Microtubule-Active Drugs Taxol, Vinblastine, and Nocodazole Increase the Levels of Transcriptionally Active P531

ICANCER RESEARCH 55. 6021-6025. December IS, I995J Advances in Brief

Microtubule-active Drugs Taxol, Vinblastine, and Nocodazole Increase the Levels of Transcriptionally Active p531

Roy B. Tishler,2DianaM. Lamppu,SoniaPark,and BrendanD. Price Joint Cenierfor Radiation Therapy. Boston, Massachusetts 02115

Abstract interact with microtubules by different mechanisms, and the micro tubule inhibitor nocodazole. We will demonstrate that all three induce A range of DNA-damaging agents has been shown to increase cellular p53 in a NIH-3T3 fibroblast system. We will also show that, to levels of the nuclear phosphoprotein p53 and to induce p53-dependent varying degrees, these agents induce the @2JwAF!/cIPJmRNA that is processes. We examined the ability of three microtubule-activeagents, an integral component of the p53-induced G1 checkpoint. We also taxol, vinblastine, and nocodazole, to increase p53 levels and activate p53-dependent processes. When tested using a p53 DNA-binding assay, all examined the ability of the three drugs to induce p53-dependent three agents induced p53 in a dose-dependent manner. To varying de transcription in a CAT reporter system with two p53 binding sites in grees, these agents also induced @2jWAFI/C1PlmRNAand transcription in the promoter. The results clearly showed that the transcriptional a chloramphenicol acetyl transferase reporter system. These data suggest activity increased in a manner similar to @2jWAFI/C!PIinduction, there is an additional pathway for activating p53 and subsequent p53- indicating that this p21 WAFI/CIPIincrease most likely was also in dependent processes. duced by a p53-dependent mechanism.

Introduction Materials and Methods

DNA-damaging agents, which function by a number of different Cells. NIH-3T3 mouse fibroblasts were grown in DMEM (Sigma Chemical mechanisms, lead to the accumulation of increased levels of the Co., St. Louis, MO) supplemented with 10% bovine calf serum (HyClone nuclear phosphoprotein p53 and activate subsequent p53-dependent Laboratories, Los Angeles, CA), L-glutamifle, and penicillin/streptomycin processes (1â€”7).These downstream events include the p53-dependent (GIBCO, Grand Island, NY). For flow cytometry, EMSA, and Northern blot transcription of the p21 WAFI/CIP!3(8, 9) and gadd45 (3) genes and the experiments, cells were plated in 100-mm dishes at a concentration of @ subsequent regulation of processes such as arrest (1, 2) and 2.5 X l0@cells/dish. Cells were allowed to attach for 24 h, and drugs were apoptosis by p53 (10â€”13).The importance of DNA damage as the applied for an additional 24 h before processing. initiating stimulus for p53 increases has led to the investigation of the Preparation of Nuclear Extract. After drug exposure, the medium was role p53 plays in the response of cells to anticancer therapies, such as aspirated, and the cells were washed twice with PBS at 4Â°C. All washes were collected and used for cell preparation. Nuclear extracts were prepared as radiation, and direct DNA-damaging chemotherapeutic agents, in described previously (4). Cells were lysed by addition of2.5 ml ofbuffer A [20 cluding actinomycin D, cis-platinum, and Adriamycin. Studies in mM HEPES (pH 7.6)-20% glycerol-lO nmi NaC1-l.5 mM MgCI2-0.2 mM mice with tumors lacking the p53 gene (12) indicate that p53 is an EDTA-l mMDTT-1 mMphenylmethylsulfonyl fluoride-0.l % Triton X-lOO], important determinant of how well DNA-damaging agents induce scraped from the dish, resuspended, and incubated on ice for 5 mm. Lysates apoptosis, suggesting that lack of p53 may be a significant parameter were centrifuged (800 x g for 4 mm), and the nuclear pellet was resuspended in determining tumor response to therapy. Although the ability of in three volumes of extraction buffer (buffer A plus 500 mMNaCI). Nuclei DNA-damaging agents to induce p53 has been studied extensively, were incubated at 4Â°Cfor 30 mm, then centrifuged at 35,000 X g for 10 mm. the relationship between p53 function and drugs that act via a micro The supernatant was removed for immediate use or aliquoted and stored at tubule-based mechanism has not been examined. In addition, most â€”80Â°Cforsubsequent assays. studies on the cell cycle function of p53 have focused on its role in the EMSAs. The consensus p53 bindingsequencedeterminedby Funket a!. (GGACATGCCCGGGCATGTCC; Ref. 18) was synthesized, prepared in signal transduction pathway between DNA damage and the G, block. double-stranded form, and labeled as described previously (19). Binding However, recent studies have shown that p53 may be a component of reactions consisted of nuclear extract (20 @.tgofprotein), 0.5 ng 32P-labeled a microtubule/G2-related pathway that is induced by microtubule oligonucleotide, 0.2 @gsalmonsperm DNA (Sigma), and 100ng p53 antibody active drugs (14), and that the p53 status of cells may influence the (pAb42l; Oncogene Science, Manhasset, NY) with buffer A (without the response to G2-active agents ( 15â€”17).These factors led us to inves Triton), used to reach a final volume of 25 @.tl.Bindingreactions were tigate the effect of microtubule-active drugs on the induction of p53, incubated at room temperature for 20 mm, and 8 pi of reaction mixture were the subsequent induction 0f@2JWAFI/Cd'P1mRNA, and p53-dependent analyzed on 4% nondenaturing polyacrylamide gels, as described previously transcription. (19). This study examines the interaction of microtubule-active drugs Drug Treatment. Stock solutions of the three drugs were prepared in with p53 induction and p53-controlled processes. Three agents were DMSO and kept frozen until use. Flow Cytometry. Cells were preparedwith trypsin, pelleted, and then studied: two chemotherapeutic agents (taxol and vinblastine) that fixed with ethanol:water (2:1). Cells were stained using 0.01% propridium iodide and treated with RNase (Sigma) before analysis on a Becton Dickinson Received 7/24/95; accepted I I/I /95. flow cytometer using the CellFIT cell cycle analysis software and the SOBR The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with model. Distributions for vinblastine at 10ng/ml could not be fit using standard 18 U.S.C. Section 1734 solely to indicate this fact. models (Table I); the background of the distribution had a relatively large I Supported by funds from the Joint Center for Radiation Therapy. monotonically decreasing component from 0 to 4N, with G1 and 02 peaks 2 To whom requests for reprints should be addressed, at Joint Center for Radiation superimposed on it. Consequently, the fit was estimated by dividing the graph Therapy, 50 Binney Street, Boston, MA 02115. into three fields representing 0,, S phase, and G2-M.Using these methods, the 3 The abbreviations used are: WAFI, wild-type p53-activated fragment I; dPI, cyclin-dependent kinase-interacting protein I : EMSA, electrophoretic mobility shift distribution for 1 ng/ml gave G@58%, S phase 19%, and G2-M 24%, in good assay; CAT, chloramphenicol acetyl transferase. agreement with the values shown in Table 1. 6021

TabledistributionSamplePercentage I Effect oftaxol, yinblastine, and nocodazole on cell cycle cycle distribution. Taxol at 1 @LMledto changes in the cell cycle of cellscycleS in phase of cell distribution in as little as 6 h, and by 48 h this treatment resulted in >95% of cells having a G2-M DNA content (data not shown). Vin G2-MControl4934 phase blastine treatment led to changes in cell cycle distributions for con 17TaxollOnM5034 centrations of 1 ng/ml or higher. Concentrations of 1 and 10 ng/ml led to distributions that clearly showed an increase in the number of cells 16boo@4130 29l@M427 in G2-M but also had a barge number of cells with DNA contents less 69Vinblastine0.1 than 2N, with lesser quantities for 2N to 4N (data not shown; see â€œMaterialsand Methodsâ€•).Cells treated with nocodazole showed no 16Ing/mI5225ng/ml5232 change in cell cycle distribution at 2 ng/ml, slight changes in distri 23lOng/mI5318 29lOOng/mI1411 bution at 20 ng/ml, and G2-M DNA contents of over 70% for con 75Nocodazole2ng/ml5133 centrations of 200 ng/ml and 2 p.g/ml. Fig. lA demonstrates a dose-dependent induction of p53-DNA 162Ong/ml6218 binding activity by taxol. The data for vinblastine (Fig. 1B) show no 212oon@/ml713 802@g/ml814 induction of p53-DNA binding activity at 0.1 ng/ml, a concentration 78 that did not affect the cell cycle distribution (Table 1). A significant increase in p53-DNA binding is evident for concentrations of 1 and 10 ng/ml (Fig. 1B), which had a relatively minor effect on cell cycle Northern Blots. Cellular RNA was prepared using the acid guanidine distribution. Treatment with nocodazole leads to increases in p53 at isothiocyanate method, and RNA was separated on 1% agarose/2.2 M formal dehyde gels (20). RNA was transferred to nylon membrane, and p21 mRNA concentrations of 20 ng/ml to 2 @g/ml.No detectable changes were was detected with an oligonucleotide complementary to amino acids 111â€”120 observed for 2 ng/ml; this concentration did not alter the cell cycle of the mouse p2! cDNA clone (TCAGACACCAGAGTGCAAGAGACAGC distribution (Fig. 1C). These data demonstrate that induction of p53 GACAA; Ref. 8). This oligonucleotide specifically detects the 2-kb mouse p21 by these three microtubule inhibitors can occur at concentrations that mRNA. RNA concentration was measured by absorbance (260 am), equal do not significantly alter the cell cycle distribution (Table 1). How quantities were loaded and then confirmed by ethidium bromide staining of the ever, maximal increases in p53-DNA binding were observed at higher agarose gels, and the rRNA bands were assessed. Membranes were washed in concentrations. 0.5X SSC at 56Â°C for 10 mm. Vinblastine caused accumulation of p21 WAFJ/CIP!mRNA at 1 and p53 Cell Line with CAT Reporter. NIH-3T3 cells were transfected by 10 ng/ml (Fig. 2B), concentrations that also induced p53-DNA bind calcium phosphate precipitation with 10 @xgofplasmid p50â€”2,whichcontains ing activity (Fig. 1B). It was surprising that taxol did not cause any two copies ofthe muscle creatinine kinase p53 binding site (21), plus 1 p@gpSV significant accumulation of p21 WAFI/CIPI(Fig. 14 ), despite the in Neo (NPCAT cells). Cells were trypsinized, replated at 1:5 to 1:20 dilutions, and exposed to 400 g.@g/mlG418 for 10 days. Surviving colonies were crease in p53-DNA binding activity seen in Fig. 1A. Nocodazole at 2 trypsinized, and pooled cell populations (containing approximately 100 cob ng/ml, which did not induce p53, did not affect p2JwAFI/CJPJ levels, nies) were maintained in 400 p@g/ml G418. Cells were treated with the but concentrations of 20 ng/ml to 2 @ig/mlnocodazole caused signif @ specified quantity of drug for 24 h. Protein levels were quantitated using a icant accumulation of @2JwAFI/cIP1 (Fig. 2C). Although p53 Bio-Rad DC protein assay kit. CAT assays were performed using a Boehringer can transcriptionally regulate the @2jWAFI/CIP!gene,its mRNA levels Mannheim kit and used according to the manufacturer's instructions. Absorb can be increased by p53-independent pathways (22, 23). Fig. 3 shows ance was read at 405 nm using a Bio-Rad 450 microplate reader. the efficacy of a 24-h exposure of each of the three drugs in inducing transcription of a CAT reporter construct in NPCAT cells. Significant Results and Discussion increases in CAT protein with taxob were observed at the highest The dose-response relationship of the NIH-3T3 fibroblasts to 24-h concentration used, 1 @.tM,withan approximately 2.8-fold increase; a treatment with taxol, vinblastine, and nocodazole is shown in Table 1. slight increase was seen for 10 nM taxol. In contrast, vinblastine Treatment with taxol at both 100 nM and 1 p@ led to changes in cell increased the levels of CAT protein at concentrations of 1 ng/ml or A. B. VinbiastineC. EnMI Ing/mil In@/mI1

__J ;;@ooo ct@@oq I- ii-O @o,â€”o Iâ€” @J Fig. 1. Induction of p53-DNA binding activity by taxol, vinblastine, and nocodazole. EMSAs for p53 binding for cells treated with taxol (A), vinblastine (B), :@TJ@@:@:1 or nocodazole (C) for 24 h. Control NIH-3T3 cells were exposed to the same concentration of DMSO as drug samples. Nuclear extracts were prepared and DNA binding activity was measured as described in â€œMate rials and Methods.â€•Experiments were repeated twice with similar results. CTRL, control.

@tiLi

6022

A. Taxol B. VinbiastineC. Nocodazole [ng/mI] [ng/mIJ Fig. 2. Induction of p2IWAFI/CIPI mRNA by [nM] taxol (A), vinblastine (B), and nocodazole (C). Northem blot analysis of total RNA using an oligo -I â€”I nucleotide probe to amino acids I I 1â€”120ofmouse 000 ;;@C%J0 00 @ p21 . Cells were treated with drugs for 24 h before ci: c%j00 preparation of total RNA as described in â€œMaterials Iâ€” @â€”0 and Methods.â€•Controls were treated with the same C-) C_) i@ concentration of DMSO as was used in drug treated samples. Experiments were repeated with similar results. CTRL, control.

@ greater, drug levels at which both p53 were induced. present study are not included in any of the previously described Nocodazole increased CAT protein levels in a similar manner, with a induction pathways. Taxol, vinblastine, and nocodazole interact with significant increase over the range of 20 ng/ml to 2 @g/ml.Minimal microtubules via different mechanisms. Although they do not directly changes were seen for concentrations of 2 ng/ml, which did not affect interact with DNA, some DNA damage may result from the disruption cell cycle distributions, p53, or @2JWAFI/CIPITheincreased levels of of the microtubule system. It is not likely that this secondary damage CAT protein can be compared with that seen for actinomycin D, a to DNA is the only or even the dominant mechanism for alteration in direct DNA-damaging agent that has been shown previously to be a p53 levels because the p53 changes are seen at concentrations of drugs potent inducer of p53-DNA binding activity (1, 2, 4). A concentration that do not show a large effect on microtubule functioning in cell of 2.5 ng/ml led to minimal changes in CAT protein levels, whereas division (i.e., no change in cell cycle distribution). significant dose-dependent increases were seen with 10 and 25 ng/ml Recent studies have indicated that some event(s) occurring in 02 (Fig. 3A ). For concentrations of the microtubule agents that gave may be regulated via a p53-dependent mechanism (14â€”17). This maximal changes in cell cycle distribution, the levels of CAT induc suggests that microtubule-active agents may effect some changes in Lion are comparable to those seen for the actinomycin concentrations the cell by modulating p53. One report demonstrated that mouse shown. However, higher levels of induction are possible with increas embryo fibroblasts with a wild-type p53 treated with nocodazole and ing actinomycin concentrations. The dependence of the actinomycin Colcemid (another microtubule-active agent) activated a p53-depend induction of CAT activity on a p53 pathway was demonstrated in ent mitotic checkpoint that was absent in fibroblasts that lacked both transient transfection experiments with a mutant p53 expression vec p53 alleles (14). Treatment of all cells with nocodazole or Colcemid tor. The mutant protein completely eliminated the CAT response to led to cell populations with an increased number of cells in G2-M with actinomycin.4 In addition, the p53 specificity of the taxol-induced a 4N DNA content. The lack of activation of the microtubule-based response in the gel shift assays was demonstrated by the induction of pathway in fibroblasts from p53@ transgenic mice caused cells in a supershift when the p53 specific monocbonal Ab42l was added to G2-M to undergo a second round of DNA synthesis but not division. the reaction mixture.4 This results in a large number of cells, with an 8N or higher DNA These data demonstrate that all three of the microtubule-active content accumulating for the p53@ cells. This did not occur to any agents cause cell cycle arrest in G2 and lead to increases in p53-DNA significant extent in cells with intact p53 protein, suggesting the binding. Only vinblastine and nocodazole treatment resulted in in existence of a p53-microtubule interaction. Recent publications look creases in @2jWAFI/CIPImRNAlevels. All agents led to increases in ing at therapy and the effect of overriding the G2 checkpoint with CAT protein levels, but for taxol this was only seen at the highest agents such as caffeine showed differential effects on cells based on concentration used. This discrepancy could in part be due to the their p53 status (15â€”17).This also suggests that there may be a greater sensitivity of the CAT assay relative to the Northern blot pathway involving microtubules and p53 that could potentially be analysis, but also suggests that taxol may only be a weak inducer of activated by microtubule-active agents. transcriptional activity. Various stimuli can cause cells to initiate a series of steps leading Previous reports have demonstrated that p53 is induced as a result to programmed cell death; wild-type p53 has been shown to be a of treatment of cells with DNA-damaging agents, including chemo component of an apoptotic pathway induced by DNA damage (10â€” therapeutic drugs and radiation (1â€”7).The techniques used to show 13). Both in vitro and in vivo studies of cells with defined genetic this have included flow cytometry with antibodies to p53, immuno changes have demonstrated that loss of p53 may play a central role in histochemistry, and Western blotting. The EMSA method has been the response of cells to DNA-damaging chemotherapy agents and used to demonstrate that a range of DNA-damaging chemotherapy radiation (12, 13). In these carefully constructed systems with E1A drugs, as well as radiation and hydrogen peroxide, leads to increases and ras cotransfected (12, 13), induction of apoptosis via a p53- in p53 levels (4, 5). The data presented here indicate that three drugs, dependent mechanism by the agents seemed to be a major determinant the primary mode of action of which is to alter microtubule function of cellular and tumor response to treatment. Our data raise the pos and that are not direct DNA-damaging agents, can initiate a p53 sibility that a component of the antineoplastic effect of taxol and induction pathway. This result raises the question of how these three vinblastine may function via a p53-dependent pathway. drugs cause p53 levels to increase. The agents shown previously to The p53 protein manifests its pleiotropic cellular effects by acti induce p53 share a common pathway that begins with some form of vating the transcription of multiple genes. One of the major effectors DNA damage. The intermediate steps that link this damage to the of the cellular effects of p53 is the protein p21WAFh/@@@,aMr 21,000 induction of p53 have not been elucidated, but the drugs used in the inhibitor of cyclin-dependent kinase 2 kinase activity, which is re quired for the 01-S transition (8, 9). Increased p53 levels after DNA 4 B. D. Price, unpublished data. damage cause transcriptional activation of the p21 WAFI/CIPIgene, 6023

10 A 8 8 B Fig. 3. p53-dependent induction of CAT activ ity. NIH-3T3 cells were permanently transfected 6 with a CAT reporter construct containing p53- C DNA binding sites in the promoter. Cells were C 6 0 treated for 24 h with actinomycin D (A ) or taxol, 0 vinblastine, or nocodazole (B) at the specified con .54 centrations. CAT assays were performed as out E lined in â€œMaterialsand Methods.â€•All values are .@ 4. expressed relative to appropriate control, consisting of the solvent used for each agent (ethanol for the @0 V 02 actinomycin and DMSO for other drugs). Controls 0 U- were measured to have an absolute level of 7â€”8pg LL@ CAT per 50 ng protein. Columns, mean for three separate experiments; bars, SEM.

@@@@ â€˜I Ill vs 0 @8i@ ;@â€˜-â€˜@8@

Actlnomycln(ng/mlJ TaxolInMI VinbiastineIng/mIl Nocodazole(ng/mlj

accumulation of the p2 1WAF1/CIPIprotein, and inhibition of cyclin support the existence of an alternative mechanism for induction of dependent kinase 2, leading to G3 arrest. Having established the p53. There is also a suggestion of differences in the induction of the induction of p53 by taxol, vinblastine, and nocodazole, we examined [email protected]@'h1@1and transcriptional activity between the two different their ability to induce p2JwAFJ/cIPI mRNA (Fig. 2). Because it is mechanisms involved. Because these agents currently play a major possible for @2JWAF!/CIPIto be induced by a non-p53-dependent role in chemotherapeutic regimens, and will do so in the future, we pathway, we also examined the ability of these agents to directly will need to incorporate this information into our evolving description induce p53-dependent transcription (Fig. 3). of p53 pathways, chemotherapy treatments, and therapeutic response. All three agents used in this study interact with the same cellular targets (microtubules), but the mechanisms of action differ substan References

tially. The primary mode of action for vinblastine and nocodazole is 1. Kastan, M. B., Onyekwere, 0., Sidransky, D., Vogelstein, B., and Craig, R. W. to inhibit formation of microtubules (24). This is also the mechanism Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 51: of action of most of the known microtubule-active drugs, such as 6304â€”6311, 1991. 2. Kuerbitz, S. J., Plunkett, B. S., Walsh, W. V., and Kastan, M. B. Wild-type p53 is a Cobcemid and derivatives of the Vinca alkaloids (24). In contrast, cell cycle checkpoint determinant following irradiation. Proc. Natl. Acad. Sci. USA, taxol and the related compound taxotere act by stabilizing microtu 89:7491â€”7495,1992. bules and enhancing polymerization (25). There does appear to be 3. Kastan, M. B., Than, Q., El-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fomace, A. J., Jr. A mammalian cell cycle some difference between taxol and vinblastine, particularly in terms of checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. the transcriptional activity at concentrations of drug that give similar Cell, 71: 587â€”597,1992. 4. Tishler, R. B., Calderwood, S. K., Coleman, C. N., and Price, B. D. Increases in levels of cell cycle changes. The difference in mechanisms between sequence specific DNA binding by p53 following treatment with chemotherapeutic the drugs would not appear to be sufficient to alter the induction of and DNA damaging agents. Cancer Res., 53: 22 12â€”2216,1993. @ but the pathway by which these drugs induce p53 has 5. Price, B. D., and Calderwood, S. K. Increased sequence-specific p53-DNA binding activity after DNA damage is attenuated by phorbol esters. Oncogene, 8: 3055â€”3062, not been elucidated (i.e., does it depend on DNA damage, or is there 1993. an alternative pathway?). A possible explanation is that taxol and 6. Nelson, W. G., and Kastan, M. B. DNA strand breaks: the DNA template alterations vinblastine induce p53 via different pathways, and that the taxol that trigger p53-dependent DNA response pathways. Mol. Cell. Biol., 14: 1815â€”1823, 1994. pathway does not lead to @2jWAFI/CIPJinduction. Alternatively, yin 7. Fritsche, M., Haessler, C., and Brander, G. Induction of nuclear accumulation of the blastine may induce @2JwAFI/cIPJviaa p53-independent mechanism, tumour suppressor protein p53 by DNA-damaging agents. Oncogene, 8: 307â€”318, 1993. as has been shown to be the case for other chemotherapy agents. 8. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., However, this does not appear to be the case because vinblastine Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. WAF1, a potential induces transcriptional activity in the reporter system. mediator of p53 tumor suppression. Cell, 75: 817â€”825,1993. 9. Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. The p21 Another issue raised by these data concerns the role of the induced Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclin-dependent kinases. p53. These agents are all known to lead to an increase of cell Cell,75:805â€”816,1993. 10. Lowe, S. W., Schmitt, E. M., Simth, S. W., Osbome, B. A., and Jacks, T. p53 is populations in G2-M; this is supported by our data. However, p53 required for radiation-induced apoptosis in mouse thymocytes. Nature (Land.), 362: induction also leads to an increase of cells with a 2N DNA content 847â€”849,1993. based on the block in G1. One possibility is that there is a transient I 1. Clarke, A. R., Purdue, C. A., Harrison, D. J., Morris, R. G., Bird, C. C., Hooper, M. L, and Wylie, A. H. Thymocyte apoptosis induced by p53-dependent and independent induction of a 0, block. However, cells treated with drug for 6 h show pathways. Nature (Land.), 362: 849â€”851, 1993. a decrease in the fraction of cells in G@and an increase in the fraction 12. Lowe, S. W., Bodis, S., Mcdlatchey, A., Remington, L., Ruley, H. E., Fisher, D. E., of cells in 02, indicating that a G@block is not being effected (data not Housman, D. E., and Jacks, T. p53 status and the efficacy of cancer therapy in vivo. Science (Washington DC), 266: 807â€”810, 1994. shown). A possible explanation is that the p53 is only induced by 13. Lowe, S. W., Ruley, H. W., Jacks, T., and Housman, D. E. p53-dependent apoptosis these agents when cells are past the point in G@at which cells could modulates the cytotoxicity of anticancer agents. Cell, 74: 957â€”967,1993. 14. Cross, S. W., Sanchez, C. A., Morgan, C. A., Schimke, M. K., Ramel, S., Idzerda, be stopped by the checkpoint (e.g., these agents may only induce p53 R. L., Raskind, W. H., and Reid, B. J. A p53-dependent mouse spindle checkpoint. in G2). Science (Washington DC), 267: 1353â€”1356,1995. In summary, we have demonstrated activation of p53-DNA binding 15. Russell, K. J., Wiens, L. W., Demers, W. G., Galloway, D. A., Plon, S. E., and Groudine, M. Abrogation of the G2 checkpoint results in differential radiosensitiza by a class of drugs not previously shown to induce p53. The micro tion of G1 checkpoint-deficient and G1 checkpoint-competent cells. Cancer Res., 55: tubule-active drugs used here do not directly damage DNA, and they 1639â€”1642,1995. 6024

16. Powell, S. N., DeFrank, J. S., Connell, P., Eogan, M., Preffer, F., Dombrowski, D., p53 mediates positive regulation of gene expression through a specific DNA sequence Tang, W., and Friend, S. Differential sensitivity of pS3@ and @53(+)cellsto caffeine element. Genes & Dcv., 6: 1143â€”1152,1992. induced radiosensitization and override of G2 delay. Cancer Res., 55: 1643â€”1648, 22. Johnson, M., Dimitrov, D., Vojta, P. J., Barrett, J. C., Nods, A., Pereira-Smith, 0. M., 1995. and Smith, J. R. Evidence for a p53-independent pathway for upregulation of 17. Fan, S., Smith, M. L., Rivet, D. J., II, Duba, D., Zahn, Q., Kohn, K. W., Fomace, A. J., SDI/CIP1/WAFI/p2l RNA in human cells. Mol. Carcinog., ii: 59â€”64, 1994. Jr., and O'Connor, P. M. Disruption of p53 function sensitizes breast cancer MCF-7 23. Sheik, M. S., Li, X-S., Chen, i-C., Shao, Z-M., Ordonez, i. V., and Fontan, I. cells to cisplatin and pentoxifylline. Cancer Res., 55: 1649â€”1654, 1995. Mechanisms of regulation of WAFI/Cipi gene expression in human breast carcinoma: 18. Funk, w. D., Pak, D. T., Karas, R. H., Wright, W. E., and Shay, J. W. A transcrip role of p53-dependent and independent signal transduction pathways. Oncogene, 9: tionally active DNA-binding site for human p53 protein complexes. Mol. Cell. Biol., 12:2866â€”2871,1992. 3407â€”MIS,1994. 24. Calabresi, P., and Chabner, B. A. Chemotherapy of neoplastic diseases. In: A. G. 19. Price, B. D., and Calderwood, S. K. Ca2@is essential for multistep activation of the heat shock factor in permeabilized cells. Mol. Cell. Biol., 6: 3365â€”3368,1991. Goodman, T. W. Rall, A. S. Nies, and P. Taylor (eds.), Goodman & Gilman's 20. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid Pharmacological Basis ofTherapeutics, Ed. 8, pp. 1202â€”1263.New York: Pergamon guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., /62: 156â€” Press, 1990. 159,1987. 25. Schiff, P. B., and Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast 21. Zambetti, G. P., Bargonetti, J., Walker, K., Prives, C., and Levine, A. J. Wild-type cells. Proc. NatI. Acad. Sci. USA, 77: 1561â€”1565,1980.

6025

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1995 American Association for Cancer Research. Microtubule-active Drugs Taxol, Vinblastine, and Nocodazole Increase the Levels of Transcriptionally Active p53

Roy B. Tishler, Diana M. Lamppu, Sonia Park, et al.

Cancer Res 1995;55:6021-6025.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/55/24/6021

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/55/24/6021. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.