Aus dem Institut für Tierzucht und Vererbungsforschung der Tierärztlichen Hochschule Hannover
Molecular genetic analysis of bilateral convergent strabismus with exophthalmus in German Brown cattle
INAUGURAL-DISSERTATION zur Erlangung des Grades einer DOKTORIN DER VETERINÄRMEDIZIN (Dr. med. vet.) durch die Tierärztliche Hochschule Hannover
Vorgelegt von Stefanie Hedwig Mömke aus Quakenbrück
Hannover 2004
Scientific supervisor: Univ.-Prof. Dr. Dr. O. Distl
Examiner: Univ.-Prof. Dr. Dr. O. Distl Co-examiner: Univ.-Prof. Dr. H.-J. Hedrich
Oral examination: 19.11.2004
This work was supported by grants from the German Research Council, DFG, Bonn, Germany (DI 333/7-2).
Dedicated to my family
Parts of this work have been submitted for publication in the following journals:
1. Animal Genetics 2. Cytogenetic and Genome Research 3. The Veterinary Journal Contents
1 Introduction 2
2 Bilateral strabismus with exophthalmus (BCSE) in cattle: a molecular genetic approach 5
– 2.1 Introduction 5
– 2.2.1 Anatomy of structures providing eye-movement 5
– 2.2.2 Strabismus and exophthalmus in cattle 6
– 2.2.3 Clinical signs of bilateral convergent strabismus with exophthalmus (BCSE) in cattle 7
– 2.2.4 Differential diagnoses for BCSE 8
– 2.2.5 Occurrence and prevalence of bovine strabismus 9
– 2.2.6 US Brown Swiss and milk production trait associations 10
– 2.2.7 Mode of inheritance 11
– 2.2.8 Histolopathological findings 12
– 2.2.9 Human paralytic strabismus in comparison to bovine BCSE 13
– 2.2.10 Whole genome scans as alternative approaches 15 2.2.11 Comparative genomics 16
– 2.3 Conclusions 17
3 Genome-wide search for markers associated with BCSE in German Brown cattle 19
– 3.1 Introduction 19
– 3.2. Material and methods 20
– 3.2.1 Sampling and pedigree structure 20
– 3.2.2 Marker selection and three step analysis 22
– 3.2.3 Linkage analysis 23
– 3.3 Results 23
– 3.3.1 Quality of the used marker set 23
– 3.3.2 Whole genome scan 26
– 3.3.3 Mapping of putative BCSE loci with flanking markers 26
– 3.4 Discussion 27
4 Physical mapping of the KCNJ8, MRPS35 and PRPH genes on bovine chromosome 5 by fluorescence in situ hybridisation and confirmation by RH mapping 35
– 4.1 Introduction 35
– 4.2 Material and methods 35
– 4.2.1 Identification of BAC clones containing the genes 35
– 4.2.2 Fluorescence in situ hybridisation 36
– 4.2.3 Radiation hybrid (RH) mapping 36
– 4.3 Assignment of the KCNJ8 gene to bovine chromosome 5q3.2-q3.4 37
– 4.3.1 Description 37
– 4.3.2 Isolation and characterisation of the bovine KCNJ8 clone 37
– 4.3.3 Fluorescence in situ hybridisation 38
– 4.3.4 Radiation hybrid mapping 38
– 4.3.5 Comment 38
– 4.4 Assignment of the PRPH gene to bovine chromosome 5q1.4 39
– 4.4.1 Description 39
– 4.4.2 Isolation and characterisation of the bovine PRPH clone 40
– 4.4.3 Fluorescence in situ hybridisation 40
– 4.4.4 Radiation hybrid mapping 40
– 4.4.5 Comment 41
– 4.5 Assignment of the MRPS35 gene to bovine chromosome 5q3.1-q3.2 41
– 4.5.1 Description 41
– 4.5.2 Isolation and characterisation of the bovine MRPS35 clone 42
– 4.5.3 Fluorescence in situ hybridisation 42
– 4.5.4 Radiation hybrid mapping 42
– 4.5.5 Comment 43
5 A comparative radiation hybrid map of bovine chromosome 5q1.3-q2.5 with human chromosome 12q 45
– 5.1 Introduction 45
– 5.2 Material and methods 46
– 5.2.1 Selection of genes and primer design 46
– 5.2.2 Radiation hybrid mapping 47
– 5.2.3 Statistical analysis 47
– 5.3 Results 47 – 5.4 Discussion 48
6 A comparative radiation hybrid map of the telomeric region of bovine chromosome 18 to human chromosome 19q13 55
– 6.1 Introduction 55
– 6.2 Material and methods 55
– 6.2.1 Selection of genes and primer design 55
– 6.2.2 Isolation of two BAC clones by radioactive hybridisation 57
– 6.2.3 Chromosomal location 57
– 6.2.4 Radiation hybrid (RH) mapping 58
– 6.2.5 Statistical analysis 59
– 6.3 Results 58
– 6.4 Discussion 60
7 Fine mapping of two gene loci on bovine chromosomes 5 and 18 responsible for bilateral convergent strabismus with exophthalmus in German Brown cattle 64
– 7.1 Introduction 64
– 7.2 Material and methods 64
– 7.2.1 Pedigree material 64
– 7.2.2 Search for microsatellite markers in published BAC-end sequences 64
– 7.2.3 Development of microsatellites from bovine BAC clones 65
– 7.2.4 Microsatellite marker analysis 67
– 7.2.5 Development of single nucleotide polymorphisms (SNPs) 68
– 7.2.6 SNP marker analysis 68
– 7.2.7 Linkage analysis 70
– 7.3 Results 70
– 7.4 Discussion 73
8 Summary 82
9 Erweiterte Zusammenfassung 85
– 9.1 Einleitung 85
– 9.2 Genomscan und nicht-parametrische Kopplungsanalyse anhand von Mikrosatelliten 86
– 9.2.1 Material und Methoden 86
– 9.2.2 Ergebnisse 88
– 9.2.3 Diskussion 88
– 9.3 Physikalische Kartierungen mittels Fluoreszenz in situ Hybridisierung (FISH) und Radiation Hybrid (RH)-Kartierung 89
– 9.3.1 Material und Methoden 89
– 9.3.2 Ergebnisse 91
– 9.3.3 Diskussion 91
– 9.4 Entwicklung von Mikrosatelliten und SNP Markern mit anschließender Feinkartierung 92
– 9.4.1 Material und Methoden 92
– 9.4.2 Ergebnisse 93
– 9.4.3 Diskussion 93
10 References 96
11 Appendix 108
12 Acknowledgements 134
13 List of publications 137
– 13.1 Journal articles 137
– 13.2 Oral presentations 138
Abbreviations
List of abbreviations
A adenine Acc. no. accession number ad autosomal dominant AI artificial insemination APS ammonium persulphate ar autosomal recessive AT annealing temperature ATX amoxicillin, tetracyclin, X-Gal BAC bacterial artificial chromosome BCSE bilateral convergent strabismus with exophthalmus BLAST basic local alignment search tool BTA chromosome of Bos taurus bp base pair C cytosine cDNA complementary desoxyribonucleic acid cM centiMorgan cR centiRay DAPI 4',6-diaminidino-2-phenylindole DFG Deutsche Forschungsgemeinschaft (German Research Council) DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTPs deoxy nucleoside 5’triphosphates (N is A,C,G or T) DUS divergent unilateral strabismus E. coli Escherichia coli EDTA ethylenediamine tetraacetic acid EMBL European Molecular Biology Laboratory EST expressed sequence tag F forward FISH fluorescence in situ hybridisation G guanine Abbreviations gss genomic survey sequence HET heterozygosity HSA chromosome of Homo sapiens IBD identical by descent IMAGE integrated molecular analysis of genomes and their expression IRD infrared dye ISCNDB international system for chromosome nomenclature of domestic bovids kb kilobase LB Luria Bertani LOD logarithm of the odds M molar MARC U.S. Meat Animal Research Center Mb megabase MERLIN multipoint engine for rapid likelihood inference MMU chromosome of Mus musculus mRNA messenger ribonucleic acid MS microsatellite mtDNA mitochondrial desoxyribonucleic acid NCBI National Center for Biotechnology Information NPL nonparametric linkage OMIA online mendelian inheritance in animals OMIM online mendelian inheritance in man p error probability PCR polymerase chain reaction PEO progressive external ophthalmoplegia PIC polymorphism information content QTL quantitative trait locus R reverse RH radiation hybrid RPCI Roswell Park Cancer Institute rpm rounds per minute RZPD Resource Center/Primary Database, Berlin SAS statistical analysis system Abbreviations
SNP single nucleotide polymorphism STS sequence-tagged site T thymine TBE tris-borate-ethylenediamine tetraacetic acid TE tris- ethylenediamine tetraacetic acid TEMED N,N,N’,N’-tetramethylenediamine USDA United States Department of Agriculture UV ultraviolet wgs whole genome shotgun w/v weight to volume X-Gal 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside
Chapter 1. Introduction 1
Chapter 1
Introduction 2 Chapter 1. Introduction
Introduction
Bilateral convergent strabismus with exophthalmus (BCSE) is a heritable eye defect, which is prevalent in many cattle breeds and known worldwide. German Brown cattle shows a high incidence for BCSE. The defect is characterised by a bilateral symmetric anterior-medial rotation of the eye associated with a slight to severe protrusion of the eyeball. BCSE shows a progressive course and ends up in complete blindness. Breeding with animals, which are known or suspected to be carriers of BCSE is forbidden by paragraph 11b of the German animal welfare laws, due to the severly limited use of the eyes in affected individuals. The onset of the defect can sometimes be late in life and often first signs of the defect are not noticed prior to first breeding. Thus, prevention of BCSE cannot be achieved alone by exclusion of affected animals from breeding. Consequently, a molecular genetic diagnosis of carriers is urgently needed. The objective of the present study is to identify the genomic regions harbouring the gene loci responsible for BCSE. In order to achieve this goal, a whole genome scan was performed and after that, for the genomic regions significantly linked to BCSE, comparative human-bovine maps with high resolution were constructed. Using these maps, new microsatellites and single nucleotide polymorphisms (SNPs) were developed for fine mapping the identified BCSE regions in cattle.
Overview over the chapter contents Chapter 2 reviews the literature for BCSE in German Brown cattle and other cattle breeds, including the clinical signs, prevalence, phenotypic associations, inheritance patterns, and histopathology. Moreover, parallels to human strabismus are shown, and the advantages of comparative genomics and different molecular genetic approaches are described. Chapter 3 describes the whole genome scan performed on ten German Brown cattle families and the linkage analysis to determine the genomic regions responsible for BCSE in German Brown cattle. In Chapter 4 the isolation and mapping of three potential candidate genes for BCSE is described. Chapter 1. Introduction 3
Chapter 5 and Chapter 6 contain the construction of two high resolution human bovine comparative maps for two genomic regions determined by the whole genome scan (Chapter 3). Chapter 7 shows the development of new microsatellite and SNP markers and the results of fine mapping the two genomic regions linked with BCSE. 4 Chapter 2. Review of literature
Chapter 2
Bilateral strabismus with exophthalmus (BCSE) in cattle: a molecular genetic approach Chapter 2. Review of literature 5
Bilateral strabismus with exophthalmus (BCSE) in cattle: a molecular genetic approach
2.1 Introduction Bilateral convergent strabismus with exophthalmus (BCSE) is an eye disorder affecting many cattle breeds worldwide. The defect is heritable and of relatively high incidence, particularly in Holstein and German Brown cattle. BCSE can become a significant problem because of its progressive course, which leads to complete blindness. This can cause changes in the behaviour of the affected animals such as aggressiveness, shying and panic in everyday situations, or reluctance to walk to the milking parlour or to pasture. Cattle showing the clinical signs of BCSE may be suspected of being affected with bovine spongiform encephalopathy (BSE) due to similar symptoms such as insecure gait, trembling when forced to walk and shyness, as well as strabismus of the eyes. Due to the impact of BCSE on the proper use of organs, breeding with animals suspected to be carriers is not allowed by German animal welfare laws; however, sufficiently early detection is not yet possible and efficient preventive measures have to be developed to reduce the occurrence of BCSE. The objective of this chapter was to provide an overview of the phenotypic forms of strabismus in cattle, to review its prevalences, associations with other characteristics, and reported mode of inheritance, and to discuss histological findings in connection with human molecular genetic candidate genes useful for further research work.
2.2.1 Anatomy of structures providing eye-movement While primates have frontally oriented eyeholes, in cattle the physiological angle of the axis of the eyes is 104°. This provides a field of vision of nearly 360°. Seven extraocular skeletal muscles move the eyeball: one retractor bulbi, four rectus and two oblique muscles. The interaction of these muscles adjust the eyes to particular lines of sight. The retractor bulbi muscle originates at the edge of the optic foramen, incloses the optic nerve, and attaches to the back of the eyeball. Its function is to protect the eye by retraction. The four slender rectus muscles (superior, medial, 6 Chapter 2. Review of literature inferior and lateral) originate dorsal, medial, ventral and lateral of the optic foramen, respectively, and run towards the eyeball. Their tendons insert at the sclera, near the cornea. These muscles move the eyeball in every direction. The oblique muscles turn the bulbus around the axis of the eye. The inferior oblique muscle emerges from the lacrimal bone and circles ventrally around the bulbus to the temporal side of the eye. The superior oblique muscle originates near the ethmoid foramen and runs to the nasal corner of the eye. It loops orthogonally around the trochlea and proceeds around the bulbus to the temporal side. The motoric innervation of the eye muscles is accomplished by the oculomotor (III), trochlear (IV) and abducens (VI) nerves. The oculomotor nerve is the third cranial nerve. It enters the orbit and innervates the superior rectus, medial rectus, inferior rectus, inferior oblique muscle and the medial portion of the retractor bulbi muscles. The trochlear nerve is the fourth and weakest cranial nerve. It innervates the superior oblique muscle. The sixth cranial nerve, the abducens, innervates the lateral rectus muscle and the lateral portion of the retractor bulbi muscle.
2.2.2 Strabismus and exophthalmus in cattle Strabismus is defined as the permanent or temporary deviation of the eyes from their normal visual axis. The signs of strabismus can manifest congenitally or later in life. Paralytic and non-paralytic forms of strabismus are distinguished in human and veterinary medicine. Concomitant (non-paralytic) strabismus is due to a functional disturbance of the ocular apparatus and can be congenital or caused by infectious diseases. The angle of misalignment of the visual axes does not vary with ocular movements, and the function of individual eye muscles is usually intact. The paralytic form of strabismus (incomitant strabismus) results from paralysis of one or more ocular muscles and leads to limited eye motion and thus to different angles of the axes of the eyes. The most frequently observed manifestation of strabismus is convergent strabismus (esotropia), which is characterised by squinting eyes that deviate inwards, toward the nasal angle. In divergent strabismus (exotropia), the affected eye deviates outwards from its visual axis, toward the temporal angle. In other forms of strabismus the visual axis deviates upwards, downwards or obliquely. Strabismus can have many causes: Chapter 2. Review of literature 7 congenital defects (e.g. aplasia of the eye-muscle nuclei), space-occupying processes within the orbit (e.g. neoplasias, haemorrhages, inflammations), neurologic diseases (e.g. meningitis, encephalitis, intracranial tumours, ischaemia, neuritis), muscular impairment (e.g. myositis), metabolic diseases (e.g. tetany, hypocalcaemic partiturient paresis, the nervous form of acetonaemia) or intoxication (e.g. phosphoric acid ester, seeds of Aesculus octandra [Magnusson et al. 1983]). Exophthalmus is the abnormal prominence of an eyeball of normal size. It can occur in one or both eyes. In advanced stages of this defect, the cornea often desiccates. Exophthalmus can be caused by paralysis of the muscles of the eye (e.g. a defect of the abducens nerve, lesions of the musculus retractor bulbi), space-occupying processes within the orbit (e.g. neoplasia, haemorrage, inflammation, abscess), congenital deformity of the scull or by defects of the suspension apparatus of the eyeball.
2.2.3 Clinical signs of bilateral convergent strabismus with exophthalmus (BCSE) in cattle The signs of bilateral convergent strabismus with exophthalmus (BCSE) were first described in cattle by Koch (1875) at the end of 19th century. BCSE is characterised by a bilateral symmetric rotation of the eyeballs in an anterior-medial direction, which results in a permanent deviation of the visual axes. Bilateral convergent strabismus is accompanied by slight to severe laterodorsal exophthalmus. According to Power (1987) this is due to the oval shape of the bovine eye, whose transverse diameter is greater than its axial diameter (Sisson 1953). Thus, the eyeball protrudes when it is rotated. Epiphora is often seen, particularly in cattle with advanced BCSE (Vogt 2000). In many cases, the visible sclera shows a dark pigmentation (Veenendal 1958; Schütz-Hänke et al. 1979). Parts of the lateral rectus muscle (Barrier and Brissot 1885) or even the retrobulbar fat pad (Schütz-Hänke et al. 1979) can become visible in severely affected animals. These defects are chronic and incurable. The degree of deviation of both eyes from the regular visual axis can be determined by the amount of sclera permanently visible in the temporal corner of the eye. Vogt and Distl (2002) proposed a four-stage scale for classifing affected animals: stage 1, with less than 25% of the eye filled with sclera; stage 2 from 25% to 50%; stage 3 from 50% to 75%; and stage 4, with more than 75% filled (Chapter 11, Figures 1 - 4). 8 Chapter 2. Review of literature
Mild forms of BCSE (stage 1) are more difficult to diagnose than advanced stages. For diagnosis of stage 1 BCSE, the animal has to be carefully watched from a distance of one to two meters for at least several minutes. The animals' sense of orientation may be intact in mildly affected individuals in spite of the limited field of vision (Miles 1932), but animals showing stage 3 or 4 of BCSE are generally disoriented (Koch 1875; Distl et al. 1991), have an insecure gait, sometimes walk in circles or even lose their balance and fall down (Jakob 1920). Handling of these animals is difficult due to their limited vision. Farmers describe affected cows as shy, leery, jumpy and wild. Behavioural changes mainly attract attention when the animals jump and kick unexpectedly upon hearing noise from behind (Schütz-Hänke et al. 1979). Affected animals have to be handled very carefully, particularly in cubicle housing and on pasture, because of their cautious movements (Distl and Gerst 2000). BCSE causes economic losses because of the animals' decreased market value and the fact that they and their progeny cannot be used as breeding animals (Distl and Gerst 2000).
2.2.4 Differential diagnoses for BCSE While BCSE is clearly a genetic defect, several similar clinical pictures caused by other factors have been described in the literature. Zschokke (1885) carried out a pathological examination in a cow with manifest strabismus and the eyeballs rotated medially 90° from the anatomical visual axis. He detected a bilateral angioma at the foramen orbitorotundum within the orbit. The pressure of this tumour caused paralysis of the abducens nerve. An extreme exophthalmus combined with convergent strabismus was observed by Röder (1890) and Göring (1898). They found these symptoms to be connected with Morbus Basedow (Graves' Disease). In those cases the squinting animals showed typical symptoms of hyperthyroidism (e.g. struma, tachycardia and dilatation of the heart). Dexler (1891) observed bilateral convergent strabismus with exophthalmus in four animals of different breeds. He attributed the symptoms to a hypertrophic retrobulbar corpus adiposum which led to partial or complete paralysis of the lateral rectus muscle. Magnusson et al. (1983) reported the case of a calf which developed bilateral dorsomedial strabismus after being fed with seed of Aesculus octandra Marsh. Ventromedial strabismus was found in four animals showing clinical coccidiosis (Jubb 1988). Chapter 2. Review of literature 9
Bovine leukosis occasionally causes tumours which sometimes affect the central nervous system and lead to strabismus with exophthalmus, if their position is retrobulbar (Power 1987). Furthermore, Möller (1910) and Jakob (1920) described different tumours, orbital bone defects, traumatic injuries and a small orbit which caused strabismus and exophthalmus. Distl and Scheider (1994) reported a full sib pair of male Highland cattle showing divergent unilateral strabismus (DUS), which is assumed to be inheritable. The reason for this eye defect was a 40° ventral displacement of the insertion of the lateral rectus muscle. Julian (1975) described a case of divergent bilateral strabismus with hydrocephalus in a Holstein calf (1975). At birth the calf showed strabismus along with several other abnormalities. When the calf was euthanised at two months of age, the eyes returned to their normal position.
2.2.5 Occurrence and prevalence of bovine strabismus BCSE has been observed in different cattle breeds, including German Brown, Jersey, Shorthorn, Ayrshire, Bulgarian Grey, Irish Holstein Friesian, German Fleckvieh, German Black and White, and Dutch Black Pied (Distl et al. 1991; Distl and Gerst 2000; Holmes and Young 1957; Mintschev 1965; Power 1987; Regan et al. 1944; Vogt and Distl 2002). Generally, no signs of the defect are present at birth, but develop later in life. According to Holmes and Young (1957), the earliest manifestation of the defect is usually at the age when the heifers are in calf and often not until after calving, although those investigators also report one calf affected at birth. Regan et al. (1944) observed BCSE earliest in one six-month-old calf, but all other animals were at least one year old. First symptoms of BCSE were found in cattle at least one year old by Gerst and Distl (1997 and 1998), who also found it impossible to ascertain an age limit after which all affected animals would have started showing symptoms of BCSE. The condition generally shows a progressive course that advances at an individual speed and which may be interrupted by long, apparently stable periods (Holmes and Young 1957). Given a sufficently long lifetime, affected animals can sooner or later become completely blind. The incidence of BCSE in German Brown cattle was estimated by Gerst and Distl (1997) to be 0.9 % in adult cows and 0.1% in young animals. Due to the smaller corpus of data for the breeds German Black and White and German Fleckvieh, only tendencies for incidences were estimated for these breeds. 10 Chapter 2. Review of literature
However, the incidence BCSE in German Black and White cattle seemed to be higher and that of Fleckvieh lower than in German Brown cattle. Vogt and Distl (2002) analysed the influence of an unproven German Brown sire affected by BCSE on his offspring and proved that there was a significant relationship between the paternity of this sire and the occurrence of BCSE in his progeny. The incidence of BCSE was 8.33% in the decendants of this sire, which was used for artificial insemination (AI) in German Brown dairy cattle. This incidence is much lower than the expected 50% for an autosomal dominant inheritance and a heterozygote carrier, and it was assumed that further genes influence the occurrence or age of manifestation of BCSE (Vogt 2000).
2.2.6 US Brown Swiss and milk production trait associations It is remarkable that the proportion of US Brown Swiss blood in affected German Brown animals was up to 7% higher than in unaffected animals of this breed (Gerst and Distl 1998), and a potential association was suspected between BCSE and the incrossings of US Brown Swiss bulls. However, in a subsequent study, Vogt and Distl (2002) did not find a significant influence of the percentage of US Brown Swiss blood on the occurrence of BCSE in data from about 130 herds. Therefore it is not clear whether the spread of BCSE is caused by the intensive use of US AI bulls in the German Brown population. The defect definitely cannot be caused solely by incrossing of US Brown Swiss sires, since BCSE was also observed in maternal families without US Brown Swiss blood (Distl 1993). No associations were found in German Brown cattle between BCSE and the milk performance traits milk, fat and protein yield or content. Nor was the prevalence of BCSE in cows associated with higher or lower breeding values for milk production traits, so it is unlikely that there was a selection advantage for cows with BCSE (Distl and Gerst 2000; Vogt 2000). Therefore it seems rather improbable that there was an indirect selection for BCSE caused by higher milk performance in affected cows. It appears unlikely that there is a close genetic linkage of the defect allele for BCSE and a gene for milk yield. Thus, bovine chromosomes other than 1, 6, 9, 10 and 20 which have already been mapped for quantitative trait loci for milk production traits, may be assumed as the most probable candidates for containing the BCSE gene or genes (Distl and Gerst 2000). Chapter 2. Review of literature 11
2.2.7 Mode of inheritance As early as 1885, BCSE in cattle was assumed to be an inherited defect. Barrier and Brissot (1885) described the case of a cow with one decendant showing a similar occurrence of strabismus and exophthalmus. Jakob (1920) advised farmers to exclude animals affected with BCSE from breeding. However, both the mode of inheritance as well as the number of contributing genes was controversially discussed for several decades. Regan et al. (1944) were the first to collect systematic records on this defect. They compared the ancestry of two male and seven female affected animals of the Jersey cattle herd owned by the California Agricultural Experiment Station. Most of the affected animals were inbred (sire- daughter matings) progeny of three different, apparently unaffected sires. The progeny of bulls from strabismus-free lines mated with affected cows did not show the defect. Thus, Regan et al. (1944) supposed that strabismus in cattle was caused by one autosomal recessive gene. This thesis was only partly affirmed by Holmes and Young (1957), who observed BCSE in three groups of Shorthorn and Ayrshire cattle, which included more than 20 affected individuals in all. Those investigators could not exclude the possibility of a recessive gene causing BCSE because their material was not sufficiently extensive. Using regressive logistic models of segregation analysis, Distl et al. (1991) examined 107 animals of the German Brown cattle breed and postulated a major gene model influenced by additively acting genes, taking into consideration environmental and polygenic effects. Complex segregation analysis was employed to study additional 10 pedigrees, including 184 German Brown individuals (Distl 1993). The results showed that an autosomal dominant major gene was the most likely explanation for the segregation of BCSE- affected cattle within the pedigrees when ascertainment was corrected. Gerst and Distl (1997) proposed that the defective allele segregated mainly within cow families and herds. The segregation analysis performed by Gerst (1996) showed a single autosomal dominant mode of inheritance with an incomplete penetrance of 70%. For this model the frequency of the BCSE gene was estimated as f = 0.008 for the available cattle population. Vogt and Distl (2002) supposed that complete penetrance for a single autosomal dominant gene causing the disease is unlikely, due to the variable age of manifestation of BCSE in cattle. A mitochondrial DNA defect responsible for BCSE might be an alternative hypothesis 12 Chapter 2. Review of literature for the mode of inheritance of BCSE. This latter hypothesis can be excluded only by showing transmission of BCSE from an affected bull to his progeny. Our unpublished data including two German Brown AI sires affected by BCSE with more than 40 affected daughters out of about 35 different herds did not provide evidence for maternal cytoplasmatic inheritance. Nearly 50% of the examined 75 descendants of these two sires were affected by BCSE.
2.2.8 Histolopathological findings Knowing the pathogenesis of a defect can help to assign it to a specific gene that causes the same or similar findings in other species. Therefore histopathological examinations can be most helpful. In the case of BCSE-affected animals, the defect was suspected in the lateral rectus muscles (Barrier and Brissot, 1885) or in the supplying nerves and appropriate nuclear regions (Jakob 1920). Mintschev (1965) diagnosed BCSE in Bulgarian Grey cattle and came to the conclusion that the defect was probably caused by infranuclear lesions of the abducens nerves. Pathomorphological investigation by Schütz-Hänke et al. (1979) revealed no differences in the eyes, eye muscles and the N. abducens between affected and unaffected individuals. However, those investigators' histomorphological examinations of the nucleus of the abducens nerve showed that the number of nerve cells in both nuclear regions of this nerve is decreased in animals with symptoms of BCSE and that this induces paresis of the lateral rectus muscles and the lateral part of the retractor bulbi muscles. Histological examination on the lateral and medial rectus muscles of affected cattle eyes revealed “ragged red fibres”, which are indicators for muscle defects and can be associated with mitochondrial DNA defects (Vogt 2000). Since "ragged red fibres" are not exclusively signs of mitochondrial DNA defects but can also be shown in other defects in the respiratory chain of the muscle, clarification of the pathogenesis depends on molecular genetic approaches and/or examination of tissue sections by electron microscopy for detection of deformed organelles, characteristically arranged cristae and para-cristalline inclusions.
Chapter 2. Review of literature 13
2.2.9 Human paralytic strabismus in comparison to bovine BCSE It has become apparent that there are extensive genetic homologies between the human and even distantly related species. Great progress has been made in the comparative gene map between humans and cattle, so that syntenic genomic regions can be identified with high precision. Genes causing defects, e.g. strabismus, that have already been identified in man can be used as candidate genes for the clarification of BCSE in cattle. Human congenital-infantile esotropia is not connatal, but develops in the first few weeks or months after birth (Nixon et al. 1985). Examination of 39,227 children in Bethesda, MD, USA, from gestation to the age of seven years showed that esotropia developed in 3.0% of them (Chew et al. 1984). Progressive external ophthalmoplegia (PEO) in man shows striking similarities to BCSE in cattle. PEO refers to a group of disorders characterised by ptosis and slowly progressive bilateral immobility of the eyes (Sorkin et al. 1997), and is considered to be the most frequent form of mitochondrial encephalomyopathies in man (Deschauer et al. 2001). In many cases the onset of the disease is in adolescence or adulthood. Based on age of onset and severity of clinical symptoms, patients with PEO are divided into three groups. The most severe variant is called Kearns-Sayre syndrome and is characterised by an infantile, childhood or adolescent onset. The second is the milder, chronic PEO with an adolescent or adult onset. The third is isolated chronic PEO with an adult onset and mild symptoms. PEO are monogenetic defects caused by mutations of different genes (Table 1): DNA polymerase gamma (POLG) (van Goethem et al. 2001), solute carrier family 25A4 (SLC25A4) (Kaukonen et al. 2000; Napoli et al. 2001; Komaki et al. 2002) and chromosome 10 open reading frame (C10orf2) (Spelbrink et al. 2001). Furthermore, a mutation in the endothelial cell growth factor/platelet-derived (ECGF1) gene causes a subform of PEO (Vissing et al. 2002). Since all proteins required for replication of the mitochondrial genome are encoded by nuclear genes, defects in these genes will cause mtDNA loss or deletion, which leads to tissue dysfunction (Suomalainen and Kaukonen, 2001). Because of their high energy consumption and dependence on oxidative energy, ocular tissues are affected especially often by mitochondrial defects (Mojon, 2001).
14 Chapter 2. Review of literature
Table 1 Genes responsible for progressive external ophthalmoplegia (PEO) in humans, and their genomic locations in man and cattle
Gene Function Location Location human cattle POLG Encodes for DNA polymerase involved in replication 15q25 21q17- of mitochondrial genome (Clayton 1982) q22 SLC25A4 Catalysation of exchange of ADP and ATP across 4q35 27q14- mitochondrial internal membrane (Li et al. 1989) q15 C10orf2 Involved in mammalian mitochondrial DNA 10q24 26q13- maintenance (Spelbrink et al. 2001) q21 ECGF1 Promotion of angiogenesis in vivo and stimulation of 22q13 - the in vitro growth of endothelial cells, limitation of glia cell proliferation (Hagiwara et al. 1991; Stenman et al. 1991, 1992)
The mode of inheritance of the various gene defects causing PEO is autosomal dominant (adPEO) or autosomal recessive (arPEO) (Table 2). Furthermore, mitochondrial point mutations have been suggested which are passed on maternally (Deschauer et al. 2001). In a sporadic case of PEO, Van Goethem et al. (2003) also identified heterozygosity for a 1031G-A transition in the C10orf2 gene, which resulted in an arg334-to-gln mutation, and heterozygosity for a gly884-to-ser mutation in the POLG gene, which indicate a digenic mode of inheritance. A survey of the mutations causing PEO in man is given in Table 2 for the genes POLG, SLC25A4, C10orf2 and ECGF1. The three genes with dominantly acting mutations causing PEO in humans were chosen as candidate genes for BCSE in cattle by Hauke et al. (2003). After localisation of POLG, SLC25A4 and C10orf2 on bovine chromosomes BTA 21, BTA 27 and BTA 26, microsatellite markers were developed and tested for allelic cosegregation with the BCSE phenotype. Neither these markers nor evenly distributed microsatellite markers on the respective bovine chromosomes showed significant linkage with BCSE. Thus these candidate genes could be excluded as responsible for bovine BCSE. Chapter 2. Review of literature 15
Table 2 Examples of mutations in the genes POLG, SLC25A4, C10orf2 and ECGF1 causing symptoms of PEO
Gene Mode of inheritance Mutation POLG Autosomal dominant A-to-G transition -> tyr955-to-cys (Van Goethem et al. 2001) Autosomal recessive G-to-A transition -> ala467-to-thr (Van Goethem et al. 2001) T-to-G transversion -> leu304-to-arg (Van Goethem et al. 2001) SLC25A4 Autosomal dominant G-to-C transversion -> ala-to-pro (Kaukonen et al. 2000) G-to-A transition -> val-to-met (Kaukonen et al. 2000) T-to-C transition -> leu98-to-pro (Napoli et al. 2001) A-to-G heterozygous transition -> asp104-to-gly (Komaki et al. 2002) C10orf2 Autosomal dominant Duplication at nucleotides 1053-1092, resulting in a duplication of amino acids 352-362 of twinkle (Spelbrink et al. 2001) G-to-C transversion -> ala475-to-pro (Spelbrink et al. 2001) G-to-C transversion -> arg354-to-pro (Spelbrink et al. 2001) T-to-C transition -> leu381-to-pro (Spelbrink et al. 2001) ECGF1 Autosomal recessive A-to-C transversion -> glu289-to-ala (Nishino et al. 1999) A-to-C transversion -> gly145-to-arg (Nishino et al. 1999) A-to-G transition -> lys222-to-ser (Nishino et al. 1999)
2.2.10 Whole genome scans as alternative approaches A whole genome scan can be used to detect markers significantly linked to the BCSE phenotype. This approach is based on highly informative microsatellites evenly spread over all chromosomes with an average distance of less than 20 cM. The most recent linkage map of Kappes et al. (1997) contains 1250 markers covering 2990 cM with a mean marker distance of 2.5 cM. The updated bovine map with about 1250 microsatellites is freely available in the internet (URL: http://sol.marc.usda.gov). However, much denser maps are needed in the second step of the linkage study to progress from the initial mapping of the disease to one or more specific bovine chromosomes to the identification of the precise chromosomal region. The average spacing of markers in such maps should be between 0.5 and 2 cM. Once a genomic region of the size below 2–3 cM has been successfully identified for BCSE, positional candidate genes from the conserved chromosomal region in man can be selected for testing cosegregation with BCSE. 16 Chapter 2. Review of literature
2.2.11 Comparative genomics Candidate genes for BCSE may code for ionic channels, hormones, enzymes, metabolic factors and/or their receptors involved in the development of cranial nerves or eye muscles. As the number of potential candidate genes in the whole genome is far too large to be included in a study, very precise identification of the position of the genomic region harbouring the BCSE causing gene(s) is necessary. Then a candidate gene can be chosen from the homologous human genomic region based on the comparative human-bovine map. This positional candidate gene has to be considered to be causal for BCSE due to its function or pattern of expression. Of all mammals, human and mouse are the species whose genomes are best researched. With the development of highly resolved human-bovine comparative maps, the identification of genomic regions containing candidate genes known in human or mouse becomes feasible for the bovine genome. After the early large genome surveys which showed rough chromosomal homologies and breakpoints (Hayes 1995; Solinas-Toldo et al. 1995; Chowdhary et al. 1996), and the more detailed radiation hybrid (RH) maps (Williams et al. 2002; Band et al. 2000), Larkin et al. (2003) constructed a comparative human-bovine map by producing about 60,000 bovine BAC end sequences out of 40,224 cattle BAC clones. Using BLASTN, 29.4% and 10.1% significant hits could be anchored to human and mouse genome sequences, respectively. Using these bovine BAC end sequences, Everts-van der Wind et al. (2004) were able to further refine the comparative human- bovine map by identification of 195 conserved segments with their breakpoints in the bovine map. Once a positional candidate gene has been localised, single nucleotide polymorphisms (SNPs) can be developed for this gene and the flanking genes to be used in linkage analysis. In the case of BCSE, cosegregation of SNPs with BCSE can easily be detected when heterozygous SNPs within the positional candidate gene have been identified for the affected AI bulls. In this way it will be possible to characterise the yet unknown BCSE-causing gene(s) in cattle.
Chapter 2. Review of literature 17
2.3 Conclusions Bilateral convergent strabismus with exophthalmus (BCSE) is a dominantly inherited defect in cattle which usually cannot be diagnosed in calves, heifers or young bulls, so these animals will spread the defect in the cattle population before they can be excluded from breeding. The development of a gene test is necessary to identify affected animals at an early age. Three candidate genes causing dominantly inherited progressive external ophthalmoplegia (adPEO) in man have been excluded. A whole genome scan has to be completed for the BSCE-causing genes to be identified. Comparative genomics can then be used as a very effective approach towards unravelling the genetic basis of bovine BCSE. When the genes with their causal mutations for BCSE are identified, breeding strategies can be developed to eradicate this defect in cattle. Furthermore, new insights may be gained into the causes and pathogenesis of strabismus, possibly leading to therapeutic measures. 18 Chapter 3. Whole genome scan
Chapter 3
Genome-wide search for markers associated with BCSE in German Brown cattle Chapter 3. Whole genome scan 19
Genome-wide search for markers associated with BCSE in German Brown cattle
3.1 Introduction
The bilateral convergent strabismus with exophthalmus (BCSE) is a widespread inherited defect in several cattle populations. Affected cattle shows a permanent anterior-medial rotation of both eyes with a bilateral symmetric protrusion of the eyeballs. The defect usually does not manifest prior to an age of six months and sometimes not until after first calving. The condition is progressive and in advanced stages the deviation of the eyeballs from the proper optic axis is so strong, that pupils disappear in the nasal angles of the eyes, what leads to blindness. In the course of the disease four different stages can be distinguished: in the first stage the temporal angle of the eye is filled out by sclera up to 25 %, in the second and third stage up to 50 and 75 %, respectively, and in the fourth stage more than 75 % of the temporal angle of the eye is filled with sclera. Distl et al. (1991) used six pedigrees with altogether 107 animals of the breed German Brown Swiss to test for the mode of inheritance of BCSE. The complex segregation analysis showed that a major gene model with additively acting genes was the most likely explanation for the occurence of BCSE in these pedigrees. A further complex segregation analysis gave evidence for a single autosomal dominant major gene responsible for the phenotypic expression of BCSE (Distl 1993). On this account we performed a genome-wide search for BCSE associated microsatellite markers using two paternal half-sib pedigrees of affected German Brown sires and mostly affected descendants. In addition, eight German Brown families mainly consisting of affected cows were analysed. The objective of the present analysis was to identify genomic regions linked with the BCSE phenotype in German Brown cattle.
20 Chapter 3. Whole genome scan
3.2. Material and methods
3.2.1 Sampling and pedigree structure For the linkage analysis we collected blood, semen or hair samples from 131 German Brown cattle individuals belonging to ten families segregating for BCSE (Table 1). Of these animals 72 belonged to two paternal half-sib families. The first half-sib family consisted of the affected sire, 16 affected daughters and nine dams, of which three were affected. The second half-sib family included the affected sire and 26 affected and 19 nonaffected daughters. The remaining eight families segregating for BCSE contained affected females and their relatives (Figure 1). Because of the late onset of the disease we preferentially included affected individuals in our analysis. Most animals showed a first or second stage of BCSE. Regarding all maternal pedigrees (families 1-8), seven non-affected sires occurred in more than one family. In total, the pedigrees contained 53 male and 208 female animals and 126 founders. The average family size was 27.3 individuals, with a maximum of 89 and a minimum of 5. In the average, the families included 3.9 generations, ranging from 2 to 8. The prevalence of BCSE was 70.2 % in the genotyped animals. The average examination age, at which a strabismus was detected was 6.1 for the maternal families (families 1-8), 6.9 for family 9 and 3.7 for family 10.
Table 1 Family sizes and prevalence of BCSE. The families 1 to 8 are maternal families segregating for BCSE, 9 and 10 are half-sib families of affected sires
Maternal Half-sib Total1 families families Family 1 2 3 4 5 6 7 8 9 10 Number of animals 31 45 7 13 5 14 11 25 33 89 261 Number of animals affected by BCSE 8 11 3 5 2 4 3 9 20 28 93 Prevalence of BCSE (total %) 25.8 24.4 42.9 38.5 40.0 28.6 27.3 36.0 60.6 31.5 35.6 Genotyped individuals 15 18 6 7 2 6 5 12 26 46 131 Genotyped individuals affected by 8 11 3 5 2 4 3 9 20 27 92 BCSE Prevalence of BCSE (genotyped, %) 53.3 61.1 50.0 71.4 100 66.7 60.0 75.0 76.9 58.7 70.2 1Seven sires are present in more than one family (Family 1 to 8). This causes total values smaller than the sum of family sizes. Chapter 3. Whole genome scan 21
800 813 809 800 III VII
804 40 34 118 II
33 119 819
809 800 VI
78 810 806 41 37
767 303 87 31 25 477 801 802 801 787 VIII
782 27 807 48 43 55
802 79 800 26 V
86 115 125 51 338
821 804 818 802 808 800
353 805 116 114 106 800 71 332 IV
56 444 824 806 755 107 64 772
785 738 731 102 65
Male Fe m a le Affected No sam p le availab le Pedigree had to be splitted for statistic program
Figure 1 Family structure of eight maternal families (I-VIII) segregating for BCSE. The families are specified by Roman numerals. 22 Chapter 3. Whole genome scan
Genomic DNA from EDTA blood samples was extracted by using the QIAamp 96 Spin Blood Kit (Qiagen GmbH, Hilden, Germany). For hair specimen, the DNeasy® Tissue Kit (50) (Qiagen GmbH, Hilden, Germany) was used and for semen samples, the Nucleon BACC2-Kit for blood and cell cultures (Amersham Biosciences, Freiburg, Germany) was applied.
3.2.2 Marker selection and three step analysis For the whole genome scan we selected 164 highly polymorphic microsatellite markers from published bovine linkage maps to achieve a uniform coverage of all bovine autosomes. Markers with a reported low heterozygosity or an uncertain location on the bovine linkage map were not used. The 164 markers were evenly distributed over all bovine autosomes (Chapter 11, Figures 5 - 9) comprising 2808.9 cM with an average pair-wise distance of 19.9 cM. We used 5.7 markers per chromosome in the average. The marker set used for scanning the bovine autosomes is presented in Chapter 11 (Table 1). The whole genome scan included families 1 to 9. In the second step of the genome scan, six genomic regions located on six different chromosomes with error probabilities lower than p=0.1 for LOD scores were scanned with 30 additional microsatellite markers. In the average, the respective six chromosomes were now covered by 11 markers each with a mean pair-wise distance of 9.3 cM. The same families were used as in the whole genome scan. All additional markers employed for fine mapping are given in Chapter 11 (Table 2). In the third step, all markers showing significant linkage in step two were additionally genotyped for family 10. All PCR reactions were carried out in 12 µl reaction mixtures containing 2 µl genomic DNA (10 ng/µl), 1.2 µl 10x PCR buffer, 0.24 µ DMSO, 0.5 µl of each primer (10 pmol/µl), 0.2 µl dNTPs (5 mM each) and 0.1 µl Taq Polymerase (5 U/µl) (Qbiogene, Heidelberg, Germany). To increase efficiency, 102 primer pairs were pooled into PCR multiplex groups of two to five markers, and the 62 remaining primer pairs were amplified separately. One primer of each pair was endlabeled with fluorescent IRD700 or IRD800. For amplification, PTC 100™ or PTC 200™ thermal cyclers (MJ Research, Watertown, MA, USA) and a general PCR program with variable Chapter 3. Whole genome scan 23
annealing temperature (AT) were used. The reaction started with denaturing all samples at 94°C for 4 min followed by an empirically determined amount of cycles (32 to 37) comprising denaturation for 30 s at 94°C, annealing for 30 s at AT (52- 60°C) and extension for 45 s at 72°C. The PCR was completed with a final cooling at 4°C for 10 min. The multiplex groups and the separately amplified PCR products were pooled according to their size and labelling and diluted with formamide loading buffer in ratios from 1:3 to 1:50, that were determined empirically and carried out prior to electrophoresis. For the analysis of the marker genotypes, the PCR products were size-fractionated by gel electrophoresis on an automated sequencer (LI-COR 4200, Lincoln, NE, USA) using 6% polyacrylamide denaturing gels (Rotiphorese®Gel 40, Roth, Karlsruhe, Germany). Allele sizes were scored against IRD 700- and IRD 800-labeled DNA ladders used as standards on every gel. Alleles were assigned by visual examination.
3.2.3 Linkage analysis We performed a multipoint non-parametric linkage analysis by using the MERLIN Software Package version 0.10.2 (Abecasis et al. 2002). The linkage between the BCSE phenotype and markers was estimated through the proportion of alleles shared identical by descent (IBD) by affected animals (Kong and Cox 1997; Whittemore and Halpern 1994; Kruglyak et al. 1996). The Whittemore and Halpern NPL pairs statistics, the Zmean, p-values and the LOD scores according to Kong and Cox (1997) were employed for the chromosomewise search for allele sharing among affected family members. Prior to linkage analysis family 10 was splitted into two subfamilies, because the MERLIN program was not capable to manage its size.
3.3 Results
3.3.1 Quality of the used marker set The markers for the whole genome scan had a mean number of 5.9 alleles in our material. Compared with the published data, we observed fewer alleles. For eight markers however, the number of alleles counted was higher than in literature. The n n−1 n 2 2 p ∑ 2 p 2 ∑ i ∑ i p average polymorphism information content (PIC= 1-i=1 - i=1 j=i+1 j ) of this 24 Chapter 3. Whole genome scan set was 0.56 and the mean observed heterozygosity 0.60, so our marker set was highly informative and appropriate for linkage studies (Table 2). The heterozygosity of individual markers was ranging from 2% (BM741) to 88% (BSE1MS2). The PIC values per microsatellite showed a minimum of 2% (BM741) and a maximum of 82% (BM315). The PIC was higher than 50% in 110 markers (67.1%). Only ten markers (6.1 %) showed a PIC < 25% (Table 3). The highest average number of alleles was 8.3 for BTA 23 and the lowest one was 5.0 for BTA 7 and BTA 24 (Table 4). The mean observed heterozygosity ranged from 40.0 % (BTA 16) to 75.0 % (BTA 29) and the mean PIC value ranged from 37.0 % (BTA 16) to 69.0 % (BTA 18 and BTA 27). The highest average marker distance was reached on BTA 27 (29.2 cM) and the smallest one was calculated for BTA 26 (14.3 cM).
Table 2 Characteristics of the 164 bovine microsatellite markers on all 29 autosomes for families 1-9
Characteristic Mean Minimum Maximum Number of alleles (literature) 9.76 2 30 Number of alleles observed 5.91 2 13 Heterozygosity (literature) (%) 61.0 13.0 88.0 Heterozygosity (%) observed 60.0 2.0 88.0 Polymorphism information content (%) 56.0 2.0 82.0 Average distance between the markers (cM) 19.9 5.2 38.5
Table 3 Distribution of the polymorphism information content (PIC) for all markers of the genome scan for families 1 - 9 and in total. Family 10 was not used for the whole genome scan and was listed for comparison with values refering to the markers on chromosome 5 and 18
PIC1 (%) Percentage of markers per family (1-10) and in total 1 2 3 4 5 6 7 8 9 Total2 103 < 25 12.2 9.1 17.7 12.2 15.2 10.4 14.6 11.6 9.1 6.1 13.3 25 - 50 26.8 29.3 28.7 36.6 45.7 38.4 35.4 30.5 30.5 28.8 46.7 > 50 61.0 61.6 53.6 51.2 39.1 51.2 50.0 57.9 60.4 67.1 40.0 1Polymorphism information content (%) 2Total values for all markers of the whole genome scan respecting families 1 to 9 3Only for markers on bovine chromosome 5 and 18 Chapter 3. Whole genome scan 25
Table 4 The marker set with mean number of alleles, heterozygosity, PIC and marker distance per chromosome as well as chromosome size and number of markers Bovine Average Average Observed Average Average Chr. Number chromo- allele HET1 average PIC2 distance size of some number (literature) HET1 (cM) (cM)3 markers BTA 01 6.1 58.44 67.00 63.00 17.5 135.50 9 BTA 02 5.2 69.33 53.00 47.00 22.5 120.41 6 BTA 03 7.0 54.86 55.00 49.00 17.6 125.21 8 BTA 04 5.2 56.17 57.00 51.00 20.0 101.50 6 BTA 05 6.6 63.43 58.00 58.00 20.0 122.10 7 BTA 06 5.3 58.00 51.00 47.00 17.5 125.60 8 BTA 07 5.0 54.11 54.00 47.00 15.8 134.10 9 BTA 08 6.0 63.50 70.00 63.00 22.1 116.30 6 BTA 09 6.3 69.50 72.00 68.00 20.5 108.41 6 BTA 10 5.3 60.80 62.00 62.00 19.5 101.41 6 BTA 11 5.9 66.43 59.00 55.00 18.7 123.50 7 BTA 12 5.2 62.83 44.00 41.00 19.5 105.80 6 BTA 13 7.3 62.00 63.00 61.00 26.5 87.10 4 BTA 14 7.8 65.40 69.00 65.00 14.9 85.71 6 BTA 15 4.8 59.80 58.00 48.00 18.5 93.41 6 BTA 16 4.6 60.80 40.00 37.00 21.5 93.21 5 BTA 17 6.4 61.60 68.00 62.00 23.7 98.60 5 BTA 18 7.4 69.40 74.00 69.00 21.2 84.71 5 BTA 19 5.3 58.83 66.00 61.00 19.7 99.50 6 BTA 20 5.2 61.80 49.00 49.00 18.8 75.00 5 BTA 21 6.4 61.50 71.00 64.00 20.4 87.60 5 BTA 22 4.4 60.80 62.00 54.00 20.3 81.10 5 BTA 23 8.3 63.25 61.00 64.00 19.0 67.10 4 BTA 24 5.0 67.75 61.00 56.00 17.7 62.50 4 BTA 25 6.5 61.75 54.00 51.00 20.2 64.91 4 BTA 26 6.0 61.00 70.00 66.00 14.3 72.60 5 BTA 27 6.3 68.00 72.00 69.00 29.2 64.10 3 BTA 28 5.8 61.75 54.00 50.00 17.5 52.40 4 BTA 29 6.5 62.25 75.00 67.00 21.7 65.00 4 Average 6.0 62.20 61.00 57.00 19.9 94.98 5.7 1Heterozygosity (%) 2Polymorphism information content (%) 3Chromosome size (cM), MARC/USDA (www.marc.usda.gov) 26 Chapter 3. Whole genome scan
3.3.2 Whole genome scan In the first step of the whole genome scan, we detected six different putative genomic regions linked with the BCSE phenotype with error probabilities for LOD scores below or equal 0.1. All putative BCSE loci were located on different chromosomes. The loci were mapped on bovine chromosomes 5, 6, 8, 16,18, and 22 (Table 5).
Table 5 Chromosomal regions linked to BCSE with an error probability of ≤0.1 for the LOD score. LOD scores and Zmeans with error probabilities (p-values) are given
1 2 3 4 BTA Position (cM) Marker LOD score pL-value Zmean pz-value 5 34.7 OARFCB5 0.45 0.07 0.87 0.2 6 0.0 ILSTS093 0.35 0.1 0.77 0.2 8 76.7 HEL9 0.4 0.09 0.87 0.2 16 24.5 BM121 0.95 0.02 1.77 0.04 18 84.7 TGLA227 0.62 0.05 1.49 0.07 22 81.1 BM4102 0.37 0.1 0.6 0.3 1Bovine chromosome 2centi Morgan 3Error probability for the LOD score 4Error probability for the Zmean value
3.3.3 Mapping of putative BCSE loci with flanking markers Additional 30 markers were tested in family 1 to 9 in the second step. Significant linkage between BCSE and markers on chromsome 5, 16 and 18 was confirmed. The loci on all other chromosomes did not show significant linkage with BCSE. In a third step all markers on chromosomes 5, 16 and 18 were additionally tested in family 10. A linkage analysis for these markers regarding all families revealed a significant linkage for markers on chromosome 5 and also a significant linkage for markers on chromosome 18 (Tables 6 and 7). The putative QTL for BCSE on chromosome 16 was not longer confirmed. On BTA 5, the locations of the peaks for Zmeans and LOD scores differed between the families 9, 10 and 1 to 8. For family 9, the Zmean and LOD score peaked at the marker BMC1009 at 40.6 cM. In the families 1 to 8 and 10, the highest Zmean and LOD score were at BL23 at 28.6 cM. The most likely positions for the genes causing Chapter 3. Whole genome scan 27
BCSE are located on chromosome 5 between the markers BP1 and BL37 and on chromosome 18 in the neighbourhood of the markers TGLA227 and MS936FBN at about 84.7 cM (families 1 to 8 and 10), or near to the marker BM6507 at 78.9 cM (family 9). The 95% confidence interval on BTA 5 extends from 18.8 to 50.9 cM, on BTA 18 it ranges from 73.7 to 85.0 cM. The paternal half sib family including 16 affected descendants of one affected sire (family 9) was a highly informative pedigree. In this family, 11 siblings got the same haplotype for the linked markers on chromosome 5 from their sire. Only two half sibs (222, 287) did not show that specific haplotype (Figure 2). One sibling showed a recombination between the markers RM103 and BMC1009 and of the remaining two half sibs the inherited haplotype could not be defined. Haplotype analysis of the second genomic region for BCSE on the telomeric region of chromosome 18 revealed that 12 siblings got the same paternal haplotype, one showed a recombination between the markers BMS2785 and BM6507, two had the alternative haplotype (278, 535), and of one animal (280), the inherited haplotype could not be defined (Figure 2). In total, eight daughters inherited the susceptible haplotype on both chromosomes, five daughters on one of the both chromosomes and one animal (233) had a recombinant haplotype for both chromosomes. For three individuals (604, 566, 280) the inherited haplotype could not be determined for one chromosome but on the other chromosome these individuals showed the haplotype associated with BCSE. For family 9, the highest Zmean reached was 2.86 for 40.6 cM at BTA 5 and 3.53 for 78.9 cM at BTA 18 (Table 8 and 9). The second paternal half-sib family (family 10) included no genotyped dams for the 45 descendants of the common sire, but due to its size it is still a valuable family. The highest Zmeans reached for BTA 5 and BTA 18 were 2.94 at 28.6 cM and 0.79 at 84.7 cM, respectively (Table 8 and 9). The remaining eight families (families 1 to 8) were not as informative. Yet, they supported the results of the first two families with highest values at 40.6 cM for BTA 5 and at 84.7 and 85 cM for BTA 18 (Table 8 and 9).
3.4 Discussion
The linkage analysis based on IBD mapping showed the existence of two putative gene loci involved in the development of BCSE in cattle. These putative BCSE loci were located on the bovine chromosomes 5 and 18, respectively. The two loci were 28 Chapter 3. Whole genome scan
Table 6 Linkage analysis for families 1-10 for bovine chromosome 5, regarding Zmean, LOD score and error probabilities (p-values)
2 3 Marker Position Zmean pz-value LOD score pL-value (cM)1 max achievable 19.33 0.0 6.55 0.0 min achievable -3.5 1.0 -0.44 0.9 BMS1095 0.0 1.6 0.05 0.97 0.02 BMS6026 6.7 0.95 0.2 0.28 0.13 BMS695 9.0 1.06 0.14 0.48 0.07 BMS610 12.8 1.04 0.15 0.5 0.07 BP1 18.8 0.41 0.3 0.09 0.3 RM103 28.6 3.51 0.0002 1.72 0.002 BL23 28.6 3.53 0.0002 1.72 0.002 AGLA293 32.0 3.46 0.0003 1.71 0.002 BM1315 32.5 3.42 0.0003 1.7 0.003 OARFCB5 34.7 3.24 0.0006 1.6 0.003 ILSTS022 38.0 2.98 0.0014 1.35 0.006 BM321 38.0 3.01 0.0013 1.38 0.006 BMC1009 40.6 3.68 0.00012 1.8 0.002 BMS1898 44.1 3.17 0.0008 1.21 0.009 BL37 50.9 0.59 0.3 0.09 0.3 BL4 51.2 0.56 0.3 0.09 0.3 BMS1617 55.6 0.41 0.3 0.06 0.3 BMS1216 75.6 0.15 0.4 0.01 0.4 BM315 100.1 0.80 0.2 0.17 0.2 BMS597 120.0 0.19 0.4 0.05 0.3 1centi Morgan 2Error probability for the Zmean value 3Error probability for the LOD score
Chapter 3. Whole genome scan 29
Table 7 Linkage analysis for families 1-10 for bovine chromosome 18, regarding Zmean, LOD score and error probabilities (p-values)
2 3 Marker Position Zmean pz-value LOD score pL-value (cM)1 max achievable 19.54 0.0 6.58 0.0 min achievable -3.51 1.0 -0.44 0.9 IDVGA31 0.0 -1.27 0.9 -0.16 0.8 BMS2213 26.2 -0.69 0.8 -0.09 0.7 INRA63 48.7 -0.71 0.8 -0.08 0.7 BMS2639 57.0 -0.56 0.7 -0.07 0.7 IDVGA055 70.5 -0.13 0.6 -0.01 0.6 RME001 70.5 -0.12 0.5 -0.01 0.6 BMS2785 73.7 0.53 0.3 0.15 0.2 BMS2078 77.8 1.39 0.08 0.62 0.04 BMS6507 78.9 1.53 0.06 0.68 0.04 TGLA227 84.7 2.5 0.006 1.35 0.006 MS936FBN 85.0 2.49 0.006 1.34 0.007 1centi Morgan 2Error probability for the Zmean value 3Error probability for the LOD score
mapped on BTA 5 between the markers BP1 (18.8 cM) and BL37 (50.9 cM), and on the telomeric end of BTA 18 distally to the marker BM2785 (73.7 cM). Distl (1993) proved a single autosomal dominant major gene responsible for the phenotypic expression of BCSE, so it is possible that only one of the two chromosomes carries the gene causing BCSE. The second gene could influence the grade of BCSE or the age of onset. A possible indication for this theory can be found in the paternal half-sib families (families 9 and 10). While most of the animals of family ten showed an early onset of the eye defect with about three to four years, most of the progeny in family nine developed signs of BCSE not prior to an age of six years. The heterogenity of the LOD scores for BTA 18 between these two families may be caused by the different age of onset. So bovine chromosome 18 could harbour a gene suppressing the expression or delaying the onset of BCSE. 30 Chapter 3. Whole genome scan
When regarding all pedigrees, affected individuals carry marker alleles that are linked to BCSE on both chromosomal BCSE regions. However, 21 out of the 42 affected animals in the paternal half-sib families showed BCSE even if they got only one of the paternal haplotypes linked with BCSE. Therefore it could also be assumed, that one copy of a gene of these two independently acting gene loci would be sufficient for the development of BCSE. This latter hypothesis would rely on two dominantly acting genes whereby each locus can cause BCSE. However, these animals could also have inherited one or even both haplotypes causing BCSE from their dams as the phenotype of many dams could not be recorded. Even if the maternal phenotype is noted as negative for BCSE, the cow could have the susceptible genotype due to the sometimes very late onset of the disease. Thus, a digenic inheritance cannot be excluded. In that case, animals carrying only one of the putative BCSE genes would not inevitably show the defect, but play a role as carriers. The whole genome scan and the fine mapping were a first step towards the identification of genes responsible for BCSE in cattle. Differences regarding the Zmean, Lod score and p-values between the families may be caused by markers with different information contents for the respective families. That way, the most probable location for the gene causing BCSE can only be resolved by increasing the density of the markers used in these specific genomic regions. Since all sufficient informative microsatellite markers available on linkage maps were already included into this study, it is necessary to develop new markers in the identified regions. Very helpful tools in this respect are highly resolved comparative human-bovine maps. With the aid of these comparative human-bovine maps and the bovine EST sequences, orthologous bovine genes can be identified and then used for the development of new markers. The most abundant and useful markers for fine mapping are single nucleotide polymorphisms (SNPs). Development of SNPs requires sequencing of DNA for the respective genomic regions of the sires that are founders of the half-sib families and to identify heterozygous base pairs. After a heterozygous base pair is found, the whole half-sib family can be genotyped for this informative SNP marker. An alternative approach may be to choose candidate genes close to the markers linked with BCSE by means of comparative genetics. Positional candidate genes should be involved in the development of cranial nerves or eye muscles or should have been shown to be responsible for convergent strabismus in Chapter 3. Whole genome scan 31 other species. The identified region of BTA 5 is homologous to a region of about 50 Mb on centromeric HSA 12 (Everts-van der Wind et al. 2004; Liu et al. 2003). The region on BTA 5 is splitted into different separate sections of conserved synteny. As the breakpoints of these sections were not exactly defined so far, further refinements of the comparative map are necessary for a more precise identification of the syntenic human genome region. In total, three positional candidate genes were found in the corresponding human genome region spanning from 21.8 to 48.0 Mb. The peripherin gene (PRPH) encodes for a protein that occurs in the peripheral nervous system and neurons of mammals and the KCNJ8 gene encodes an ATP sensitive K+ channel (uKATP1). HSA 12p11 contains a further gene (MRPS35) with the basic function of biosynthesis of mitochondrial proteins and the ribosomal structure and biogenesis. The telomeric terminus of BTA 18 is homologous to the telomeric section of HSA 19 (Everts-van der Wind et al. 2004; Brunner et al. 2003). The respective region of BTA 18 is reported to be orthologous to HSA 19 with the same gene order as in human (Brunner et al. 2003) or hypothesised to be inverted at the distal section between 60.3 and 62.4 Mb (Everts-van der Wind et al. 2004). Thus, the gene order of the distal section of BTA 18 is not certainly defined so far. The KCNJ14 gene may be chosen as candidate gene from BTA 18. This gene is located on HSA 19 at 53.7 Mb. KCNJ14 encodes a K+ inward rectifier channel expressed predominantly in motoneurons of cranial nerve motor nuclei. The SLC27A5 gene, located at 63.7 Mb on HSA 19 may serve as a further candidate gene due to its location at the distal end of HSA 19. It encodes a protein, which is an isozyme of very long-chain acyl-CoA synthetase and acts as a fatty acid transporter. Fine mapping using SNP markers for all genes in the identified BCSE genomic regions should enable us to locate the responsible genes for BCSE. Then, genes with a perfect linkage with BCSE can be sequenced for the sires and their affected and non-affected daughters in order to detect consistent mutations with the aim to develop a direct gene test for BCSE. 32 Chapter 3. Whole genome scan
BMS2785 BM6507 TGLA227 MS936FBN 4 5 6 12 2 8 3 7 566 4 5 6 12 2 5 3 7 1 6 7 16 604 2 6 8 14 4 5 6 12 221 2 6 8 14 222 4 5 6 12 4 5 1 10 2 6 6 14 287 2 8 2 5 2 5 6 12 234 2 8 2 5 233 2 6 3 7 4 5 7 16 535 4 5 6 12 2 5 7 14 2 5 5 15 270 2 6 6 1 4 5 6 12 230 2 6 6 1 231 4 5 6 12 4 5 7 14 516 2 6 3 7 2 5 3 7 1 5 3 7 278 2 5 3 7 4 5 6 12 236 No sam ple available 2 5 3 7 1 5 6 12 235 4 6 3 7 4 5 6 12 307 4 6 3 7 82 4 8 10 1 4 5 6 12 4 5 6 12 279 2 6 3 7 Affec ted 1 3 7 1 280 2 5 6 12 4 5 6 12 255 2 5 6 12 2 6 3 7 256 2 5 7 1 4 5 6 12 635 Fe m a le 2 5 7 1 2 5 2 5 636 2 6 7 15 4 5 6 12 547 2 6 7 Male 15 4 5 6 12 548 1 2 6 3 7
Chapter 3. Whole genome scan 33
Table 8 Markers of bovine chromosome 5 showing highest test statistics itemised by families. Due to their small size, families 1 to 8 were analysed together
1 2 3 Family Marker Position (cM) Zmean pz-value LOD score pL-value 9 BMC1009 40.6 2.86 0.002 0.69 0.04 10 BL23 28.6 2.94 0.002 0.59 0.05 1-8 BMC1009 40.6 0.93 0.2 0.2 0.2 1centi Morgan 2Error probability for the Zmean value 3Error probability for the LOD score
Table 9 Markers of bovine chromosome 18 showing highest test statistics itemised by families. Due to their small size, families 1 to 8 were analysed together
1 2 3 Family Marker Position (cM) Zmean pz-value LOD score pL-value 9 BM6507 78.9 3.53 0.0002 0.77 0.03 10 TGLA227 84.7 0.79 0.2 0.44 0.08 1-8 TGLA227 84.7 0.93 0.2 0.31 0.12 MS936FBN 85.0 1centi Morgan 2Error probability for the Zmean value 3Error probability for the LOD score 34 Chapter 4. Chromosomal assignment of three genes
Chapter 4
Physical mapping of the KCNJ8, MRPS35 and PRPH genes on bovine chromosome 5 by fluorescence in situ hybridisation and confirmation by RH mapping Chapter 4. Chromosomal assignment of three genes 35
Physical mapping of the KCNJ8, MRPS35 and PRPH genes on bovine chromosome 5 by fluorescence in situ hybridisation and confirmation by RH mapping
4.1 Introduction
As potential candidate genes for bilateral strabismus with exophthalmus in cattle (BCSE), the potassium inwardly-rectifying channel, subfamily J, member 8 gene (KCNJ8), the mitochondrial ribosomal protein S35 gene (MRPS35) and the peripherin gene (PRPH) were selected. These three genes are coding for a K+ channel, mitochondrial protein synthesis and a nervous system protein, respectively. They were annotated to a region on human chromosome (HSA) 12 that has been shown syntenic to the genomic region on bovine chromosome (BTA) 5, which is linked to BCSE (Chapter 3). To confidently map these genes in the cattle genome, fluorescence in situ hybridisations (FISH) were carried out. All genes were mapped on BTA 5 and their positions were verified and refined by RH mapping.
4.2 Material and methods
4.2.1 Identification of BAC clones containing the genes High density BAC colony filters (Warren et al. 2000) were probed according to the CHORI protocols (http://bacpac.chori.org) with a heterologous 32P-labelled insert of a murine Prph cDNA clone (IRAKp961K19100) provided by the Resource Center/Primary Database of the German Human Genome Project (http://www.rzpd.de/) or with 32P–labelled specific bovine MRPS35 and KCNJ8 PCR products, respectively. Primers for MRPS35 (F 5’- TAA ACT TTC CAG TTT GAA TTT AG -3‘, R 5’- GTC TTG ATG GTA AGC ACA TC -3’) and KCNJ8 (F 5’-GCG CTT GTC AAT CAC ATG G-3‘, R 5’-CCT CTG CTT TCC TCT TCT C-3’) were designed on the basis of bovine EST sequences (GenBank accession nos. CB449694 and CB165999). For MRPS35, this sequence contained exon 6 of the MRPS35 gene and amplified a product of 102 bp on bovine genomic DNA. For KCNJ8, a product of 402 bp was amplified on bovine genomic DNA. Three bovine BAC clones 36 Chapter 4. Chromosomal assignment of three genes containing the PRPH, KCNJ8 and MRPS35 gene, respectively, were identified. BAC DNA was prepared from 100 ml overnight cultures using the Qiagen Midi plasmid kit according to the modified protocol for BACs (Qiagen, Hilden, Germany). BAC ends were sequenced using the ThermoSequenase Sequencing Kit (Amersham Biosciences, Freiburg, Germany) and a LI-COR 4200 automated sequencer (LI- COR, Inc., NE, USA). The BAC SP6 and T7 end sequences were deposited in the EMBL nucleotide database, and subjected to BLASTN analysis against build 34.3 of the human genome.
4.2.2 Fluorescence in situ hybridisation Bovine metaphase spreads for FISH on GTG-banded chromosomes were prepared using phytohemagglutinin stimulated blood lymphozytes. Cells were harvested and slides prepared using standard cytogenetic techniques. Prior to FISH the chromosomes were GTG-banded and well-banded metaphase chromosomes were photographed using a highly sensitive CCD camera and IPLab 2.2.3 (Scanalytics, Inc.). Identification adhered strictly to the ISCNDB 2000 classification (Cribiu et al. 2001). The BAC clones containing the bovine genes were labelled by nick translation using a Nick-Translation-Mix (Boehringer Mannheim Corp.). FISH on the GTG- banded cattle chromosomes was performed using 750 ng of digoxigenin labelled BAC DNA. As competitors in this experiment, 1 µg sheared total bovine DNA and 10 µg salmon sperm DNA were used. After hybridisation overnight, signal detection was performed using a Digoxigenin-FITC Detection Kit (Quantum Appligene, Heidelberg, Germany). The chromosomes were counterstained with DAPI and embedded in propidium iodide/antifade. Previously GTG-banded metaphase spreads were re- examined after hybridisation with a Zeiss Axioplan 2 microscope equipped for fluorescence.
4.2.3 Radiation hybrid (RH) mapping To confirm the cytogenetic assignment, the bovine BAC clones containing the respective genes were localised on the 3,000 rad Roslin/Cambridge bovine radiation hybrid panel (Williams et al. 2002), purchased from Research Genetics (Huntsville, Chapter 4. Chromosomal assignment of three genes 37
Ala., USA). PCR primers for RH mapping were designed basing on the BAC end sequences using the primer3 software (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi). For each pair of primers, two independent PCR reactions were carried out in a 20 µl reaction containing 25 ng of RH cell line DNA, 15 pmol of each primer and 0.5 U Taq polymerase (Qbiogene, Heidelberg, Germany). The reaction conditions started with a denaturing step at 94°C for 4 min followed by 35 cycles using the following conditions: denaturation for 30 s at 94°C, annealing for 60 s at the annealing temperature and extension for 40 s at 72°C. PCR was completed with a final cooling at 4 °C for 10 min. PCR products were separated on 1.5% agarose gels and presence or absence of a PCR signal was scored for each cell-line. The RHMAP3.0 package (Lange et al. 1995) was used for a two-point analysis against approximately 1,200 bovine markers typed previously on the panel (http://www.ri.bbsrc.ac.uk/radhyb) to localise the three genes.
4.3 Assignment of the KCNJ8 gene to bovine chromosome 5q3.2-q3.4
4.3.1 Description The potassium inwardly-rectifying channel, subfamily J, member 8 gene (KCNJ8), previously termed KIR6.1, maps to HSA 12p11.23 and encodes an integral membrane protein and inward-rectifier type potassium channel (Inagaki et al. 1995). The human gene consists of 3 exons spanning about 9.7 kb and the encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins (Inagaki et al. 1995). KCNJ8 is expressed preferentially in human heart muscle (Erginel-Unaltuna et al. 1998). Further studies including Kir6.1 knock out mice revealed a high rate of sudden death associated with spontaneous elevation on the electrocardiogram (Miki et al. 2002). Administration of vasoconstrictive agents to these KIR6.1 lacking mice leads to hypercontraction of the coronary arteries and thus a phenotype resembling variant angina in humans (Miki et al. 2002).
4.3.2 Isolation and characterisation of the bovine KCNJ8 clone We identified one BAC clone (RP42-124E12) containing the KCNJ8 gene. The BAC insert size of 170 kb was determined by pulsed-field gel electrophoresis. The RP42- 38 Chapter 4. Chromosomal assignment of three genes
124E12 SP6 and T7 end sequences were deposited in the EMBL nucleotide database under accession numbers AJ781388, and AJ781389, respectively. A BLASTN sequence comparison of the bovine SP6 BAC end sequence with the build 34.3 of the human genome sequence revealed a significant match (BLAST E-value 7e-46) over 252 bp (identity=85%) starting at 21,939,421 bp of HSA 12 approximately 130 kb downstream to human KCNJ8.
4.3.3 Fluorescence in situ hybridisation The KCNJ8 gene was located to BTA 5q3.2-q3.4 by examination of metaphase chromosomes of 40 cells (Figure 1). The number of cells with specific signals was 0 (1), 1 (1), 2 (8), 3 (10), 4 (20) chromatids per cell with no background signals.
4.3.4 Radiation hybrid mapping Primers for PCR amplification of a 494 bp fragment (F 5’-GAT TGT AAA TCC TCT GAA GAA TGT G-3’, R 5’-CGC ATT CAT GAA AAC TGT GG-3’) were designed for Rh mapping from the RP42-124E12 SP6 BAC end sequence (EMBL accession no. AJ781388). The primers were used at an annealing temperature of 60°C. The STS markers showed a retention frequency of 17% and the RH mapping revealed a close linkage to BM8230 (16.3 cR; LOD 11.97). The linked microsatellite marker had been previously mapped on BTA 5 by linkage mapping (Stone et al. 1995). The RH result confirms the result obtained by FISH.
4.3.5 Comment The physical assignment of the bovine KCNJ8 gene on BTA 5q3.2-q3.4 agrees with the comparative mapping data of the current bovine-human comparative map of BTA 5 RH map, which showed conserved synteny to centromeric HSA 12p (Liu et al. 2003). Chapter 4. Chromosomal assignment of three genes 39
Figure 1. Chromosomal assignment of the bovine KCNJ8 gene-containing BAC RP42-124E12 by FISH analysis. Double signals indicated by arrows are visible on both chromosomes BTA 5.
4.4 Assignment of the PRPH gene to bovine chromosome 5q1.4
4.4.1 Description The peripherin (PRPH) gene encodes for a 57 kD cytoskeletal protein that occurs in the peripheral nervous system and neurons of mammals and in cultured cells of neuronal origin (Portier et al. 1984). This protein is involved in mediating signal transduction and is a member of the transmembrane 4 superfamily, also known as the tetraspanin family, and was classified as a type III intermediate filament (Leonard et al. 1988). PRPH has been physically assigned to human chromosome 12q12-q13 (Moncla et al. 1992). A sustained over-expression of Prph provokes massive and selective degeneration of motor axons during aging in mice (Beaulieu et al. 1999). 40 Chapter 4. Chromosomal assignment of three genes
PRPH may play a role in the pathogenesis of amyotrophic lateral sclerosis in human (He and Hays 2004). This gene was selected as a candidate gene for BCSE, because alterations in peripheral neurons which supply eye muscles could cause a strabismus.
4.4.2 Isolation and characterisation of the bovine PRPH clone A bovine genomic BAC clone designated RP42-153B6 with an insert of approximately 195 kb containing the PRPH gene was identified. The BAC ends were sequenced and deposited in the EMBL nucleotide database (Accession nos. AJ781390 and AJ781391). BLASTN analysis of the SP6 BAC end against build 34.3 of the human genome revealed a significant match on HSA 12q, located approximately 110 kb proximal of the human PRPH gene (BLAST E-value 1e-60).
4.4.3 Fluorescence in situ hybridisation We assigned the bovine RP42-153B6 BAC clone containing the PRPH gene on BTA 5q1.4 (Figure 2) by FISH. In total, 40 cells were examined. The number of cells with specific signals was 2 (7), 3 (10) and 4 (23) chromatids per cell.
4.4.4 Radiation hybrid mapping A pair of bovine RH-primers (F 5’-GTT AAT GAT GGG TGG CTG CT-3’, R 5’-CAC CTT CAG TGT TGC TGG AA-3’) for PCR amplification to give a 717 bp fragment was designed based on the SP6 sequence of BAC clone RP42-153B6. The annealing temperature of these primers was 61°C. The retention frequency of the STS marker was 21%. Two-point analysis revealed total linkage of RP42-153B6 at a distance of 0.0 cR to the LALBA gene and close linkage to microsatellite marker CSSM034 at a distance of 16.6 cR. The corresponding LOD scores were 20.4 and 13.5, respectively. CSSM034 has been previously located on BTA 5 by linkage mapping (Moore et al. 1994) and in the human genome sequence build 34.3 the LALBA gene was annotated approximately 725 kb upstream to PRPH. Chapter 4. Chromosomal assignment of three genes 41
4.4.5 Comment The RH mapping results confirmed the results obtained by FISH and the assignment of the bovine PRPH gene on BTA 5q1.4 agrees with the comparative mapping data, which showed conservation of synteny to HSA 12q. The localisation corresponds well to the synteny data of the current bovine chromosome 5 RH map (Liu et al. 2003).
Figure 2. Chromosomal assignment of the bovine PRPH gene-containing BAC RP42-153B6 by FISH analysis. Double signals are visible on both BTA 5 as indicated by arrows on this part of a metaphase spread.
4.5 Assignment of the MRPS35 gene to bovine chromosome 5q3.1-q3.2
4.5.1 Description The mitochondrial ribosomal protein S35 (MRPS35) belongs to a group of 15 proteins present in mammalian mitochondrial 28 S subunits (MRPS22 through MRPS36) which are specific to mitochondrial ribosomes and help in protein synthesis within the mitochondrion (Cavdar Koc et al. 2001). Proteins in this group have no apparent homologs in bacterial, chloroplast, archaebacterial, or cytosolic ribosomes. The human MRPS35 gene consists of 8 exons spanning about 45.5 kb and was mapped on HSA 12p11, inferred following RH mapping (Kenmochi et al. 2001; NCBI 42 Chapter 4. Chromosomal assignment of three genes map viewer, human genome build 34.3). Pseudogenes corresponding to this gene are found on HSA 3p, 5q, and 10q (Zhang and Gerstein, 2003). The murine Mrps35 gene also consists of 8 exons and is located on mouse chromosome (MMU) 6G3 (NCBI map viewer, mouse genome build 32). Because of the possible involvement of mitochondrial ribosomal defects in human diseases we have started to characterise the MRPS35 gene also in cattle. This mapping report provides a basis for studying possible roles of MRPS35 defects in bovine mitochondrial disorders.
4.5.2 Isolation and characterisation of the bovine MRPS35 clone We identified one bovine genomic BAC clone (RP42-186J2) containing the MRPS35 gene. Pulsed-field gel electrophoresis prove a BAC insert size of 190 kb. The BAC SP6 and T7 end sequences were deposited in the EMBL nucleotide database under the accessions AJ781392 and AJ781393, respectively. Sequencing and BLASTN analysis of the T7 BAC end (AJ781393) revealed a significant match over 104 bp on HSA 12p11 that is located approximately 65 kb distal of the MRPS35 gene (BLAST E-value 6e-10).
4.5.3 Fluorescence in situ hybridisation The chromosomal location of the bovine MRPS35 gene on BTA 5q3.1-q3.2 was determined by FISH of the BAC clone RP42-186J2 to bovine metaphase chromosomes by examination of 30 cells (Figure 3). The number of cells with specific signals was 0 (0), 1 (0), 2 (2), 3 (4), 4 (24) chromatids per cell with no background signals. A total of 30 cells was examined.
4.5.4 Radiation hybrid mapping PCR primers for RH mapping were designed from the SP6 sequence of the BAC clone RP42-186J2 (F 5’- TCT GCA GCC TGT CAC ATA GC -3’; R 5’- ATA TCA CGA TGC TCC CGA AG -3’) to give a 530 bp fragment with an annealing temperature of 60°C. The STS marker showed a retention frequency of 13%. Two-point analysis revealed close linkage of MRPS35 to the BTA 5 marker BM8230 at a distance of 36.1 cR with a LOD score of 7.1. This RH result confirms the chromosomal location Chapter 4. Chromosomal assignment of three genes 43 obtained by FISH. The BM8230 microsatellite marker was previously mapped on BTA 5 by linkage mapping (Stone et al. 1995).
4.5.5 Comment The assignment of the bovine MRPS35 gene on BTA 5q3.1-q3.2 agrees with the comparative mapping data, which shows conserved synteny between BTA 5, HSA 12 and MMU 6 (Liu et al. 2003; Hayes et al. 2003).
Figure 3. Chromosomal assignment of the bovine MRPS35 gene by FISH analysis. The digoxygenin labelled bovine BAC RP42-186J2 containing the MRPS35 gene was hybridised on GTG-banded metaphase chromosomes of a normal cow. Double signals are visible on both BTA 5q3.1-q3.2 as indicated by white arrows. Black arrows indicate the same chromosomes after G-banding for chromosome identification. The chromosomes were counterstained with DAPI and propidium iodide and subsequently identified by GTG-banding and DAPI staining.
44 Chapter 5. Construction of a BTA 5 RH map
Chapter 5
A comparative radiation hybrid map of bovine chromosome 5q1.3-q2.5 with human chromosome 12q
Chapter 5. Construction of a BTA 5 RH map 45
A comparative radiation hybrid map of bovine chromosome 5q1.3-q2.5 with human chromosome 12q
5.1 Introduction
A gene locus for bilateral convergent strabismus with exophthalmus (BCSE) has been assigned to a region on bovine chromosome (BTA) 5 by using a whole genome scan (Chapter 3). The region was located between 18.8 (BP1) and 50.9 cM (BL37). Additionally, a putative quantitative trait locus (QTL) for ovulation rate was found on BTA 5 at a relative position of 40 cM (Kappes et al. 2000), a QTL for milk protein content (Bennewitz et al. 2003) was found at about 42.0 cM between the markers RM103 and CSSM34, and a QTL for birth and yearling weight at 50 cM was reported by Kim et al. (2003). Chowdhary et al. (1996) showed a synteny of a segment on BTA 5 to human chromosome (HSA) 12q by Zoo-FISH. Barendse et al. (2000) compared radiation hybrid and genetic linkage maps on bovine chromosome 5 regarding 17 loci and detected differences in the gene order between these maps. Multiple rearrangements between BTA 5 and the syntenic regions in the human and murine genomes were shown by Ozawa et al. (2000), who constructed a map of 54 markers covering BTA 5. The proximal BTA 5 contained five blocks of conserved synteny mapping to HSA 12q. Liu et al. (2003) created a comprehensive RH map including 88 markers spanning a region of 70 cM on BTA 5. This dense map of proximal BTA 5 revealed six new blocks of synteny on HSA 12 of a region between 43.4 Mb and 101.3 Mb. Larkin et al. (2003) constructed a comparative whole genome map by sequencing about 60,000 bovine BAC ends from 40,224 cattle BAC clones, of which about 400 were located on BTA 5. Using BLASTN, 29.4% and 10.1% significant hits were anchored to human and mouse genome sequences, respectively. A refined 5,000 rad whole genome cattle-human comparative map was constructed by Everts-van der Wind et al. (2004), in which a total of 103 sequence tagged site (STS) markers were positioned on BTA 5. The objective in this work was to further resolve the breakpoints of BTA 5q1.3-q2.5 in the human-bovine comparative map of BTA 5. 46 Chapter 5. Construction of a BTA 5 RH map
5.2 Material and methods
5.2.1 Selection of genes and primer design Based on the previous studies described above, which suggest that the BTA 5 region of interest between 12.8 and 74.0 cM is orthologous to regions on HSA 12q, nine human genes (APAF1, UBE2N, PPFIA2, GRP49, STAT2, OR6C1, KIAA0748, AAAS, KIF21A) were initially chosen from the published map of HSA 12 (NCBI map viewer build 35.1). These genes are situated at 97.8, 92.3, 80.2, 70.1, 55.0, 54.0, 53.6, 52.0 and 38.0 Mb on HSA 12q, respectively. We used the human reference mRNA sequences (NM_001160 for APAF1, NM_003348 for UBE2N, NM_003625 for PPFIA2, NM_003667 for GRP49, NM_005419 for STAT2, XM_372459 for OR6C1, XM_374983 for KIAA0748, NM_005615 for AAAS, NM_017641 for KIF21A) as query within BLASTN searches against bovine genome survey sequences. Thus we detected significant hits to end sequences of eight bovine BAC clones containing the respective genes APAF1, PPFIA2, GRP49, STAT2, OR6C1, KIAA0748, AAAS, and KIF21A (Table 1). For one gene (UBE2N) we used BLASTN against bovine expressed sequence tags, and MegaBLASTN against bovine whole genome shotgun sequences in the NCBI trace archive to obtain bovine sequences of these genes (Table 1). To create a denser map we chose 16 additional gene containing BAC clones already mapped on BTA 5 by Larkin et al. (2003), primer sequences from two genes (BI550285, ITGA7) previously mapped by Everts-van der Wind et al. (2004), one BAC clone previously mapped by Mömke et al. (2004), which contained the PRPH gene, and ten microsatellites (BP1, RM103, BL23, AGLA293, BMS1315, OARFCB5, ILSTS22, BMS321, BMC1009, BMS1898) from the bovine linkage map (Kappes et al. 1997) to obtain an average distance of about 1.6 Mb. Thus, we mapped a total of 38 markers (Figure 1) corresponding to the 38.0 – 97.5 Mb HSA 12q region (NCBI map viewer build 35.1) on the 3,000 rad Roslin/Cambridge bovine RH panel (Williams et al. 2002). The BAC end sequences and the gene sequences served as STS markers after pairs of primers for RH mapping were designed by using the primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) (Table 2). Chapter 5. Construction of a BTA 5 RH map 47
5.2.2 Radiation hybrid mapping All markers showed distinct bands of the appropriate size when tested on genomic bovine DNA, and they were localised on the 3,000 rad Roslin/Cambridge bovine RH panel (Williams et al. 2002) purchased from Research Genetics (Huntsville, AL, USA). PCR reactions were performed on 20 µl samples containing 25 ng of RH cell line DNA, 0.5 U of Taq polymerase (Qbiogene, Heidelberg, Germany) and a standard PCR program with 35 cycles and at an annealing temperature of 60 °C. PCR was carried out using PTC 200™ thermal cyclers (MJ Research, Watertown, MA, USA). Electrophoresis was carried out on ethidium bromide-stained 1.5% agarose gels. The gel was put under UV light after electrophoresis for analysis. The panel consisted of 94 hybrid cell lines. Genomic cattle DNA and genomic hamster DNA were amplified as positive and negative controls, respectively.
5.2.3 Statistical analysis The RH map was constructed using the RHMAP3.0 software package (Lange et al. 1995) with the programs RH2PT and RHMAXLIK. Initially, two-point analyses (RH2PT) were applied for data description, locus retention probabilities, maximum LOD scores, breakage probabilities, distance estimates and linkage groups with an LOD score threshold of 6.0. Subsequently a multipoint analysis (RHMAXLIK) was employed to determine the most probable locus order and intermarker distances. A framework map (ADDMIN = 2.0) was established. The comprehensive map of loci (ADDMIN = 0.0) was constructed by adding the remaining markers to the framework map. The marker positions were calculated by RHMAXLIK and confirmed by consideration of the maximum LOD scores of the two-point analysis.
5.3 Results
Seventy-eight (83.0%) of all cell lines were informative for mapping of the mentioned BTA 5 markers, and 1 (1.0%) was positive and 15 (16.0%) were negative for all 38 markers. The retention patterns were different for all markers. The mean retention fraction was 0.23 with a minimum of 0.11 (KIAA0748) and a maximum of 0.32 (ILSTS22). Two-point analysis revealed two linkage groups consisting of 25 and 13 linked markers, respectively, at a LOD score threshold of 6.0. At a LOD score threshold of 8.0, the largest linkage groups contained 14, 6 and 4 markers, respectively. 48 Chapter 5. Construction of a BTA 5 RH map
Each of the remaining nine groups contained one to three markers. In the framework map, the order of 34 markers was ascertained (GRP49, TRHDE, KCNC2, OSBPL8, SYT1, PPFIA2, BP1, KITLG, RM103, DCN, BL23, UBE2N, AGLA293, PLXNC1, BMS1315, HOXC9, BM321, AAAS, BMC1009, LOC283400, PRPH, PFKM, KIF21A, BI550285, CNOT2, HTG2, HMGA2, SRGAP1, STAT2, ITGA7, OR6C1, KIAA0748, SNRPF, APAF1). The remaining four markers were fitted into this map. To create the comparative map, the RH3,000 data of BTA 5 were aligned with the homologous regions of HSA 12 by using the human genome sequence information (NCBI map viewer build 35.1). The gene order observed in cattle displays four groups of conserved synteny with two inverted segments and three breakpoints in comparison to the human map. The breakpoints on BTA 5 are located between PLXNC1 and HOXC9, between KIF21A and BI550285 and between KIAA0748 and SNRPF. The first inversion is the section between HOXC9 and KIF21A, the second is between BI550285 and KIAA0748 (Figure 1). The mean marker distance calculated by RHMAXLIK is 3.5 cR, ranging from 0.9 cR (between AGLA293 and UBE2N) to 8.9 cR (between BMS1315 and OARFCB5). The entire RH3,000 map is 130.2 cR long. The region between BP1 and BMS1898 in the MARC linkage map spans 25.3 cM and corresponds to a region of 61.0 cR in our map. Therefore the total map length of the RH3,000 map corresponds to 53.8 cM on the linkage map. Using this relationship between the RH3,000 and the linkage map, our map shows an average ratio of 2.4 cR per cM and a mean marker density of 0.7 markers per cM in comparison with the same linkage map, but the ratio was not constant for all of the marker intervals.
5.4 Discussion
The present RH3,000 map affirms the comparative maps reported by Liu et al. (2003) and Everts-van der Wind et al. (2004). However, when we compared conserved segments of HSA 12 on the comprehensive RH3,000 map with the previously published bovine RH12,000 BTA 5 map of Liu et al. (2003), we found two differences in marker order and arrangement (Figure 1). First, we mapped the genes MYF6, PHLDA1 and NAV3 onto one conserved segment on proximal BTA 5, which maps to a region on HSA 12 spanning from 70.1 Mb (GRP49) to 93.0 Mb (PLXNC1), whereas Liu et al. (2003) assigned these genes to a region more distal on BTA 5 between IGF1 and RDH5. Chapter 5. Construction of a BTA 5 RH map 49
Second, we located the region between KIAA0748 (53.6 Mb) and BI550285 (69.1
Mb) on HSA 12 as one segment distal between KIF21A and SNRPF on the RH3,000 map. In contrast to the RH12,000 map, this section was a conserved and simply inverted segment in our map. When the present RH3,000 map was compared to that of Everts-van der Wind et al. (2004), no discrepancies were found regarding the conserved segments. We were able to confirm the marker order of these segments and enlarged the four blocks of synteny in this chromosomal region. By combining our mapping results with the map shown by Everts-van der Wind et al. (2004), the position of the three breakpoints in the region between 38.0 and 100.6 Mb of the HSA 12 map are narrowed down to 1.1 Mb on the average. The order of the microsatellite markers chosen is in agreement with the linkage map (Kappes et al. 1997). Furthermore, using the 3,000 rad Roslin/Cambridge bovine RH panel, we were able to define the locations of four markers which were not resolved in the linkage map. At the linkage map, RM103 and BL23 are both positioned at 28.6 cM, and ILSTS22 and BM321 are both at 38.0 cM. In our map, they are placed as follows: RM103 on 30.5 cR, BL23 on 33.5 cR, ILSTS022 on 61.7 cR and BM321 on 67.2 cR. Although different RH maps for BTA 5 have been previously published (Barendse et al. 2000; Ozawa et al. 2000; Liu et al. 2003; Everts-van der Wind et al. 2004), the breakpoints of the proximal part of BTA 5 in comparison to HSA 12 had not been precisely defined. In this study we constructed a high resolution comparative map of proximal BTA 5 to improve breakpoint resolution in the human-bovine comparative map. The comparative map of BTA 5 and HSA 12 presented here should lead to improvement of linkage analyses and the selection of candidate genes affecting BCSE and other traits that have been mapped on this bovine chromosome. 50 Chapter 5. Construction of a BTA 5 RH map
Table 1 Information for 26 sequence tagged site markers, including the assigned human gene with the location on HSA 12, accession number of the bovine sequence and bovine BAC clone, alignment start and E-value. Genes indicated by (N) were not identified in the bovine BAC clone, but are in close proximity
Gene symbol Gene location Acc. no1 Bovine BAC clone Alignment E-value (Mb) on HSA12 start (Mb) KIF21A 37.97 - 38.12 CC476878 CH240-302D10 38.02 2e-10 PFKM 46.79 - 46.83 BZ915352 CH240-57N14 46.81 8e-11 PRPH 47.98 AJ781390 RP42-153B6 47.87 1e-60 LOC283400 (N) 50.18 - 50.19 BZ933127 CH240-88E17 50.37 3e-04 AAAS 51.99 - 52.00 CC549058 CH240-433A8 51.99 8e-37 HOXC9 52.27 - 52.68 BZ914713 CH240-56G18 52.68 4e-23 KIAA0748 53.63 - 53.66 CC557138 CH240_465A3 53.64 4e-15 OR6C1 54.00 BZ873882 CH240_238B11 54.13 2e-24 STAT2 55.02 - 55.04 BZ930874 CH240-46D16 55.04 1e-58 LOC390334 57.73 - 57.74 BZ903249 CH240-24G6 57.74 7e-61 SRGAP1 62.52 - 62.82 BZ907521 CH240-31K19 62.70 2e-14 HMGA2 64.50 - 64.65 BZ918744 CH240-64C19 64.56 2e-21 HGT2 (N) 65.95 BZ943823 CH240-82I22 65.84 6e-06 CNOT2 68.93 - 69.03 BZ936581 CH240-87G22 69.03 7e-62 GRP49 70.12 - 70.26 CC498123 CH240_335O11 70.26 1e-145 TRHDE (N) 70.95 - 71.35 BZ930787 CH240-46B5 70.93 1e-19 KCNC2 73.72 - 73.89 BZ949531 CH240-38C21 73.80 4e-12 OSBPL8 75.25 - 75.45 BZ922352 CH240-120L2 75.28 3e-08 SYT1 (N) 78.08 - 78.35 BZ904331 CH240-25P12 77.80 7e-33 PPFIA2 80.16 - 80.66 BZ952508 CH240-45N12 80.18 5e-49 KITLG 87.39 - 87.48 BZ905609 CH240-27P14 87.42 3e-35 DCN 90.04 - 90.08 BZ929434 CH240-34B7 90.05 3e-11 UBE2N 92.30 - 92.34 TI4551626432 n.a. 92.31 1e-94 PLXNC1 93.04 - 93.20 BZ907479 CH240-31C23 93.13 1e-16 SNRPF (N) 94.76 BZ948751 CH240-36N21 94.70 5e-19 APAF1 97.54 - 97.63 BZ939205 CH240-105N22 97.63 7e-06 1Accession number of sequence matching to HSA 12 2Whole genome shotgun sequence, NCBI trace archive Chapter 5. Construction of a BTA 5 RH map 51
Table 2 Information for 26 sequence tagged site markers, including the assigned human gene, accession number of the bovine sequence, primer sequences and base pairs. Genes indicated by (N) were not identified in the bovine BAC clone, but are in close proximity
Gene symbol Acc. no1 Primers (forward/reverse), 5´ -> 3´ bp2 KIF21A CC476878 GGTGTCATGCTCCAGGGTAT 398 AGGGACTCAAAGCTCCAGGT PFKM BZ915270 GGACAGATCCAGGGCTCATA 353 CATGGCTATCCCCAGAAAAA PRPH AJ781390 GTTAATGATGGGTGGCTGCT 717 CACCTTCAGTGTTGCTGGAA LOC283400 (N) BZ933127 AAGGCCTGCTTAAGGGGTAG 490 TTGCCTCTGTTTTATGGGTTG AAAS CC549058 ATTTGGCCTCCAGAGTTCCT 179 AGTGGGATGTGGGTTTGGTA HOXC9 BZ914713 AAGGTCCCGAGGTCCTACC 232 ATTTCTTTGTGGAGCAGCAG STAT2 BZ930937 GCCTTGATCTTGCCACAAAT 408 CGGCAATGGATAATGGGATA KIAA0748 CC557138 TTCAAGACTTGGGTATATCTGACAAG 234 CCATGGGCAAGAAGGTTAAA OR6C1 BZ873882 GTGCTGTGTTGACCTTCATCAT 297 ATGCTTGCTTCACTTGCTTGT LOC390334 BZ903249 CCTCAGAAACATTTCAAGACCA 567 GGGAATTAGGCTGGATTAGGA SRGAP1 BZ907521 AGACACATCCCCATTGAGGT 460 GTGGTTTCCTTTGCTTGCTC HMGA2 BZ918677 TGAATTAAAGCCTTCAAAAATAGGA 462 TGTGACCACCATAACTTCCAGA HGT2 (N) BZ943823 CCATCCTATCATGAGCCCTTT 539 GTGGGGAGGTTGATCAGAAA CNOT2 BZ936657 TCCCCCTATAAACCAATCCTG 614 TTGTGCCTTCATGCATCATT GRP49 CC498123 TGGTGGCTCAGTGGTAAACA 369 TGCATTTCATGCCTTCATGT TRHDE (N) BZ930787 TTCCCCAAATCATCCTATTCA 399 TGGAAAATTCCCACAGAAGAG
52 Chapter 5. Construction of a BTA 5 RH map
Table 2 (continued)
Gene symbol Acc. no1 Primers (forward/reverse) , 5´ -> 3´ bp2 KCNC2 BZ949531 CCCTGAGAATGTTTATTTCATTTG 350 CTATCCCTCCGTTTCCCTTC OSBPL8 BZ922431 TGCTGTAAGAAACAAAATCTGGA 350 ACCTCGCTTCACAGGAGGTA SYT1 (N) BZ904404 GGGACAAGAGGGATGAGAAG 532 CAGCAGTCTCAAACGCATGT PPFIA2 BZ952508 TCCTCTTCCCCTTACATCCA 429 GGCCCAGGTAGGAAATTCA KITLG BZ905687 TCAATATAACCCAGTTCTTCTCCTTC 580 ATGATGCGGAGGTACTGACA DCN BZ929434 TTGACCTACAAGATGTTTGTTGAAA 596 GGCCGATCATAAGTACATCCA UBE2N TI4551626433 CAATGGCAGCCCCTAAAGTA 325 AGCCTGGATCGATAGCAGAA PLXNC1 BZ907479 CCAGGAGTTTAGGCATCCAA 581 AGATGAGGCGTCCACTGACT SNRPF (N) BZ948751 GGATGACTGATGAACTCATTTTGT 250 TGGGAAATGATTAAAGGTAGGC APAF1 BZ939287 TTCAAGTGTGTTGAGTTGTTCG 250 ATGGAGCACACACAGAACCA 1Accession number of BAC end sequence used for STS primer design. (Eight pairs of primers designed out of BAC end sequences shown in Table 1 failed to produce a product suitable for RH mapping and had to be replaced by adequate ones from the other end sequence of the same BAC clone.) 2PCR product size (base pairs) 3Whole genome shotgun sequence, NCBI trace archive
Figure 1 (next page) RH3,000 map of the studied section of BTA 5 aligned with linkage, RH5,000 and HSA 12 maps. The linkage map was drawn according to Kappes et al. (1997). Vertical lines in the linkage map indicate two markers located at the same position. In the RH3,000 map, framework markers are bold. The maps are compared to HSA 12 sequence (NCBI map viewer, build 35.1). The information for the RH5,000 map stems from the map reported by Everts-van der Wind et al. (2004). In the RH5,000 map, only the outermost markers of the particular conserved blocks are shown. Chapter 5. Construction of a BTA 5 RH map 53
(2004) 5 B et al. et C 034 F A254 M C1009 R L 4 37 STS022 STS066 M L L L L PPP1R12A BP1 BMS610 BL23 PDE1B UBE2N BMS1315 OA I B CSS COL2A1 BI550285 B B AG ITGA7 AA029694 I SYCP3 tel cen cR 46.3 54.9 96.3 148.5 104.5 118.4 132.8 140.9 147.9 156.8 163.1 201.6 209.4 215.8 303.4 302.8 305.0 308.8 327.35 rad 5,000 RH Everts-van der Wind Wind der Everts-van UBE2N CNOT2 COL2A1 APAF1 DCN KITLG PPFIA2 SYT1 OSBPL8 KCNC2 TRHDE BI550285 HGT2 HMGA2 SRGAP1 LOC390334 ITGA7 HOXC9 AAAS LOC283400 PFKM SYCP3 SNRPF PLXNC1 GRP49 STAT2 PDE1B PRPH KIF21A PPP1R12A AA029694 tel cen 54.053.6 OR6C1 KIAA0748 95.2 97.5 92.3 90.0 87.4 80.2 78.7 78.1 75.2 71.0 69.1 68.9 65.9 64.5 62.5 57.7 55.0 53.2 52.7 52.0 50.2 48.0 46.8 46.7 Mb 93.0 94.8 70.1 54.4 38.0 73.7 100.6 HSA 12, 12, NCBI HSA 35.1 build rad GRP49 (CH240-335O11) GRP49 TRHDE (CH240-46B5) (CH240-38C21) KCNC2 (CH240-120L2) OSBPL8 SYT1 (CH240-25P12) (CH240-45N12) PPFIA2 BP1 (CH240-27P14) KITLG RM103 (CH240-34B7) DCN BL23 UBE2N AGLA293 (CH240-31C23) PLXNC1 BMS1315 HOXC9 (CH240-56G18) ILSTS022 BM321 AAAS (CH240-433A8) BMC1009 LOC283400 (CH240-88E17) BMS1898 (RP42-153B6) PRPH (CH240-57N14) PFKM (CH240-302D10) KIF21A BI550285 (CH240-87G22) CNOT2 HGT2 (CH240-82I22) (CH240-64C19) HMGA2 SRGAP1 (CH240-31K19) LOC390334 (CH240-24G6) (CH240-46D16) STAT2 ITGA7 OR6C1 (CH240-238B11) (CH240-465A3) KIAA0748 (CH240-36N21)SNRPF (CH240-105N22) APAF1 OARFCB5 3,000 tel cen RH 0.0 4.1 6.0 7.6 11.8 16.6 20.8 30.5 37.4 38.3 39.8 43.8 24.4 32.3 33.5 52.7 58.0 61.7 67.2 72.8 76.6 78.8 81.8 83.7 86.9 94.3 97.4 98.1 cR 127.3 130.2 124.9 102.8 104.2 106.5 121.2 109.2 116.3 119.4 (1997) BMS610 MYF5 BP1 RM103 BL23 BMS1315 OARFCB5 ILSTS022 BMS321 BMC1009 BMS1898 BL37 BL04 IGF1 CSSM034 et al. tel cen 12.8 18.8 28.6 32.032.5 34.7 AGLA293 38.0 40.6 44.1 50.9 51.2 74.0 Kappes Kappes 45.1 Linkage cM
54 Chapter 6. Construction of a BTA 18 RH map
Chapter 6
A comparative radiation hybrid map of the telomeric region of bovine chromosome 18 to human chromosome 19q13 Chapter 6. Construction of a BTA 18 RH map 55
A comparative radiation hybrid map of the telomeric region of bovine chromosome 18 to human chromosome 19q13
6.1 Introduction
By using a whole genome scan (Chapter 3), a gene locus for bilateral convergent strabismus with exophthalmus (BCSE) has been assigned to the telomeric end of bovine chromosome (BTA) 18, distal to marker BM2078 at 77.8 cM. In addition, quantitative trait loci (QTL) for the somatic cell score (SCS) have been assigned to the telomeric end of BTA 18 in the neighborhood of the marker TGLA227 by three independent studies (Schrooten et al. 2000; Kühn et al. 2003; Schulman et al. 2004). At the same QTL position, a genomewide significant QTL for mastitis resistance was detected (Schulman et al. 2004). Human-bovine comparative maps can identify conserved chromosomal segments and improve their breakpoint resolution in order to facilitate selection of candidate genes for QTL. Synteny for the telomeric region of BTA 18 has been shown to the human chromosome (HSA) 19q (Chowdhary et al. 1996). Goldammer et al. (2002) constructed a comprehensive RH map of BTA 18 consisting of 103 markers and found several intrachromosomal rearrangements in comparison to the gene order of homologous human or mouse chromosomes. Brunner et al. (2003) refined this map and proved the high evolutionary conservation of the telomeric end of BTA 18 with a single segment of HSA 19q. Everts-van der Wind et al. (2004) constructed a 5,000 rad RH map of the entire cattle genome, expanding the whole genome RH map of Band et al. (2000) to a total of 1,463 markers that showed significant BLASTN hits (E < e-5) against the human genome sequence. They showed two blocks of conserved synteny when comparing telomeric BTA 18 and HSA 19q. Our objectives were to extend the human-bovine comparative map of the telomeric region distal to 70 cM, near the previously mapped BCSE locus on BTA 18 and to identify possible unknown chromosomal breakpoints or rearrangements.
6.2 Material and methods
6.2.1 Selection of genes and primer design In total, we mapped 20 markers on the 3,000 rad bovine whole-genome 56 Chapter 6. Construction of a BTA 18 RH map
Roslin/Cambridge RH panel (Williams et al. 2002). We used five previously published BTA 18 microsatellites: BMS2785, BM2078, BMS6507 and TGLA227 (Kappes et al. 1997) and MS936FBN (Brunner et al. 2003). The bovine STS primers for eight HSA 19 genes (CD37, NKG7, LIM2, TNNT1, RPL28, ZIM2, STK13 and ZNF132) were taken from Everts-van der Wind et al. (2004). The remaining 7 markers were gene- associated sequence agged site (STS) markers developed either from end sequences of BAC clones containing the genes KCNJ14, SLC27A5, MGC2705, EPN1 and ZNF582 from the corresponding region on HSA 19q or derived from bovine gene specific whole genome shotgun sequences (BAX and PRKCG). The selected 15 genes are located at the 53.7 - 63.7 Mb region of HSA 19q (NCBI map viewer build 35.1) and were nearly equally distributed with a mean distance of 0.7 Mb. The calculated RH map was anchored to BTA 18 by fluorescence in situ hybridisation (FISH) analysis of each one BAC clone located at the distal and proximal ends of the region mapped. Using human reference mRNA sequences of five genes (Acc. nos. NM_138764 [Bax], NM_002739 [PRKCG], NM_032701 [MGC2705], NM_013333 [EPN1] and NM_144690 [ZNF582]), BLASTN searches were performed against the bovine genomic survey sequence division at NCBI, or against bovine expressed sequence tags with following MegaBLAST against Bos taurus whole genome shotgun sequences in the NCBI trace archive (Table 1). That way, we detected significant hits (E-value < e-5) to end sequences of three bovine BAC clones
Table 1 Significant (E-value < e-5) and unique BLAST matches of bovine sequences against human genomic sequences (build 35.1).
Locus Bovine BAC clone Bovine sequence Position on Alignment E- accession HSA 19 (Mb) start (bp) value KCNJ14 RP42-397O7 AJ783716 53.65 - 53.66 53,797,584 3e-11 BAX NCBI trace archive TI3952095361 54.15 - 54.16 54,150,616 6e-97 PRKCG NCBI trace archive TI4017665221 59.08 - 59.10 59,101,767 3e-69 MGC2705 CH240-110G13 BZ911838 60.54 - 60.55 60,550,689 2e-26 EPN1 CH240-73L3 BZ926226 60.88 - 60.90 60,895,099 2e-19 ZNF582 CH240-97M15 BZ955909 61.59 - 61.60 61,587,140 2e-18 SLC27A5 RP42-155H10 AJ783719 63.70 - 63.72 63,701,694 5e-30 1 Whole genome shotgun sequence Chapter 6. Construction of a BTA 18 RH map 57 of the bovine CHORI-240 BAC library (Table 1; MGC2705: CH240-110G13, EPN1: CH240-73L3, ZNF582: CH240-97M15).
6.2.2 Isolation of two BAC clones by radioactive hybridisation To screen the bovine RPCI-42 BAC library (Warren et al. 2000) for BAC clones containing the KCNJ14 and SLC27A5 genes, we hybridised the high-density BAC colony filters with 32P-labelled inserts of the respective human IMAGE cDNA clones (IRAKp961D1253 and IMAGp998D194497, respectively) provided by the German Human Genome Resource Center/Primary Database (http://www.rzpd.de/) according to the RPCI protocols (http://bacpac.chori.org). For the bovine KCNJ14 gene, the genomic bovine BAC clone RP42-397O7 with an insert size of 195 kb was identified and the 240 kb BAC clone RP42-155H10 was isolated for the bovine SLC27A5 gene. BAC clone DNA was isolated using the Qiagen plasmid midi kit (Qiagen, Hilden, Germany). BAC ends were sequenced using the ThermoSequenase Sequencing Kit (Amersham Biosciences, Freiburg, Germany) on a LI-COR automated sequencer (LI- COR, Inc., Lincoln, NE, USA). The RP42-397O7 and RP42-155H10 SP6 and T7 end sequences were deposited into the EMBL nucleotide database under accession numbers AJ783716, and AJ783717, and AJ783718, and AJ783719 respectively. A BLASTN sequence comparison of the generated bovine BAC end sequences to the build 35.1 of the human genome sequence revealed significant matches to the telomeric segment of the HSA 19 sequence (Table 1).
6.2.3 Chromosomal location The bovine BAC clones for KCNJ18 and SLC27A5 were labelled with digoxygenin by nick translation using a nick-translation mix (Boehringer Mannheim, Mannheim, Germany). FISH on GTG-banded cattle chromosomes was performed using 750 ng of digoxigenin-labelled BAC DNA. 1 µg sheared total bovine DNA and 10 µg salmon sperm DNA were used as competitors in this experiment. After hybridisation overnight, signal detection was performed using a Digoxygenin-FITC Detection Kit (Quantum Appligene, Heidelberg, Germany). The chromosomes were counterstained with DAPI and embedded in propidium iodide/antifade. Metaphases previously photographed with a highly sensitive CCD camera were re-examined after hybridisation with a Zeiss Axioplan 2 microscope (Zeiss, Jena, Germany) equipped for fluorescence. Identification of chromosomes strictly followed the international 58 Chapter 6. Construction of a BTA 18 RH map system for chromosome nomenclature of domestic bovids ISCNDB 2000 (Cribiu et al. 2001). We used metaphase chromosomes from an average of 32 examined cells to locate the bovine genomic BAC clone RP42-397O7 containing the KCNJ14 gene to BTA 18q25, and the bovine genomic BAC clone RP42-155H10 containing the SLC27A5 gene to BTA 18q26 (Figure 1).
6.2.4 Radiation hybrid (RH) mapping We analysed the 3,000 rad Roslin/Cambridge bovine RH panel (Williams et al. 2002) purchased from Research Genetics (Huntsville, AL., USA). STS primers for RH mapping were designed using the primer3 software (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi) (Table 2). PCR was carried out in a 20 µl reaction mixture containing 25 ng of RH cell line DNA, 15 pmol of each primer and 0.5 U Taq polymerase (Qbiogene, Heidelberg, Germany). The reaction started with denaturing at 94 °C for 4 min and subsequently 35 cycles were performed under the following conditions: denaturation for 30 s at 94 °C, annealing for 60 s at 60 °C and extension for 40 s at 72 °C. The PCR was completed with a final cooling at 4 °C for 10 min. PCR products were separated on a 1.5% ethidium bromide-stained agarose gel.
6.2.5 Statistical analysis After scoring positive signals the RHMAP3.0 package (Lange et al. 1995) was used for the construction of the RH map. First, a two-point analysis (RH2PT) was applied for data description, two-point distance calculation and definition of linkage groups by using a LOD score threshold of 8.0. The most probable locus order and intermarker distances were determined by using a multipoint analysis (RHMAXLIK). The ordering strategy used was the stepwise locus ordering under the equal retention probability model. After establishing a framework map (ADDMIN=2.0), we determined the most probable location of the remaining markers by restricting the data according to the framework locus order to produce a comprehensive map of loci (ADDMIN=0.0).
6.3 Results
On 41 (42.7 %) cell lines at least one marker showed a positive signal. The remaining 53 (57.3 %) were negative for all markers. The retention patterns were different for 15 markers. The three markers TNNT1, MGC2705 and RPL28 as well as Chapter 6. Construction of a BTA 18 RH map 59
Table 2 Primer sequences, product size and annealing temperature for each sequence tagged site marker, developed out of one end sequence of the gene-containing BAC clone.
Locus Bovine sequence accession Primers (forward/reverse), 5´ -> 3´ bp1 AT2 KCNJ14 AJ783716 GCTTCCTGGATTCGAGAGTG 239 60 CAGTGAAACTGACCCCAGGT BAX TI395209536 CTGAGCAGATCATGAAGACAG 216 60 GTCCAATTCATCTCCGATGC SLC27A5 AJ783718 TTCCACTTTCAGAGGTCCTG 299 58 GCTCATGTTCTGTGGAAACC MGC2705 BZ911838 CTTGCCTTCACCCCCTTCT 367 61 CTCAGGGATCAGCAGTCACA PRKCG TI|401766522 GGACAGGCTGGAACGATTAG 202 60 GGAACTCAGCCTGGTCGAT EPN1 BZ926226 CTCAGGCTGCTGATCCTTG 228 61 AGGGGGTCTCACCATCAGAG ZNF582 BZ955980 GAG GAT GTG GTG GGT TAT GG 468 60 GCA ATC GGA AGA CAA GGG TA 1Product size in base pairs 2Annealing temperature
the two markers NKG7 and LIM2 had identical retention patterns, respectively. The retention fraction ranged from 0.17 (CD37) to 0.27 (EPN1) and was 0.21 on average. Using two-point analysis, we assigned all 20 markers into a single linkage group at a LOD score threshold of 8.0. Using the framework option, the order of 15 markers (KCNJ14, BAX, CD37, NKG7, LIM2, PRKCG, TNNT1, MGC2705, RPL28, EPN1, BM6507, ZNF582, ZIM2, STK13 and SLC27A5) could be ascertained and formed the scaffolding. Altogether we assigned all 20 bovine markers, five microsatellites and 15 bovine STS markers, into a single comprehensive map (Figure 2). The marker distance ranged from 0.3 cR (between KCNJ14 and BAX, PRKCG and BM2078) to 4.5 cR (between EPN1 and BM6507), and was 1.1 cR on average. The total length of the present RH3,000 map is 20.9 cR, with 19.4 cR corresponding to 11 cM. Thus the total length corresponds to approximately 11.9 cM on the bovine MARC linkage map 60 Chapter 6. Construction of a BTA 18 RH map
(Kappes et al. 1997). When this relationship between the RH and the linkage maps is used, the mean marker density is 1.7 markers per cM and 1.8 cR in our physical map correspond to one cM in the bovine linkage map.
6.4 Discussion
The order of the four common microsatellites is identical between the linkage map, the RH3,000 map reported by Williams et al. (2002) and the present RH3,000 map. In addition, the microsatellite markers BMS2785 and TGLA227 assigned on the RH5,000 map by Goldammer et al. (2002) and Everts-van der Wind et al. (2004) show the same order when compared with the present RH3,000 map. In contrast to our results, Goldammer et al. (2002) and Everts-van der Wind et al. (2004) mapped the microsatellite BM2078 distally to BMS6507, which suggests an inverse arrangement of these two microsatellites in comparison to the present RH map and the bovine linkage map. The microsatellite marker MS936FBN was assigned proximal to BM6507 by Goldammer et al. (2002) and distal to TGLA227 by Brunner et al. (2003). In our map the marker MS936FBN was located slightly distal to TGLA227. Everts- van der Wind et al. (2004) described an inversion of the distal region of BTA 18 starting at about 60.3 Mb of HSA 19q on the distal end of the bovine chromosome. This inversion was not confirmed in our map, in which the marker order was orthologous to that of distal HSA 19q. The RH mapping results indicate that the most likely gene order in cattle is KCNJ14 - BAX - CD37 - (NKG7 - LIM2) - PRKCG - (TNNT1 - MGC2705 - RPL28) - EPN1 - ZNF582 - ZIM2 - STK13 - ZNF132 - SLC27A5, which completely corresponds to the human gene order on the homologous segment of HSA 19q and thus suggests the conservation of synteny between cattle and humans for this 10 Mb chromosomal region. Furthermore, we may assume that the telomeric end of BTA 18 between 73.7 cM and 84.7 cM does not harbour breakpoints in the human-bovine comparative map. Therefore, these data increase the number of genes known to be positioned on the telomeric end of BTA 18 and this further refinement of the human-bovine comparative map should lead to improvements in the fine mapping of BCSE, SCS and mastitis QTL by making it possible to select suitable positional candidate genes in cattle. Chapter 6. Construction of a BTA 18 RH map 61
Figure 1 (A) Chromosomal assignment of the bovine KCNJ14 gene-containing BAC RP42- 397O7 by FISH analysis. Double signals indicated by arrows are visible on both chromosomes BTA 18q25. (B) Chromosomal assignment of the bovine SLC27A5 gene-containing BAC RP42- 155H10 by FISH analysis. Double signals indicated by arrows are visible on both chromosomes BTA 18q26.
A B
Figure 2 (next page) Generated RH3,000 map of the BTA 18 telomere in comparison to the telomeric BTA 18 linkage map (Kappes et al. 1997), the genome sequence of
HSA 19q (NCBI map viewer build 35.1) and an extraction of the RH5,000 map (Everts- van der Wind et al. 2004). Framework markers on the RH3,000 map are in boldface.
The location of the marker BMS2785 was taken from the RH3,000 map of Williams et al. (2002) and all distances of the newly mapped loci were referred to this location of BMS2785. In the map of Everts-van der Wind et al. (2004), the gap indicates the beginning of a different linkage group. Vertical lines in the maps indicate two markers located at the same position and microsatellites are italicised. 62 Chapter 6. Construction of a BTA 18 RH map
(2004) et al. et 6507 S2785 2078 M M M ZNF132 B PLAUR IDVGA55 NKG7 CD37 STK13 PTPRH RPL28 ZIM2 TNNT1 B TGLA227 B tel cen rad 0.0 6.9 cR 26.2 29.3 23.5 22.2 49.0 19.7 130.3 BAX 128.4 155.0 LIM2 181.7 73.0 161.7 75.3 5,000 Everts-van der Wind Wind der Everts-van RH ZNF132 CD37 KCNJ14 BAX NKG7 LIM2 MGC2705 EPN1 ZNF582 ZIM2 STK13 SLC27A5 RPL28 PLAUR TNNT1 PRKCG tel cen 59.1 63.6 60.6 60.5 60.3 48.8 53.7 56.6 60.9 61.6 63.7 62.0 62.4 54.5 54.5 54.2 Mb HSA19, NCBI build 35.1 build NCBI HSA19, LIM2 MS936FBN MGC2705 (CH240-110G13) (CH240-110G13) MGC2705 RPL28 (CH240-73L3) EPN1 (CH240-97M15) ZNF582 STK13 TGLA227 ZNF132 (RPCI42-155H10) SLC27A5 BMS2785 BAX CD37 NKG7 BM2078 ZIM2 TNNT1 BM6507 KCNJ14 (RPCI42-397O7) KCNJ14 PRKCG rad tel cen 3,000 cR RH 153.8 143.0 144.1 144.4 145.5 146.9 150.3 150.6 151.0 158.3 160.0 161.4 162.0 162.4 162.8 163.3 163.9 (1997) IDVGA55 RME01 BMS2785 UWCA5 BM2078 EAC BM6507 TGLA227 et al. tel cen Linkage map Linkage cM Kappes Kappes 70.5 73.7 77.8 78.9 84.7 Chapter 7. Fine mapping 63
Chapter 7
Fine mapping of two gene loci on bovine chromosomes 5 and 18 responsible for bilateral convergent strabismus with exophthalmus in German Brown cattle 64 Chapter 7. Fine mapping
Fine mapping of two gene loci on bovine chromosomes 5 and 18 responsible for bilateral convergent strabismus with exophthalmus in German Brown cattle
7.1 Introduction
Congenital bilateral convergent strabismus with exophthalmus (BCSE) has been reported in many cattle populations. Affected animals show a bilateral symmetrical protrusion of the eyeballs associated with an anterior-medial rotation of the eyes. A previously accomplished linkage analysis revealed two genomic regions on bovine chromosomes (BTA) 5 and 18 significantly linked to the BCSE phenotype (Chapter 3). The objective of the present study is to develop dense marker maps for the genomic regions on BTA 5 and BTA 18 harbouring the genes responsible for BCSE and to employ these newly developed markers for a non-parametric linkage analysis with BCSE. Bovine BAC end sequences mapped on BTA 5 and BTA 18 by BLASTN sequence comparisons to corresponding human chromosomal sequences were used to develop new microsatellites as well as single nucleotide polymorphisms (SNPs). The families used for subsequent genotyping of the additional markers included two paternal half-sib groups descending from affected sires (Chapter 3).
7.2 Material and methods
7.2.1 Pedigree material For the linkage analysis we used DNA from 72 animals belonging to two paternal half-sib families whose sires were affected by BCSE. In total, these families included 124 individuals of which 72 were available. Of the genotyped animals, 65.3 % showed the BCSE phenotype. Family 1 consisted of the affected sire, 16 affected daughters and 9 available dams. Family 2 included the affected sire with 26 affected and 19 non-affected daughters.
7.2.2 Search for microsatellite markers in published BAC-end sequences As an approach towards the detection of new microsatellite markers, we scanned Chapter 7. Fine mapping 65
BAC-end sequences previously located on BTA 5 and 18 by Larkin et al. (2003) for short tandem repeats. The respective BACs were chosen due to their close chromosomal location that we found to be linked with BCSE. Microsatellites were identified by using the Repeat Masker searching tool for repetitive elements (http://repeatmasker.genome.washington.edu/). Repeat flanking single copy sequences were used to design primer pairs for the microsatellite amplification by using the Primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Microsatellites were amplified using a 12 µl reaction mixture containing 20 ng genomic DNA, 2 % DMSO, 5 pmol of each primer, 5 mM of each dNTP and 0.5 U Taq polymerase (Qbiogene, Heidelberg, Germany). One of each pair of primers was end-labeled with fluorescent IRD 700 or 800. The reaction started with denaturing all samples at 94°C for 4 min followed by 35 cycles comprising denaturation for 30 s at 94°C, annealing for 30 s at AT (58-60°C) and extension for 45 s at 72°C. The PCR was completed with a final cooling at 4°C for 10 min. After addition of formamide loading buffer for dilution the amplified fragments were electrophoresed on 6% denaturing polyacrylamid gels with a LI-COR 4200 automated sequencer and scored by visual examination.
7.2.3 Development of microsatellites from bovine BAC clones For the development of microsatellites, four bovine genomic BAC clones previously mapped on the 3,000 rad Roslin/Cambridge RH panel (Chapter 5 and 6) were obtained from BACPAC Resources, CA, USA (http://bacpac.chori.org/). These BACs were chosen due to their positions close to the chromosomal locations that showed close linkage to the BCSE phenotype in a whole genome scan (Chapter 3). Two bovine BAC clones (RP42-397O7 and RP42-155H10) were chosen from the BTA 18
RH3,000 map (Chapter 6) and further two BAC clones (CH240-34B7, CH240-433A8) were chosen from the BTA 5 RH3,000 map (Chapter 5). DNA was isolated from all four clones using the Qiagen plasmid midi kit (Qiagen, Hilden, Germany). BAC DNA of one clone (RP42-397O7) was mechanically sheared to obtain fragments of approximately 2 kb. Sheared BAC DNA was used to construct a shotgun plasmid library. Plasmid subclones were sequenced with the ThermoSequenase Sequencing Kit (Amersham Biosciences, Freiburg, Germany) and a LICOR 4200 automated sequencer (LI-COR, Inc., Lincoln, NE, USA). The BAC clones CH240-34B7, CH240-433A8 and RP42-155H10 were digested with 66 Chapter 7. Fine mapping
Table 1 Twelve newly developed microsatellite markers on BTA 5 and BTA 18. The microsatellites of both chromosomes are given with the corresponding accession numbers (if existent), repeat motif, observed heterozygosity, polymorphism information content (PIC) and observed number of alleles
Marker BTA1 Acc. No.2 Repeat motif HET3 PIC4 A5
MS_DCN 5 BZ937943 (TA)17 interrupted 31.6 27.7 2
MS_UBE2N 5 BZ948751 (TG)7 + (TG)7 0 0 1
MS_COL2A1 5 BZ908733 (TA)19 36.4 29.4 4
MS_LYZ 5 BZ951574 (AC)49 interrupted 0 0 1
MS_MYF 5 BZ940219 (CA)12 0 0 1
MS_433S15 5 (TGGGG)5 0 0 1
MS_APOE 18 BZ946553 (CA)13 23.8 23.9 2
MS_397O7 18 (CA)15 + (CA)17 0 0 1
MS_397O7_2 18 (GA)32 0 0 1
MS_CD79 18 BZ956413 (TGAA)10 interrupted 0 0 1 1Bovine chromosome 2Accession number 3Observed heterozygosity (%) 4Polymorphism information content (%) 5Observed number of alleles
the restriction enzymes Sac I and Xba I. The resulting fragments were separated on ethidium bromide-stained 0.6% agarose gels for five hours at 100 V and subcloned into the polylinker of pGEM4-Z (Promega, Mannheim, Germany). After this, they were transformed into XL1-Blue competent E. coli and plated on LB-ATX selective plates. Single white E. coli colonies were picked from each agar plate and inoculated into 5 ml LB medium containing tetracyclin and ampicillin. After 12 hours recombinant plasmid DNA was isolated and prepared for sequencing on a LI-COR 4200 automated sequencer (LI-COR, Inc., Lincoln, NE, USA). Sequencing reactions were carried out using the ThermoSequenase Sequencing Kit (Amersham Biosciences, Freiburg, Germany). A BLASTN search was performed against the human genome for all newly generated sequences. Significant hits were obtained for all sequences for the expected syntenic regions on HSA 12 and 19, respectively. The search for microsatellite markers, PCR reactions and genotyping of the microsatellites was carried out as described above. Chapter 7. Fine mapping 67
Table 2 All newly developed microsatellite markers on BTA 5 and BTA 18. The microsatellites of both chromosomes are given with the corresponding primer sequences, product size and annealing temperature.
Marker BTA1 Primers (forward / reverse), 5´ -> 3´ bp2 AT3 MS_DCN 5 AGAGTCAGACAGAACTGAGCAGA 242-248 59 TCACTTTGCTGTGCACTTGA MS_UBE2N 5 GGATGACTGATGAACTCATTTTGT 324 59 TGGGAAATGATTAAAGGTAGGC MS_COL2A1 5 ACGTCCATTGAGCCAGTGAT 145-211 60 TAGGGCACACGAATTTTATTAGC MS_LYZ 5 GAGCTGGCCTGAAAAGATT 226 58 ACCAAAGGGTGTGTGTATGTG MS_MYF 5 CTTAGCACAGCCCAAGAGAG 182 58 TTTTATGCTAATGATTTTGAAACAA MS_433S15 5 CAGTCTGCTACTGGGTGGAC 196 58 CATGTTTGCATCATGCTCTC MS_APOE 18 TGTTGTCATGGAAACCACAG 148-150 58 ATAGGCATGTATGTGTGTGTGTG MS_397O7 18 TTCCATCTAGTGATGTGTCTCTATTTC 149 60 TCCATTCCACTTCCTCAAGC MS_397O7_2 18 AATACAGGCGGACACACACA 250 60 ATGGTGTGTACCTGGGCTCT MS_CD79 18 AAATTTATGGAAGAATAAAGTGAATGA 196 58 GGTCCCTTTATTCATTCATTCA 1Bovine chromosome 2Product size (basepais) 3Annealing temperature (°C)
7.2.4 Microsatellite marker analysis We were able to identify six new microsatellites on BTA 5 and four new microsatellites on BTA 18 (Table 1 and 2). Out of the 10 microsatellites, eight consisted of dinucleotide repeats and two showed repeats of four and five nucleotides, respectively. Two of the microsatellites were composed of two repeats and three were multiple interrupted. The microsatellites were tested for their degree of polymorphism by using 24 unrelated German Brown cattle animals. In this 68 Chapter 7. Fine mapping material, two markers on BTA 5 (MS_DCN and MS_COL2A1) and one marker on BTA 18 (MS_APOE) were polymorphic with up to four different alleles (MS_COL2A1). The highest heterozygosity of 36.4% was observed for the marker MS_COL2A1. MS_APOE showed the lowest value for heterozygosity with 23.8 %. The remaining seven microsatellites were monomorphic, and so they were non- informative for linkage analysis.
7.2.5 Development of single nucleotide polymorphisms (SNPs) Ten bovine genomic sequences of each BAC clone CH240-433A8, CH240-34B7 and RP42-155H10 (Chapter 5 and 6), which gave significant hits to the syntenic region of HSA 12 and HSA 19, respectively, were used to design 30 pairs of primers in total, yielding products with a length of 300 to 800 bp. Further 30 pairs of primers were designed by using BAC end sequences, which were published by Larkin et al. (2003) and assigned to the bovine genome in the BTA 5 and BTA 18 RH3,000 comparative maps (Chapter 5 and 6). Of these in total 60 pairs of primers, 45 were located on BTA 5 and 15 were located on BTA 18. The amplicons were used for an analysis of single nucleotide polymorphisms (SNPs) on a MegaBACE 500 automated sequencer. The sequencing reaction was carried out using the DYEnamic-ET- Terminator Cycle Sequencing Kit (Amersham Biosciences, Freiburg, Germany). Amplification started with an initial denaturation at 94°C for 1.5 minutes, followed by 34 cycles of 20 s denaturing at 94°C, 15 s annealing at 50°C and 2 min elongation at 60°C. Finally the reaction was cooled down to 4°C for 10 minutes. The reaction product was cleaned up using Sephadex G50 filtration. Sequence data were analysed with the Sequencher 4.1.4 program (Gene Codes, Ann Arbor, MI, USA). In the first step the sequence analysis was performed for the PCR products of both sires of the two half-sib families. If a heterozygous SNP was found for one or both sires, all progeny and dams of the respective families were analysed for that SNP.
7.2.6 SNP marker analysis In total we identified 22 heterozygous SNPs for one or both of the two sires that founded the half-sib families in our material (Table 3 and 4). These SNPs were identified in 15 DNA sequences of 10 different BAC clones. Of all SNPs, five were heterozygous for both sires, 12 were only heterozygous for the sire of family one and five only for the sire of family two. The most frequent form of SNPs with a frequency Chapter 7. Fine mapping 69
Table 3 New 22 SNPs for paternal half-sib families 1 and 2, regarding BTA 5 and 18 are given with the corresponding accession numbers (if existent), observed heterozygosity and polymorphism information content
Bovine BAC clone BTA1 Fam2 Acc. No.3 HET4 PIC5 CH240-24G6 5 1 BZ903249 45.5 29.0 CH240-25P12 5 1 BZ904404 64.0 34.1 (2 SNPs) CH240-34B7_1 5 1 33.3 31.2 CH240-34B7_4_a 5 1 34.6 34.3 2 53.9 37.5 CH240-34B7_4_b 5 1 44.0 36.0 2 53.9 37.5 CH240-34B7_8_a 5 1 - - CH240-34B7_8_b 5 1 56.5 37.3 CH240-36N21 5 1 BZ948751 38.1 37.4 2 62.2 36.9 CH240-57N14 5 1 BZ915270 55.6 37.6 2 40.6 31.4 CH240-64C19 5 1 BZ918677 39.1 32.3 CH240-98C16 5 2 BZ956659 57.9 34.9 (2 SNPs) CH240-106C2 5 2 BZ939551 - - CH240-155H10_4 18 2 - - CH240-155H10_10 18 1 100 37.5 2 79.3 37.0 CH240-433A8_1_a 5 1 95.7 37.5 CH240-433A8_1_b 5 1 - - CH240-433A8_1_c 5 2 83.3 37.2 CH240-433A8_2_a 5 1 - - CH240-433A8_2_b 5 1 - - CH240-433A8_5 5 1 64.0 37.1 1Bovine chromosome 2Family number 3Accession number 4Observed heterozygosity (%) per family 5Polymorphism information content (%)
70 Chapter 7. Fine mapping of 22.7 % was the G/T transversion and the C/T transition motif, respectively. The scarcest one was the A/T transversion motif with a frequency of 4.55 %. Of all SNPs, 20 were located in sequences of BTA 5 and two in sequences of BTA 18.
7.2.7 Linkage analysis Multipoint non-parametric linkage analysis was employed to test the proportion of alleles which affected individuals share identical by descent (IBD) at the considered marker loci irrespective of the mode of inheritance of the phenotype (Kong and Cox 1997; Whittemore and Halpern 1994; Kruglyak et al. 1996). The Whittemore and Halpern NPL pairs statistic was used for significance tests for allele sharing among affected pedigree members. The statistical analysis was performed using the MERLIN Software Package (http://www.sph.umich.edu/csg/abecasis/Merlin, Abecasis et al. 2002). Linkage analysis was performed regarding the chromosomal regions of BTA 5 and BTA 18 previously proven to be linked to the BCSE phenotype. The pedigrees for the linkage analysis consisted of two half-sib families including 72 animals. In addition to the markers used for the whole genome scan (Chapter 3), 15 SNPs described above were chosen according to their information content and their location in the bovine genome and incorporated into the linkage analysis. None of the microsatellites was found to be heterozygous for one of the sires, so they were not used for genotyping. Of the 15 chosen SNPs, two were present in both families, 9 were present only in family 1 and 4 were present only in family 2. In addition, the marker set for BTA 5 contained the following microsatellites: BP1, RM103, BL23, AGLA293, BMS1315, ORAFCB5, ILSTS022, BMS321, BMC1009, BMS1898, BL4 and the marker set for BTA 18 contained the microsatellites IDVGA55, BMS2785, BM2078, BM6507, TGLA227 and MS936FBN. For the linkage analysis, the markers were positioned according to the RH mapping data (Chapter 5 and 6).
7.3 Results
A linkage analysis was at first carried out for both families conjoined. On BTA 5, the highest Zmean with a value of 4.79 (p<0.00001) was reached for the marker BMC1009 at 40.6 cM on BTA 5. On BTA 18 the marker TGLA227 peaked with a Zmean of 3.53 (p=0.0002) at 84.7 cM (Table 5 and 6). After this, the two families Chapter 7. Fine mapping 71
Table 4 New 22 SNPs for paternal half-sib families 1 and 2, regarding BTA 5 and 18 are given with the corresponding primers and the product region containing the SNP, the product size and the annealing temperature
Bovine BAC clone Primer F1 (5´ -> 3´), SNP sequence, primer R2 (5´ -> 3´) bp3 AT4 CH240-24G6 CCTCAGAAACATTTCAAGACCA 567 60 GGCTGTGGGT(AG)TATCAGTGGCCA GGGAATTAGGCTGGATTAGGA CH240-25P12 GGGACAAGAGGGATGAGAAG 532 60 (2 SNPs) ATCATTCTGACAT(G/T)(C/T)TCAAGTT CAGCAGTCTCAAACGCATGT CH240-34B7_1 ACAAGACCTACGTGGGGTGA 506 60 TTTTTAGAAAAA(C/G)TTAGGTGCATG GCACTCTGATGCCTGTCTAGC CH240-34B7_4_a CGAGCTGGTGGAGTCAGAA 750 60 TTCAAAAGTGTGT(C/G)TTTAGAGAGA AGGAGGTCCATAGGGGACAG CH240-34B7_4_b CGAGCTGGTGGAGTCAGAA 750 60 AGAGAGTAAAAC(A/G)TGGTGGTGGT AGGAGGTCCATAGGGGACAG CH240-34B7_8_a GCTACCTCTGCGTCTGCTCT 359 60 TAACATGTAAA(A/G)AGCTTGAAAATA GAAAGAAAGACAAAGTTCACTCACC CH240-34B7_8_b GCTACCTCTGCGTCTGCTCT 359 60 CAAGAATA(C/T)TGGAGTAGGTTGTCA GAAAGAAAGACAAAGTTCACTCACC CH240-36N21 GGATGACTGATGAACTCATTTTGT 250 59 AAAACTTTAAAACA(CT)TTTGTTTAGA TGGGAAATGATTAAAGGTAGGC CH240-57N14 GGACAGATCCAGGGCTCATA 353 60 GATGGAGGGTAA(CT)GGTAAAACAAG CATGGCTATCCCCAGAAAAA CH240-64C19 TGAATTAAAGCCTTCAAAAATAGGA 462 60 GGCAAACCA(GT)AGTTATTCAACGTA TGTGACCACCATAACTTCCAGA
72 Chapter 7. Fine mapping
Table 4 (continued)
Bovine BAC clone Primer F1 (5´ -> 3´), SNP sequence, primer R2 (5´ -> 3´) bp3 AT4 CH240-98C16 ACGTCCATTGAGCCAGTGAT 109 60 (2 SNPs) TATATAT(C/A)TC(A/T)CTGCGTCTCAA TAGGGCACACGAATTTTATTAGC CH240-155H10_4 GTGTGCCTGTTGCCCTGT 416 60 ACGCCGCCCAC(G/T)GTCTTGGCCC CTTACTTTTAGCCGGTGCAGA CH240-155H10_10 CACTCCAAGGACCAGATGCT 618 60 AGGGGTGGTT(C/G)TCTCAGGAGGG GGATGAGGCCATTCTCAAAG CH240-433A8_1_a AACTTTCTTCGGGTCAGCAA 382 60 AAAAAGTT(G/T)ACTTTCTGAAACTAA CGCAGGAACCACTGAAGAG CH240-433A8_1_b AACTTTCTTCGGGTCAGCAA 382 60 AAAAAAAAAA(AC)GAGGCTATTAAAA CGCAGGAACCACTGAAGAG CH240-433A8_1_c AACTTTCTTCGGGTCAGCAA 382 60 ATAGGATTATTT(TG)GCTGACCCGAA CGCAGGAACCACTGAAGAG CH240-433A8_2_a AGATGGGAATAGGGGAAGGA 451 60 CATC(TA)GAA(A/G)CTGACTATCTGTG CTGAAGACAGGGGGAGTGAG CH240-433A8_2_b AGATGGGAATAGGGGAAGGA 451 60 ACCCTAATCCC(A/C)GGTAGTGGGCT CTGAAGACAGGGGGAGTGAG CH240-433A8_5 CTGTGCGAGTGTGACGATG 737 60 TGAATGCAGTGG(C/T)GACACGGACA GGTCAAAACCAGAGTCATGTTG 1Forward 2Reverse 3Product size (basepairs) 4Annealing temperature (°C)
Chapter 7. Fine mapping 73 were scanned separately. When analysing the two BCSE loci separately for family one, the obviously highest values were shown for BTA 5 at 40.6 cM (BMC1009) with a Zmean of 3.75 (p=0.00009) (Table 7) and for BTA 18 the marker BM6507 at 78.9 cM reached a value of 3.58 for the Zmean (p=0.0002) (Table 8). Regarding family 2 and BTA 5, a Zmean value of 2.75 (p=0.003) was reached for the SNP of the BAC clone CH240-57N14, positioned at 45.0 cM, but all Zmean values and error probabilities in the interval from 28.5 to 52.0 cM were almost as high (Table 9). Analysing the markers on BTA 18 for family 2, the highest Zmean was reached at 84.7 cM (TGLA227) with a value of 2.07 (p=0.02) (Table 10). The mean polymorphism information content (PIC) was determined for family 1 and 2 and for both chomosomes separately, regarding all markers used for the fine mapping. For BTA 5, family 1 showed a slightly lower PIC (39.0 %) than family 2 (41.2 %). Regarding BTA 18, family 1 and 2 showed almost equal PIC values (52.4 and 52.7, respectively). The SNP markers showed high heterozygosity values of 58.0 % in the average and PIC values ranging from 29.0 to 37.6 % (Table 3). The haplotypes for BTA 5 and BTA 18 are shown for family 1 and 2 in Figures 1 to 3. Only markers which are informative for the respective sire are depicted. For family 1 no new informative marker was found on BTA 18, since the only SNP discovered was heterozygous for all animals of this family. Thus, the haplotypes are the same as presented in Chapter 3 (Figure 2).
7.4 Discussion
We developed 10 microsatellite and 22 SNP markers with the intention to create a denser map for linkage analysis of the two previously discovered genetic regions on BTA 5 and 18 linked to the BCSE phenotype. Although three of the microsatellite markers turned out to possess more than one allele, none of the microsatellites was useful for our linkage analysis. This was due to the fact, that both affected sires, who were founders of the two half-sib families were homozygous for each of the developed microsatellites. However, these newly developed microsatellite markers could be useful for linkage studies with another family material or for other cattle breeds. 74 Chapter 7. Fine mapping
All SNP markers were chosen due to their heterozygosity in one or both of the sires and these markers turned out to be mostly unambiguous and useful. For this reason, the use of SNPs in addition to informative microsatellites appears recommendable. The inclusion of the SNP markers led to higher peaks of the test statistics at each one location of BTA 5 and 18 as compared to the whole genome scan where only
Table 5 Linkage analysis for families 1 and 2 for bovine chromosome 5, regarding Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance (cM) Zmean pz-value LOD-score pL-value Maximal achievable values 16.93 0 -0.07 0.00003 Minimal achievable values -1.18 0.9 3.5 0.7 *CH240-25P12 15.0 -0.11 0.5 -0.01 0.6 BP1 18.8 -0.2 0.6 -0.01 0.6 RM103 28.6 2.37 0.009 0.94 0.02 *CH240-34B7_8_b 28.5 2.63 0.004 1.05 0.014 *CH240-34B7_4_b 28.55 2.84 0.002 1.12 0.012 *CH240-34B7_4_a 28.57 3.09 0.001 1.2 0.009 BL23 28.7 3.11 0.0009 1.2 0.009 AGLA293 32.0 3.86 0.00006 1.43 0.005 BMS1315 32.5 3.87 0.00005 1.43 0.005 OARFCB5 34.7 3.93 0.00004 1.43 0.005 ILSTS22 38.0 3.94 0.00004 1.29 0.007 BMS321 38.1 3.94 0.00004 1.29 0.007 *CH240-433A8_5 38.2 3.93 0.00004 1.28 0.008 *CH240-433A8_1_a+c 38.25 3.95 0.00004 1.28 0.008 BMC1009 40.6 4.79 <0.00001 1.2 0.009 BMS1898 44.1 4.56 <0.00001 1.2 0.009 *CH240-57N14 45.0 3.45 0.0003 0.97 0.02 *CH240-98C16 48.0 2.66 0.004 0.75 0.03 BL4 51.2 1.91 0.03 0.32 0.11 *CH240-64C19 52.0 1.81 0.04 0.28 0.13 *CH240-24G6 54.0 1.67 0.05 0.26 0.14 *CH240-36N21 60.0 1.32 0.09 0.23 0.15 1Error probability regarding Zmean 2Error probability regarding LOD score *Single nucleotide polymorphisms Chapter 7. Fine mapping 75
Table 6 Linkage analysis for families 1 and 2 for bovine chromosome 18, regarding Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance Zmean pz-value LOD-score pL-value (cM) Maximal achievable values 14.48 0 -0.08 0.7 Minimal achievable values -1.26 0.9 3.22 0.00006 IDVGA55 70.5 0.5 0.3 0.06 0.3 BMS2785 73.7 0.57 0.3 0.06 0.3 BM2078 77.8 1.14 0.13 0.11 0.2 BM6507 78.9 1.30 0.1 0.12 0.2 TGLA227 84.7 3.53 0.0002 1.64 0.003 *CH240-155H10_10 85.0 3.50 0.0002 1.63 0.003 MS936FBN 87.0 3.34 0.0004 1.58 0.003 1Error probability regarding Zmean 2Error probability regarding LOD score *Single nucleotide polymorphism
Table 7 Linkage analysis for family 1 for bovine chromosome 5, regarding positions with significant Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance (cM) Zmean pz-value LOD-score pL-value AGLA293 32.0 2.63 0.004 0.68 0.04 BMS1315 32.5 2.59 0.005 0.68 0.04 OARFCB5 34.7 2.45 0.007 0.66 0.04 ILSTS22 38.0 2.33 0.010 0.64 0.04 BMS321 38.1 2.32 0.010 0.64 0.04 *CH240-433A8_5 38.2 2.32 0.010 0.64 0.04 *CH240-433A8_1_a 38.25 2.35 0.009 0.65 0.04 BMC1009 40.6 3.75 0.00009 0.81 0.03 BMS1898 44.1 3.53 0.0002 0.79 0.03 *CH240-57N14 45.0 1.68 0.05 0.54 0.06 1Error probability regarding Zmean 2Error probability regarding LOD score *Single nucleotide polymorphisms 76 Chapter 7. Fine mapping microsatellites were used (Chapter 3). Regarding BTA 5, the highest Zmean was reached at 40.6 cM (BMC1009) which is in agreement with the results of the whole genome scan. This location is in close proximity to the candidate gene PRPH. PRPH encodes a cytoskelettal protein that occurs in the peripheral nervous system and neurons (Portier et al. 1984). In mice, an over-expression of Prph has been proven to lead to massive and selective degeneration of motor axons during aging (Beaulieu et al. 1999). This degeneration might include the sixth cranial nerve with following paralysis of the supplied muscles, which would cause strabismus and exophthalmus. To assure the position of the BCSE locus on BTA 5, more SNPs, especially for the candidate gene have to be developed. The highly significant Zmean on BTA 18 reported for the whole genome scan was also confirmed, but it did not reach values as high as on BTA 5. However, heterogenity between the families was obvious as in the previously performed whole genome analysis (Chapter 3). Adding of the SNP markers confirmed the looser linkage for the BCSE region on BTA 18 in half-sib family 2, though the mean PIC values were almost identical for both families. Taking these results into account, the hypothesis of two dominantly acting genes cannot be excluded, but the theory of a single dominant gene on BTA 5 causing BCSE and a gene on BTA 18 suppressing the onset of BCSE gets more likely. As in family 2 the onset of BCSE can be observed in younger animals than in the other half-sib family, we may assume that the founder sire may not segregate for a gene retarding the onset and progression of BCSE.
Table 8 Linkage analysis for family 1 for bovine chromosome 18, regarding positions with significant Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance (cM) Zmean pz-value LOD-score pL-value IDVGA55 70.5 1.82 0.03 0.56 0.05 BMS2785 73.7 2.07 0.02 0.60 0.05 BM2078 77.8 3.26 0.0006 0.76 0.03 BM6507 78.9 3.58 0.0002 0.79 0.03 TGLA227 84.7 3.08 0.0010 0.74 0.03 MS936FBN 85.0 3.06 0.0011 0.74 0.03 1Error probability regarding Zmean 2Error probability regarding LOD score Chapter 7. Fine mapping 77
Table 9 Linkage analysis for family 2 for bovine chromosome 5, regarding positions with significant Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance (cM) Zmean pz-value LOD-score pL-value RM103 28.5 2.57 0.005 0.75 0.03 *CH240-34B7_8_b 28.55 2.56 0.005 0.75 0.03 *CH240-34B7_4_b 28.6 2.6 0.005 0.75 0.03 *CH240-34B7_4_a 28.65 2.61 0.005 0.76 0.03 BL23 28.7 2.61 0.004 0.76 0.03 AGLA293 32.0 2.36 0.009 0.74 0.03 BMS1315 32.5 2.36 0.009 0.73 0.03 OARFCB5 34.7 2.35 0.009 0.67 0.04 ILSTS22 38.0 2.29 0.011 0.49 0.07 BMS321 38.1 2.29 0.011 0.48 0.07 *CH240-433A8_5 38.15 2.29 0.011 0.48 0.07 *CH240-433A8_1_c 38.2 2.29 0.011 0.48 0.07 BMC1009 40.6 2.34 0.010 0.38 0.09 BMS1898 44.1 2.66 0.004 0.43 0.08 *CH240-57N14 45.0 2.75 0.003 0.44 0.08 *CH240-98C16 48.0 2.71 0.003 0.50 0.07 BL4 51.2 2.45 0.007 0.53 0.06 *CH240-64C19 52.0 2.39 0.008 0.54 0.06 *CH240-24G6 54.0 2.24 0.013 0.55 0.06 *CH240-36N21 60.0 1.79 0.04 0.56 0.05 1Error probability regarding Zmean 2Error probability regarding LOD score *Single nucleotide polymorphisms
Table 10 Linkage analysis for family 2 for bovine chromosome 18, regarding positions with significant Zmean, LOD score and error probabilities (p-values)
1 2 Marker Distance (cM) Zmeanpz-value LOD-score pL-value TGLA227 84.7 2.07 0.02 0.92 0.02 *CH240-155H10_10 85.0 2.05 0.02 0.92 0.02 MS936FBN 87.0 1.89 0.03 0.87 0.02 1Error probability regarding Zmean 2Error probability regarding LOD score *Single nucleotide polymorphism 78 Chapter 7. Fine mapping CH240-25P12 CH240-25P12 RM103 CH240-34B7_4_b CH240-34B7_4_a AGLA293 OarFCB5 CH240-433A8_5 CH240-433A8_1_a BMC1009 BMS1898 CH240-57N14 CH240-64C19 CH240-24G6 CH240-36N21 2 6 2 1 2 3 3 4 2 2 2 10 2 1 1 2 1 6 1 2 1 6 4 1 1 1 5 5 1 2 2 1 566 1 2 1 2 2 3 3 4 2 2 2 10 1 2 2 2 2 6 2 1 1 6 4 1 1 1 5 5 1 2 1 2 604 2 6 1 2 2 6 3 1 2 2 7 12 1 1 1 1 2 6 2 1 1 6 4 1 1 1 5 5 1 2 1 2 221 2 6 2 1 1 6 4 1 1 1 5 5 1 2 2 2 2 6 2 1 1 6 4 1 1 2 5 5 1 2 1 2 222 2 6 2 1 1 6 4 1 1 1 5 5 0 2 2 2 2 6 2 1 1 6 4 1 1 1 5 5 0 2 1 2 287 2 2 1 2 2 3 3 4 2 2 2 10 2 1 0 1 2 6 2 1 1 3 4 1 1 1 5 5 1 2 0 1 535 2 2 0 2 2 3 3 4 2 0 2 10 2 1 1 1 2 6 0 2 2 2 3 1 1 0 5 5 1 1 2 2 270 2 6 1 2 2 6 2 2 2 2 2 0 2 2 1 2 1 2 1 2 2 6 3 2 2 1 4 0 1 2 1 1 230 6 2 2 1 1 3 3 4 2 2 2 10 2 1 0 0 1 2 1 2 2 6 3 2 2 1 4 5 1 2 0 0 231 1 2 2 2 2 4 3 2 2 2 2 12 2 2 1 2 2 6 2 2 2 3 3 4 2 2 2 2 1 1 1 10 234 2 6 2 1 1 6 4 1 1 2 10 0 1 1 0 1 2 6 2 2 2 3 3 4 2 2 2 0 1 1 0 10 233 2 2 1 2 2 3 3 4 2 2 2 10 2 2 2 2 2 6 2 2 2 2 3 1 2 1 4 1 2 1 1 10 516 1 2 0 2 2 3 3 4 2 2 2 10 2 2 2 2 2 2 0 2 2 6 4 1 1 1 2 1 2 1 2 10 278 2 6 2 1 1 6 4 1 1 2 5 5 1 2 1 1 2 6 2 1 1 6 4 1 1 1 5 5 1 2 1 1 236 1 2 1 2 2 3 3 4 2 2 2 10 0 2 2 0 2 6 2 1 1 6 4 1 1 1 5 5 0 2 1 0 235 1 2 2 2 2 6 1 2 2 2 4 7 1 2 1 0 2 6 1 2 2 6 4 1 1 1 5 5 1 2 1 0 307 1 2 1 2 2 3 3 4 0 0 2 10 1 0 2 2 2 6 1 2 2 6 4 1 0 0 5 5 1 0 1 2 82 2 2 0 0 2 6 3 2 1 0 4 12 0 0 0 1 2 2 0 0 2 3 3 2 2 0 2 0 0 0 1 12 279 No sample available sample No 0 2 1 2 2 3 3 4 2 2 2 10 0 1 0 0 0 2 2 1 2 3 3 2 2 1 2 0 2 0 0 12 280 1 6 2 1 1 6 4 1 1 1 5 5 0 2 1 1 2 2 1 2 2 6 1 2 2 2 4 7 0 2 1 1 255 1 2 1 2 2 3 3 4 2 0 2 10 2 1 1 1 2 2 1 2 2 6 1 2 2 0 4 7 1 2 1 1 256 Affe c ted 1 6 2 1 1 6 3 1 2 2 2 10 1 2 1 2 2 6 2 1 1 6 4 1 1 1 5 5 2 2 1 2 635 1 2 1 2 2 3 3 4 2 2 2 10 2 1 1 1 2 6 2 1 1 6 4 1 1 1 5 5 2 2 1 2 636 1 2 2 2 2 6 3 1 2 2 4 10 1 1 1 1 Fe m a le 2 6 1 2 2 6 4 1 1 1 5 1 2 1 1 12 547 1 0 1 2 2 3 3 4 2 2 0 10 0 1 1 1 2 0 1 2 2 6 4 1 1 1 0 0 2 1 1 12 548 Male 1 2 1 2 2 3 3 4 2 2 2 10 2 1 1 1 1 2 6 2 1 1 6 4 1 1 1 5 5 1 2 2 2 Bovine chromosome family 1 5, Chapter 7. Fine mapping 79 BP1 CH240-34B7_1 BL23 AGLA293 CH240-433A8_1_c BMS1898 CH240-57N14 CH240-98C16 CH240-36N21 5 1 3 3 2 2 10 0 0 2 BP1 BP1 CH240-34B7_1 BL23 AGLA293 CH240-433A8_1_c BMC1009 BMS1898 CH240-57N14 CH240-98C16 CH240-36N21 3 2 3 6 1 2 0 0 1 86 10 5 0 3 3 0 2 10 2 0 2 3 0 2 6 1 5 5 1 0 1 0 2 6 0 2 1 0 2 5 0 3 3 2 2 2 0 1 75 12 10 10 100 5 1 3 3 0 2 10 0 0 2 5 2 2 6 1 5 10 2 0 2 8 2 2 6 0 4 5 0 0 2 5 1 2 3 2 2 1 0 1 58 57 12 5 1 3 3 2 2 10 2 0 1 3 0 2 6 1 0 10 0 0 1 3 1 2 6 1 5 1 0 1 5 0 2 3 2 0 0 0 2 85 10 27 10 3 2 2 6 1 2 10 2 2 2 3 2 2 6 1 5 5 1 0 1 5 1 2 6 2 4 5 1 1 2 1 1 3 3 2 5 5 1 0 2 34 94 5 2 2 6 1 5 5 0 1 0 3 2 2 6 1 5 5 1 0 1 2 2 6 2 5 7 0 2 0 5 2 3 3 2 5 5 1 0 1 11 16 61 5 1 3 3 1 5 5 0 1 1 3 2 2 6 0 5 5 0 1 1 5 2 2 3 2 2 0 1 2 2 3 6 0 4 5 0 1 1 19 10 49 14 3 2 2 6 1 5 0 1 1 2 3 2 2 6 1 5 5 1 1 1 5 1 2 6 2 4 0 1 2 2 3 1 1 2 2 4 1 2 2 97 48 12 3 2 2 6 1 5 5 1 0 1 3 2 2 6 1 5 5 1 0 1 5 1 3 3 2 2 5 1 0 2 5 1 2 6 2 5 1 0 1 68 42 13 5 1 2 6 1 5 5 0 1 1 3 2 2 6 1 5 5 1 0 1 5 1 2 2 2 4 0 1 2 5 1 3 3 1 2 2 0 1 12 90 10 107 3 0 2 6 1 0 0 0 0 1 3 2 2 6 1 5 5 1 2 2 5 0 2 3 1 0 0 0 0 2 5 2 2 6 2 5 1 2 1 87 84 12 3 2 2 6 0 5 5 0 1 1 3 1 3 3 0 2 10 2 0 2 5 2 2 6 0 5 5 0 2 1 3 1 2 0 2 2 0 1 11 78 80 10 3 2 2 6 1 5 5 1 1 1 3 1 3 3 0 2 10 2 0 2 5 1 2 6 2 5 5 1 1 1 3 2 2 6 0 2 2 0 1 79 72 10 3 2 2 6 1 5 5 1 0 1 5 1 3 3 2 2 10 0 0 2 5 1 3 3 2 5 5 1 0 2 1 2 2 6 1 5 5 0 0 1 83 26 3 0 2 6 1 5 5 1 0 0 5 1 3 3 2 2 10 0 0 2 5 0 2 6 1 5 2 0 0 5 1 2 6 1 5 0 0 1 82 10 65 12 5 1 2 3 2 2 10 0 0 2 0 2 2 6 1 5 5 1 1 1 3 2 3 6 1 2 0 0 1 0 2 2 6 1 5 5 1 2 1 69 10 102 3 2 2 6 1 5 5 1 1 1 5 1 3 3 2 2 10 2 0 2 5 2 2 3 2 5 5 1 1 2 1 2 6 1 2 2 0 1 73 37 12 10 No sample available sample No 5 1 3 3 2 0 10 0 0 2 3 2 2 6 0 5 5 1 0 1 3 1 3 3 1 0 0 0 1 7 1 2 2 0 4 1 0 1 10 12 10 106 3 2 2 6 1 5 5 1 1 1 5 1 3 3 2 2 10 2 0 2 5 2 2 6 1 5 5 1 2 1 2 2 6 1 5 5 1 0 2 38 93 14 5 1 3 3 2 2 10 0 0 2 3 2 2 6 0 5 5 1 1 0 Affected 3 1 2 2 1 2 0 0 1 3 1 2 6 0 4 1 1 0 10 52 10 104 3 2 2 6 1 5 5 1 1 1 5 1 3 3 2 2 0 2 0 2 2 2 6 2 2 7 1 2 2 5 1 3 6 1 2 0 1 0 1 33 14 76 3 0 2 6 1 5 5 1 1 1 5 0 3 3 0 2 10 0 0 0 Fe m a l e 3 0 2 6 2 5 1 1 2 5 0 2 3 0 2 0 0 0 67 12 91 12 3 2 0 6 1 5 0 1 1 1 5 1 3 3 2 2 10 2 0 2 3 2 0 6 1 5 0 1 2 2 3 1 3 6 2 4 1 0 1 88 10 111 Male 3 2 2 6 1 5 5 1 1 1 3 2 2 6 1 5 5 1 1 1 5 1 3 3 2 2 2 2 2 5 1 3 3 2 2 2 2 2 2 10 2 10 80 Chapter 7. Fine mapping BM6507 TGLA227 CH240-155H10_10 6 3 0 4 5 0 BM6507 TGLA227 CH240-155H10_10 33 6 3 2 6 3 2 3 1 1 4 2 1 34 100 6 3 2 6 3 2 3 3 1 3 3 1 97 79 6 3 0 6 3 0 3 6 0 3 7 0 87 19 6 3 0 0 1 0 4 7 0 0 3 0 27 94 4 1 0 6 3 0 4 2 0 4 6 0 73 106 4 3 2 4 1 0 3 5 1 3 6 0 67 37 4 1 1 4 3 0 4 6 2 4 7 0 82 104 4 3 0 4 1 2 3 3 0 6 6 2 65 111 4 3 2 4 3 2 3 3 1 3 3 1 12 69 6 3 1 4 3 0 3 6 1 4 0 57 26 10 4 3 0 6 3 1 4 8 0 4 3 1 78 107 6 1 1 4 3 2 1 7 1 4 6 1 90 84 6 3 2 4 1 1 4 6 1 6 8 2 61 102 4 1 0 6 3 0 4 2 0 3 2 0 68 48 4 1 1 6 3 2 4 3 1 4 1 11 58 49 4 1 0 6 3 0 No sample available sample No 3 3 0 3 3 0 52 42 4 1 1 6 3 2 3 5 2 3 6 1 86 93 4 1 1 6 3 2 4 5 2 3 2 1 85 76 Affec ted 4 1 1 6 3 0 3 7 2 4 3 0 83 91 4 1 1 6 3 2 3 2 1 3 2 1 75 88 Fe m a le 6 3 2 4 1 1 4 8 1 4 6 2 11 80 4 1 0 6 3 0 Male 4 2 0 3 3 0 38 72 4 1 1 4 1 1 6 3 2 6 3 2 2 2 Chapter 8. Summary 81
Chapter 8
Summary 82 Chapter 8. Summary
Summary
Stefanie Mömke (2004)
Molecular genetic analysis of bilateral convergent strabismus with exophthalmus in German Brown cattle
The objective of the present thesis was to map gene loci responsible for bilateral convergent strabismus with exophthalmus (BCSE) in German Brown cattle on the bovine genome and to identify positional candidate genes for this eye defect.
To achieve this aim, a genome scan over all autosomes was carried out. The linkage analysis showed the existence of two putative gene loci involved in the development of BCSE in cattle. These putative BCSE loci were located on the bovine chromosomes 5 and 18, respectively. For both regions a total of five potential candidate genes were selected from the syntenic human genomic regions on human chromosomes 12 and 19, respectively. The genes were located in the bovine genome by fluorescence in situ hybridisation (FISH) and radiation hybrid (RH)-mapping. Genomic regions and the selection of further positional candidate genes in cattle can be expediently reconnoitred by comparative mapping of the bovine and human genomes. Although different RH maps for bovine chromosomes (BTA) 5 and 18 have been previously published, the breakpoints of synteny within the proximal part of BTA 5 and the telomeric part of BTA 18 in comparison to the human chromosomes 12 and 19 had not been precisely defined. In this study we constructed high resolution comparative maps of the 12.8 to 74.0 cM region of BTA 5 and the 70.5 to 84.7 cM region of BTA 18 to improve breakpoint resolution in the human-bovine comparative map. That way the gaps in the bovine maps of these respective chromosomal regions were narrowed to a minimum. Furthermore, ten new microsatellites and 22 new SNP-markers were developed by sequencing BAC ends. Chapter 8. Summary 83
Of these 32 new markers, 15 informative SNPs were used for fine mapping of the two genomic locations for BCSE identified by the whole genome scan. The inclusion of the SNP markers lead to higher peaks of the test statistics at each one location of BTA 5 and 18 as compared to the whole genome scan where only microsatellites were used. Regarding BTA 5, the highest Zmean was reached at 40.6 cM (BMC1009). For BTA 18, the highest values were reached at 84.7 cM (TGLA227). However, heterogenity of the family material used was obvious. While all families showed highly significant values for the location on BTA 5, not all of them showed obvious significance for the location on BTA 18. These results indicate that the major dominant gene causing BCSE is located on BTA 5. The gene on BTA 18 might also be able to cause the defect independently with a dominant inheritance or it might affect characteristics of BCSE like retarding the time of onset or the progression of BCSE. 84 Chapter 9. Erweiterte Zusammenfassung
Chapter 9
Erweiterte Zusammenfassung Chapter 9. Erweiterte Zusammenfassung 85
Erweiterte Zusammenfassung
Stefanie Mömke
Molekulargenetische Untersuchung des bilateral konvergierenden Strabismus mit Exophthalmus (BCSE) beim Deutschen Braunvieh
9.1 Einleitung
Der bilateral konvergierende Strabismus mit Exophthalmus (BCSE) ist eine ererbte Krankheit, die weltweit bei vielen Rinderrassen bekannt ist. Bei Kühen der Rasse Deutsches Braunvieh wurde eine Inzidenz von 0,9 % ermittelt. Bei Kühen der Rasse Deutsche Holsteins dürfte die Inzidenz noch höher sein. BCSE wurde erstmalig Ende des 19. Jahrhunderts beschrieben und wurde seit dieser Zeit vielfach untersucht. Im Laufe der Erkrankung, die selten vor der Zuchtreife sichtbar wird, kommt es zu einer symmetrischen Rotation der Augäpfel in anterio-mediale Richtung mit einer Fixation in dieser Position. Dabei geht die natürliche Divergenz des Rinderauges verloren. Die Erkrankung verläuft progressiv und ist je nach Schwere der Symptome in vier Stadien einteilbar. Wird der temporale Augenwinkel zu weniger als 25 % von Sklera ausgefüllt spricht man von einem BCSE ersten Grades. Die Erkrankung schreitet über Grad 2 (25 - 50 %) und Grad 3 (50 - 75 %) fort und erreicht letztendlich Grad 4, bei dem mehr als 75 % des sichtbaren Augapfels von Sklera ausgefüllt sind. In fortgeschrittenen Stadien der Erkrankung kommt es zum Exophthalmus, Tränenfluss und aufgrund der starken Drehung des Augapfels nach axial zum Verschwinden der Pupillen im nasalen Augenwinkel, was die Erblindung des Tieres zur Folge hat. Daraus resultiert eine stark eingeschränkte Nutzbarkeit des Tieres aufgrund von Schreckhaftigkeit bis hin zur kompletten Desorientierung, die äußerlich der Bovinen Spongiformen Encephalopathie (BSE) gleichen kann. Des Weiteren ist der Marktwert dieser Tiere eingeschränkt. Der Defekt ist außerdem tierschutzrelevant nach § 11b des Deutschen Tierschutzgesetzes, da der artgemäße Gebrauch eines Organs eingeschränkt wird und eine Erblichkeit nachgewiesen wurde. Somit dürfen Tiere, die Defektgenträger sind oder bei denen damit zu rechnen ist, nicht zur Zucht verwendet 86 Chapter 9. Erweiterte Zusammenfassung
werden. Der erbliche Charakter des Defektes wurde schon früh vermutet. Zunächst wurde aufgrund des unregelmäßigen Auftretens der Erkrankung ein monogen, autosomal rezessiver Erbgang angenommen. Aufgrund komplexer Segregationsanalysen konnte ein autosomal dominantes Hauptgen neben weiteren genetischen Einflüssen als Ursache für BCSE nachgewiesen werden. Der Zuchtausschluss betroffener Tiere allein genügt jedoch nicht, um die Krankheit einzudämmen, da die meisten Tiere schon zur Zucht eingesetzt wurden, wenn der Defekt offensichtlich wird. Aus diesen Gründen ist es von erheblicher Bedeutung, BCSE molekulargenetisch zu untersuchen, um so ein molekulargenetisches Testverfahren entwickeln zu können, welches die Identifizierung von Anlageträgern und späteren Merkmalsträgern ermöglicht. Das Ziel dieser Dissertation ist es, die für BCSE kausalen Genorte mittels eines Genomscans zu lokalisieren und anschließend ein Testverfahren zur molekulargenetischen Diagnose von BCSE zu entwickeln. Da mittels vergleichender Genkarten zum Menschen Genombereiche des Rindes wesentlich schneller aufgeklärt werden können, wurden für die Genomregionen, in denen die für BCSE kausalen Gene lokalisiert wurden, die vergleichenden Genkarten zwischen Rind und Mensch verfeinert. Damit sollten zum einen positionelle Kandidatengene identifiziert werden, um diese gezielt auf ihre Kausalität für BCSE untersuchen zu können, und zum anderen ermöglicht eine hochauflösende vergleichende Genkarte die systematische Suche nach den kausalen Genen für BCSE in den bereits identifizierten bovinen Genomregionen.
9.2 Genomscan und nicht-parametrische Kopplungsanalyse anhand von Mikrosatelliten
9.2.1 Material und Methoden
9.2.1.1 Pedigreematerial Insgesamt wurden 131 Tiere der Rasse Deutsches Braunvieh in die Untersuchung einbezogen. Die Tiere verteilten sich auf 10 Familien. Zwei dieser Familien waren paternale Halbgeschwistergruppen (HF1 und HF2) zweier von BCSE befallenen Chapter 9. Erweiterte Zusammenfassung 87
Besamungsbullen. Die erste bestand aus insgesamt 26 genotypisierten Tieren: dem befallenen Bullen, neun Kühen und 16 betroffenen Nachkomen. Die zweite dieser Familien enthielt neben dem befallenen Bullen 45 genotypisierte Nachkommen, davon 26 befallene und 19 von BCSE freie Tiere. Die übrigen Tiere verteilten sich auf acht maternale Familien (MF1-MF8), die sich über mehrere Generationen erstreckten und für BCSE segregierten. Diese Familien beinhalteten zwischen zwei (MF5) und 18 (MF2) untersuchte Tiere. Das durchschnittliche Untersuchungsalter der Tiere bei dem BCSE erstmalig festgestellt werden konnte, lag bei 6.1 Jahren für die maternalen Familien (MF1-MF8), 6.9 Jahren für die erste Halbgeschwisterfamilie (HF1) und 3.7 Jahren für die zweite Halbgeschwisterfamilie (HF2).
9.2.1.2 Genomscan Für den Genomscan über alle bovinen Autosomen wurden insgesamt 164 Mikrosatellitenmarker aus veröffentlichten Markerkarten, vorwiegend aus der MARC/USDA Karte (http://marc.usda.gov), ausgewählt. Der durchschnittliche Markerabstand betrug 19,9 cM. Alle Mikrosatellitenmarker wurden über PCR und Polyacrylamidgelelektrophorese zunächst an Proben von 85 Tieren ausgewertet. Diese Tiere verteilten sich auf neun Familien, davon acht maternale Familien und die paternale Halbgeschwisterfamilie HF1. Zur weiteren Abklärung und zum Ausschluss falsch positiver Ergebnisse wurden insgesamt 30 zusätzliche Mikrosatellitenmarker in den Regionen mit einer Irrtumswahrscheinlichkeit von p<0.10 für den LOD-Score an dem Familienmaterial genotypisiert. Zusätzlich wurde die zweite Halbgeschwisterfamilie mit einbezogen.
9.2.1.3 Kopplungsanalyse Die nicht-parametrische Kopplungsanalyse wurde unter Verwendung der Software MERLIN (multipoint engine for rapid likelihood inference, Version 0.10.2) durchgeführt und basierte auf dem "identical-by-descent" (IBD) Verfahren. In dem sogenannten "Pairs" Modus (paarweiser Vergleich mit gleichmäßiger Gewichtung der betroffenen Tiere) wurden die Markerallele immer zwischen Paaren von Geschwistern bzw. Verwandten auf Kosegregation mit der phänotypischen Ausprägung der Erkrankung getestet. Darauf folgend wurde die einer Normalverteilung folgende Teststatistik für den Anteil von IBD-Markerallelen 88 Chapter 9. Erweiterte Zusammenfassung
(Zmean) und ein daraus abgeleiteter LOD-Score berechnet. Als signifikant für die Kosegregation eines Markerallels mit dem Phänotyp des BCSE gelten Irrtumswahrscheinlichkeiten (p) von 0,05 oder kleiner.
9.2.2 Ergebnisse
Das aus 164 Mikrosatelliten bestehende Markerset zeichnete sich durch eine durchschnittliche Allelanzahl von 5,9, einen mittleren Heterozygotiegrad von 60% und einen durchschnittlichen PIC-Wert von 56% aus. Die Familien MF1, MF2 und HF1 erreichten die höchsten PIC Werte für die verwendeten Marker. So erreichten 61,0, 61,6 und 60,4 % der verwendeten Marker in diesen Familien PIC Werte von über 50%. Als am wenigsten informative Familie erwies sich MF5 mit nur 39,1% der Marker über 50% im PIC. Hinsichtlich der Verteilung im Genom waren die höchsten durchschnittlichen PICs auf den Chromosomen 18 und 27 mit 69% und der niedrigste PIC auf Chromosom 16 mit 37% zu finden. Durch die nicht-parametrische Kopplungsanalyse wurden sechs putative genomische Regionen für BCSE-Genorte identifiziert. Nach Erweiterung des Markersets um 30 Mikrosatelliten mit einer durchschnittlichen Distanz von 9,3 cM auf den sechs Chromosomen konnte für zwei chromosomale Regionen auf BTA 5 und BTA 18 eine signifikante Kopplung (BTA 5: p=0,00012, BTA 18: p=0,006) zum bilateral konvergierenden Strabismus mit Exophthalmus festgestellt werden. Diese Regionen befanden sich zentromernah auf Chromosom 5 und am telomeren Abschnitt von Chromosom 18.
9.2.3 Diskussion
Die Ergebnisse der Kopplungsstudie weisen darauf hin, dass BCSE in erster Linie durch ein mit dem Marker BMC1009 gekopppeltes dominantes Gen auf Chromosom 5 verursacht wird. Ein weiteres Gen auf dem telomeren Ende von Chromosom 18 könnte ebenfalls selbständig die Entwicklung von BCSE auslösen. Da der Bereich auf diesem Chromosom für eine der verwendeten Halbgeschwisterfamilien (HF2) nur eine Irrtumswahrscheinlichkeit von p=0.2 aufwies, wurde als alternative Hypothese für die Wirkung des Gens auf Chromosom 18 diskutiert, dass dieses Gen die Chapter 9. Erweiterte Zusammenfassung 89
Geschwindigkeit des Verlaufs oder das Manifestationsalter beinflusst. Diese Theorie wird durch das duchschnittliche Untersuchungsalter, bei dem BCSE erstmalig pro Familie festgestellt wurde, unterstützt. Da die Nachkommen in Familie HF2 im Durchschnitt etwa drei Jahre früher erkrankten als die Mitglieder der anderen Familien, könnte der Genort auf Chromosom 18 eine Verzögerung des Ausbruchs der Erkrankung bewirken.
9.3 Physikalische Kartierungen mittels Fluoreszenz in situ Hybridisierung (FISH) und Radiation Hybrid (RH)-Kartierung
9.3.1 Material und Methoden
9.3.1.1 Isolierung von bovinen genomischen BAC-Klonen Für die Isolierung von bovinen, genomischen BAC-Klonen wurden mit 32P markierte, humane IMAGE cDNA Sonden verwendet. Die cDNA IMAGE Klone wurden vom RZPD (German Human Resource Center/Primary Database) bezogen. Für die Suche nach den orthologen bovinen Genen wurden die Filter der bovinen genomischen RPCI-42 BAC-Genbank verwendet. Nur bei positiven Signalen für die Sonde wurde die genomische bovine BAC-DNA für die weitere Bearbeitung bezogen. Nach Isolierung der bovinen BAC-DNA wurde über eine Pulsfeldgelelektrophorese zunächst die Größe der bovinen genomischen DNA-Fragmente bestimmt. Die SP6 und T7 Enden der BAC-Klone wurden auf einem automatischen Sequenziergerät (LI- COR 4200) ansequenziert. Nach Maskierung repetitiver Elemente mit dem Repeat Masker Programm wurden die Randsequenzen mit Datenbankeinträgen über das Programm BLASTN verglichen.
9.3.1.2 Fluoreszenz-in-situ-Hybridisierung Die Fluoreszenz-in-situ-Hybridisierung wurde an phytohämagglutinin-stimulierten Blutlymphozyten eines gesunden Bullen auf GTG-gebänderten Metaphasechromosomen durchgeführt. Die Präparation der Metaphasen erfolgte nach zytogenetischen Standardtechniken. Vor der Hybridisierung wurden die GTG- gebänderten Chromosomen digital fotografiert. Die DNA der BAC- (bacterial artificial 90 Chapter 9. Erweiterte Zusammenfassung
chromosome) Klone wurde über Nick-Translation mit Digoxygenin markiert und auf den gebänderten bovinen Chromosomen hybridisiert. Als Kompetitor-DNA zum Binden repetitiver Sequenzen der markierten Klone, wurde gescherte genomische bovine DNA und Lachssperma-DNA eingesetzt. Unter Verwendung des Digoxigenin- FITC Detection Kit wurden die Signale der hybridisierten Proben erfasst. Die Chromosomen wurden mit DAPI gegengefärbt und in Propidiumjodid/Antifade eingebettet. Mit Hilfe eines Fluoreszenzmikroskops wurden die Metaphasechromosomen auf Signale überprüft.
9.3.1.3 Radiation hybrid (RH) Kartierung Die RH Kartierung war notwendig, um die zum Menschen vergleichende Genkarte zu verbessern und die Positionen der neu entwickelten Marker aus den Genombereichen, die signifikant mit BCSE gekoppelt sind, zu bestimmen. Die Verfeinerung der vergleichenden Genkarte war von besonderer Bedeutung, da in den bisher veröffentlichten RH-Karten die Syntäniebeziehungen zwischen Rind und Mensch sowie die Eingrenzung der Bruchpunkte nicht ausreichend genau waren. Für die Kartierung der aus dem Genomscan resultierenden BCSE-Genomregionen wurden insgesamt 15 Mikrosatellitenmarker und 43 BAC-Randsequenzen bzw. Gensequenzen aus den entsprechenden Regionen ausgewählt. Aus den Randsequenzen der Klone und Gensequenzen wurden Primer entwickelt, die über PCR an den Zelllinien des bovinen 3,000 rad Roslin/Cambridge RH Panels typisiert wurden. Mit Hilfe des RHMAP3.0 Softwarepakets wurden Zwei-Punkt-Ananlysen (RH2PT) und Mehr-Punkt-Analysen (RHMAXLIK) durchgeführt.
9.3.1.4 Kandidatengenauswahl In den zu den genomischen BCSE-Regionen der Chromosomen 5 und 18 des Rindes syntänischen menschlichen Genombereichen wurden insgesamt 5 Kandidatengene ausgewählt, die aufgrund ihrer Funktion oder Expression mit dem Erscheinungsbild des BCSE in Zusammenhang stehen könnten. Die ausgewählten Gene werden entweder im Nervengewebe exprimiert oder kodieren für Ionentransporter. Im Einzelnen waren dies die folgenden Gene: PRPH (Peripherin), MRPS35 (Mitochondrial ribosomal protein S35), KCNJ8 (Potassium inwardly- Chapter 9. Erweiterte Zusammenfassung 91
rectifying channel, subfamily J, member 8), KCNJ14 (Inwardly rectifying potassium channel, subfamily J, member 14) und SLC27A5 (Solute carrier family 27).
9.3.2 Ergebnisse
Die Kartierungsergebnisse für die Gene PRPH, MRPS35, KCNJ8, KCNJ14 und SLC27A5 entsprachen den Syntäniebeziehungen zwischen Mensch und Rind in den vergleichenden Genomkarten. Die Ergebnisse der Fluoreszenz-in-situ- Hybridisierungen sind in Tabelle 1 zusammengefasst. Neben der Kartierung der Kandidatengene wurde eine umfassende, vergleichende RH-Kartierung von insgesamt 58 Markern beider BCSE-Regionen durchgeführt. Auf diese Weise konnte die Markerdichte der bisher publizierten komparativen Genkarten zwischen Mensch und Rind deutlich erhöht und die Bestimmung der Bruchpunkte deutlich verfeinert werden.
Tabelle 1 Ausgewählte Kandidatengene mit entsprechender humaner und boviner Lokalisation durch Fluoreszenz-in-situ-Hybridisierung
Bovines Gen Humane Bovine Chromosom Lokalisation Lokalisation 5 KCNJ8 12p11.23 5q3.2-q3.4 5 MRPS35 12p11 5q3.2-q3.4 5 PRPH 12q12-q13 5q1.4 18 KCNJ14 19q13 18q25 18 SLC27A5 19q13.43 18q26
9.3.3 Diskussion
Die Lokalisation der genomischen bovinen BAC-Klone konnte über physikalische Kartierungsmethoden und Datenbankvergleiche von Sequenzdaten abgesichert werden. Neben der Fluoreszenz-in-situ-Hybridisierung, die für die Kandidatengene durchgeführt wurde, erwies sich die RH-Kartierung als wertvolle Methode für die Kartierung von Markern. Die Sequenzierung von BAC-Subklonen mit den folgenden 92 Chapter 9. Erweiterte Zusammenfassung
Vergleichen von Sequenzen und Positionen der Gene hinsichtlich der Syntänieangaben zwischen Mensch und Rind war eine sinnvolle Ergänzung der physikalischen Kartierungsmethoden. Die RH-Kartierung von insgesamt 58 bovinen Markern mit einer verbesserten Aufklärung der Syntänie und deren Bruchpunkte ist ein wertvoller Beitrag für die Entwicklung einer hochauflösenden vergleichenden Genkarte von Mensch und Rind.
9.4 Entwicklung von Mikrosatelliten und SNP Markern mit anschließender Feinkartierung
9.4.1 Material und Methoden
9.4.1.1 Pedigreematerial Als Familienmaterial für die SNP-Suche wurden die beiden Halbgeschwisterfamilien HF1 und HF2, die auch für den Genomscan eingesetzt wurden, verwendet.
9.4.1.2 Subklonierung der BAC-DNA und Markersuche Aus den RH-Karten wurden insgesamt vier strategisch günstige BAC Klone ausgewählt, davon zwei auf Chromosom 5 und zwei auf Chromosom 18 des Rindes. Diese bovinen BAC Klone wurden zur Subklonierung jeweils entweder im Shotgun- Verfahren mechanisch geschert oder mit den Restriktionsenzymen SAC I und XBA I gespalten, anschließend in den pGEM4-Z Vektor ligiert und zur Kultivierung in kompetente XL1-blue E. coli transformiert. Aus den resultierenden Subklonen wurde die Plasmid-DNA isoliert und von beiden Rändern ansequenziert. Um Mikrosatelliten zu identifizieren und flankierende Primer zu entwickeln, wurden diese durchschnittlich 600 Basenpaare umfassenden Sequenzen mit den Programmen Sequencher 4.1.4, Repeat Masker und Primer3 bearbeitet.
9.4.1.3 Identifizierung von SNPs (Single Nucleotide Polymorphisms) Zur Identifizierung von SNPs wurden Primer aus der RH-Kartierung und neu entworfene Primer aus den BAC-Subklonsequenzen verwendet. Die SNPs wurden Chapter 9. Erweiterte Zusammenfassung 93
an den DNA-Sequenzen der beiden betroffenen Zuchtbullen aus den Halbgeschwisterfamilien identifiziert. Die Amplifikate wurden mit Hilfe des MegaBACE 500 sequenziert und auf SNPs untersucht. Bei Vorliegen eines oder mehrerer SNPs wurde die entsprechende DNA-Sequenz der gesamten zugehörigen Familie ebenfalls amplifiziert und sequenziert. Die Auswertung erfolgte mit Hilfe des Sequencher 4.1.4 Programms. Die Genotypen der neuen SNP Marker wurden zu den Genotypen der für die Kopplungsanalyse verwendeten Mikrosatelliten hinzugefügt und gemeinsam unter Verwendung des Programms MERLIN ausgewertet.
9.4.2 Ergebnisse
Zur weiteren Feinkartierung dieser Bereiche wurden 10 neue Mikrosatellitenmarker und 22 neue SNPs entwickelt. Sieben der Mikrosatellitenmarker waren in Rindern verschiedener Rassen vollständig homozygot, drei erwiesen sich zwar als heterozygot, jedoch nicht informativ in Bezug auf das verwendete Familienmaterial. Die SNPs waren größtenteils informativ im vorliegenden Familienmaterial und bestätigten in einer folgenden Kopplungsanalyse die Lokalisation auf Chromosom 5 deutlich. Der Bereich auf Chromosom 18 war ebenfalls hochsignifikant, zeigte aber zwischen den beiden Halbgeschwisterfamilien etwas unterschiedlich hohe Teststatistiken und Irrtumswahrscheinlichkeiten. Anhand der Haplotypen konnte gezeigt werden, dass in allen untersuchten Braunviehfamilien entweder einer der signifikant gekoppelten Bereiche oder beide gemeinsam an der Entwicklung von BCSE beteiligt sein mussten.
9.4.3 Diskussion
Hinsichtlich der Markerentwicklung zeigte es sich, dass die Entwicklung von Mikrosatelliten ein arbeitsaufwändiges und sehr häufig fruchtloses Unterfangen ist, da viele Marker komplett homozygot oder uninformativ sind. Zusätzlich wird die Mikrosatellitenmarkersuche auch durch das sehr seltene Vorkommen dieser Repetitivsequenzen beim Rind erschwert. Die Entwicklung und Analyse von SNP- Markern stellt dagegen eine sinnvolle und empfehlenswerte Alternative dar. 94 Chapter 9. Erweiterte Zusammenfassung
Hinsichtlich der Feinkartierung ist zu vermuten, dass der Genort auf Chromosom 5 ein dominantes Hauptgen enthält. Die Lokalisation auf Chromosom 18 könnte ebenfalls ein dominantes Gen enthalten oder ein Gen, welches auf das Erscheinungsbild des BCSE einwirkt. Da das Manifestationsalter der Tiere aus Familie HF1 deutlich höher war als das der Tiere aus Familie HF2 und da Familie HF1 eine höhere Signifikanz für die Kopplung des Phänotyps des BCSE mit dem telomeren Ende des Chromosoms 18 zeigte, ist es möglich, dass der auf Chromosom 18 lokalisierte Genort eine Verzögerung der Erkrankung bewirkt. Chapter 10. References 95
Chapter 10
References 96 Chapter 10. References
References
Abecasis G. R., Cherny S. S., Cookson W. O., Cardon L. R. (2002) Merlin – rapid analysis of dense genetic maps using sparse gene flow trees. Nature Genetics 30, 97-101.
Band M. R., Larson J. H., Rebeiz M., Green C. A., Heyen D. W., Donovan J., Windish R., Steining C., Mahyuddin P., Womack J. F., Lewin H. A. (2000) An ordered comparative map of the cattle and human genomes. Genome Research 10, 1359-1368.
Barendse W., Armitage S. M., Aleyasin A., Womack J. E. (2000) Differences between the radiation hydrid and genetic linkage maps of bovine chromosome 5 resolved with a quasi-phylogenetic method of analysis. Mammalian Genome 11, 369–72.
Barendse W., Armitage S. M., Kossarek L. M., Shalom A., Kirkpatrick B. W., Ryan A. M., Clayton D., Li L., Neibergs H. L., Zhang N., Grosse W. M., Weiss J., Creighton P., McCarthy F., Ron M., Teale A. J., Fries R., McGraw R. A., Moore S., Georges M., Soller M., Womack J. E., Hetzel D. J. S. (1994) A genetic linkage map of the bovine genome. Nature Genetics 6, 227-235.
Barrier M., Brissot (1885) Paralysie du muscle droit supérieur de l’oeil. Bulletin de la Societe de Centrale de Medecine Veterinaire 29, 303-304.
Beaulieu J. M., Nguyen M. D., Julien J. P. (1999) Late onset of motor neurons in mice overexpressing wild-type peripherin. The Journal of Cell Biology 147, 531-544. Chapter 10. References 97
Bennewitz J., Reinsch N., Grohs C., Leveziel H., Malafosse A.,Thomsen H., Xu N., Looft C., Kuhn C., Brockmann G.A., Schwerin M., Weimann C., Hiendleder S., Erhardt G., Medjugorac I., Russ I., Forster M., Brenig B., Reinhardt F., Reents R., Averdunk G., Blumel J., Boichard D., Kalm E. (2003) Combined analysis of data from two granddaughter designs: A simple strategy for QTL confirmation and increasing experimental power in dairy cattle. Genetics, Selection, Evolution 35, 319-338.
Bishop M. D., Kappes S. M., Keele J. W., Stone R. T., Sunden S. L. F., Hawkins G. A., Solinas-Toldo S., Fries R., Grosz M. D., Yoo J. Y., Beattie C. W. (1994) A genetic linkage map for cattle. Genetics 136, 619-639.
Brezinsky L., Kemp S. J., Teale A. J. (1993) ILSTS005: a polymorphic bovine microsatellite. Animal Genetics 24, 73.
Brezinsky L., Kemp S. J., Teale A. J. (1993) ILSTS006: a polymorphic bovine microsatellite. Animal Genetics 24, 73.
Brunner R.M., Sanftleben H., Goldammer T., Kuhn C., Weikard R., Kata S. R., Womack J. E., Schwerin M. (2003) The telomeric region of BTA 18 containing a potential QTL region for health in cattle exhibits high similarity to the HSA 19q region in humans. Genomics 81, 270-278.
Cavdar Koc E., Burkhart W., Blackburn K., Moseley A., Spremulli L. L. (2001) The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present. The Journal of Biological Chemistry 276, 19363-19374.
Chew E., Remaley N. A., Tamboli A., Zhao J., Podgor M. J., M. Klebanoff (1994) Risk factors for esotropia and exotropia. Archives of Ophthalmology 112,1349- 1355. 98 Chapter 10. References
Chowdhary B. P., Fronicke L., Gustavson I., Scherthan H. (1996) Comparative analysis of the cattle and human genomes: detection of Zoo-FISH and gene mapping-based chromosomal homologies. Mammalian Genome 7, 297-302.
Clayton D. A. (1982) Replication of animal mitochondrial DNA. Cell 28, 693-705.
Cribiu E. P., Di Berardino D., Di Meo G. P., Eggen A., Gallagher D. S., Gustavsson I., Hayes H., Iannuzzi L., Popescu C. P., Rubes J., Schmutz S., Stranzinger G., Vaiman A., Womack J. (2002) International System for Chromosome Nomenclature of Domestic Bovids (ISCNDB 2000). Cytogenetics and Cell Genetics 92, 283-299.
Deschauer M., Muller T., Dreha S. Zierz S. (2001) Familiäre mitochondriale chronische progressive externe Ophthalmoplegie. Fünf Familien mit unterschiedlicher Genetik. Nervenarzt 72, 122-129:
Dexler H. (1891) Casuistische Beiträge zur Kenntnis der Stathopathien des Auges beim Rinde. Zeitschrift vergleichender Augenheilkunde 7, 141-170.
Distl O. (1993) Analysis of pedigrees in dairy cattle segregating for bilateral strabismus with exophthalmus. Journal of Animal Breeding and Genetics 110, 393-400.
Distl O., Gerst M. (2000) Association analysis between bilateral convergent strabismus with exophthalmus and milk production traits in dairy cattle, Journal of Veterinary Medicine A 47, 31-36.
Distl O., Scheider A. (1994) Ein ungewöhnlicher Augendefekt beim Highland Cattle: Divergierendes unilaterales Schielen. Deutsche Tierärztliche Wochenschrift 101, 202-203. Chapter 10. References 99
Distl O., Wenninger A., Kräusslich H. (1991) Zur Erblichkeit von Strabismus convergens mit Exophthalmus beim Rind. Deutsche Tierärztliche Wochenschrift 98, 354-356.
Erginel-Unaltuna N., Yang W. P., Blanar M. A. (1988) Genomic organization and expression of KCNJ8/Kir6.1, a gene encoding a subunit of an ATP-sensitive potassium channel.Gene 211, 71-78.
Everts-van der Wind A., Kata S. R., Band M. R., Rebeiz M., Larkin D. M., Everts R. E., Green C. A., Liu L., Natarajan S., Goldammer T., Lee J. H., McKay S., Womack J. E., Lewin H. A. (2004) A 1463 gene cattle-human comparative map with anchor points defined by human genome sequence coordinates. Genome Research 14, 1424-1437.
German Animal Welfare Laws (1998) BGBl. Part I, No. 30, 1105ff.
Gerst M. (1996) Populationsgenetische Untersuchungen zum bilateralen Strabismus convergens mit Exophthalmus beim Rind. Diss. med. vet., Ludwig- Maximilians-Universität München.
Gerst M., Distl O. (1997) Einflüsse auf die Dissemination des bilateralen Strabismus convergens mit Exophthalmus beim Rind. Archiv für Tierzucht 40, 401-412.
Gerst M., Distl O. (1998) Verbreitung und Genetik des bilateralen Strabismus convergens mit Exophthalmus beim Rind. Tierärztliche Umschau 53, 6-15.
Göring K. (1898) Morbus Basedowii bei einer Kuh. Deutsche Tierärztliche Wochenschrift 6, 306-307.
100 Chapter 10. References
Goldammer T., Kata S. R., Brunner R. M., Dorroch U., Sanftleben H., Schwerin M., Womack J. E. (2002) A comparative radiation hybrid map of bovine chromosome 18 and homologous chromosomes in human and mice. Proceeding of the National Academy of Sciences USA 99, 2106-2111.
Hagiwara K., Stenman G., Honda H., Sahlin P., Andersson A., Miyazono K., Heldin C. H., Ishikawa F., Takaku F. (1991) Organization and chromosomal localization of the human platelet-derived endothelial cell growth factor gene. Molecular and Cellular Biology 11, 2125-2132.
Hauke G. (2003) Candidate gene analysis for bilateral convergent strabismus with exophthalmus in German Brown cattle. Diss. med. vet., Tierärztliche Hochschule Hannover.
Hayes H. (1995): Chromosome painting with human chromosome-specific DNA libraries reveals the extent and distribution of conserved segments in bovine chromosomes. Cytogenetics and Cell Genetics 71, 168-174.
He C. Z., Hays A. P. (2004) Expression of peripherin in ubiquinated inclusions of amyotrophic lateral sclerosis. Journal of the Neurological Sciences 217, 47-54.
Holmes J. R.; Young G. B. (1957) A note on Exophthalmus with strabismus in shorthorn cattle. Veterinary Record 69, 148-149.
Inagaki N., Inazawa J., Seino S. (1995) cDNA sequence, gene structure, and chromosomal localization of the human ATP-sensitive potassium channel, uK(ATP)-1, gene (KCNJ8). Genomics 30, 102-104.
Jakob H. (1920) Tierärztliche Augenheilkunde. Schoetz, Berlin, 71-75.
Jubb T. F. (1988) Nervous disease associated with coccidiosis in young cattle. Australian Veterinary Journal 65, 353-354. Chapter 10. References 101
Julian, R. J. (1975) Bilateral convergent strabismus in a Holstein calf. Veterinary Medicine Small Animal Clinican 70, 1151.
Kappes S. M., Bennett G. L., Keele J. W., Echternkamp S. E., Gregory K. E., Thallman R. M. (2000) Initial results of genomic scans for ovulation rate in a cattle population selected for increased twinning rate. Journal of Animal Science 78, 3053–3059.
Kappes S. M., Keele J. W., Stone R. T., McGraw R. A., Sonstegard T. S., Smith T. P. L., Lopez-Corrales N. L., Beattie C. W. (1997) A second-generation linkage map of the bovine genome. Genome Research 7, 235-249.
Kaukinen J., Varvio S. L. (1993) Eight polymorphic bovine microsatellites. Animal Genetics 24, 148.
Kaukonen J., Juselius J. K., Tiranti V., Kyttala A., Zeviani M., Comi G. P., Keranen J., Peltonen L., Suomalainen A. (2000) Role of adenine nucleotide translocator 1 in mtDNA maintenance. Science 289, 782-785.
Kenmochi N., Suzuki T., Uechi T., Magoori M., Kuniba M., Higa S., Watanabe K., Tanaka T. (2001) The human mitochondrial ribosomal protein genes: mapping of 54 genes to the chromosomes and implications for human disorders. Genomics 77, 65-70.
Kim J.-J., Farnir F., Savell J., Taylor J. F. (2003) Detection of quantitative trait loci for growth and beef carcass fatness traits in a cross between Bos taurus (Angus) and Bos indicus (Brahman) cattle. Journal of Animal Science 81,1933-1942.
Koch (1875) Tierärztliche Mitteilung. Quoted after Möller H. (1910) Lehrbuch der Augenheilkunde für Tierärzte. 4th edition, Enke, Stuttgart, 400-403.
102 Chapter 10. References
Komaki H., Fukazawa T., Houzen, H., Yoshida K., Nonaka I., Goto Y. (2002) A novel D104G mutation in the adenine nucleotide translocator 1 gene in autosomal dominant progressive external ophthalmoplegia patients with mitochondrial DNA with multiple deletions. Annals of Neurology 51, 645-648.
Kong A., Cox N. J. (1997) Allele-sharing models: LOD scores and accurate linkage tests. American Journal of Human Genetics 61, 1179-1188.
Kruglyak L., Daly M. J., Reeve-Daly M. P., Lander E. S. (1996) Parametric and nonparametric linkage analysis: a unified multipoint approach. American Journal of Human Genetics 58, 1347-1363.
Kühn C., Bennewitz J., Reinsch N., Xu N., Thomsen H., Looft C., Brockmann G. A., Schwerin M., Weimann C., Hiendleder S., Erhardt G., Medjugorac I., Forster M., Brenig B., Reinhardt F., Reents R., Russ I., Averdunk G., Blumel J., Kalm E. (2003) Quantitative trait loci mapping functional traits in the German Holstein cattle population. Journal of Dairy Science 86, 360-368.
Lange K., Boehnke M., Cox D. R., Lunetta K. L. (1995) Statistical methods for polyploid radiation hybrid mapping. Genome Research 5, 136-150.
Larkin D. M., Everts-van der Wind A., Rebeiz M., Schweitzer P. A., Bachman S., Green C., Wright C. L., Campos E. J., Benson L. D., Edwards J., Liu L., Osoegawa K., Womack J. E., de Jong P. J., Lewin H. A. (2003) A cattle human comparative map built with cattle BAC-ends and human genome sequence. Genome Research 13, 1966 –1972.
Leonard D. G., Gorham J. D., Cole P., Greene L. A., Ziff E. B. (1988) A nerve growth factor-regulated messenger RNA encodes a new intermediate filament protein. The Journal of Cell Biology 106, 181-193.
Chapter 10. References 103
Li K., Warner C. K., Hodge J. A., Minoshima S., Kudoh J., Fukuyama R., Maekawa M. Shimizu Y., Shimizu N., Wallace D. C. (1989) A human muscle adenine nucleotide translocator gene has four exons, is located on chromosome 4, and is differentially expressed. The Journal of Biological Chemistry 264, 13998- 14004.
Liu Z., Hansen M., Womack J. E., Antoniou E. (2003) A comparative map of interstitial bovine chromosome 5 with human chromosomes 12 and 22. Cytogenetics and Genome Research 101, 147–154.
Magnusson R. A., Whittier W. D., Veit H. P., Easley K. J., Meldrum J. B., Jortner B. S., Chickering W. R. (1983) Yellow Buckeye (aesculus octandra marsh) toxicity in calves. The Bovine Practitioner 18, 195-199.
Miki T., Suzuki M., Shibasaki T., Uemura H., Sato T., Yamaguchi K., Koseki H., Iwanaga T., Nakaya H., Seino S. (2002) Mouse model of Prinzmetal angina by disruption of the inward rectifier Kir6.1. Nature Medicine 8, 466-472.
Miles K. A. (1932) A congenital deformity of both eyes in a calf. The Veterinary Record 12, 759-760.
Mintschev P. (1965) Über das mit laterodorsalem Exophthalmus verlaufende medioventral convergente Lähmungsschielen beim Rind. Monatshefte der Veterinärmedizin 20, 41-44.
Möller H. (1910) Lehrbuch der Augenheilkunde für Tierärzte. 4th edition., Enke, Stuttgart, 400-403.
Mömke S., Kuiper H., Spötter A., Drögemüller C., Williams J. L., Distl O. (2004)
Assignment of the PRPH gene to bovine chromosome 5q1.4 by FISH and
confirmation by RH mapping. Animal Genetics, in press. 104 Chapter 10. References
Mojon D. (2001) Eye diseases in mitochondrial encephalopathies. Therapeutische Umschau 58, 49-55.
Moncla A., Landon F., Mattei M.-G., Portier M.-M. (1992) Chromosomal localisation of the mouse and human peripherin genes. Genetical Research 59, 125-129.
Moore S. S., Byrne K., Berger K. T., Barendse W., McCarthy F., Womack J. E., Hetzel D. J. (1994) Characterization of 65 bovine microsatellites. Mammalian Genome 5, 84-90.
Napoli L., Bordoni A., Zeviani M., Hadjigeorgiou G. M., Sciacco M., Tiranti V., Terentiou A., Moggio M., Papadimitriou A., Scarlato G., Comi G. P. (2001) A novel missense adenine nucleotide translocator-1 gene mutation in a Greek adPEO family. Neurology 57, 2295-2298.
Nishino I., Spinazzola A., Hirano M. (1999) Thymidine phosphorylase gene mutations in MNGIE, a human mitochondrial disorder. Science 283, 689-692.
Nixon R. B., Helveston E. M., Miller K., Archer S. M., Ellis F. D. (1985) Incidence of strabismus in neonates. American Journal of Ophthalmology 100, 798-801.
Ozawa A., Band M. R., Larson J. H., Donovan J., Green C. A., Womack J. E., Lewin H. A. (2000) Comparative organization of cattle chromosome 5 revealed by comparative mapping by annotation and sequence similarity and radiation hybrid mapping. Proceedings of the National Academy of Sciences of the United States of America 97, 4150-4155.
Portier M.-M., de Nechaud B., Gros F. (1984) Peripherin, a new member of the intermediate filament protein family. Developmental Neuroscience 6, 335-344.
Power P. P. (1987) Bilateral convergent strabismus in two frisian cows. Irish Veterinary Journal 41, 357-358. Chapter 10. References 105
Regan W. M., Gregory P. W., Mead S. W. (1944) Hereditary strabismus in Jersey cattle. The Journal of Heredity 35, 233-234.
Röder (1890) Die Basedow’ sche Krankheit beim Rinde. Berliner Veterinärwesen Königreich Sachsen 35, 77-78.
Schrooten C., Bovenhuis H., Coppieters W., Van Arendonk J. A. M. (2000) Whole Genome Scan to Detect Quantitative Trait Loci for Conformation and Functional Traits in Dairy Cattle. Journal of Dairy Science 83, 795–806.
Schütz-Hänke W., Stöber M., Drommer W. (1979) Klinische, genealogische und pathomorphologische Untersuchungen an schwarzbunten Rindern mit beidseitigem exophthalmisch-konvergierendem Schielen. Deutsche Tierärztliche Wochenschrift 86, 185-191.
Schulman N. F., Viitala S. M., de Koning D. J., Virta J., Mäki-Tanila A., Vilkki J. H. (2004) Quantitative trait loci for health traits in Finnish Ayrshire cattle. Journal of Dairy Science 87, 443-449.
Sisson S. (1953) The anatomy of the domestic animals. 4th edition, pp 860, 883- 884, 919.
Solinas-Toldo S., Lengauer C., Fries R. (1995) Comparative genome map of humans and cattle. Genomics 27, 489-496.
Sorkin J. A., Shoffner J. M., Grossniklaus H. E., Drack A. V., Lambert S. R. (1997) Strabismus and mitochondrial defects in chronic progressive external ophthalmoplegia. American Journal of Ophthalmology 123, 235-242.
Spelbrink S. M., Li F-Y., Tiranti V., Nikali K., Yuan Q.-P., Tariq M., Wanrooij S., Garrido R., Beeson D., Poulton J., Soumalainen A., Jacobs H. T., Zeviani M., Larsson C. (2001) Human mitochondrial DNA deletions associated with 106 Chapter 10. References
mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nature Genetics 28, 223-231.
Soumalainen A., Kaukonen J. (2001) Diseases caused by nuclear genes affecting mtDNA stability. American Journal of Medical Genetics 106, 53-61.
Stenman G., Sahlin P., Dumanski J. P., Hagiwara K., Ishikawa F., Miyazono K., Collins V. P., Heldin C.-H. (1992) Regional localization of the human platelet- derived endothelial cell growth factor (ECGF1) gene to chromosome 22q13. Cytogenetics and Cell Genetics 59, 22-23.
Stenman G., Sahlin P., Hagiwara K., Dumanski J., Collins V., Heldin C.-H. (1991) Mapping of the human platelet-derived endothelial cell growth factor (PD- ECGF) gene to chromosome 22q13. Cytogenetics and Cell Genetics 58, 2051.
Stone R. T., Pulido J. C., Duyk G. M., Kappes S. M., Keele J. W., Beattie C. W. (1995) A small insert bovine genomic library highly enriched for microsatellite repeat sequences. Mammalian Genome 6, 714.
Vaiman D., Mercier D., Moazami-Goudarzi K., Eggen A., Ciampolini R., Lepingle A., Velmala R., Kaukinen J., Varvio S. L., Martin P., Leveziel H., Guerin G. (1994) A set of 99 cattle microsatellites: characterization, synteny mapping, and polymorphism. Mammalian Genome 5, 288-297.
Van Goethem G., Dermaut B., Lofgren A., Martin J. J., Van Broeckhoven C. (2001) Mutations of POLG is associated with progressive external ophthalmoplegia characterized by mtDNA deletions Nature Genetics 28, 211-212.
Van Goethem G., Lofgren A., Dermaut B., Ceuterick C., Martin J.-J., Van Broeckhoven C. (2003) Digenic progressive external ophthalmoplegia in a sporadic patient: recessive mutations in POLG and C10orf2/Twinkle. Human Mutatation 22, 175-176. Chapter 10. References 107
Veenendal H. (1958) Exophthalmus en strabismus convergens (esophorie) bij en rund. Tijschrift voor Diergeneeskunde 83, 337-338.
Vissing J., Ravn K., Danielsen E. R., Duno M., Wibrand F., Wevers R. A., Schwartz M. (2002) Multiple mtDNA deletions with features of MNGIE. Neurology 59, 926-929.
Vogt C. (2000) Untersuchungen zum bilateralen Strabismus convergens mit Exophthalmus (BCSE) beim Deutschen Braunvieh. Diss. med. vet. Tierärztliche Hochschule Hannover.
Vogt C., Distl O. (2002) Untersuchungen zum bilateralen Strabismus convergens mit Exophthalmus beim Deutschen Braunvieh. Tierärztliche Praxis 30, 148-152.
Warren W., Smith T. P., Rexroad C. E., Fahrenkrug S. C., Allison T., Shu L., Catanese J., de Jong P. (2000) Construction and characterization of a new bovine bacterial artificial chromosome library with 10 genome-equivalent coverage. Mammalian Genome 11, 662-663.
Whittemore A. S., Halpern J. (1994) A class of tests for linkage using affected pedigree members. Biometrics 50, 118-127.
Williams J. L., Eggen A., Ferretti L., Farr C. J.,Gautier M., Amati G., Ball G., Caramori T., Critcher R., Costa S., Hextall P.,Hills D., Jeulin A., Kiguwa S. L., Ross O., Smith A. L., Saunier K., Urquhart B., Waddington D. (2002) A bovine whole genome radiation hybrid panel and outline map. Mammalian Genome 13, 469- 474.
Zhang Z., Gerstein M. (2003) Identification and characterization of over 100 mitochondrial ribosomal protein pseudogenes in the human genome. Genomics 81, 468-480.
Zschokke E. (1885) Schielen bei einer Kuh. Schweizer Archiv für Tierheilkunde 27, 174-176. 108 Chapter 11. Appendix
Chapter 11
Appendix
Chapter 11. Appendix - stages of BCSE 109
Clinical appearance of BCSE, classified into four stages
Figure 1 Stage one of BCSE Figure 2 Stage two of BCSE
Figure 3 Stage three of BCSE Figure 4 Stage four of BCSE 110 Chapter 11. Appendix - marker set
SOD1MICRO2 TGLA44 19,1 14,5 BMS711 TEXAN2 21 BMS2725 33,8 17 BMS1126 BMS4030
20,4 23,7 BMS4006 TGLA226 16,2 20 BMS4028 13 BMS2267 BM1824 5,2 UWCA46 20,4 FCB11 28,3 2 120 cM URB014 1 142 cM
BMS871 BMC1410
19,9 24,7 UWCA7 4,1 RM188 12,2 BMS482 17 BMS1840 23,3 17,6 MB099 INRA072 18,4 24,7 ILSTS064 IDVAG51 21,2 16,2 BMS835 BR6303 23,9 4 101 cM BMC4214
3 125 cM
BMS1095 ILSTS093 8,2 12,8 INRA133 BMS610
21,9 27,3 OarFCB5 BM1329
20,9 19,7 BMS1617 BMS518 20 16,1 RM127 BMS1216 22,9 24,5 BM8124 BM315 18,7 19,9 BMC4203 BMS597 9,4 BL1038 122 cM 5 6 125 cM Figure 5 Microsatellite markers on bovine chromosomes 1 to 6 Chapter 11. Appendix - marker set 111
BMS1864 RM012 7,3 19,1 BMS713 RM372 13,9 BMS2607 19,3 BMS678 21,3 BM741 22,9 10,6 BM6117 URB037 21,4 15,4 HEL9 (3) INRA192 20 33,8 BM9065 13,6 CSSM047 ILSTS006 (2) 18,1 8 116 cM BL1043
7 134 cM
BMS2151 BM3033 8,1 MB009
23,9 38,5
RM216 BMS2742 27 20,8 BMS1290 INRA071 9,7 21,8 CSRM60 (4) 10,1 BMS2251 BMS2641 18,3 21,7 ILSTS005 (5) BMS1967 9 108 cM 10 101 cM
BMS2621 BMS410 10 BMS1953 21,2 19,2 BL1022 CA096 19 TGLA28 25,6 21 ILSTS036 BMS975 16,9 BMS2047 18,5 BM4028 17,1 RM363 17,7 23,6 ILSTS033 HEL13 (3)
12 105 cM
11 123 cM Figure 6 Microsatellite markers on bovine chromosomes 7 to 12 112 Chapter 11. Appendix - marker set
TGLA23 BMS1747 5,3 CSSM66 (6) 14,9 31,1 RM180 17,1 BMS1352 BMC1207
31 26,3
RM327 BM4513 17,4 16,2 AGLA232 BL1036
13 87 cM 14 85 cM
BR3510 BMS357 19,8 17,4 JAB8 BM121 18,8 21,7 MB064 BMS1907 26,7 19,7 ILSTS027 IDVGA69 15,3 27,3 BM848 11,8 BMS429 BMS462 15 93 cM 16 96 cM
IDVGA31 BMS499
26,2 27,6 BMS2213 BMS1101 22,5 INRA063 30,9 8,3 BMS2639 MB008 19,3 27,7 TGLA170 TGLA227 17 BM1233 18 84 cM 17 98 cM Figure 7 Microsatellite markers on bovine chromosomes 13 to 18 Chapter 11. Appendix - marker set 113
BM9202 BM3517 15,9 19,1 BMS745 BMS1282 12,1 28,8 TGLA126
BMS2142 21,2 16,4 BM4107 MB020 22,6 24,8 BMS521 RM388 75 cM 12,5 20 BMC1013 19 99 cM
BM8115 CSSM026
21,8 30 INRA194 0,5 BSE1_MS2 (7) BM103 18,6 19,5 BMS2573 DIK064 20,7 BMS875 31,5 20 BMS743 BM4102 21 87 cM 22 81 cM
CSSM005 BMS917 12,6 16,8 BM1815 BMS2270 16,2 19,5 MB019 BMS1743 28,3 16,7 BMS1926 BM1905 23 67 cM 24 62 cM
BMC4216 BMS651 21,2 22,5 BMS2843 BSE3_MS2 (7) 24,1 15,4
BMS1353 BM188 15,3 19,2 AF5 BM804
25 64 cM 26 72 cM Figure 8 Microsatellite markers on bovine chromosomes 19 to 26 114 Chapter 11. Appendix - marker set
BM3507 BMS2060 17,8 BL25 34,1 18 BMS689 BMS2658 24,3 16,6 BMC2208 INRA027 28 52 cM 27 64 cM
BM4602 19,7 BMC8012
21,8 OarHH22
23,5 ILSTS081 29 65 cM
Figure 9 Microsatellite markers on bovine chromosomes 27 to 29
Most microsatellite markers were obtained from the linkage map of Kappes et al. (1997), freely available in the internet at the Website of the U.S. Meat Animal Research Center (MARC) of the United States Department of Agriculture (USDA) (http://www.marc.usda.gov/). Markers originating from other sources are indicated by arabian numerals. They are assigned to the following authors:
(1) Vaiman et al. (1994) (2) Brezinsky et al. (1993a) (3) Kaukinen and Varvio (1993) (4) Moore et al. (1994) (5) Brezinsky et al. (1993b) (6) Barendse et al. (1994) (7) Hauke et al. (2003) Chapter 11. Appendix - marker set 115
i Ref. 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 8 18 20 18 27 17 12 14 18 20 18 17 14 19 22 20 15 12 22 16 23 11 23 Repeat motif Repeat n.a. (TG) (TG) (TG) (CA)32 (CA) (TG) (TG) (TG) n.a. (CA) (CA) n.a. (CA) (TG) (TG) (CA) n.a. (TG) (CA) (TG) (TG) (CA) n.a. (CA) (TG) (TG) (TG) (TAAA) (TA)24 (TG)13 h IRD 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 800 700 700 700 700 700 700 800 800 800 800 800 800 g 136-176 106-124 131-157 162-180 148-158 92-120 178-192 116-150 115-127 136-172 106-128 122-158 129-151 89-109 139-168 103-113 84-100 200-224 137-157 160-180 136-174 129-145 172-202 202-224 123-147 165-187 112-138 173-183 205-222 bp f AT 61 58 60 58 60 58 58 60 62 58 58 58 58 58 50 58 56 55 58 58 58 58 56 58 60 58 58 54 58 Primer (reverse), 5´ -> 3´ -> 5´ (reverse), Primer AGCGATTCACAGTCACCTCACCTA TGAAATCGCAGAGTTGTACATG ACCTAGAGGAGTGAGATAGACGG TGACAGAGGGACCCATATCC ATATAGTGTGGGTGTGGGTGTG ATAAAGCAGATGTGGTGTGTGC CATTCTCCAACTGCTTCCTTG CTCTCACAGGTGGGGTC GCAACCTCCGTGTCCATCAACAG CACAACTTAGCGACTAAACCACCA ACTCTGGGTATGTATATGTGCAAG GCCAGCATCAAGTCAGCTC ACATGAAAAGAAGCAATATCGTAAC GAAGGTGTTCATCTCCCTTCC GGCCTGAACTCACAAGTTGATATATCTATCAC TCCAGTGACTCTTTTCTGCC GCAAATACAACCCAGTCTGGTG TAACTACAGGGTGTTAGATGAACTC TGGTGGACAGTCCCATACAG CTAAGAGTCGAAGGTGTGACTAGG CTAGAGGATCTATCCACAGC ATCTGCCTACCTGGGCATC GCATTTCCAGACCTTTCCTG CACATTGCTCAGCATCCATC GCACTATTGGGCTGGTGATT AAATCCACCCGAAGTATGAGG AGTGATTGAGCACATTGCGCAT ATTCCTTGATGGTCTAATGGTTA TTTGTTCCTCTTTATTTTCTTCTGC whole genome scan, comprising 164 markers (Continued on next page) Primer (forward), 5´ -> 3´ -> 5´ (forward), Primer AGGGCTACAGTCCACGGGTTG AGCTTCTTATGGCAACACCTG CTGGAGGATAATTGCTTTACAAA TGTACCCAACACAGGAGCAC CATCCATGTTGTTGCAAATAGC TGGGGTTGAAAAAGAACTGG GAGCAAGGTGTTTTTCCAATC CCATTTCTCTGTTGGTAACTGC CATTGGTAGGTGGGTTCTTTCC AACTGTATATTGAGAGCCTACCATG ACATTGTCATGTGGTTGCTAAC AGCCAGCAGCAATCAAGG AGTGGAATCCAGATAAGATGTATCA CACACTGAACATCGGCCC GCAAGCAGGTTCTTTACCACTAGCACC GAACATGAGGTTGACAAAGGA TGTAGCTCCCTGGAGGAGAA GAGTAGAGCTACAAGATAAACTTC ACTTCCCCAGTCTTCCCAGT CTGGAGGTGTGTGAGCCCCATTTA TTGGGTTGCCAAATTGCTCC TCATGTGCATGGGGTTTG CTAGATTGTTTTCTATGAACAGGGG AAGGCTAAAGGATGCAGGAG GGGTTCACAAAGAGCTGGAC TTTCAGCTGTTCACTTAGCTGC CTTAACTCATTCACCTCAACTG ATGGCAATATTTTGTTCTTTTTC TGAGCCATAGAATTAAGATTCAAGC e 0,68 0,47 0,5 0,7 0,77 0,74 0,69 0,67 0,48 0,25 0,31 0,55 0,56 0,38 0,79 0,43 0,16 0,52 0,64 0,46 0,76 0,24 0,74 0,55 0,72 0,52 0,38 0,35 0,55 PIC d 0,74 0,55 0,51 0,8 0,62 0,8 0,77 0,69 0,56 0,22 0,33 0,56 0,67 0,53 0,84 0,51 0,19 0,6 0,7 0,53 0,81 0,29 0,77 0,66 0,8 0,53 0,44 0,38 0,64 HET c A 5 4 8 8 6 8 4 7 5 4 3 6 4 3 11 4 3 8 8 9 12 5 7 6 7 5 5 4 4 d 59 57 57 56 72 62 61 61 41 83 69 77 52 47 88 32 61 83 58 56 75 40 62 54 50 56 55 55 67 HET c Literature BCSE- study A 16 9 9 8 10 12 8 14 8 16 10 13 12 7 14 4 7 13 9 8 18 9 13 9 9 8 12 6 6 Markers SOD1MICRO2 BMS711 BMS2725 BMS4030 BMS4006 BMS4028 BM1824 UWCA46 URB014 TGLA44 TEXAN2 BMS1126 TGLA226 BMS2267 FCB11 BMS871 UWCA7 INRA23 BMS482 MB099 ILSTS064 BMS835 BMC4214 BMC1410 RM188 BMS1840 INRA072 IDVGA51 BR6303 b Characteristics of the markerset selected for 1,9 21 42 59 79,4 95,6 108,6 113,8 142,1 8 22,5 56,3 80 100 120,4 0 19,9 24 36,2 59,5 77,9 99,1 123 0 24,7 41,7 59,3 84 100,2 cM a Table 1 BTA 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 3 3 4 4 4 4 4 4 116 Chapter 11. Appendix - marker set
i Ref. 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 1 1 4 14 23 23 19 16 16 20 15 19 20 12 15 17 16 16 15 18 18 25 20 13 15 15 16 Repeat motif Repeat (TG) n.a. (TG) (TG) (CA) (CA) (TG) (CA) (TG) (CA) (CA) (CA) (CA) (TG) n.a. (CA) (CA) (TG) (TG) (TG) (TG) (TG) n.a. n.a. (CA) (CA) (TG) (CA) n.a. h IRD 800 800 700 800 800 800 800 800 800 800 800 800 800 800 800 800 800 800 800 800 800 800 700 800 800 800 800 800 700 g 95-119 102-128 77-93 145-165 131-173 107-163 128-140 179-202 206-232 137-161 147-166 126-143 115-139 144-170 97-113 104-108 129-157 131-135 172-188 110-126 124-144 162-184 281-299 89-125 145-159 116-138 87-111 172-198 143-167 bp f AT 56 56 56 54 58 60 60 58 56 58 58 52 58 60 60 58 58 58 54 58 58 58 54 58 58 56 58 60 52 Primer (reverse), 5´ -> 3´ -> 5´ (reverse), Primer GTTGCAGAGTCGGACATGAC ATGTATTCATGCACACCACACA AAGTTAATTTTCTGGCTGGAAAACCC TCTGTGTCGGAATACCCTCC CAATGCTGTGGGTACTGAGG GCTCCTAGCCCTGCACAC AAGAAGACCTCTCTGACCCTCC TTGTTTTAACTCCCCACCCC GAATCTTCTCCCCCTGCATC AACACCGCAGCTTCATCC GGGCCCTGATCAGATAGGAT CAGCAACAGCAGTACCTAAACTC GATGGCAAACTGGCCTAGAG CCTGGGAAATCCCATGGAC GCAAAAGTCTAGGTGAAATGCC ACTGGGAACCAAGGACTGTCA ACCAGCAGTAGGTTGAGGTTAA TTCCTGTGGGCTGGCTAG CCAAAAGGTCCTATCTCCAAA GGTGAGCTACAATCCATAGGG TGTTTTAATTTGCATTTCCTGA GTCAACCTCAGCAAAACTGATG ACACGGAAGCGATCTAAACG GACTTGACCGTTCCACCTG TATAATGCCCTCCAAGTCCA ACTTAGATTTCCAAGCCCAGG GCAGAAACACAATACTCAGTGC GAGTGGCTGTTGCTAAATTTGG CACATCCATGTTCTCACCAC mprising 164 markers (Continued on next page) 164 markers (Continued mprising AAGAGCAAAGG Primer (forward), 5´ -> 3´ -> 5´ (forward), Primer AGGGATTGGTTTATGCTCTCTC TTTCACTGTCATCTCCCTAGCA GACCTGACCCTTACTCTCTTCACTC GCCTGCATGTGTCTGTGG GAGTAGAACACAACTGAGGACACA TGGTTTAGCAGAGAGCACATG AGAAGAAGAGC TGAAATATACCTGAGTAGCAGC ATCCTCAAAGCAACCTGGC TTGTTTAGGCAAGTCCAAAGTC GAAGACTTTTTCTTGGCTTACAGC GCCTGGAGGGCCTACACGTTC ACTCCAGGCATGTGTAAGGG GCAAATGTAAGCTGAAGGCC GGCAAGCTAGAGTCAGACACG CTGAGCTCAGGGGTTTTTGCT CCAAGGGAGGAAAAATAAGTTAA GGCCTGTGACTCCTTGTAGG GCCCCTGAAGGAATGGTG GTTCTGAGGTTTGTAAAGCCC GACCTTTACAGCCACCTCTTC ACTCTCCCTCCACACAGGG TGTCTGTATTTCTGCTGTGG AGTGCCAAAAGGAAGCGC ATATAGGGCAGCATTCTTTTCA TTCAACCCAACATCCACTTG ACCATCTACTGTGCTATGGCTT ACTGGAGACGACTGAAGCAACC CCCATTCAGTCTTCAGAGGT e 0,78 0,68 0,6 0,28 0,25 0,82 0,61 0,39 0,45 0,6 0,09 0,72 0,45 0,54 0,5 0,07 0,73 0,45 0,02 0,42 0,63 0,67 0,63 0,63 0,6 0,68 0,59 0,59 0,59 PIC d 0,8 0,8 0,66 0,34 0,22 0,78 0,45 0,4 0,45 0,62 0,1 0,77 0,55 0,55 0,62 0,08 0,78 0,45 0,02 0,58 0,69 0,76 0,72 0,75 0,73 0,72 0,64 0,69 0,72 HET selected for the whole genome scan, co for the whole selected c BCSE- study 9 8 4 5 8 10 2 5 6 6 2 6 5 6 6 3 8 3 2 3 5 5 6 10 6 5 6 6 7 A d 80 61 40 65 66 75 57 76 46 53 71 48 48 69 53 22 69 26 21 69 50 73 69 88 33 69 75 66 76 HET c Literature 13 12 6 8 19 17 6 19 7 9 8 6 11 10 7 3 13 3 8 5 9 7 10 16 6 11 11 8 13 A Markers BMS1095 BMS610 OARFCB5 BMS1617 BMS1216 BM315 BMS597 ILSTS093 INRA133 BM1329 BMS518 RM127 BM8124 BMC4203 BL1038 RM012 BMS713 BM2607 BM741 BM6117 INRA192 BM9065 ILSTS006 BL1043 BMS1864 RM372 BMS678 URB037 HEL9 b Characteristics of the markerset Characteristics 0 12,8 34,7 55,6 75,6 100,1 120 0 8,2 35,5 55,2 71,3 94,2 112,9 122,3 7,9 15,2 29,1 50,4 61 82,4 102,4 116 134,1 0 19,1 38,4 61,3 76,7 cM a Table 1 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 8 8 8 8 8 BTA Chapter 11. Appendix - marker set 117
i Ref. 1 1 1 1 1 1 1 1 1 1 5 1 6 1 1 1 1 1 1 4 1 1 1 1 1 1 1 1 1 8 (TC) 17 19 25 10 15 20 14 18 12 19 19 16 17 15 17 13 14 35 23 23 15 20 16 Repeat motif Repeat (TG) (TG) (CA) (CA) (CA) (TG) (TG) (CA) (TG) n.a. (CA) n.a. (TG) (TG) (CA) (TG) (TG) (CA) n.a. (TG) n.a. n.a. (CA) (TG) (CA) n.a. (TG) (CA) (CA) h IRD 800 700 700 700 700 700 700 700 800 800 700 800 700 800 800 800 800 800 800 700 800 800 800 800 700 700 700 700 700 g 149-170 125-145 141-159 96-118 97-123 94-108 79-105 104-106 127-159 193-229 90-108 173-179 181-185 115-121 104-124 90-116 139-169 143-193 146-154 177-197 80-108 98-118 137-157 84-98 102-126 132-158 92-116 85-105 81-111 bp f AT 58 58 60 52 58 58 58 58 58 58 58 58 54 58 58 58 60 58 58 52 58 58 58 58 58 56 58 58 56 Primer (reverse), 5´ -> 3´ -> 5´ (reverse), Primer CTGGGCACCTGAAACTATCATCAT ATGGAGTCACTGAAAGGTACTGA ACATGACAGCCAGCTGCTACT GATCTGAAAAAGAAATGAATAGA TTTTCTGGATGTTGAGCCTATT CTGGGTGAACAAATGGGC AACTGAGCTGTATGGTGGACG GCAAACTGCTGGATAGGGAG CTTCAGCATCTTGATTGTTGC GGCAGGACCTGAAGTGTGGTC ATCGACTCTGGGGATGATGT AAAGCCGGACTGGAGTGTC TGTTCTGTGAGTTTGTAAGC TTTTTGGAAGCTGGAGATGC TTTGCTGAGAGGACTTTGAGA TTAGCAGGGTGCCTGACACTT AGACAGGATGGGAAGTCACC AGTAGGTGGAGATCAAGGATGC AGGGTTGCTAGGGGCTTG CCATCTACCTCCATCTTAAC TTGCCACATTTACCTTCTTTCA AAGGGAGAGGACTGGTTTCTG GTCTCTGAAGATGTTTGGCCTT CCCAATGGCCAATTAAGTACC ATGGAAACATGGTCTCCTGC ATGCAGACAGTTTTAGAGGG TGCCCCAGTTGATTTATTAAAAACA TCTGCAAGGAATGACAGTGC GCAGTCCTGAGAGTAGTAAACTCTG mprising 164 markers (Continued on next page) 164 markers (Continued mprising TCACTATATGGC Primer (forward), 5´ -> 3´ -> 5´ (forward), Primer TCTCTGTCTCTA CCATTAAGAGGAAATTGTGTTCA GATCACCTTGCCACTATTTCCT TTCTGCAATGTTGAGCTTCAAG TTGGCACTTACTACCTCATATGTT AACGGCTTTCACTTTCTTGC GGGCAGATGTGAGTAATTTTCC TGCTGGTGGTCTTTGAACAG GCTTCAGTTCTGCTTTTCACC GCCTAGCATCCACAATACCAC CAAGACAGGTGTTTCAATCT GTGCGGAAAGGAACAGAGTC GGAAGCAATGAAATCTATAGCC TTCCCATATGCTAACGAGGG TGCTGTAGGAGAAAATAAAGCAG TCGCAAAAAGTTGGACAAGACT GAGTATTATGCTTGGGAGGC ACTATGGACATTTGGGGCAG AACAGCCCAAGAGACCCAC TAAGGACTTGAGATAAGGAG GGCTGAAAAGCTGTGGTGTT CAAAGCAATTTAAAAGCTGCC TGCTTCTGTAGGTTCTTAGACT TGGAGCTAAATCAATGCGTG ACGGAAGCAGCATCTCTTAC TATTAGAGTGGCTCAGTGCC GAGACACAAGCTTTCAACCACC GACTCCAGGTGCAGGAAGAG ATACGCCGCAAGAAATGATA e 0,71 0,7 0,77 0,59 0,59 0,65 0,77 0,61 0,71 0,76 0,68 0,63 0,33 0,32 0,74 0,31 0,74 0,68 0,44 0,59 0,68 0,48 0,34 0,14 0,49 0,31 0,59 0,35 0,72 PIC d 0,73 0,77 0,77 0,65 0,6 0,71 0,82 0,5 0,76 0,77 0,69 0,7 0,31 0,32 0,76 0,34 0,8 0,77 0,44 0,67 0,75 0,53 0,32 0,15 0,53 0,33 0,67 0,35 0,76 HET selected for the whole genome scan, co for the whole selected c BCSE- study 6 6 7 7 6 5 7 2 10 7 6 5 2 2 5 6 8 10 6 4 7 6 5 4 5 4 5 5 9 A d 62 67 71 85 69 54 71 56 85 68 62 33 38 42 82 77 80 73 73 88 50 65 65 66 43 48 62 65 HET c Literature 8 10 10 12 11 8 14 2 15 12 10 4 3 3 7 9 9 20 5 8 15 8 7 8 13 12 11 8 12 A Markers CSSM047 BMS2151 MB009 RM216 BMS1290 BMS2251 BMS1967 BM3033 BMS2742 INRA071 CSRM60 BMS2641 ILSTS005 BMS2621 BMS1953 CA096 ILSTS036 BMS2047 RM363 HEL13 BMS410 BL1022 TGLA28 BMS975 BM4028 ILSTS033 TGLA23 BMS1352 RM327 b Characteristics of the markerset Characteristics 110,5 0 8,1 32 59 80,8 102,5 0 38,5 59,3 69 79,1 97,4 2,1 12,1 31,3 56,9 73,8 90,9 114,5 0 21,2 40,2 61,2 79,7 97,4 0 31,1 62,1 cM a Table 1 8 9 9 9 9 9 9 10 10 10 10 10 10 11 11 11 11 11 11 11 12 12 12 12 12 12 13 13 13 BTA
118 Chapter 11. Appendix - marker set
i Ref. 1 1 7 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 13 (CA) 25 20 22 26 11 22 22 17 15 17 15 23 15 21 20 17 17 20 25 23 20 Repeat motif Repeat n.a. (TG) n.a. n.a. (TG) (CA) n.a. (CA) (TG) n.a. (CA) (TG) (TG) (TG) (CA) n.a. (CA) (CA) (TG) (CA) n.a. (TG) (TG) (TG) (CA) (CA) n.a. (CA) (TC) h IRD 700 800 700 800 800 800 800 700 700 700 700 800 700 700 700 700 800 800 700 700 700 700 700 700 700 700 800 800 800 g 155-183 81-99 175-199 120-142 128-150 141-161 178-202 90-114 218-244 150-168 159-171 215-227 119-143 104-117 114-160 107-119 191-207 108-130 102-130 139-183 222-243 81-101 166-182 197-223 118-146 178-188 155-185 76-102 79-115 bp f AT 54 58 58 58 58 58 56 60 56 58 58 58 56 58 58 58 58 58 58 60 66 58 58 60 58 58 58 56 56 Primer (reverse), 5´ -> 3´ -> 5´ (reverse), Primer AATGGTTCTACATTTGCTAGGTGTC GGCTTTGTATTCCCCTCTCC AATTTAATGCACTGAGGAGCTTGG GGAGTCTGGTGGGTTACAGTCC GGGTGGAATAGTCAGTCCCA TCAGCAATTCAGTACATCACCC ATCTGATGTGGGTTTCTGACTG ACCCCGTGGACTGTAGTCTG GGTGAGTGTAACACCTGTGTGCG CAACTGGCAAAATTTCATTCTT GAATCATAGACCTGACTTCC CCCTCTGCTCCTCAAGACAC CCCTTGATTTCTCTCATGAGTATT CCAAATAATTGCTGGTCAGG ACTAGCACTATCTGGCAAGCA CTCTCAAAAAGTAGTGTGTGCCT CAGCGTCTGTGGACCATTTC CTCACTTCCTCCTCAGGTGC TTTAAGGTAGATGGGTAGTTGTACG TCCATGAACAGAGGATGCTG GCACCCCAACGAAAGCTCCCAG AGTAAGGACCTGCTGTATAGCA ATGTACAACTGAATCACTCCGC AACGCAGCCAGCAGGGTCAGG CTTCAAGAGCCTTCAGTGGG AAACCACAGAAATGCTTGGAAG GAGAGATAAATTGGGAGTTTGAGA ACAGACAGAAACTCAATGAAAGCA GCATCCCGGTCTCCTATG mprising 164 markers (Continued on next page) 164 markers (Continued mprising Primer (forward), 5´ -> 3´ -> 5´ (forward), Primer CCTTTGCAAATACCTCCTGACCAG TCTAAGCTCCTTGAAGACAGGC ACACAAATCCTTTCTGCCAGCTGA TGGCCAAGACATCTGCCATTCC ACCAACAAGTCTGAATCTTCATT GCGCAAGTTTCCTCATGC TAGCTTATGCCATTGTTTTTGC GCTGGTGGGTTGTTTACCAC CACGTCACCCGCTTTCTCTTG GGGACTCATAGACCATTCATAGC GGTGTGTTGGTTAAGACTGG TGGTTGGAAGGAAAACTTGG TACATTAACCCCAAAATTAAATGC TCCAAACAAGTCTTCTCTATTTACC TGGCATTGTGAAAAGAAGTAAA AAGTGATGGGACCAGATTAGG TGTGCCTTGGGATGATTTTT TGCAGACGGGAGAAAAGC CAGGCTTAAGTATCAAACTTTCTTC TACATGTTTGTGAGGGCTGC TGCATGGACAGAGCAGCCTGGC GTCCTTGTTGATTATGTTACACAT TGGCAGGTGGATTCTTTACC CCTTGAGATGAATGTTTGAGGATG ATGGGCAGCTTAGGGATTG ATTTGCACAAGCTAAATCTAACC ATATCGTTTTCAGATTTCTTTTGC CGAATTCCAAATCTGTTAATTTGCT TCTATGAAGACTTTCAGGACCTTC e 0,77 0,58 0,72 0,58 0,77 0,57 0,66 0,49 0,48 0,45 0,69 0,21 0,59 0,39 0,71 0,18 0,47 0,09 0,68 0,75 0,72 0,34 0,6 0,76 0,69 0,52 0,71 0,79 0,7 PIC d 0,74 0,63 0,73 0,62 0,87 0,63 0,65 0,53 0,76 0,56 0,8 0,22 0,64 0,35 0,83 0,19 0,54 0,1 0,7 0,8 0,8 0,45 0,67 0,81 0,7 0,6 0,77 0,81 0,7 HET selected for the whole genome scan, co for the whole selected c BCSE- study 10 5 9 7 9 6 11 5 4 6 6 2 6 3 7 5 4 4 9 7 9 2 5 8 5 6 9 9 7 A d 73 69 . 59 73 69 57 60 51 52 69 37 67 67 72 75 27 63 56 71 71 58 52 62 65 69 71 80 69 HET c Literature 15 9 13 10 10 10 10 10 9 8 6 4 10 7 19 6 6 8 12 12 8 5 9 9 11 6 13 13 10 A Markers AGLA232 BMS1747 CSSM66 RM180 BMC1207 BM4513 BL1036 BR3510 JAB8 MB064 ILSTS027 BM848 BMS429 BMS357 BM121 BMS1907 IDVGA69 BMS462 BMS499 BMS1101 MB008 TGLA170 BM1233 IDVGA31 BMS2213 INRA063 BMS2639 TGLA227 BM9202 b Characteristics of the markerset Characteristics 79,5 4,2 9,5 19,1 36,2 62,5 78,7 1 20,8 39,6 66,3 81,6 93,4 7,1 24,5 46,2 65,9 93,2 3,8 31,4 62,3 81,6 98,6 0 26,2 48,7 57 84,7 0 cM a Table 1 13 14 14 14 14 14 14 15 15 15 15 15 15 16 16 16 16 16 17 17 17 17 17 18 18 18 18 18 19 BTA Chapter 11. Appendix - marker set 119
i Ref. 1 1 1 1 1 1 1 1 1 1 1 8 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 70 16 17 13 21 16 23 20 20 23 19 15 20 29 20 22 12 20 20 30 18 16 15 15 33 (TG) (CGG) (CA) (CA) (CA) (TG) n.a. (TG) (CA) (TG) (AT)5 (AT)6 (AT)4 (GT)9 (TG) n.a. (CA) (TA) (TG) (TG) (TG) (TG) (TG) (GA) n.a. (CA) (CA) (CA) (TG) (TG) (TG) Repeat motif (TG) h IRD 800 800 800 800 800 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 700 800 800 800 800 800 g 99-123 81-113 173-183 134-150 216-228 104-124 141-159 116-122 157-191 134-150 119-143 187-199 146-166 96-120 121-159 238-278 145-165 117-133 97-105 137-173 115-133 140-170 188-224 170-199 146-160 70-110 135-171 124-150 161-171 bp f 58 58 58 58 54 58 58 58 58 56 54 57 56 54 56 58 56 58 58 58 56 60 58 58 58 58 58 56 54 AT Primer (reverse), 5´ -> 3´ TGCAAGCTGTGAGGAGGAG GTCGGCACTGAAAATGATTATG GTTGGGTCCTTACTAAATAACGAGC GGGACAGCCAGTCTTCTCAG TAGGTAGTGTTCCTTATTTCTCTGG TGTCAAATTCTATGCAGGATGG CCTCCTTCCTCCAGAGCC TTGGTCTCTATTCTCTGAATATTCC AGCCCCTGCTATTGTGTGAG GTGTGCTCTAAAGGATTCAGGG CCACCCCAAAGACCTTTCTA ATATTGGCAGTGGCATGATC GGCTGCTCTGGGCTATTG AAAGGCCACTTATGAATCCAT GCTCTGAAATTCTGGCAGTG TTTTCCCATTATGGTTTATCCCAG AAAAAGAATACTCCACAGTTCTGG GTTAATTGTGTATTACTGCTGCCA AAGCAAAGGCTGGGAACAC GAGCGGCCTATCAACCCTAC GTCCTTACTATCTTTAAGTGACTG CAAGGAGACAAGTCAAGTTCCC TCGCGATCCAACTCCTCCTGAAG ACGCCTGCTGATGCTGTAG CAAGCTGGTTGTTCTTTTGC GCAGGAAGGCTGATGCAC TGGCAAAGCAAAGAGGAAGT TTCTCCCAATCTGTAACTGCA GAGTGGTTCACAAAAATGTGC whole genome scan, comprising 164 markers (Continued on next page) Primer (forward), 5´ -> 3´ TAGGGACTTGTTACCCGTGG AAGCAGGTTGATGATCTTACCC TGTCTAAAATGCTGTAGCTTTGGTG GGGGACCATCACGTACACTC AAAAATGATGCCAACCAAATT GTGTGTTGGCATCTGGACTG ACTCTTCCACAGTTGGCCTG CTAATTTAGAATGAGAGAGGCTTCT ATAGGCTTTGCATTGTTCAGG GAATTTGGAAACATGCTGGG AATCAACATCCAGATTTCTTTTTG CTGAAGTGTGACAGCTTTTGG CTAGCTGCTGGCTACTTGGG CATCATTCTAATGGTAAGGAG AGCTACCCTGGTATACAACACG GACTTCTGCTTGTGGTTTCCAAGT CCTGTTTCAGAATAAATTCCAGTT ACACAGGAAACCATCAGCAT TCCAGCTTGAATCCCTTCC CCAAATTCCACTGTGCTGC TGTACTATATAAGCACCAGAGAGT AGAGGATGATGGCCTCCTG GGAGGGTTACAGTCCATGAGTTTG GTCCATGGGTTCACAAAGAG TAATGCCTCTGGAAGGTTGA CTGCGTTAACACCCCACC ACTCAGGAGTCTCTCTTGCACA CAACTAGCTTCTCAATGCCTTT TGAGGGAAAAGGGAGATGG e 0,6 0,62 0,47 0,64 0,62 0,7 0,63 0,16 0,45 0,5 0,65 0,76 0,71 0,39 0,71 0,67 0,41 0,65 0,42 0,54 0,61 0,59 0,8 0,56 0,3 0,68 0,57 0,68 0,56 PIC d HET 0,67 0,69 0,47 0,79 0,63 0,72 0,59 0,18 0,54 0,43 0,7 0,88 0,78 0,45 0,75 0,77 0,46 0,66 0,55 0,64 0,38 0,63 0,84 0,59 0,33 0,76 0,66 0,69 0,62 c BCSE- study 8 8 2 4 3 8 6 2 6 4 6 7 6 4 9 5 5 5 3 4 7 7 13 6 3 6 6 5 4 A d 63 73 45 55 48 69 71 67 35 67 50 . 73 52 71 62 73 71 46 52 51 67 78 57 38 83 81 69 51 HET c Literature 12 16 6 6 7 10 9 3 10 6 12 5 10 9 18 15 5 9 5 9 9 8 11 11 7 19 16 11 5 A Markers BMS745 BMS2142 MB020 RM388 BMC1013 BM3517 BMS1282 TGLA126 BM4107 BMS521 BM8115 BSE1_MS2 BM103 DIK064 BMS743 CSSM026 INRA194 BMS2573 BMS875 BM4102 CSSM005 BM1815 MB019 BM1905 BMS917 BMS2270 BMS1743 BMS1926 BMC4216 b Characteristics of the markerset selected for 15,9 44,7 61,1 85,9 98,4 0 19,1 31,2 52,4 75 0 15 30,5 50 81,5 0 21,8 40,4 61,1 81,1 7,2 19,8 36 64,3 4,4 21,2 40,7 57,4 0 cM a Table 1 19 19 19 19 19 20 20 20 20 20 21 21 21 21 21 22 22 22 22 22 23 23 23 23 24 24 24 24 25 BTA
120 Chapter 11. Appendix - marker set
i Ref. 1 1 1 1 1 8 1 1 1 1 1 1 1 1 1 1 1 1 1 21 20 10 (CA) (TA) (CA) 15 9 21 20 30 17 17 27 20 22 15 20 19 16 14 35 10 Repeat motif Repeat (TG) (TG) (TG) (TG) (CA) (CA) n.a. (TG) (CA) (CA) (CA) (CA) n.a. (TG) (TG) (TC) (CA) (CA) (CA) h IRD 800 800 800 700 800 700 700 700 700 700 700 800 800 800 800 800 800 800 800 g 214-252 90-130 132-158 109-145 139-161 113-117 97-119 136-158 159-189 140-170 152-164 83-103 161-183 114-134 139-151 112-144 199-215 103-126 88-122 bp f AT 58 58 58 58 58 59 54 58 58 58 58 58 58 58 56 58 58 56 56 Primer (reverse), 5´ -> 3´ -> 5´ (reverse), Primer TCCTCCAGTGGGAAATATGG ATTCAGACCTGCCTGGTGAC GATCCTGCGAGCCACAAG CCTGGCAAGCAACAGTTAAT AAATGCCACACATTCAAACTC TCTGCTCATGCACTGTAACTTG GAGGAACATTGCGAGGCTAC GGCAGATTCTTTGCCTTCTG TAGTGCGGAGTCAGTCATGTG ACAAGCTCTAGGTTCATCTGCC CACTGCATCCCTCCCCACTAAC TCCAATTTTAGCCATCTTTGTG AGTCAGGATCTAGTGGGTGAGTG CTGGCCCCAGACACAATC ACGAGTCCCTGCTGCTCTAC GCAGCTTTAGCATCTGGGTC GATTCCAGAAAGTTCCCCCA CTCAGTTTAATTCCATAGACCAACAGG TTTCGAACAGGCTTTTGGGG References 1 MARC/USDA (1994) et al. 2 Vaiman (1993a) et al. 3 Brezinsky (1993) et Varvio 4 Kaukinen (1994) 5 Moore et al. (1993b) et al. 6 Brezinsky (1994) 7 Barendse et al. (2003) 8 Hauke et al. Primer (forward), 5´ -> 3´ -> 5´ (forward), Primer ATCCAAGGAGGTCCCAGG TTTCAGGACTAATAGGGCATGG GCAGAAGGAAAAAGCAATGG AATATGTGAAAACAAGTCAAAGCA GAAGATGGGCCCTATAGCTG TGGGAAGGTGAGAGTTCTTGG AGTCGCCAAGTCGTGTCTG CCAGCATCAACTGTCAGAGC GCCCAAAGAAAGAAGTATGTGC GCCTCCCTTTCCCTGATC CTCCCCACTTAGGAACTCTGTATC TTGGTAAAGGAGGTATGCAATG AACAGTGGCAATGGAAGTGG TCCCTGGACTTCTTGCAGAG GTTGAGCAGGGGGTAACAAG GTGCATTCACACATCTCCATG AATTCCATGCACAGAGGACC CAACAGGACCTTGAAAACCACACC AGTCAGACAACGACTGTGCG for the whole genome scan, comprising 164 markers genome scan, comprising for the whole e 0,4 0,5 0,57 0,78 0,66 0,51 0,68 0,67 0,79 0,74 0,55 0,47 0,54 0,64 0,35 0,64 0,74 0,6 0,7 PIC d 0,43 0,54 0,55 0,75 0,68 0,59 0,78 0,69 0,8 0,77 0,59 0,6 0,5 0,69 0,35 0,65 0,86 0,66 0,81 HET c BCSE- study 7 9 6 8 5 3 8 6 9 6 4 4 7 9 3 8 8 5 5 A d 46 81 69 82 58 . 62 42 87 52 65 56 79 69 43 75 49 46 79 HET c Literature 6 19 12 13 8 3 10 10 16 11 6 9 6 10 6 14 9 10 15 A e, marker labelling Markers BMS2843 BMS1353 AF5 BMS651 FASMC2 BSE3_MS2 BM188 BM804 BM3507 BMS689 INRA027 BMS2060 BL25 BMS2658 BMC2208 BM4602 BMC8012 OARHH22 ILSTS081 b Characteristics of the markerset selected of the markerset selected Characteristics 21,2 45,3 60,6 2,5 13,8 25 40,4 59,6 0 34,1 58,4 0 17,8 35,8 52,4 0 19,7 41,5 65 cM a Table 1 a Bovine chromosome (cM) marker of b Position c Alleles d Heterozygosity (%) content information e Polymorphism (°C) Annealing temperature f g Product size (bp) h Impact recording devic i Reference 25 25 25 26 26 26 26 26 27 27 27 28 28 28 28 29 29 29 29 BTA Chapter 11. Appendix - marker set 121
i Ref. 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 11 15 (TG) (CA) 20 20 19 26 32 14 15 15 13 12 19 20 22 24 13 20 95 15 25 12 27 (TG) n.a. n.a. (CA) n.a. (TG) (CA) (TG) n.a. (TG) n.a. n.a. (CA) (TG) n.a. (CA) (TG) (CA) (TG) (TG) n.a. (TG) (TG) (CA) (CA) (TC) (TG) (CA) Repeat motif (CA) h IRD 700 700 800 800 700 700 700 700 800 800 800 700 700 700 700 700 800 800 700 800 700 700 800 800 800 700 800 700 800 g bp 148-168 75-85 302-332 242-256 114-136 237-257 133-157 108-126 176-184 265-289 90-112 236-260 145-165 74-102 141-171 183-209 144-182 100-116 122-128 128-150 190-200 156-172 105-115 261-281 92-114 146-160 137-157 81-97 129-141 f 56 58 56 54 58 54 58 60 60 58 58 58 56 56 54 58 58 58 58 56 58 58 58 63 56 58 56 58 58 AT Primer (reverse), 5´ -> 3´ ACTGATGTGCTCAGGTATGACG TGTCCAAGAAGATCAGGTCTCA CATCGTGAATTCCAGGGTTC CTTATTTCAAAATTCGGTTGGG GTGGTCTATTGAACTTTTGTTCAGA ATGACTTTATTCTCCACCTAGCAGA GAGTTTCCTTTTTCCCCCAC ATCCTTGCCCTAATTCTCATTC CTTACAGTCCTTGGGGTTGC ACCGGCTATTGTCCATCTTG TCTCCCCACCTCTTCCATC CATTCATGTTGCTGTAAATGGC TCACCCTGACTGTGAATGC CTGGGTCTTCATGGTAGGGA GAGCTAATCACCAACAGCAAG AATGCAGAAATCCACAAAGCTCATC TCTGAATCTACTCCCTCCTCAGAGC AGGTGCGACTGAGACATGC TCCAAGTTGAGCCTTAGTTCTT CACTGACTATGTGACTTTGGGC TCTAAAACGGAGGCAGAGATG AGGTTGCTGGCTCCTTTTCT GGCAATCAGTCGGACACAC ATTTACCACAGACCTTATCCTC TCAGAGTTTGGGGTCCTCAG ATGTTATTCCATCAGGAGGAGC CGCTGCTGTCAACTGGGTCAGGG AGACACGCCTGCATCAGAG AACTGCCACCACTGTCAGG (continued on next page) Primer (forward), 5´ -> 3´ GCAACTAAGACCCAACCAAC CAATTAAAAAACCCTGACAGCA AAAATCCCTTCATAACAGTGCC TCAATCCCTGGGTCAGGAAG TCTGTGCACTTTACATTTAACAGA GAAACTCAACCCAAGACAACTCAAG AAGCCATTGATTGTAGATTGGG AAGGGTCAGACAAAACTTAGCA AGTCTGAAGGCCTGAGAACC GCACCAGCAGAGAGGACATT GACATCACTTTGGGGCATG GCAATCCCACTCTCCAGGTG AAATTTTTCATCCTTCTTTCTGAC ACAAAACCACTTTCTTAGCAAACA GCTACAGCCCTTCTGGTTTG TATTCCAGAGAATGTTTAAGAGCCT TACAGTCCATGGGGTCACAAGAG AAATAAATGTCACCTATGGGGC TGCTCAGTTATGCTTGAGAGTC TCGAATGAACTTTTTTGGCC GTGACTGTATTTGTGAACACCTA GTCTCCCTTCAGTGTTCCCA ACAAACCTGTGCGCCTTG CCACTGTACCCACCTGAACTTG CCCAAAAGAAGCCAGGAAG ACTTAGCACAATGCCCTCTAGG CCCTAGGAGCTTTCAATAAAGAATCGG TTGACAACCAAGGCCTCC GAAAGCTGGAGCAAACATCC for the fine mapping e 0,6 0,3 0,66 0,23 0,4 0,44 0,28 0,57 0,27 0,62 0,65 0,6 0,64 0,76 0,64 0,37 0,58 0,45 0,02 0,42 0,8 0,73 0,5 0,28 0,34 0,29 PIC d 0,57 0,3 0,76 0,28 0,49 0,39 0,32 0,67 0,29 0,69 0,76 0,55 0,66 0,78 0,69 0,38 0,61 0,79 0,38 0,83 0,53 0,02 0,44 0,81 0,75 0,6 0,3 0,36 0,35 HET c BCSE- study A 8 3 10 3 3 5 4 5 5 6 6 6 6 6 7 4 5 3 3 7 3 2 3 9 7 4 4 4 3 d HET 44 34 63 40 50 59 46 65 33 74 73 58 54 61 73 60 82 56 38 68 37 13 59 50 85 56 57 70 50 c Literature A 9 4 15 5 11 11 9 7 4 9 10 10 10 11 14 7 11 9 4 11 6 4 4 5 11 7 7 9 6 Markers BMS6026 BMS695 BP1 BL23 RM103 AGLA293 BMS1315 BM321 ILSTS22 BMC1009 BMS1898 BL37 BL4 BMS360 BM415 TGLA13 MCM64 BMS1348 BMS538 BM4025 IDVGA55 RME001 BMS2785 MS936FBN BM2078 BM6507 OARFCB304 BMS1932 HMH1R b Additional microsatellite markers used 6,7 9 18,8 28,6 28,6 32 32,5 38 38 40,6 44,1 50,9 51,2 66,5 76,3 51,4 62,7 12,8 24,4 28,6 70,5 70,5 73,7 75 77,8 78,9 69,5 71,8 77 cM a Table 2 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 8 8 16 16 16 18 18 18 18 18 18 22 22 22 BTA
122 Chapter 11. Appendix - marker set
i Ref. 1 1 1 20 14 Repeat motif n.a. (TG) (TG) h IRD 700 800 700 g bp 283-301 151-175 92-108 f 56 58 58 AT Primer (reverse), 3´-> 5´ AGCCTCAGCACATGGAAATG GATCCCAGAGAATCACTCACC AGCCGGACACAACTGAGTG References MARC/USDA 1 2 Brunner et al. (2003) Primer (forward), 3´-> 5´ TGTGAATTTCCATCTACTTGGC TAATTGATCACAAAGAGGAGCC TTTTCCCAGATTGGCTTGTC e PIC 0,56 0,8 0,49 d 0,6 0,84 0,56 HET rkers used for the fine mapping c BCSE- study 5 11 6 A d HET 56 83 67 c Literature 8 13 8 A Markers DIK115 BMS1857 BMS764 b Additional microsatellite ma cM 79 0,9 9,7 a Table 2 a Bovine chromosome b Position of marker (cM) c Alleles d Heterozygosity e Polymorphism information content (%) f Annealing temperature (°C) g Product size (bp) h Impact recording device, marker labelling i Reference BTA 22 29 29
Chapter 11. Appendix - gene abbreviations 123
Table 3 Abbreviations of gene names
Short name Full name AAAS Achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) APAF1 Apoptotic protease activating factor BAX BCL2-associated X protein BI550285 cDNA clone IMAGE 5275947 CD37 CD37 antigen CNOT2 CCR4-NOT transcription complex, subunit 2 DCN Decorin EPN1 Epsin 1 GRP49 Leucine-rich repeat-containing G protein-coupled receptor 5 HGT2 Glycoprotein, alpha-galactosyltransferase 1 pseudogene HMGA2 High mobility group AT-hook 2 HOXC9 Homeo box C9 ITGA7 Integrin alpha 7 KCNC2 Potassium voltage-gated channel, Shaw-related subfamily, member 2 KCNJ14 Potassium inwardly-rectifying channel, subfamily J, member 14 KCNJ8 Potassium inwardly-rectifying channel, subfamily J, member 8 KIAA0748 KIAA0748 gene product KIF21A Kinesin family member 21A KITLG KIT ligand LIM2 Intrinsic membrane protein 2 LOC283400 Hypothetical protein LOC283400 LOC390334 Hypothetical gene supported by NM_152636 MGC2705 Suppressor of variegation 4-20 homolog 2 (Drosophila) MRPS35 Mitochondrial ribosomal protein S35 NKG7 Natural killer cell group 7 sequence OR6C1 Olfactory receptor, family 6, subfamily C, member 1 OSBPL8 Oxysterol binding protein-like 8 PFKM Phosphofructokinase, muscle PLXNC1 Plexin C1 PPFIA2 PTPRF interacting protein alpha 2; liprin-alpha 2 PRKCG Protein kinase C, gamma PRPH Peripherin RPL28 Ribosomal protein L28 SLC27A5 Solute carrier family 27 (fatty acid transporter), member 5 SNRPF Small nuclear ribonucleoprotein polypeptide F SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 STAT2 Signal transducer and activator of transcription 2, 113kDa STK13 Aurora kinase C SYT1 Synaptotagmin 1 TNNT1 Troponin T1, skeletal, slow TRHDE Thyrotropin-releasing hormone degrading ectoenzyme UBE2N Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) ZIM2 Zinc finger, imprinted 2 ZNF132 Zinc finger protein 132 (clone pHZ-12) ZNF582 Zinc finger protein 582
124 Chapter 11. Appendix - itemisation of alleles
Table 4 Itemisation of alleles to basepairs (bp) for microsatellites in the pedigrees
Code no. 1 2 3 4 5 6 7 8 9 10 11 12 AGLA293 219 221 223 225 227 229 231 233 235 237 239 241 BL23 244 246 248 250 252 254 256 258 260 262 264 266 BM6507 144 146 148 150 152 154 156 158 160 162 164 166 BMC1009 274 276 278 280 282 284 286 288 290 292 294 296 BMS1898 86 88 90 92 94 96 98 100 102 104 106 108 BMS2785 105 107 109 111 113 115 117 119 121 123 125 127 BMS321 107 109 111 113 115 117 119 121 123 125 127 129 BP1 308 310 312 314 316 318 320 322 324 326 328 330 MS936FBN 204 206 208 210 212 214 216 218 220 222 224 226 OARFCB5 101 103 105 107 109 111 113 115 117 119 121 123 RM103 120 122 124 126 128 130 132 134 136 138 140 142 TGLA227 80 82 84 86 88 90 92 94 96 98 100 102
Table 5 Itemisation of alleles to bases for SNPs in the pedigrees
Code no. 1 2 CH240-155H10_10 C G CH240-35P12 G T CH240-24G6 A G CH240-34B7_1 C G CH240-34B7_4_a C G CH240-34B7_4_b A G CH240-34B7_8 C T CH240-36N21 C T CH240-433A8_1_a G T CH240-433A8_1_c G T CH240-433A8_5 C T CH240-57N14 C T CH240-64C19 G T CH240-98C16 A C Chapter 11. Appendix - laboratory paraphernalia 125
Laboratory paraphernalia
11.1 Equipment
Thermocycler PTC-100™ Programmable Thermal Controller (MJ Research, Watertown, USA) PTC-100™ Peltier Thermal Cycler (MJ Research, Watertown, USA) PTC-200™ Peltier Thermal Cycler (MJ Research, Watertown, USA)
Automated sequencers LI-COR Gene Read IR 4200 DNA Analyzer (LI-COR, Inc., Lincoln, NE, USA) MegaBACE 500 (Amersham Biosciences, Freiburg)
Centrifuges Sigma centrifuge 4-15 (Sigma Laborzentrifugen GmbH, Osterode) Desk-centrifuge 5415D (Eppendorf, Hamburg) Biofuge stratos (Heraeus, Osterode) Centrifuge Centrikon H 401 (Kontron, Gosheim) Megafuge 1.OR (Heraeus, Osterode) Speed Vac® Plus (Savant Instruments, Farmingdale, NY, USA)
Agarose gel electrophoresis and pulsed field gel electrophoresis Electrophoresis chambers OWL Separation Systems, Portsmouth, NH, USA Biometra, Göttingen BioRad, München Generators 2301 Macrodrive 1 (LKB, Bromma, Sweden) Power Pac 3,000 (BioRad, München) Gel documentation system BioDocAnalyze 312 nm, Göttingen
Fluorescence in situ hybridisation Zeiss Axioplan 2 microscope (Carl Zeiss, Jena) SenSys Digital CCD Camera system, Kodak KAF 1400 (Fa. Photometrics, München) 126 Chapter 11. Appendix - laboratory paraphernalia
Pipettes Multipette® plus (Eppendorf AG, Hamburg) Pipetus®-akku (Hirschmann® Laborgeräte GmbH & Co.KG, Eberstadt) Pipetman® (P2, P10, P20, P100, P200, P1000) (Gilson Medical Electronics S.A., Villiers-le-bel, France) Pipettor, Multi 12 Channel (0.1 – 10 µl) (Micronic® systems, Lelystad, The Netherlands) Impact® Pipettor 8-Channel (Matrix Technologies Corporation, Lowell, USA) HAMILTON 8-channel syringe (Hamilton Company, Reno, NV, USA) Distriman® (Abimed, Langenfeld)
Others Milli-Q® biocel water purification system (Millipore GmbH, Eschborn) Incubator VT 5042 (Heraeus, Osterode) UV-Illuminator 312 nm (Bachhofer, Reutlingen) Centomat® R Desk-Shaker (B. Braun Melsungen AG, Melsungen) Biophotometer (Eppendorf AG, Hamburg)
11.2 Kits
DNA purification
Montage PCR96 Cleanup Kit (Millipore GmbH, Eschborn)
FISH Dik-Nick Translation Mix (Roche, Penzberg) Digoxigenin-FITC Detection Kit (Quantum Appligene, Heidelberg)
Isolation of DNA QIAamp 96 DNA Blood Kit (QIAGEN, Hilden) DNeasy Tissue Kit (QIAGEN, Hilden) LIFE SCIENCE Nucleon BACC2 Kit (Amersham Biosciences, Freiburg) HiSpeed Plasmid MIDI Kit (QIAGEN, Hilden) Plasmid Mini Prep 96 Kit (Millipore GmbH, Eschborn) Chapter 11. Appendix - laboratory paraphernalia 127
Radioactive hybridisation RadPrime DNA Labelling System (Gibco-BRL, Eggenstein)
Sequencing ThermoSequenase Sequencing Kit (Amersham Biosciences, Freiburg) DYEnamic-ET-Terminator Cycle Sequencing Kit (Amersham Biosciences, Freiburg, Germany)
11.3 Size standards
100 bp Ladder (New England Biolabs, Schwalbach Taunus) 1 kb Ladder (New England Biolabs, Schwalbach Taunus) IRDye™ 700 or 800 (LI-COR, Inc., Lincoln, NE, USA)
11.4 Reagents and buffers
APS solution (10 %) 1 g APS
10 ml H2O
Bromophenol blue solution 0.5 g bromophenol blue 10 ml 0.5 M EDTA solution
H2O ad 50 ml
Buffer X1 10 mM Tris-Cl pH 8.0 5.0 ml 10 mM EDTA [0.5 M] 10 ml 100 mM NaCl 2.92 g SDS [2%] 10 g
H2O ad 500 ml add directly prior to usage per ml: 40 µl DTT [1M] 128 Chapter 11. Appendix - laboratory paraphernalia
14 µl Proteinase K [20mg/ml] dNTP solution 100 µl dATP [100 mM] 100 µl dCTP [100 mM] 100 µl dGTP [100 mM] 100 µl dTTP [100 mM]
1600 µl H2O the concentration of each dNTP in the ready-to-use solution is 5 mM
Gel solution 12.75 ml Urea/TBE solution (Roth, Karlsruhe) 2.25 ml Rotiphorese® Gel 40 (38% acrylamide and 2% bisacrylamide) 95 µl APS solution (10 %) 9.5 µl TEMED
High stringency wash buffer II
1 mM NA2EDTA
40 mM NaHPO4, pH 7.2 1% SDS
Hybridisation solution II (Church buffer) 1% bovine serum albumine (BSA) 1 mM EDTA
0.5 M NaHPO4, pH 7.2 7% SDS
Loading buffer for agarose gels EDTA, pH 8 100 mM Ficoll 400 20% (w/v) Bromophenol blue 0,25% (w/v) Xylencyanol 0,25% (w/v) Chapter 11. Appendix - laboratory paraphernalia 129
Loading buffer for gel electrophoresis 2 ml bromophenol blue solution 20 ml formamide
Low stringency wash buffer II 0.5% bovine serum albumine (BSA) 1 mM EDTA
40 mM NaHPO4, pH 7.2 5% SDS
TBE-buffer (1x) 100 ml TBE-buffer (10x)
900 ml H2O
TBE-buffer (10x) 108 g Tris [121.14 M] 55 g boric acid [61.83 M] 7.44 g EDTA [372.24 M]
H2O ad 1000 ml pH 8.0
Urea/TBE solution (6 %) 425 g urea [60.06 M]
250 ml H2O 100 ml TBE-buffer (10x) solubilise in a water bath at 65°C
H2O ad 850 ml
11.5 Chemicals a-[32P]-dCTP (50µl, 3,000 Ci/mmol) (Hartmann Analytic GmbH, Braunschweig) 130 Chapter 11. Appendix - laboratory paraphernalia
Agarose (Invitrogen, Paisley, UK) Ammonium persulfate (APS) ≥ 98 % (Sigma-Aldrich Chemie GmbH, Steinheim) Ampicillin (Serva, Heidelberg) Boric acid ≥ 99.8 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) Bromophenol blue (Merck KgaA, Darmstadt) dATP, dCTP, dGTP, dTTP > 98 % (Carl Roth GmbH & Co, Karlsruhe) Chloramphenicol (Serva, Heidelberg) DMSO ≥ 99.5 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) dNTP-Mix (Qbiogene GmbH, Heidelberg) EDTA ≥ 99 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) Ethidium bromide (Carl Roth GmbH & Co, Karlsruhe) Ethyl alcohol (AppliChem, Darmstadt) Formamide ≥ 99.5 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) LB (Luria Bertani) agar (Scharlau Microbiology, Barcelona, Spain) LB (Luria Bertani) broth (Scharlau Microbiology, Barcelona, Spain) Paraffin (Merck KgaA, Darmstadt) Rotiphorese®Gel40 (Carl Roth GmbH & Co, Karlsruhe) SephadexTM G-50 Superfine (Amersham Biosciences, Freiburg) TEMED 99 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) Tris PUFFERAN® ≥ 99.9 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) Urea ≥ 99.5 %, p.a. (Carl Roth GmbH & Co, Karlsruhe) Water was taken from the water purification system Milli-Q® X-Gal (AppliChem, Darmstadt)
11.6 Enzymes
Taq-DNA-Polymerase 5 U/µl (Qbiogene GmbH, Heidelberg)
Incubation Mix (10x) T.Pol with MgCl2 [1.5 mM] (Qbiogene GmbH, Heidelberg) The polymerase was always used in the presence of incubation Mix T.Pol 10x buffer. The encymes SAC I, XBA I and ECO RI (New England Biolabs, Schwalbach Taunus) were used with the adequate 10x encyme buffer. Chapter 11. Appendix - laboratory paraphernalia 131
11.7 Clones
All required clones have been ordered at the Resource Center/Primary Database (RZPD, http://www.rzpd.de).
11.8 BAC-libraries and RH-panel
The gene-bank-screening was carried out on the RPCI-42 Male Bovine BAC Library (Warren et al. 2000). The RH-panel used was the Roslin/Cambridge Bovine Radiation Hybrid Panel (WILLIAMS et al. 2000) from Research Genetics, Huntsville, AL, USA.
11.9 Consumables
96 Well Multiply PCR plates, skirted (Sarstedt, Nümbrecht) Combitips® plus (Eppendorf AG, Hamburg) Pipette tips 0.1 – 10 µl, 0.1 – 10 µl, 5 – 200 µl (Carl Roth GmbH & Co, Karlsruhe) Reaction tubes 1.5 and 2.0 ml (nerbe plus GmbH, Winsen/Luhe) Reaction tubes 10 und 50 ml (Falcon) (Renner, Darmstadt) Thermo-fast 96 well plate, skirted (ABgene, Hamburg) X-ray films Kodak Biomax MS, developer and fixer (Eastman Kodak Company, Rochester, NY, USA)
11.10 Software
BLASTN, trace archive http://www.ncbi.nlm.nih.gov IPLab 2.2.3 Scanalytics, Inc. MARC/USDA linkage map http://www.marc.usda.gov/ MERLIN 0.10.2 package http://www.sph.umich.edu/csg/abecasis/Merlin Order of primers MWG Biotech-AG, Ebersberg (https://ecom. mwgdna.com/register/index.tcl) PED4.0 Dr. H. Plendl et al. (1999) Institute for Human Genetics, Kiel 132 Chapter 11. Appendix - laboratory paraphernalia
Primer design http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_ www.cgi Purchase of BACs http://bacpac.chori.org/ Repeat Masker http://www.repeatmasker.genome. washington.edu/ RHMAP 3.0 software package Lange et al. (1995) Sequencher 4.1.4 GeneCodes, Ann Arbor, MI, USA SUN Ultra Enterprise 450 Sun microsystems Chapter 12. Acknowledgements 133
Chapter 12
Acknowledgements 134 Chapter 12. Acknowledgements
Acknowledgements
First of all I wish to thank Prof. Dr. Dr. habil. Ottmar Distl, the supervisor of my doctoral thesis, for offering me the opportunity to work on an exciting dissertation. His academic guidance, constructive criticism and support in the course of this work were invaluable.
Furthermore, I am most thankful to my direct supervisor Prof. Dr. Cord Drögemüller for his continuous support of my study, his valuable advice and the always open ear for my questions.
I wish to express my appreciation to the German Research Council (DFG) for supporting this work financially.
I also want to thank Prof. Dr. Tosso Leeb for his advice concerning scientific questions.
I wish to thank Dr. Heidi Kuiper and Dr. Andreas Spötter very much for their invaluable help regarding the fluorescence in situ hybridisation and the radioactive hybridisation.
I am also very grateful to Heike Klippert-Hasberg and Stefan Neander for teaching me the laboratory techniques and for their support during the work in the laboratory.
I wish to thank Dr. John Williams from Roslin Institute in Edinburgh for the verification of the positions of the PRPH, MRPS35 and KCNJ8 genes by RH mapping. Furthermore, I wish to thank him and Judith McAlister-Hermann for proof-reading parts of this thesis and improving the English language used.
My thank is due to the LKV Bayern for providing the data of all animals required for the genetic analyses.
Chapter 12. Acknowledgements 135
My appreciation goes to all the farmers who allowed me to take samples from their animals. I am grateful for their valuable participation, their friendly support, their interest in my work and all the cups of coffee.
My special thank goes to all colleagues and friends of the Institute for Animal Breeding and Genetics of the University of Veterinary Medicine Hannover for their support, humour and the friendly atmosphere in the laboratory. You all made me feel at home at work.
I am very grateful to Jörn Wrede for his support during the statistical analyses and his help with computer problems.
I am grateful to R. I. Schwan for the graphical presentation of the bovine chromosomes.
Last but not least, I wish to thank my family for their tireless encouragement and support during the work on this thesis. 136 Chapter 13. List of publications
Chapter 13
List of publications Chapter 13. List of publications 137
List of publications
13.1 Journal articles
1. Stefanie Mömke, Ottmar Distl: Bilateral strabismus with exophthalmus (BCSE) in cattle: a molecular genetic approach. Submitted for publication in The Veterinary Journal.
2. S. Mömke, C. Drögemüller, O. Distl: A high resolution comparative radiation hybrid map of bovine chromosome 5q1.3-2.5 with human chromosome 12q. Submitted for publication in Animal Genetics.
3. S. Mömke, H. Kuiper, A. Spötter, C. Drögemüller, O. Distl: A refined comparative radiation hybrid map of the telomeric region of bovine chromosome 18q25-26 to human chromosome 19q13. Submitted for publication in Animal Genetics.
4. S. Mömke, H. Kuiper, A. Spötter, C. Drögemüller, J. L. Williams, O. Distl: Assignment of the PRPH gene to bovine chromosome 5q1.4 by FISH and confirmation by RH mapping. Accepted for publication in Animal Genetics.
5. C. Drögemüller, S. Mömke, A. Spötter, H. Kuiper, J. L. Williams, O. Distl: Physical mapping of the KCNJ8 gene to bovine chromosome 5q3.2-q3.4. Accepted for publication in Animal Genetics.
6. Heidi Kuiper, Stefanie Mömke, Cord Drögemüller, Andreas Spötter, John Lewis Williams, Ottmar Distl: Assignment of the MRPS35 gene to bovine chromosome 5q3.2-q3.4 by fluorescence in situ hybridisation and confirmation by radiation hybrid mapping. Accepted for publication in Cytogenetic and Genome Research.
138 Chapter 13. List of publications
13.2 Oral presentations
1. S. Mömke, C. Drögemüller, H. Kuiper, G. Hauke, T. Leeb, O. Distl: Molekulargenetische Aufklärung des bilateralen Strabismus convergens mit Exophthalmus beim Rind. DGFZ/GfT conference in Göttingen, Germany, 17.-18.09. 2003.