such as AchJya ambisexuaJ-is (Rozek and Timberlake, 1979) , Ach|ya kTebsiana, Lagenidium giganteum, pachgetra chaunorhiza,
Verrucafvus fLavofaciens (Belkhiri et af., L992) and 98
Sa¡:roTegnia ferax (How]ett et a7., L992).
The purpose of this study is to examine 55 gene organization ín phyEophthora and relat.ed Oomycetes, using Southern hybridizations and pCR. We show Chat 55 gene organization is maíntained in a refatively non_random patt.ern. We also report that unlinkage of 55 genes has phytophEhora arisen in both arlð Hajophytophthora, as was previously pyEhiurn demonstrated in (Chapter 1) . 99
RESUIJTS Detection of 55 genes in the res by hybridization The tcs region of 45 species of phytophthora (5! isolates) , 9 HaTophytophthora species, and 19 other oomycet.e species was first amplified using the primers e
and P2, folfowed by Sout.hern hybridization with the 55 rRNA
gene probe to det.ermine linkage of the 55 gene to t.he rDNA repeat. The sizes of the e-p2 ampficons ranged from approximately 4 t.o 9 kb (Figures l-iA and liiA) . For Phytophthora and Halophytophthora isolates only, Lhe size ranged from 4 to 7 kb. The 55 rRNA gene probe hybridized phytophthora v/iL.h 39 out. of 43 specíes (45 out of 49 isolat.es), 3 out ot 6 HalophyEophthora species, and 16 of the 18 ot.her Oomycet.e species (Figures 1iB and liiB) (Tabfe 1) . Six specíes in t.otal_ failed to produce any e_p2 amplicon and therefore could not be incÌuded in the init.iaf 5s screening process by hybridization. The two varieties of P. crptogea both hybridized with the 55 gene probe, as did both variet.ies of p. porri, as welf as af l- three isolates
of P. palmivora, and the two isol_ates of p. syringrae. Four species of phytophthora (p. humicoJa, p insolita, p. quininea, and p. boehneriae), three species of HaTophyEophthora (H. epistomium, H. poJymorpåjca and IJ. spinosa var. Lobata) , Dictyuchus ,sterj_Z js , arrd. pach4etra 100
Fignrre 1. The presence of 55 sequences in the fGS as
detected by hybridization of the 55 probe to t.he e_p2
amplicon. i. Hybridization of t.he 55 probe to t.he e_p2
amplcons of the ÏDNA repeat t.o detect linkage of the 55
gene t.o the other rRNA genes of phytopht¡lora and HaTophytoph tJ:ora isolates. .ã,) pCR products of e_p2
amplification of genomic DNA of (CBS accession numbers
fof l-ow species names) : lane 2) p. palnivora 35g.59, lane 3)
P. mexicana 554.88, fane 4) p. nirabiLis 6.18.85, lane 5) empty, lane 6) p. neadii 219.99, lane T) p. cfandestina 347.86, fane 8) p. erythroseptica 12g.23, lane 9) p. cr)E)togea b. 468.81. lane tO) p. JaEeraLis 1,6g.42, lane i_1) P. phaseoTi 556.89, lane 14) p. iJ-icis 255.93, lane 15) p. capsici I28.23, lane 16) empty, lane 17) empt.y, l-ane 1g) p. sinensjs 557.88, lane 19) p. megakarya 23g.83, lane 20) p. spec. marine. 215.85, lane 2!) p. botryosa 5g1.69, lane 22) P. wignae 24L.j3, fane 231 p. cambivora 248.60, Iane 24) p. katsurae 587.85, lane 25) p. syringae 367.79, lane 26) empty, Iane 2'l) p. fz.agariae f. 209.46, lane 2gl p. crwtogea 113.19, fane 29) p. pafmivora 29g.29, Iane 30) p. citricofa 22!.88, Iane 3L) p. arecae 305.62, lane 34) HaJ-ophytophthora opercufata 24L.g3, lane 35) p. palmivora 236.30, lane 36) p. cactorum 1Og.09, lane 371 p. richardiae 240.30, lane 38) p. syrjngae L32.23, lane 39) p. humicola 101
200.81-, lane 40) p. iranica 3j4.j2, lane 41) p. citrophEhora 950.87, fane 42) p. cìnnamomi l-44.22, lane 43) empty, fane 44) empty, lane 45) p. boehmeriae 291,.29, lane 46) p. primuTae 2't5.74, lane 47) p. megasperma n. 402.72, lane 48) empty, lane 49) p. infestans 366.51, fane 50) p. heveae 296.29, lane 51) empty. The BRL 1Kb pfus Ladder was run j.n lanes 1, 1-2, 13, 32, 33 and 52. Ladder band sizes (from bottom) : 1.65, 2.00, 3. OO, 4.00, 5.00, 6.00, 7.00, 8.00, 9.00, 10.00 kb. B) Chemi luminescent autoradiograms of the gels shown in A) after blotting and hybridizatíon to
DIc-labefled 55 rRNA gene specific probe. r,anes 2_1,I , L4_ 31, and 34-51 were exposed. t.o X-ray fílm for 3 minutes. AB
kb
4.0-
2.0- 103
Figurê f. ii. Hybridization of t.he 55 probe to t.he e-p2 amplicons of the rDNA repeat of phytophthora, HaTophytophthora, and other Oomycet.es to detect linkage of
the 55 gene to the other rRNA genes. A) pCR product.s of e_
P2 amplification of genomic DNA of (CBS accession numbers
foflow species names) : lane 2) p, quininea 407.4g, lane 3)
P. Eentacufata 552.96, lane 4) p. tropicaLis 434.91_, l-ane 5) P. vignae 241 .73, lane 6) pJecEospira myriandra 523.8j, lane 7) empty/ lane 8) SaproTegnia parasitica 540.67, lane 9) SaproTegnia poTymorpha 61,8.97, fane IO) Saprofegnia unispora 213.35, lane 11) Thraustotheca cl-avata 343.33, lane 14) AchTya aquatica 103.67, lane j_5) Achlya sparrowii
L02.49, lane 76) ATbugo candida, lane 17) Aphanomyces iridis 524.87, fane LBI Apfanes androglmes 5.19.6j, fane 19)
ApTanopsis spinosa 1-1-2.6I , lane 2O) empty, lane 21) empty,
Iane 22) CalytraLegnia achTyoides 31-4. g1-, lane 23) Dictyuchus sEerifis 550.67, lane 24) HajophyEophthora bahamensis 586.85, lane 25) HaLophytophthora epistomium
590.85, lane 26) HaTophytophthora kandelii 1,LL.9!, Iane 271
HaTophytophthora po7\/morphica 690.84, lane 2g)
HaTophytophthora spinosa 58g.85, lane 29) empty, fane 30) empty, lane 31) Lagenidium caudaEum 594.95, lane 34) Lagenidiun giganteum 590.84, lane 35) LeptoJegnia caudata
680.69, lane 36) PachJ/meEra chaunorhiza 960,g1, lane 37) 104
Peronophythora fitchii 100.81, lane 3g) peronospora parasitica, fane 39) p. cam]>ivora 24g.60, lane 40) p. colocasiae 955.87, Ìane 41) p. drechsLeri 29L.35, Iane 42) empty, fane 43 1 p. idaei 97L95, 1ane 44) p. inso:ila 691-.79, lane 45) p. mefonis 582.69, lane 46) p. nicotianae
305.29, lane 47) p. pini IgL.2S, fane 48) p. porri B
L78.81 , lane 49l, p. porri B I79.97, fane 50) p. porri A 567 .81 , fane 5L) empty. The BRL 1 Kb pfus fadder was run in lanes 1, 12, L3, 32, 33 and 52. I-,adder band sizes (from bot.tom) : 1.00, L.65, 2.00, 3.00, 4.00, 5.00, 6.00, 7.00, 8.00, 9.00, 10.00 kb. B) Chemi luminescent autoradiograms of the gels shown in A) after blotting and hybridization to
Drc-labefled 5S rrìÀtA gene specific probe. Lanes 2_1L, L4_ 31, and 34-51 were exposed to X-ray fifm for 3 minutes. Il
kb
4.0 -
2.0
A B
kb
4.0
2.0
kb
4.0
2.0 106
TÀBIJE 1. Presence and absence of 55 ïRNA sequences in rDNA repeat of Phytophthora, Halophytophthora and other oomycet.e species
55 probe hvb¡idizes Q-N2 Q-Y3 N2-Y N2-Y3 55 gene Isoiateu starusb rá lcs PCR PCR PCR PCR o¡ientation'
Plt',ttoDhlltora qrecae CBS 305.62 NT + + N botr¡'osa çgg 5gt.Ut T + + N cactorwn /paeoniae CBS I 08.09 NT + + N canbivora CBS 248.60 T + + N capsici CBS 128.23 T + + N cituantonù CBS 144.22 T + + N citricola CBS 221.88 T + + N rop cit ht ho ra CBS 950.87 NT + + N colocasiae CBS 955.87 NT + N clandestina CBS 347 .86 T + + N cryptogea CBS l13.l9 T + + N cryplogea yat. áeg. CBS 468.81 T + + N drechsleri CBS 292.35 AU + + N e r y t lt s pt ro e ica CB S 129.23 T + N fragariae var. fru. CBS 209.46 AU + + N heveae CBS 296.29 T + + N idaei CBS 971.95 T + + ño N i/lc¡¡ CBS 255.93 NT + + N irtfestans CBS 366.51 NT + + N iranicq CBS 374.72 T + + N katsurae CBS 587 .85 T + + N lateralis CBS 168.42 T + + N nteadii CBS 219 .88 NT + + N negakaryø CBS 238.83 T + N nlegaspenna yal. nt. CBS 402.72 T + + N nelottis CBS 582.69 T + ño N ntexicqna CBS 554.88 NT + + N r¡iraáilrs CBS 678.85 T + + N tticotianae CBS 305.29 NT + *o N palnivora CBS 298.29 + + N palmivoru CBS 236.3O T + + N paltnivora CBS 358.59 + + N påøseo1i CBS 556.88 + + N pirri CBS 181.25 T + N porri A CBS 567.86 T + + N pani B CBS 178.87 + + N p s e u d o ts u g a e CBS 444.84 T ND + Nd s ier¡sls CBS 557.88 T + + N syriugae CBS 367 .79 N + + N .eùtaculara CBS 552.96 T + + ño N tropicalis CBS 434.91 T + ND N vignae CBS 241.73 AU + + ND prinulae N CBS 215.74 NT + syringae CBS 132.23 + (+)t 't 10'7
Porri B cBS 179.8'1
hunicola CBS 200.81 T- + U solita CBS i 691.79 ND U quíttitreø CBS 407 .48 T- + U boehneriae CBS 291.29 T- (+) (+) (+) ?N richardíae CBS 240.30 TND (+)++ ?N spec. naritte. CBS 215.84 -+ (+)++ 'tÃl Haloohvloohthora ba,l¡arn¿¡s¡s CBS 586.85 T + N kandelii CBS 111.91 NT + +- N operculata CBS 241.83 T + N epístoniun CBS 59O.85 T U po lynorphica CBS 680.84 T :1)Io U spitosa var. /oå. CBS 588.85 T ND U avicenniae CBS 188.85 NT ño -++ U b at en1 at n s rc i s CB S 67 9.84 T ND -++ U vesícula CBS 393.81 T ND .+ND U Other Oomvcetes
btgenidiunt caudatunt CBS 584.85 NDI giganteunt CBS 58O.84 NDI Peronopltytltora /l¡cl¡li CBS 100.81 ND Acltlyø aquatica CBS 103.67 T+ ND sparrov,ii CBS 102.49 T+ ND Aplnnomyces it'idis CBS 524.87 T ND Aplanes androgynes CBS 579.67 ND Aplanopsß spínosa CBS 112.67 ND Calyptrulegnia achlyoides CBS 314.81 (+) ND Peronospora parasitica ND
Plecîospirø ntyrianda CBS 523.87 (+) ND Søprolegnia parasitica CBS 54O.67 ND pol¡,morpha CBS 618.97 T ND 108
unispora CBS 213.35 ND
Tltrøustotlucø clavata CBS 343.33
AIbugo cattdida
Brevilegnia nacrospora CBS 732.37 ND
Dictyucltus s¡e¡l1ls CBS 550.67
Psch!ûrctra chaunorhiza CBS 960.87 ND
- cljs = accessi-on numbers of strains obtained from CentraaLbureau voor Schimmelcuf tures , Baarn, Netherlands. b T strain = from which the t]¡pe matérial was derived; AU = authentíc st.rain, identified by the author of the species; PN = strain used by van der plaats_Niterink for description of the species of the genus pytåjum; NT = strain desigrrated as neotl4)e because alL type material is missing; REP = represent.ative strain, no TypE, NEOTYPE, AU, or PN available, " I = inverted wit.h ïespect to other rRNA genes; N = non_ invert.ed with respect to other rRNA genes,. ? = orientation unknown with respect to other rRNA genes; U = unlinked with respect to other rRNA genes. d Results obtained from pCR amplifications onl_y, d.ue to no Q-P2 amplifícation product (s) as indicated by ND. " Linkage of 55 gene-like seguence detected by DNA_DNA hybridization only. pCR analysis did not yield positive results, therefore r orientat.ion has not been determined. PCR amplicon appeared. faint ge1 . s on Unknown orientation likely due to a failed e_y3 pCR reaction (Refer Lo p. porri CBS 178.g7 and CBS 567.86) ND = no data 109
chaunorhiza showed no hybridization. This absence suggests that there are no 55 genes or SS-fike sequences present in the IGS and that they are located elsewhere j.n the genome. Q-P2 PCR amplificat.ion sometimes resulted. in more than
one amplicon being produced. This lengt.h heterogeneíty had
afso been observed ín pyEhiun (Buchko and Kfassen, L990¡
Chapter 1) .
PCR amplification t'o confirm presence and orientat,ion of 55 gene(s)
In addition t.o hybridization, pCR anplification was used to confirm the presence and determine the orientation
of 55 gene(s) finked t.o the rGS, and in some cases Lo show evidence of linkage when amplification of the entire IcS (using Q and p2 primers) had faifed. These amplifications consisted of using e primer in pCR amplifícation in
combinat.ion v,¡ith either the N2 or y3 primers, as had been
previously used and described in Chapt.er 1 (Figures 2i and 2ii) . .Amplification with e-y3 indicates the noninverted
orient.ation and amplification with e_N2 indicates the ínverted orientation. e-N2 pCR amplification products of 1.6 to 2.0 kb were obtained from 2 species of phytophthora (P. primuJae CBS 275.74 and p. syringae CBS 132.23). e_y3 ampJ.icons of 1.0 to 2.3 kb were obt.ained from 41 species 110
Figure 2. Amplificat.íons to determine the location and orientation of 55 rRNA sequences in the IGS. í. pCR
product.s of Q-y3 and e-N2 amplification of genomic DNA from
Phytophthora and HaTophytophthora isolates. The CBS accession numbers foffows the species name. À) e_y3 pCR amplification of: lane 2) p. iLicis 255.93, lane 3) p.
capsici 128.23, lane 4') Ha jophytophthora batemanensis
619.84, lane 5) empty, lane 6) p. sjne¡sis 557.8g, fane 7) P. megakarya 238.83, lane 8) p. spec. marine. 215.g5, lane
9) P. botryo-ca 581.69, fane 10) p. vignae 24L.73, lane 11)
P. cambivora 248.60, lane 12) p. katsurae 587.85, lane 13)
P. syringae 367.j9, lane 14) p. palmivora 2gg.2g, fane 15)
P. citricofa 221-.88, lane 16) p. arecae 305.62, lane 17) Haf ophytophthora opercuJ-ata 24I.83, fane 1B) p. palmivora 236.30, lane 19) p. cactorum 108.09, 1ane, lane 22) p. heveae 296.29, fane 23) p. infestans 366.51, lane 241 p.
quininea 40'7.48, lane 25) p. megasperma m. 402.j2, 1ane 26)
P. primuTae 275.74, lane 2j\ p. boehmeriae 2g1_.2g, fane 29) P. porri A 567.86, fane 29) HaLophytophthora avicenniae L88.85, lane 30) p. cinnamomi 1_44.22, Iane 31) p.
citrophthora 950.87, lane 32\ p. iranica 374.72, lane 33)
P. crptogea Lt3 .19, lane 34) p. f ragariae f . 2Og.46, f ane p. 35) pseudotsugae 444.84, lane 36) p. humicofa 2OO.8L, lane 37) P. syringae 1,32.23, lane 38) p. richardiae 240.30, 111
lane 39) P. paTmivora 358.59, lane 42\ p. mexicana 554.g8, lane 43) P. nirabifis 678.85, fane 44) p. drechsferi 291-.35, l-ane 45) p. meadii 2L9.gg, lane 46) p. cjandestina 347.86, lane 47) p. erythroseptica t2g.23, lane 4Bl p.
crptogea b. 468.81, lane 49) p. faterajis L6g.42, lane 50)
P. phaseoJi 556.88. B) e-N2 pCR amplification of: fanes 1_ 40 same order as in A) , lane 41) p. mexicana 554.gg, fane
42) p. mirabiLis 678.95, lane 431 p. drechsferi 291,.35, lane 44) P. meadii 219.A8, lane 45) p. cLandestina 34j.86, p. lane 46) erythroseptica L29.23, fane 41 ) p. cryptogea b. 468.81-, lane 48) p. jaterajis l-6g.42, Iane 49) p. phaseoli
556.88. The BRL 1Kb plus ladder l^¡as run in Lanes 1, 20, zL, 4U, 4t ancl 50- kb
2.O
1.0 113
Figure 2. ii. pCR products of e-y3 and e_N2 amplification
of genomic DNA from phyEophthoîa, Halophytophthora anð, other Oomycetes. The accession numbers follows the species name. à) Q-y3 pCR amplificat.ion of: lane 2l AchTya aquatica
L03.61 , lane 3) AchJya sparrowii 1_02.4g, lane 4) ATbugo
candida, lane 5) Aphanomyces iridis 524.g.1, lane 6) ApTanes androgynes 579.67, lane 7l ApTanopsis spinosa 112.61-, lane 8) empty, lane 9) empty, lane 10) CajyEnafegnia achTyoides
3L4.8L, lane 11) Dictyuchus sterifis 550.67, lane 12)
HaTophytophthora bahamensjs 5g6.g5, Lane 13)
HaTophytophthora epistomium 590.g5, lane 14) Haf ophytophthora kandeJii III.91, fane !5) HaJophytophthora poTlmorphica 680.84, fane !61 HaTophytophthora sp:nosa 1. 588.85, lane 17) empty. lane 1g) empty, fane 19) Lagenidium caudaEum 584.85, Iane 22) Lagenidium giganteum 5g0.g4, lane 23) LeptoTegnia caudata 680.69, lane 24) pachymetra chaunorhiza 960.91 , lane 251 peronophythora fitchjj 100.g1, lane 26) peronospora parasitica, l..ane 2,7) p. cambivora 248.60, lane 281 p. colocasiae 955.87, fane 29) p. drechsferi 29L.35, fane 30) empty, fane 31) p. idaei 97L.95, lane 321 p. insoLita 69L.79, Ìane 33) p. mefonis 582.69, lane 34) p. nicotianae 305.29, lane 35) p. pini 181,.25, p. lane 36) porri B 1,jg.Bj, fane 37) p. porri B
L'79.87, lane 38) p. porri A 561 .87, lane 39) empty. l-ane It4
42) P. quininea 407.48, fane 43) p. tentacufaEa 552.96, lane 44) P. tropicafis 434.91, lane 45) p. vignae 24j..13, lane 46) PJectospira myriandra 523.81 , lane 4?) empty, lane 48) Saprofegnia parasiEica 540.67, fane 49) Saprojegnia polltmorpha 61,8.97, lane 50) Saprofegnia unispora 2L3.35,
fane 51) Thraustotheca cfavata 343.33. B) e_N2 pCR
amplification of: lanes 1-40 same order as in a) , fane 41)
P. mexicana 554.88, lane 42) p. nirabijis 6Tg.85, lane 43)
P. drechsl_eri 29L.35. lane 441 p. meadji 2Lg.gg, lane 45) P. cfandestina 34't.86, fane 461 p. erythroseptica J.29.23, lane 47) P. crwtoqea b. 468.g1, lane 4gl p. JateraLis 1,68.42, lane 49) p. phaseoTi 556.89. The BRL 1Kb plus ladder was run in lanes L, 20, 2L, 40,41 and 51.
i16
(47 isolates) of phytophthora, indicat.ing a non_inverted oríentation, íncluding the two species t.hat. afso amplified when usíng the e-N2 primer pair. Amplification with both primer paírs implies both inverLed and noninverted orientation. This anomaly will be considered in the discussion. Another p. syrìngae isolate (CBS 367.79), that has been designated as the neot]¡pe culture, only amplified \,,¡i th and Q-Y3 not e-N2 as did another isol-at.e of -P. syringae (CBS 132.23). None of the other 40 species
amplified with e-N2. Only three species of phytophthora (p. humicofa, p insofita, and p. quininea\ fail-ed to amplify
with either e-N2 or e-y3 primer pairs. Therefore the non_ invert.ed orient.ation is dominant amorrg phylophthora species with finked 55 genes. For the eight species of HaTophytophthora, none amplified wit.h the primer pair e_N2 and three (H, bahamensis, H. kandeLii, and ¡f. opercufata) amplified ü/it.h e-y3. The remainíng five HaLophytophthora species did not amplify with either primer pair combination. We found that for 16 out of 19 other oomycete species examined., neíther the e_N2 noï e_y3 pCR amplifícat.ion at.tempts produced any amplicons, despite their Q-p2 amplicon hybridizing wit.h the 55 gene probe. The only exceptions were Lagenidium caudatum and Lagenidium giganteum, of which borh ampfified rdith e_N2 (1.5 kb) , bur 117
neither wit.h e-y3 (indicating an inverted 5S gene) and PeronophyEhora fitchii which amplifíed wirh e_y3 (1.5 kb) , but noE. with e-N2 (indicating a non_invert.ed 55 gene) .
The presence of t.andem arrays of 55 genes was i-nvestigated by gene to gene amplification using the primer paír N2 and y, and at t.imes wíth t.he primer pair N2 and y3. It ís expect.ed that all species with unlinked 55 genes
should amplify \n/ith these primers, and if not, ít may be that t.he 55 primers are not specifíc enough for some of the more distantfy related Oomycetes or that t.heir 55 genes are dispersed throughout t.he genome. For the phytophthora species whose e-p2 amplícon (s) did not. hybridíze with Lhe 55 gene probe (p. humicola, p. insoLita, p. quininea, p. boehmeriae, and p. richardiae), all of them amplified wíth N2-Y, as welf wít.h N2-y3 when used (Tabfe 1) (Figures 3iA, 3iB, and 3ii). ¡'or E:he HaLophytophthora species with unfinked 55 genes (H. epistomium, H. poJymorphica, H. spinosa var, fobata, H. avicenniae, H, batemanensis, and JJ. vesicufa) all amplified wit.h N2-y, except for ¡J. polymorphica and ¡f. spinosa var. fobata in which we were unabfe t.o detect t.he presence of any 55 tandem arrays, ATbugo candida, BreviJegnia macîospora, Dictyuchus steriJ-is, and Pachlzmetra chaunorhiza were afso found to have unlinked 55 genes. The N2-y and N2_y3 products 118
Figure 3. Amplifications t.o determine whether there is
gene-to-gene amplification due t.o the presence of tandem
arrays in t.he IGS. i. pCR products of N2-y and N2_y3
amplification of genomic DNA of phytophtl:ora and HalophyEophËhora isolat.es. cBS accession numbers forlow the species names. A) N2-y pCR amplification of: lane 2) p.
ificis 255.93, lane 3) p. capsici L28.23, lane 4)
HaTophytophthora batemanensis 679.g4, l-ane 5) empLy, l-ane
6l P. sinensjs 557.88, lane 7l p. megakarya 238.g3, lane 8) P. spec. marine. 215.85, lane 9) p. botryosa 5g1.69, fane 10) P. vignae 241. .'13, lane 11) p. cambivora 24g.60, lane 12) p. katsurae 587.95, lane 1-3) p. syringae 367.79, Iane p. I4l palmivora 298.29, lane 15) p. ciEricoLa 221_.88, lane L6) P. arecae 305.62, fane 17) HalophyEophthora opercufata 24L.83, lane 18) .P. palmivora 236.30, lane 1-9) p. cactorum 108.09, Iane 22) p. heveae 296.29, lane 23) p. infesEans
366.51, lane 24) p. quininea 401 .48, lane 25) p. megasperma n. 402.'72, Iane 26) p. primuJae 275.j4, Iane 27) p. boehmeriae 29L.29, lane 29) p. porri S6j.g6, fane 29)
HalophyEophthora awicennjae 1gg.g5, lane 3O) p. cinnamomj L44.22, lane 31) p. citrophthora 950.87, lane 32) p. iranica 37 4.72, lane 33 ) p. crptogea 113 . 19, lane 34) p. fragariae f. 209.46, lane 35) p. pseud.otsugae 444.84, Iane p. 36) humicola 2OO.81 , Ìane 37) p. syringae I32.23, lane 119
38) p. richardiae 240.30, l-ane 39) p. paTmivora 358.59,
lane 41) p. mexicana 554.89, Iane 42) p. nirabil-is 6Tg.g5, lane 43\ p. drechsferi 291.35, lane 44) p. meadii 2L9.Bg, fane 45) P. cfandestina 3 4.1 .g6, lane 461 p. erythrosepEica L29 .23, f ane 47 ) p. crptogea b. 468. 81, lane 4e) p. faterafis 168.42, lane 49) p. phaseoli 556.88. The BRL 1 Kb PÌus ladder was run in fanes 1_, 20, 2L, 40 and 50. B) N2_y3 PCR ampfifícat.ion of: fanes 1-40 same ordeï as in A) , Iane p. 42) mexicana 554.88, lane 43 ) p. nirabilis 61g.85, fane 44\ P. drechsLeri 291_.35, lane 4Sl p. meadii 2!g.gg, tane 46) P. cLandesEina 34j.96, lane 47) p. erythroseptica
L29.23, fane 481 p. crptogea b. 468.81, lane 491 p. lateraLis 1-68.42, p. lane 50) phaseoli 556.gg. The BRL 1 KB Plus fadder was run ín lanes L, 20, 2j_ and, 40. kb
1.0
0.5 T2I
Fí$¡re 3. ii. PCR products of N2-Y ampl-ification of genomic
DNA of Phytophthora, Halophytophthora and other Oomycetes
(CBS accession numbers foflow species names): lane 2) AchLya aquaEica 103.6'1 , lane 3l AchLya sparrowii 702.49, lane 4) Albugo candida, lane 5) Aphanomyces iridis 52A.9't, lane 6) Apfanes androgynes 579.61 , lane 7) ApTanopsis
spinosa 1,L2 .61,, f ane I ) empEy, lane 9 ) empty, lane l-0 )
CafpEraTegnia achJyoides 3l-4 . 81, lane 1Ll Dictyuchus sEeriTis 550.67, lane t2) HaTophytophthora bahamensis 586.85, fane L3| HaTophytophEhora epistomium 590.85, lane
L4l HaTophytophthora kandeLii LL!.91,, lane 15)
HaTophytophthora poTltmorphica 680.84, lane 16) Haf ophytophthora spinosa 1. 588.85, fane l-7) empty, lane L8) HaTophytophthora vesicuja 393.81, lane 19) Lagenidium caudatum 584.85, Iane 221 Lagenidium giganteum 580.84, lane 23) LeptoJegnia caudata 680.69, fane 241 pachymetra chaunorhiza 960.81 , lane 25) peronophyEhora Jitchii 10O.gl-, lane 26) Peronospora parasitica -, fane 2j) p. cambivora 248.60, lane 28) P. colocasiae 955.87, fane 29]l p. drechsleri 29!.35, lane 30) empty, lane 31) p. idaei
911-.95 , lane 32 ) p. insoTit.a 691-.19 , lane 33') p. nef onis 582.69, l-ane 34) p. nicotianae 305.29, lane 35) p. pini
181-.25, lane 36) p. porri B 178.87, lane 3j) p. porri B L19.81 , l-ane 38) .F,. porri A 56j.91, lane 39) empty, lane 122
42) p. quininea 407.48, l-ane 43) p. tentacuLata 552.96, lane 44) P. tropicaTis 434.91, lane 45) p. vignae 24f .j3, lane 46) PTectospira myriandra 523.87, lane 47) empty, Iane 48) SaproTegnia parasitica 540.67, fane 49) Saprojegnia poTymorpha 61-8.91 , fane 50) SaproTegnia unispora 21-3.35,
lane 51) Thraustotheca cfavata 343.33. The BRL j. Kb plus ladder was run in lanes 1, 20, 2L, 40, 41- and 52. lt 124 ranged from 0.35 to 0.85 kb in size. 125
DISCUSSION
Tn this study we have broadened our 55 rRNA gene
family organization survey to ínclude the Genera Phytophthora and Halophytophthora, genera that are closely
related Eo Pythium. We have chosen type cultures when
avaifable or authentic cultures to provide the most
accurate picture possible and to minimize E.he numlcer of misident.ified isofates. This was also done for
HafophyEopthora and t.he other oomycete species examined.
The phylogeny of phyEophthora has been examined by
sequence comparison in the D2 domain of E.he 2gS rRNA gene
(Briard et af., L995), but most ext.ensivefy in the ITS regions (l.,ee and Taylor, 1992; Cooke and Duncan, L99T;
Lévesque et af,, L999; Först.er et af., 2OOO; Cooke et aL.,
2000) . The erection of t.he cenus ¡fa_Zophytophthora (Ho and Jong, L990) is conL.roversial . HaTophyEophtåora differs from Phytophthora primaríly in ít.s sa1t. tolerance. rt is uncertain if this character is enough to faunch a new genus. According to the fTS sequence data, HaLophytophthora species are díspersed amongst severaf different. clades within Phytophthora and pythium (Lévesque et af., 1,ggg). For our purpose in this survey of 55 gene family organization, we wil-l consider HaTophytophthora simply as a division of the cenus påyLophthora. 126
Unlike Pythium, which can be subdivided int.o three major branches accordj.ng to C.he predominant 55 gene organizat.ion patterns, i.e. tinked and inverted 5S genes (Group 1), unfinked 55 genes (Group 2), and finked and non- inverted 55 genes (Group 3) (See Chapter L), phytophthora may be considered as an extension of pythiun Group 3, which will be described in detait below. We also have found some cases of unlinked 55 genes in thís group. We have shown that the majority of species of
Phytophthora have E.heir 55 genes 1ínked to t.he rDNA repeat in the non-inverted orientation (Tab1e 1) . This also confirms the results of Howlet.t et a7. (1992) who first demonstrated by Sout.hern hybridizat.ion and pCR that. p. vignae, P. cinnamomi, and P. megasperma have 1ínked and non-inverted 55 genes with respect to the rDNA repeat. The opposite situation was observed in pythiun, where linked 55 genes in most species occurred. in the 'inverted, orientatíon (Befkhirí et a7., 1-992; Chapter 1) . Onfy a sma11 group of relat.ed pyËhiums (Group 3) shared the 'non- inverted' orient.ation wiLln phythophEhora. Other evidence has linked some of the Gïoup 3 pythiums with the Genus Phytophthora. The strongest. support. is the molecular phylogeny of Pythium ar]d phytophthora, based on ITS sequences/ which shows t.hat Group 3 pythiums form a cLade 127
that is cfoser Lo PhyEophthora than Eo pythium (Lévesque et a7., 1-999). Work done by panavières et af. (I99j) demonstrated that some species of pythium, i.e. pythium
oedochifum arrrd Pythium vexans, produce elicitins (small holoproteins) that are characteristic of phytophthora, whereas most Pytårum species do not produce these proteins. The only anomaly was that Pythiun marsipium also produced these efícitins, yet ITS sequences have shown that pythium
marsipium is distanE. from both the Group 3 pythiuns and PhyEophEhora (Lévesque et af., 1-999). Elicitin production is an important character in phytophthora taxonomy but it is not l-imited Lo that genus as previously befieved, and there is at least one case ín pythium (p. marsipiun) , outside of the Group 3 pythiums, demonstrating t.his. However, elicitin production is st.il-1 an important character that. Links Group 3 pyEhium arrd phytophthora species t.ogether. It \^rou f d be ínt.eresting to see if all Group 3 Pythiuns produce elicitins.
Unlinked 55 genes were shown to occur in only 12 out. of 54 species of PhytophEhora and Halophytophthora, and in only four of the other Oomycetes examined in this survey
(Figures 3i and 3ii) . rn addit.ion to having unfinked 55 genes, P. boehmeriae, P. richardiae, and .P. spec, marine. were afso shown to have the linked and non-invert.ed 55 (or 128
5S-1ike) gene arrangement common to the majority of
Phytophthoras. Although most speci.es predominant.ly have linked 55 genes, it may be acknowledged that cases of unlinked 55 rRNA genes do occur in phyEophthora (and HalophytopEhora ) as was previously shown ín pythium (Belkhiri et af., L992; Chapter 1).
We described 55 gene orientation in Chapter l- as a 'frozen accident' with a low probability of change. This hypothesis is now further reinforced with the findings that 5S gene orientation in Phytophthora is highly conserved. Onfy two anomalíes were present for the entire genus, those being P. primuJae CPS 2'15.74 and p. syringae CBS 1-32.23, which amplified with both the Q-y3 and e-N2 primer pair combinations (Figures 2i and 2ii) . we cannot draw concfusions as to why both primer combinat.ions fed to pCR amplicons in the expect.ed size range \,,¡ithout sequencing the IGS region. The purpose of this study was to broaden our survey of 55 rRNA gene organizat.ion outside the genus pyËhjum, This has result.ed in a nearly compfete picture of 55 gene arrangement ín Phytophtåora and HaTophytophthora, which are most. closely relaLed Lo pyEhiun. Figure 4 shows the schematic phylogeny of the stramenopiles and the evolution of 55 gene family organization withín this group, It also 129
ilfustrates the dominant pattern of 55 gene arrangement in Phytophthora ar,d Hafophytophthoîa and shows t.hat there are few inconsistencies. These results agree with the overall scheme that. 55 gene family organization is diverse yet. relatively stabl-e within the stramenopiles. As described in
Chapter 1 and further demonstrated here, the linkage of 55
genes is domínant and ancestral for phytophthora and.
HafophytophEhora, as wefl as numerous other Oomycet.es. The reason why species have devefoped unlinked 55 genes wit.hin the Pythiaceae must be further examined, perhaps by
exploring the effects of ecological adaptation on 5S gene organization and amplification. Unlinked tand.em arrays of 55 genes may be an evolutionary adaptat.ion which enables enhanced growth and proliferation since Lhis arrangement is present in most eukaryotic organisms. In the línked arrangement it is possible that the close proximity of aÌl four rj-bosomaf RNA genes could cause an overall reduction in transcript.ion due to interfeïence between RNA poll¡merase f and RNA pollanerase III The ïate of 55 IRNA gene transcription may serve as the limitj.ng fact.or in ribosome synthesis, and therefore the growth rate of an organism wit.h linked 5S genes would be restrict.ed. fn the unfinked arrangement, RNA pofl¡merase III would be unobstructed by RNA pofl¡merase f, and this would permit t.he unrestricted 130
Fi$rre 4. Schemat.ic phyfogeny of stramenopiles and summary of 55 gene family arrangement. The tree represents topology only. The groups enclosed i-n grey boxes are discussed in t.he text. Broken lines in the tree indicate predominance of the unlinked 55 gene family arrangement. Number posit.ions in rDNA map: L-N, number of species (or families for
s tramenochromes ) with finked 55 genes in the noninverted orientation; L-I number of species (famílies) with linked 55 genes in the inverted orient.ation; U, number of species
(famifies) with unfinked 55 genes in tandem arrays. The asterisk índicat.es that the species with unlinked 5S genes afso have linked 55 genes. The solid boxes represent the dominant form, Lhe shaded boxes indicat.e rare forms, and the open boxes índicat.e absence of the form. Data from 1) Bel-khiri et af., L992, 2) HowleLE et aL., 1992, 3) chaprer
3, 4) Kawai et aJ., 1997. r¡ m m 1.
pMophthonlz l r 5 ., f .38 n rr Fl 3 tlo - and lrr-- - n r,t n3. -'1 - lrL Ti ¡ 1" .'/ /a HatopMophthon I-¡å-..'I I r 16 w::,ffiî;,];:;" rr-*-.- ¡ i-l n9(3) P'thialesl r r I? ¡ ¡ n0 oomycetesl,2 Al;z€.---I n n | 2 (2,) \ Peronosporales l- ¡ r¡ 1* ¡ l-l n 1. - 3" - HyphocMr¡ds3 -{+----r \ Saprotegniatesl,2 r ? 1t r nni:l 2 Stramenochromes4 I ¡5 faml aI ¡2fam. \ \ L]ofam \ and -,¡rro \ -{;-r \ \ -{#- rllU Sclerosporalesl -{*----I Tìn-l1* 132 transcription of 55 genes. Furt.her ïesearch involving the measurement of cellufar levefs of 55 RNA and ribosome synthesis is needed Lo confirm a correLation between unlinked 55 gene transcripE.ion and. faster growth rates. 133
CIIAPTER 3 5S rRNÀ genê organization in H¡¡phochytriomycetes 134
INTRODUCTION
55 rRNA gene family organizatíon has been surveyed very broadly wít.hin the stramenopíles. All major
phot.ot.rophic groups within this kíngdom (s E.ramenochromes ) have been investigated (Kawai et af, L997) and among the non-photot.rophic groups, the Oomycetes have been widely surveyed/ wit.h special attention to pytåj um and PhytophEhora (Rozek and Timberlake 1979; Belkhirj. et af.
1-992; Howlet.t et a_Z . L992; Chapters 1 and 2 ) . The predominant pattern is one in which the 55 gene is linked to the rDNA repeat, but. in some stïamenochrome lineages
(Baci l lariophyceae and Synurophyceae ) , a sma11 number of Phytophthora species, and j_n roughly half the pythium species/ the 55 genes are unlinked to the ïDNA repeat and are found in t.andem arrays elsewhere (Kawai et a7, !997 ¡ Be]khiri eE aL. 1992; Befkhiri eL a7. 1,997\. The linked arrangement may represent the ancestraf state and unlinking and tandemi zaLion may have occurred occasíona11y in the course of st.ramenopile divergence. To confirm this idea, more sister taxa shoufd be invest.igated, The HyphochytriomyceLes have been shown to be closely refated to the Oomycetes on the basís of rRNA sequences (Van de
Auwera L995; Van de Peer et af. 1996) and morphological and physiologícal characters (FuJ.1er 1990) . The two species of hyphochytrids invest.igated in this work represene two of the three famiLies of hyphochytrids and are virtually the only species availabfe for genetic investigation at the present time (Fuller 1990 ) . 136
RESUIJTS
Testing for the presence of 55 gene(s) linked with the other rRNA genes was done by first amptifying the intergenic spacer (IGS) region of the rDNA repeat using the
primer pair Q-P2, followed by hybridization of the pCR
product. (s) with the 55 gene probe (Klassen eË al . L996) (See Figure 1 for prímer annealíng sit.es in t.he rDNA repeat
unit) . Amplíficatíon of Rhizidiomyces apophysatus artð, Hwhochy|rium catenoides DNA produced e-p2 amplicons of approximately 4.0, 4.8, 5.6, 6.4 kb and 3.5, 4.4, 5.0, 7.0 kb respectivefy (Fígure 2A) . The 55 gene hybridized to afl
Q-P2 amplicons of both R. apophysatus and .Ff . catenoides, as well as to the positive controls phytophthora cryptogea and Pythium oedochifum, but not. to the negative control pythium paddicum (Figure 28) .
5S rRNA gene orientation and position was determined. by attempt.ed Q-y3 and e-N2 pCR amplificat.ions. The N2 and
Y3 primer sites are conserved regions in funct.ional 55 genes. Q-Y3 amplícons of 1.45 kb were obt.ained from bot.h R. apophysatus and H. catenoides, but neither species produced
Q-N2 amplicons (data not shown) . This indicates that the 55 gene in t.he two species is located on the same strand as the other rRNA genes in the 'non-inverted, orientation. It also serves to locate L.he gene at 1.45 kb downstream of the Fígure 1. Primer sites in the rDNA unit. LSTRNA - large subuniL rRNA gene, SSTRNA - smaff subunit rRNA gene, 55
55 rRNA gene . N2 Y3
LSTRNA 55 SSTRNA IGS I t39
Fí$lre 2. Hybridization of the 55 rRNA gene probe to the fGS of the rDNA repeat to detect linkage of the 55 gene to the ot.her rRNA genes. À) pCR products of e-p2 amplifícation
of genomic DNA of: lane L, phytophthora cryptogea JMLO;
lane 2, Pythium oedochifun CBS 292.37; lane 3, pythiun
paddicum CBS 698.83; Lane 4, BRL 1Kb pfus ladder; lane 5, R. apophysaEus P.F'296; fane 6, H. catenoides. F,R2L7. Ladder band sizes (from botto¡n) : 0.85, 1.00, l-.65, 2.00, 3.00,
4.00, 5.00, 6.00, 1.00, 8.00, 9.00, 10.00 kb. B) Chemi luminescent exposure of the gef shown in A) after blotting and hybridization to DIc-l-abef Led 55 rRNA gene probe. Lanes 1-3 were exposed to X-ray film for 1min, and lanes5and6for5min. AB 1234 561234 56 141
Q primer site, which is about 1.2 kb downstream of the 3'
end of the LSTRNA gene. The possì-b1e existence of tandem arrays of 55 genes in
the IGS of the rDNA repeats of R. apophysatus and ¡t. catenoides was tested for by attempted gene-t.o-gene
amplification usíng 55 gene-specific primers N2 and y3 as
wel-l as SL and SR and using purified e-p2 products as t.he
template. Amplification of both species with Che N2-y3 primer pair resulted in 120 bp products, t.he length of a single 55 gene. No products were obtained. from att.empted
SL-SR amplifícation, consistent. with the absence of 5S gene tandem arrays within the IGS (Figure 3, lanes 1-4). This indicat.es that bot.h R. apophysatus and H. catenoides have single 55 genes which occur once per rDNA repeat. unit. (linked) and are coded on the same DNA strand as the other rRNA genes ( 'non- ínverLed, ) .
Even t.hough presumably funct.ional 55 rRNA genes have been found in Lhe IGS of the rDNA repeat. of both specíes of Hyphochytrids, the existence of other 55 genes or pseudogenes in tandem arrays elsewhere in t.he genome is a possibility. To search for such arrays, gene-to-gene amplifications using N2-y3 and SL-SR primer pair amplifications were attempted with genomic DNA as the template (Fígure 3, lanes 5,6). For R, apophysatus, the r42
Figrure 3. Amplifications Eo fi.nd arrays of t.andem repeats of 55 rRNA genes. Lanes 1 and 2: Attempted gene-to-gene
amplification wíth primer pair SL-SR, using t.he e-p2 amplicon as the template. Lanes 1-, R. apophysa tus BR 296;
Lane 2 , H. catenoides BR27'l; Lanes 3 and 4: Amplif ication with primer pair N2-Y3, using e-p2 as the templaLe. Lane 3,
R. apophysatus BR 296; Lane 4, H. catenoides P,F'2L7. Lanes 5 and 6: Amplificat.ion wit.h SL-SR, using genomíc DNA as the tempfate. Lane 5, R. apophysa tus BR 296; Lane 6, H. catenoides B.R2L1 . L = BRL 1 kb+ ladder. Band sizes, from bottom: 0.1, 0.2, 0.3, 0.4, 0.5, 0.65, 0.85, 1.0, 1.65, 2.0, 3.0 kb. L123456L 144
results were identical to those obtained when e-p2 was used as the template. There is thus no reason t.o believe that unfinked 55 gene arrays exist in the genome. Foï ¡Í.
catenoides, however, abundant 450 bp and faint 10OO bp products were obtained wíth SL-SR. These aïe the predicted products for gene-to-gene amplification for two adjacent genes (450 bp spacer) and for the dimer (2 -450 bp spacers + 120 bp 55 gene) . These results were confírmed by amplification with the N2-y3 primer pair, which prod.uced predicted gene-to-gene products in addit.ion to the expected intragenic 120 bp amplicon (data not' shown) . Thus ä. catenoides appears t.o have an unfinked array of 55 genes ín addit.ion to t.he single 55 gene in the IGS. t45
DISCUSSTON
Two isofates of hyphochytrids from different genera were invest.igated with respect to their 55 IRNA gene family organizat.íon. Both were found to have theír 55 genes linked to Lhe ÏDNA repeat.. In addition, H. catenoides also contained an unfinked Landem array of 55 genes. Afthough two isofates are an inadequate sample of the phylum Hyphochytriomycota, the number of characterized isoLates is very sma11, and the number that can be routinefy cuftured even smafler (FuIler 1990 ) . The linked arrangement of 55 genes is also found in most. familíes of stramenochromes (Kawai et aJ. 1997) and in most Oomycetes, but roughly half of pythium species have the unlinked arrangement, with tandem arïays elsewhere in the genome (Belkhiri et aJ-. 1_992'). The discovery of linked 55 genes in bot.h hyphochyt.rids supports the idea that the linked condition j.s ancestral for non-phototrophic stramenopiles and that the unfinked tandem repeats seen in marry Pythium species were derived from the finked condition as t.he result of chance or selection. The occurrence of unfinked 55 genes in H. caEenoides alongside the linked 55 genes is noL unprecedented in that we have observed the same condition in pythium osEracodes arrd pythium tracheiphiTum (Chapter 1). For H. caEenoides, all of the 55 146
primers tested so far recognize the sequences, so there is
no reason to befieve that. the 55 sequences are noE functíonal. Furt.her work is required to determine whether
both linked and unfinked 55 sequences are t.ranscribed. The existence of both types of 55 gene farnily organization in the same organism supports the idea that l inking /unl inking
events occur in the course of hyphochyt.rid evol-ution as
they do for stramenochromes and Oomycetes.
The finked 55 rRNA genes of R. apophysa¿us and IJ.
catenoides were found to be transcribed from t.he same strand as the other rRNA genes. This is consistent wíth what was found for s t.ramenochromes (Kawii et af, 1997), but wít.hin t.he oomycetes, the gene, when linked to the rDNA repeat/ can be on either st.rand (Belkhiri et af. L992). AE this time we believe L.hat lit.tle taxonomic significance should be given to 55 gene orientation in the
Hyphochytriomycetes, although it ís by no means random. The position of the gene, about a kilobase downstream of the LSTRNA gene, is very similar to t.he positíons of linked genes in the Oomycet.es (Belkhiri et a.7. . L992) .
In the course of 55 gene family charac teri zation, a st.riking characteristic of the int.ergenic spacer (fcs) of the ÏDNA repeat was also observed.. Amplification of the fGS produced mult.ip1e amplicons from both h1æhochytrids. All r47
amplicons hybridized to the 55 gene probe and thus appear to be alternate versions of the IGS. The sizes of the amplicons form an incremental series with the increment for R. apophysatus beíng 0.8 kb, and for H, catenoides being 0.7 kb. This was int.erpreted to mean that the IGS cont.ains
variable numbers of subrepeats of 0.8 and 0. T kb
respectively. A similar sít.uation was reported for t.he
oomycete Pythium uJtimum, although the subrepeat.s \arere less than half as long as those seen in the hyphochyt.rids (Buchko and Klassen 1990). This tlæe of length heterogeneity in the IGS is conÌmon in plant.s and animals and may now be consídered to be an occasíona1 characteristic of stramenopiles as wel-l_. 148
Chapter 4
Characterization of a 55 rRNÀ pseudogene found in the intergeníc spacer of. pythiam ìrregruTate 149
TNTRODUCTION
The complexity of 55 rRNA gene family organization in the Genus Pythiun has been well examined. Belkhiri et af. (1992) demonstrated the presence of two major 55 gene
organizaLional patterns in pyChjum. The first pattern was t.hat species with filamentous sporangia tend Lo have their 55 genes 1ínked to the other ribosomal genes within the
ribosomaf DNA (rDNA) repeat unit. These 55 genes were found to be coded on t.he DNA strand opposíte to t.hat of the other rRNA genes. The second patt.ern was that species of
Pythium with globose sporangia (or hyphal swellíngs) Eended to have their 55 genes unlinked to the rDNA repeat.. Instead, their 55 genes were found in tandem arrays elsewhere in the genome (Kfassen et af., 1996; Chapter 1) . In PyEhium irreguTare, t.he species examined in t.his study, no 55 genes had been found within the IGS (Belkhiri et aJ., L997). As in the case of other globose sporangíal-type species of Pythiun, Pythium irreguLare was shown to have it.s 55 genes l.ocated in tandem arrays at other genomic regions unlinked to the rDNA repeat unit. (Belkhírí et aJ.,
1992; Belkhiri et a7., 1997) .
55 ÏRNA pseudogenes or gene variants have been found in t.he genomes of a number of different organisms. 55 pseudogenes have been found in Xenopus Laevis, occurríng 150
adjacent to each functional 55 gene in a tandem array (.facq
eE a7., 197'7; Korn and Brown, L978). Other organisms where 55 gene variants have also been descrj-bed in tandem arrays
of functional 55 genes include NotophthaJmus (Kay and Gal1,
l-981-), CaTTiphora (Rubacha et af., 1-994) arLd pythium (Befkhiri et aL., 1996¡ Belkhiri et af. L99.t). rn p. irregulare a pseudogene was díscovered duríng the
charac teri zat ion of a tandem array of 55 genes, The
pseudogene occurred at the 3, -end of the tand.em array of
nine 55 genes and spacer regions. In addition, .P. pachycaule, a specíes wit.h filamentous sporangia, was found
to contaj.n a linked 55 pseudogene located directly upsLream of the functional 55 gene wíthin t.he IGS region of each rDNA repeat unit (Belkhiri. et aL., 1_995). A number of 55 gene variants occur in the ascomycetes ¡ ln Neurospora (Selker et af ., l-981a) and in espergiJlus (Bartnik et af., 1986; Gniadkowski et al ., 1997) t.he 55 genes are dispersed, most.ly as single units, throughout. the genome. Most intensively examined were t.he 55 gene variants in Neurospora crassa (Selker et aj., 1981a; Selker et aj.,
1981b; Sefker et aJ-., l-985) . A heavily mer.hylared 55 pseudogene discovered in N. crassa contained a t.ransposable element inactivated by repeat.-induced point mutaL.ion (Margolin et aJ.., l-998) . Other cases of t.ransposable 151 element insertion have not been found.
In t.his study \,re wiff describe the discovery and characterí zation of a híghly divergent SS-fike sequence which is likely to be a 55 rRNA pseudogene within the IGS region of the plant pat.hogen pyEhium irreguTare. This is the first report of the presence of a SS-fike sequence within the IGS of an organism whose functional 55 genes are found to occur in tandem arrays not finked to the rDNA repeat. 152
RESULTS
PCR .ãmplif ication of the IGS in p. ÍrreguTare fnitial evidence for the exi-stence of a 5S-fike
sequence within the rGS of p. irregul.are was discovered by PCR and DNA hybridization. The p. irreguLare IGS was first.
PCR amplified with the Q and P2 prímer pair using genomic DNA as a template. The amplicon produced was approximately
5.2 kb in size (Figure l-A) . After Southern bfotting. the e- P2 product was hybridized t.o the 55 gene probe. After extended (75 min) exposure to X-ray fi1m, a posit.ive signal was observed (Figure 18) .
Restríction end.onuclease digestion and 5S gene hybrídization to the P. irregruTare IcS In order to find the hybridizing regíon within the
IGS, t.he Q-P2 PCR amplicon was digested with HincII , HinfI , HpaIl , arrd TaqI. The fragments produced ranged in size from 200 to 2000 bp (Figure 2A) . The gels were Southern blotted and hybridized to the 55 gene probe (Figure 28) . Hybridization of the 55 probe to the HincII and JJinfI digested Q-P2 amplicon revealed fragments with approximate sizes of 1-970 bp and 100 bp, respectiveJ.y. HpaIf digestion and hybrídization of the ïcS fragments with the probe revealed a fragment of approxímately 1700 bp. The ïcS "aq.I i53
Fígure 1. À. Amplification of int.ergenic spacer of. pythium irreguTare using Q and p2 prímers. Lane L = Gibco BRL 1 Kb p. Pfus standard ladder. Lane 1 = irregulare (CBS 25o.2gl .
B. Southern bfotting and hybridízation to DIc-labetled 55 rRNA gene probe of gel shown in A. The hybridized bfot was exposed t.o x-ray fifm for 75 minutes, f.r¡f¡glf¡.Þ o o ooo ct W:r¡rtt 155
Figure 2. À. Restriction endonuclease digest.íons of the e-
P2 amplicon from Pythium irceguJare (CBS 250.28). Lanes L = Gibco 1 Kb Plus standard ÐNA fadder; fane 1 = HincII¡ lane 2 = HinfI; lane 3 = HpaI; lane 4 = TaqI. B.
Hybridization resufts of Fig. 2A t.o the 55 gene probe. D = DNA moLecular weighL. marker VI DIc-Labefed. LD'l 2 3 4
bp
2000 - 1650 -
1000 - 850 -
650 -
500 -
400 -
300 -
200 -
bp
2't76 - 1766 -
1230 - 1033 -
653 - 517 - 453 - 394 - 298 - 234 -
154 - 15,1
digest and hybridization revealed a fragment. of about 650 bp in size.
The 650 bp TaqI fragmenE. that hybridized wíth the 55
probe was sefected as the best candidate for cloning and sequencing, due to its relatively sma11 size. The ?aqI digest of the Q-P2 PCR product. was repeated and. upon closer examination of the rest.rj-ction digest, ít was observed that in fact that there v,¡as a cluster of three fragment.s present
in close proximity, between 650 and 6?0 bp (Figure 3A) .
Fragment. 1 was approximately 670 bp, fragment 2
approximately 660 bp, and fragment. 3 approximat.ely 650 bp in size. The ge1 containing these fragments was then
Southern blot.ted and hybridized wit.h the 5S probe. Exposure to X-ray fifm reveal_ed that only fragmenE.s 1 and 2 hybridized with the probe (Figure 38) .
Cloning of IeS U'aqf fragments into BLuegcript plasmíd
Fragments l and 2 were cloned into Bluescript. and amplifíed ín ø. coTi competent cells as described in the Materials and Methods section. An X-gal/IpTG screening system was used to detect potential clones. Thirty-eight potent.ial cfones were obt.ained. plasmid DNA from these clones was extracted, efectrophoresed and Southern bfotted onto a nylon membrane. The plasmid DNA on L.he membrane was 158
Figrure 3. À. Purifed TaqI restrict.ion dígest fragments from the Q-P2 amplicon of P. irreguTare. Lane L = Gíbco BRL 1 Kb Pfus standard ladder; lane 1 = purified fragment. 1 (610 bp) ; lane 2 = purified fragment 2 (660 bp) ; fane 3 = purified fragment 3 (650 bp) . ¡. Hybridízation of the gel sho\^¡n in Fig. 3A with the 55 gene probe.
160
hybridized with the 55 probe in order to det.ect which of
the plasmids contained the desired insert. One plasmid out of the 38 screened hybridized to the 55 probe. This plasmid (Pl-24) contaíned fragment 2 DNA, as det.ermined by size comparison on a ge1.
Sequence characterízation of the pI2A inEert
The insert in the recombinant plasmì_d pI2A was
sequenced in both directions using the primers T3 and T7. These primer sites occur on either side of the ,9rfI restriction site, the síte for ligat.ion of the insert. The resultant sequence, a total of 639 bases, was compared with t.he known 55 rRNA gene sequence ín pythium (Wal_ker and Doolit.tle, 1982) (Figure 4). Using the cene RurÌner version 3.00 computer software (Hast.ings Software Ìnc., 1994), it was determíned that there was a 59-nucleot.ide sequence which showed 81.48 homology to part of t.he 55 gene. The 5,- end of this homofogous region resides 263 nucleotides downstream of t.he 5,-end of the cLoned 639 base fragment. The sequence was also aligned wit.h the sequence of the known 55 pseudogene (C13A3) existing at the end of the tandem array of 55 genes described by Belkhiri eE af. (1997) in P. irreguTare 8R486. No region of pI2A insert exhibited significanE. homology with the 55 pseudogene 161
Figrure 4. DNA sequence of the pI2A insert, which is a TagI fragment. of Lhe int.ergenic spacer of pythium irreguJare (CBS 250.28) . The central 150 bases of sequenced fragment
(nt 251-400) were aligned with sequence of the known 55
gene (and partial flanking regions) and the sequence of a 55 pseudogene found at t.he end of the 55 tand.em array in Pythium irreguTare 8R486 (C13A3) (Befkhiri et af., L991 ). Legend: blue = plasmid; light green = SrfI restrict.ion
sit.e; purple = GA repeats; green = CA repeat.s; orange = GT repeats; red = shared sequence identity of pI2A, or pC13A3, and known 55 rRNA gene. (5'->3') Pl-asmid Insert 1 GT A,UU\NCNGGAGCTCAGGGCGCGGT GCCCCGTCTAGCCCCGAAÄACATA
51 GGTGCAC.N,CCCTGAGAACACTCTGAACCATTCATTTTTGAGCTCå,GGAAG
101 CGAGAAACAÄÃATGT GATAT T T GGCT CGGAA.AGTAATAGGAACGG GAAAG
151 TCATACTCGGCGCAAGTGTATTGTGGTTGTGAGAGTGATGGTGTGTTTTT
20L TGIGTÄATTGG6TTGATGGGTTTTATTGTGTGATGATAGTGAAATAGGAG
5s 5S+fIank GAGCAGTTGAACACTAGTAGÃ,CGGCCATCTTAGGCTGAGAACACCGTATC Pcl.3A3 GAGCAGT TGAACACTAGTÀGACGGCCÀTCTGAGGCTGAGA.å,CACC -TATG 251, TCAAGAGCATAG gCCGGTACCGATTTCCCGGTGGCTCACTGGGAGAGCGT
5S+flenk -CCGTTCGCTCTcCcÃl\cTTAÀGCJ|GCCTCåA--GCTCcccTAGTACTCccG pC13A3 TCCGATGACGCGCTCTCGATCTCGACCCTCAACGGCTCGAGTAGCA---AcjA 301 TTGGTACGCGTTTTGAAGTTåÀGCAGCCTTTT--GCTCGGGCAGTACTCGGG
5S+f]-ank TGGGTGÃ,CCACCGGGGÃÀGTCCGAGTGCTGTCTACTCTTTTCTCTTTTTC pC13A3 TCTCT---cÀccCAGCA-GCCCCAAÀGCTcGAAAGAATCCGCTCCTGCTG 351 TGGGTGACTCCÀTAAACATTTTTTGCGCGCACÀAGGCAA.AÃCTGGCTTTT
401 AGAATAGTCTGTGEGGCAGGTTTATATTTGTGGTGGCGCACACACÃCACA
451 C C GI]CÀCAC GTCACACATTTGCGCACCGCGATATC.âGCATATTCACGCGC
5 01- GCTATGC TATTT GAGÀGAGAGACACACATACACACATACACAGAGAGAGA
GAGAGTTATC C GTCACACGTCACACÃ.TCAGTACå,CACGCATACAGCAGCA
60 r- TATTCACÃTGCACACACACAGCGAACACCTTCCACAACGAATCTTT.AAAT Plasmid 651 TGATA.ACAAAGCA.A.ATGCGCAAGTGATCGGGGCGGATCCCCCGGGCTGCA
10L GGAÄTTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCG
'15L GAACCCAATTCGCCCCTATAGTGAGTCGTATTACGCGCTCTCACTGGGCC t63
contained within C1343.
The upstream and downstream flanking regions of the 55 gene show soÍ'.e interest.ing non-random sequence patterns
with respect to simple repeats. The doublet GT ís in great.
excess in the region beginning with base 165 (Figure 4) and ending near the S,-end of the 55 gene and then agaín from
the 3'-end of the gene to base 434. IL appears that Lhe
gene ís embedded in a region rich in GT doublets which sometimes form short. microsatellites. After base 434, there is an abrupt change to a reÌatívely long sequence (bases 440-636) in which the complementary doublet (CA) is in excess. The doubfet GA is also in excess in both of these sequences, forming two microsatelfites (bases 5L3-522, 543- 554) ín the downstream flanking region.
Determinatíon of orientatíon of insert and location of 55- like sequence in IcS of p. ÍtreguLaîe In order t.o determine t.he orientat.íon of the SS-like sequence wíthin t.he IGS, primers were d.esigned that corresponded to a 15 bp nucleotide sequence wit.hin t.he 55_ like sequence (Figure 4) . pCR amplification of p. irreguJare genomic DNA was carried out using primer paír e and N5 and prímer pair e and N5C. If the 5s-like sequence was located on t.he same DNA strand. as t.he other rRNA genes, 164
then primer pair Q-N5C would produce the amplicon. Afternatívely, if the 5S-1ike sequence was locaL.ed. on the opposiLe DNA strand as the ot.her rRNA genes, then primer pair Q-N5 will produce the amplicon. After amplification
and efectrophoresis of PCR products, we found L.hat primer pair Q-N5 produced an arnplicon of approximately 1-.6 kb in
size, whife primer pair Q-N5C produced none. Hence, it was concluded that the 5S-1ike sequence was coded on the opposite DNA strand with respect to the rDNA repeat unit., i.e. in the 'inverE.ed, orientation, Given the fact that the Q primer is located approximately 250 bp upstream from the 3'-end of the LSTRNA gene, it was determined t.hat the 55- like sequence occurs at about 1.35 kb downstream from the 3'-end of the LSTRNA gene, and in the inverted orient.ation.
Fuüther clraracterizat,ion of Èhe IGS region ín p. írregrulare Further sequencj.ng of the fGS was done in oïder to further evaluat.e and characL.erize portions of the IGS-1 region (the sequence between the LSTRNA gene and 55 pseudogene) . This part of the IGS region of p. irreguJare was PCR amplified using primers e and N5, then purifíed for DNA sequencing. Sequencing from the e primer resulted in approximat.e),y 250 bp of sequence of the LSTRNA gene (3,- end) , and an addit.ional_ 350 bp of IGS sequence (Fiqure 5) . 165
When this region was aligned with the same region in .P. ultimum (Buchko PhD thesis, l-996), ít was found that the
3'-end of the LSTRNA gene was weff conserved. There were
relatívely few base pair differences between the two LSTRNA
sequences (15 out of 285 bases). Sequence homology between
P. irreguTare and P. uftimum extended 25 bp beyond what was
previously befieved Lo be the 3,-end of the LSTRNA gene in P. uftimum. Beyond this point there is no furL.her
sígnificant homology and it is 1ikely that. the gene ends
just. before homology is lost. This means that. the fGS
regíon begins at this point and not 25 bp upstream, as previously indicated by Buchko (phD thesis, t9g6) . analysis of the rRNA transcript is needed to confírm this.
PoeEible 5S-1ike EeçIuences ín other pythíum species To see whether other pyË¡ljum species wit.h globose sporangia also contain 5S-fike sequences not det.ected by hybridization experiments similar to the one in p. irreguTare, Q-N5 and e-N5C pCR amplification was attempt.ed on t.en oLher PyEhium species (Figure 6). Six pythiun species examined produced an amplicon with the primer pair Q-N5 (P. mamiTlatum, p, paroecandrum, p. spinosum, p. macrosporun, P, tracheiphiTun, and .P, hydnosporum) and not wit.h prímer pair Q-N5C, whereas only p, oedochifum prod.uced Figrure 5. DNA sequence alignment and comparison of .P. irreguJare (CBS 250.28) and P. ufEimum (BR47l-) DNA sequences; beginning at. the Q primer in the IJSTRNA gene, and cont.inuing inL.o IGS-1. P. iÍÍegufare CCTCTAÀGTC AGA-ATCC-T P. uftimun ...... A. l------Q------> I
20 GCTGGAAT_G ACGATAÂT_A CCTTTCCTGA TGTACCGCGA ATAGCGATAG ...,....4. ,...... C.
ATGTCCTTTG GTCATCCA.AC ATCATÄ.AAÀ.T TGCGACGCAC TCACATTGCC .....T..,. .c...... A...... c......
r20 TGACAAGTGT TGGTAGTGGA GAGTATGCTG AATTGTAÄTT ...... 4. c...... TCAÄÄTATTG
1?0 GGA.AÄ.GATAA ATCCTTTGTA GACGACTTA.A ATACAGA.ACG GGGTGTTGTA
220 AGCATGAGAG TAGTCTTGTA ....c... CTACGATCTG CTGAGATTTA GCCCTTGTTC
21O TATTGATTTG TTCAGA.A.ATG ÀA,CATTTCTC CCCCCTCCAÄ TACATA.ATGA ...... TTTC...... A. . CTACC ATATACGTCT ---LSTRNA---> I ---IcS--->
320 TCGTCTGCTC CCCTCCCCCC ATCGTGTTGC TTTCTTGCAG CACTCCCTAT ACTCCCCCCT ATATGAGGAT TTCTATACTA TCATACÎATC ATATACTAGC
370 AAT,A.AATGCT ACACTCGCGC A.AAGCGGCTG TGGTATCGCA TACTAATATA CCGCACCGCC TAGGCGCCTG CTGGCAÀAÄ.G GTTCCTTACC TTCGCGCGCG
42O CGCGCCGAGA GGCGTGCAÂG GCTCTTTACT TTCGCA-AÄGT GAGAGTGCGA TGTCGAGTCC ATTTTTATTT TAGCGCTGGT AÄATACGGCA AGTGTTTTGT
4'7O AAGTTGACTT CTGCGCA¡.GC GGTTGTTCTT TCGTTCTCÄA TCTTTACTGG TGTATTGGGC TTTCGGTTCC TTTTCAGTTT GCTGA-AÃ,AAG CACCAAGTCA
52O TGTTGTGAÂT GTTAACAGTG TGGAGACTTT GTTTTTGTTG TTGTTGTGTG TTTTGCTGTT ATAGTTGGCT CGGCCTTTGC GTTCCTTTTC GGCA.ACGAÄA
5-IO GATTTGGTGC AAGTCTATTT CGCTGTATGA ACAGTATCGG GTTTGTTTGG A.AGCACC,AAG TCATTTCGCT ATTATA.A.CTG GCTCGGCTTT CGGTTCCTTT
620 GTTTGTTTAT GAGAÀAATTG GACC TCGGCAÄ.CGA A.AAAGCACCA AGTC r68
Figrure 5. QN-5 and Q-N5C PCR amplificat.ion of genomic DNA from a set of Pythium species. À. e-N5 pCR amplificat.ions.
L = 1 Kb plus DNA ladder; lane 1 = p. narnmiTa Lum CBS 25L.28; fane 2 = P. paroecandrum CBS 157.64; lane 3 = p. spinosum CBS 275.67; lane 4 = P, macrosporum CBS 574.80; lane 5 = P. macrosporum CBS 575.80; lane 6 = p. anandrum
CBS 258.31; fane 7 = P. EracheiphiTum CBS 323.65¡ fane 8 =
P. amasculinul?? CBS 552.88; fane 9 = p. hydnosporum CBS
253.60; lane 10 = P. oJigandrum CBS 382.34; lane L1_ = p. oedochiLum CBS 292.37; lane L2 = p. irreguJare CBS 250.28.
B. Q-N5C PCR amplifications. Order of lanes is the same as listed in Fig . 6Ã,. L 1 2 3 4 5 6 7 I I 10 11 12
kb
1.0
I 2 3 4 5 6 7 I I 10 11 12
kb
1.6 1_0 a Q-N5C PCR amplicon but no Q-N5 amplicon. P. anandrum, amascufinum, and P, oTigandrum failed to amplifiy using e j-ther primer pair . 1'71
DISCUSSION
Functional 55 rRNA genes have not. been found linked to the rDNA repeat in PyEhiun irreguTare (Befkhiri et aJ., L992) . They are located in t.andem arrays efsewhere in the
genome¡ and in one case at. least, the array also contains a 55-like sequence which is so divergent from t.he sequence of t.he known 55 gene, that ít is reasonably safe to refer to
it as a pseudogene (Belkhiri et aL., I99't). The same arrangement is also found in species closely refated to p. irreguTare and others which have globose sporangia or hyphal swellings. The present study demonst.rates that in addition to the tandem repeats of functional genes, the t]T)e culture of P. irreguTare also has a highly diverged SS-like sequence linked to the ïDNA repeat in a position and orient.ation very similar to Ehat found for the functionaL, linked 55 rRNA gene in most species of pythium with filamentous sporangia, A similar 55-1ike sequence also appears to be present in the IGS of species closely relat.ed
Lo P. irreguJare (P. mammifatum, p. paroecandrum, and, p. spinosum) as welf as other species with globose sporangia or hyphal swellings that are more distantly related (p. macrosporum, P. EracheiphiTun, and .P. hydnosporum\ . Þ,rt exhaustíve survey of af l_ possíb1e pythium species has not. been done, but from the resufts obt.ained thus far, it is 112
Iike1y that the presence of SS-like sequences in the IGS is common in species of Pythium which have functj.onaf 55 genes in arrays unfinked to Lhe IGS. These sequences were missed in an earlier hybridizat.ion survey (Belkhiri et af., t99l-) presumably because the t.arget is highly diverged and. autorad.iogram exposure times were not long enough to reveaf faint s ignal s .
The SS-like (5S') sequence had diverged from the known 55 gene sequence in Pythium irreguJare in a non-random fashion (Wafker and Doolit.tIe, 1-982; Befkhiri et af., L99'l) . When the insert was a1ígned with the 55 rRNA gene sequence/ 62 of L}:e 118 positions were found to be identical (52.8U ) . Sequence símilarity was found t.o be very low at both the 5'- and 3,-ends of 55,, whereas the central region of 59 bp (positions 37-96, was relat.ively homologous, wíth sequence simifarity calcufat.ed at gl-.4?. It is interest.ing that the centraf core of 55, has diverged at a lower rate, since transcription initiation occurs ín that central region. If thís pseud.ogene is not expressed, there woufd have been no reason to maintaín the sequence of this region in preference to the 5, and 3, ends. When comparíng the secondary RNA stïucture between a functional
55 gene, based on the Xenopus Taevis model (pieler and 173
Theunissen, 1993) and the predicted 55, variant in p. irreguTare (Figure ?), we see that several changes that. woufd affect Lhe funct.ion of the core region in 55, have indeed taken place, specifically in ,box A, and 'box C,. Piefer et af. (1987) demonstrated ín Xenopus that t.he 'box A' and 'box C' regions play key rofes in t.ranscript.ion regufat.ion. There are no base changes in the sequence of
'box A' in 55', but there are four noncompensat. íng base changes in helix C and loop b. These changes greaLfy affect the predicted secondary st.ructure of loop b, and would likely prevent the binding of TFIII t.o the 'box A' region
(Piefer et af., L987). Similarly in .box C, Lhere are no base changes in the sequence it.self , but looking at the predicted secondary struct.ure of 55,, we find four noncompensating base changes affecting both heLix E and, to a lesser extent, loop e. This change drastically shortens helix E and expands t.he síze of loop d. Based on t.hese resufLs it is to be expected that this 55 gene varianL. is a pseudogene and that. the product, if any, would not be functional . When 55, was aligned \,7ith the 55 pseudogene (pcl-343) described by Betkhiri et aL. (1,99i) , only 33I homology (39 out. of 118 positions) was found. As we1f, there was no region(s) that. showed a noteworthy amounL of sequence simj-larity, nor was there any obvious nonrandom 174
FígR¡re 7. Top: Secondary structure model for the 55 rRNA of P. irreguTare showing loops a, b, c, d, and e, and helices A, B, C, D, and E. Put.ative regufatory regions for transcription ('box A' and 'box C) are labefed in red. They are analogous to those in X. Taevis. Bottom: Folding of potent.ial product of the 55, pseudogene. Asterisks indicat.e base substitut.ions wíth respect to the functionaf 55 gene, and t.he '> ' s]¡mbol indicates an insert.ion. C 'box A' B D E ,oo* c, ocu AAc ..c- c AA u c c-119-y99999 eGun n,no^ u v9ç9 9V o f9999 0 9y999 :, u- " AUcc-cA ucccA-uuc,,rr cocccucI ccccc " : G^ -Aeen-C G AAU ¡ G CCC^U clA"U ^CCA- cG G.C G.U . c.G A A.u G.C A.U U.A
cG ce .: 'A , .^A"^uAc' G G ', "yy"^AA^ ol9 ùii9-'"g99" nggu o, : " o"vg "fgggu o " T, ,qcçâs-f99Ç.l9¡6uceeu-sTg"!yvvv'.r^.o , o ov4"ç., "on ,U.G .A G. A:3 ";. 'ccAA' U.A GG. 5' 3' t76 disLribution of differences between the two pseudogenes to indicate that they may have at one time had element.s belonging to Che same 55 sequence. The 55 pseudogene (55,) of p. irregulare is located in the IGS about 1,4 kb dovrnstream of the LSTRNA gene. This is the same focation at whích the functionaf 55 gene is found in species of Pythiun which have this gene ín the IGR. The linked 55 gene is always found 1.35-1.75 kb downstream of the 3'-end of the ITSTRNA gene. This similar position wit.hin the IGS for functional genes and for the p. irreguTare pseudogene, leads us t.o hl4)othesize that in p. irreguJare t.he creation of tandem arrays of funct.ional 55 genes unlinked to rDNA may have allowed t.he linked 55 gene t.o diverge as the functional genes in the t.andem arrays became responsible for 55 rRNA productj-on. perhaps during 55 gene evofution in P. irreguJare (and many otheï pyEhium species), the unfinkage and tandemízation of 55 genes was advantageous in some way, resuf t.ing in the foss of function of the l-inked form. The unlinkage of 55 genes may be an adaptat.ion that releases ribosome synthesis from a growth_ limiting condition associated with finked 55 genes . pythium species wit.h unfinked 55 genes are, in general , more adapted to terrest.rial habit.ats and have a faster growth raLe than Pythiun species that. have finked 55 genes and 177 remain in t.he aquatic habitat.s. It is possible that this faster growth rate may be relaLed to the unlinking of 55 genes, and this may provide an ecological reason as to why this mode of evolution of 55 genes took place.
Examinat.ion of sequences flanking the 5S-Iike sequence in P. irregu-7.are revealed the pïesence of an excess of GT, AC, and GA doubfets upstream and downst.ream of the sequence. The sequence itseff seemed to be embedded in a region of GT excess. Adjacent repetitions of t.he doublets gave rise to a number of microsatelliLe arrays wit.h two t.o six repeats. BeLkhiri (phD Thesis, 1994) observed similar simple sequences in t.he intergenic regions that separat.e tandem 55 genes (5S TGS) of p. uJ-timu¡n and p, spinosum, where CA repeats were found near the 5,-end and GT repeats at the 3'-end. This pattern of simple sequences was not. observed in the 55 IGS of. p. irreguJare, however (Belkhiri et af., 1-997\. Furt.her analysis of t.he regions flanking 55 genes in oL]ner Pythium species ís needed to d.etermine whet.her this situation is corTunon within the genus. If it is, this may add further support to an understanding of how 55 gene ffow occurs wit.hin the genome. perhaps t.he observed simple sequence in pythium functions as site of recombination to allow for faster homogenization of 5S rRNA genes in tandem arrays. The microsatel l i te-rích region may 178
be prone to crossing-over and/or gene conversion evenEs, as for other such regions (CharlesworE.h et af., 1-994\. This
could afso explain why t.he centraf portion of the 55 pseudogene of. P. irregu-Zare described here was welf conserved. The 5'-end of the IGS was afso sequenced (329
bp), but no simífar microsatef f i te -rich region was observed. The gene regions that were sequenced afso did not have microsatellites. ft has been shown that microsat.ef l-ites of various
lengths aríse due to strand slippage occurring during DNA
replication (Schfötterer and Tautz, 1992¡ revíewed by
Charfesworth et af., 1-9941 . It has also been suggest.ed that strand slippage alone may not be enough to expfain the distríbution of simple sequence motifs, and addítional factors determining the dist.ribution of these motifs may play a ro1e, depending on the taxonomic group examined
(TóEh et al ., 2000). Neverthel-ess, it is widely accepted. that. strand slippage is a key mechanism in the amplificat.ion and dist.ribut.ion of microsatelfites. fn the strand slippage hypothesis, it is unknovrn whether t.he presence of the dinucleoEíde repeats, surrounding the 5S pseudogene ín P. irregu-Zare rcs, would have helped play a role in the unlinkage of 55 genes from the rDNA repeat. If we look at the possibii.ities of unequal crossing over or 179
gene conversion evenLs occurring in t.he amplifj-cation and dist.ribution of simple sequences (reviewed by Charlesworth et af., 1-994), their mode of action may have importance in
helping us to explain the movemen t of the 55 gene throughout the genome, If an event such as gene conversion took p1ace, the presence of these microsatelfite 'artefacts' woufd provide a cfue of the 55 gene being amplified and distributed elsehrhere in the genome. This viewpoint could provide some additional support in helping to explain how the 55 gene became unfinked and tandemized ín P. irregufare.
DNA sequencing downstream of the LSTRNA gene (approximately 350 bp) did not uncover any significant. amount of simpJ.e sequence. But the sequence did provide some new useful j-nformation with respect. to the precise location of t.he S,-end of the IcS. By comparing the
sequences begínning from the e primer within the 3, -end of the IJSTRNA gene of p, irreguJare with the previously
sequenced homologous region in p. ujtimum (J. Buchko phD Lhesís, 1,9961 , we h¡ere able t.o determine more accuraLely
t.he most likely focation of the 3'-end of t.he LSTRNA gene in PyEhiun and the point. at which t.he rGS begins.
PCR amplification using t.he e-N5 and e-N5C primer pairs with other species of pythium revisít.ed in the 180 discovery of other possible 5S-like sequences focated in the rcs region. This is not surprísing. DNA fingerprinting reveafed that P. irreguJare is closely refated to p. mamiffatum, P. paroecandrum, and p. spinosum (M. Balcerzak MSc t.hesis, 1998) Previous pCR and hybridization data indicatíng the presence of 5S-1ike sequence in the IGS already exist.ed f.or P. tracheiphiTum (See Chapter 1), and the Q-N5 amplicon provídes further confirmation. p. oedochiTum served as a positj_ve controf for e-N5C, since it. is known to have a linked 55 gene in the non-inverted orientat.ion (See Chapt.er 1). p. amasculinum, p. hydnospoz:um, and P, oTigandrum have identical DNA fingerprints (.A,. Schurko, personal communicatj.on) ; yet only P. hydnosporum had a e-N5 amplícon of the expected size.
Further experiments, such as DNA sequencing of the IGS region, wilf have be completed t.o account for this inconsistency, but. will provide further informat.ion to the sLory of the evofution of the 55 rRNA gene family. 181
CONCIJUSIONS
The main goal of this study was Eo investigate the evolution of the 55 rRNA multigene family in stramenopiles. Earlier work had revealed that at least two very different patterns of 55 gene family organizat.ion exísted in a single
oomyceLe genus, Pythìum, and that. some members of the 55
family were diverged 55-like sequences that could safely be
cal1ed pseudogenes (Belkhiri et af., L992; Belkhiri and
j_99'l Kfassen, 1996; Belkhiri et a1., ) . To get a greater understanding of 55 gene evolut.ion in stramenopiles, a nearly exhaust.ive study of 55 gene family
organization was conducted for pythiun arrd. phytophthora ln order to assess the stabil_ity of organizationaL patL.erns and to get an idea of possible mechanisms of change. The study was extended beyond pythium ar¡d phytophthora Lo est.ablish E.he general patt.ern for Oomycetes, and beyond Oomycet.es to hyphochytrids to try to det.ermine the possible ancestral form of the 55 gene family for the entire stramenopile kingdom.
The main generalizations t.hat emerge from this study are as folfows. First, studies of pythium ar]d phytophEhora indicate that 55 gene family organization can change dramatical-ly during speciation, but thaE large clades of r82 species are homogeneous with respect to organizational features such as u/hether the 5S genes are Linked or unlinked to the rDNA repeat. and whet.her the linked genes are inverted wit.h respect to the other rRNA genes, or noninverted. Linked genes are always at about t.he same focation in the IGS, and unlinked genes are always in tandem arrays with about the same sized spacer between them. This stability of pattern may indicate that. naLural selectíon is at work and t.hat changes in 55 gene family organization are not random. Ecological differences between aquatic species of Pythium and terrestrial ones may correlate with 55 gene family organization because both realities may relat.e to t.he growE.h rat.e of t.he organisms.
The second insight. following from thís study has to do with the possible mechanism of change \,/ithin the 55 gene family duríng evofution, The presence of putat.ive pseudogenes in a number of pythium species, linked to the rDNA repeat, indicat.es that species wíth unLinked tandem arrays of 55 genes may at one time have had linked genes which have now diverged. The presence of simple sequence tracts in the region where finked 55 genes are always found. may be a clue to the hist.ory of gene excísion or insertion from or int.o this region. The unexpected díscovery of tandem arrays of 55 genes or SS-Like sequences within the 183
IGS of a number of Pythium specíes further hefps to explain 55 gene family change. The existence of repetitive regions great.ly increases the 1íkelihood that homologous recombination is at work in rearrangíng this gene family. Fina11y, the broader survey of 55 gene family organization, which included two h]¡phochytrids, strongLy supports the idea that the ancestral state of 55 gene family organization ín stramenopiles was t.he linked
arrangemenL, and t.hat unlinking and t.andemization of 5S genes has occurred from time to time in the history of the st.ramenopiles. This conclusion is support.ed by published
data on the stramenopilous algae (Kawai et af., tggll ,
Perhaps episodes of 55 gene unlinkage were associat.ed. with major ecological changes or with adaptations t.o ne\¡, hosts. The data made available by this sLudy may form the basis for further evofutionary st.udies of this kínd. t84
ÀPPENDICES Appendix 1 r86
Tabfe 1. Eukaryotic organisms in which t.he 55 ÏRNA genes are linked to the rDNA repeat unít.
Orient.ation* Re f erence PlantE
Marchant ia Sone et al.. poTymorpha (199e ) ( l iverwort ) Sone et al.. Funaria hygrometrica ( 1999 ) (moss)
Basidiornycetes
Agaricus bisporus Pukkifa & Cassidy
(1987 )
ArmiTTaria spp. Duchesne & Änderson (1990) Coprinus Pukkila & Cassidy atramentarius (1987 ) Coprinus cinereus Pukkila & Cassidy (1987 ) Coprinus comatus Pukkila & Cassidy (L987 \ Coprinus micaceus Pukkífa & Cassidy ( 1987 ) Ffammulina veTutipes Pukkila & Cassidy (19e'7 ) Puccinia graminis Kim et a-2. (1992\ Tiffetia caries zerucha et af. (1992)
TiJ-Jetia cont roversa Zerucha eE al . (L992\
Ascomyqetes 187
Candida aTbicans + Magee et a-2. (1987 )
Candida gJabraEa + Magee eË al.. (L981 )
Candida + Magee et a-1 . guiTTiermondii (1987 )
Candida steffa|oidea + Magee et a-l . (1987 )
Candida tropicaTis + Magee eË aJ. (1987 )
HansenuTa wingei ? Verbeet et af. (1984)
Kluywermyces factis ? Verbeet. et af. (1984)
Pyrenophora graminea ? ¡mici & Rolfo (1991-)
Saccharomyces ? Bef I et a-Z . carTsbergens i s (L917 |
Saccharomyc es Bel I et a-Z . c erevis iae (1977 )
Saccharomyces rosej ? Verbeet et af. (1983 ) ToruTopsis utifis Tabat.a (1980) Zygomycete
Mucor miehei Maicas et a7. (2000)
Mucor îacemosus Cihlar & S)æherd (1980) Peronosporomycetes ( Oomycetes ) 188
AchTya anbisexuafis Rozek & Timberfake (1979 )
AchTya kfebsiana Befkhiri et aL. (!992)
Lagenidium giganteum Befkhiri et aJ. (1992) PachWetra Belkhiri et af. chaunorhi za (1992)
Phytophthora Howlet.t et af . c innamomi (1992)
PhytophEhora Belkhiri et a7. crWtogea (1992], Phytophthora Howfett et af. gTyc inea (1992],
PhyEoph|hora Howlett et a7. megaspeTma (]-992)
Phytophthora vignae Hor,^/leLE. eE al-. (1992], PyEhium aristosporum Belkhiri et af. (re92)
Pythium arrhenomanes Belkhiri eE a7. (1992)
Pythium coToratum Belkhiri et a7. (1992) Pythiun dicfinum Belkhiri et af. (1-992)
Pythium coToratum Befkhiri et aL. (1992],
PyEhiun graminicoTa Befkhiri et aJ. / aristosporum (1992',) 189
Pythium hypogynum Befkhiri eE a7. (L992)
Pythium pachycauTe Belkhíri et al-. (1992)
Pythiun Belkhiri et al-. salpingophorunt / (7992], conidiophorum
Pythium suicatum BeLkhiri eE af. /100t\
Pythium Befkhiri et al-. tardicrescens (1992],
Pythium Eorufosum Befkhirí et aL. (1992],
Pythiun vanterpooJii Befkhiri et a7. (1992)
Pythium viofae Befkhiri et al-. (t992],
SaproJegnia ferax Hov,¡let t. et af . (1992)
VerrucaTvus + Belkhiri et aJ-. f Tavofac i ens (L992',) CrlE)tomonad algae
Isofate cs 134 + Gilson et af, (le94)
Konna caudate + Gif son et al- . (L994],
Rhinomonas pauca + Gilson et aL. (L994)
Storatufa major Gilson et al-, (199 4\ Brown algae 190
Scytos iphon Kar,/ai et a-2. fomentar ia (1995)
ChromophyLes
Phaeophyceae, Kawai eË al..
Chrysophyceae, (L991 ) xanthophyceae, Raphídophyceae, Eus t. igmatophyceae , Haptophyceae, and Di c tyochophyc eae
OpaT ina + Kawai et a-2. (1997 )
Proteromonas + Kawai eL a-2. (1997 |
Dinophyc eae + Kawai eË a-l .
(le97 )
Eugf enophyc eae + Kavnai eL al.. (L997 ) Aveola!es
Perkinsus atfanEicus de fa Herran et aJ. (2000) PJasmodium Shippen-Lentz & faTciparum (human Vezza (L988l rnalaria paras i te ) Slime mold 191
Dic tyoste 7 iun (191 6\ di sco ideum
Copepods ( zooplankten)
CaLanus finmarchicus Drouin et a7. (1987 ) Calanus gJaciaTis Drouin et af.
(1987 )
Ca fanus Drouin et a7.
he TgoJandicus (1987 )
*Orientation of 55 rRNA gene transcription with respect to the other rRNA genes is indícated by the symbols: + = same orientation; - = opposite orientaLion; ? = orientat.ion undetermined. 192
Tab1e 2. Organisms in which t.he 55 rRNA genes are tandemly arranged and unfínked To rDNA
Organism Unit size Re f erence
Ma¡n¡ria 1s
Homo sapiens 1.600 Sorensen & (Human) 2.300 Frederiksen ( 1991)
Macaca fascicufaris 4.300 (one 5S lTensen & (Macaque ) gene ) Frederiksen 12000 ) 7 .300 (two 5S genes ) (...3 kb- 5.s- 4.3kb-5,s- 4.3kb-5.9...) Mus musculus 1.600 Suzuki et af. domesticus (mouse ) (199 4\
Rat 1.800 Frederiksen et al-. 2. s00 (55 (1997 ) psedogene )
Syrian hamster 2.200 Hart & Folk (19 82 ) A¡nphibÍans xenopus faevis Carrolf & Brown (1976a)
Peterson et aJ-, (1980) Fish
Brycon sp, 0.340 Wasko et (Neotropícal fish) 0.341- (2001) 0.342-0.343
Brycon brevicauda 0.321 Wasko et 0.238 (2001) n ?.)0 0 .197 0.798 193
Brycon cephalus 0.341 Wasko et a-2. 0.349 (2001) 0 .352
Brycon insignis 0 .235 Wasko et al.. 0.511_ (2001)
Brycon fundii 0 .228 Wasko et al.. 0.242 (2001) 0 .243
Brycon microJepis 0.224 I¡lasko eË a-l . o .240 (2001-)
Brycon orbignyanus u . z26 Wasko et a-l . o .240 (2001) 0 .241-
Coregonus 0.394 Sajdak et a1 . (Coregoníd fish) 0.524 (L997 ) Leporinus cf. 0.199 Martins & Galettí, efongatus 0.850 ,fr. (2001) 0 .900
Leporinus efongates 0 .201 Mart.ins & Galetti, 0.900 .Tr. (2001)
Leporinus friderici 0 .220 Martins & calett.i, 0.900 .fr. (200i-) Leporinus obtusidens 0.201- Martins & cal-etti, 0.900 .rr. (2001) Salmo salar 0.257 Pendas et af. (Atlantic salmon) 0.507 (199 4) PLants
Acer rubrum 0.338 Gottlob-McHugh et (red maple ) a7. (l-990) AJibertia acuminata 0.438 Persson (2000) (Rubi ac eae )
Af ilcert ia 0 .546 Persson (2000) 194
amplexicauT i s
Af ibert i a 0 .4'7 4 Persson (2000) bertierifoLia
ATibertia concofor 0 .620 Persson (2000)
AJiberEia curvif J.ora 0 .441 Persson (2000) ALibertia eduJis 0.438 Persson (2000)
ATibertia effiptica 0 .657 Persson (2000) Afibertia hassTeriana 0.657 Persson (2000) AJiberEia hispida 0.586 Persson (2000) Alibertia myrciifoTia 0.699 Persson (2000) Af ilcertia piTosa 0.699 Persson (2000) Afibertia sessi-Zis 0.547 Persson (2000) Afibertia steinbachii 0.698 Persson (2000)
Afibertia aff . stricta 0.547 Persson (2000)
AJbizia Tebbeck 0 .441 Go t t 1ob-McHugh ef (Indian walnut ) af. (1990)
A77ium cepa 0.336 Go t t.l ob-McHugh ( oníon ) a7. (1990)
Af J. o syncarp i a t erna ta 0.334 Udovicic et aL. (1995 ) Amaioua corlnnl>osa 0.517 Persson (2000) (Rubiaceae )
Amaioua guianensis 0.516 Pers s on (2000) Angophora fToribunda 0.380 Udovicic et af, (199s)
Angophora hi spida 0.386 Udovi c ic et aL. (199s ) Arabidopsis thafiana 0 .491 Cambeff et al . (1992) 0 .25L 0.500 Cloix et a-2. (2000)
Ar i f f as trum gummi f erum 0 .310 Udovicic et af, 0.324 (1995)
Beaufort ia 0 .422 Ladiges et af. heterophyf fa (Myrt.aceae )
Beaufortia orbi tofia 0 .428 Ladiges et a1 . (Myrtaceae ) (1ee9 )
BeauforEia sparsa 0 .382 Ladiges et a7. (Myrtaceae ) (1e99 ) Borojoa patinoi 0.609 Persson (2000) (Rubi aceae )
Cafamus aidae 0.463 Baker et aJ. (Arecaceae ) 0.495 (2000)
Cafamus bTumei 0. s02 Baker et a-2.
(2000 )
Cafamus caesius 0.488 Baker et al.. 0.490 (2000)
CaLamus castaneus 0.352 Baker eL al . 0.353 (2000) 0.357
CaLamus ciliaris 0 .499 Baker et a-U. 0.501 (2000)
CaLamus conirostris 0 .498 Baker et al., 0.504 (2ooo)
Cafamus deeratus 0.503 Baker et a-2. (2000)
CaTamus diepenhorstii 0.510 Baker eË a-l . o .51_2 (2000) Cafamus erinaceus 0.418 Baker et a-Z . 0.479 (2000)
Cafamus heteracanthus 0.505 Baker et aJ. (2000)
Cafamus hoTTrungii 0.502 Baker eL a-7.. 0.507 (2000 )
Cafamus humbofdEianus 0.485 Baker et a-7., 0.490 (2000)
Cafamus koordersianus 0.384 Baker et a-2. 0.385 (2000)
CaJ-amus Tongispathus 0.382 Baker et a-2. (2000)
Calamus manan 0.488 Baker et a-2. 0 .491- (2000)
Caiamus nanodendron 0 .412 Baker et a-2. 0.508 (2000)
CaTamus ornatus 0 .487 Baker et a-2. 0.489 (2000)
CaLamus paspalanthus 0.508 Baker et a-2. 0.509 (2000)
CaLamus pogonacanthus 0.399 Baker et a-2. 0 .499 (2000)
CaJ-amus reticufaEus 0 .415 Baker et a.7.. 0.480 (2000) 0.638
Cafamus scipionum 0 .436 Baker et aJ. 0.485 (2000)
CaLamus sede.¡is 0.522 Baker eË al.. (2000)
Cafamus sordidus 0.504 Baker et a-Z. 0.507 (2000)
Cafamus thysanolepis 0 .471 Baker eË aJ. l9'7
0.500 (2ooo) 0.50r_
Cafamus htarburgìi 0.488 Baker eË al.. (2000)
Caf f i stemon acuminatus 0 .218 Ladiges et af. (Myrtaceae ) ( 1999 )
CaTfisEemon buseanum 0 .434 Ladiges et aL. (Myrtaceae ) (1999 )
Caffistemon 0 .277 Ladiges et af. comboynensis (1999 ) (Myrtaceae ) CaTTisEemon gTaucus 0.2'78 Ladiges et af. (Myrtaceae ) (l"ee9 )
CaLi istemon gnidioides 0 .434 Ladiges eE af. (Myrtaceae ) (1999)
Caf J- istemon .T inearis 0 .218 Ladiges et af. (Myrtaceae ) ( 1999 ) CaLListemon pa77idus 0.283 Ladiges et af. (Myrtaceae ) (1999 )
Caffistemon pearsonii 0 .218 Ladiges eE af, (Myrtaceae ) (1999 )
Caf f i s Eemon pini f o 7 ius 0.278 Ladiges et aL, (Myrtaceae ) ( 1999 )
CaTfisEemon pityoides rì t?o Ladiges et aL. (Myrtaceae ) (199e)
CafListemon pancheri o.434 Ladiges et aL. (Myrtaceae ) ( 1999 )
CaJ-iistemon sal ignus 0.279 Ladiges et aJ-. (Myrtaceae ) (t9e9 )
Caffistemon suberosum 0 .423 Ladiges et aL. (Myrt.aceae ) (1999 )
CaJ7isEemon subuLaEus 0.265 Ladiges et aL. 198
(Myrtaceae ) (L999 ) CafListemon viminaf i s Ladiges et aJ. (Myrtaceae ) (1999 )
CaI ospatha 0.530 Baker et a-2. scortechini i (2000 ) (Arecaceae )
CaJ.othamnus graciTis 0.317 I-.,adiges eE aL. (Myrtaceae ) (1999],
Caf othamnus o ldf iel-di i 0.396 Ladiges et aL. (Myrtaceae ) (1,999],
Cafothannus rupestris 0.356 Ladiges eE aL. (Myrtaceae )
Ca 7 othamnus sanguineus 0.403 Ladiges et aL. (Myrtaceae ) (1-999 ) Camefla sinensis 0.300 Singh e Sinqh (tea) 0.325 (2001)
Capsicum annuum 0 .294 Park et a-2. (2000) (pepper )
Capsicum baccaEum 0.300 Park et a-l . (2000)
Capsicum chinense 0 .298 Park et a-2. (2000)
Capsicum fruEescens 0 .296 Park et a-7. (2000) Capsicum pubescens 0.278 Park eL a-2. (2000)
Carpinus carofiniana 0.329 Forest & Bruneau ssp. Virginiana (2000) (Vírginia Alnerican
hornbeam )
CeratoTobus concoJ-or 0.507 Baker et a-2. (Arecaceae ) 0.511 (2000)
Cera tof obus 0. s00 Baker et a-2. subanguJatus 0.510 (2000) Conothannus trinervis 0.364 Ladiges et af. t99
(MyTt.aceae ) (]-999)
Coryfus (most species ) 0.335 Forest & Bruneau (fi lbert ) (2000)
Cucumis sativus 0.341 Gottfob-McHugh eL ( cucumber ) aJ. (1990) Cycas revofuta L.572 Got.tlob-McHugh et (sago palm) a7. (1990)
Cynara carduncuTus 0 .320 Gottlob-McHugh et (artichoke) 0 . 33 0 af. (1990) 0.480
Daemonorops caTicarpa 0.518 Baker eL a-Z . ( Arecac eae ) 0.519 (2000)
Ðaemonorops 0 .463 Baker eË a-2. didymophyTTa (2000)
Daemonorops fissa 0.503 Baker et a.Z.. 0.505 (2000) 0.507
Daemonorops longipes 0 .404 Baker et al.. 0.468 (2000)
Daemonorops oxycarpa 0 .464 Baker et a.i.. (2000)
Ðaemonorops 0 .4'77 Baker eL aJ. periacantha 0.504 (2000)
Duroia aquatica 0.518 Persson (2000) (Rubiaceae )
Duroia eriopiTa 0.518 Pers s on (2000)
Duroia hirsute 0.516 Pers s on (2000 )
Duroia micrantha 0.518 Pers s on (2000)
Eremaea beauf ortioides 0.373 Ladige s et af. (Myrtaceae ) ( 1999 ) 200
Eruca saEiva 0.500 Sinqh et aJ. ( Bras s icaceae ) 1.000 (1994)
EucafpEopsis papuana 0.345 Udovicic eE af. (sum) /'1 0ô<\
EucaJ-Wtus caTophyTTa 0.401- Udovicic et af. 0.405 (199s ) Eucaf tE)tus 0.413 Udovicíc et af. camaldufens i s ( 199s ) (red gum) EucaLwtus citriodora r\ 200 Udovicic et af, (lemon-scented gum) (l_e9s)
Eucalwtus c Toez iana 0.408 Udovícic et af, ( 1995 ) EucaTwtus curt is i i 0.410 Udovicic et af. ( 1995 ) EucalWEus 0.400 Udovicic et af. do7 ichocarpa (]-ees)
EucafJG)Eus 0.409 Udovícic et aJ-. erythrocorys
EucaJ.Wtus 0.391 Udovicic eE aL. erythrophToia (r-995)
Eucalptus eximia 0 .409 Udovicic et al-, (199s )
EucaTwtus ficifoTia 0.408 Udovicic et a7. (red flowering gum) (199s)
Eucaf Wtus gTobules 0.409 Udovicic et aL. (Tasmanian blue gum) ( 199s ) EucafWEus 0.408 Udovicic et af. haemaEoxyTon (199s)
Eucaf Wtus JeucoxyTon 0 .409 Udovicic et af. (white ironbark) (199s )
Eucalptus microcorys 0.415 Udovicic et a7. 201
(199s)
Eucaiwtus muefferiana 0.403 Udovicic et aL. (199s)
Eucaf Wtus papuana 0.413 Udovici-c eE a7. (1e95 ) Eucaf Wtus preissiana 0.410 Udovicic et af. ( 1995 )
EucaTwtus tesseTfaris 0 .41-2 Udovicic eL a-Z .
(199s ) Eucaf Wtus tetragona 0.409 Udovicic et af. (19es)
Genipa aff. wifJiansii 0 .412 Persson (2000) (Rubiaceae )
GTycine max 0.330 Gottlob-McHugh eË (soybean) af. (1990)
GymnocTadus dioicus 0 .21-5 Gottlob-McHugh et (Kentucky coffee tree ) af. (1990) HaynaTdia viffosa 1.160 z}rov et ai. (2OOI, 1.510
Hordeum gTaucum o.204 Baum & Johnson (Poaceae : Triticeae, 0.260 (1999\ barl ey ) 0.282 0.307 0.331_ 0 .3't 6 0 .420 0 .424 0 .425 0 .434 0.435 0.460 0 .479 0.480 0 .487 0 .492 0.494 0 .496 202
0.535 0.599
Hordeum leporinum 0 .293 Baum & tÏohnson 0.309 (199e) 0.336 0.365 0.31 6 0.433 0.480 0 .484 0 .491 0 .493 0 .494 0.589
Hordeum Teporinum var. 0.436 Baum & .Tohnson s imuLans 0.438 (19ee ) 0.448 0.493 0.495 0.541
Hordeum murinum 0 .449 Baum & .Iohnson 0.451 t1000\ 0 .494 0.495 0 .549 Hordeum vuTgare 0.304 Gottlob-McHugh et 0 .442 a7. (1990)
0.301 Kolchinsky eE a7. (199r-) 0.291 0.301 Baum & .Tohnson 0.303 (199 4\ 0.307 0.315 0.322 0.340 0.382 0.390 0.430 0 .452 0 .454 0.489 203
0 .491- 0.508
Ibetraf ia surinamensis 0.581 Persson (2000) ( Rubíac eae )
Junuperus virginiana 0.378 Gott.fob-McHugh (cedar ) af . (l-990)
KengyiTia afatavica 0.307 Baum a Baily (Poaceae:Tríticeae) 0.31-2 (L997 \ 0 . 31_3 0.314 0.315 0 .422 0 .428 0 .441- 0 .445 0 .447 0 .4'78 0.480 0 .482
KengyiTia bataJinii 0.394 Baum & Baily 0 .441- (2000b) 0 .443 0 .446 0 .448 0 .469 0 .413 0.481 0 .489
Kengyi 7 ia grandigTumi s 0.297 Baum & Baily n too (2000b) 0 .445 0 .448 0.4s0 0 .452 0 .412 0 .471 0.480 0.48L
Kengyi 7 ia kokonorika n tot Baum & Bail-y 0.299 (2000b) i l)1 204
0 .446 0 .450 0.475 0.481 0.483
KengyiTia faxiffora 0.298 Baum & Baily 0 .404 (2000b) 0 .440 0 .443 0 .444 0 .445 0 .446 0 .447 0 .448 0 .449 0 .472 0.480 0.481 0.483 0.485
KengyiTia mefanthera 0 .441 Baum & Baily 0 .448 (2000b) 0.470 0 .479 0.481 0.485
KengyiTia mutica 0 .44't Baum & Baily 0.48r_ (2000b) 0.483
Kengyi 7 ia r igiduJa 0 .443 Baum & Baify o .445 (2000a) 0 .446 0 .447 0 .448 0 .449 0.4s0 0.451_ 0 .411 0.480 0.481- 0 .482 0.483 0 .484 0.485 0.489 0.490 0 .492
Kengyi 7 ia thoro 1diana 0 .297 Baum & Bai ly 0.299 (2000b) 0 .444 0 .446 0 .441 0 .448 0.450 0 .4'79 0.480 0.481- 0 .482 KengyiTia zhaosuensis 0.725 Baum & Baily 0 . 31-1 (2000b) 0.314 0.430 0 .425 0.430 0 .484
L'amarchea hakeifofia ^ ¿.)) Ladiges et aJ-. (Myrtaceae ) r¡1ôôô\
Larix deciduas 0.650 Trontin et aJ.. (European larch) 0.870 (199e)
Larix kaempferi 0.650 Tront.ín et aJ. (,Japanese larch) 0.870 fi"e99 ) LophosEemon confertus 0.438 Ladiges et al . (Myrt.aceae ) (t9e9) I-'ycopers icon 0.400 Lapitan et af. esculentum (1991) ( t.omato )
MeJafeuca armiTfaris 0.408 Ladiges et af. (Myrtaceae ) (1e99 )
MefaTeuca brevifoTia 0 .428 Ladiges et (Myrt.aceae ) (199 9 )
Mef aL euca brongni ar ti i 0 .4L9 I-,adiges e Ë al (Myrt.aceae ) (1e99 )
Mefafeuca decussata 0 .420 Ladiges et af. (Myrtaceae ) (1999 )
MeLaleuca diosmifoiia 0 .429 Ladiges et aL. (Myrtaceae ) (1999 )
MeiaLeuca ericifoLia 0.375 Ladiges et a1 . (Myrtaceae ) (1999 )
MefaTeuca gibbosa 0 .449 Ladiges et a7. (Myrtaceae ) (tee9 )
Mefafeuca gnidioides 0 .433 Ladiges eE a7. (Myrtaceae ) /10ôô\ Melafeuca howeana 0.395 Ladiges et af, (Myrtaceae ) (1999 )
Melaleuca 0 .41-4 Ladiges et al . hypericifoTia ( 1999 ) (MyrLaceae )
MefaLeuca TanceoTata 0.393 Ladiges et af. (Myrtaceae ) (1e99 ) MeJaTeuca Tateritia 0.403 Ladiges et af. (Myrtaceae ) /10ôô\
MeLaleuca 7 inarii f of ia 0 .420 Ladiges et af, (Myrtaceae ) (199e )
Mathioia incana 0.5L0 HemLeben & Werts ( Bras s i caceae ) (1988)
Me f af euca minut i f ol- ia 0.431 Ladiges et af, (Myrtaceae ) (1999 \
MefaLeuca puJcheTTa 0 .41-6 I-.,adiges et aJ. (Myrt.aceae ) (19e9 )
Mel-af euca pustuTaEa o .445 Ladiges et al". (Myrtaceae ) /'1 ôôô \
MeTaleuca spathuJ.ata 0 .424 Ladiges et af. (Myrt.aceae ) ¿l ooô \ Mefa f euca 0.427 Ladiges et a7. s typheT io ides (1999 ) (Myrt.aceae )
Mefafeuca thymifolia 0 .391 Ladiges et af. (Myrtaceae ) 0.398
Mel-aTeuca wifsonii 0.375 Ladiges eE af. (Myrtaceae ) (1ee9 )
MyriaTepis paradoxa 0 .41-9 Baker et a-2. (Arecac eae ) 0 .425 (2ooo)
Myrfaceae sp. 0.356 Udovicic et aL. (199s)
Nicotiana Eabacum 0 .41-6 Go t. t. L ob-McHugh et ( t.obacco ) 0 .6L7 af. (1990)
Ostrya virginiana 0.364 Forest. 6< Bruneau (American hornbeam) (2000)
Ostryopsis davidiana 0.325 Forest & Bruneau (2000) PhaseoJus vuTgaris 0.389 Gottlob-McHugh et (broad bean) af . (1990 ) Ph)/matocarpus 0.370 I-,adiges et aJ. maxwefJ-ii (199e) (Myrt.ac eae )
Picea gTauca 0.22L Broh¡n & Carfson (white spruce ) 0.600 (19e7 )
Pinus radiata o .524 Gorman et af. (conífer ) (7992], 0.525 0.850 Moran et al.. (1992)
PJ ec tocomiops i s 0 .427 Baker et a-l . gemini f Tora (2000) (Arecaceae )
Pogonotium ursinum 0 .411 Baker eË a-2, (Arecaceae ) 0.48L (2000)
Pseudotsuga menziesii 0.87i_ Amarasinghe and (Douglas-fir) 0.888 Carlson (19 98 )
Randia tessmannii 0. 630 Persson (2000) (Rubiaceae )
Randia aristeguieEae 0.504 Persson (2000 ) RegeTia inops 0.365 Ladiges et af. (Myrt.aceae ) / 1 0ôô \
RegeLia veJ-utina 0.505 I-,adiges et al- . (Myrt.aceae ) /'t ooo \
Retispathe dumeEosa 0.205 Baker et a-2. (Arecac eae ) 0.206 (2000)
Rosenbergiodendron 0.389 Persson (2000) deni s f Torum (Rubiaceae )
Setaria adhaerans 0.340 Benabdelmouna eË ( Paniceae ) af. (2001) Setaria faberii 0.340 Benabdel-mouna et 0.450 af . (2001) SEaria iEaJica 0.300 Benabdelmouna et 0.340 a7. (2 0 01)
Setaria verticiffata 0.300 Benabdelmouna eE 0.340 af. (2001 t
Set,aria viridis var . 0.300 Benabdelmouna et viridi s 0.340 aL. (2001)
Setaria viridis var , 0.340 Benabdel-mouna eL pycnonoma a7. (2001_l
Spinacia vuTgaris 0.336 Go t t.l- ob-McHugh et ( spinach ) aJ-. (1990) StenosepaJ-a hirsute 0.544 Persson (2000) (Rubi ac eae ) 209
Tripsacum spp. (5) 0.260 Zímmer et af. (maize) ( 1988 )
Triticum aestivum 0.41_0 Gerfach & Dyer (wheat. ) 0.500 (1980)
0.800 Zhou et a1 . (2 0 01- ) 1.100 L.200 1.700
Vigna radiata 0.215 Hemleben & Wert.s (mung bean) (1988 )
Zea mays 0 .323 Gottlob-McHugh et ( corn ) af. (1990) fnéect s
Drosophi 7a 0.375 Hershey et af. melanogas ter (r97'7 )
CaTTiphora 0.480 Rubacha et a7. erythrocephal-a (1984 ) CrusÈacean
Artemia 8.50** Cruces et af.
9.00** (1989 ) ProasefLus coxalis 0.589 Pefficcia et af. (1998)
Nevrt
No tophthafmus 0.231- Kay & call (1981) virides cens 0.269
Nematod.es
Ancyfostoma duodenafe 0.370 Liu et al.. (1995 )
Caenorhabdi E i s e 7 egans 1.000 Nelson et a7. (r-998 )
Caenorhabdit i s 0.700 Nelson et aL. briggsae 1.000 (19e8 ) 210
Enterobius 0.920 Liu et al . (1995) vermicular i s
Haemonchus contortus 0 .205 Liu eË a-l . (1996) HeEerodera glycines 0.380 I-,iu eÊ a-2. (1996) Heterohabdi t i s 0.330 Liu et a-2. (1996) bact eriophora
MansoneJ-la ozzardi 0 .420 Casiraghi eE af. (2001-) MeToidogyne arenaria 0.310 Liu et a-Z . (199 6 ) Necator americanus 0.200 Liu et a-Z. (1996) Pelfioditis peJJio 0.390 l-,iu et a-2. (1996) StrongyTo ides 0.375 Liu et aí. (1995 ) s tercoraf is
Toxocara canis 1.150 Liu et a]. (1996)
TrichineLfa britovi 0.780 Rombou t. et af. (2001)
Trichineffa murreTTi 0.780 Rombout. et aL. (2001_)
TrichineLJ-a nativa 0.780 Rombout et af. (2001)
TrichineT 7a ne Tsoni 0.770 Ronìlcou t et af . (2001)
Tr i chineL J-a 0.560 RoÍìlcout et af , ps eudospiraT i s (200r-)
TrichineJfa spiraTis 0.780 Liu eL a7. (199s); Rombout et af. (2001)
Wuchereria bancrof E i 5SR1-5SR2 = Das s anayake et af. 0.349 (2001) 5SR2 = 0.094 211
5SR2-5SR3 = 0.507 5SR3 = 120 5SR3-5SR4 = 0.349
OomyceÈes
Pyt hium acanthicum 0.600 Kfassen eE a7. (1996) Pythium anandrum 0.450 Klassen et af. (1,996) Pythium inEermedium 0.600 Klassen et aL. Pythium irregulare 0.659 (L996l
Pythiun macrosporum 0. s00 Belkhiri et al-. (L991 | Pythium mas tophorum 0.500 Klassen et a7. Pythium okanoganense 0.500 (19e6) Pythium syTvaticum 0.500 Kfassen et af. (1,996)
Pythium uftimum var . 0.350 Klassen et aL. sporangi i f erum /10ô4\
Pythium uLtimum var . 0.500 Kfassen et al_. ufEimum (1e96) Protozoa CycTidiopsis acus 0.651 Frantz et af, (Euglenoid) (2000) Distigma proteus 0.380 Frant.z et af, (Euglenoid) 0.381 (2000) 0.388 0.392
Eimeria tenella 0.728 Stucki et aL. il-ee3 )
Entosiphon sufcatum 2 .52L Ebel eË aJ. (l-999) (Euglenoid) 212
Eugelna gracilis 0.603 Keffer eE af, (Euglenoid) 0 .623 (L992],
EupLotes eurystomus 0.930 Roberson et aJ-. (1989 )
Menoidium peTTucidum 0 .'77 6 FralfLz et af, (Euglenoid) 0.177 (2000)
OxyEricha nova 0.600 Roberson eE a] .
0.680 ( 1989 ) Onychodromus 0.640 Roberson eE af. quadricornutus (1989)
Phacus curvicauda 0.563 Frantz et aJ-. ( Eugl eno id ) (2000)
Rhabdomonas costata 0.405 FralfLz et a7. ( Eugl enoid ) 0 .432 (2000) 0.455 0 .496
StyTonuchia femnae 0.600 Roberson et al . (L989 ) Trypanosoma cruzi 0.48L Hernandez -Rivas af . (1-992) Ttpanosoma rangeTi 0.913*** Askoy eË aJ. (!992) Tetrah\tmena Pederson et af. thermophi 7a ( 1984 )
ChromophyEes
Synura (Synurophyceae) 0.650 Kawai eË a-2. (1997 )
Dityfun 0.450 Kawai eL a-2. (Bac i 11ar iophyc eae ) 0.480 (1991 \
NiEzschia 0 .220 Kawai et a-2, ( Bac i 1l ari ophyc eae ) 0.350 (1_997 ) 0.450 *Organisms may have more than one array of tandemly repeated 55 rRNA genes. **Histone genes are associated with 5S rRNA gene repeat units ín Artemia. ***Spliced leader RNA (sIRNA) genes are organízed wit.hin the tandem repeats in Trtry)anosoma rangeJi. 214
Àppendix 2
The ribosomal DNÀ intergenic spacer as a source of information for species assignment írL phytophthora 215
ABSTRÀCT Over 30 ísolates of phytophtåora were used to investigate the usefulness of the ribosomal DNA intergeníc spacer as a region for species discrimínation wíthin the genus. We amplified the 5-7 kb intergenic spacer in the ribosomal DNA repeat unit. and then digested the pCR product
with a set of restriction endonucfeases to produce RFLP patt.erns as fingerprints. These fingerprints were unique to
the isolate and/or species t.hey represented, This meE.hod reveafed that some phyEophzhora species may be assemblages of related or miscfassified species and. afso validates severaf accepted species boundaries. This met.hod,s main utility is rapid screening of large numbers of isolat.es t.o confirm correct specíes assignment.. 216
INTRODUCTION The Genus Phytophthora of the Oomycetes is part of the Kingdom Straminipila (Chromist.a) , which also incfudes the diat.oms and brown algae. Most of the 60 species that. make up t.his genus are plant pathogens, and are mainly found ín soil or freshwater habitats. Species are capable of either sexual or asexual reproduction, depending mainly on environmental conditions. Sexual reproduct.ion occurs by the associat.ion of the male gameL.e producing antheridia and femafe gamet.e producing oogonía to produce a fertile diploid oospore. Asexual reproduct.ion and díspersal ís by means of motile zoospores produced from zoosporangia. Some species are homothallic, meaning that they are capable of seff-fertilizatíon. Others are heterot.half ic which requires the int.eract.ion of two mating tlæes, typically represent.ed as male and female, + and -, or A1 and A2 strains. Phytophthora ís most. closely reLated to the genus Pythium. Recent DNA sequencing (A. Lévesque, personal communication) , 5S ribosomal RNA gene organization d.at.a (Chapters 1 and 2), and morphological similarities also suggest overlap between species in the two genera. Species discrimination based on morphological characters ín phytophthora is very time-consuming and often a Ledious task. Morphological characters within the genus are continuous and Lhere is a high degree of int.raspecific variability, which results in overlap bet\n¡een species. pure cultures of isofates must be grown in several varying 217 conditions j-n order to accurately observe growth ïates, growt.h patterns, sexual states, etc. Morphological characters within a species can be strongfy influenced by the growth media, temperature, and age of cufture. In water cufture it. is ofLen difficuft. to achieve sporufat.íon of zoospores in some species, if ít i.s possible at all. Furthermore, when het.erothaflic species are involved, mating t.ests must be undertaken ín order to observe the productj-on of oogonia and antherídia. These limitations may and sometimes do resuft in unnecessary new species descriptions or misclassificat.ion of curïently recognized ones. Mofecular methods of investigation may hefp to resolve these limitations in defining species boundaries. Several methods are available. These include isozymes and random amplified polymorphic DNAS (R-A,pDs), both of which are very sensitive to experimental conditions, and therefore can result in non-reproduc íbLe results. Methods that utiLize the wel-l conserved ribosomaL RNA genes and spacer regions are more reliab1e. The ribosomal genes and spacer regions, collectively known as the rDNA repeat unit, are part of a repetitive gene family that occurs in tandem arrays, and may be found on severaf chromosomes of any eukaryotic organism. As part of a multigene family they are under the constant inffuence of concert.ed evolut.ion which helps prevent. the proliferation of muftiple versions, and keeps the region homogeneous within a species. The ribosomaf RNA (rRNA) gene 218
family is comprised of the 18S, 5.85, 28S, and 55 genes. In PhyEophthora t.he 55 gene is generally linked to the ïRNA genes/ but in some cases is unlínked and found in tandem arrays away from the rDNA repeac (See Chapt.er 2). The intergenic spacer (IGS) region is focated between the 2gS and 18S rRNA genes. Here we wilf demonstrate the usefulness of the intergenic spacer of t.he rDNA repeat as a region for species discriminat.ion withj.n t.he genus phytophthora. 219
Table 1. A list of isolat.es used in this study
Species Accession Original Origin Statusb Numbero Substrate
Phytophfhora arecae CBS 305.62 Areca catechu India NT P hy t o p htho r a b o e hme r iae CBS 291 .29 Boehmeria nivea Japan T Phytophthora botryosa CBS 581 .69 Hevea brasiliensis Malaysia T Phytophthora cactorum CBS 108.09 Cactus sp. NT P hyt o p ht ho rct c amb ív o r a CBS 248.60 Castanea sativa France T Phytophthora capsici CBS 128.23 Capsicum annum T P hy t o p htho r a c innamonti CBS 144.22 Cinnamomunt lndonesia T burmannii P hy t o p htho r a c it r ic o la CBS 221 .88 Citrus sinensis T P hytop htho ra citrophtho ra CBS 950.87 Citrus sp. USA NT P hyt o p htho r a c lande s t ùM CBS 347.86 Trifolium Ausrralia T subterraneum P hytophthora crypto gea CBS 113.19 Lycopersicon LÌsh Republic T esculentum ot Petunia sp. P hytophthora crypto gea CBS 468.81 Begonia eliator Germany T var. begoniae Phytophthora erythroseptica CBS 129.23 Solanunt tuberosum Irish Republic T Phytophthora fragariae CBS 209.46 Fragaria sp. UK AU var, fragariae Phytophthora heveae CBS 296.29 Hevea brasiliensis India T P hyto phtho ra hunzicola CBS 200.81 Soil Taiwan T Phytophthora ilicis cBS 255.93 NT P hyto phtho ra ùtfe stans CBS 366.5i Solanum tuberosun? Netherlands NT Phytophthora iranica CBS 374.72 Solanum melongena Il:an T Phytophthora katsurae CBS 587.85 Soil Taiwan T P hytop htho ra late ralis CBS 168.42 Chamaecyparis USA T Iawsoniana Phytophthora nteadii CBS 219.88 Hevea brasiliensis India NT P hytophthora nrc gakarya CBS 238.83 Theobroma cacao Cameroon T Phytophthora me gaspenna CBS 402.72 Althaea rosea USA T vaf. megøsperma P hyto p ht ho ra nte xi c an a cBS 554.88 NT P hy t o p htho r a mir a b íli s CBS 678.85 Mirabilis jalapa Mexico T Phytophthora operculata" CBS 241.83 Avicewtia marina Australia T P hy t o p htho r a p a Iniv o ra CBS 298.23 Theobronta cacao Trinidad & Tobago
P hytop htho ra p almivo ra CBS 236.30 Cocos rtucifera India 220
P hy t o p htho r a p almiv o r a CBS 358.39 Hevea brasiliensis Sri Lanka Phytophthora phaseoli cBS 556.88 Phytophthora primulae CBS 275.74 Malus sylvestis Netherlands NT P hytophthora spec. marine. cBs 215.84 Phytophthora syringae CBS 367.79 Forsythia sp. Ñetherlands it Phytophthora syritryae cBS 132.23 T]K
" CBS = accession numbers of sLrains obt.ai-ned from Centraafbureau voor Schimmel-cul tures b , Ulrecht, Netherlands. T = strain from which the t)t)e material was derived; AU = authentíc strain, identifíed by author of the species; NT = sL.rain designated as neot]4)e because al1 C)æe material ís missing. " Name was fater changed Lo HaLophytophthora opercuLata. 221
RESULTS PCR amplifícation of the phytophthora rDNA isolates using the Q and P2 primers resulted in amplicons ranging from 4 - 7 kb (data not shown) . After restriction endonuclease digestion of the Q-P2 amplicons, we observed a number of different síE.uations (Figure 1). As expected/ many recognized species have unique IGS- RFLP DNA fingerprint. patterns. These 17 species include: p. megakarya, P. cacEoruml P. botryosa, p. citricoTa, p, katsurae, P. hevae, P. ificis, p, boehmeriae, p. opercuJata, P. TateraLis, p, cambivora, p. fragariae f., p. cinnamomi, P. humicoLa, and p. spec. marine, A number of species revealed evofutíonary relatedness wit.h each other, as indicated by the existence of some coincídent bands beL.ween their RFLP patterns. These species clusters included: i) p. cfandestina and .P. iranica, í!)
P. infestans, P. mirabi_Zis, and p. phaseoJi, iii) .P. citrophthora and p. meadii, and ív) p. capsici and p. mexicana.
Some groups of specíes were found to have the same IGS-RFLP patterns, and thus are judged to be conspecific: i) P. crwtogea and p. erythnoseptica, ii) p. paJmivora and. P. arecae, and iii) p. megasperma and p, syringae. Finally in the case of p. paJmivora, isolate 35g.59 has a different fingerprint pattern in comparison with two other P. paJmivora isofates (296.29 and 236.30) . This is a situat.ion ín which we see ,species lumping, taking p1ace. 222
Figrure 1. Restriction digestions of phytophEhora IGS spacers (Q-P2 amplicon) wit.h A. TaqI and B. Hinff.. BRL 1 Kb Pfus ladder sizes sLarting from the bot.tom are 0.L, 0.2 0.3, 0.4, 0.5, 0.65, 0.85, 1.0, !.6, 2.0, 3.0 and íncrease thereafter at l-.0 kb increment.s. 255.93 >. boehmeriae CBS 291.29 P- operculata CBS 241.83 boehmeñae CBS 291.29 I kb+ ladder P. operculata CBS 241.83 'I kb+ ladder
1 kb+ ladder P primulaeprit CBS 275.74 P syrsyringae CBS 132.23 P. syrÌl4gaesyr CBS 367.79 P. cryptogeacN CBS 113.19 P eíieryth roseptica CBS'l 29.23 cryptogea b. CBS 468.81 /aferal,s CBS 168-42 cambivora CBS 248.60 fragar¡ae f. CBS 209.46 cinnamom¡ CBS 144.22 cambivora CBS 248.60 megasperma m. cBs 402.72 humicola CBS 2OO .81 spec- mañne CBS 215.85 palmiyora CBS 358.59 palmivora CBS 298.29 palmiwra CBS 236.30 arecae cBs 305.62 kb+ ladder 224
Similarly, the case of two p. syringae isolates (L32.23 and 36'7.19), where again, both have different fingerprint patterns. 225
DISCUSSION The use of IGS-RFLPs ín phytophthora was extremely useful as a method for rapid screening of J-arge numbers of isol-ates and it was informative enough for species assignment of t.hese isolates. The simplicity of the IGS- RFLP method is advantageous over the rigours and t.echnical difficulty involved with such methods as RApDs (Cooke et af., 1-996), oligonucleotide hybridization (Lee et aJ., L993; Scott eE a7., 1998) and DNA sequencing met.hods (Bailey et af, 2002). Except for the programmable t.hermaf cycLer, only the most basic laboratory equipment was required. The Q and p2 prímers are part of the wefl conserved rRNA genes from which we coufd then amplify the IcS between the genes. t_,iew eE aL. (1998) used the IGS region for species differentiation between p. medicaginis and related species by amplifying the IGS-2 region (the 55 gene downstream t.o the LSTRNA gene) , folfowed by ÐNA sequencing and designing species specific pCR primers.
Howlet.t et af. (1992) demonstrated that the 55 gene was linked and non-inverted in orientation with respect to the rDNA repeat. unit in severa] species of phytophtJrora, though recent. evidence shows Lhat there are a number of species that do not have their 55 genes associated with t.he rDNA repeat (See Chapter 2). Liew et aL. (199g) used an experimental strategy of first sequencing t.he complete ITS2 regíon from many Phytophthora species and then designing oligonucleotide primers for species specific detection with 226
PCR. This method is much more labouríous than generat.ing DNA fingerprints, for species díscriminat. ion . Ristaino et af. (l-998) used PCR amplificat.ion and restrict.ion digests of the ITS regions for species ident.ification in Phytophthora. They observed a number of similar fragment patterns between the species. ITS-RFLP based met.hods are successful in separating species when t.he data is derived from a fair number of different restrict.ion enzf¡me digests, but lacks enough information to dist.inguish between species when analyzing a single rest.riction digest. Of t.en only one or two bands are present on the ge1 (Ristaino et a7. , 1998) . Due t.o the relat.ively conserved natuïe of the spacer sequences within species and their large size, as compared to the ITS, our IGS-RFLP method ensures t.hat isolat.es may often be accurately separated ínto their respect.ive species by analyzing the DNA fingerprint patteïn from a single restrict.ion enzl¡me.
The first situation we observed was t.hat many different species of phytophtåora had unique TGS-RFLP patterns. The method was extremely useful in validating the accepted species boundaries for L't species out of the 30 isolates. As wefl, this demonstrated that the IGS_RFLP method is a potent.ially useful diagnostic t.ool for further screening of other phyEophthora isolat.es. The second sit.uation involved the exist.ence of coincident bands shared between two or more distinct species. This revealed a potential evol-utionary relat.edness 227
between t.he isolat.es. Consensus trees inferred from the ITSl-5.8S-ITS2 region of phyEophEhora isolates confirmed (Lévesque our resulL.s et aL,, L999; Cooke et aJ., 20001 , This evolutionary refatedness was confirmed by morphological similarit.ies observed in cuÌture between different species, and in some cases it. suggested refatedness which had not been prevíous1y recognized. The third situatíon consisted of identical or nearly ident.ical banding patterns that. revealed groups of species with f old interspecific variation. This is 1ike1y due to "splitting" by taxonomists, where somet.imes only a single discrepancy in morphology was enough to establish a new species. For example, in p. crwtogea CBS 113 .19 and p. erythrosepEjca CBS 468.81 bot.h species have simifar sporangia (non-papillate) , grow opL.imally wit.hin 22-2.toC, and produce amphigynous ant.heridia, whereas the only not.able dif f erences are that p. crptogea is heterothaf f ic and parasitizes legume hosts only and p. erythosepEica is homothaÌLic and parasitizes woody perennial hosLs (Cooke et a7., 20001 . Similarly, p. arecae CBS 305.62 and p. paJmivora CBS 298.29 and CBS 236.30 were judged by our met.hods conspecific. BoLh are nearly identical apart. from the formation of a metaphase ring, aerial hyphae, and pathogenicity to woody perennials in the latter species. Again t.hese findings are in compLete agreement wíth the moLecufar phylogeny based on the ITS-j.-5.9S-ITS-2 ribosomal- DNA sequence data (Lévesque et af., 1_999) including the 228
conspecifícity of P, megasperma m. CBS 402.j2 and p. syringae CBS 367.79.
Lastly, we found some isofates t.hat have probably been misclassified. this incfudes two (or potentialfy more) species that are erroneously classified within a single species, for example, due to morphologicaf similarities. Here we have uncovered two sítuat.ions of isolates being 'lumped' into a single species. IGS-RFLps have shown t.his to be the case in the .P. paJmiwora isolate 359.59 which by our met.hods appears to be unrelated to p. paTmivora isofate 298.29 and isolate 236.30 (the t.læe culture) . The same
situation takes place wit.h p. syringae, isolat.es 1,32.23 a.rrð, 361 .19. We have two different fingerprínt patterns for isolat.es of one species. Since isolaLe 36j.79 is the type culture, that isolate has precedence.
In t.his study we have shown the usefufness of IGS_ RFLPs in helping to subst.antiate or disprove species boundaries. This method clearly provides fast, additiona] moLecufar evidence in al-1 of the aforemenL.ioned situations. 229
REFERENCES
Aksoy, S., c. L. Shay. M. S. Villanueva, C. B. Beard, and F. F. Richards. 1992. Spliced leader RNA sequences of Trpanosoma rangeTi are organized wit.hin the 55 rRNA_ encoding genes . Gene LL3:239-243
Al-exopoulos, C. ,J., C. W. Mims and M. Bfackwef l. 1996. Phylum Oomycota, Order peronosporales. _fn Introduct.ory Mycology. 4rh ed. John Wiley, Ner¡r york, pp. 7L0-737. Al-oni, Y., L. E. Hatlen, and G. Attardi . Lg't!. St.udies of fractionated HeLa ce11 metaphase chromosomes. II. Chromosomal dist.ributíon of sítes for transfer RNA and 5S RNA. ,J. Mof . Biof . 56: 555-563 .
Amarasinghe, A., and !T. E. Carl_son, L99g. physical mapping and charac teri zatíon of 5S rRNA genes in Douglas_fír. LL Heredity 89 :495-500.
Amici, À,., and F. Roflo. 1991. The nucLeotide sequence of t.he 55 ribosomaf RNA gene of pyrenophora graminea. NucLeic ,Acids Res. !9 :50i 3 . Baily, 4.M., Mitchef 1, D.,f ., Manjunath, K.L., Nolasco, c. and Niblet.t, C.L. 2002. Identification of the plant pathogens Phytophthora and pythium by using uníque sequences of the ITS1 region of ribosomaf DNA as capture probes for pCR ELISA. FEMS MicobioL. Lett. 20'7 :1-53-158 .
Baker, W. ,1 . , T. A. Hedderson, and ,f . Dransf ield. 2000. MolecuLar phylogenetics of Ca-Zamus (palmae) and relat.ed rattan genera based based on 55 nrDNA spacer sequence daLa. Mol . phyTogen. EvoJ. 1_4:2Lg_23I.
Barr, D. ,L L992. Evofutíon and kingdoms of organisms from the perspective of a mycologisE. MycoJogia 84(1) :1_11. Bart.nik, E. , K. St.rugala, and p. p. St.epien. 19g1-. Cloning and analysis of recombinant plasmids containing genes f.or Aspergiffus niduTans 55 rRNA. Curr. Genet. 4:!j3_ l_/b.
Bartnik, E., ,1 . Kulik, M. M. Nagiec, and I,rI. zagrodzka. 1984. Cfoning and mapping of fourteen different DNA 230
fragments cont.aining AspergiTTus nidufans 55 rRNA genes. Acta Microbiof. pol-on, 33:5-10.
Bartnik, 8,, S. Bartosewski, p. Boïsuk, and .T. Empel . 19g6. Aspirgiffus nidufans 55 rRNA genes and pseudogenes. Curr. Genet. L0;453-45'l . Bartoszeu/ski, S., P. Borsuk, I. Kern, and E, Bartnick. 1987. Microheterogenei ty in ,AspergiJTus nidul.ans 5S rRNA genes. Curr. Genet. 11,:57L-451 . Bary, A. de. 1881. Zur KennLniss der peronosporeen. Bot. zeit. 39: 521-530, 537-544, 553-565, 569-5?9, 595-595, 6 0 1- 6 0 9 , 6L7 - 625 . Baum, B. R., and L. c. Bailey. I99j. The molecular díversity of t.he 5S ïRNA gene in KengyiJia alatavica ( yang Drobov ) ,.T . L . , yen, and Baum ( poaceae : Triticeae) : Potential genomic assignment of different ÏDNA units . cenome 40:2L5-228.
Baum, B. R., and L. G. Bailey. 2000a. The 55 rRNA gene diversity ín KengyiJia rigidula (Keng and S.L. Chen) .f .L. Yang, yen, and Baum (poaceae: Trit.iceae) : Possj-ble contribution of the H genome t.o the origin of KengyiTia. Genome 43 :'79-85.
Baum, B. R., and L. c. Bailey. 2000b. The 55 rDNA units in KengyiTia rigiduTa (poaceae: Triticeae): diversity of the nontranscribed spacer and genomic relationships. Can. LT. Bot. 78:!5'1L-t5'19.
Baum, B. R. and D. A, .Tohns on. !994. The molecular divers j.ty of the 55 rRNA gene in barley (Hordeum vulgare'¡ . Genome 37:992-998.
Baum, B. R. and D. A. Johnson. 1999. The 55 rRNA gene in wa11 barley (Hordeum murinum L. sensu lato) : Sequence variation among repeat units and relationship y j.n to the haplome the genus ¡Jordeum (poaceae: Tritíceae) . cenome 42:854-866 .
Bedard, .T., Schurko, 4., Klassen, c. R., de Cock, A. W. A. M. 1998. Evofution of the 55 rRNA gene family in Pythium. 6th Annuaf Int.ernational Meeting of the
Society of Mofecufar BioLogy and EvoLution (Abstract) , 231
Bedard, ,1 .E.,J., Klassen, G.R, and De Cock, A.W,A.M. 2000. 55 rRNA gene organization in the genus påytopå thora. Inocufum 51 (3 ) : j_7 (Abstract.) .
Belkhiri, 4., ,I. Buchko, and G. R. Kfassen. 1992. The 55 ribosomal RNA gene in PyEhium species: two different genomíc locat.ions. Mo1. Biol . Evol. 9: l-089-l_102 .
Belkhíri, A. and c. R. Kfassen. 1996. Diverged 55 rRNA sequences adjacent to 55 rRNA genes in the rDNA of Pythium pachycauTe. Curr. Genet. 29 :28't-292.
Belkhiri, 4., H. fntengan, and G, R. Kfassen. Lg9j . A tandem array of 55 ribosomal RNA genes ín pythiun irreguTare. Gene 186:115-1L9.
BelI, c. I., L. ,]. De cennaro, D. H. celfand, R. J. Bishop, P. Valenzuela, and W. !T. Rutter . 1"91'1 . Ribosomal RNA genes of Saccharomyces cerevisiae. I. physical map of the repeating unit and locafization of the regions coding for the 5S, 5.85, j-gs and 25S rRNAs. ,j. Biol. Chen. 252:8118-81-25.
Benabdelmouna, 4., M. Abirached-Darmency, and H. Darmency. 2001. Phylogenetic and genomic relationships in Setaria itafica and its cfose refatives based on the molecufar diversity and chromosomal organization of 5S and 185-5.8S-25S rDNA genes. Theor. Appf. GeneE. L03:668-677.
Bobrova, V. K., V. V. coremykin, a. V. Troitskii, K. M. Val'ekho Roman, and A, S. Arìtonov. 1995. Molecular biology study of angiosperms, origin. zhurnaf Obshchei bioTogii 56:645-661-.
Bogenhagen, D. F., S. Sankonju, and D. D. Brown. 1990. A control region in the center of the 55 RNA gene directs specific initiation of transcript.ion. IL The 3' border of the region. CeJJ 19:2j-35.
Bonen, I-,. , T. Y. Huh, and M, W. Gray, 19g0. Can part.ial methylation explain t.he complex fragment patterns observed when plant mitochondrial DNA is cleaved wit.h rest.riction endonucLeases? ¡'E'BS LeEt. L1_1_: 340_346.
Bonen, L., and M. W, Gray. 1980. Organization and expressj-on of mitochondrial genome of pfants I The 232
genes for wheat mitochondrial ribosomal and transfer RNA: Evidence for an unusua] arrangement. Nucleic Acids Res. 8:319-335. Borst, P., and L. A. crive]-l. . L9'1L. Mitochondrial ribosomes . FEBS Lett. 1,3:73-88. Borsuk, P., M. Gniadkowski, E. Bartnik, and p. Stepien. 1988. Unusual evofut.ionary conservation of 55 rRNA pseudogenes ín AspergiTlus nidulans: simífarity of the DNA sequence associat.ed with the pseudogenes with the mouse immunoglobulin swit.ch region. ,J. Mol . EvoJ. 28 :1-25-1,30 . Bouvet, P., S. Dimitrov, and A. p. WoLffe. 1994. Specific regulation of Xenopus chromosomaf 55 rRNA gene transcripLíon in vivo by hístone H1,. Genes Dev. 8: LL47 -11-59 .
Briard, M., M. Duteït.re, F. Rouxel, and y. Brygoo. 1995. Ribosomal RNA sequence divergence within t.he Pythiaceae. MycoT . Res. 99 :1-1,1"9 -L12't . Brownlee, G. G., F. Sanger, and B. G. Barell . L96j. Nucleotide sequence of 5S-ribosomaf RNA from Escherichia cofi . Nature 21_5:735-136.
Brownlee, G. c. L972. Sequence of 55 RNA. .rn Laborat.ory techniques in Biochemistry and Molecufar Bíology. Nort.h-Holfand, New york, pp. L00-196.
Brownlee, G. c., E, M. Cartwríght, and D, D. Brown. 1974. Sequence studies of the 55 of xenopus J-aevjs. ,f, MoJ. Biof. 89:703-718.
Brown, D. D., and E. Littna. 1966, Synt.hesis and accumufation of low molecuLar weight. RNA during embryogenesis of. Xenopus faevis. ,f. Mot. Biof. 20:95_ 1L2.
Brown, D. D., and I. B. Dawid. 1968. Specific gene amplification in oocytes. Science !60:272-2g0.
Brown, D. D., P, C. Wensínk, and E. Jordon, 1971. purification and some characteristics of 5S DNA from Xenopus Taevis. proc. Nat. Acad. Sci. USA 6g:31_75_ 31-7 9 . ¿53
Brown, Ð. D., and K. Sugimot.o. 1973. 55 DNAS of Xenopus faevis and Xenopus mufferi: evolution of a gene family. ,T. MoJ.. BioL. 18:39j-4L5.
Brown, c. R. , and ,.f . E. Carlson. 1997. Molecular cytogenet.ics of t.he genes encoding 1Bs-5.9s-26s rRNA and 5s rRNA in two species of spruce (picea) . Theor. Appi. Genet. 95:1-9. Buchko, J., and Klassen, G. R. 1990. Detect.ion of length heterogeneity in Lhe ríbosomaf ÐNA of pythium uftimum by PCR of the intergenic region, Curr. Genet, 1g:203_ 205 .
Butow, D.E. , and W. M. Wood. 1978. The mit.ochondrial translation system. Subceff . Biochem. 5:l--g5.
Campbe11, W. A. and F. F. Hendrix. l-967. A new het.erothallic eythium from Sout.hern United Stat.es. uycoTogia 59 :21 4-2'7 I.
Cambell, B. R., Y. Song, T. E. posch, C. A. Cullis, and C. D. Town. 1992. Sequence and organization of 55 ribosomal RNA-encoding genes of Arabidopsis thaJ-iana. Gene !1-2 :225 -228 .
Carro11, D., D. D, Brown. L976a. Repeating units of xenopus faevis oocyte-tl4)e 55 DNA are heterogeneous in length. Ceff 7 :46'l -47 5 . Carrof l-, D., D. D. Brown. j-976b. Adjacent repeating units of Xenopus laevis 55 DNA can be heterogeneous in length. CeLT '7 :477 -48L.
Casiraghi, M., G. Favio, G. Cancrini, A. Baïtofoni, and C. Bandi. 2001-. MoLecular identífication of WoJ-bachia from the f ilarial- nematod.e MansoneLl-a ozzardi. Parasit. Res. 87 :4L7 -420 .
Cassidy, ,f . R. , and P. ,J. pukki]a. j.987. Inversion of 55 ribosomal RNA genes within the genus Coprinus. Curr. Genet. L2:33-36.
Cavafier-Smith, T. 1989. The kingdom Chromista. .Tn The Chromophyt.e algae: problems and perspectives. EdiEed by J. C. creen, B. S. C. L,eadbeater, and W. L. Diver. 234
Systematics Assoc. Special Vol . No, 3g. Cfarendon Press, Oxford. pp. 381-407.
Charfesworth, 8., p. Sniegowski, and W. Stephan. 1994. The evofut.ionary dynarnícs of repet.itive DNA in eukaryotes. Nature 3'7 L :21-5-220 .
Chipev, C. C., and A. p. Wolffe. !992. Chromosomaf organizat.íon of Xenopu s Jaevis oocyte and somaE.ic 5S rRNA genes in vivo. Mof. Ceff. Biof. j"2:45-55. Cíhlar, R. Ir. and P. S. Slæherd. L980. The organization of the ribosomal RNA genes in the fungus Mucor racemosus. NucTeic åcids Res. 8:793-804.
Cilibert.o, G,, c. Raugei, F. Costanzo, L. Dente, and R. Cortese. 1983, Common and int.erchangeable elements in the promoters of genes transcribed by RNA polymerase III . Ce_Z_Z 32:'725-733.
C1oíx, C., S. Tutois, O. Mathieu, C. CuviLLier, M. C. Espagnol, G. Picard, and S. Tourmente. 2000. Analysís of 5S rDNA arrays ín arabìdopsis thajianâ: physical mapping and chromosome specific polymorphisms. Genome Res . 10 :619-690 .
Co1t, W. M. and R. M. Endo . 1972. Ultrastructuraf changes in Pythiun aphanidermatum zoospores and cysts during encystment, germination and penetrat.ion of primary lettuce roots. phytopathoLogy 62:751 (Abstract.). Comb, D. G., and S. Kat.z. 1-964. Studies on the biosynthesis and methylation of transfer RNA. ,J. Mof. BioL. 8:790_ 800. Cooke, D.E.L., Kennedy, D.M., cuy, D,C., Russel, J., Unkles, S.E, and Duncan, J.M. 1996. Relat.edness of Group r species of phyEophEhora as assessed by randomly amplified polymorphic DNA (RÃpDs) and sequences of DNA. MycoJogicaL Res. 100 29j_303. Cooke, D. E. L., and .T. M. Ðuncan. 1997. phylogenetic analysis of phytophtåora species based on fTSl and fTS2 sequences of the ribosomal RNA gene repeat. MycoL. Res. 101:667-6"77 . 235
Cooke, D. E. L,, A. Drenth, ,f. M. Duncan, G. Wagels, and C. M, Brasier. 2000. A molecular phylogeny of Phytophthora and ref at.ed Oomycetes. Fungaj Genet. Biof . 3A:I'1 -32 .
Cruces, .T., M. Diaz-Guerra, I. ci1, and ,f. Renart. 1999. The 55 rRNA-histone repeat in t.he crustacean ArL.emia: structure, polymorphism and variaLion of the 55 rRNA segment. in dífferenE. populations. Nucfeic Acids Res. L7:6280-6297.
Cunningham, R. S., and M. W. Gray. I97'l . Iso:-ation and characteri zat.ion of 32p-labefed mit.ochondriaf and cytosof rj-bosomal RNA from germinat.ing wheat embryos. Biochim. Biophys . Acta 415:4j6-49L.
Dassanayake, R. S., N. V. Chandrasekharan, and. E. H. Karunanayake. Trans-spliced leader RNA, 5S_ïRNA genes and novel variant orphan spliced-leader of the lymphat.ic fifariat nematode Wuchereria bancrofti, and, a sensitive polymerase chain react.ion based detection assay. Gene 269: 185 -193 . De Bary, A. 1886. Researches into the potato fungus, PhytophEhora infestans, ,J. R. Agric. Soc. Engf. L2:239-269 .
De Cock, A. W. A. M., A. M. Mendoza, A. A. padhye, A. A. Ajello, and L. Kaufman. L987. pythium insidiosum sp. nov. The Etiologic Agent of pythiosis . ,f. CJin. Microbiof.25:344-349
Ðe Cock, A. W. A. M., euail A., Descaize R., Mayes C., Lévesque C. A. 1998. Identification and detection of Pythium species by reverse dot blot hybridizatíon. 7rh fnternational Congress of plant pat.hology, 9- j_6 August 1998, Edinburgh, Scot.fand, Abstract 3 .3 .26. de la Herran. R., M. A. Garrid.o-Ramos, J. f. Navas, C. R. Rejon, M. and R. Rejon. 2000. Mol_ecular characteri zat.ion of the ribosomal- RNA gene region of Perkinsus atianticust its use in phylogenetic anal.ysis and as a target for a molecular diagnosis. Paras itoLogy L20 : 3 45-353 . 236
Defihas, N. and .T. Andersen. 1-982. Generafized structures of the 55 ribosomal RNAS. NucLeic Acids Res. 1,0 (22\ t7323-7344.
Dj-ck, M. W. 1969. Morphology and E.axonomy of L.he Oomycetes with special reference Eo Saprolegníaceae, Leptomitaceae and pythiaceae. I. Sexual reproduct.ion. Nevr PhytofogisL 68 :'l5I-7'15.
Ðick, M. W. 1990. Keys Eo pyEhiun. M. W. Dick, Reading, UK. Pp. 1-64.
Dick, M. W. 2001. The peronosporomycetes . .rn The Mycota Vff Part A. Edited by Mc],aughlin, t'lcl_Jaughlin, and Lemke. Springer-Verlag Berlin Heíde1berg. pp. 39-72. Diez, 8.. A. C. pedros, R. Massana. 2001. Study of genetic diversity of eukaryoE.ic picoplankL.on in different oceanic regions by smal1 subunic rRNA gene cloning and sequencing. App7. Environ. MicrobioJ. 67 :2932_2941_. Dimitrov, S., c. Almouzni, M. Dasso, and A. p. Wolffe. 1993. Chromatin transitions during early Xenopus embryogenesis: Changes in hist.one H4 acetylat.ion and in finked histone t]æe. Dey. BioJ. L60:2L4_227 .
Drouir:., G, , ,f . D. Hof fman, and W. F. Dool-ittf e. 19g7. Unusual ribosomal RNA gene organization in copepods of t.he genus CaJ-anus. J. Moj. BioL. 196:943-946
Drouin, G,,J. M. Sevigny, I. A. McIraren, ,J, D. Hofman, and W. F. DoolitE.e. 1992. Variable arrangement. of 55 ribosomaf genes within the ribosomal DNA repeats of arthropods. Mol. Biof. Evoj. 9:826-g35. Drouin, G, and Moníz de Sá, M. 1995. The concerted evolution of the 55 ribosomal- evolution of 55 genes finked to the repeat units of other multigene families . Mof . Biol . Evof. !2 ¡ 48L-493 .
Duchesne, L. C., and ,f . B. Anderson. 1990. Location and direction of t.he 55 rRNA gene in ArmiLlaria. MycoL. Res. 94 2266-269 - paulus, Ebe1, C. , C. Frantz, F. and p. Iirìlcauf t . L999 . Trans-splicing and cis-splicing in the colourless 237
Euglenoid, Entosiphon suJ.catum. Curr. cenet. 35:542_ s50.
Efson, D. 1-96L. A ribonucleic acid partícle released from ribosomes by salt. Biochim. Biophys. AcEa 53:232_234.
Elson, D. 1961. The ribosomal t.ransf er RNA: fdent i f icat.ion, ísofation, locat.ion and propertíes, Biochim. Biophys. Acta 80:319-390 .
Ford. P. ,f ., and E. M. Southern. 1973. Different sequences for 55 RNA in kidney and ovaries of Xenopus l-aevis. Nature New BioL. 24L:7 -I2 . Forest, F., and A. Bruneau. 2000. phylogenetic analysis, organizatíon, and mol_ecular evofution of the nontranscríbed spacer of 5S ribosomaf RNA genes in Coryfus (BetuÌaceae) Int. ,f . pjant. Sci. L6L:793_g06. Forget, B. G., and S. M. Weissman, L967. Nucl-eotide sequence of KB cefl 55 RNA. Science 15g:1695_1699. Förster, H., M. D, Coffey, H. Efwood, and M, L. Sogin, 1990. Sequence analysis of the smafL subunit ribosomaf RNAs of three zoospric fungi and implicat.ion for fungal evolution. MycoTogia 82:306-312 .
Förster, H., M. P. Cummíngs, and M. D. Coffey. 2000. Phylogenetíc relationships of phytophthora species based on ribosomal ITS I DNA sequence analysis wit.h emphasis on Waterhouse groups V and VI . Myco7. Res. 104:1055-1061.
Fox, G, 8., and C. R. Woese, L9j5. 55 RNA secondary st.ructure. Nature 256 : 505-507.
FranLz, C., C. Ebel, F. paulus, and p. hbauf t. 2000. Charact.eri zation of trans-splicing in EugJ.enoids. Curr. Genet. 37:349-355.
Frederiksen, S., H, Cao, B. Lomho1t, G, Levan, and C. Hallenberg. 1997. The rats 55 rRNA bona fide gene repeat. maps to chromosome 19q12*qter and the pseudogene repeat maps to L2qL2. Cytogenet. Cefl GeneL.. 76:L0L-1,06. 238
Free, S, ,f ., P. W. Rice, and R. L. Metzenberg. L979. ArrangemenL of the genes coding for ribosomal nucleic acids in Neurospora crassa. ,J. Bacterioj. L31 , L2L9- L226.
Fu11er D. 1990. Hyphochytríomycot.a. In Handbook of Protoctista, L. Margulis, ,.t. O.iorliss, M. Melkonían, D. rT. Chapman, Eds. ,lones and Bartlett., Boston. pp. 380-387.
Galibert, F. C. ,f. Larsen, .T. C. Lefong, and M. Boiron. 1965. RNA of fow molecular weight. in ribosomes of mammalian cel1s. NaEure 20i :L039-i,04!. Gaubatz, .7., and R. c. Cutfer. L975. Hybridization of ribosomal RNA labefed t.o high specífic radtioactivity with dimethyl sulfate. Biochemistry !4:.1 60-.t64. Gerbi, S. A. 1985. Evolution of ribosomaf DNA. Jn Molecufar evofutionary genetics. Edited by R, MacIntyre, pfenum, New York, pp. 419-517.
Gerlach, W. L., and T. A. Dyer. 1980. Sequence organization of the repeat.ing units in the nucleus of wheat which contain 55 rRNA genes. NucJ-eic Acids Res. g:4g51_4g65.
GiLson, P. R., G. ,J. Adcock, B. ,t. Howfett, and c. f . McFadden. 1995. Organisation and sequence analysis of nuclear-encoded 55 ribosomal RNA genes in cryptomonad algae. Curr. Genet. 2j:239-242.
Gniadkowski, M., ,J. Ffett. p. Borsuk, D. Hoffman- Zacharska, P. P. Stepien, and E. Bartnik. 1991. Struct.ure and evofution of 55 rRNA genes and pseudogenes in the genus ,4,spergri7lus. ,J, Mof . Evof . 33 : 175-17g .
Gockel, c., and W. Hachtel . 2000. Compfete gene map of the plastíd genome of the nonphotosynLhetic eugleoid flagellate Astasia 7onga. protjst L5L:34j_35!.
Goremykin, V., V. Bobrova, !T. pahnke, A. Troitsky. A. Antonov, and W. Martin. 1996. Noncoding sequences from the slowly evolving chloroplasts inverted repeat ín addition t.o rbcl, data do not support gnetalean affiníties of angiosperms. Mo1. Biol-. Evol . 13:3g3_ 396. 239
Gorman, S. W., R. D. Teasda1e, and C. A. Cuffis. !992. Structure and organization of the 55 rRNA genes (55 DNA) in Pinus radiata (pinaceae). p-Z. Syst. EvoJ. L83:223-234.
Gottfob-McHugh, S. G., M. Levesque, K. Mackenzie, M. Ofson, O. Yarosh, and D. A. ,fohnson. 1990, Organization of the 55 rRNA genes in the soybean Gfycine max (L.) Merrilf and conservat.ion of the 55 rDNA repeat. structure in higher plant.s , Genome 33:4g6-494. cray P. W., and R. B. Haflick. L978. physical mapping of E}]e EugJena graciTis chloropl-ast DNA and ribosomal RNA gene region . Biochemistry I7:284-289.
Gunderson, ,.T. H., H. Elwood, A. fngold, K. Kindle, and M. I-.,. Sogin. 1987 . phylogenetic relat.ionships bet\^reen chlorophyt.es, chrysophytes, and oomycetes. proc. Natf. Acad. Sci. USA 84:5823-5821 . cuLe11, R. R., and Fox¡ c. E. 1988. Compílatíon of large subunit RNA sequences presented in a struct.ural format. Nuc7. Acids Res. 16:rL75-r2i0.
Hafl-, B. D., S. c. Cfarkson, and G. Tocchini -Valentini . 1982. Transcriptíon ínitj_ation of eukaryot.ic transfer RNA genes . Ceff 29:3-5.
Harper, M. E,, J. Price, and L. ,f . Korn. 19g3. Chromosomal- mapping of Xenopus 55 genes: Somatic-type versus oocyte-tl4)e. Nucfeic,4cjds Res. !1_:23!3-2323. Hartfey, M. R. 1979. The synthesis and origin of chloroplast low-molecular-weight ribosomaf rj.bonucleic acid in spinach. Eur. ,f. Biochem. 96:311-320.
Hart. R. P, and ,f . p. Fofk, 1982. Structure and organization of a mammalian 5 S gene cluster. ,f. Biof, Chem . 257 : f]-'l 06 - 1,I7 !1- .
Hatlen, L. 8., F. Ãma1di, and G. Attardí . 1_969. OÌigonucleotide pattern after pancreat.ic ribonuclease digestion and the 3, and 5' termini of 55 ribonucleic acid from HeLa cel_l"s . Biochem. g(12) :49g9_5005. 240
Hat.Len, L., and G. Attardi . f9j!. proport.íon of the HeLa cel1 genome complementary to transfer RNA and 55 RNA. ,J. Mof. Biof. 56:535-553 .
Hemleben, V., and D. Werts. j-999, Sequence organization and puE.ative regulatory elements in the 55 rRNA genes of two higher plants (Vigna radiaEa arld Matthiofa incanal . Gene 62': !65-169 .
Henderson, A. S., K. C. Atwood, and D. Warburton. 1_9i6. Chromosomal distribution of rDNA in pan paniscus, Goriffa goriTTa beringei, arrd SgphaLangus syndacEyTus: Comparison to relat.ed primates, Chromosoma 59:!41 -!55 .
Hendrix, F.F. ,fr., and K. E. papa. 1974. Taxonomy and genet.ics of pythium. proc. Äm. phytopat.h. Soc. 1:200_ 207 .
Henning, W., and B. Meer. 1971. Reduced polyt.eny of ribosomaf RNA cistrons in giant chromosomes of DrosophiTa hydei. NaEure New Biof. 233:.lO-72.
Hernandez -Rivas, R., S. Martinez -Cal-vi 11o, M, Romero, and R. Hernandez. L992. Trwanosoma cruzi 55 rRNA genes: Molecular clonj-ng, structure and. chromosomal organiza,tiorr. FEMS Microbiof. Lett. 92:63-67. Hershey, N. D., S. E. Conrad, A. Sodja, p. H. yen, M. Jr. Cohen, and N. Davidson. 1977. The sequence arrangement of Dz:osophiTa meTanogaster 55 DNA cloned in recombinant plasmids . Cejf l-l-:5g5-59g. Hindley, ,f ., and S. M. page. 19?2. Nucleotide sequence of yeast 55 ribosomaL RNA. F EA^S Lett. 26:157_160.
Ho, C. L. 1-975. population st.udies of the genus pyL_hi um. Ph.D. thesis of the University of Reading, UK.
Ho, H. H., and S. C. ,fong. !990. HaTophytophthora gen. nov. t a new member of the famiJ.y pythiaceae. MycoEaxon 36:371-382 .
Hofman, .f . D., R. H. Lau, and W. F. Doolittle. 1979. The number, physical organization and transcription of ribosomal RNA cistrons in an archaebac terium: 241
Hafobacteriunt hafobium. Nucfeic Acids Res. .l:I32!- 1333.
Hoffmann, J., T. Winckfer, A. Hanenkamp, M. Bukenburger, G. Schumann, and T. Díngermann. 1993, The Dictyostefium discoideum 55 rDNA is organized in the same transcriptionaf orientation as the other rDNAs. Biochem. Biophys, Res, Connun. 191:55g-564.
Howfett, 8. ,f ., Brownfee, A. G., Guest, D. I., Adcock, G. .f ., and McFadden, c. I. 1992. The 5S ribosomal RNA gene is linked Lo large and smal1 ribosomal RNA genes ín the oomyceE.es, phytophEhora vignae, p. cinnamomi, P. megasperma f ,sp. gTycinea and ,saprol.egnia ferax. Curr. Genet. 22:455-461,. Hunsley, D. 1973. Apical wal1 structure in hyphae of Phytophthora parasitica. New phytoLogisE. 12 z98O-990.
Jacq, C., .I . R. Miller, and G. G. Brownlee. 1,977 , A pseudogene st.ruct.ure in 55 DNA of Xenopus faevis. CeLJ- !2 :1-09 -120 .
Jarsch, M., J. AfLenbuchner, and A. Bock. 19g3 physical organization of the genes for ribosomaf RNA in Methanococcus vannieTii, Mof. Gen. Genet. 199 4!_47. ,Jenni, 8., and E. Stutz . lgjg. physical. mapping of the ribosomal RNA gene region of. EugJena gracilis choloplast DNA. Eur. ,f. Biochem. 88:L2j-L43.
.Jensen, L. R. and S. Frederiksen, 2000. The 55 rRNA genes ln Macaca fascicuTari,s are organized in two large tandem repeats . Biochimica et Biophysica Acta L492 :531 -542 .
Kandolf, H. L994. The H1A hist.one repressor is an jn rzj vo repressor of oocyte-t.ype 5S gene L.ranscripL.ion in Xenopus Taevis embryos. proc. Natf. Acad. Sci. USA 9L:1257 -7261- .
Kawar-, H. , H. Mut.o, T. Fu j ii, and A. Kat.o . 1995 . A f inked 55 ÏRNA gene in Scutosiphon fomentaria ( Scytos iphonal es , phaeophyceae) . ./. phycoJ. 31:306_ 311. 242
Kawai, H,, Nakayama, A., Inouye, I., and Kato, A. 1997, Linkage of 55 ribosomal DNA to other rDNAs in the chromophytic algae and related t.axa. L7- phycoL. 33:505-511.
Kay, B. K. and ,.T. c. calf . 1981. 55 ribosomal RNA genes of the newL NotophthaTmus viridescens. Nucjeic Acids Res. 9:6451 -6469 . Ke11er, M., L. H. Tessier, R. L. Chan, ,J. H. Weif , and p. Imbault.. 1992. In Eugl-ena, spliced-leader RNA (SL-RNA) and 55 rRNA genes are tandemly repeated. NucJeic Acids Res. 2 0 :1'7 !1--1-'7 !5 .
Kim, W. K., T. Zerucha, and G. R. KLassen, 1_992. A region of heterogeneity adjacenL. to the 55 ribosomaL RNA gene of cereaf rusts. Curr. cenet. 22:!01"-L05.
Kiss, .A., B. Sain, and p. Venetianer. L9'l j . T]ne number of rRNA genes in Escherichia cofi. FEBS LetE. j9:j.t-79.
KJ.assen, c. R., Balcerzak, M., and de Cock, A. W. A. M. L996. 55 ríbosomal RNA gene spacers as species_ specific probes for eíght species ot pythium. PhytopaEh. 86 : 581-587. Kfassen, G. R., and Buchko, ,f. 1990. Subrepeat st.ructure of the intergenic region in the ribosomaf DNA of the oomyceL.ous fungus pyEhium ufEimum. Curr. Genet. L'l :L25-L27 .
Kobayshi, N. and S. Akai. 1-974a. Studíes on the encysLment of zoospores ín pyEhium aphaniderma tum, Fine struct.ure of zoospores. ?rans. Mycoj. Soc, Japan 15:35g-364. Kobayshi, N. and S. Akai. 1-974b. Studies on the encystment of zoospores in pythium aphaniderma Ëum. Fine structuïe of zoospores. Trans, MycoL. Soc. ,fapan 15:365_369,
Kolchinsky, 4., M. KoLesnikova, and E. Ananiev. 1991-. Portraying of pfant genomes using polymerase chain react.ion amplification of ribosomaf 5S genes. Genome 34:1028-1031.
Korn, L. M. and D. D. Bro\^n. I9jg. Nucleotide sequence of Xenopus boreaLis oocyte 55 DNA: comparíson of 243
sequences that flank several related eukaryotic genes. CeLT t5:1145-1156.
Kossel, H., K. Edwards, E. Fritzsche, W. Koch, and Z. Schwarz. 1983. Phylogenetic significance if nucleot.ide sequence analysis. .Zn protein and Nucleic ecids in Plant. Syst.ematics. EdiEed by U, .Tensen and D. E. Faírbrot.hers. Springer-Verfag, Berlin, pp. 36-57.
Kramer, R., P. ehí11ippsen, and R. W. Davis. L97g. Dívergent transcript.ion in the yeast ribosomal RNA coding region as shown by hybridization t.o separated strands and sequence analysis of cloned DNA. ,_I. ryoJ. Biof . 1,23 : 405- 4L6 .
Kuntzef, H., B. Piechuffa, and U. Hahn. 19g3. Consensus structure and evolut.ion of 55 rRNA. ivuc]e ic Acids Aes. 11 (3 ) :893-910.
Ladiges, P. Y., c. t. McFadden, N. Middleton, D. A. Orlovich, N. Trefoar, and F. Udovicic . L999. phylogeny of Mefafeuca, CaTfistemon, and related genera of t.he Beaufortia suballiance (Myrtaceae) based on 5S and fTS-1 spacer regions of nrDNA. CLadistics L5:L5!_1_.]-2.
Lang, B. F., L. ,J. Goff, and M. W. cray. 1996. A 55 rRNA gene is present in the mitochondrial genome of the protist Recfinomonas americana but. is absent from red algal mitochondriaf DNA. ,_i- Mof. BioL. 26Lz40: -4L3.
Lang, B. F., c. Burger, C. J. O,Kel_Iy, R. Cedergren, c. B. Golding, C. I_,emieux, D. Sankoff, M. Turmel, and M. W. Gray, L997. An ancestraf mitochondrial DNA resemblíng a eubacterial genome in miníat.ure. Nature_London 381 :493-491 .
Lapitan, N. L. V., M. W. Ganal , and S. D. Tanksley. !99L. Organizat.ion of the 55 ribosomal RNA genes in the genome of tomato. Genome 34:509-514.
Leander, C. A. and D. port.er. 2001 . The l_.,abyrinthulomycota is comprised of three distinct lineages . MycoJogia 93 ;459 -464 .
Leaver, C. ,I ., and M. A. Harmey. 1976. Higher_pfant mitochondrial ribosomes contain a 55 ribosomal
ribonucLeic acid componenE. Biochem. ,J. IE.l :2.:-5_2j7 . 244
Leblanc, C., C. Boyen, R. Odile, c. Bonnard, LJ. M. Grienenberger, and B. Kloareg, 1995. Complete sequence of the mitochondrial_ DNA of the rhodophyte Chondrus crispus (Gigartj.nafes): Gene content and genome organizatiorL. J. Mo7. Bio7. 2SO:484-495. Lee, S. 8., and ,f . W. Tayfor. 1992. phylogeny of five fungus-1ike Protoctistan phytophthora species, inferred from the internaf transcribed spacers of ribosomaf DNA. Mo-l. Biof. Evof. 9:636-653.
Lee, S.8., White, T.J. and Taylor, ,f .W. 1993. Detection of Phytophthora species by oligonucf eotide hybrídization
of ribosomal DNA sequences, phytopathojogy g3:j_-t7-L91 .
Lee, Y., A. M. Erkine, D, f. Van Ryk, and R. Nazar. 1995. In vivo analysis of the j.nternal control region in the 55 rRNA gene from Saccharomyces cerevisiae. Nucfeic Acids Res. 23:634-640 . Leipe, D. D., P. O. Wainright, J. H. cubderson, ,J. porter, D, J. Patterson, F. V1ois, S. Himmerich and M. L. Sogin. 1994. The stramenopiles from a mofecufar perspective: 16S-Like rRNA sequences from LabyrinthuToides minuta and Cafeteria roenbergensis. PhycoTogia 33 :3 69 -377 .
Lenardo, M. ,f ., Dorfman, D. M., Reddy, L. V,, and. Donelson, ,J. E. l-985 . Charac teri zat.ion of the TrJrpanosoma brucei 55 ribosomal RNA gene and transcript: the 55 rRNA is a spl iced- leader- independent species. Gene 35:131_141.
Lévesque, C. 4., de Cock, A. W. A. M., euail, A., and Gorman, D. O. 1-999. Molecular phylogeny evolut.ion and mofecufar groups of pythium arrd phytopht.irora species based on ribosomal DNA. CpS/ApS 99 Mont.reaf (Àbstract) .
Lie\¡¡, E.C.Y. , Maclean, D.LT, and Irwin, J.A.G. 199g. Specific PCR based detection ot phytophthora medicaginis using t.he intergenic spacer region of the ribosomal DNA. Myco1. Res. 102:73-g0.
Liu, L. X., ,f . Chi, M. p. Upton, and L. R. Ash. 1995. uosinopbilic cofitis associaLed. with larvae of the pinworm Enterobius wermicufaris, Lancet. 346:4L0-4L2. 245
Liu, L. X., M. L. Blaxter, and A. Shi. 1996. The 55 ribosomal RNA int.ergenic spacer region of parasit.ic nematodes: variation in size and presence of SLI- RNA. Mof. Biochem. parasitoJ. g3:235-239. Long, E. O., and I. B. Dawíd. 1990. Repeated genes in eukaryot.es . Annu. Rev. Biochem. 49 :72j -.1 64 .
MacKay, R. M,, D. Salgado, L. Bonen, E. Stackebrandt, and W. F. Dool-ittfe. 1982. The 5S ribosomal RNAS of Paracoccus denitrif ican.s and prochforon. NucJeic Acids Res . 10 :29 63 -29'7 0 .
Magalhaes, P. !T., A. L, Andreu, and E. A. Schon. 199g. Evidence for the presence of 55 rRNA in mammal ian mitochondria. Mof. Biof. CefL 9:23.15-23g2. Magee, B. 8., T. M. Ð,Souza, and p. T. Magee. 3,99j. Strain and species identificat.ion by restricLion fragment fength polyrnorphisms in the ribosomal DNA repeat. of Candida species .,J. Bacteriof . L69:l-639_1643. Maicas, S., A. Àdam, and .T. polaina. 2000. The ribosomaf ÐNA of the Zygomyc ete Mucor miehei. Curr. Genet. 37:41-2-41"9.
Mairy, M., and H. Denis. L971_. Recherche biochemique sur 1'oogenese. f. Synthese at accumulat.ion du RNA pendant. 1'oogenese du crapaud sud-african Xenopus Laewis. Dev. BioJ-. 24:143-165
Maizels, N. 19'76. Dictyostefiun !.].5, 25S, and 55 rDNA fie within a 38,000 base pair repeat.ed unit. Ce_Z_Z 9:431-_ 438.
Mao, rT., B. Appef, ,.T. Schaack, S. Sharp, H. y. yanada, and D. Sofl . 1-982. The 55 RNA genes of Saccharomyces pombe. NucLeic .4cids Res. 10:4g7-500. Margolin, 8.S., p. W. carrett-Engele, ,f. N. Stevens, D. y. FriLz, C. carrett-Enge1e, R. IJ. Metzenberg, and E. U. Selker. 1998. A met.hylated Neurospora 55 rRNA pseudogene contains a transposabfe efement inactivat.ed by repeaL.-induced poínt mutat.ion. Genetjcs !49,:L1gl-_ t79't. ¿+o
Martins. C., and p. M. cafetti, ,Ir, 2001. Organization of 5D rDNA j.n species of the fídn Leporinus: two different genomic focatíons are characterized by díst.inct nontranscríbed spacers . Genome 442903-9L0.
Matsumoto, C., K. Kageyama, H. Suga, and M. Hyakumachi. 1999. Phylogenetic relat.ionships of pyEhium species based on ITS and 5,8S sequences of t.he ribosomaf DNA. Mycoscience 40 :32!-33L ,
Maxam, A. M., and !V. Gilbert, L9i7. A new method for sequencing DNA. proc. Natj. Acad. Sci. USA 74:560_564
McNabb. S. 4., Eros, R. W., and Kfassen, c. R, 19g7. Presence and absence of large invert.ed repeats in the mitochondrj_al DNA of Hyphochytriomycetes . Can ,f. Bot. 66 t 2371 -237 9 .
Middfeton, J. T. l-943, The taxonomy, host. range and geographic and distribution of the genus pythium. Torrey Bot . CJub 20 :1-1'11, .
Miller, L. L973. Cont.rol of 5S RNA synthesis during early devel-opment of anucleofate and. part.ial nucfeolate mutants of Xenopus J-aevis. J CeJj Biof. 59:624_632. Miller, L. L974. Metabofism of 5S RNA in the absence of ribosome production. CefJ 3 :275-2g7.
Möfler, E. M., Bahnweg, c., Sandermann, H., and Geiger, H. H. L992. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruít bodies, and infected plant tissues. Nuc_2. Acids Res. 20:6115-6116.
Moran, c. F., D. Smith, ,f . C. 8e11, and R. Appels . 1,992. The 55 RNA genes in pjnus radiata and the spacer region as a probe for relationshíps between pi¡us species. pl_. Syst. Evoj. L83:209-22L.
Nelson, D,, R. M. Linníng, p. ,.f . Davison, and B. M Honda. 1998. 5,-Flanking sequences required for efficient t.ranscription in vitro of 55 RNA genes, in t.he related nematodes Caenorhabditis elegans arrd. Caenorhabditis briggsae. Gene 2L8 :9 -1,6 . 247
Newhook, F. J., Waterhouse, G. M., and St.amps, D. ,I. 1979. Tabular key to the species of phytophtåora de Bary. Mycol . Pap. 143. Commonw. Mycol . Inst., Kew, Surrey, Engfand. Pp. 1-20.
Nierlich, D. P. 1982. Fragement.ary 55 rRNA gene in the human mitochondrial genome. Mof. CejJ. BioJ. 2:207- t^o
Nishikawa, K,, and S. Takemura. J"9j4. Nucfeotide sequence of 55 RNA from ToruTopsjs utj1 js. FEBS Lett. 40 (1) :106-109.
O'Brien, T. W., and D. E. Mathews . L976. Mitochondrial_ ribosomes . Handb. Genet. 5:535-580.
Ogihara, Y., K, Isono, T. Kojima, A. Endo, M. Hanaoka, T. Shiina, T. Terachi, S. Utsugi, M. Murata, N. Mori, S. Takumi, K. Ikeo, T. Gojobori, R. Murai, K. Murai, y, Matsuoka, y. Ohnishi, H. Tajiri, and Koichero Tsunewaki. 2000. Chinese spring wheat (?riticum aestivum L.) chloroplast genome: Compfete sequence and contig clones, pLanE Mof. Biof. Report. J-g:243-253. Palmer, ,J. D., and Thompson, W. F, 1991, Rearrangements in the chloroplast genomes of mung bean and pea, pnoc. NatJ-. Acad. Sci. USA 78:5533-5537.
Palmer, ,J. D., and Thompson, W. F. 1992. Chloroplast. DNA rearrangemenLs are more frequent when a large inverted sequence is lost . CejJ. 29:53'l-550.
Panabières, F., M. ponchet, V. A11asis, L. Cardin, and p. Ricci. 1997. Charac teri zat.ion of border species among Pythiaceae: several pythiun isolates produce eficitins, typical proteins from phyEophtåora spp. Mycof . Res. l-01 :L459-L468.
Pardue, M. L., D. D. Bror4¡n, and M. L. Birnst.ieI. L973. Location of the genes for 55 ribosomal RNA in Xenopus faevis. Chromosoma 42 : 1-9I-203 .
Park, Y. K., K. C. park, C. H. park, N. S. Kim. 2000. Chromosomal focalization and sequence variat.ion of 55 rRNA gene in five Capsicum specíes. Mof. CejLs. 10:1g_ 24. 248
Patterson, D. .I. 1989. Stramenopifes: chromophytes from a protistan perspect.ive. In: Gïeen, ,1 . C., Leadbeater B, S. C., and Ðíver, W. L. (eds.): The chromophyte algae problems and perspectives. Cfarendon press, Oxford, pp. 357-379.
Pederson, D. S., M. C. yao, R. Kimmel, and M. A. Gorovsky. 1984. Sequence organization within the flanking clusters of 55 ribosomaf RNA genes ín Tetrahgena, NucJ-eic Àcids Res. L2:3003-3021 . Pelficcia, F., R. BarzoLti, E. V. Vo1pi, E. Bucciareffi, and A. Rocchi. 1998. Nucleotide sequence and chromosomal- mapping of the 55 IDNA repeat of the crust.acean ProaseLius coxafis. Genome 4L:1_29-1_33. Pendas, A, M., P. Moran, .I. p. Freije, and E, Garcia_ Vazqvez, 1994. Chromosomal mapping and nucleot.ide sequence of two tandem repeat.s of Atlantíc salmon 55 rDNA. CytoErenet. Ceff Genet. 6'7:3L-36. Persson, C. 2000. phylogeny of the neotropical AJibertia group (Rubiaceae), with emphasis on the genus ATibertia, inferred from fTS and 55 ribosomal DNA sequences . Amer, ,J. Bot. B7 :1018_1029.
Peterson, R. C., .f. L. Doering, and D. D. Brown. 1990. Charact eri zat.ion of two Xenopus somatic 55 DNAS and one minor oocyte-specific DNA. Ceff 20:L3l._1_41
Pieler, T., B. Appe1, S. L. Oei, H. MentzeL, and V. A. Erdmann. 1985a. point. mutational analysis of the Xenopus faevis 5S gene promoter. EMBO 4:1g47_1g53.
Pieler, T., S. L, Oei, ,.T. Hainrn, U. Engelke, and V. A. Erdmann. 1985b. Functionaf d.omains of the Xenopus faevis 5S gene promoter. EMBO 4:375L-3l-56.
Pieler, T. , ,.1. Hamm, and R. c. Roeder. L987. The 55 gene internaL control region is composed of three distinct sequence elements, organízed as two funct.ional domains with variable spacing. Cell 4g:91-100. Pieler, T. and O. Theuníssen. 1993. TFIfIA: nine fingers_ t.hree hands? Trends Biochem. ,gci. i.g :226_230. 249
Pringsheim, N. 1858. Beiträge zur MorphologJ_e und Systematik der .Algen. 2. Die Saprolegnieen. ,_Ib. r¡dss. Bot. L:284-306.
Pukkila, P. J. and A. R. Cassidy. 1_987. Varying patterns of ribosomal- RNA gene organizat.ion in basidiomycet.es . .rn Evolutionary biology of the fungi. EdiEed by A. D. M. Rayner. C. M. Brasíer, and Ð. Moure. Cambridge U. Press, Cambridge, pp. 75-82. Quincy, R. V, 1971. The number and focat.íon of genes of DrosophiTa meTanogasEer. Biochem. ,J. L23:227 -233. Rawson, ,T. R. Y., S. R. Kushner, D. Vapnek, N. K. Afton, and C. L. Boema. 1978. Chloroplast ribosomaf RNA genes in EugTena graciTis exist. as three ctustered. tand.em repeafs . Gene 3:]-9L-209 .
Renkawítz-Pohl , R. 1978. Number of repetit.ive euchromatic 55 RNA genes in polyploid tissues of DrosophiTa hydei. Chromosoma 66 : 249 -258, Ristaino, J.8., Madrit.ch, M., Tïout, C.I_,. and parra, c. 1998. PCR amplificat.ion of ribosomaf DNA for species identificat.ion in the plant paLhogen genus Phytophthora. Appl- Envir. MjcrobioL. 64:94g_954. Ritossa, F. M., and S. Spiegelman. 1965. Localization of DNA compl.ement.ary t.o ribosomal- RNA in the nucleoLus organizer region of DrosophiTa meTanogaster. proc. Nat7. Acad. Sci . USA 53 :'t37 -'I 45 .
Roberson, A. E., A. p. WoLffe, Ir. ,f . Hauser, and D. E. Ol-ins. 1989. The 55 RNA gene minichromosome of Eupfotes. Nucfeic ,4cjds Res. L7:4699-4j1-2.
Rombay, P., E. Westhoff, R. Toukimpa, R. Mache, ,f. p. Ebef, C. Ehresmann, and B. Ehresmann. 19gg. Higher_order structure of chloroplast.ic 55 ribosomal RNA from spinach. Biochemistry 2j : 4j2L-4'130.
Rombay, P., C. Brunel, E. Westhoff, F. Baudin, p. ,J. Romaniuk, R. Mache, C. Ehresmann, and B. Ehresmann. l-991, The solution structure of spinach chloroplast and of Xenopus Laevis oocyte 55 rRNAs. -rn The t.ransl-ational apparatus of photosynthetic organelles. 250
Vol H55. Edited by R. Mache, E. Stutz, and A. R. Subramaniam. Springler-Ver1ag, Berlin, pp. 3l-
Rombout, Y, 8., S. Bosch, and ,1 , W. B. van d.er Giessen. 2001. Detection and ídentification of eight TrichineTTa genot]T)es by reverse line blot hybridization. ,f. Clín. Micro. 39 642-646.
Rosenbaum, J. 19L'l . Studies of the genus påytophthora. .L Agric. Res. 8:233-2'1 6.
Rosset., R. , R. Monier, and ,J. ,fulien. 1964. Les ribosomes d'escherichie coli. I. Mise en evid.ence d,un RNA ribosomique de faible poids moleculaire. Buff. Soc. Chin. Biol-. 46:87 -L09 . Rozek, C. E. and W. E. Timberlake. 1979. Restriction endonucfease mapping by crossed contacL. hybrídizat.ion: The ribosomal RNA gene of Achtya ambisexuafis. Nuc-Zeic Acids. Res. 7 :1567 -15'l I .
Rubacha, 4., W. Sumner Iff, IJ. Richter, and K. Beckingham. 1984. Conserved 5, flank homologies on dipt.eran 55 RNA genes that would funct.ion on 'A, form DNA. lVuc]eic Acids Res. 12:8L93-820i .
Rubstov, P. M., Musakhanov, M. M., Zakharyev, V. M., Krayev, A. S., Skryabin, K. 8., and Bayev, A. A. 1990. The complet.e structure of yeast. ribosomaf RNA genes. I. The compleL.e nucl-eotide sequence of the 1gS ribosomal RNA gene from ^Saccha romyces cerewisiae. Nucf . Acids Ães. 8:5'179-5794. Rubin, c. M., and .T. E. Sulston. J.973. physical linkage of the 55 cistrons t.o the l-BS and 2gS ribosomal RNA cist.rons in Saccharomyces cerevisiae. ,f. Mof. Bioj. 79:.521"-530 .
Sajdak, S. L., K. M. Reed, and R. B. lhi11ips. 1998. j-ndividuaL Int.ra and int.erspecies variatíon in the 5S rÐNA of Coregonoid fish. ,7. Moj. Evof. 46:680_6g8.
Sankonju, S., D. F. Bogenhagenm and. D. D. Brown. 19g0. A control region in the centeï of t.he 55 RNA gene direct.s specific initiation of transcription: I. The 5' border of the region. CeJf 1,9:L3_25. 251
Sankonju, S., D. Ð. Brown, D. Engelke, S. y. Ng, B. S. Shastry, and R. c. Roeder. 1981. The binding of a transcríption factor to defetion mutants of a 55 ribosomal RNA gene. CelJ- 23:665-669.
Sankonju, S. , and D. D. Bro\¡m . L982. Contact points bet\^¡een a positive transcription factor and the xenopus 55 RNA gene. Ce.l. -Z 31:395-405.
Schafer, U., and W. Kunz . L9'76. Ribosomal DNA content and bobbed phenotlæe in ÐrosophiLa hydei. HerediEy 3T:351- 355.
Schlissel, M. S., and D. D. Brown. 1984. The transcriptional regulation of xenopus 55 genes in chromatin: The roles of active stabfe transcription complexes and hístone H1_. CeLJ 37:903-911. Schlöt.terer, C. and D. Tautz. L992. Slippage synthesis of simple sequence DNA. Nuc1ejc Acids Research 20:2I1,_ 21-5.
Schmickel, R. D. 1973. euantitat.ion of human ríbosomaf DNA. Hybridization of human DNA wit.h ribosomaf RNA from quantitatíon and fractionation. pediatr. Res. 1:5-!2. Schröt.er, ,J. 1897, pythiaceae. Engler and prantl, nat. PffFam. 1 (1) : 104-105.
Scott., D. , and CLark, C. , Fyf fe, A. . lrralker, M. , Tooley, P., Mass, ,_T. and Deahl, K. l-999, The use of an ol igonuc leot.ide that hybridizes to DNA sequences interspersed in the genome of members of t.he genus Phytophthora as an adjunct t.o morphological crit.eria in species identification. Moj. Biotech. 9:2j3_2.1 6. Selker, E, U., C. yanofsky, K. Driftmier, R. L. Metzenberg, B. Alzner-Ðeweerd, and U. L. RajBhandary. 19g1a. Dispersed 55 RNA genes in N. crassa: structuïe and. funcLion. CeTf 24: 819-828 .
Selker, 8.U., S. LT. Free, R. L. Metzenberg, and C. Yanofsky. 1981b. An isolated pseud.ogene rel_ated to the 55 RNA genes in Neurospora crassa. Nature 294:5j6_57A. 252
Selker, E. U. , ,J. N. St.evens, and R, L. Metzenberg. 19g5. Heterogeneity of 55 RNA ín fungal ribosomes , Science 227 : L3 40 -L3 43 .
Selker, E. U., and rT. N. St.evens. 1995. DNA methyfatíon aL asymmetric sites is associated with numerous transition mutations , proc. Natf. Acad. Sci. USA 82:8114-8118.
Selker, E. U., and .t. N. Stevens . L9g7. Signal for DNA methylation associated v¡ith tandem duplicat.ion in Neurospora crassa. Science 238:4g-53, Selker, E. U. 1991. premeiotic instability of repeated sequences in Neurospo ra crassa. Annu. Rev. Genet. 24:579-6L3.
Shippen-lenLz, D. 8., and A. C, Vezza 19gg. The t.hree 5S rRNA genes from the human malaria parasite pLasmodium falciparum are fínked. Mof. Biochem. parasjtof. 27 :263 -27 4 .
Sietsma, ,f . H., ,1 . J. Child, L. R. Nesbitt, and R. H. Haskins . 19'75. Chemístry and uLtrastructure of hyphal wa11s of pythiun acanthicum. ,J. Gen. Microbjof. g6:29_ 38.
Singh, K. S. Bhatia, and M. Lakshmikumaran. 1994. Novef variant.s of the 55 rRNA genes in Eruca sativa. Genome 31 :1-2L-L28.
Singh, D. and M. Singh. 2001. Organization of 55 ribosomaf RNA genes in tea (CanefTia sjnensis) Genome 44:!43_ L46.
Sogin, M. L. and ,1. D. Silberman. 199g. Evolution of the protists and protistan parasites from the perspective of molecular systematics. Int.. ,f. parasit.ology 2g:11_ 20.
Sommerville, C. C., S. Jouannic, and S. Loiseaux_de Goer. 1992. Sequence, proposed. secondary stïucture, and phylogenetic analysis of the chloroplast. 5S rRNA gene pyfaiel_J-a of t.he brown alga Littoralis (L,.1 KjeLjn. ,1. Mof. Evof. 3 4:246-253 . 253
Sone, T., M. Fujisawa, M. Takenaka, S. Nakagawa, S, Yamaoka, M, Sakaida, R, Nishiyama, K. T. yamaeo, N. Ohmido, K. Fukuí, H. Fukuzawa, and K. Ohyama. I9gg. Bryophyte 55 rDNA was i_nserted into 45S rDNA repeat units after the divergence from hígher plants . pjant Mo7. BioL.4I:679-685.
Sorensen, P. D. and S. Frederiksen. 1991. Charac teri zat ion of human 55 ribosomal RNA genes. NucLeic .Acids Res. t9:4L47 -41-52 .
Southern, E. 1975. Detection of specific sequences among DNA fragments separat.ed by ge1 electrophoresis. ,-7. Mof. Biof. 98:503 . Sparrow, F. K. 1976. The present status of cfassifícation of biflagellate fungi. .rn Recent advances in aquatic mycology. Edited by E. B. c. rfones . .Tohn Wif ey, Ne\,,¡ York. Pp. 21-3 -222 . Stern, D. 8., T. A. Dyer, and D. M. Lonsdal-e. I9g2. Organization of t.he mit.ochondriaf ribosomat RNA genes of maize. NucLeic.Acids .Res. 10:3333-3340. Stucki, U., R. Braun, and I. Rodít.i. 1993. Eimeria teneffa: Characteri zat ion of a 55 ribosomaL RNA repeat unit and íts use as a speci es - speci fic probe, Exp. parasit. 76:68-75.
Studnicka, c. M., F. A. Eiserling, and J. A. Lake. 19gl-. A unique secondary folding patt.ern for 5S RNA corresponds to the lowest energy homologous secondary structure in 17 different prokaïyotes. Nucteic Acids Res. 9 (8) :1885-1904.
Suzukí, H., K. Moriwaki, and S. Sakuraí . 1_g94. Sequences and evofutionary analysis of mouse 55 rDNAs. Mol.. Biof . Evof . 1"L:'7 04-71-O .
Tabata, S. l-980. StrucLure of the 55 ribosomal RNA gene and its adjacent. regions in ToruJopsjs uCjl. js. Eur. LT. Biochem. 110 : l-07-114.
Tartof, K. Ð., and R. p. perry. 19?0. The 55 RNA genes of DrosophiTa meTanogaster. ,f. MoL. Biof. 51:171_183. 254
Tautz D.¡ and Renz, M. 1983. An optimized freeze-squeeze method for the recovery of DNA fragments from agarose gels . .4na_7 . Biochem. 132:L4-L9.
Tayfor, M. ,J., and ,f . Segal1. 1985. Charac terí zat ion of factors and DNA sequences required for accurate t.ranscription of the Saccharomyces cerevisiae 55 RNA gene . ,J . Biol . Chem . 260 : 453 j--4540 .
Thurfow, D. L., T. L. Mason, and R. A. Zimmermann. 19g4. 55 RNA-1ike structures in large ribosomal subunit RNAs of f ungal mitochondria (hlæothesís ) . ¡'.EB.S Lett. lj3:271_ 282.
Tomaszewski, R. 8., and A. .Jerzmanowskí. J_99'1 . The AT-rich ffanks of the oocyte-tl4)e 55 RNA gene of Xenopus Taevis acLs as a strong 1oca1 signal for histon H1_ mediated chromatin reorganizat.ion in vitro. Nuc]ejc ,Acids Res. 25:458-465.
Tomaszewski, R., E. Mogielnicka, and A. ,Jerzmanowski, 199g. Bot.h the 55 ÏRNA gene and the AT-rich flanks of Xenopus laevis oocyte-tl4)e 55 rDNA repeat are required for histone H1-dependent repression of transcript.ion of po1 f II-t)¡pe genes in in vitro reconstitut.ed chromatin. NucLeic,åcids Res. 26:5596-560!.
Tót.h, c., z. Gáspári, and ,f . .Jurka. 2000. Microsateffites in different. eukaryotic genomes: survey and analysis. Genome Research 1,0 :9 6'l -9Bt .
Trontin, ,f . F,, C. crandemange, and. ,.T. M. Favre. 1999. Two highly divergent. 55 rDNA unit síze cfasses occur in composíte tandem arrays in European larch (Iarjx decidua Mill.) and ,fapanese larch (Larix kaempferi (i,amb. ) Carr. ) Genome 42:B3j-g48.
Tucker, C. M. l-931. Taxonomy of the genus phyEophthora de Bary . Mo. Agric. Exp. Stn. Res. Bu_Z_Z . 153 . pp. 1,_2OB .
Tyler, B. M. l-987. Transcription of Neurospora crassa 5 S rRNA genes requires a TATA box and three int.ernal elements . ,f . MoJ . Biof . 196: 801-gl-1 -
Udovicic, F., c. L McFadden, and p. y. Ladiges. L995. Phylogeny of Eucalwtus and Angophora based on 55 rDNA spacer sequence d.aLa, Mol. phyJo. Evol . 4:247_256. 255
Valenzuela, P., G. I. Bell-, A. Venegas, E. T. Sewelf, F. R. Masiarz, L. !T. Degennaro, F. Weinberg, and W. ,_1. Rutter. t917a. Ríbosomaf RNA genes of Saccharomyces cerewisiae. ,7. Bio7. Chem. 252:8L26-8135.
Valenzuela, P., G. I Befl, F. R. Masiarz, L. ,.f . Degennaro, and W. ,J. Rutter. I911b. Nucleotide sequence of the yeasL 55 ribosomal RNA gene and adjacent put.ative controf regj-ons . JVa Lure 267 :641_-643 .
Van de Peer, Y., G. Van der Àuwera and R. De Wachter. 1996. The evolutíon of stramenopiles and alveofates as derived by .'substit.ution rate calibration,, of small ribosomaf subunit RNA. ,t. Mof . Evol-. 42:201_-2LO .
Van den Eynde, H,, R. De Baere, E. De Roeck, y. Van de Peer, A. Vandenberghe, p, Willekens, and R, De Wachter. 1988. The 55 ribosomal RNA sequences of the red alga rhodoplasts and a gymnospermal chloroplast. ,f. Mof . Evof. 27:L26-1,32.
Van der Auwera, G., De Baere, R., Van d.e peer, y., De Rijk, P., Van den Broeck, I., and De Wachter, R. 1995. The phylogeny of the H]æhochyt.riomycota as deduced from ribosomal RNA sequences ot HwhochyErium catenoides. Mof Biof. Evof. !2 : 671"- 6i L
Van der Moon, S. S. y., R, De Wachter and D. Vaulot. 2OOI. Oceaníc 18S rÐNA sequences from picoplankt.on reveaf unsuspected eukaryotic diversity. IVa ture 409:607_6L0. Van der Plaats -Ni terínk, A. ,1. 1991. Studies in Mycology. Vo]- 2l:Monograph of the genus pythjum. Centraal-bureau voor Sc immelcul tures , Baarn, Net.herl-ands,
Verbeet, M. P., ,J. Klootwijk, H. van Heerikhuizen, R. D. Fontíjn, E. Vrengdenhil, and R. J. planta. 19g3. Molecular cloning of the rDNA of Saccharomyces rosei and comparison of it.s transcription initiation region \,,¡ith that of Saccharomyces carlsbergensis, Gene 2j:53_ 63.
Verbeet, M. P., H. van Heerikhuizen, J. Klootwijk, R. D. Fronti jn, and R. ,.T. pl-anta. 19g4. Evolut.ion of yeast. ribosomal DNA,: Molecular cloning of the rDNA units of KJuyweromyces lactis and äanse¡u Ja wingei and their 256
comparison wit.h the rDNÄ units of other Saccharomycet.oideae . Mof, Gen. Genet. !95:L!6-L25. Vermeulen, C. W., and K. C. Atwood. 1965. The proportion of DNA complementary to ribosomal RNA in DrosophiJa meJanogaster. Biophys, Res, Cornmun. L9:22I-226. Wal-ker, W.F. and W. F. Doofittle. 1982. Nucfeotide sequences of 55 ribosomaf RNA from four oomycet.e and chytrid urater mo1ds. Nucfeic Acid.s Research l-0 :S: L.t - 512L.
Wang, P. H. and White, J. c. L99't. Mol-ecufar charac teri zation of pythium species based on RFLP analysis of t.he internaf transcribed spacer region of ribosomal DNA. påys. Mof. pJant paEhoLogy 5L:L21__1,43.
Wakasugi, T., T. Nagai, M. Kapoor, M. Sugit.a, M. Ito, S. Ito, J. Tsudzuki, K. Nakashima, T. Tsudzukí, y. Susuki, A. Hamada, T. Ohta, A. Inamura, K. yoshinaga, and M. Sugiura. 1997. Complete nucleot.ide sequence of the chloroplast genome from the green alga Chforefla vuJgaris: The exist.ence of genes possibly involved in chloroplasL division. proc. NatL. Acad. Sci. USA 94:596'7-5972. Wasko, A. P., C. Martins, ,.t. M. Wright., and p. M. cafetti, Jr. 2001,. Molecular organizat.ion of 55 rDNA in fishes of the genus Brycon. Genome 44:993-902. Waterhouse, c. M. 1963. Key to t.he species of phyEophthora de Bary, Myco7. pap. 92 Commonw. Mycol. fnst. , Ke\,/, Surry, England. pp. 1,-22.
Waterhouse, c. M. 1967. Key to pyEhiun pringsheim. Mycof. Pap. 109: 1-15 .
Waterhouse, G. M. 1968. The genus pythium, Diagnoses (or descriptions) and figures from the original papers. Myco7. Pap. 110:1-50.
Weerkoon, N. D., ,f K. Roberts, L. p. Lehnen, Jr, ¡J, M. Wilkinson, J. S. Marsha11, A. R. Hardham. 199g. fsofation and characteri z ation of the single B_tubulin gene in PhyEophthora cinnamomi. Mycologia 90:g5_95. 257
Wegnez, M., and R. Monier. 1972. Sequence heterogeneit.y of 55 RNA in Xenopus faevis. FEBS L?EE. 25:L3-20.
Weinmann, R., and R. G. Roeder. 19'14. Role of DNA-dependent RNA po1]merase III in the L.ranscription of the I.RNA and 55 gerÌes. proc. Natf . Acad. Sci. USA .11,: j-j9O_1794. tr{ifson, R.K. l-999. How the worm \¡¡as won - the C. eJegans genome sequencing project.. Trends in Genet. 15:51-5g.
Wimber, D. E., and D. M Steffensen. L9'lO. I_,ocaf ízation of 55 RNA genes on Drosophila chromosomes by RNA- DNA hybridization.,gcience 1-7 0 : 639-64I.
Wolff, G., and U. Kueck. 1996. TranscripL mapping and processing of mitochondriaf RNA in the chlorophyLe alga Prototheca wickerhamii. pjant Mof. Biof. 30:571- s95. Wolffe, A. P., and D. D. Brown. 19gg. Devefopment.al regulation of two 55 ribosomal- RNA genes , Science 24L :7626-1632 .
Wolters, J., and Erdmann, V. A. 1999. Compilation of 55 rRNA gene sequences. JVucJ. Acids Res. 16:r1-r70.
Wormington, W. M., D. F, Bogenhagen, E, .fordan, and D. D. Brown. 1981_. A quantitat.ive assay for Xenopus 55 RNA gene transcríption in viEro. CeJf 24:gO9-g17.
Yoshionari, S., T. Koike, T. yokogawa, K. Nishikawa, T. Ueda¡ K. I. Miura, and K. Watanabe. !994. Existence of nuclear encoded 55 rRNA in bovine mitochondria. FEBS ¿eËt. 338:1-3'7 -L42.
Young, B. D., A. He1l, and G. D. Birnie. 19j6. A ne\,v estimate of human ribosomal gene number. Biochem, aiophys. Acta 454:539-548. zehani-Wil1ner, T., and D. c. Comb. 1966. St.udies on the relationship between t.ransf er RNA and transfer_like RNA. ,_7. Mol . Bio7. 76:250_254 . zerucha, T., W. K. Kim, W. Mauthe, and G. R. Klassen. l_992. The Location and nucfeotide sequence of the 55 rRNA gene of wheat bunt., TifLetia carjes and ?. conEroversa. Nucleic Acids Res. 20:2600. 258
Zhou, 4., G. Xia, X. ZlnarLg, H. Chen, and H. Hu. 2001. Analysis of chromosomal and organellar DNA of somatic hybrids between TriEicurt aesEivum and, HaynaTdia viffosa Schur. Mo7. Genet. Genomics 265:3Bi-393.
Zimmer, 8., E. R. .Tupe, and V. Wafbot. 1988. Ribosomal gene sEructure, variation and inheritance in maize and its ancestors . Genetics L20:L1,25-1,L36 , Zoph, W. 1890. Die Pifze in Morphologischer, Biologíscher und Systematischer Beziehung. rn: A. Schenk, Handbuch der Botaník 4 : 2'l I-'7 55 .