DOCSLIB.ORG

The Evolution of Mitochondrial Genome and Proteome in Animals Xiujuan Wang Iowa State University

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Evolution of Mitochondrial Genome and Proteome in Animals Xiujuan Wang Iowa State University Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2010 The evolution of mitochondrial genome and proteome in animals Xiujuan Wang Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Ecology and Evolutionary Biology Commons Recommended Citation Wang, Xiujuan, "The ve olution of mitochondrial genome and proteome in animals" (2010). Graduate Theses and Dissertations. 11298. https://lib.dr.iastate.edu/etd/11298 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The evolution of mitochondrial genome and proteome in animals by Xiujuan Wang A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Co-majors: Genetics; Bioinformatics and Computational Biology Program of Study Committee: Dennis V. Lavrov, Co-major Professor Xun Gu, Co-major Professor Karin S. Dorman Oliver Eulenstein Stephen Proulx Iowa State University Ames, Iowa 2010 ii TABLE OF CONTENTS ABSTRACT ....................................................................................................................... iv CHAPTER 1. GENERAL INTRODUCTION ....................................................................1 Introduction ......................................................................................................................1 Dissertation Organization ................................................................................................8 References ........................................................................................................................9 CHAPTER 2. MITOCHONDRIAL GENOME OF THE HOMOSCLEROMORPH OSCARELLA CARMELA (PORIFERA, DEMOSPONGIAE) REVEALS UNEXPECTED COMPLEXITY IN THE COMMON ANCESTOR OF SPONGES AND OTHER ANIMALS .................................................................................................14 Abstract ..........................................................................................................................14 Introduction ....................................................................................................................15 Materials and Methods ...................................................................................................18 Results ............................................................................................................................21 Discussion and Conclusion ............................................................................................29 Acknowledgements ........................................................................................................31 Literature Cited ..............................................................................................................32 CHAPTER 3. SEVENTEEN NEW COMPLETE MTDNA SEQUENCES REVEAL EXTENSIVE MITOCHONDRIAL GENOME EVOLUTION WITHIN THE DEMOSPONGIAE ............................................................................................................48 Abstract ..........................................................................................................................48 Introduction ....................................................................................................................49 Results ............................................................................................................................51 Discussion ......................................................................................................................60 Methods..........................................................................................................................63 Acknowledgements ........................................................................................................66 References ......................................................................................................................67 CHAPTER 4. GENE RECRUITMENT – A COMMAN MECHANISM IN THE EVOLUTION OF TRANSFER RNA GENE FAMILIES ................................................80 Abstract ..........................................................................................................................80 Introduction ....................................................................................................................81 Methods..........................................................................................................................83 Results ............................................................................................................................85 Discussion ......................................................................................................................90 Conclusion .....................................................................................................................94 Acknowledgements ........................................................................................................95 Literature Cited ..............................................................................................................96 iii CHAPTER 5. COMPARATIVE STUDY OF HUMAN MITOCHONDRIAL PROTEOME REVEALS EXTENSIVE PROTEIN SUBCELLUAR RELOCALIZATION AFTER GENE DUPLICATIONS ...............................................106 Abstract ........................................................................................................................106 Background ..................................................................................................................108 Results and Discussion ................................................................................................108 Conclusions ..................................................................................................................118 Methods........................................................................................................................119 Acknowledgements ......................................................................................................120 References ....................................................................................................................121 CHAPTER 6. GENERAL CONCLUSIONS ...................................................................133 Conclusions ..................................................................................................................133 Future Directions .........................................................................................................136 References ....................................................................................................................137 APPENDIX A. SUPPLEMENTARY MATERIALS FOR CHAPTER 2 .......................139 APPENDIX B. SUPPLEMENTARY MATERIALS FOR CHAPTER 3 .......................146 ACKNOWLEDGEMENTS .............................................................................................151 iv ABSTRACT Mitochondria, found in nearly all eukaryotes, are indispensable double membrane organelles that play pivotal roles in several cellular processes. While diversity of mitochondrial genomes among eukaryotes has been recognized, it was thought that animal mitochondrial genomes are small circular molecules with little variation in size and gene content. However this picturing of animal mitochondrial genomes was based on a biased sampling drawn primarily from bilaterian animals. In order to explore the diversity and understand the evolution of mitochondrial genomes in animals, we sequenced and analyzed mitochondrial genomes from all 14 orders of demosponges, the biggest class within sponges (phylum Porifera). Comparative genome analysis shows that a large variation in mitochondrial genome architecture is present within this group exceeding that found within Bilateria. Phylogenomic analyses based on mtDNA data support demosponges as a monophyletic group and suggest that the last common ancestor of animals might have had a tissue-level organization. Although transfer RNA (tRNA) genes are generally conserved in these genomes, evidences were found for horizontal evolution of some tRNA genes that cautioned the use of tRNA phylogeny to infer genetic code evolution. While animal mitochondrial genomes only encode a handful of proteins, the complex functions of mitochondria require over a thousand of proteins that more than 98% are nuclear encoded. Comparative gene family analyses for nuclear encoded mitochondrial proteins demonstrate that protein subcellular relocalization enabled the retention and gain of function of genes after duplications and provided a way for recruiting mitochondrial proteins. In addition, mitochondrial proteome also expanded through subfunctionalization mechanism after gene duplications. 1 CHAPTER 1. GENERAL INTRODUCTION Introduction Mitochondria, found in nearly all eukaryotes, are cellular powerhouses that produce ATP as energy source of cell through respiration/oxidative phosphorylation. They also play key roles in many other cellular processes including Krebs cycle, heme biosynthesis, cell metabolism, apoptosis, and Fe/S cluster biosynthesis. Proteins involved in these functions
Load more

Recommended publications
  • Reef Sponges of the Genus Agelas (Porifera: Demospongiae) from the Greater Caribbean
    Zootaxa 3794 (3): 301–343 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3794.3.1 http://zoobank.org/urn:lsid:zoobank.org:pub:51852298-F299-4392-9C89-A6FD14D3E1D0 Reef sponges of the genus Agelas (Porifera: Demospongiae) from the Greater Caribbean FERNANDO J. PARRA-VELANDIA1,2, SVEN ZEA2,4 & ROB W. M. VAN SOEST3 1St John's Island Marine Laboratory, Tropical Marine Science Institute (TMSI), National University of Singapore, 18 Kent Ridge Road, Singapore 119227. E-mail: [email protected] 2Universidad Nacional de Colombia, Sede Caribe, Centro de Estudios en Ciencias del Mar—CECIMAR; c/o INVEMAR, Calle 25 2- 55, Rodadero Sur, Playa Salguero, Santa Marta, Colombia. E-mail: [email protected] 3Netherlands Centre for Biodiversity Naturalis, P.O.Box 9517 2300 RA Leiden, The Netherlands. E-mail: [email protected] 4Corresponding author Table of contents Abstract . 301 Introduction . 302 The genus Agelas in the Greater Caribbean . 302 Material and methods . 303 Classification . 304 Phylum Porifera Grant, 1835 . 304 Class Demospongiae Sollas, 1875 . 304 Order Agelasida Hartman, 1980 . 304 Family Agelasidae Verrill, 1907 . 304 Genus Agelas Duchassaing & Michelotti, 1864 . 304 Agelas dispar Duchassaing & Michelotti, 1864 . 306 Agelas cervicornis (Schmidt, 1870) . 311 Agelas wiedenmayeri Alcolado, 1984. 313 Agelas sceptrum (Lamarck, 1815) . 315 Agelas dilatata Duchassaing & Michelotti, 1864 . 316 Agelas conifera (Schmidt, 1870). 318 Agelas tubulata Lehnert & van Soest, 1996 . 321 Agelas repens Lehnert & van Soest, 1998. 324 Agelas cerebrum Assmann, van Soest & Köck, 2001. 325 Agelas schmidti Wilson, 1902 .
    [Show full text]
  • Progress in Understanding 2-Hydroxyglutaric Acidurias
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector J Inherit Metab Dis (2012) 35:571–587 DOI 10.1007/s10545-012-9462-5 METABOLIC DISSERTATION Progress in understanding 2-hydroxyglutaric acidurias Martijn Kranendijk & Eduard A. Struys & Gajja S. Salomons & Marjo S. Van der Knaap & Cornelis Jakobs Martijn Kranendijk Received: 13 December 2011 /Revised: 25 January 2012 /Accepted: 30 January 2012 /Published online: 6 March 2012 # The Author(s) 2012. This article is published with open access at Springerlink.com Abstract The organic acidurias D-2-hydroxyglutaric acidu- D2HGDH gene encoding D-2-hydroxyglutarate ria (D-2-HGA), L-2-hydroxyglutaric aciduria (L-2-HGA), dehydrogenase and combined D,L-2-hydroxyglutaric aciduria (D,L- L-2-HG L-2-hydroxyglutaric acid 2-HGA) cause neurological impairment at young age. L-2-HGA L-2-hydroxyglutaric aciduria Accumulation of D-2-hydroxyglutarate (D-2-HG) and/or L- L-2-HGDH L-2-hydroxyglutarate dehydrogenase 2-hydroxyglutarate (L-2-HG) in body fluids are the bio- enzyme chemical hallmarks of these disorders. The current review L2HGDH gene encoding L-2-hydroxyglutarate describes the knowledge gathered on 2-hydroxyglutaric dehydrogenase acidurias (2-HGA), since the description of the first patients D,L-2-HGA combined D,L-2-hydroxyglutaric aciduria in 1980. We report on the clinical, genetic, enzymatic and IDH2 gene encoding isocitrate dehydrogenase 2 metabolic characterization of D-2-HGA type I, D-2-HGA 2-KG 2-ketoglutaric acid type II, L-2-HGA and D,L-2-HGA, whereas for D-2-HGA HOT hydroxyacid-oxoacid transhydrogenase type I and type II novel clinical information is presented enzyme which was derived from questionnaires.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mitochondrial translational initiation factor 2 Gene Symbol MTIF2 Organism Human Gene Summary During the initiation of protein biosynthesis initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt) an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s with the greatest degree of conservation in the G domains of the proteins. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases Not Available RefSeq Accession No. NC_000002.11, NG_017017.1, NT_022184.15 UniGene ID Hs.149894 Ensembl Gene ID ENSG00000085760 Entrez Gene ID 4528 Assay Information Unique Assay ID qHsaCEP0058136 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000263629, ENST00000366137, ENST00000441307, ENST00000420637, ENST00000417363, ENST00000412530, ENST00000394600 Amplicon Context Sequence CCAAGCTCCTCATTTTACAGAAAAGGAAACGGAAATCCAGAAGGGTCAAAAAAG CTTCTCCAATGTCATACCGCTAGTTAATGGCAGTCAAGACTAGAACCCAGACG Amplicon Length (bp) 77 Chromosome Location 2:55495715-55495821 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9995 cDNA Cq 21.05 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79 gDNA Cq 24.56 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Taxonomy and Diversity of the Sponge Fauna from Walters Shoal, a Shallow Seamount in the Western Indian Ocean Region
    Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region By Robyn Pauline Payne A thesis submitted in partial fulfilment of the requirements for the degree of Magister Scientiae in the Department of Biodiversity and Conservation Biology, University of the Western Cape. Supervisors: Dr Toufiek Samaai Prof. Mark J. Gibbons Dr Wayne K. Florence The financial assistance of the National Research Foundation (NRF) towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF. December 2015 Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region Robyn Pauline Payne Keywords Indian Ocean Seamount Walters Shoal Sponges Taxonomy Systematics Diversity Biogeography ii Abstract Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region R. P. Payne MSc Thesis, Department of Biodiversity and Conservation Biology, University of the Western Cape. Seamounts are poorly understood ubiquitous undersea features, with less than 4% sampled for scientific purposes globally. Consequently, the fauna associated with seamounts in the Indian Ocean remains largely unknown, with less than 300 species recorded. One such feature within this region is Walters Shoal, a shallow seamount located on the South Madagascar Ridge, which is situated approximately 400 nautical miles south of Madagascar and 600 nautical miles east of South Africa. Even though it penetrates the euphotic zone (summit is 15 m below the sea surface) and is protected by the Southern Indian Ocean Deep- Sea Fishers Association, there is a paucity of biodiversity and oceanographic data.
    [Show full text]
  • Organellar Signaling Expands Plant Phenotypic Variation and Increases the Potential for Breeding the Epigenome
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Agronomy and Horticulture Department 10-2012 Organellar Signaling Expands Plant Phenotypic Variation and Increases the Potential for Breeding the Epigenome Roberto De la Rosa Santamaria University of Nebraska-Lincoln Follow this and additional works at: https://digitalcommons.unl.edu/agronhortdiss Part of the Agriculture Commons, and the Genetics Commons De la Rosa Santamaria, Roberto, "Organellar Signaling Expands Plant Phenotypic Variation and Increases the Potential for Breeding the Epigenome" (2012). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 57. https://digitalcommons.unl.edu/agronhortdiss/57 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. ORGANELLAR SIGNALING EXPANDS PLANT PHENOTYPIC VARIATION AND INCREASES THE POTENTIAL FOR BREEDING THE EPIGENOME By Roberto De la Rosa Santamaria A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy (Plant Breeding and Genetics) Under the Supervision of Professor Sally A. Mackenzie Lincoln, Nebraska October, 2012 ORGANELLAR SIGNALING EXPANDS PLANT PHENOTYPIC VARIATION AND INCREASES THE POTENTIAL FOR BREEDING THE EPIGENOME Roberto De la Rosa Santamaria, Ph.D. University of Nebraska, 2012 Adviser: Sally A. Mackenzie MUTS HOMOLOGUE 1 (MSH1) is a nuclear gene unique to plants that functions in mitochondria and plastids, where it confers genome stability.
    [Show full text]
  • Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation
    From THE DEPARTMENT OF MICROBIOLOGY TUMOR AND CELL BIOLOGY (MTC) Karolinska Institutet, Stockholm, Sweden ROLE OF MITOCHONDRIAL RIBOSOMAL PROTEIN S18-2 IN CANCEROGENESIS AND IN REGULATION OF STEMNESS AND DIFFERENTIATION Muhammad Mushtaq Stockholm 2017 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by E-Print AB 2017 © Muhammad Mushtaq, 2017 ISBN 978-91-7676-697-2 Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation THESIS FOR DOCTORAL DEGREE (Ph.D.) By Muhammad Mushtaq Principal Supervisor: Faculty Opponent: Associate Professor Elena Kashuba Professor Pramod Kumar Srivastava Karolinska Institutet University of Connecticut Department of Microbiology Tumor and Cell Center for Immunotherapy of Cancer and Biology (MTC) Infectious Diseases Co-supervisor(s): Examination Board: Professor Sonia Lain Professor Ola Söderberg Karolinska Institutet Uppsala University Department of Microbiology Tumor and Cell Department of Immunology, Genetics and Biology (MTC) Pathology (IGP) Professor George Klein Professor Boris Zhivotovsky Karolinska Institutet Karolinska Institutet Department of Microbiology Tumor and Cell Institute of Environmental Medicine (IMM) Biology (MTC) Professor Lars-Gunnar Larsson Karolinska Institutet Department of Microbiology Tumor and Cell Biology (MTC) Dedicated to my parents ABSTRACT Mitochondria carry their own ribosomes (mitoribosomes) for the translation of mRNA encoded by mitochondrial DNA. The architecture of mitoribosomes is mainly composed of mitochondrial ribosomal proteins (MRPs), which are encoded by nuclear genomic DNA. Emerging experimental evidences reveal that several MRPs are multifunctional and they exhibit important extra-mitochondrial functions, such as involvement in apoptosis, protein biosynthesis and signal transduction. Dysregulations of the MRPs are associated with severe pathological conditions, including cancer.
    [Show full text]
  • Checklist of Fish and Invertebrates Listed in the CITES Appendices
    JOINTS NATURE \=^ CONSERVATION COMMITTEE Checklist of fish and mvertebrates Usted in the CITES appendices JNCC REPORT (SSN0963-«OStl JOINT NATURE CONSERVATION COMMITTEE Report distribution Report Number: No. 238 Contract Number/JNCC project number: F7 1-12-332 Date received: 9 June 1995 Report tide: Checklist of fish and invertebrates listed in the CITES appendices Contract tide: Revised Checklists of CITES species database Contractor: World Conservation Monitoring Centre 219 Huntingdon Road, Cambridge, CB3 ODL Comments: A further fish and invertebrate edition in the Checklist series begun by NCC in 1979, revised and brought up to date with current CITES listings Restrictions: Distribution: JNCC report collection 2 copies Nature Conservancy Council for England, HQ, Library 1 copy Scottish Natural Heritage, HQ, Library 1 copy Countryside Council for Wales, HQ, Library 1 copy A T Smail, Copyright Libraries Agent, 100 Euston Road, London, NWl 2HQ 5 copies British Library, Legal Deposit Office, Boston Spa, Wetherby, West Yorkshire, LS23 7BQ 1 copy Chadwick-Healey Ltd, Cambridge Place, Cambridge, CB2 INR 1 copy BIOSIS UK, Garforth House, 54 Michlegate, York, YOl ILF 1 copy CITES Management and Scientific Authorities of EC Member States total 30 copies CITES Authorities, UK Dependencies total 13 copies CITES Secretariat 5 copies CITES Animals Committee chairman 1 copy European Commission DG Xl/D/2 1 copy World Conservation Monitoring Centre 20 copies TRAFFIC International 5 copies Animal Quarantine Station, Heathrow 1 copy Department of the Environment (GWD) 5 copies Foreign & Commonwealth Office (ESED) 1 copy HM Customs & Excise 3 copies M Bradley Taylor (ACPO) 1 copy ^\(\\ Joint Nature Conservation Committee Report No.
    [Show full text]
  • California Marine Life Protection Act (MLPA) Initiative
    California Marine Life Protection Act (MLPA) Initiative Evaluation of Existing Central Coast Marine Protected Areas DRAFT, v. 2.0 November 4, 2005 CONTENTS EXECUTIVE SUMMARY ..........................................................................................................................4 1.0 INTRODUCTION ................................................................................................................................8 2.0 EVALUATION OF EXISTING MPAs .................................................................................................11 2.1 Año Nuevo Special Closure...........................................................................................................11 2.2 Elkhorn Slough State Marine Reserve ...........................................................................................12 2.3 Hopkins State Marine Reserve......................................................................................................15 2.4 Pacific Grove State Marine Conservation Area.............................................................................16 2.5: Carmel Bay State Marine Conservation Area ..............................................................................17 2.6 Point Lobos State Marine Reserve................................................................................................19 2.7 Julia Pfeiffer Burns State Marine Conservation Area.....................................................................20 2.8 Big Creek State Marine Reserve....................................................................................................22
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Exceptional Development of Dissepimental Coenosteum in the New Eocene Scleractinian Coral Genus Nancygyra (Ypresian, Monte Postale, NE Italy)
    TO L O N O G E I L C A A P I ' T A A T L E I I A Bollettino della Società Paleontologica Italiana, 59 (3), 2020, 291-298. Modena C N O A S S. P. I. Exceptional development of dissepimental coenosteum in the new Eocene scleractinian coral genus Nancygyra (Ypresian, Monte Postale, NE Italy) Francesca R. Bosellini*, Jarosław Stolarski, Cesare Andrea Papazzoni & Alessandro Vescogni F.R. Bosellini, Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Modena e Reggio Emilia, Via Campi 103, I-41125 Modena, Italy; [email protected] *corresponding author J. Stolarski, Institute of Paleobiology, Polish Academy of Sciences, Twarda 51/55, PL-00-818 Warsaw, Poland; [email protected] C.A. Papazzoni, Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Modena e Reggio Emilia, Via Campi 103, I-41125 Modena, Italy; [email protected] A. Vescogni, Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Modena e Reggio Emilia, Via Campi 103, I-41125 Modena, Italy; [email protected] KEY WORDS - Aphroid colony, dissepiments, Euphylliidae, coral diversity, EECO, lower Eocene. ABSTRACT - In colonial corals, the polyps are interconnected with a common tissue called coenosarc. Polyps and coenosarc secrete distinct skeletal structures: corallites and coenosteum, respectively. Ratio of corallite to coenosteum development may vary resulting in two extreme architectural patterns of coral colonies: corallite-dominated (e.g., cerioid) and coenosteum-dominated (e.g., aphroid) colonies. A large suite of examples of these patterns can be identified among extant and fossil corals, including Paleozoic rugosan corals.
    [Show full text]
  • A Soft Spot for Chemistry–Current Taxonomic and Evolutionary Implications of Sponge Secondary Metabolite Distribution
    marine drugs Review A Soft Spot for Chemistry–Current Taxonomic and Evolutionary Implications of Sponge Secondary Metabolite Distribution Adrian Galitz 1 , Yoichi Nakao 2 , Peter J. Schupp 3,4 , Gert Wörheide 1,5,6 and Dirk Erpenbeck 1,5,* 1 Department of Earth and Environmental Sciences, Palaeontology & Geobiology, Ludwig-Maximilians-Universität München, 80333 Munich, Germany; [email protected] (A.G.); [email protected] (G.W.) 2 Graduate School of Advanced Science and Engineering, Waseda University, Shinjuku-ku, Tokyo 169-8555, Japan; [email protected] 3 Institute for Chemistry and Biology of the Marine Environment (ICBM), Carl-von-Ossietzky University Oldenburg, 26111 Wilhelmshaven, Germany; [email protected] 4 Helmholtz Institute for Functional Marine Biodiversity, University of Oldenburg (HIFMB), 26129 Oldenburg, Germany 5 GeoBio-Center, Ludwig-Maximilians-Universität München, 80333 Munich, Germany 6 SNSB-Bavarian State Collection of Palaeontology and Geology, 80333 Munich, Germany * Correspondence: [email protected] Abstract: Marine sponges are the most prolific marine sources for discovery of novel bioactive compounds. Sponge secondary metabolites are sought-after for their potential in pharmaceutical applications, and in the past, they were also used as taxonomic markers alongside the difficult and homoplasy-prone sponge morphology for species delineation (chemotaxonomy). The understanding Citation: Galitz, A.; Nakao, Y.; of phylogenetic distribution and distinctiveness of metabolites to sponge lineages is pivotal to reveal Schupp, P.J.; Wörheide, G.; pathways and evolution of compound production in sponges. This benefits the discovery rate and Erpenbeck, D. A Soft Spot for yield of bioprospecting for novel marine natural products by identifying lineages with high potential Chemistry–Current Taxonomic and Evolutionary Implications of Sponge of being new sources of valuable sponge compounds.
    [Show full text]
  • ABSTRACT NI, SIHUI. RNA Translocation
    ABSTRACT NI, SIHUI. RNA Translocation into Chloroplasts. (Under the direction of Dr. Heike Inge Sederoff). Plastids and mitochondria are known as semi-autonomous organelles because they can encode and synthesize proteins that are essential for metabolism. They are both derived from endosymbiotic events. The bacterial ancestor of plastids was cyanobacteria, while the bacterial ancestor of mitochondria was a proteobacteria. During their evolution, most of the ancestral bacterial DNA was translocated into the nuclear genome DNA. The current plastid genome encodes proteins for the photosynthetic apparatus, the transcription/translation system, and various biosynthetic processes. The current mitochondrial genome mainly encodes proteins for electron transport, ATP synthesis, translation, protein import and metabolism. Plastids and mitochondria are not self-sufficient; they import the majority of their proteins, which are synthesized in the cytosol. For plastids, a transit peptide at the N-terminus of protein precursors can be recognized by TOC/TIC complex and mediate their import. Similarly, for mitochondria, a piece of β-signal at the N-terminal of protein precursors can be recognized by TOM/TIM complex and mediate the import of the protein precursors. It worth noting that plastids also encode a suite of transfer RNAs while mitochondria need to import certain types of tRNAs. In most angiosperms, plastids and mitochondria are inherited maternally and can only be passed down from the maternal plant organs through seed to the next generation. Maternal inheritance has benefits for organellar genetic engineering such as stable inheritance of genes over generations, absence of out-crossing, absence of contamination by pollen and minimal pleiotropic effects. The tradition methodology of plastid genomic engineering is biolistic transformation, where DNA covered gold particles parent cell walls of tissue or protoplasts at high velocity, leading to integration of DNA into chromosome(s) through recombination.
    [Show full text]