DOCSLIB.ORG

Loss, Mutation and Deregulation of L3MBTL4 in Breast Cancers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Loss, Mutation and Deregulation of L3MBTL4 in Breast Cancers Addou-Klouche et al. Molecular Cancer 2010, 9:213 http://www.molecular-cancer.com/content/9/1/213 RESEARCH Open Access Loss, mutation and deregulation of L3MBTL4 in breast cancers Lynda Addou-Klouche1, José Adélaïde1, Pascal Finetti1, Nathalie Cervera1, Anthony Ferrari1, Ismahane Bekhouche1, Fabrice Sircoulomb1, Christos Sotiriou2, Patrice Viens3,4, Soraya Moulessehoul5, François Bertucci1,3,4, Daniel Birnbaum1, Max Chaffanet1* Abstract Background: Many alterations are involved in mammary oncogenesis, including amplifications of oncogenes and losses of tumor suppressor genes (TSG). Losses may affect almost all chromosome arms and many TSGs remain to be identified. Results: We studied 307 primary breast tumors and 47 breast cancer cell lines by high resolution array comparative genomic hybridization (aCGH). We identified a region on 18p11.31 lost in about 20% of the tumors and 40% of the cell lines. The minimal common region of loss (Chr18:6,366,938-6,375,929 bp) targeted the L3MBTL4 gene. This gene was also targeted by breakage in one tumor and in two cell lines. We studied the exon sequence of L3MBTL4 in 180 primary tumor samples and 47 cell lines and found six missense and one nonsense heterozygous mutations. Compared with normal breast tissue, L3MBTL4 mRNA expression was downregulated in 73% of the tumors notably in luminal, ERBB2 and normal-like subtypes. Losses of the 18p11 region were associated with low L3MBTL4 expression level. Integrated analysis combining genome and gene expression profiles of the same tumors pointed to 14 other potential 18p TSG candidates. Downregulated expression of ZFP161, PPP4R1 and YES1 was correlated with luminal B molecular subtype. Low ZFP161 gene expression was associated with adverse clinical outcome. Conclusion: We have identified L3MBTL4 as a potential TSG of chromosome arm 18p. The gene is targeted by deletion, breakage and mutations and its mRNA is downregulated in breast tumors. Additional 18p TSG candidates might explain the aggressive phenotype associated with the loss of 18p in breast tumors. Background and 40% of the cell lines. We delineated a minimal com- The development and progression of breast cancer is the monregionofdeletionthattargetedtheL3MBTL4 result of the accumulation of genetic alterations such as gene. The L3MBTL4 gene is one of the four human amplification of oncogenes and deletions of tumor sup- orthologs of Drosophila lethal (3) malignant brain tumor pressor genes (TSG) in the epithelial cells of the mam- (l(3)mbt). L(3)mbt is a bona fide TSG in the fly [4,5]. mary gland. Frequent deletions have been reported on The L3MBTL4 protein contains three “malignant brain chromosome arms 1p, 3p, 7q, 8p 9p, 16q and 17p but tumor” (MBT) domains. This domain of about 100 only few reports describe such deletions on chromo- amino acid residues is conserved in protostomians and some arm 18p [1-3]. deuterostomiansandoftenexistsasrepeats[6].The We profiled a series of 307 primary breast tumors and MBT domain binds methylated histone residues. The 47 breast cancer cell lines by using high resolution array human genome contains several MBT-containing pro- comparative genomic hybridization (aCGH). We identi- teins, some of which have been linked to gene regula- fied a region on 18p11.31 deleted in 25% of the tumors tory pathways and polycomb-mediated repression, and to cancer [7]. L3MBTL1 is a TSG implicated in myeloid * Correspondence: [email protected] malignancies [8], and L3MBTL3 deregulation is asso- 1 Marseille Cancer Research Center; Department of Molecular Oncology, ciated with neuroblastoma [9]. UMR891 Inserm; Institut Paoli-Calmettes; Marseille, France Full list of author information is available at the end of the article © 2010 Addou-Klouche et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Addou-Klouche et al. Molecular Cancer 2010, 9:213 Page 2 of 13 http://www.molecular-cancer.com/content/9/1/213 To document the involvement of L3MBTL4 in breast extracted from a normal area of paraffin-embedded cancer we searched for mutations by sequence analysis T8584, T8847, T9193 and T8525 tissues. of 180 primary tumor samples and 47 cell lines. We found that, in addition to deletions, L3MBTL4 is tar- Genome analysis by array-comparative genomic geted by mutations. Finally, we found that L3MBTL4 hybridization (aCGH) deletions correlate with low mRNA expression and with Genome profiles were established on 307 tumors and 47 the presence of lymph node metastasis, high Scarf- breast cancer cell lines by aCGH using 244K CGH Bloom-Richardson (SBR) grade and luminal B molecular Microarrays (Hu-244A, Agilent Technologies, Massy, subtype. France) as previously described [16]. A pool of 13 nor- Our study is the first to identify a region on chromo- mal male DNAs was used as reference. Scanning was some arm 18p likely to contain a putative TSG involved done with Agilent Autofocus Dynamic Scanner in breast oncogenesis, and to show that this TSG may (G2565BA, Agilent Technologies). Data analysis was be L3MBTL4. We did not exclude the existence of other done and visualized with CGH Analytics 3.4 software potential 18p TSGs, some of which could explain the (Agilent Technologies). Extraction of data (log2 ratio) aggressive phenotype of breast tumors with 18p loss. was done from CGH analytics, while normalized and fil- tered log2 ratio were obtained from “Feature extraction” Samples and Methods software (Agilent Technologies). Data generated by Breast tumors probes mapped to × and Y chromosomes were elimi- Tumor tissues were collected from 307 patients with nated. The final dataset contained 225,388 unique primary adenocarcinoma who underwent initial surgery probes covering 22,509 genes and intergenic regions at the Institut Paoli-Calmettes (Marseille, France) according to the hg17/NCBI human genome mapping between 1992 and 2004. Immediately after macroscopic database (build 35). Data were analyzed using circular examination of the surgery specimen by two patholo- binary segmentation (CBS) [17] as implemented in the gists, samples containing more than 60% of tumor cells DNA copy R/Bioconductor package [18] with default were obtained, frozen in liquid nitrogen and stored at parameters to translate intensity measurements in -80°C until nucleic acids extraction. The main histoclini- regions of equal copy number, each region being defined cal characteristics of tumors are listed in the Additional by at least five consecutive probes. Thus, each probe file 1, Table S1. Each patient gave written informed con- was assigned a segment value referred to as its sent and the study was approved by our institutional “smoothed” value. review committee. We used a threshold value of |0.33| (log2 ratio) to define a copy number aberration (CNA) [16]. Identifica- Cell lines tion of copy number variations (CNV) was done using The 47 breast cell lines used in this study were BT-20, the regions published by McCarroll et al [19] which are BT-483, HCC1937, CAMA-1, HCC38, HCC1500 [10], stored in the Database of Genomic Variants (release v8) Hs 578T [11], BT-474, BT-549, HCC202, HCC1395, [20]. To determine altered regions, we used the GISTIC HCC1569, HCC1806, HCC1954, HCC2218, HME-1, algorithm [21], which computes for each genomic seg- MCF7, MDA-MB-134, MDA-MB-157, MDA-MB-175, ment through the whole genome a score based on the MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA- frequency of CNA combined with its amplitude, with MB-436, MDA-MB-453, MDA-MB-468, SK-BR-3, bootstrapping to calculate the significance level (p < SK-BR-7, T47 D, UACC-812, UACC-893, ZR-75-1, ZR- 0.001). To establish significant association between CNA 75-30 (ATTC, Manassas, VA), BrCa-Mz-01, BrCa-Mz- and categorical variables, Fisher’sexacttestwasused. 02 [12], SUM44, SUM52, SUM102, SUM149, SUM159, Gains and losses were handled separately. SUM185, SUM190, SUM206, SUM225, SUM229 [13], S68 (V. Catros, Rennes, France), and CAL51 [14]. All Mutation analysis cell lines were grown as recommended by their Sequence analysis was done on 180 out of the 307 suppliers. breast tumors and on the 47 breast cell lines after amplification of genomic DNA. Seventeen primers pairs DNA and RNA extraction were designed to amplify L3MBTL4 DNA by polymerase DNA and RNA were extracted from frozen samples by chain reaction (PCR) (Additional file 1, Table S2). PCR using guanidium isothiocynanate and cesium chloride amplifications were done in a total volume of 25 μl PCR gradient, as previously described [15]. DNA quality and mix containing at least 10 ng template DNA, Taq buffer, RNA integrity were respectively controled on polyacryla- 500 μmol of each deoxynucleotide triphosphate, 100 mide gel electrophoresis and on Agilent Bioanalyzer μmol of each primer and 1 unit of Hot Star Taq DNA (AgilentTechnologies,Massy,France).DNAwasalso polymerase (Qiagen, Courtaboeuf, France). PCR Addou-Klouche et al. Molecular Cancer 2010, 9:213 Page 3 of 13 http://www.molecular-cancer.com/content/9/1/213 amplification conditions were as follows: 95°C 10 min All probes were mapped based on their EntrezGeneID. and 95°C 30 sec, annealing T° 55°C 30 sec, 72°C 45 sec When multiple probes were mapped to the same gene, to to 1 min depending on PCR product length, 72°C 10 the probe sets with an extension « at », next « s_at », min, 35 cycles. PCR products were purified using Milli- and followed by all other extensions were preferentially pore plate MSNU030 (Millipore SAS, Molsheim, kept. When several probe sets with the best extension France). Aliquots (1 μl) of the purified PCR products were available, the one with the highest median value were sequenced using Big Dye terminator v1.1 Cycling was retained. Sequencing Kit (Applied Biosystems, Courtaboeuf, The five molecular subtypes related to the intrinsic France) including the forward or reverse primer.
Load more

Recommended publications
  • Cooperativity of Imprinted Genes Inactivated by Acquired Chromosome 20Q Deletions
    Cooperativity of imprinted genes inactivated by acquired chromosome 20q deletions Athar Aziz, … , Anne C. Ferguson-Smith, Anthony R. Green J Clin Invest. 2013;123(5):2169-2182. https://doi.org/10.1172/JCI66113. Research Article Oncology Large regions of recurrent genomic loss are common in cancers; however, with a few well-characterized exceptions, how they contribute to tumor pathogenesis remains largely obscure. Here we identified primate-restricted imprinting of a gene cluster on chromosome 20 in the region commonly deleted in chronic myeloid malignancies. We showed that a single heterozygous 20q deletion consistently resulted in the complete loss of expression of the imprinted genes L3MBTL1 and SGK2, indicative of a pathogenetic role for loss of the active paternally inherited locus. Concomitant loss of both L3MBTL1 and SGK2 dysregulated erythropoiesis and megakaryopoiesis, 2 lineages commonly affected in chronic myeloid malignancies, with distinct consequences in each lineage. We demonstrated that L3MBTL1 and SGK2 collaborated in the transcriptional regulation of MYC by influencing different aspects of chromatin structure. L3MBTL1 is known to regulate nucleosomal compaction, and we here showed that SGK2 inactivated BRG1, a key ATP-dependent helicase within the SWI/SNF complex that regulates nucleosomal positioning. These results demonstrate a link between an imprinted gene cluster and malignancy, reveal a new pathogenetic mechanism associated with acquired regions of genomic loss, and underline the complex molecular and cellular consequences of “simple” cancer-associated chromosome deletions. Find the latest version: https://jci.me/66113/pdf Research article Cooperativity of imprinted genes inactivated by acquired chromosome 20q deletions Athar Aziz,1,2 E. Joanna Baxter,1,2,3 Carol Edwards,4 Clara Yujing Cheong,5 Mitsuteru Ito,4 Anthony Bench,3 Rebecca Kelley,1,2 Yvonne Silber,1,2 Philip A.
    [Show full text]
  • Genome‐Wide Association Studies of the Self‐Rating of Effects of Ethanol (SRE)
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eScholarship - University of California UC San Diego UC San Diego Previously Published Works Title Genome-wide association studies of the self-rating of effects of ethanol (SRE). Permalink https://escholarship.org/uc/item/94p1n78c Journal Addiction biology, 25(2) ISSN 1355-6215 Authors Lai, Dongbing Wetherill, Leah Kapoor, Manav et al. Publication Date 2020-03-01 DOI 10.1111/adb.12800 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Received: 18 December 2018 Revised: 6 May 2019 Accepted: 27 May 2019 DOI: 10.1111/adb.12800 ORIGINAL ARTICLE Genome‐wide association studies of the self‐rating of effects of ethanol (SRE) Dongbing Lai1 | Leah Wetherill1 | Manav Kapoor2 | Emma C. Johnson3 | Melanie Schwandt4 | Vijay A. Ramchandani5 | David Goldman4 | Geoff Joslyn6 | Xi Rao1 | Yunlong Liu1 | Sean Farris7 | R. Dayne Mayfield7 | Danielle Dick8 | Victor Hesselbrock9 | John Kramer10 | Vivia V. McCutcheon3 | John Nurnberger1,11 | Jay Tischfield12 | Alison Goate2 | Howard J. Edenberg1,13 | Bernice Porjesz14 | Arpana Agrawal3 | Tatiana Foroud1 | Marc Schuckit15 1 Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana 2 Department of Neuroscience, Icahn School of Medicine at Mt. Sinai, New York, New York 3 Department of Psychiatry, Washington University School of Medicine, St. Louis, Missouri 4 Office of the Clinical Director, National Institute on Alcohol Abuse
    [Show full text]
  • Genome-Wide Parent-Of-Origin DNA Methylation Analysis Reveals The
    Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Research Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline methylation-independent mechanism of establishment Franck Court,1,15 Chiharu Tayama,2,15 Valeria Romanelli,1,15 Alex Martin-Trujillo,1,15 Isabel Iglesias-Platas,3 Kohji Okamura,4 Naoko Sugahara,2 Carlos Simo´n,5 Harry Moore,6 Julie V. Harness,7 Hans Keirstead,7 Jose Vicente Sanchez-Mut,8 Eisuke Kaneki,9 Pablo Lapunzina,10 Hidenobu Soejima,11 Norio Wake,9 Manel Esteller,8,12,13 Tsutomu Ogata,14 Kenichiro Hata,2 Kazuhiko Nakabayashi,2,16,17 and David Monk1,16,17 1–14[Author affiliations appear at the end of the paper.] Differential methylation between the two alleles of a gene has been observed in imprinted regions, where the methylation of one allele occurs on a parent-of-origin basis, the inactive X-chromosome in females, and at those loci whose methylation is driven by genetic variants. We have extensively characterized imprinted methylation in a substantial range of normal human tissues, reciprocal genome-wide uniparental disomies, and hydatidiform moles, using a combination of whole- genome bisulfite sequencing and high-density methylation microarrays. This approach allowed us to define methylation profiles at known imprinted domains at base-pair resolution, as well as to identify 21 novel loci harboring parent-of-origin methylation, 15 of which are restricted to the placenta. We observe that the extent of imprinted differentially methylated regions (DMRs) is extremely similar between tissues, with the exception of the placenta.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name zinc finger protein 161 Gene Symbol Zfp161 Organism Mouse Gene Summary Description Not Available Gene Aliases ZF5 RefSeq Accession No. NC_000083.6, NT_039649.8 UniGene ID Mm.29434 Ensembl Gene ID ENSMUSG00000049672 Entrez Gene ID 22666 Assay Information Unique Assay ID qMmuCID0009626 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000112674, ENSMUST00000062369, ENSMUST00000112676 Amplicon Context Sequence GATCAGCCTGAGTCTGATCTGAAGATTTTGGTGTTTAAGGCATTAAGAACATAGC CTGAATTGTTCATGGAGTTTTTCATCAGTATGTCTGAAACCATAAAATATAATGAT GATGATCATAAAACGCTGTTTCTGAAAACACTGAACGAACAGCGCCTGGAGGGA GAATTCTGCGACATCGCCATCGTGGTTGAAGATGTAAAGTTCCGAGCCCACCGG TGTGTCCTCGC Amplicon Length (bp) 200 Chromosome Location 17:69385436-69387472 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 104 R2 0.9993 cDNA Cq 24.19 cDNA Tm (Celsius) 82 gDNA Cq 35.48 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Zfp161, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Imprinting of the Human L3MBTL Gene, a Polycomb Family Member Located in a Region of Chromosome 20 Deleted in Human Myeloid Malignancies
    Correction GENETICS Correction for “Imprinting of the human L3MBTL gene, a poly- The authors note that a mistake occurred during the prepa- comb family member located in a region of chromosome 20 deleted ration of Fig. 1B. Three control lanes (6, 7, and 8) were inad- in human myeloid malignancies,” by Juan Li, Anthony J. Bench, vertently duplicated and also shown as lanes 3, 4, and 5. This George S. Vassiliou, Nasios Fourouclas, Anne C. Ferguson-Smith, resulted from a technical error during preparation of the figure and Anthony R. Green, first published April 30, 2004; 10.1073/ and does not alter any of the conclusions of the paper. The pnas.0308195101 (Proc. Natl. Acad. Sci. U.S.A. 101, 7341–7346). corrected figure and the unaltered figure legend appear below. A CORRECTION B C Fig. 1. Allelic methylation of the L3MBTL gene. (A) Locus of the L3MBTL gene and intron/exon structure of its 5′ and 3′ regions. Coding and noncoding exons are shown in black and gray boxes, respectively. Bent arrows indicate two putative promoters. Patterned horizontal bars represent the four CpG islands. Asterisks indicate the locations of SNPs used in the study, and primers spanning the respective SNPs are indicated (P1–P8). (B) Methylation analysis of the CpG island 3 by using SSCP. Lane 1, universally methylated genomic control DNA; lanes 2–5, normal bone marrow; lanes 6–9, normal granulocytes; lanes 10–13, granulocytes from patients, with an acquired 20q deletion. (C) Bisulfite sequencing of CpG island 3. Sequences relate to samples corresponding to individual lanes from B, as indicated.
    [Show full text]
  • Molecular Effects of Isoflavone Supplementation Human Intervention Studies and Quantitative Models for Risk Assessment
    Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis committee Promotors Prof. Dr Pieter van ‘t Veer Professor of Nutritional Epidemiology Wageningen University Prof. Dr Evert G. Schouten Emeritus Professor of Epidemiology and Prevention Wageningen University Co-promotors Dr Anouk Geelen Assistant professor, Division of Human Nutrition Wageningen University Dr Lydia A. Afman Assistant professor, Division of Human Nutrition Wageningen University Other members Prof. Dr Jaap Keijer, Wageningen University Dr Hubert P.J.M. Noteborn, Netherlands Food en Consumer Product Safety Authority Prof. Dr Yvonne T. van der Schouw, UMC Utrecht Dr Wendy L. Hall, King’s College London This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 20 June 2014 at 13.30 p.m. in the Aula. Vera van der Velpen Molecular effects of isoflavone supplementation: Human intervention studies and quantitative models for risk assessment 154 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in Dutch and English ISBN: 978-94-6173-952-0 ABSTRact Background: Risk assessment can potentially be improved by closely linked experiments in the disciplines of epidemiology and toxicology.
    [Show full text]
  • 1 Inventory of Supplemental Information Presented in Relation To
    Inventory of Supplemental Information presented in relation to each of the main figures in the manuscript 1. Figure S1. Related to Figure 1. 2. Figure S2. Related to Figure 2. 3. Figure S3. Related to Figure 3. 4. Figure S4. Related to Figure 4. 5. Figure S5. Related to Figure 5. 6. Figure S6. Related to Figure 6. 7. Figure S7. Related to Figure 7. 8. Table S1. Related to Figures 1 and S1. 9. Table S2. Related to Figures 3, 4, 6 and 7. 10. Table S3. Related to Figure 3. Supplemental Experimental Procedures 1. Patients and samples 2. Cell culture 3. Long term culture-initiating cells (LTC-IC) assay 4. Differentiation of CD34+ cord blood cells 5. Bi-phasic erythroid differentiation assay 6. Clonal assay 7. Mutation and sequencing analysis 8. Bisulphite sequencing and quantitative pyrosequencing 9. Human SNP genotyping 10. Strand-specific cDNA synthesis and PCR 11. Chromatin Immuno-precipitation (ChIP) 12. Immunoprecipitation and western blot 13. Colony genotyping 14. shRNA generation and viral infection 15. Retrovirus generation and transduction 16. Study approval 17. Statistical Methods 18. Primers list Supplementary References (19) 1 Additional SGK2 families 2 3 4 ♂ ♀ ♂ ♀ ♂ ♀ C/G C/C C/C C/G C/C C/G ♀ ♀ ♂ ♀ C/G C/G C/G C/G T T C T G C T A G A T T C T C C T A G A T T C T C C T A G A T T C T C C T A G A T-Cells T-Cells T-Cells T-Cells Additional GDAP1L1 familiy 2 ♂ ♀ G/G A/A ♀ G/A A C A C G G T G Erythroblasts Figure S1 - .
    [Show full text]
  • Supp Material.Pdf
    Supplementary Material for: Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data. Roger Pique-Regi1;y;∗, Jacob F. Degner 1;2;y;∗, Athma A. Pai1, Daniel J. Gaffney1;3, Yoav Gilad1;∗, Jonathan K. Pritchard1;3;∗ 1Department of Human Genetics, University of Chicago 2Committee on Genetics, Genomics and Systems Biology, University of Chicago 3Howard Hughes Medical Institute, University of Chicago yThese authors contributed equally. ∗To whom correspondence should be addressed: [email protected], [email protected], [email protected], [email protected] 1 Contents 1 Overview 3 2 Data sources and processing 4 2.1 PWM scanning. .4 2.2 Data for the prior. .5 2.3 Experimental data. .5 2.4 Models for experimental data. .6 3 The CENTIPEDE model 7 3.1 The model. .7 3.2 Implementation details. 11 4 Validation of the CENTIPEDE predicted TF-bound sites 12 4.1 Validation with ChIP-seq. 12 4.2 Relationship to other methods.................................... 19 4.3 Conservation as validation of the CENTIPEDE predictions. 20 5 Motif analysis 20 5.1 De novo motif discovery. 20 5.2 Identification of groups of overlapping motifs. 21 5.3 Novel words that have a match in existing protein binding microarray data . 22 5.4 GO analysis of putative gene-targets of each TF. 22 5.5 Co-occurrence analysis of binding locations for each TF. 23 5.6 Linear modeling of steady state mRNA levels. 24 5.7 Analysis of multi-tissue expression for TF target genes. 25 5.8 Estimating enrichment/depletion of histone modifications at TF binding locations.
    [Show full text]
  • Refinement of Regions with Allelic Loss on Chromosome 18P11.2 and 18Q12.2 in Esophageal Squamous Cell Carcinoma1
    Vol. 6, 3565–3569, September 2000 Clinical Cancer Research 3565 Refinement of Regions with Allelic Loss on Chromosome 18p11.2 and 18q12.2 in Esophageal Squamous Cell Carcinoma1 Jayaprakash D. Karkera,2 Saleh Ayache,2 more frequently in African-Americans than in Caucasians, Rodman J. Ransome, Jr., Marvin A. Jackson, whereas adenocarcinoma is more prevalent among Caucasians Ahmed F. Elsayem, Rajagopalan Sridhar, (2). Tobacco and alcohol consumption represents major envi- ronmental risk factors for this malignancy (3), but the molecular Sevilla D. Detera-Wadleigh, and events leading to esophageal cancer and the genetic components 3 Robert G. Wadleigh that are mutated at the inception and course of the neoplasm are Medical Oncology Section, Department of Veterans Affairs Medical largely unknown. Unraveling the genetic factors could provide Center, Washington, DC 20422 [J. D. K., S. A., R. G. W.]; targets for the development of more effective therapeutic agents. Departments of Pathology [R. J. R., M. A. J.], Medicine [A. F. E.], A variety of tumor suppressor genes have been implicated and Radiation Therapy and Cancer Center [R. S.], Howard University, Washington, DC 20060; and National Institute of Mental Health, in esophageal cancer (4, 5). Chromosomal abnormalities and NIH, Bethesda, MD 20892 [S. D. D.] LOH4 in which random isolated markers are used have been associated with esophageal tumors (6, 7). Analysis of chromo- some 18 has focused mainly on 18q21, where two known tumor ABSTRACT suppressor genes, DCC (8) and DPC4 (9) have been mapped. Esophageal cancer ranks among the 10 most common However, only infrequent deletions of DCC and DPC4 have cancers worldwide and is almost invariably fatal.
    [Show full text]
  • PRMT3 (1-531, His-Tag) Human Protein – AR51778PU-N | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR51778PU-N PRMT3 (1-531, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: PRMT3 (1-531, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 62.3 kDa Concentration: lot specific Purity: >90% by SDS - PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: Phosphate buffer saline (pH 7.4) containing 20% glycerol, 1mM DTT. Preparation: Liquid purified protein Protein Description: Recombinant human PRMT3, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. Storage: Store undiluted at 2-8°C for one week or (in aliquots) at -20°C to -80°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_001138638 Locus ID: 10196 UniProt ID: Q8WUV3 Cytogenetics: 11p15.1 Synonyms: HRMT1L3 Summary: This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 PRMT3 (1-531, His-tag) Human Protein – AR51778PU-N Protein Families: Druggable Genome Product images: This product is to be used for laboratory only.
    [Show full text]