Human Cancer Biology

Expression Analysis of Barrett’s Esophagus ^ Associated High-Grade Dysplasia in Laser Capture Microdissected Archival Tissue Edmond Sabo,1Patricia A. Meitner,1Rosemarie Tavares,1Christopher L. Corless,3 GregoryY.Lauwers, 4 Steven F. Moss,2 and MurrayB. Resnick 1

Abstract Purpose: Identifying differentially expressed in nondysplastic BE (NDBE) from those expressed in high-grade dysplasia (HGD) should be of value in improving our understanding of this transition and mayyield new diagnostic and/or prognostic markers.The aim of this studywas to determine the differential transcriptome of HGD compared with NDBE through microarray analysis of epithelial cells microdissected from archival tissue specimens. Experimental Design: Laser capture microdissection was used to isolate epithelial cells from adjacent inflammatoryand stromal cells. Epithelial mRNA was extracted from areas of NDBE and HGD in matched biopsies from 11patients. mRNA was reverse transcribed and applied on Affymetrix cDNA microarray chips customized for formalin-exposed tissue. For a subset of these genes, differential was confirmed byreal-time PCR and immunohistochemistry. Results: There were 131genes overexpressed byat least 2.5-fold in HGD versus NDBE and 16 genes that were underexpressed byat least 2.5-fold. Among the overexpressed genes are several previouslyshown to be increased in the neoplastic progression of BE, as well as novel genes such as lipocalin-2, S100A9, matrix metallopeptidase 12, secernin 1,andtopoisomerase IIa.Genes decreased in dysplastic epithelium include MUC5AC, trefoil factor 1 (TFF1), ,andCD13. Real-time PCR validated the changes in expression in 24 of 28 selected genes. Immuno- histochemistryconfirmed increased protein expression for topoisomerase II a,S100A9,and lipocalin-2 and decreased expression of TFF1across the spectrum of BE-associated dysplasia from NDBE through adenocarcinoma. Conclusions: This is the first studyto identifyepithelial genes differentiallyexpressed in HGD versus NDBE in matched patient samples.The genes identified include several previouslyimplicat- ed in the pathogenesis of BE-associated dysplasia and new candidates for further investigation.

Barrett’s esophagus (BE) is a premalignant condition in which dysplasia (LGD) to high-grade dysplasia (HGD). Approxi- the normal squamous epithelium of the distal esophagus mately half of all patients with HGD will progress to EAC (3). undergoes metaplasia to a specialized intestinal epithelium. Several genetic abnormalities have been implicated in the The presence of BE increases the risk of developing esophageal transition from BE through HGD to EAC, including micro- adenocarcinoma (EAC);approximately 1% of patients diag- satellite instability (4), promoter hypermethylation (5–8), and nosed with BE will progress from metaplasia to dysplasia and altered expression of a large set of genes (reviewed in 9). The finally to BE-related EAC (1, 2). EACs are thought to develop identification of HGD by light microscopy is still considered from BE by way of a stepwise transition through low-grade the gold standard by which patient follow-up and treatment is coordinated. However, the morphologic distinction between LGD and HGD can be challenging (10, 11). It would be Authors’ Affiliations: Departments of 1Pathologyand 2Medicine, Rhode Island beneficial to identify novel markers that would objectively Hospital/Brown University, Providence, Rhode Island; 3Department of Pathology, differentiate the grade of dysplasia as well as identify patients Oregon Health and Science University, Portland, Oregon; and 4Department of irrespective of the degree of dysplasia who are more likely to Pathology, Massachusetts General Hospital, Boston, Massachusetts progress to EAC. To date, many molecular, immunohistochem- Received 2/4/08; revised 5/7/08; accepted 5/26/08. Grant support: Molecular PathologyCore of the COBRE Center for Cancer ical, and other markers have been evaluated;however, none Research Development and NIH grant P20 RR17695, awarded bythe National reliably distinguishes between LGD and HGD or serves to Center for Research Resources, Institutional Development Award Program. predict progression of dysplasia to EAC (11). The costs of publication of this article were defrayed in part by the payment of page Expressional profiling, which allows for the simultaneous charges. This article must therefore be herebymarked advertisement in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. examination of a large panel of genes, is one method currently Note: Supplementarydata for this article are available at Clinical Cancer Research used to search for novel biomarkers. DNA microarrays have been Online (http://clincancerres.aacrjournals.org/). used to compare EAC, esophageal squamous cell carcinoma, Requests for reprints: MurrayB. Resnick, Department of Pathology,Rhode and BE and have identified unique gene expression profiles Island Hospital, APC12, 593 EddyStreet, Providence, RI 02903. Phone: 401-444- 4380; Fax: 401-444-8514; E-mail: [email protected]. capable of discriminating between these entities (12–22). F 2008 American Association for Cancer Research. However, only one report has attempted to discriminate doi:10.1158/1078-0432.CCR-08-0302 the transcriptome of BE-associated dysplasia compared with

ClinCancerRes2008;14(20)October15,2008 6440 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Transcriptome of BE-Associated Dysplasia

LCM and RNA extraction. A Paradise FFPE Reagent System kit Translational Relevance (Molecular Devices) was used to extract and amplify RNA from laser- captured cells. In brief, 7-Am sections were air dried, stained, Identification of biomarkers capable of distinguishing the dehydrated through graded alcohols, and subjected to LCM within grade of Barrett’s esophagus (BE)-associated dysplasia, 2 h of deparaffinization. About 5,000 surface epithelial cells each from as well as identifying patients who are most likely to areas of HGD and NDBE were microdissected from the tissue sections progress to adenocarcinoma, would provide extremely and captured on LCM Macro CapSure caps (Molecular Devices) using an AutoPix Automated LCM instrument (Molecular Devices). From the valuable tools for both surgical pathologists and gastro- microdissected cells, total RNA was extracted, purified, and amplified entorologists. In this study, we have identified several through 1.5 rounds of linear amplification using T7 bacteriophage RNA potential biomarkers using laser capture microdissection polymerase-driven in vitro transcription. After first-strand cDNA followed bygene expression profiling on archival clinical synthesis, quality of RNA was evaluated by real-time PCR using primers samples. As pathologists, our primarygoal was to identify for the 3¶ and 5¶ ends of h-actin. RNA was considered acceptable for candidates for the generation of immunohistochemical analysis if the quantity of RNA was >15 ng and the 3¶ end to 5¶ end ratio reagents, as this technique is readilyavailable in all pathol- for h-actin was <10. The final amplification and labeling of the dsDNA ogydepartments. A pilot studyto determine the utilityof product was done using an Enzo BioArray HighYield RNA Transcript using four of these as immunohistochemical markers Labeling kit (Enzo Life Sciences). showed that lipocalin-2, S100A9, TFF1, and especially Microarray hybridization. Labeled cRNA was fragmented and then hybridized onto cDNA microarray chips customized for RNA extracted topoisomerase IIa all possess promising potential as indi- from FFPE tissues (human U133-X3P expression arrays;Affymetrix) cators of BE-associated dysplasia.These proteins will need at the Affymetrix GeneChip Resource at the W.M. Keck Foundation to be validated in a larger series of cases.We also identified Biotechnology Resource Laboratory (Yale University, New Haven, CT). several other potential candidates, manyof which as yet These procedures have been described previously (23). do not have commerciallyavailable antibodies suitable for Bioinformatics and statistical methods. The expression signals were immunohistochemistry. normalized using the Standardization and Normalization of Microarray Data web-based software (24). Concordantly, absent expression signals were removed from the analysis. Statistical comparison of the gene expression levels between the two groups (HGD versus ND) was done nondysplastic BE (NDBE;ref. 22). Our study takes advantage of using the Wilcoxon matched-pairs signed-ranks test using the Statistical two technologies to allow for a more definitive comparison of Package for the Social Sciences statistical package for Windows (version the BE and HGD transcriptomes. One is laser capture microdis- 16.0;SPSS, Inc.). To correct for the multiple hypotheses testing effect, section (LCM) of HGD and BE to obtain purified populations of q values were also calculated using the R open source statistical program epithelial cells with minimal contaminating inflammatory and with the q value package (Bioconductor Software Project). Gene stromal cells. The second is the use of microarrays specifically annotation for classification of the genes in functional categories was designed for analyzing material from formalin-fixed paraffin- done using the GenMAPP 2.0 (Gene MicroArray Pathway Profiler, embedded (FFPE) archival tissue specimens. Together, these Gladstone Institutes, University of California at San Francisco, San technologies have allowed us to examine epithelium-specific Francisco, CA) and the web-based Database for Annotation, Visualiza- tion and Integrated Discovery5 (25). The overall correlation of the fold changes that are related to the development of dysplastic BE. changes between the Affymetrix chip and the PCR results was tested using the Spearman’s coefficient of correlation. Two-tailed P values of Materials and Methods V0.05 were considered to be statistically significant. Confirmation of microarray results by real-time PCR. Several genes Patients and biopsies. Archival FFPE endoscopic esophageal biopsies of interest expressed at a >2.5-fold difference between NDBE epithelium that had been collected for clinical purposes were obtained from the and HGD epithelium were selected for confirmation. cDNAs retained Pathology Departments of the Rhode Island and Miriam Hospitals for gene of interest confirmation purposes were analyzed by real-time (Providence, RI), the Oregon Health and Science University Hospital PCR to verify the result from gene chip analysis. Real-time PCR was (Portland, OR), and the Massachusetts General Hospital (Boston, MA) done on the 11 different paired samples per gene. Results were further in accordance with Institutional Review Board approvals from all confirmed by analysis of 17 new cases, 8 NDBE and 9 HGD. Whenever hospitals. Sections (4 Am) were cut from each paraffin block and possible, gene-specific primers for real-time PCR were designed to span stained by H&E. The slides were reviewed by experienced gastrointes- an intron (to rule out artifacts from genomic DNA contamination) and tinal pathologists (M.B.R. and either C.L.C. or G.Y.L.) to confirm the to amplify f100 bp from within 400 bases of the 3¶ end of the gene presence of HGD and NDBE. For gene array analysis, suitable cases had because the Paradise kit uses oligo(dT) priming for first-strand synthesis areas of both NDBE as well as HGD available for LCM and extraction and formalin-fixed RNA is often fragmented to <400 bases. Primers of RNA. RNA from a total of 11 paired biopsies was extracted for were designed using Primer3 shareware (26) and synthesized by analysis on 22 microarray chips. For confirmation of representative Operon Technologies. Real-time PCR was accomplished on an MX4000 genes of interest from the array results, additional biopsy samples from real-time instrument (Stratagene) using Brilliant SYBR Green Master additional patients were laser captured for real-time PCR and sectioned Mix reagents (Stratagene) according to the manufacturer’s instructions. for immunohistochemistry. In parallel to measuring expression of genes of interest, reactions were Quality of RNA. Because of the potential for RNA degradation in done using primers for the 3¶ end of the human b-actin gene to which the routinely collected and processed FFPE tissues, it was important to all data were then normalized. Amplification conditions yielded check that the blocks contained RNA of suitable quality. Several 10-Am efficiencies >90% and linear regression coefficients >0.990. b-Actin  sections were cut from each paraffin block and total RNA was extracted was amplified from serial 10 dilutions of cDNA reverse transcribed and purified using a Paradise Quality Assessment kit (Molecular from Stratagene Reference RNA and values were used to construct a Devices). Genomic DNA was removed with RNase-free DNase from calibration curve for each PCR run to relate the threshold cycle to the the same kit. RNA was evaluated by an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies) as described previously (23). 5 http://david.abcc.ncifcrf.gov/

www.aacrjournals.org 6441 Clin Cancer Res 2008;14(20) October 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Human Cancer Biology log input amount of template used and to determine relative amounts Systems). Antigen retrieval was done by microwaving in citrate buffer of gene transcripts. The sequence of each primer pair and the amplicon (pH 6.0) for 10 min. Slides were blocked using Peroxidase-Blocking size are listed in Table 1. Thermocycling was carried out for 45 cycles, Reagent (Dako Corp.). Primary antibody was diluted at 1:50 and with denaturation at 95jC for 30 s, annealing for 1 min at 57jC, and incubated overnight at 4jC for topoisomerase IIa and diluted at extension at 72jC for 30 s. All samples were run in duplicate. A 1:1,000 and incubated overnight at 4jC for lipocalin-2. For topoiso- dissociation temperature gradient was included at the end of each run merase IIa, the antibody was detected using the Dako EnVision + Dual to confirm absence of high molecular weight DNA and primer dimers. Link System Peroxidase and the chromogen was developed using Dako Immunohistochemistry. Immunohistochemical analysis was done Liquid DAB+ Substrate System. For lipocalin-2, the secondary antibody on 12 additional biopsy samples from different patients with either biotinylated anti-rat by Vector was incubated for 30 min. The antibody NDBE, HGD, or adenocarcinoma and 11 samples of biopsies with was detected using the Vectastain avidin-biotin complex method kit and LGD. Topoisomerase IIa staining was done using a monoclonal anti- the chromogen was developed using Dako Liquid DAB+ Substrate body (NeoMarkers) and lipocalin-2, a rat polyclonal antibody (R&D System. Immunohistochemistry for the pS2 monoclonal antibody,

Table 1. Real-time PCR primers for confirmation of microarray results

Name Symbol Genbank ID Sense primer/antisense primer Amplicon h-Actin ACTB NM_001101 TCCCCCAACTTGAGATGTATGAAG/ 91 AACTGGTCTCAAGTCAGTGTACAGG Alanyl (membrane) ANPEP NM_001150 AACCTCATCCAGGCAGTGAC/ 92* aminopeptidase (CD13) AAGCCTGTTTCCTCGTTGTC Aldolase B, fructose bisphosphate ALDOB NM_000035 TGGCATCTGCTTTTTGTCTG/ 83* TTGGTAGAGGGCAAAGGTTG Calcium/calmodulin-dependent CAMK2N1 N75559 ACGGCGGTAACAGTTATTGG/ 85 protein kinase II inhibitor 1 TGATTTCATCGTGGGTAGCA Complement component 3 C3 NM_000064 GGAGCAGTCAAGGTCTACGC/ 82* GCTTTCCATCCTCCTTTTCC Fatty acid binding protein 1, liver FABP1 NM_001443 GCAGAGCCAGGAAAACTTTG/ 88* CACCCCCTTGATATCCTTCC Fidgetin-like 1 FIGNL1 NM_022116.2 TGCACAGTACCTGGAGTGAAA/ 99* GAGCTGGAGGTCTGCATTTT/ Formyl peptide receptor 1 FPR1 NM_002029 AAGACCACAGCTGGTGAACA/ 101* AGCCAGCAGATACAGCAGGT Histone cluster 1,H2ag HIST1H2AG NM_021064 TGCCCAAAAAGACTGAGAGC/ 95 CGTTGGTTTGGACTCGATTT Hydroxyprostaglandin HPGD J05594 AAAAGAAGAAAACATGGGACAA/ 99* dehydrogenase 15-(NAD) CCATTGGCAATCAATGGTG Hydroxysteroid (17-h) HSD17B2 NM_002153 CACGAAGCCAGTGCAGATAA/ 85* dehydrogenase 2 ATTGTTGATCACAGCCCACA Lipocalin-2 LCN2 NM_005564 CAAGGAGCTGACTTCGGAAC/ 104* TACACTGGTCGATTGGGACA Meprin A, a MEP1A NM_005588 TTGTTGGCACTCAACAATGG/ 104* TTTCATCATATATATTCAATCTGCAA Minichromosome maintenance MCM10 AL136840 TTGTTGTGGGAGATGGTTGA/ 96* complex component 10 CCTTCCACCCAATTAGAGCA Matrix metallopeptidase 1 MMP1 NM_002421 AGGTCTCTGAGGGTCAAGCA/ 111* CTGGTTGAAAAGCATGAGCA Matrix metallopeptidase 12 MMP12 NM_002426 AGGAATCGGGCCTAAAATTG/ 110* TGGTGATACGTTGGAGTAGGAA Mucin 5AC MUC5AC AW192795 TCCTTCGAGTGCTTGTGTTG/ 82 GCCTTTCAGCTACACGAGGT Nurim (nuclear membrane NRM NM_014641 CATGGGCCTCAAACAGGTAT/ 95* envelope protein) GCAGGTGGGAGAAGAGTCTG Protein phosphatase 2 (formerly 2A) PPP2CB AI379894 CGAGTGTAAGCAGCTGAACG/ 93* catalytic subunit, h isoform CGAACCTCTTGCACATTTGA Protein tyrosine phosphatase, PTPN7 NM_002832 ACTTCTGGGAGATGGTGTGG/ 95* nonreceptor type 7 GGGCCAGTAGTGGACACATT S100 calcium binding protein A9 S100A9 NM_002965 AGAAGATGCACGAGGGTGAC/ 96 CACTGTGATCTTGGCCACTG Secernin 1 SCRN1 NM_014766 ATTCTGCACAGTCCCAGGTC/ 107 CACGAGAAATCTGCAGGTGA TIA1 cytotoxic granule-associated TIAL1 NM_003252 TGAAGGACATGTGGTTAAATGC/ 108* RNA binding protein-like 1 CCATACACTTGGCTCCATTG Trefoil factor 1 TFF1 NM_003225.2 CCCTCCAGAAGAGGAGTGTG/ 101* CCGAGCTCTGGGACTAATCA Topoisomerase (DNA)II a TOP2A AL561834 GCCCTCAAGAAGATGGTGTG/ 104* TGCCAATGTAGTTTGTTTCTTTG

NOTE: All primers were designed to amplify at the 3¶ end of their respective transcripts. *Intron-spanning primers.

ClinCancerRes2008;14(20)October15,2008 6442 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Transcriptome of BE-Associated Dysplasia

Fig. 1. Differentiallyexpressed genes in HGD divided into functional categories.

which recognizes TFF1 (Zymed) and the S100A9 monoclonal antibody (16 up-regulated and 11 down-regulated;Table 2). One other (Novus Biologicals), was done on the Ventana Discovery System using gene (S100A9) of potential interest as an immunohistochem- CC1 antigen retrieval. Antibody dilutions were 1:25 and 1:100, ical marker of BE-associated dysplasia was also evaluated. For respectively. The antibodies were developed using the DAB MAP kit this study, certain genes were excluded if they were from (Ventana). The slides were counterstained using hematoxylin, dehy- uncharacterized or partially characterized proteins or if they drated, and coverslipped. Positive controls included normal squamous mucosa, which stains were not previously shown to be expressed by epithelial cells strongly for both lipocalin-2 and S100A9, normal gastric cardia, which based on our search of the current literature in the National 6 stains strongly for TFF1, and basal cells of squamous mucosa and Library of Medicine PubMed database. In the vast majority of glandular crypt cells, which stain for topoisomerase IIa. We used the genes tested (24 of 28), there was agreement in terms of following scoring system based on the extent of staining of the increase or decrease between microarray data and the real-time superficial aspects of the NDBE and dysplastic BE mucosa and PCR data (Fig. 2). In the case of testisin, osteoglycin, sucrase- adenocarcinoma: negative to weak staining, 0% to 10% staining = 1; isomaltase, and the t(12;16) fusion gene FUS..CHOP, the moderate, 10% to 50% = 2;and strong, 50% to 100% = 3. The amplification signal was very low (either not detected at all association between the diagnostic categories (NDBE, LGD, HGD, and or only detected in some of the tissue samples). adenocarcinoma) and the immunohistochemical staining binarized Confirmation of selected genes by immunohistochemistry. Immu- scores (negative to low versus moderate to high) was tested using the m2 test. Two-tailed P values of V0.05 were considered to be statistically nohistochemical analysis was done on three proteins, top- a significant. oisomerase II , S100A9, and lipocalin-2, whose expression was shown to be greatly increased by microarray analysis in HGD Results epithelium, and one protein, trefoil factor 1 (TFF1), whose expression was decreased in areas of HGD. Staining was done Expression array analysis of dysregulated epithelial genes in on 12 sections of NDBE, HGD, and adenocarcinoma and 11 BE HGD. After removing the concordantly absent microarray sections of LGD, all from additional patient samples not used signals, 7,990 transcripts decreased and 14,562 increased in the for the microchip analysis. Topoisomerase IIa strongly stained HGD group compared with the NDBE group. Applying a the nuclei of the luminal surface epithelial cells from areas of statistical threshold of P < 0.05 and q < 1 led to a final list of HGD (Fig. 3A). Five HGD cases exhibited a strong staining 147 genes of interest. Multiple gene function categories were pattern (over 50% of nuclei stained) and seven exhibited a represented in this list of differentially expressed genes, moderate (10-50%) staining pattern (Fig. 4). In the biopsies of including genes involved in calcium binding and ion channels, NDBE, occasional nuclear staining was evident in the prolifer- cell adhesion, motility and membrane proteins, cell prolifera- ative crypt region varying in numbers from 10% to 40% of the tion and cell death, and , and crypt nuclei;however, only rare (<1%) surface epithelial metabolism and mitochondria (Fig. 1). A list of the 147 genes staining was identified (Fig. 3B). The extent of staining of the divided into these categories as well as a full list of all low-grade cases was intermediate compared with the control differentially expressed genes and their expressed signals are cases, whereas there was no significant difference between stain- available as Supplementary Data (see Supplementary Tables S1 ing of the HGD cases and the adenocarcinoma cases (Fig. 4). and S2, respectively). The pattern of S100A9 staining was both nuclear and cyto- Confirmation of selected genes by real-time PCR. Quantita- plasmic. Of the 12 cases of HGD examined, moderate staining tative real-time PCR was used to verify changes in those genes whose expression according to the microarray analysis showed the greatest differential expression between NDBE and HGD 6 http://www.ncbi.nlm.nih.gov/

www.aacrjournals.org 6443 Clin Cancer Res 2008;14(20) October 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Human Cancer Biology was seen in five cases;however, the extent of staining was Discussion patchy involving between 10% to 50% of the dysplastic epi- thelium (Figs. 3C and 4). Seven other cases of HGD exhibited Identifying genes differentially expressed in BE without negative to focal weak staining pattern. S100A9 staining dysplasia from those expressed in BE with HGD should be of was also seen in lamina propria inflammatory cells (Fig. 3C). value in improving our understanding of this transition, and None of the NDBE epithelium exhibited staining for S100A9 genes might also prove to be of diagnostic and of prognostic (Fig. 3D). The extent of staining of the LGD was no different utility. Screening for biomarkers using cDNA microarray expres- than the HGD cases;however, significantly more staining was sion technologies is a powerful means to obtain a genome-wide seen in adenocarcinomas than the HGD (Fig. 4). assessment of differential gene expression. Although several Similar to the S100A9 staining pattern, staining of the cDNA microarray studies have been conducted comparing the dysplastic epithelium with lipocalin-2 was variable. Moderate differential gene expression of EACs with normal esophageal to strong cytoplasmic staining was seen in 7 of 12 cases mucosa or with NDBE (12–22), only one other microarray examined (Figs. 3E and 4);however, the staining was nega- study specifically compared gene expression of BE with HGD tive to focal in the 5 remaining cases. Eleven of the 12 NDBE with NDBE mucosa (22). The study by Bax et al. examined the were negative for lipocalin-2 (Figs. 3F and 4). There were no expression profile of paired whole-biopsy (as opposed to LCM significant differences between the extent of staining of the epithelium) samples of HGD and NDBE from only one patient, HGD and the LGD or adenocarcinoma cases. although the expression of up-regulated genes was confirmed in Eleven of the 12 HGD biopsies were negative for TFF1 additional patient samples (22). Other than being the second (Figs. 3G and 4), whereas 1 case exhibited strong diffuse study to specifically compare the transcriptome of HGD with cytoplasmic staining pattern. All of the NDBE epithelium tested NDBE, our study is the first to use LCM to concentrate on genes showed strong diffuse cytoplasmic staining for TFF1 (Figs. 3H expressed only by the neoplastic epithelium and the only study and 4). The extent of staining of the HGD cases was sig- to use FFPE tissues for this purpose. nificantly different than the LGD but not different than the Using a 2.5-fold threshold, we identified a total of 131 up- adenocarcinomas (Fig. 4). regulated and 16 down-regulated genes in HGD epithelium and

Table 2. Differentially expressed genes confirmed by quantitative real-time PCR

Functional gene group Genbank ID GeneChip Foldchange P Up-regulated genes Complement component 3 Miscellaneous NM_000064 13.1 0.016 Topoisomerase (DNA)II a 170 kDa Cell proliferation and cell death AL561834 12.6 0.01 Matrix metallopeptidase 1 Extracellular matrix and protease NM_002421 10.8 0.018 (interstitial ) Matrix metallopeptidase 12 Extracellular matrix and protease NM_002426 9.3 0.006 () TIA1 cytotoxic granule-associated Cell proliferation and cell death NM_003252 8.3 0.005 RNA binding protein-like 1 Protein tyrosine phosphatase, Metabolism and mitochondria NM_002832 7.3 0.010 nonreceptor type 7 Nurim (nuclear envelope membrane protein)Cell adhesion, motility and membrane proteins NM_014641 7 0.016 Histone cluster 1, H2ag Nucleic acid binding and transcription factors NM_021064 7 0.004 Lipocalin-2 (oncogene 24p3)Ca + binding and ion channels NM_005564 6.8 0.003 Fidgetin-like 1 Cell proliferation and cell death AK023411 6.8 0.01 Protein phosphatase 2 (formerly 2A), Cell proliferation and cell death AI379894 6.7 0.003 catalytic subunit, h isoform Formyl peptide receptor 1 Cell adhesion, motility and membrane proteins NM_002029 6.4 0.003 Minichromosome maintenance Cell proliferation and cell death AL136840 6.3 0.005 complex component 10 Secernin 1 Miscellaneous NM_014766 6 0.004 S100 calcium binding protein A9 Ca+ binding and ion channels NM_002965 4.1 0.003 Down-regulated genes Fatty acid binding protein 1, liver Metabolism and mitochondria NM_001443 -2.5 0.003 Trefoil factor 1 Cell adhesion, motility and membrane proteins NM_003225 -2.6 0.003 Mucin 5AC, oligomeric mucus/gel-forming Extracellular matrix and protease AW192795 -2.6 0.01 Aldolase B, fructose-bisphosphate Metabolism and mitochondria NM_000035 -2.8 0.003 Calcium/calmodulin-dependent protein Signal transduction N75559 -3 0.006 kinase II inhibitor 1 Hydroxysteroid (17-h)dehydrogenase 2 Metabolism and mitochondria NM_002153 -3.1 0.003 Hydroxyprostaglandin dehydrogenase 15-(NAD)Metabolism and mitochondria J05594 -3.3 0.004 Meprin A, a (PABA peptide )Extracellular matrix and protease NM_005588 -4.7 0.003 Alanyl (membrane)aminopeptidase Extracellular matrix and protease NM_001150 -4.7 0.003

NOTE: See Supplementary Data for complete list of genes (fold change z2.5)listed by functional group.

ClinCancerRes2008;14(20)October15,2008 6444 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Transcriptome of BE-Associated Dysplasia

Fig. 2. Confirmation of the expression levels of selected dysregulated genes by real-time PCR and correlation with microarraydata.

verified several of these dysregulated genes by real-time PCR on analysis, it is not surprising that the absolute fold values did not the original biopsy material and additional tissue samples. The agree completely between the gene microarray data and the correlation between the chip and real-time PCR was excellent, follow-up real-time PCR studies. Just four dysregulated genes confirming that this technology is a viable application for future could not be confirmed probably because they were expressed at biomarker discovery. Because T7 bacteriophage RNA polymer- levels below detection in some of our FFPE tissues. ase-driven linear amplification of RNA was used for the chip Our study identified several genes previously described as being modified in the progression of BE through EAC as well as several novel genes. Bax et al. (22) also reported that expression of the calcium binding protein S100A9 (calgranulin B) was consistently up-regulated in HGD. S100A9 is expressed by neutrophils and monocytes and is thought to be involved in chemotaxis (27);however, it is also expressed by certain epithelial cells where its function has been linked to cell proliferation (28). Four genes, two of which were up-regulated (ADAMTS12 and pleckstrin homology-like family domain A) and two down-regulated (sucrose isomaltase and fatty acid binding protein 1), were also identified by Helm et al. (19) as candidate gene predictors of progression to EAC in BE. Both collagenase (MMP1) and metalloelastase (MMP12) are up-regulated in the epithelium of BE-associated adenocarcinoma;however, a component of this increased expression may be related to macrophages and other inflammatory cells (29). Several additional genes that we found to be down-regulated in HGD (TFF1, MUC5AC, meprin A, CD13, and sucrose isomaltase) were also found by others to be decreased in BE-associated neoplasia (22, 30–33). MUC5AC is a gastric-type mucin expressed by NDBE epithelium (31) whose expression pattern is altered during neoplastic progression (33). The trefoil protein TFF1, which is thought to play a role as a tumor suppressor gene in gastric carcinoma, has been shown by Fox et al. (32) to be lost late in the progression of BE to EAC and was decreased in HGD in the study by Bax et al. (22). Meprin A is a protease known to cleave extracellular matrix components in vitro and thus may contribute to tumor progression by facilitating migration, intravasation, and metastasis of carcinoma cells (30). Interest- ingly, in our study and in the study by Fox et al. (32), meprin A was shown to be down-regulated in EAC, suggesting that this protease may be involved in processes other than extracellular Fig. 3. A to H, immunohistochemical analysis of select proteins in biopsies of matrix degradation in BE-associated neoplastic progression. HGD and NDBE. All magnifications at Â200. A, strong nuclear staining of surface dysplastic epithelium with topoisomerase IIa (To p o II a). B, nuclear staining seen Finally, Fox et al. (32) also described decreased expression of onlyin the crypt region of NDBE with topoisomerase II a. C, patchystaining of the microsomal aminopeptidase CD13 and the sucrose dysplastic epithelium with S100A9. D, negative staining of NDBE with S100A9. isomaltase in EAC compared with NDBE. E, strong cytoplasmic staining of dysplastic epithelium with lipocalin-2. F, negative staining of NDBE with lipocalin-2. G, negative staining of dysplastic epithelium with One goal of our study was to identify potential immunohis- TFF1. H, strong diffuse staining of NDBE withTFF1. tochemical biomarkers for HGD, which would be suitable for

www.aacrjournals.org 6445 Clin Cancer Res 2008;14(20) October 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Human Cancer Biology

Fig. 4. Summaryof immunohistochemical ( IHC ) stains for topoisomerase IIa (To p o ), lipocalin-2 (Lipo), S100A9 (S-100), and TFF1. ADCA, adenocarcinoma. use on endoscopic FFPE biopsy material. Commercial anti- staining for TFF1 was seen in the majority of HGD biopsy tested bodies developed for FFPE tissue were available for three and, albeit a negative marker, suggests that TFF1 may be useful proteins that we found to be highly up-regulated in HGD and in the diagnosis of HGD in challenging cases. Loss of TFF1 was one down-regulated protein. Topoisomerase IIa is an enzyme also seen in about half of the cases of LGD, suggesting that this required for DNA replication, which has been previously is an early event in neoplastic progression of BE to adenocar- shown to be increased in gastrointestinal cancers (stomach, cinoma. Based on this limited study, it seems that only colon, and esophagus;refs. 34–36);however, its expression has topoisomerase IIa may be useful in differentiating HGD from not been studied in BE or BE-associated dysplasia. Here, we LGD;however, we are planning to extend this pilot study to show that topoisomerase IIa mRNA expression was increased include additional cases and also examine whether any of these 12-fold in regions of HGD. By immunohistochemistry, top- markers is capable of predicting progression of BE with or oisomerase IIa nuclear staining extended from the proliferative without dysplasia to adenocarcinoma. region up to the surface dysplastic epithelial cells in cases of We identified several potential biomarkers for HGD for both LGD and HGD in a pattern similar to that described for which antibodies suitable for FFPE tissues do not as yet exist. the proliferative marker Ki-67 (37, 38). It remains to be seen Secernin expression was highly increased in HGD and has been whether topoisomerase staining will be superior to Ki-67 in recently shown to be up-regulated in gastric cancer (45). differentiating LGD from HGD, or BE with reactive changes Gastrointestinal glutathione peroxidase (GPx2) is highly from dysplasia, as well as whether it predicts progression of expressed in the proliferative area of the intestinal crypt (46) dysplasia to adenocarcinoma. Lipocalin-2 is a cell survival and up-regulated during the development of colon cancer (47) factor (39), which is up-regulated in pancreatic, breast, and and has been recently been shown to be expressed by BE (48); ovarian cancer (40–42) and more recently in gastric cancer however, nothing is known about its expression in BE- (43) and esophageal squamous carcinoma (44). It is expressed associated dysplasia or adenocarcinoma. Glial cell line–derived both by epithelial cells and inflammatory cells, primarily neurotrophic factor receptor is a ligand for a polypeptide, neutrophils. The extent of immunohistochemical staining for which promotes neuronal survival and has also been shown both lipocalin-2 and S100A9 in the HGD biopsies sampled was to be up-regulated in bile duct and pancreatic carcinomas patchier than that observed for topoisomerase, suggesting that (49, 50). Hydroxyprostaglandin dehydrogenase 15 (HPGD), these two proteins may be less useful as markers of HGD. which was down-regulated in HGD as opposed to NDBE mucosa, Interestingly, the extent of staining of S100A9 was greater in is a putative tumor suppressor in lung carcinoma, which may the adenocarcinomas than in the HGD cases, suggesting that act by decreasing the levels of proliferative prostaglandin E2 this protein may be used as a marker for progression. Loss of (51).

ClinCancerRes2008;14(20)October15,2008 6446 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Transcriptome of BE-Associated Dysplasia

In summary, we have shown that with careful selection of equivocal cases;however, this would probably require LCM, a tissue blocks and attention to ensuring a high quality of extracted technique that is quite labor intensive and not universally RNA it is possible to uncover the global gene expression profile available in most pathology departments. of esophageal epithelial cells from FFPE archival tissue. Recent studies have shown that similar techniques have been success- fully done on breast, gastric, colonic, and prostatic epithelium, Disclosure of Potential Conflicts of Interest suggesting that this methodology is a powerful means for No potential conflicts of interest were disclosed. screening new biomarkers (23, 52–54). As pathologists, our primary goal was to identify candidates for the generation of immunohistochemical reagents, as immunohistochemistry is Acknowledgments

available in all pathology departments and all pathologists are We thank Shrikant Mane and Sheila Westman at the Yale/Keck Foundation quite comfortable with the technique. Theoretically, real-time Affymetrix GeneChip Facility for helpful discussions and assistance with microarray PCR could be used as an adjunct technique on morphologically hybridizations.

References 1. O’Connor JB, Falk GW, Richter JE. The incidence cursor lesions serves as a diagnostic and cancer pro- (MMP-12) and their inhibitors TIMP-1and TIMP-3 in of adenocarcinoma and dysplasia in Barrett’s eso- gression marker and potential novel drug target. Am J Barrett’s oesophageal adenocarcinoma. Br J Cancer phagus: report on the Cleveland Clinic Barrett’s Surg Pathol 2005;29:390^9. 2001;85:383^92. Esophagus Registry. Am J Gastroenterol 1999;94: 17. Gomes LI, Esteves GH, Carvalho AF, et al. Expres- 30. Lottaz D, Maurer CA, Hahn D, Bu« chler MW, 2037 ^ 42. sion profile of malignant and non-malignant lesions of Sterchi EE. Nonpolarized secretion of human meprin 2. Shaheen N, Ransohoff DF. Gastroesophageal reflux, esophagus and stomach: differential activityof func- a in colorectal cancer generates an increased proteo- Barrett esophagus and esophageal cancer. JAMA tional modules related to inflammation and lipid me- lytic potential in the stroma. Cancer Res 1999;59: 2002;287:1972 ^ 81. tabolism. Cancer Res 2005;65:7127 ^ 36. 112 7 ^ 3 3 . 3. Levine DS. Management of dysplasia in the colum- 18. Kimchi ET, Posner MC, ParkJO, et al. Progression of 31. Warson C, Van Der Bovenkamp JH, Korteland-Van nar-lined esophagus. Gastroenterol Clin North Am Barrett’s metaplasia to adenocarcinoma is associated Male AM, et al. Barrett’s esophagus is characterized 19 97;26 :613 ^ 3 4. with the suppression of the transcriptional programs byexpression of gastric-type mucins (MUC5AC, 4. Meltzer SJ, Yin J, Manin B, et al. Microsatellite of epidermal differentiation. Cancer Res 2005;65: MUC6) and TFF peptides (TFF1and TFF2), but the risk instabilityoccurs frequentlyand in both diploid and 3146 ^ 54. of carcinoma development maybe indicated bythe in- aneuploid cell populations of Barrett’s-associated 19. Helm J, Enkemann SA, Coppola D, Barthel JS, testinal-type mucin, MUC2. Hum Pathol 2002;33: esophageal adenocarcinomas. Cancer Res 1994;54: KelleyST,YeatmanTJ. Dedifferentiation precedes inva- 660^8. 3379 ^ 82. sion in the progression from Barrett’s metaplasia to 32. Fox CA, Sapinoso LM, Zhang H, et al. Altered ex- 5. Klump B, Hsieh CJ, Holzmann K, Gregor M, Por- esophageal adenocarcinoma. Clin Cancer Res 2005; pression of TFF-1and CES-2 in Barrett’s esophagus schen R. Hypermethylation of the CDKN2/p16 pro- 11:2478 ^ 85. and associated adenocarcinomas. Neoplasia 2005;7: moter during neoplastic progression in Barrett’s 20. Hao Y,Triadafilopoulos G, Sahbaie P, Young HS, 407^16. esophagus. Gastroenterology1998;115:1381 ^6. OmaryMB, Lowne AW. Gene expression prof iling 33. Glickman JN, Blount PL, Sanchez CA, et al. Mucin 6. Eads CA, Lord RV, Kurumboor SK, et al. Fields of ab- reveals stromal genes expressed in common between core polypeptide expression in the progression of errant CpGisland hypermethylation in Barrett’sesoph- Barrett’s esophagus and adenocarcinoma. Gastroen- neoplasia in Barrett’s esophagus. Hum Pathol 2006; agus and associated adenocarcinoma. Cancer Res terology2006;131:925 ^ 33. 37:1304 ^ 15. 2000;60:5021^6. 21. Greenawalt DM, Duong C, Smyth GK, et al. Gene 34. Kim R, Ohi Y,TogeT. Expression and relationship be- 7. Lee OJ, Schneider-Stock R, McChesneyPA, et al. expression profiling of esophageal cancer: compara- tween topoisomerase I and IIa genes in tumor and Hypermethylation and loss of expression of glutathi- tive analysis of Barrett’s esophagus, adenocarcinoma, normal tissues in esophageal, gastric and colon can- one peroxidase-3 in Barrett’s tumorigenesis. Neopla- and squamous cell carcinoma. Int J Cancer 2007;120: cers. Anticancer Res 1999;19:5393^ 8. sia 2005;7:854 ^ 61. 1914 ^ 21. 35. StaleyBE, Samowitz WS, Bronstein IB, Holden JA. 8. Clement G, Braunschweig R, Pasquier N, Bosman FT, 22. Bax DA, Siersema PD, Haringsma J, et al. High- Expression of DNA topoisomerase I and DNA topoi- Benhattar J. Methylation of APC, TIMP3, and TERT: a grade dysplasia in Barrett’s esophagus is associated somerase IIa in carcinoma of the colon. Mod Pathol new predictive marker to distinguish Barrett’soesoph- with increased expression of calgranulin A and B. 1999;12:356^61. agus patients at risk for malignant transformation. Scand J Gastroenterol 2007;42:902^ 10. 36. Kanta SY,Yamane T, Dobashi Y, Mitsui F, Kono K, J Pathol 2006;208:100 ^ 7. 23. Resnick MB, Sabo E, Meitner PA, et al. Global anal- Ooi A. Topoisomerase IIa gene amplification in gastric 9. Fitzgerald RC. Molecular basis of Barrett’s oesopha- ysis of the human gastric epithelial transcriptome al- carcinomas: correlation with the HER2 gene. Hum gus and oesophageal adenocarcinoma. Gut 2006;55: tered by Helicobacter pylori eradication in vivo.Gut Pathol 2006;37:1333^43. 1810 ^ 20. 2006;55:1717^ 24. 37. Reid BJ, Sanchez CA, Blount PL, Levine DS. Bar- 10. MontgomeryE, Bronner MP, Goldblum JR, et al. Re- 24. Colantuoni C, HenryG, Zeger S, Pevsner J. SNO- rett’s esophagus: cell cycle abnormalities in advancing producibilityof the diagnosis of dysplasia in Barrett MAD (Standardization and NOrmalization of MicroAr- stages of neoplastic progression. Gastroenterology esophagus: a reaffirmation. Hum Pathol 2001;32: rayData): web-accessible gene expression data 1993;105:119^ 29. 368^78. analysis. Bioinformatics 2002;18:1540 ^ 1. 38. Hong MK, Laskin WB, Herman BE, Johnston MH, 11. Selaru FM, ZouT, XuY, et al. Global gene expression 25. Dennis G, Sherman BT, Hosack DA, et al. DAVID: et al. Expansion of the Ki-67 proliferative compart- profiling in Barrett’s esophagus and esophageal can- Database for Annotation,Visualization, and Integrated ment correlates with degree of dysplasia in Barrett’s cer: a comparative analysis using cDNA microarrays. Discovery, rev. 2007. Genome Biol 2003;4:R60. esophagus. Cancer 1995;75:423^ 9. Oncogene 2002;21:475 ^ 8. 26. Rozen S, SkaletskyHJ. Primer3 on the WWW for 39. Tong Z, Wu X, Ovcharenko D, Zhu J, Chen CS, 12. Odze RD. Diagnosis and grading of dysplasia in Bar- general users and for biologist programmers. In: Kra- Kehrer JP. Neutrophil -associated lipocalin rett’s oesophagus. J Clin Pathol 2006;59:1029^ 38. wetz S, Misener S, editors. Bioinformatics methods as a survival factor. Biochem J 2005;391:441 ^ 8. 13. XuY,Selaru FM,YinJ, et al. Artificial neural networks and protocols: methods in molecular biology. Totowa 40. Argani P,RostyC, Reiter RE, et al. Discoveryof new and gene filtering distinguish between global gene ex- (NJ): Humana Press; 2000. p. 365^86. markers of cancer through serial analysis of gene ex- pression profiles of Barrett’s esophagus and esopha- 27. Ryckman C, Vandal K, Rouleau P,Talbot M, Tessier pression: prostate stem cell antigen is overexpressed geal cancer. Cancer Res 2002;62:3493^ 7. PA.ProinflammatoryactivitiesofS100:proteins in pancreatic adenocarcinomas. Cancer Res 2001;61: 14. Barrett MT,Yeung KY,RuzzoWL, et al. Transcription- S100A8, S100A9 and S100A8A9 induce neutrophil 4320^ 4. al analyses of Barrett’s metaplasia and normal upper chemotaxis and adhesion. J Immunol 2003;171: 41. Santin AD, Zhan F, Bellone S, et al. Gene expression GI mucosae. Neoplasia 2002;4:121 ^ 8. 2602^ 9. profiles in primaryovarian serous papillarytumors and 15. Dahlberg PS, Ferrin LF, Grindle SM, Nelson CM, 28. Broome AM, Ryan D, Eckert RL. S100 protein sub- normal ovarian epithelium: identification of candidate Hoang CD, Jacobson B. Gene expression profiles in cellular localization during epidermal proliferation and molecular markers for ovarian cancer diagnosis and esophageal adenocarcinoma. Ann Thorac Surg 2004; psoriasis. Histochem Cytochem 2003;51:675 ^ 85. therapy. Int J Cancer 2004;112:14 ^ 25. 77:1008 ^ 15. 29. Salmela MT, Karjalainan-Lindsberg ML, Puolakkai- 42. Fernandez CA, Yan L, Louis G, Yang J, Kutok JL, 16. Hansel DE, Dhara S, Huang RC, et al. CDC2/CDK1 nen P, Saarialho-Kere U. Upregulation and differential Moses MA. The matrix -9/neutro- expression in esophageal adenocarcinoma and pre- expression of matrilysin (MMP-7) and metalloelastase phil associated lipocalin complex plays a

www.aacrjournals.org 6447 Clin Cancer Res 2008;14(20) October 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Human Cancer Biology

role in breast tumor growth and is present in the urine nium dependent glutathione peroxidase GSHPx-GI. J 51. Ding Y,Tong M, Liu S, Moscow JA, Tai HH. NAD+ of breast cancer patients. Clin Cancer Res 2005;11: Biol Chem 1993;8:2571^6. linked hydroxyprostaglandin dehydrogenase (15- 5390 ^5. 47. Al-Taie OH, Uceyler N, Eubner U, et al. Expression PGDH) behaves as a tumor suppressor in lung cancer. 43. Kubben FJ, Sier CF, Hawinkels LJ, et al. Clinical ev- profiling and genetic alterations of the selenoproteins Carcinogenesis 2005;26:65 ^ 72. idence for a protective role of lipocalin-2 against GI-GPx and SePP in colorectal carcinogenesis. Nutr 52. Ma XJ, Wang Z, Ryan, P, et al. A two-gene expres- MMP-9 autodegradation and the impact for gastric Cancer 2004;48:6^ 14. sion ratio predicts clinical outcome in breast cancer cancer. Eur J Cancer 2007;43:1869 ^ 76. 48. Mork H, Scheurlen M, Al-Taie O, et al. Glutathione patients treated with tamoxifen. Cancer Cell 2004;5: 44. ZhangH,XuL,XiaoD,etal.Upregulationofneu- peroxidase isoforms as part of the local antioxidative 607^16. trophil gelatinase-associated lipocalin in oesophageal defense system in normal and Barrett’s esophagus. 53. CoudryRA, Meirless SI, Stoyanova R, et al. Suc- squamous cell carcinoma: significant correlation with Int J Cancer 2003;105:300 ^ 4. cessful application of microarraytechnologyto micro- cell differentiation and tumour invasion. J Clin Pathol 49. Iwahashi N, NagasakaT,Tezel G, et al. Expression of dissected formalin-fixed paraffin embedded tissues. J 2007;60:555 ^ 61. glial cell-line derived neurotrophic factor correlates Mol Diag 2007;9:70 ^ 9. 45. Suda T,Tsunoda T, Uchida N, et al. Identification of with perineural invasion of bile duct carcinoma. Can- 54. Furusato B, Shaheduzzaman S, Petrovics G, et al. secernin 1as a novel immunotherapytarget for gastric cer 2002;94:167 ^ 74. Transcriptome analyses of benign and malignant pros- cancer using the expression profiles of cDNA microar- 50. ItoY, OkadaY, Sato M, et al. Expression of glial cell- tate epithelial cells in formalin-fixed paraffin embed- ray. Cancer Sci 2006;97:411^ 9. line derived neurotrophic factor familymembers and ded whole mounted radical prostatectomy 46. Chu FF, Doroshow JH, EsworthyRS. Expression, their receptors in pancreatic cancers. Surgery2005; specimens. Prostate Cancer Prostatic Dis 2008;11: characterization and tissue distribution of a new sele- 13 8 :78 8 ^ 9 4. 19 4 ^ 7.

ClinCancerRes2008;14(20)October15,2008 6448 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research. Expression Analysis of Barrett's Esophagus−Associated High-Grade Dysplasia in Laser Capture Microdissected Archival Tissue

Edmond Sabo, Patricia A. Meitner, Rosemarie Tavares, et al.

Clin Cancer Res 2008;14:6440-6448.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/14/20/6440

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2008/12/19/14.20.6440.DC1

Cited articles This article cites 53 articles, 14 of which you can access for free at: http://clincancerres.aacrjournals.org/content/14/20/6440.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/14/20/6440.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/14/20/6440. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2008 American Association for Cancer Research.