Influence of Iron Regulating Genes Mutations on Iron Status in Egyptian Patients with Sickle Cell Disease

Available online at www.annclinlabsci.org

304 Annals of Clinical & Laboratory Science, vol. 44, no. 3, 2014 Influence of Iron Regulating Genes Mutations on Iron Status in Egyptian Patients with Sickle Cell Disease

Hala A. Abdel Rahman1, Heba H. Abou-Elew1, Reem M. El-Shorbagy1, Rania Fawzy1, and Ilham Youssry2

1Department of Clinical Pathology and 2Department of Pediatrics, Faculty of Medicine, Cairo University, Cairo, Egypt

Abstract. Mutations of the HAMP gene and HFE gene have a role in iron overload. We assessed the frequency of the G71D mutation of the HAMP gene and the H63D mutation of the HFE gene and the correlation between these mutations as well as the correlation between them and the iron overload in sickle cell disease (SCD) patients. Genotyping of G71D of HAMP and of H63D of HFE variants was performed by polymerase chain reaction-restriction fragment length polymorphism on 47 SCD patients and 45 controls. The iron status was assessed by serum ferritin and transferrin saturation. We found 61.7% of the patients had a wild genotype in both genes, 14.9% had a variation in HAMP-G71D, 27.7% had a variation in HFE- H63D, and 4.3% had variations in both. Patients with either HAMP-G71D or HFE-H63D variants did not show significant difference in iron status in comparison to patients with wild type genotypes. Multivari- ate regression analysis revealed that the number of mutations harbored by the patients tends to affect the serum ferritin level; p=0.07. Thus, The HAMP-G71D and HFE-H63D variants are not uncommon among the Egyptian SCD patients; neither of them alone was found to be a major determinant of iron overload in the studied patients. Nevertheless, the number of harboured mutations may increase the probability of iron overload in these patients.

Keywords: HAMP, HFE, sickle cell disease, iron overload.

Introduction Sickle cell disease is a multisystem disorder charac- terized by a chronic inflammatory state with a Hepcidin is a major iron regulator protein, which greater proportion of patients in need of chronic exerts its effect through binding ferroportin and transfusion therapy than ever before. Consequently, causing its internalization and degradation, thus this results in iron overload and necessitates the inhibiting enterocyte and macrophage iron release need for iron chelation therapy. Nevertheless, it is [1]. Hepcidin is regulated by a number of mecha- evident that the frequency and extent of iron over- nisms, including genes, signals released from the load is greatly under-appreciated and under-treated erythroid bone marrow, iron stores, circulating in patients with SCD [2]. iron, oxygen homeostasis, and inﬂammatory cyto- kines [2]. The HAMP gene (encoding hepcidin) In an attempt to shed light on the genetic determi- and the hereditary haemochromatosis (HFE) gene nants of iron overload in poly-transfused SCD pa- (encoding HFE protein) modulate the expression tients, we analyzed the frequency of the G71D mu- of hepcidin and change the iron absorption from tation of HAMP gene and the H63D mutation of intestine, affecting iron homeostasis [3,4,5,6]. the HFE gene in a group of SCD patients. Then we Accordingly, hepcidin deficiency is the underlying studied the relative contributions of these genetic cause of increased iron absorption by intestinal en- variations on iron status in these patients. terocytes which leads to iron overload in most types of hereditary haemochromatosis [7]. Materials and Methods

The current study was performed on a total of92 Address correspondence to Dr. Ilham Youssry, 1 Ben Kutiba Street, Section seven, Nasr city, Cairo, Egypt, 11487; phone: +201205555848/ Egyptian subjects. It included 47 patients with sickle cell +201001684117; fax: 202 37483241; e mail: ilhamyoussry@yahoo. disease (39 patients with HbSS and 8 patients with com and [email protected] HbS/β-thalassemia) following up regularly at the

Hematology Outpatient Clinic, New Cairo University Genotypic analysis. Five millilitres of venous blood Children Hospital (NCUCH). They were diagnosed by were withdrawn under complete aseptic conditions from hemoglobin electrophoresis; their mean age at diagnosis all participants on EDTA. Genomic DNA was extracted was 2.1 years. There were 30 males and 17 females. Their from peripheral blood leukocytes by the salting out tech- ages ranged between 2.5 and 27 years with a mean age of nique [8]. Genotyping of G71D of HAMP and of H63D 10.5 years. Forty five unrelated age-gender-ethnic of HFE variants was performed by polymerase chain re- matched healthy subjects with normal iron indices were action-restriction fragment length polymorphism (PCR- included in the current study as a control group. They RFLP) analysis according to Merryweather-Clarke et al. were 27 males and 18 females. Their ages ranged be- [9] and Feder et al.[10], respectively. All PCR reactions tween 2 and 23 years with a mean age of 9.3 years. The were performed in a total volume of 25µl containing Institutional Review Board approved the study and in- 12.5 µl Master Mix (QIAGEN®, Germany), 1 µl forward formed consent was obtained from all subjects or their primer (25 pmol), 1 µl reverse primer (25 pmol), 7.5 µl guardians. nuclease- free water, and 3 µl genomic extracted DNA.

Clinical parameters. Almost half of the SCD patients For G71D genotyping, the following primers were used, were frequently transfused; 23/47 (48.9%) patients re- Forward primer: 5’- ceived more than 50 blood transfusions in their life ATGCAGGGAGGTGTGTTAGGAGGCT-3’ and (range 60-264, median 90) while 24/47 (51.1%) pa- Reverse primer: tients received 50 or less blood transfusions (range 4-48 CAAGGCAGGGTCAGGACAAGCTCTTAGC -3’ median 27). Almost all of the studied patients 45/47 (Midland Certified Reagent Co., USA). The thermocy- (96%) experienced sickle-related complications in the cler program applied was initial heating at 94°C for 5 form of vaso-occlusive crises in 43/47 (91.5%), hemo- min, followed by 30 cycles of denaturation at 94°C for lytic crises in 16/47(34.0%), thrombotic attacks in 30 s, annealing at 60°C for 30 s, and extension at 72°C 4/47(8.5%), sequestration crisis in one /47 (2.1%) pa- for 60 s. A final extension step was carried out at 72°C tient who suffered also from vaso-occlusive and hemo- for 10 min. lytic crises. Four patients (8.5%) were hepatitis C virus (HCV) positive and showed a median of 62 IU/L ala- H63D genotyping was performed by using the following nine transaminase (ALT) levels (range 24–97). primers: forward primer 5’- ACATGGTTAAGGCCTGTTGC-3 and reverse primer Thirty-one/47 (66.0%) patients were on iron chelation 5’-GCCACATCTGGCTTGAAATT-3’ (Midland therapy: 23/31(74.2%) patients received oral deferi- Certified Reagent Co., USA). The reaction conditions prone alone, 5/31(16.1%) patients received subcutane- included an initial heating at 94°C for 5 min, followed ous desferrioxamine therapy, and 2/31(6.5%) patients by 30 cycles of denaturation at 94°C for 30 s, annealing received combined desferrioxamine and deferiprone at 56°C for 30 s and extension at 72°C for 60 s. A final treatment. One patient (3.2%) stopped chelation thera- extension step was carried out at 72°C for 10 min. py. Compliance to iron chelation therapy was verified in For each individual, we systematically amplified two 17/31(54.8%) of the chelated patients whereas 14/31 PCR fragments surrounding both mutations in two sep- (45.2%) received irregular iron chelation therapy. arate reactions, using the pairs of primers previously de- scribed. The sizes of the amplified fragments were 714 Twenty-three out of 47 (48.9%) patients were treated bp for G71D (exons 2 and 3) and 207 bp for H63D with hydroxyurea with a dose ranging from 15 to 40 mg/ (exon 2). Ten microliters of the amplified products was kg/day with a mean of 21.7±8.40 mg/kg/day. One pa- subjected to digestion with Aci I (Fermentas, USA Cat. tient out of 47 (2.1%) patients stopped hydroxyurea No.#FD1794) for the G71D mutation and with Bcl I treatment due to recurrent attacks of absolute (New England Biolab, USA Cat. No.#R0160S) for the neutropenia. H63D substitution in accordance to the manufacturer’s recommendations. The digested products were then run Iron overload parameters. Iron profile was assessed for on a 2.5% agarose gel for 1 hour and photographed un- both SCD patients and controls. Two ml venous blood der UV light. A DNA molecular weight marker was also without anticoagulant was collected. Serum iron and to- run to identify the site of bands (Figure 1). tal iron binding capacity (TIBC) were measured colori- metrically and serum transferrin saturation was calcu- For quality control, genotyping was repeated with related. Steady-state serum ferritin was determined by spect to case/control status for 30 samples to confirm the Microparticle Enzyme Immunoassay (AxSYM, Abbott, results. Results of genotyping were interpreted blindly USA) after an overnight fast. by two different observers and were 100% concordant. 306 Annals of Clinical & Laboratory Science, vol. 44, no. 3, 2014

Table 1. Distribution of allele and genotype frequencies of G71D and H63D mutations in the studied cases.

Mutation No. of alleles Mutant allele No./ Genotype frequency (%) p-value studied frequency (%) WT/WT WT/M or M/M

G71D SCD patients (n=47) 94 8.5 40 (85.1) 7 (14.9) 0.83 Controls (n=45) 90 6.7 39 (86.7) 6 (13.3)

H63D SCD patients (n=47) 94 13.8 34 (72.3) 13 (27.7) 0.02 Controls (n=45) 90 4.4 41 (91.1) 4 (8.9)

SCD: Sickle cell disease, WT: wild type, M: mutant allele, p< 0.05 is statistically significant

Table 2. Transferrin saturation and serum ferritin of the patients with wild genotype and the patients with HAMP-G71D & HFE-H63D variants.

Patients studied Transferrin saturation (%) median Serum ferritin (ng/mL) median

Wild type* (n= 29) 35.00 1268 G71D variant (n=7) 33.80 (p=0.49) 3054 (p=0.07) H63D variant (n=13) 28.00 (p=0.38) 1807 (p=0.34)

*statistical analyses are all related to the wild type group, p< 0.05 is statistically significant.

Table 3. Transferrin saturation levels and serum ferritin levels of patients with the wild genotype and the patients with single mutation who received > 50 transfusions in lifetime.

Patients received >50 transfusions in life Median transferrin saturation (%) Median serum ferritin (ng/mL)

Wild type* (n=18) 35.65 1698 Single mutation(n=5) 38.90 (p=0.371) 5782 (p=0.017)

*statistical analyses are all related to the wild type group, p< 0.05 is statistically significant

Statistical methods. Statistical calculations were done Results using computer programs SPSS (Statistical Package for the Social Science; SPSS Inc., Chicago, IL, USA) version Genotyping of HAMP-G71D and of HFE-H63D 15 for Microsoft Windows. Comparison of numerical variants in SCD patients revealed that 29/47 variables was done using the Mann Whitney U test for (61.7%) patients showed a wild type genetic profile independent factors. For comparing categorical data, in both genes, 7/47 (14.9%) had a variation in Chi square (χ2) test was performed. Exact test was used instead when the expected frequency is less than 5. The HAMP-G71D, 13/47 (27.7%) had a variation in multivariate analysis model was used to test for the pref- HFE-H63D, and 2/47 (4.3%) had variations in erential effect of important variable(s) on ferritin level. both genes. The G71D mutation was detected in Ferritin was log transformed to attain normality. p val- heterozygous state in 6/47 (12.8%) and in homo- ues less than 0.05 were considered statistically significant zygous state in 1/47 (2.1%) of SCD patients. All [11]. Iron regulating genes in sickle cell disease 307 carriers of the H63D mutation were in the heterozygous condition. The allelic frequency of G71D and H63D variants among the studied SCD patients were 8.5% and 13.8%, respectively (Table 1).

Of the healthy controls studied, 36/45 (80.0%) carried a wild type genetic profile in both genes, 6/45 (13.3%) had a variation in HAMP-G71D, 4/45 (8.9%) had a variant in HFE-H63D, and 1/45 (2.2%) had variant in both genes. Both HAMP-G71D and HFE-H63D mutations observed in the control group were in the heterozygous condition. The allelic frequency of G71D and H63D variants among controls were 6.7% and 4.4%, respectively. Compared to the controls, SCD patients showed a statistically significant higher fre- Figure 1. Agarose gel electrophoresis of PCR fragments di- quency of H63D mutation (27.7% vs. 8.9%, gested by restriction enzymes. (A) Diagnosis of G71D mutation: Aci I digestion of a 714 bp PCR product containing p=0.02). No statistically significant difference in HAMP exons 2 and 3. Wild-type digestion product sizes gene frequencies of G71D mutation was observed are 370, 217, 94 and 33 bp; digestion products from the between studied patients and controls (Table 1). homozygous mutant genotype are 587, 94 and 33 bp, digestion products from heterozygous genotype are 587, 370, 217, 94 and 33 bp. Lane 1 PCR marker of 100 bp ladder, The SCD patients carrying either HAMP-G71D or lanes 2,3,4 wild type individuals; lane 7 homozygous indi- HFE-H63D variants did not show statistically sig- vidual; lanes 5,6,8 heterozygous individuals (B) Diagnosis of H63D mutation: Bcl I digestion of a 207 bp PCR prod- nificant difference in iron overload parameters in uct containing HFE exon 2. Wild-type digestion product relation to the patients with the wild genotype sizes are 137 and 70 bp. The mutation abolishes the restric- (Table 2). tion site. Homozygous mutant genotype are one fragment of 207 bp while heterozygous are three fragments (207,137 and 70 bp). Lane 1 PCR marker of 100 bp ladder, lanes The serum ferritin level was significantly higher 2,3,5 wild type individuals; Lanes 4,6,7,8 heterozygous (2767 ng/mL) in patients who received more than individuals. 50 transfusions in their lifetime than patients who received ≤ 50 transfusions in their lifetime (1211.5 ng/mL) (Mann-Whitney U p=0.011) (Figure 2). On the other hand, among the group of SCD patients who received >50 transfusions in their lifetime, the serum ferritin level was significantly higher in those carrying a single mutation as compared to wild type patients. The median serum ferritin level was 5782 ng/mL vs. 1698 ng/mL in patients with single mutation vs. wild type patients, respectively (p=0.017) (Table 3).

A multivariate regression analysis was done to re- veal the association between the serum ferritin level and the independent factors among the studied Figure 2. The serum ferritin (ng/ml) in SCD patients re- cases (age of onset of disease, number of transfu- ceived ≤50 and those received >50 transfusions in sions in lifetime, treatment with hydroxyurea, iron lifetime. 308 Annals of Clinical & Laboratory Science, vol. 44, no. 3, 2014 chelation therapy, compliance to chelation, HCV mutation of HAMP gene as a possible modifier in antibody, presence of HAMP-G71D mutation, iron overload diseases [9,12,13,18]. On the other presence of HFE-H63D mutation, and number of hand, the HFE-H63D gene mutation is a common mutations harbored by the studied patients). The variant that is occasionally associated with iron analysis revealed that treatment with hydroxyurea overload, usually in the homozygous state or in significantly reduces the serum ferritin level compound heterozygote individuals that also har- (p=0.029). The number of mutations harbored also bour the C282Y mutation of HFE gene [19]. In tends to increase the serum ferritin level (p=0.07), beta thalassemia trait and thalassemia major, there but this effect was not statistically significant. were conflicting reports about the impact of this Discussion mutation on iron overload [19,20,21]. However in a previous study on chronically transfused SCD pa- This study contributes to establishing the presence tients, there was no difference in HFE-H63D gene of the G71D mutation of the HAMP gene and of mutation frequencies between those who were the H63D mutation of the HFE gene in SCD pa- heavily iron overloaded and those who were less tients and in healthy controls in Egypt. The G71D iron overloaded [4]. mutation in the HAMP gene was detected in the Our study confirmed the major impact of total general northern European population at an allele lifetime transfusions on serum ferritin in SCD pa- frequency of 0.3% [9] and has been identified in tients (Figure 2). This is in agreement with previ- France [12], Italy [13], and UK [9]. Little is known ous studies that revealed a positive correlation be- about the frequency of the G71D variant among tween the liver iron concentration levels (LIC) and the Egyptian population and in SCD patients. In the duration of transfusion or the number of trans- our study, the G71D mutation of the HAMP gene fusions [22]. In our study, out of the SCD patients revealed higher frequency among SCD patients who received >50 transfusions in their lifetime, the than the normal controls, 8.5% vs. 6.7% respec- serum ferritin levels were significantly higher in pa- tively, although statistically non-significant. The tients carrying a single mutation as compared to the H63D mutation has a prevalence of approximately levels of SCD patients with the wild genotype 16% in the European population [10,14]. It was (p=0.017). This genetic variation may represent a found in 6/88 (6.8%) African-American patients risk factor for frequently transfused SCD patients with SCD [4]. The H63D allele frequency was with frequent exposure to iron. 10.7% in sickle cell disease patients in Brazil [15]. In Egypt, the allele frequency of H63D mutation Interestingly in our study, the multivariate regres- ranged from 13 to 30% in thalassemic patients and sion analysis of independent factors that may affect between 10 and 11% in controls [16,17]. In this serum ferritin level showed that the number of mu- study, the frequency of H63G heterozygous muta- tations harbored but not the individual mutations tion was significantly higher in SCD patients than tend to increase the serum ferritin level, albeit it did in the controls, 27.7% vs. 8.9%, respectively, not reach statistical significance (p=0.07), and the p=0.02. The overall allele frequency of H63D in hydroxyurea treatment significantly reduced serum SCD patients and normal controls in our study ferritin levels (p=0.029). Our results may support were 13.8 % and 4.4%, respectively. the hypothesis that interaction between genetic de- terminants of iron regulating genes could in some In the current study, the SCD patients carrying ei- cases be implicated in increasing iron storage. This ther HAMP-G71D or HFE-H63D variants did not comes in accordance with previous researchers who show statistically significant difference in iron over- suggested that, based on a digenic model of inheri- load parameters in relation to the patients with wild tance, the association of heterozygous mutations in genotype (Table 2). Previous studies reported con- the HFE and HAMP genes could lead to an adult- tradictory results regarding the impact of G71D onset form of primary iron overload [12]. Iron regulating genes in sickle cell disease 309

A limitation of our study was the inability to assess Wimhurst VL, Livesey KJ, Tanphaichitr V, Rochette J, Robson KJ. Digenic inheritance of mutations in HAMP and HFE re- LIC which remains the reference standard for de- sults in different types of haemochromatosis. Hum Mol Genet termining iron status in patients at risk of iron over- 2003;12(17):2241-7. load. Also, the estimation of the serum ferritin may 10. Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Domingo R Jr, Ellis MC, Fullan A, not be the ideal method for determining iron load Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, Lee in SCD. However, in order to limit the likelihood VK, Loeb DB, Mapa FA, McClelland E, Meyer NC, Mintier of the fluctuations of serum ferritin related to the GA, Moeller N, Moore T, Morikang E, Prass CE, Quintana L, Starnes SM, Schatzman RC, Brunke KJ, Drayna DT, Risch inflammatory nature of the disease, the steady state NJ, Bacon BR, Wolff RK.A novel MHC class I-like gene is values were considered in this study. Previously, it mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13(4):399-408. was found that the steady state serum ferritin levels 11. Saunders DB, Trapp GR. Basic and Clinical Biostatistics. 3rd correlate with liver iron concentration, and they are ed. Connecticut: Appleton & Lang; 2001. more likely to reflect the total body iron stores [23]. 12. Jacolot S, Le Gac G, Scotet V, Quere I, Mura C, Ferec C. HAMP as a modifier gene that increases the phenotypic expression of the HFE pC282Y homozygous genotype. Blood Conclusion 2004;103:2835–40. 13. Biasiotto G, Roetto A, Daraio F, Polotti A, Gerardi GM, Girelli D, Cremonesi L,Arosio P, Camaschella C. Identification The G71D mutation of HAMP gene and H63D of new mutations of hepcidin and hemojuvelin in patients with mutation of HFE gene are not uncommon among HFE C282Y allele. Blood Cells Mol Dis 2004;33:338–343. 14. Lyon E, Frank E. Hereditary hemochromatosis since discovery the Egyptian SCD patients. Neither the HAMP- of the HFE gene. Clin Chem 2001;47:1147–1156. G71D mutation nor the HFE-H63D mutation 15. Viana-Baracioli LM, Tukamoto Junior NC, Ricci Junior O, alone is a major determinant of total body iron sta- Mattos LC, Ângulo IL, Bonini-Domingos CR. Comparison of oxidative stress and the frequency of polymorphisms in the tus in patients with SCD. Nevertheless, the num- HFE gene between hemoglobin S trait blood donors and sickle ber of harbored mutations may increase the proba- cell disease patients. Genet. Mol. Res.2011; 10 (4): 3446-3454 bility of iron overload. 16. El-Rashidi FH, Elshafey AE, Ragab SM, Hegazy FF, EL-Nabi SH. Haemochromatosis gene mutation H63D is a risk factor for iron overload in egyptian beta- thalassemic children. Egypt. References J. Med. Hum. Genet 2008;9(2):149-59. 17. Madani HA, Afify RA, Abd El-Aal AA, Salama N, Ramy N. 1. Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Role of HFE gene mutations on developing iron overload in Ward DM, Ganz T, Kaplan J. Hepcidin regulates cellular iron beta-thalassaemia carriers in Egypt. East Mediterr Health J efflux by binding to ferroportin and inducing its internaliza- 2011;17(6):546-51. tion. Science 2004;306:2090–3. 18. Altès A, Bach V, Ruiz A, Esteve A, Felez J, Remacha AF, Sardà 2. Inati A, Khoriaty E, Musallam KM. Iron in sickle-cell disease: MP, Baiget M. Mutations in HAMP and HJV genes and their what have we learned over the years? Pediatr Blood Cancer impact on expression of clinical hemochromatosis in a cohort 2011;56(2):182-90. of 100 Spanish patients homozygous for the C282Y mutation 3. Fleming RE, Britton RS. Iron Imports. VI. HFE and regula- of HFE gene. Ann Hematol 2009;88(10):951-5. tion of intestinal iron absorption. Am J Physiol Gastrointest 19. Andreani M, Radio FC, Testi M, De Bernardo C, Troiano M, Liver Physiol 2006;290(4):G590-4. Majore S, Bertucci P, Polchi P, Rosati R, Grammatico P 4. Jeng MR, Adams-Graves P, Howard TA, Whorton MR, Li CS, Association of hepcidin promoter c.-582 A>G variant and iron Ware RE. Identification of hemochromatosis gene polymor- overload in thalassemia major. Haematologica phisms in chronically transfused patients with sickle cell dis- 2009;94(9):1293-6. ease. Am J Hematol 2003;74(4):243-8. 20. Melis MA, Cau M, Deidda F, Barella S, Cao A, Galanello R. 5. Kroot JJ, Laarakkers CM, Kemna EH, Biemond BJ, Swinkels H63D mutation in the HFE gene increases iron overload in DW. Regulation of serum hepcidin levels in sickle cell disease. beta thalassemia carriers. Haematologica 2002;87:242–6. Haematologica 2009;94:885-7. 21. Yamsri S, Sanchaisuriya K, Fucharoen S, Fucharoen G, 6. Politou M, Kalotychou V, Pissia M, Rombos Y, Sakellaropoulos Jetsrisuparb A, Wiangnon S, Changtrakul Y, Sanchaisuriya P. N, Papanikolaou G. The impact of the mutations of the HFE H63D mutation of the hemochromatosis gene and serum fer- gene and of the SLC11A3 gene on iron overload in Greek thal- ritin levels in Thai thalassemia carriers. Acta Haematol assemia intermedia and beta(s)/beta(thal) anemia patients. 2007;118:99-105. Haematologica 2004;89(4):490-2. 22. Teixeira AL, Viana MB, Roquete ML, Toppa NH. Sickle cell 7. Le Gac G, Férec C. The molecular genetics of haemochromato- disease: A clinical and histopathologic study of the liver in liv- sis. Eur J Hum Genet 2005;13:1172-85. ing children. J Pediatr Hematol Oncol 2002;24:125–9. 8. Miller SA, Dykes DD, Polesky HF.A simple salting out proce- 23. Brittenham GM, Cohen AR, McLaren CE, Martin MB, dure for extracting DNA from human nucleated cells. Nucleic Griffith PM, Nienhuis AW, Young NS, Allen CJ, Farrell DE, Acids Res 1988;16:1215. Harris JW. Hepatic iron stores and plasma ferritin concentra- 9. Merryweather-Clarke AT, Cadet E, Bomford A, Capron D, tion in patients with sickle cell anemia and thalassemia major. Viprakasit V, Miller A, McHugh PJ, Chapman RW, Pointon JJ, Am J Hematol 1993;42(1):81–85.